WO2017142254A1 - 발모 및/또는 육모 촉진 활성을 나타내는 펩타이드 및 이의 용도 - Google Patents

발모 및/또는 육모 촉진 활성을 나타내는 펩타이드 및 이의 용도 Download PDF

Info

Publication number
WO2017142254A1
WO2017142254A1 PCT/KR2017/001409 KR2017001409W WO2017142254A1 WO 2017142254 A1 WO2017142254 A1 WO 2017142254A1 KR 2017001409 W KR2017001409 W KR 2017001409W WO 2017142254 A1 WO2017142254 A1 WO 2017142254A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
hair
hair growth
expression
growth
Prior art date
Application number
PCT/KR2017/001409
Other languages
English (en)
French (fr)
Inventor
정용지
김은미
이응지
김민웅
Original Assignee
(주) 케어젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주) 케어젠 filed Critical (주) 케어젠
Priority to CN201780010329.8A priority Critical patent/CN108699109B/zh
Priority to US15/999,744 priority patent/US10568828B2/en
Priority to ES17753415T priority patent/ES2870470T3/es
Priority to CN202210942015.4A priority patent/CN116333044A/zh
Priority to JP2018560419A priority patent/JP6672482B2/ja
Priority to CN202210941330.5A priority patent/CN116333039A/zh
Priority to EP17753415.3A priority patent/EP3418291B1/en
Publication of WO2017142254A1 publication Critical patent/WO2017142254A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/07—Tetrapeptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/14—Drugs for dermatological disorders for baldness or alopecia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q7/00—Preparations for affecting hair growth
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/74—Biological properties of particular ingredients
    • A61K2800/78—Enzyme modulators, e.g. Enzyme agonists
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a peptide that exhibits hair growth and / or hair growth promoting activity, a composition for promoting hair growth comprising the peptide as an active ingredient, and a hair growth promoting use of the peptide.
  • Hair follicles are unique organs of mammalian skin, with the lower part of the primitive epidermis growing and extending into the deeper skin layers.
  • the base of the hair follicle, the plug of the cell known as follicle or dermal papilla cells are present, and... (Stenn and Paus, Physiol Rev., 81:. 449 (2002)) teats normal circulation (Oliver, Embryol Exp Morph 15 of the follicular : 3311 (1966); Oliver, Embryol . Exp . Morph. 16: 231 (1966)) and hair shaft growth.
  • the hair shaft is a tread-shaped structure made of tightly adherent epithelial cells filled with keratin filaments and filament aggregate proteins.
  • hair loss spreads.
  • different disease states such as scarring alopecia, scarring conditions associated with burns or compression injuries can cause significant hair loss.
  • various substances have been used as a medicine until now, but the price is too expensive and various side effects are caused.
  • the raw materials used in cosmetics have the advantage of low price, but since the composition is composed of plant-derived ingredients, the effect is not so great. Therefore, there is a need in the art for a new effective ingredient that is both economical and cost effective.
  • dihydrotestosterone is added by adding a composition containing extracts such as red ginseng, red pepper, sugar, lettuce, green leaf, lettuce, licorice, licorice, peony, turmeric, fennel, cornus and garlic, and a composition containing xanthine and growth hormone.
  • a composition containing extracts such as red ginseng, red pepper, sugar, lettuce, green leaf, lettuce, licorice, licorice, peony, turmeric, fennel, cornus and garlic
  • a composition containing xanthine and growth hormone In order to improve the inhibition of cellular metabolism due to the excessive amount of growth hormone, growth hormone promotes hair growth, prevents hair loss and regenerates hair, and promotes hair growth, minerals, vitamins, and green tea to promote hair growth.
  • the inventors have selected three peptides showing excellent hair growth efficacy from the peptide library of the present inventors, and have experimented on their hair growth and / or hair growth efficacy. By clarifying, the present invention has been completed.
  • a peptide that exhibits hair growth and / or hair growth promoting activity consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs.
  • Another object of the present invention is to provide a composition for preventing and / or improving hair loss comprising at least one peptide selected from the group consisting of peptides consisting of amino acid sequences selected from the group consisting of SEQ ID NOs.
  • Still another object of the present invention is to provide a composition for promoting hair growth and / or hair growth comprising at least one peptide selected from the group consisting of peptides consisting of amino acid sequences selected from the group consisting of SEQ ID NOs: 1 to 3 as an active ingredient. .
  • Still another object of the present invention is to provide a use for preventing and / or improving hair loss of a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs.
  • Still another object of the present invention is to provide a hair growth and / or hair growth promoting use of a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs.
  • the inventors have selected three peptides showing excellent hair growth and / or hair growth promoting effects from our peptide library, and their hair growth and / or The hair growth promoting effect was experimentally identified.
  • One aspect of the invention relates to a peptide exhibiting hair growth and / or hair growth promoting activity comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to 3.
  • the peptide may be an amino acid sequence consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to 3, for example, may be composed of an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to 3.
  • peptide refers to a linear molecule formed by binding amino acid residues to each other by peptide bonds.
  • Peptides of the invention are known in the art for chemical synthesis methods, in particular solid-phase synthesis techniques; Merrifield, J. Amer . Chem . Soc . 85: 2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis , 2nd. Ed., Pierce Chem. Co .: Rockford, 111 (1984)) or liquid phase synthesis technology (US Pat. No. 5,516,891).
  • Peptides of the present invention are screened peptides excellent in hair growth through cell proliferation experiments among the peptide library possessed by the present inventors, a total of three kinds are provided as peptides of the present invention.
  • the peptides of the invention can induce N-terminal and / or C-terminal modifications of the peptides to select some sites of the amino acid sequence and increase their activity.
  • the C-terminal modification may be one in which the C-terminal of the peptide is modified with a hydroxyl group (-OH), an amino group (-NH 2 ), an azide (-NHNH 2 ), and the like, but is not limited thereto.
  • the N-terminal modification is 1 wherein the N-terminal of the peptide is selected from the group consisting of acetyl group, fluorenyl methoxy carbonyl group, formyl group, palmitoyl group, myristyl group, stearyl group and polyethylene glycol (PEG)
  • One or more protecting groups may be combined, but is not limited thereto.
  • the protecting group serves to protect the peptide of the present invention from the attack of protein cleavage enzymes in vivo.
  • the N-terminal and / or C-terminal modification of the peptide acts to greatly improve the stability of the peptide.
  • the peptide of the present invention may have a high half-life by increasing the half-life when administered in vivo.
  • stability herein means not only in vivo stability but also storage stability (eg, room temperature storage stability).
  • hair growth promotion means that the hair is produced, it is used in a broad sense to increase the hair production rate and production amount. In addition, it means that the hair root function is enhanced, or the hair dropping and production cycle is shortened, thereby increasing the number of hairs growing in the hair follicles.
  • hair growth or “hair growth” means that the thickness of the generated hair (hair) is increased or affects the growth rate of the length.
  • the peptide of the present invention promotes the growth of hair follicle cells, increases the expression of ⁇ -catenin, a hair growth related factor, and KGF (Keratinocyte growth factor), a hair growth related growth factor, bFGF ( Increases the expression of Basic fibroblast growth factor (VGF), Vascular endothelial growth factor (VEGF), increases expression of the hair growth signaling molecule, Phosphoinositide 3-kinase (PI3K), and increases phosphorylation of extracellular signal-regulated kinase (ERK), Increases the expression of MSX2 and caratin-14, a hair growth-related factor, inhibits the expression of TGF- ⁇ 1 associated with hair growth retardation, and increases the expression of Bcl-2, an apoptosis inhibiting protein, and apoptosis-related protein Bax. Induces a decrease in expression.
  • KGF Keratinocyte growth factor
  • bFGF Increases the expression of Basic fibroblast growth factor (VGF)
  • the peptides of the present invention have very good efficacy against hair growth and / or hair growth. Therefore, the peptide of the present invention can be used for preventing and / or improving hair loss, promoting hair growth and / or hair growth.
  • Another aspect of the invention relates to a composition for preventing or improving hair loss comprising the peptide of the present invention as an active ingredient.
  • anti-hair loss means that the phenomenon of hair dropout in hair follicles or scalp is prevented or weakened.
  • the peptide of the present invention induces the proliferation of cells in the hair follicle of the skin tissue, which enables the production of hair roots, thereby allowing the production of new hair follicles. Furthermore, it activates the beta-catenin signal to express hair growth promoting genes and increases the expression of growth factors involved in hair growth.
  • the peptide of the present invention serves to promote the growth stage, which is the time at which hair is produced and grown, and exhibits hair loss inhibiting effect by maintaining the cycle of the hair that progresses to the regenerator due to various environmental factors, and in normal hair, hair Nourishes your hair to keep it healthy. Therefore, the composition of the present invention is very effective in preventing and / or improving hair loss.
  • composition of the present invention includes the above-described peptide of the present invention as an active ingredient, the common content between the two is omitted in order to avoid excessive complexity of the present specification.
  • compositions for promoting hair growth and / or hair growth comprising at least one peptide selected from the group consisting of peptides consisting of amino acid sequences selected from the group consisting of SEQ ID NO: 1 to 3 as an active ingredient. .
  • composition of the present invention may be prepared as a cosmetic composition, but is not limited thereto.
  • the cosmetic composition may include a cosmetically effective amount of the above-described peptide of the present invention.
  • the cosmetic composition may further include a cosmetically acceptable carrier, but is not limited thereto.
  • cosmetic effective amount means an amount sufficient to achieve the efficacy of the cosmetic composition of the present invention described above.
  • Cosmetic compositions of the present invention may be prepared in any formulation conventionally prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing , Oils, powder foundations, emulsion foundations, wax foundations and / or sprays, and the like, but are not limited thereto.
  • it may be prepared in the form of a flexible lotion, nutrition lotion, nutrition cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray and / or powder.
  • the formulation of the cosmetic composition is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, trakant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide are used as carrier components. It may be, but is not limited thereto.
  • the formulation of the cosmetic composition is a powder or a spray
