WO2013137505A1 - 신규한 ｔｒｐｖ１ 억제 펩티드 및 이를 함유하는 피부노화 방지 또는 주름 개선용 조성물 - Google Patents

신규한 ｔｒｐｖ１ 억제 펩티드 및 이를 함유하는 피부노화 방지 또는 주름 개선용 조성물 Download PDF

Info

Publication number
WO2013137505A1
WO2013137505A1 PCT/KR2012/001932 KR2012001932W WO2013137505A1 WO 2013137505 A1 WO2013137505 A1 WO 2013137505A1 KR 2012001932 W KR2012001932 W KR 2012001932W WO 2013137505 A1 WO2013137505 A1 WO 2013137505A1
Authority
WO
WIPO (PCT)
Prior art keywords
trpv1
seq
group
peptide
skin
Prior art date
Application number
PCT/KR2012/001932
Other languages
English (en)
French (fr)
Inventor
정진호
강소민
이영미
이세라
김연경
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to KR1020147025534A priority Critical patent/KR101784766B1/ko
Priority to JP2015500346A priority patent/JP6185549B2/ja
Priority to PCT/KR2012/001932 priority patent/WO2013137505A1/ko
Priority to US13/855,022 priority patent/US9056889B2/en
Publication of WO2013137505A1 publication Critical patent/WO2013137505A1/ko
Priority to US14/725,383 priority patent/US9511011B2/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/02—Cosmetics or similar toiletry preparations characterised by special physical form
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/04—Antipruritics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/16—Emollients or protectives, e.g. against radiation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/18—Antioxidants, e.g. antiradicals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants

Definitions

  • the present invention relates to an activity inhibitory peptide of TRPV1 affecting intracellular Ca 2+ influx, and a composition for preventing skin aging, improving skin wrinkles, skin whitening, inflammation, itching, or pain.
  • Skin aging is often caused by external and internal (natural) processes associated with an increase in wrinkles, sagging and sagging, and is generally referred to as 'photoaging' because external aging is primarily caused by repeated ultraviolet rays (UV) exposure. It is called.
  • Naturally aged skin is smooth, pale and fine wrinkles, but photo-aged skin develops thick wrinkles and causes pigmentation and capillary dilatation.
  • MMP matrix metalloproteinases
  • transient receptor potential vanilloid type 1 is one of a family of calcium-permeable non-selective cation channels, in which TRPV1 activity induces Ca 2+ uptake and is inhibited by certain antagonists such as capsazepine. .
  • TRPV1 is directly activated by capsaicin, heat, low pH, bradykinin, PGE 2 , or ATP.
  • TRPV1 is the primary biological sensor for thermo-chemical stimulation and tissue damage.
  • TRPV1 is reported to be present in various tissues such as brain, kidney, bronchial epithelial cells and epidermal keratinocytes.
  • capsaicin stimulation increases the concentration of Ca 2+ in the cytoplasm of keratinocytes, which are inhibited by capsazepine.
  • TRPV1 The role of TRPV1 in the heat induced MMP-1 expression of epidermal cells has been reported, and UV light is a more decisive factor in inducing MMP expression and skin aging.
  • Ca 2+ influx through TRPV1 is a critical factor in UV-induced MMP-1 expression, and Ca 2+ dependent protein kinase C (PKC) is involved in signal transduction.
  • PKC Ca 2+ dependent protein kinase C
  • epidermal TRPV1 will function as a sensor for harmful stimuli such as ultraviolet light. Therefore, since TRPV1 may be a target for preventing skin photoaging caused by ultraviolet light exposure, there is a need for discovering a novel TRPV1 activity inhibiting substance in order to prevent and prevent skin aging.
  • An object of the present invention is to provide a TRPV1 inhibitory peptide and a composition for preventing skin aging, improving skin wrinkles, skin whitening, inflammation, itching, or pain.
  • the present invention provides a peptide described in SEQ ID NO: 1 to SEQ ID NO: 8.
  • the peptide is identified as a novel TRPV1 activity inhibitory peptide.
  • the TRPV1 is a non-specific cation channel belonging to the TRP family and is a membrane protein that is activated by capsaicin, a hot ingredient of red pepper, induces cation and forms a membrane voltage, thereby transmitting stimuli to the nervous system.
  • the activity of TRPV1 is regulated through several pathways, and it is known that activity is regulated by phosphorylation and dephosphorylation including PKA, PKC, Ca 2+ / calmodulin-dependent protein kinase (CaMK) and Src kinase. It may also be regulated by post-transcriptional regulatory mechanisms in addition to phosphorylation.
  • PKA PKA
  • PKC Ca 2+ / calmodulin-dependent protein kinase
  • Src kinase Src kinase
  • the novel peptides described in SEQ ID NOS: 1-8 have been identified.
  • the peptide is a peptide capable of inhibiting the CaMK activity site that affects intracellular Ca 2+ influx by TRPV1 activity or a phosphorylated amino acid-based peptide sequence of TRPV1 protein, and thus it was confirmed that the peptide effectively inhibits TRPV1 activity.
  • One peptide can be usefully used as an inhibitor of TRPV1 activity.
  • the present invention also provides a cosmetic composition for preventing skin aging or for improving wrinkles, which contains any one or more selected from the group consisting of peptides represented by SEQ ID NOs: 1 to 8.
  • the anti-aging of the skin refers to the action of inhibiting skin aging due to photoaging or natural aging, but the skin aging is preferably photoaging due to UV exposure.
  • the skin wrinkles may be due to photoaging or natural aging, more preferably by photoaging, and more preferably, photoaging by UV exposure, but is not limited thereto.
  • the skin aging and wrinkles are preferably based on TRPV1 activity, but is not limited thereto.
  • the peptide is preferably contained at a concentration of 0.001 to 20 mM in the cosmetic composition, more preferably at a concentration of 0.01 to 10 mM, but is not limited thereto.
  • concentration of the peptide is less than 0.001 mM, TRPV1 inhibition and anti-aging and skin wrinkle improvement effects cannot be obtained.
  • concentration of the peptide exceeds 20 mM, there is a problem in that production economy is inferior due to no apparent increase in effect due to an increase in content.
  • the peptide of the present invention can be prepared by general chemical synthesis, for example, solid-phase peptide synthesis, and by culturing a microorganism transformed with a recombinant vector containing a nucleic acid encoding the peptide.
  • the peptide may be expressed and then purified by conventional methods, but is not limited thereto.
  • the cosmetic composition according to the present invention may further contain, in addition to the above peptides, other components that can give a synergistic effect to the effects of the peptides within the range of not impairing the effects aimed at by the present invention.
  • other components that can give a synergistic effect to the effects of the peptides within the range of not impairing the effects aimed at by the present invention.
  • conventional adjuvants such as antioxidants, stabilizers, solubilizers, vitamins, pigments and flavorings, or carriers.
  • the cosmetic composition of the present invention is not particularly limited in its formulation, and may be prepared in any formulation conventionally prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, And creams, lotions, powders, soaps, surfactant-containing cleansing, oils, powder foundations, emulsion foundations, wax foundations, sprays and the like. More specifically, it may be prepared in the form of a lotion, essence, lotion, cream, pack, gel, ointment, patch or spray.
  • the formulation of the cosmetic composition is a paste, cream or gel
  • animal oil, vegetable oil, wax, paraffin, starch, trakant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide are used as carrier components.
  • Lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as the carrier component in the case of powders or sprays, in particular chlorofluorohydrocarbons, propane / Propellants, such as butane or dimethylether.
  • a solvent, solubilizer or emulsion may be used as the carrier component, for example water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, Fatty acid esters of propylene glycol, 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan.