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, in particular, in the case of a spray, additionally chlorofluorohydrocarbon, Propellants such as propane / butane or dimethyl ether may be included, but are not limited thereto.
  • a solvent, a solubilizer or an emulsifier is used as the carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, Fatty acid esters of 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan.
  • a liquid diluent such as water, ethanol or propylene glycol
  • a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester as a carrier component
  • Crystalline cellulose, aluminum metahydroxy, bentonite, agar or tracant may be used, but is not limited thereto.
  • the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, isethionate, an imidazolinium derivative, a methyltaurate, a sarcosinate, a fatty acid.
  • Amide ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters may be used, but are not limited thereto.
  • Components included in the cosmetic composition of the present invention may include components commonly used in cosmetic compositions, in addition to peptides and carrier components as an active ingredient, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments And / or conventional adjuvants such as flavorings.
  • Another aspect of the invention relates to the use of preventing and / or ameliorating hair loss of a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs.
  • Another aspect of the present invention relates to the use of the peptides consisting of amino acid sequences selected from the group consisting of SEQ ID NOs: 1 to 3 to promote hair growth and / or hair growth.
  • the present invention provides a peptide having hair growth and / or hair growth promoting activity, a composition for preventing and / or improving hair loss comprising the peptide as an active ingredient, a composition for promoting hair growth and / or hair growth comprising the peptide as an active ingredient, and the peptide
  • a composition for promoting hair growth and / or hair growth comprising the peptide as an active ingredient
  • the peptide to prevent and / or ameliorate hair loss, and to promote hair growth and / or hair growth of the peptide, wherein the peptide promotes hair follicle cell growth and increases the expression of hair growth-related growth factors and hair growth-related factors. Or it shows an excellent effect on hair growth, it can be very advantageously applied to cosmetics by excellent activity and stability.
  • 1A is a graph showing the growth promoting effect of human hair follicle dermal papilla cells (HHFDPC) of the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • HHFDPC human hair follicle dermal papilla cells
  • Figure 1b is a graph showing the effect of promoting the growth of human hair follicle dermal papilla cells (HHFDPC) of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • HHFDPC human hair follicle dermal papilla cells
  • 1C is a graph showing the growth promoting effect of human hair follicle dermal papilla cells (HHFDPC) of the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • HHFDPC human hair follicle dermal papilla cells
  • Figure 2a is a figure showing the results confirmed that the expression of ⁇ -catenin is increased by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 2b is a view showing the results confirmed that the expression of ⁇ -catenin is increased by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 2c is a view showing the result of confirming that the expression of ⁇ -catenin is increased by the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 3a is a photograph showing the results of confirming the increase in expression of KGF, bFGF by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 3b is a view showing the result of confirming the increase in expression of VEGF by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 3c is a view showing the results of confirming the expression of VEGF, bFGF increased by the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 4a is a photograph showing the results of confirming the increase in PI3K expression and ERK phosphorylation by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 4b is a picture showing the results confirmed the increase in PI3K expression and ERK phosphorylation by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 4c is a picture showing the results confirmed the increase in PI3K expression and ERK phosphorylation by the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 5a is a photograph showing the result of confirming the increase in the expression of MSX2 by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 5b is a photograph showing the result of confirming the increase in the expression of MSX2 by the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 6a is a photograph showing the results of confirming the inhibition of TGF- ⁇ 1 expression by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 6b is a photograph showing the results of confirming the inhibition of TGF- ⁇ 1 expression by the peptide consisting of the amino acid sequence of SEQ ID NO: 2 according to an embodiment of the present invention.
  • Figure 7a is a photograph showing the results of confirming the increase in the expression of Bcl-2 and reduced Bax expression by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • Figure 7b is a photograph showing the results of confirming the increased expression of Bcl-2 and reduced Bax expression by the peptide consisting of the amino acid sequence of SEQ ID NO: 3 according to an embodiment of the present invention.
  • Figure 8 is a photograph showing the result of confirming the increase in the expression of keratin-14 by the peptide consisting of the amino acid sequence of SEQ ID NO: 1 according to an embodiment of the present invention.
  • peptide exhibiting hair growth promoting activity consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 3.
  • chloro trityl chloride resin CTL resin, Nova biochem Cat No. 01-64-0021
  • MC methylene chloride
  • DMF dimethylformamide
  • 10 ml of dichloromethane solution was added to the reactor, 200 mmole of Fmoc-Ile-OH (Bachem, Swiss) and 400 mmole of diisopropyl ethylamine (DIEA) were added thereto, stirred to dissolve well, and reacted with stirring for 1 hour.
  • the Fmoc-protector was reacted twice with a deprotection solution twice for 10 minutes and then washed well.
  • acetic anhydride, DIEA, and HoBt were added to acetylate for one hour
  • the prepared peptidyl resin was washed three times with DMF, MC, and methanol, and dried slowly by flowing nitrogen air, followed by P 2 O 5
  • a fugitive solution Trifluroacetic acid 95%, distilled water 2.5%, Thianisole 2.5%), and then shake at room temperature for 2 hours. Maintained.
  • the resin was filtered off and the resin was washed with a small amount of TFA solution and then combined with the mother liquor.
  • Peptide 2 consisting of the amino acid sequence of SEQ ID NO: 2 and other peptides peptide 3 consisting of the amino acid sequence of SEQ ID NO: 3 was also synthesized in the same manner as above.
  • Human hair follicle dermal papilla cells were seeded in 96-well plates at a density of 2 ⁇ 10 3 cells / well and cultured overnight. After changing to serum-free medium, the peptides were treated and incubated for 3 days, and 100 mg of 4 mg / ml MTT solution were treated in wells for 4 hours. After the resulting formazan was dissolved through DMSO treatment, the absorbance at 560 nm was measured using a microplate reader, and the results are shown in FIGS. 1A to 1C.
  • Human dermal papilla cells were seeded in 6-well plates at a density of 4 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, peptides were treated and cultured for 15 and 30 minutes, and cells were recovered to separate nuclear and cytoplasmic proteins, respectively. Western blotting was performed using a ⁇ -catenin antibody (santacruz biotechnology, USA) to compare the expression of ⁇ -catenin in the nucleus, and the results are shown in FIGS. 2A to 2C.
  • nuclear translocation according to the increase of the activity of ⁇ -catenin, a hair growth-related factor in human dermal papilla cells consisting of the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 It was observed to be promoted by peptide treatment.
  • Human dermal papilla cells were seeded in 6-well plates at a density of 4 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, peptides were treated, incubated for 24 hours, and cells were recovered to separate RNA. After quantifying RNA, cDNA was synthesized using cDNA synthesis kit (Intron, Korea), PCR was performed using PCR premix (Intron, Korea) and primers of KGF, bFGF, and VEGF, followed by electrophoresis on 5% agarose gel. Comparison of the mRNA expression level of the growth factors in the sample treatment conditions, the results are shown in Figures 3a to 3c.
  • Human dermal papilla cells were seeded in 6-well plates at a density of 4 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, the peptide was treated and cultured for 15 and 30 minutes, and the cells were recovered to prepare cell lysates. Western blotting was performed using a PI3K antibody (santacruz biotechnology, USA) and a phospho-ERK antibody (Cell Signaling Technology, USA) to compare protein expression patterns, and the results are shown in FIGS. 4A and 4B.
  • Human dermal papilla cells were seeded in 6-well plates at a density of 4 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, peptides were treated, incubated for 24 hours, and cells were recovered to separate RNA. After quantifying RNA, cDNA was synthesized using cDNA synthesis kit (Intron, Korea), and PCR was performed using PCR premix (Intron, Korea) and MSX2 primer, followed by electrophoresis on 5% agarose gel to express mRNA under each sample treatment condition. The degree is compared and the result is shown to FIG. 5A and 5B.
  • RNA samples Human dermal papilla cells were seeded in 6-well plates at a density of 4 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, peptides were treated, incubated for 24 hours, and cells were recovered to separate RNA. After quantification of RNA, cDNA was synthesized using cDNA synthesis kit (Intron, Korea), PCR was performed using PCR premix (Intron, Korea) and TGF- ⁇ 1 primer, followed by electrophoresis on 5% agarose gel in each sample processing condition. The degree of mRNA expression was compared, and the results are shown in FIGS. 6A and 6B.
  • Human dermal papilla cells were seeded in 6-well plates at a density of 4 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, peptides were treated, cultured for 24 hours, and cells were recovered to prepare cell lysates. Western blots were performed using Bcl-2 and Bax antibodies (santacruz biotechnology, USA) to compare protein expression patterns, and the results are shown in FIGS. 7A and 7B.
  • RNA samples Human dermal papilla cells were seeded in 6-well plates at a density of 5 ⁇ 10 5 cells / well and cultured overnight. After changing to serum-free medium, peptides were treated, incubated for 24 hours, and cells were recovered to separate RNA. After quantification of RNA, cDNA was synthesized using cDNA synthesis kit (Intron, Korea), PCR was performed using PCR premix (Intron, Korea) and keratin-14 primer, followed by electrophoresis on 5% agarose gel under each sample treatment condition. The degree of mRNA expression was compared, and the results are shown in FIG. 8.
  • the present invention relates to a peptide that exhibits hair growth and / or hair growth promoting activity, a composition for promoting hair growth comprising the peptide as an active ingredient, and a hair growth promoting use of the peptide.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Dermatology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Birds (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cosmetics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 발모 촉진 활성을 나타내는 펩타이드를 제공한다. 본 발명의 펩타이드는 모낭 세포 성장을 촉진하며, 발모 관련 성장인자 및 발모 관련 인자들의 발현을 증가시킴으로써 발모에 우수한 효과를 나타낸다. 본 발명의 펩타이드는 탈모 방지 또는 개선, 발모 촉진 및 모발 성장 개선용도로 이용될 수 있다. 또한, 본 발명의 펩타이드의 우수한 활성 및 안정성은 의약외품 및 화장품에 매우 유리하게 적용될 수 있도록 한다.