  • liquid carrier diluents such as water, ethanol or propylene glycol
  • suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, and microcrystals
  • ethoxylated isostearyl alcohol such as water, ethanol or propylene glycol
  • suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters
  • microcrystals Cellulose, aluminum meta hydroxide, bentonite, agar or tracant and the like
  • surfactant-containing cleansing as a carrier component, an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, isethionate , Imidazolinium derivatives, methyltaurate, sarcosinates, fatty acid
  • TRPV1 is involved in the regulation of skin proliferation and differentiation, and TRPV1 mediated calcium influx in cultured human keratinocytes has been reported to inhibit cell proliferation and induce cell death. Moreover, activation of TRPV1 by capsaicin or heat has been known to alter the formation of the permeation barrier of the epithelium in human skin.
  • the present inventors have studied to find a novel inhibitor that inhibits the activity of TRPV1 as described above, the novel TRPV1 inhibitory peptide (peptide 1: QRRPSLKSL, peptide 2: QRAITILDT, peptide 3: RRPSL, Peptide 4: RAITI, Peptide 5: MHRQETVDC, Peptide 6: LKKFNARRKL, Peptide 7: RQETV and Peptide 8: KFNAR) were established and the effect of inhibiting skin aging and wrinkle improvement by the peptide was established.
  • the novel TRPV1 inhibitory peptide peptide 1: QRRPSLKSL, peptide 2: QRAITILDT, peptide 3: RRPSL, Peptide 4: RAITI, Peptide 5: MHRQETVDC, Peptide 6: LKKFNARRKL, Peptide 7: RQETV and Peptide 8: KFNAR
  • peptide to HaCaT cells which are human keratinocytes
  • expression of MMP-1 induced by UV exposure was reduced (see FIGS. 1A and 1B)
  • IL The expression of pro-inflammatory cytokines such as -1 ⁇ , IL-6, IL-8 and TNF- ⁇ has been shown to be inhibited (see FIGS. 2A-2H), thereby allowing peptides of the invention to be exposed to UV radiation. It was found that it suppresses the increased intracellular phenomenon.
  • capsaicin which is an activation inducer of TRPV1
  • peptide treatment after capsaicin was shown to inhibit intracellular Ca 2+ influx by capsaicin (see FIG. 3).
  • the skin of hairless mice was irradiated with UV and treated with peptides (see FIG. 4).
  • the peptides concentration-dependently reduced the skin thickness increased by UV exposure see FIGS. 5 and 9
  • MMP-13 and MMP-9 see FIGS. 6 and 7
  • Procollagen, a precursor of collagen was shown to increase (see FIG. 8).
  • the effect of inhibiting apoptosis induced by UV exposure was confirmed (see FIG. 10).
  • the novel peptide of the present invention has the effect of inhibiting the skin aging phenomenon induced after UV exposure by inhibiting the activity of TRPV1 involved in skin aging, inhibiting the expression and activity of MMP and improving the expression of procollagen. Since it can contribute to skin wrinkle and elasticity improvement, the peptide can be usefully used as an active ingredient of the cosmetic composition for preventing skin aging and wrinkle improvement.
  • the present invention also provides a pharmaceutical composition for preventing skin aging or improving wrinkles, which contains any one or more selected from the group consisting of peptides represented by SEQ ID NOs: 1 to 8.
  • the skin aging may be photo aging or natural aging, more preferably photo aging, the photo aging is most preferably due to UV exposure, but is not limited thereto.
  • the concentration of the peptide contained in the pharmaceutical composition is preferably 0.001 to 20 mM, more preferably 0.01 to 10 mM, but is not limited thereto. If the concentration of the peptide is less than 0.001 mM, the effect of preventing skin aging or wrinkle improvement may not be obtained. If the concentration of the peptide exceeds 20 mM, there is a problem of using more peptide than necessary.
  • TRPV1 inhibitory peptide of the present invention inhibits the expression of MMPs and proinflammatory cytokines induced by UV exposure in human keratinocytes and in vivo, reduces skin thickness and apoptosis, and reduces procollagen with UV exposure Since it increases the expression of, it can be usefully used as an active ingredient of the pharmaceutical composition for preventing skin aging or improving wrinkles.
  • the present invention also provides a pharmaceutical composition for skin whitening containing any one or more selected from the group consisting of peptides set forth in SEQ ID NO: 1 to SEQ ID NO: 8 as an active ingredient.
  • the concentration of the peptide contained in the pharmaceutical composition is preferably 0.001 to 20 mM, more preferably 0.01 to 10 mM, but is not limited thereto. If the concentration of the peptide is less than 0.001 mM, the skin whitening effect may not be sufficiently obtained. If the concentration of the peptide exceeds 20 mM, the skin whitening effect does not increase relative to the concentration.
  • the TRPV1 inhibitory peptides of the invention inhibit the expression of MMP induced by UV exposure in human keratinocytes and in vivo, reduce skin thickness and apoptosis, and inhibit the expression of procollagen. Increase. Since the TRPV1 inhibitory peptide shows an effect on skin blackening and skin whitening activity by UV exposure through the proliferation and regeneration of these keratinocytes, it can be usefully used as an active ingredient of a pharmaceutical composition for skin whitening.
  • the present invention provides a pharmaceutical composition for improving inflammation, itching, or pain containing any one or more selected from the group consisting of peptides set forth in SEQ ID NO: 1 to SEQ ID NO: 8 as an active ingredient.
  • the concentration of the peptide contained in the pharmaceutical composition is preferably 0.001 to 20 mM, more preferably 0.01 to 10 mM, but is not limited thereto.
  • the inflammation, itching and pain may be caused by stimulation by UV exposure, but is not limited thereto.
  • the inhibitory effect of the TRPV1 inhibitory peptide on pro-inflammatory cytokines induced by UV exposure in human keratinocytes and in vivo As a result, the expression levels of proinflammatory cytokines IL-1 ⁇ , IL-6, IL-8 and TNF- ⁇ were found to be significantly reduced (see FIGS. 2A to 2H).
  • the TRPV1 has been reported to cause inflammation in various diseases and injuries.
  • TRVP1 is known to promote the secretion of proinflammatory cytokines by inducing activity by capsaicin in keratinocytes derived from human epithelium and hair follicles, and has been known to be associated with TRPV1 and inflammation.
  • TRPV1 knockout mice have increased heat thresholds and reduced tissue swelling in arthritis (see Pharmacology and Therapeutics 2010; 125: 181.95, Science 2000; 288: 306.13, Arthritis and Rheumatism 2005; 52: 3248.56).
  • TRPV1 plays an important role in the pain delivery pathway. That is, when TRPV1 is activated by a pain medium, cations are introduced through the cation channel TRPV1, and pain is transmitted to the central nervous system by the action potential. Therefore, TRPV1 has already been studied as an important target molecule for analgesic and anti-inflammatory development (see Journal of the Korea Academia-Industrial cooperation Society, 2011, pp. 3096-3102).
  • TRPV1 is associated with the development of skin itch, which has been shown to occur through itching-specific subpopulation of sensory afferent neurons expressing TRPV1 ( J. Clin. Invest. 116, 11741186, 2006, Biochim. Biophys.Acta 1772, 10041021, 2007). TRPV1 is expressed in human skin and not in neuronal cells, particularly in epidermal keratinocytes of patients suffering from nodular itch rash.
  • the TRPV1 inhibitory peptide of the present invention can improve inflammation, itching or pain based on increasing TRPV1 activity by inhibiting TRPV1 activity, and thus can be usefully used as an active ingredient of an inflammation, itching or pain pharmaceutical composition.
  • Routes of administration of the pharmaceutical compositions according to the invention include oral, intravenous, intramuscular, intraarterial, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual or rectal, with oral or parenteral administration being preferred.
  • oral or parenteral administration is preferred.
  • the parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intralesional injection or infusion techniques.
  • composition of the present invention may further contain at least one active ingredient exhibiting the same or similar function in addition to the TRPV1 inhibitory peptide of the present invention.
  • the composition may be used in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, oral formulations, external preparations, suppositories, and sterile injectable solutions, respectively, according to conventional methods.