Description

발모 및/또는 육모 촉진 활성을 나타내는 펩타이드 및 이의 용도
본 발명은 발모 및/또는 육모 촉진 활성을 나타내는 펩타이드, 상기 펩타이드를 유효성분으로 포함하는 발모 촉진용 조성물 및 상기 펩타이드의 발모 촉진 용도에 관한 것이다.
모낭은 포유동물 피부의 독특한 기관으로서 원시 표피의 하부가 성장하여 보다 깊은 피부 층으로 신장된 기관이다. 모낭의 기부에는 소낭 또는 진피 유두 세포로서 알려진 세포의 플러그가 존재 하며(Stenn and Paus, Physiol . Rev., 81: 449 (2002)) 유두는 모낭의 정상적인 순환(Oliver, Embryol . Exp . Morph. 15: 3311 (1966); Oliver, Embryol . Exp . Morph. 16: 231 (1966)) 및 모간의 성장에 필수적이다. 모간은 케라틴 필라멘트와 필라멘트 응집 단백질로 충전된 단단하게 밀착된 상피 세포로 제조된 트레드 형상의 구조이다.
인간의 모발은 주기적으로 생장기, 퇴행기, 휴지기를 반복하며 모발이 빠지고 다시 생성되는 과정을 거치게 된다. 모발 주기의 결정은 호르몬 조절이나 많은 성장인자 등의 조절을 통하여 이루어진다. 한편, 모발은 심한 스트레스나 영양 결핍 등에 의해 일찍 퇴행기를 거쳐 휴지기로 접어들어 심한 탈모가 유발될 수 있다(American Journal of Pathology, 162(3)(2003), (Arck, Petra Clara; Handjiski, Bori)).
남성형 대머리에 있어서 두피의 전면 및 상부의 모낭은 안드로겐에 대해 감수성을 나타낸다. 그래서 남성형 대머리의 경우, 모낭의 파괴보다는 모낭의 소형화에 해당되는데 남성 호르몬인 안드로겐의 과도한 분비가 원인이다. 안드로겐 과다 분비로 인해 5-알파 환원효소가 활성화 되어 테스토스테론이 디하이드로테스토스테론(dihydrotestosterone,DHT)으로 변형되며, 이렇게 생성된 디하이드로테스토스테론은 모발이 자라는 기간을 단축시키고, 모낭을 소형화시켜 굵고 튼튼한 성모의 수를 감소시킴으로써 탈모를 유발시킨다.
일반적으로 나이가 들어감에 따라 탈모가 확산된다. 예를 들면, 흉터 탈모증, 화상 또는 압박 상해와 관련된 흉터형성 상태와 같은 상이한 질환 상태가 현저한 탈모를 일으킬 수 있다. 이런 탈모현상을 치료하기 위해 지금까지는 의약품으로 여러 가지 물질 등이 사용되어 왔으나 가격이 너무 비싸고, 여러 가지 부작용들이 유발된다.
또한, 이런 의약품들은 지속적인 사용을 필요로 하며 사용을 중단하였을 때에는 다시 탈모가 유발되고 효능에 대한 개개인의 차이가 심하며, 부작용도 개개인 마다 차이가 난다는 단점이 있다.
그 외 화장품으로 이용되고 있는 원료들은 가격이 저렴하다는 장점이 있지만, 식물 추출물 유래 성분들로 구성되어 있기 때문에 실제 그 효능은 크지 않다는 단점이 있다. 따라서 효과적이면서 비용적인 측면에서도 보다 경제적인 새로운 유효성분에 대한 요구가 당업계에 대두하고 있다.
지금까지 알려진 2가지 이용 가능한 약물(미녹시딜 및 피나스테라이드)은 추가 탈모를 지연시킬 수는 있지만, 새로운 모낭의 재생을 유도하지는 못했다. 또한, 두발 화장품 중에서 식물 추출물 등을 이용한 탈모방지 제품이 많이 출시되었다.
예를 들어, 고삼, 고추, 당약, 상백피, 상엽, 임삼, 감초, 작약, 지황, 회향, 산수유, 마늘 등의 추출물을 함유한 제품, 크산틴 및 성장호르몬을 함유하는 조성물을 첨가하여 디하이드로테스토스테론의 과잉에 따른 세포 대사 억제를 개선함과 동시에 성장 호르몬이 모발성장을 촉진함으로써 탈모방지 및 모발을 재생하여 모발성장 촉진 효과를 나타내는 제품, 발모 및 모발의 성장을 촉진하기 위해 미네랄 및 비타민류, 녹차, 로즈마리, 쑥, 감초 추출액을 함유한 제품을 개발하여 두피와 모발에 영양을 공급하며 탈모의 예방 및 모발 성장 촉진에 효과가 있는 발모 촉진용 제품, 비타민 B, 비타민 C, 비타민 D, 비타민 E, 니코틴산, 판토텐산, 비오틴 및 엽산 등의 물질과 식물추출물을 혼합하여 인체 내의 5-알파 환원효소를 억제하여 남성호르몬의 대사과정에서 디하이드로테스토스테론이 형성되지 않도록 하며 머리카락의 신진대사작용을 돕는 남성형 탈모제품들이 개발되었으나, 신생모발의 생성까지 영향을 미치는 제품은 찾기 어려웠다.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명자들은 우수한 발모 및/또는 육모 효능을 갖는 펩타이드를 개발하고자 노력한 결과, 본 발명자들의 펩타이드 라이브러리로부터 우수한 발모 효능을 나타내는 3종의 펩타이드를 선별하였고, 이들의 발모 및/또는 육모 효능에 대하여 실험적으로 규명함으로써 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 발모 및/또는 육모 촉진 활성을 나타내는 펩타이드를 제공하는 것이다.
본 발명의 다른 목적은 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택되는 1종 이상의 펩타이드를 유효성분으로 포함하는 탈모 방지 및/또는 개선용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택되는 1종 이상의 펩타이드를 유효성분으로 포함하는 발모 및/또는 육모 촉진용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 펩타이드의 탈모 방지 및/또는 개선 용도를 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 펩타이드의 발모 및/또는 육모 촉진 용도를 제공하는 것이다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명자들은 우수한 발모 및/또는 육모 촉진 효능을 갖는 펩타이드를 개발하고자 노력한 결과, 본 발명자들의 펩타이드 라이브러리로부터 우수한 발모 및/또는 육모 촉진 효능을 나타내는 3종의 펩타이드를 선별하였고, 이들의 발모 및/또는 육모 촉진 효능에 대하여 실험적으로 규명하였다.
본 발명의 일 양태는 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열을 포함하는 발모 및/또는 육모 촉진 활성을 나타내는 펩타이드에 관한 것이다.
상기 펩타이드는 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 아미노산 서열을 포함하는 것일 수 있으며, 예를 들어, 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 것일 수 있다.
본 명세서에서 용어 "펩타이드"는 펩타이드 결합에 의해 아미노산 잔기들이 서로 결합되어 형성된 선형의 분자를 의미한다. 본 발명의 펩타이드는 당업계에 공지된 화학적 합성 방법, 특히 고상 합성 기술(solid-phase synthesis techniques; Merrifield, J. Amer . Chem . Soc . 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)) 또는 액상 합성 기술(US 등록특허 제5,516,891호)에 따라 제조될 수 있다.
본 발명의 펩타이드는 본 발명자들이 보유하고 있는 펩타이드 라이브러리 가운데 세포 증식 실험을 통해 발모 효능이 우수한 펩타이드를 스크리닝한 것으로써, 총 3종이 본 발명의 펩타이드로 제공된다.
본 발명의 펩타이드는 아미노산 서열의 일부 부위를 선정하고 그 활성을 증가시키기 위해 펩타이드의 N-말단 및/또는 C-말단 변형을 유도할 수 있다.
예를 들어, 상기 C-말단 변형은 펩타이드의 C-말단이 히드록시기(-OH), 아미노기(-NH2), 아자이드(-NHNH2) 등으로 변형되는 것일 수 있으나, 이에 한정되는 것은 아니다.