  • Solid preparations for oral administration include powders, granules, tablets, capsules, soft capsules, pills and the like.
  • Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration include powders, granules, tablets, capsules, sterile aqueous solutions, solutions, non-aqueous solutions, suspensions, emulsions, syrups, suppositories, aerosols, etc.
  • an external skin pharmaceutical composition of cream, gel, patch, spray, ointment, warning agent, lotion agent, linen agent, pasta agent or cataplasma agent may be prepared and used. It is not limited to this.
  • the non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used.
  • the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the composition may further contain preservatives, stabilizers, emulsifiers or emulsifiers, auxiliaries such as salts and / or buffers for the control of osmotic pressure, and other therapeutically valuable substances and may be mixed, granulated or It may be formulated according to the coating method.
  • the pharmaceutical composition of the present invention may vary depending on several factors, including the age, weight, general health, sex, time of administration, route of administration, rate of release, drug combination and severity of the particular disease of the individual.
  • the peptide contains the peptide of the present invention as an active ingredient in a unit dose of about 0.01 to 1,500 mg, Dosages required range from about 1 to 500 mg per day, depending on the frequency and intensity of administration, but are not limited thereto. For intramuscular or intravenous administration to adults, a full dose of about 5 to 300 mg per day will usually be sufficient, but for some patients a higher daily dose may be desirable.
  • composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy and biological response modifiers.
  • the present invention provides a method for preventing skin aging or improving wrinkles, comprising the step of treating or administering to a subject any one or more selected from the group consisting of peptides described in SEQ ID NO: 1 to SEQ ID NO: 8 in a pharmaceutically effective amount. to provide.
  • the present invention also provides a skin whitening method comprising the step of treating or administering to a subject any one or more selected from the group consisting of peptides described in SEQ ID NOs: 1 to 8.
  • the present invention is a method for improving inflammation, itching, or pain, comprising the step of treating or administering to a subject any one or more selected from the group consisting of peptides set forth in SEQ ID NO: 1 to SEQ ID NO: 8 in a pharmaceutically effective amount To provide.
  • the pharmaceutically effective amount is 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / kg, but is not limited thereto.
  • the treatment or dosage may be adjusted according to the weight, age, sex, health condition, diet, duration of administration, method of administration, clearance, severity of the disease, etc. of the particular patient. Treatment or administration may be administered once a day or may be divided several times.
  • the subject is a vertebrate and preferably a mammal, more preferably an experimental animal such as a rat, rabbit, guinea peak, hamster, dog or cat, most preferably an ape-like animal such as a chimpanzee or gorilla.
  • an experimental animal such as a rat, rabbit, guinea peak, hamster, dog or cat
  • an ape-like animal such as a chimpanzee or gorilla.
  • the treatment or method of administration may be applied, oral or parenteral, and may be intraperitoneal, intrarectal, subcutaneous, intravenous, intramuscular, intrauterine dural, cerebral vascular or thoracic It can be administered by internal injection.
  • the inflammation is dermatitis, allergy, atopic dermatitis, conjunctivitis, periodontitis, rhinitis, otitis media, sore throat, tonsillitis, pneumonia, gastric ulcer, gastritis, Crohn's disease, colitis, hemorrhoids, gout, ankylosing spondylitis, rheumatic fever, lupus, fibromyalgia , Psoriatic arthritis, osteoarthritis, rheumatoid arthritis, periarthritis, tendinitis, hay salt, periarthritis, myositis, hepatitis, cystitis, nephritis, sjogren's syndrome, multiple sclerosis, and acute and chronic inflammatory diseases It may be one, but is not limited thereto.
  • the TRPV1 inhibitory peptide of the present invention effectively inhibits the activity of TRPV1, it can be usefully used for alleviating and improving skin aging, wrinkles, whitening, and inflammation, itching and pain, which are diseases based on the activation of TRPV1.
  • test substance which reduces the activity of the protein as compared to the control group by measuring the activity of the test substance-treated TRPV1 protein and the test substance-untreated TRPV1 protein as a control group.