또한, 상기 N-말단 변형은 펩타이드의 N-말단이 아세틸기, 플루오레닐 메톡시 카르보닐기, 포르밀기, 팔미토일기, 미리스틸기, 스테아릴기 및 폴리에틸렌글리콜(PEG)로 구성된 군으로부터 선택된 1종 이상의 보호기가 결합되는 것일 수 있으나, 이에 한정되는 것은 아니다. 상기 보호기는 생체 내의 단백질 절단효소의 공격으로부터 본 발명의 펩타이드를 보호하는 작용을 한다.
상기 펩타이드의 N-말단 및/또는 C-말단 변형은 펩타이드의 안정성을 크게 개선하는 작용을 하며, 이러한 변형을 통해 본 발명의 펩타이드는 생체 내 투여시의 반감기를 증가시켜 높은 반감기를 가질 수 있다.
본 명세서에서 용어 "안정성"은 인 비보 안정성뿐만 아니라, 저장 안정성(예컨대, 상온 저장 안정성)도 의미한다.
본 발명에서 "발모 촉진"은 모발이 생성되는 것을 의미하며, 모발 생성 속도 및 생성량을 증가시키는 넓은 의미로 사용된다. 또한, 모근 기능이 강화되거나, 모발의 탈락 및 생성 주기가 짧아져 모낭에서 자라는 모발의 수가 증가되는 것을 의미한다.
본 발명에 있어서, "모발 성장" 또는 "육모"는 생성된 모발(머리카락)의 굵기가 증가되거나 길이 자람 속도에 영향을 미치는 것을 의미한다.
본 발명의 다른 일 양태에 따르면, 본 발명의 펩타이드는 모낭 세포의 성장을 촉진하며, 모발 성장 관련 인자인 β-카테닌의 발현을 증가시키고, 발모 관련 성장인자인 KGF(Keratinocyte growth factor), bFGF(Basic fibroblast growth factor), VEGF(Vascular endothelial growth factor)의 발현을 증가시키며, 발모 시그널링 분자인 PI3K(Phosphoinositide 3-kinase)의 발현을 증가시키고, ERK(extracellular signal-regulated kinase)의 인산화를 증가시키며, 모발 성장 관련 인자인 MSX2 및 카라틴-14의 발현을 증가시키고, 모발 성장 지연과 관련된 TGF-β1의 발현을 억제시키며, 세포 사멸 억제 단백질인 Bcl-2의 발현 증가 및 세포 사멸 관련 단백질인 Bax의 발현 감소를 유도한다.
이러한 결과는 본 발명의 펩타이드가 발모 및/또는 육모에 대하여 매우 우수한 효능을 가진다는 것을 의미한다. 따라서 본 발명의 펩타이드는 탈모 방지 및/또는 개선, 발모 및/또는 육모 촉진 용도로 이용될 수 있다.
본 발명의 또 다른 일 양태는 본 발명의 펩타이드를 유효성분으로 포함하는 탈모 방지 또는 개선용 조성물에 관한 것이다.
본 발명에 있어서, "탈모 방지"는 모낭 또는 두피에서 모발이 탈락되는 현상이 저지되거나 약화되는 것을 의미한다.
본 발명의 펩타이드는 모근을 생성할 수 있게 하는 피부조직의 머리카락 난포(hair follicle)에 있는 세포의 증식을 유도하여 새로운 모낭이 생성할 수 있게 한다. 더욱이 β-카테닌(beta-catenin)의 시그널을 활성화 시켜 발모 촉진 유전자를 발현시키며, 발모에 관여하는 성장인자들의 발현을 증가시킨다.
본 발명의 펩타이드는 모발이 생성되고 성장되는 시기인 생장기를 촉진시키는 역할을 하며, 여러 가지 환경적인 요인으로 인해 퇴행기로 진행하는 모발의 주기를 생장기로 유지함으로써 탈모 억제 효과를 나타내고, 정상 모발에서는 모발에 영양분을 공급하여 모발 건강을 유지할 수 있도록 한다. 따라서, 본 발명의 조성물은 탈모 방지 및/또는 개선에 매우 효과적이다.
본 발명의 조성물은 상술한 본 발명의 펩타이드를 유효성분으로 포함하기 때문에, 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명의 또 다른 일 양태는 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택되는 1종 이상의 펩타이드를 유효성분으로 포함하는 발모 및/또는 육모 촉진용 조성물을 제공한다.
본 발명의 조성물은 화장품 조성물로 제조될 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물은 상술한 본 발명의 펩타이드의 화장품학적 유효량(cosmetically effective amount)을 포함하는 것일 수 있다.
또한, 상기 화장품 조성물은 화장품학적으로 허용되는 담체를 추가적으로 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 명세서에서 용어 "화장품학적 유효량"은 상술한 본 발명의 화장품 조성물의 효능을 달성하는 데 충분한 양을 의미한다.
본 발명의 화장품 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및/또는 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 예를 들어, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 포옴, 클렌징 워터, 팩, 스프레이 및/또는 파우더의 제형으로 제조될 수 있다.
상기 화장품 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.
상기 화장품 조성물의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있으나, 이에 한정되는 것은 아니다.
상기 화장품 조성물의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 화장품 조성물에 포함되는 성분은 유효성분으로서의 펩타이드류와 담체 성분 이외에, 화장품 조성물에 통상적으로 이용되는 성분들을 포함할 수 있으며, 예를 들어, 항산화제, 안정화제, 용해화제, 비타민, 안료 및/또는 향료와 같은 통상적인 보조제를 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 일 양태는 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 펩타이드의 탈모 방지 및/또는 개선 용도에 관한 것이다.
상기 펩타이드는 상술한 펩타이드와 동일하기 때문에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명의 또 다른 일 양태는 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 펩타이드의 발모 및/또는 육모 촉진 용도에 관한 것이다.
상기 펩타이드는 상술한 펩타이드와 동일하기 때문에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명은 발모 및/또는 육모 촉진 활성을 갖는 펩타이드, 상기 펩타이드를 유효성분으로 포함하는 탈모 방지 및/또는 개선용 조성물, 상기 펩타이드를 유효성분으로 포함하는 발모 및/또는 육모 촉진용 조성물, 상기 펩타이드의 탈모 방지 및/또는 개선 용도, 및 상기 펩타이드의 발모 및/또는 육모 촉진 용도에 관한 것으로, 상기 펩타이드는 모낭 세포 성장을 촉진하며, 발모 관련 성장인자 및 발모 관련 인자들의 발현을 증가시킴으로써 발모 및/또는 육모에 대하여 우수한 효과를 나타내며, 우수한 활성 및 안정성에 의해 화장품에 매우 유리하게 적용될 수 있다.
도 1a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드의 인간 모유두 세포(Human hair follicle dermal papilla cells, HHFDPC) 성장 촉진 효과를 나타낸 그래프이다.
도 1b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드의 인간 모유두 세포(Human hair follicle dermal papilla cells, HHFDPC) 성장 촉진 효과를 나타낸 그래프이다.
도 1c는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열ㅇ로 이루어진 펩타이드의 인간 모유두 세포(Human hair follicle dermal papilla cells, HHFDPC) 성장 촉진 효과를 나타낸 그래프이다.
도 2a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의해 β-카테닌의 발현이 증가되는 것을 확인한 결과를 보여주는 그림이다.
도 2b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의해 β-카테닌의 발현이 증가되는 것을 확인한 결과를 보여주는 그림이다.
도 2c는 본 발명의 일 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드에 의해 β-카테닌의 발현이 증가되는 것을 확인한 결과를 보여주는 그림이다.
도 3a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 KGF, bFGF의 발현 증가를 확인한 결과를 보여주는 사진이다.
도 3b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의한 VEGF의 발현 증가를 확인한 결과를 보여주는 그림이다.
도 3c는 본 발명의 일 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드에 의한 VEGF, bFGF의 발현 증가를 확인한 결과를 보여주는 그림이다.
도 4a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 PI3K 발현 증가 및 ERK 인산화 증가를 확인한 결과를 보여주는 사진이다.
도 4b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의한 PI3K 발현 증가 및 ERK 인산화 증가를 확인한 결과를 보여주는 사진이다.
도 4c는 본 발명의 일 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드에 의한 PI3K 발현 증가 및 ERK 인산화 증가를 확인한 결과를 보여주는 사진이다.
도 5a는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의한 MSX2 발현 증가를 확인한 결과를 보여주는 사진이다.
도 5b는 본 발명의 일 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드에 의한 MSX2 발현 증가를 확인한 결과를 보여주는 사진이다.
도 6a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 TGF-β1 발현 억제를 확인한 결과를 보여주는 사진이다.
도 6b는 본 발명의 일 실시예에 따른 서열번호 2의 아미노산 서열로 이루어진 펩타이드에 의한 TGF-β1 발현 억제를 확인한 결과를 보여주는 사진이다.
도 7a는 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 Bcl-2의 발현 증가 및 Bax의 발현 감소를 확인한 결과를 보여주는 사진이다.
도 7b는 본 발명의 일 실시예에 따른 서열번호 3의 아미노산 서열로 이루어진 펩타이드에 의한 Bcl-2의 발현 증가 및 Bax의 발현 감소를 확인한 결과를 보여주는 사진이다.
도 8은 본 발명의 일 실시예에 따른 서열번호 1의 아미노산 서열로 이루어진 펩타이드에 의한 케라틴-14의 발현 증가를 확인한 결과를 보여주는 사진이다.
서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 발모 촉진 활성을 나타내는 펩타이드에 관한 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
합성예 1: 펩타이드의 합성
클로로 트리틸 클로라이드 레진(Chloro trityl chloride resin; CTL resin, Nova biochem Cat No. 01-64-0021) 700 mg을 반응용기에 넣고 메틸렌 클로라이드(MC) 10 ml를 가하여 3분간 교반하였다. 용액을 제거하고 디메틸포름 아마이드(DMF) 10 ml를 넣어 3분간 교반한 후 다시 용매를 제거하였다. 반응기에 10 ml의 디클로로메탄용액을 넣고 Fmoc-Ile-OH (Bachem, Swiss) 200 mmole 및 디이소프로필 에틸아민(DIEA) 400 mmole을 넣은 후 교반하여 잘 녹이고, 1시간 동안 교반하면서 반응시켰다. 반응 후, 세척하고 메탄올과 DIEA(2:1)를 DCM(dechloromethane)에 녹여 10분간 반응시키고 과량의 DCM/DMF(1:1)로 세척하였다. 용액을 제거하고 디메틸포름 아마이드(DMF)를 10 ml 넣어 3분간 교반한 후 다시 용매를 제거하였다. 탈보호 용액(20%의 피페리딘(Piperidine)/DMF) 10ml를 반응 용기에 넣고 10분간 상온에서 교반한 후 용액을 제거하였다. 동량의 탈보호 용액을 넣고 다시 10분간 반응을 유지한 후 용액을 제거하고 각각 3분씩 DMF로 2회, MC로 1회, DMF로 1회 세척하여 Ile-CTL Resin을 제조하였다. 새로운 반응기에 10 ml의 DMF 용액을 넣고 Fmoc-Lys(Boc)-OH (Bachem, Swiss) 200 mmole, HoBt 200 mmole 및 Bop 200 mmole을 넣은 후 교반하여 잘 녹였다. 반응기에 400 mmole DIEA를 분획으로 2번에 걸쳐 넣은 후 모든 고체가 녹을 때까지 최소한 5분간 교반하였다. 녹인 아미노산 혼합용액을 탈보호된 레진이 있는 반응용기에 넣고 1시간 동안 상온에서 교반하면서 반응시켰다. 반응액을 제거하고 DMF 용액으로 3회 5분씩 교반한 후 제거하였다. 반응 레진을 소량 취하여 카이저 테스트(Nihydrin Test)를 이용하여 반응 정도를 점검하였다. 탈보호 용액으로 상기와 같이 동일하게 2번 탈보호 반응시켜 Lys(Boc)-Ile-CTL Resin을 제조하였다. DMF와 MC로 충분히 세척하고 다시 한 번 카이저 테스트를 수행한 다음 상기와 동일하게 아래의 아미노산 부착 실험을 수행하였다. 선정된 아미노산 서열에 의거하여 Fmoc-Arg(Pbf)-OH 및 Fmoc-Arg(Pbf)-OH 순으로 연쇄반응을 시켰다. Fmoc-보호기를 탈보호 용액으로 10분씩 2번 반응시킨 후 잘 세척하여 제거하였다. 무수초산과 DIEA, HoBt를 넣어 한 시간 동안 아세틸화를 수행한 뒤 제조된 펩티딜 레진을 DMF, MC 및 메탄올로 각각 3번을 세척하고, 질소 공기를 천천히 흘려 건조한 후, P2O5 하에서 진공으로 감압하여 완전히 건조한 뒤 탈루 용액[트리플로로화 초산(Trifluroacetic acid) 95%, 증류수 2.5%, 티오아니졸(Thioanisole) 2.5%] 30 ml을 넣은 후 상온에서 가끔 흔들어주며 2 시간 반응을 유지하였다. 필터링을 하여 레진을 거르고, 레진을 소량의 TFA 용액으로 세척한 후 모액과 합하였다. 감압을 이용하여 전체 볼륨이 절반 정도 남도록 증류하고 50 ml의 차가운 에테르를 가하여 침전을 유도한 후, 원심 분리하여 침전을 모으고, 2번 더 차가운 에테르로 세척하였다. 모액을 제거하고 질소 하에서 충분히 건조하여 정제 전의 서열번호 1의 아미노산 서열 Arg-Arg-Lys-Ile로 이루어진 펩타이드 1을 0.7 g 합성하였다(수율: 90.0 %). 분자량 측정기를 이용하여 측정 시 분자량 571.7 (이론값: 571.72)를 얻을 수 있었다.
다른 펩타이드인 서열번호 2의 아미노산 서열로 이루어진 펩타이드 2 및 서열번호 3의 아미노산 서열로 이루어진 펩타이드 3도 위와 같은 방법으로 합성을 진행하였다.
서열번호 서열목록 (5'->3') 분자량 분석값(질량분석기)
분석치 이론치
1 Arg-Arg-Lys-Ile 571.7 571.72
2 Ile-Tyr-Phe-Tyr 604 604.7
3 Lys-Lys-Phe-Ile-Gln-Gln-Val-Tyr-Leu-Ala-Ile 1350.6 1350.65
모발 성장 촉진 효능을 나타내는 펩타이드 확보를 위해 자사의 펩타이드 라이브러리 스크리닝을 세포 증식 실험을 통해 진행하였고 3종 펩타이드를 선별하였다. 이후 이 3종 펩타이드의 모발 성장 촉진 효능을 아래의 다양한 유전자 및 단백질 발현 변화 등을 통해 관찰하였고 이들의 우수한 효능을 확인하였다.
실시예 1: DPC 증식 어세이
인간 모유두 세포(Human hair follicle dermal papilla cells)를 2x103 세포/웰의 밀도로 96-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 3일간 배양하고 4 mg/ml MTT 용액을 100 ul씩 웰에 처리하여 4시간 반응시켰다. 생성된 포마잔을 DMSO 처리를 통해 녹여낸 후 마이크로플레이트 리더를 사용하여 560 nm에서의 흡광도를 측정하여, 그 결과를 도 1a 내지 도 1c에 나타내었다.
도 1a 내지 도 1c에서 확인할 수 있듯이, 각각 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포의 성장이 농도 의존적으로 촉진되는 것을 확인하였다.
실시예 2: β- 카테닌 활성화 테스트
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 15, 30분 배양하고 세포를 회수하여 핵과 세포질 단백질을 각각 분리하였다. β-카테닌 항체(santacruz biotechnology, USA)를 이용하여 웨스턴 블롯팅을 수행하여 핵에서의 β-카테닌 발현 양상을 비교하여, 그 결과를 도 2a 내지 도 2c에 나타내었다.
도 2a 내지 도 2c에서 확인할 수 있듯이, 인간 모유두 세포에서 모발 성장 관련 인자인 β-카테닌의 활성 증가에 따른 핵 이동(nuclear translocation)이 서열번호 1, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드 처리에 의해 촉진되는 것이 관찰되었다.
실시예 3: KGF, bFGF, VEGF RT-PCR
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 KGF, bFGF, VEGF 각각의 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하여, 그 결과를 도 3a 내지 도 3c에 나타내었다.
서열번호 프라이머 명명 서열목록(5'-3')
4 KGF_F TCTGTCGAACACAGTGGTACCT
5 KGF_R GTGTGTCCATTTAGCTGATGCAT
6 bFGF_F TGCTGGTGATGGGAGTTGTA
7 bFGF_R CCTCCAAGTAGCAGCCAAAG
8 VEGF_F CCATGAACTTTCTGCTGTCTT
9 VEGF_R TCGATCGTTCTGTATCAGTCT
도 3a에서 확인할 수 있듯이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 모발 성장과 관련된 성장인자인 KGF, bFGF의 mRNA 발현이 증가되는 것을 확인하였다.
또한, 도 3b에서 확인할 수 있듯이, 서열번호 2의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 모발 성장에 영향을 주는 인자인 VEGF의 mRNA 발현이 증가되고, 도 3c에서 확인할 수 있듯이, 서열번호 3의 아미노산 서열로 이루어진 펩타이드 처리에 의해 VEGF, bFGF의 mRNA 발현이 증가되는 것을 확인하였다.
실시예 4: PI3K & p-ERK WB
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 15, 30분 배양하고 세포를 회수하여 세포 용해물을 준비하였다. PI3K 항체(santacruz biotechnology, USA) 및 phospho-ERK 항체(Cell Signaling Technology, USA)를 이용하여 웨스턴 블롯팅을 수행하여 단백질 발현 양상을 비교하여, 그 결과를 도 4a 및 도 4b에 나타내었다.
도 4a 및 도 4b에서 확인할 수 있듯이, 서열번호 1 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 발모 시그널링 분자(hair growth signaling molecule)인 PI3K 발현 증가 및 ERK 인산화 증가가 관찰되었다.
실시예 5: MSX2 RT-PCR
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 MSX2 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 mRNA 발현 정도를 비교하여, 그 결과를 도 5a 및 도 5b에 나타내었다.
서열번호 프라이머 명명 서열목록(5'-3')
10 MSX2_F AACACAAGACCAACCGGAAG
11 MSX2_R GCAGCCATTTTCAGCTTTTC
도 5a 및 도 5b에서 확인할 수 있듯이, 서열번호 2 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 모발 성장 관련 인자인 MSX2의 mRNA 발현이 촉진되는 것을 확인하였다.
실시예 6: TGF-β1 RT-PCR
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 TGF-β1 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 mRNA 발현 정도를 비교하여, 그 결과를 도 6a 및 도 6b에 나타내었다.
서열번호 프라이머 명명 서열목록(5'-3')
12 TGF-β1_F GCCCTGGATACCAACTATTGC
13 TGF-β1_R TCAGCACTTGCAGGAGTAGCG
도 6a 및 도 6b에서 확인할 수 있듯이, 서열번호 1 또는 서열번호 2의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 모발 성장 지연과 관련된 TGF-β1의 mRNA 발현이 억제되는 것을 확인하였다.
실시예 7: Bcl-2/Bax WB
인간 모유두 세포를 4x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 배양하고 세포를 회수하여 세포 용해물을 준비하였다. Bcl-2 및 Bax 항체(santacruz biotechnology, USA)를 이용하여 웨스턴 블롯을 수행하여 단백질 발현 양상을 비교하여, 그 결과를 도 7a 및 도 7b에 나타내었다.
도 7a 및 도 7b에서 확인할 수 있듯이, 서열번호 1 또는 서열번호 3의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 세포 사멸 억제 단백질인 Bcl-2의 발현 증가 및 세포 사멸 관련 단백질인 Bax의 발현 감소가 확인되었다.
실시예 8: 케라틴-14 RT-PCR
인간 모유두 세포를 5x105 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 케라틴-14 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 mRNA 발현 정도를 비교하여, 그 결과를 도 8에 나타내었다.
서열번호 프라이머 명명 서열목록(5'-3')
14 Keratin-14_F CCACCTTTCATCTTCCCAATTCTC
15 Keratin-14_R GTGCGGATCTGGCGGTTG
도 8에서 확인할 수 있듯이, 서열번호 1의 아미노산 서열로 이루어진 펩타이드 처리에 의해 인간 모유두 세포에서 모발 성장 관련 인자인 케라틴-14의 mRNA 발현이 증가되는 것을 확인하였다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
본 발명은 발모 및/또는 육모 촉진 활성을 나타내는 펩타이드, 상기 펩타이드를 유효성분으로 포함하는 발모 촉진용 조성물 및 상기 펩타이드의 발모 촉진 용도에 관한 것이다.

Claims (10)

  1. 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 발모 촉진 활성을 나타내는 펩타이드.
  2. 제1항에 있어서, 상기 펩타이드는 모낭 세포 성장을 촉진하는 것을 특징으로 하는 펩타이드.
  3. 제1항에 있어서, 상기 펩타이드는 β-카테닌의 발현을 증가시키는 것을 특징으로 하는 펩타이드.
  4. 제1항에 있어서, 상기 펩타이드는 KGF(Keratinocyte Growth Factor), bFGF(Basic fibroblast growth factor) 및 VEGF(Vascular endothelial growth factor)로 이루어진 군으로부터 선택되는 발모 관련 성장인자의 발현을 증가시키는 것을 특징으로 하는 펩타이드.
  5. 제1항에 있어서, 상기 펩타이드는 MSX2(Msh homeobox 2) 및 케라틴-14로 이루어진 군으로부터 선택되는 발모 관련 인자의 발현을 증가시키는 것을 특징으로 하는 펩타이드.
  6. 제1항에 있어서, 상기 펩타이드는 PI3K(Phosphoinositide 3-kinase)의 발현 및 ERK(Extracellular Signal-regulated Kinase) 인산화를 증가시키는 것을 특징으로 하는 펩타이드.
  7. 제1항에 있어서, 상기 펩타이드는 TGF-β1(transforming growth factor beta 1)의 발현을 억제하는 것을 특징으로 하는 펩타이드.
  8. 제1항에 있어서, 상기 펩타이드는 Bcl-2(B-cell lymphoma 2)의 발현을 증가시키고 Bax(BCL2-associated X protein)의 발현을 감소시키는 것을 특징으로 하는 펩타이드.
  9. 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 탈모 방지 또는 개선용 조성물.
  10. 서열번호 1 내지 3으로 이루어진 군에서 선택된 아미노산 서열로 이루어진 펩타이드로 이루어진 군에서 선택된 1종 이상의 펩타이드를 유효성분으로 포함하는 발모 또는 육모 촉진용 조성물.
PCT/KR2017/001409 2016-02-18 2017-02-09 발모 및/또는 육모 촉진 활성을 나타내는 펩타이드 및 이의 용도 WO2017142254A1 (ko)

Priority Applications (7)

Application Number Priority Date Filing Date Title
CN201780010329.8A CN108699109B (zh) 2016-02-18 2017-02-09 呈现生发和/或育发促进活性的肽及其的用途
US15/999,744 US10568828B2 (en) 2016-02-18 2017-02-09 Peptide having hair growth-promoting activity and use thereof
ES17753415T ES2870470T3 (es) 2016-02-18 2017-02-09 Péptido que tiene actividad promotora del crecimiento del cabello y uso del mismo
CN202210942015.4A CN116333044A (zh) 2016-02-18 2017-02-09 呈现生发和/或育发促进活性的肽及其的用途
JP2018560419A JP6672482B2 (ja) 2016-02-18 2017-02-09 発毛及び／又は育毛促進活性を示すペプチド及びその用途
CN202210941330.5A CN116333039A (zh) 2016-02-18 2017-02-09 呈现生发和/或育发促进活性的肽及其的用途
EP17753415.3A EP3418291B1 (en) 2016-02-18 2017-02-09 Peptide having hair growth-promoting activity and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160019292A KR101791526B1 (ko) 2016-02-18 2016-02-18 발모 촉진 활성을 나타내는 펩타이드 및 이의 용도
KR10-2016-0019292 2016-02-18

Publications (1)

Publication Number Publication Date
WO2017142254A1 true WO2017142254A1 (ko) 2017-08-24

Family

ID=59625213

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/001409 WO2017142254A1 (ko) 2016-02-18 2017-02-09 발모 및/또는 육모 촉진 활성을 나타내는 펩타이드 및 이의 용도

Country Status (7)

Country Link
US (1) US10568828B2 (ko)
EP (1) EP3418291B1 (ko)
JP (3) JP6672482B2 (ko)
KR (1) KR101791526B1 (ko)
CN (3) CN108699109B (ko)
ES (1) ES2870470T3 (ko)
WO (1) WO2017142254A1 (ko)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102069184B1 (ko) 2019-06-28 2020-01-22 (주)미래씨티 신경줄기세포 추출물유래 bmp신호전달경로 억제 펩타이드 및 상기 펩타이드를 유효성분으로 포함하는 발모촉진 또는 탈모방지 조성물
KR102265431B1 (ko) * 2019-08-20 2021-06-15 주식회사 케어젠 발모 촉진 활성을 갖는 펩타이드 및 이의 용도
JP7485336B2 (ja) 2020-04-01 2024-05-16 丸善製薬株式会社 ＭＳＸ－２ ｍＲＮＡ発現促進剤、まつ毛の育毛剤、及びまつ毛の育毛用外用剤組成物
KR20230047693A (ko) * 2021-10-01 2023-04-10 (주)케어젠 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
KR20230047688A (ko) * 2021-10-01 2023-04-10 (주)케어젠 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
KR20230047691A (ko) * 2021-10-01 2023-04-10 (주)케어젠 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
KR20230047689A (ko) * 2021-10-01 2023-04-10 (주)케어젠 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
KR20230047692A (ko) * 2021-10-01 2023-04-10 (주)케어젠 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
KR20230047690A (ko) * 2021-10-01 2023-04-10 (주)케어젠 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
KR20240050563A (ko) * 2022-10-11 2024-04-19 (주)케어젠 발모 촉진 및 탈모 억제 활성을 갖는 펩타이드 및 이의 용도
KR20240050564A (ko) * 2022-10-11 2024-04-19 (주)케어젠 발모 촉진 및 탈모 억제 활성을 갖는 펩타이드 및 이의 용도

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5516891A (en) 1992-06-16 1996-05-14 Kinerton, Ltd. Liquid phase synthesis of peptides and peptide derivatives
JP2005239695A (ja) * 2004-02-27 2005-09-08 Mitsui Chemicals Inc ＴＧＦ−β産生抑制ペプチド
US7057013B1 (en) * 1998-11-24 2006-06-06 Proyecto De Biomedicina Cima, S.L. TGFβ1 inhibitor peptides
KR20130014700A (ko) * 2011-07-26 2013-02-08 서울대학교산학협력단 Ｖｅｇｆ 발현을 증가시키는 신규한 펩타이드 및 이를 함유하는 약학적 조성물
KR20140107784A (ko) * 2013-02-28 2014-09-05 주식회사 크라운진 탈모 방지 및 모발 성장 촉진용 조성물
KR20160003611A (ko) * 2015-12-21 2016-01-11 (주)케어젠 항염증, 골 형성 및 발모 촉진 활성을 갖는 펩타이드 및 이의 용도

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IT1226552B (it) * 1988-07-29 1991-01-24 Ellem Ind Farmaceutica Peptidi immunostimolanti.
GB9801191D0 (en) * 1998-01-20 1998-03-18 Unilever Plc Skin and hair darkening composition
US6696417B1 (en) 1997-11-21 2004-02-24 Chesebrough-Pond's Usa Co., Division Of Conopco, Inc. Skin and hair darkening composition
WO2002006515A2 (en) * 2000-07-17 2002-01-24 Diadexus, Inc. Method of diagnosing, monitoring, staging, imaging and treating colon cancer
US20030060438A1 (en) * 2000-08-18 2003-03-27 Henry James L. Oligonucleotides and other modulators of the NK-1 receptor pathway and therapeutic uses thereof
WO2002022667A2 (en) * 2000-09-18 2002-03-21 Genencor International, Inc. Twin-arginine translocation in bacillus
FR2857667B1 (fr) * 2003-07-18 2007-07-13 Inst Europ Biolog Cellulaire Nouveaux conjugues peptidiques utiles dans le traitement preventif et curatif de l'alopecie
JPWO2005082395A1 (ja) * 2004-03-02 2008-01-17 国立大学法人京都大学 新規な育毛剤、抗脱毛症剤
JP4461261B2 (ja) * 2004-05-27 2010-05-12 国立大学法人京都大学 新規な育毛剤
JP4861686B2 (ja) * 2005-11-17 2012-01-25 ライオン株式会社 神経栄養因子−４（Ｎｅｕｒｏｔｒｏｐｈｉｎ−４）アンタゴニスト
JP5048372B2 (ja) * 2007-03-30 2012-10-17 日本サプリメント株式会社 育毛促進剤
KR101163171B1 (ko) * 2009-01-20 2012-07-19 (주)케어젠 노긴?유래 펩타이드 및 그의 용도
KR101187871B1 (ko) 2009-09-23 2012-10-05 (주)케어젠 Ｆｇｆ１０－유래 펩타이드 및 그의 용도
KR101285263B1 (ko) * 2011-08-04 2013-07-11 (주)케어젠 Ｅｄａｒ 리간드 유래 펩타이드 및 이의 용도
KR101285259B1 (ko) * 2011-08-04 2013-07-11 (주)케어젠 Ｗｎｔ 계열 유래 펩타이드 및 이의 용도
KR101632948B1 (ko) 2014-05-13 2016-06-27 (주)케어젠 항염증, 골 형성 및 발모 촉진 활성을 갖는 펩타이드 및 이의 용도
KR20150130616A (ko) * 2014-05-13 2015-11-24 (주)케어젠 피부상태 개선 활성을 갖는 펩타이드 및 이의 용도
KR101618329B1 (ko) 2015-12-21 2016-05-19 (주)케어젠 항염증, 골 형성 및 발모 촉진 활성을 갖는 펩타이드 및 이의 용도
KR101841748B1 (ko) * 2016-02-18 2018-05-08 (주)케어젠 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5516891A (en) 1992-06-16 1996-05-14 Kinerton, Ltd. Liquid phase synthesis of peptides and peptide derivatives
US7057013B1 (en) * 1998-11-24 2006-06-06 Proyecto De Biomedicina Cima, S.L. TGFβ1 inhibitor peptides
JP2005239695A (ja) * 2004-02-27 2005-09-08 Mitsui Chemicals Inc ＴＧＦ−β産生抑制ペプチド
KR20130014700A (ko) * 2011-07-26 2013-02-08 서울대학교산학협력단 Ｖｅｇｆ 발현을 증가시키는 신규한 펩타이드 및 이를 함유하는 약학적 조성물
KR20140107784A (ko) * 2013-02-28 2014-09-05 주식회사 크라운진 탈모 방지 및 모발 성장 촉진용 조성물
KR20160003611A (ko) * 2015-12-21 2016-01-11 (주)케어젠 항염증, 골 형성 및 발모 촉진 활성을 갖는 펩타이드 및 이의 용도

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ARCK, PETRA CLARA; HANDJISKI, BORI, AMERICAN JOURNAL OF PATHOLOGY, vol. 162, no. 3, 2003
MERRIFIELD, J. AMER. CHEM. SOC., vol. 85, 1963, pages 2149 - 54
OLIVER, EMBRYOL. EXP. MORPH., vol. 15, 1966, pages 3311
OLIVER, EMBRYOL. EXP. MORPH., vol. 16, 1966, pages 231
STENN; PAUS, PHYSIOL. REV., vol. 81, 2002, pages 449
STEWART ET AL.: "Solid Phase Peptide Synthesis", 1984, PIERCE CHEM. CO.

Also Published As

Publication number Publication date
JP6672482B2 (ja) 2020-03-25
CN116333044A (zh) 2023-06-27
US10568828B2 (en) 2020-02-25
KR20170097830A (ko) 2017-08-29
EP3418291A1 (en) 2018-12-26
CN108699109B (zh) 2022-08-16
KR101791526B1 (ko) 2017-11-01
EP3418291B1 (en) 2021-03-24
CN116333039A (zh) 2023-06-27
CN108699109A (zh) 2018-10-23
JP2020105196A (ja) 2020-07-09
JP6868723B2 (ja) 2021-05-12
JP2020105197A (ja) 2020-07-09
EP3418291A4 (en) 2019-01-02
US20190046427A1 (en) 2019-02-14
JP6866518B2 (ja) 2021-04-28
ES2870470T3 (es) 2021-10-27
JP2019507187A (ja) 2019-03-14

Similar Documents

Publication Publication Date Title
WO2017142254A1 (ko) 발모 및/또는 육모 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2017155232A2 (ko) 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
KR101285259B1 (ko) Ｗｎｔ 계열 유래 펩타이드 및 이의 용도
KR101198918B1 (ko) Ｗｎｔ１０?유래 펩타이드 및 그의 용도
WO2017142305A1 (ko) 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2018131900A2 (ko) 나노그를 도입한 양수 내 태아 유래 중간엽 줄기세포로부터 획득한 엑소좀 내 포함된 육모 촉진용 조성물의 제조방법
WO2017105161A2 (ko) 피부 미백 활성을 갖는 펩타이드 및 이의 용도
EP2740740B1 (en) Edar ligand-derived peptide and uses thereof
KR101810868B1 (ko) 발모 촉진 활성을 나타내는 펩타이드 및 이의 용도
EP3431505B1 (en) Conjugate of finasteride with peptide
EP3501545B1 (en) Conjugate of minoxidil and peptide
WO2018199358A1 (ko) 피부 미백 활성을 갖는 펩타이드 및 이의 용도
KR101885847B1 (ko) 발모 촉진 활성 및 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
KR101209117B1 (ko) 변형된 ｗｎｔ１０?유래 펩타이드 및 그의 용도
KR101810867B1 (ko) 발모 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2018151352A1 (ko) 살리실산과 펩타이드의 결합체

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17753415

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2018560419

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2017753415

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017753415

Country of ref document: EP

Effective date: 20180918