  • a method for screening a candidate material for preventing or improving wrinkles is provided.
  • the present invention provides a screening method using any one or more selected from the group consisting of peptides of SEQ ID NO: 1 to SEQ ID NO: 8 of the present invention.
  • the transformant is treated with a TRPV1 specific activator and a TRPV1 activity inhibitor candidate in an experimental group, and the control group is any one selected from the group consisting of the TRPV1 specific activator and a peptide described in SEQ ID NO: 1 to SEQ ID NO: 8. Processing the;
  • a method of screening a TRPV1 activity inhibitor comprising comparing the respective measurements of step 3) to select a TRPV1 activity inhibitor candidate exhibiting TRPV1 ion channel activity lower or similar to the control.
  • It provides a screening method of the candidate material for preventing skin aging or wrinkle improvement comprising the step of screening the test material showing a TRPV1 ion channel activity lower or similar to the control by comparing the respective measurements of step 3).
  • the host cell of step 1) may be a human keratinocyte line, and more preferably, but not limited to, a HaCaT cell line, all cell lines that can be used for ion channel activity studies and high efficiency inhibitor screening. Available.
  • the TRPV1 specific active agent of step 2) is preferably UV or capsaicin, and the TRPV1 inhibitory peptide described in SEQ ID NOS: 1 to 8 of the present invention is preferably treated at a concentration of 0.001 to 20 mM. And, it is more preferable to treat with 0.01 to 10 mM, but is not limited thereto.
  • Candidates of step 2) may be natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, bacteria or fungi metabolites or bioactive molecules.
  • the measurement of TRPV1 ion channel activity of step 3) may be performed by calcium imaging, but is not limited thereto. Any test method capable of confirming the activity of TRPV1 may be used.
  • TRPV1 activator Since the peptides described in SEQ ID NO: 1 to SEQ ID NO: 8 of the present invention inhibit TRPV1 activity increased by UV or capsaicin known as TRPV1 activator, and have an effect of improving skin aging and wrinkles based on TRPV1 activity in animal models, Skin aging or anti-wrinkle agents mediated by TRPV1 by selecting TRPV1 activity inhibitors and test substances with similar or higher inhibitory effects compared to the inhibitory effects of peptides set forth in SEQ ID NOS: 1 to 8 on TRPV1 activity Candidates of can be screened.
  • the present invention has developed a novel peptide having an anti-aging effect and anti-wrinkle effect.
  • the peptide inhibits the expression of MMP and proinflammatory cytokines induced by UV exposure in human keratinocytes and in vivo, and reduces skin thickness and It reduces apoptosis and increases the expression of procollagen reduced by UV exposure, thereby improving skin wrinkles and elasticity due to skin aging and is effective as an agonist of a composition having anti-aging effect.
  • FIGS. 1A and 1B are diagrams showing changes in the expression level of MMP-1 induced by UV by each TRPV1 inhibitory peptide.
  • 2A to 2H are diagrams showing changes in the amount of proinflammatory cytokine expression induced by UV by each TRPV1 inhibitory peptide.
  • FIG. 5 shows increased skin thickness change by UV of hairless mouse skin by TRPV1 inhibitory peptide.
  • Fig. 6 is a graph showing the change in the expression level of MMP-13 induced by UV of hairless mouse skin by TRPV1 inhibitory peptide.
  • Fig. 7 shows changes in expression levels of MMP-13 and MMP-9 genes induced by UV of hairless mouse skin by TRPV1 inhibitory peptides.
  • FIG. 8 is a graph showing changes in the expression level of procollagen genes reduced by UV of hairless mouse skin by TRPV1 inhibitory peptides.
  • FIG. 9 is a diagram showing the change of cell thickness increased by UV of hairless mouse skin by TRPV1 inhibitory peptide.
  • FIG. 10 shows changes in apoptosis increased by UV in hairless mouse skin by TRPV1 inhibitory peptides.
  • novel peptide 1 QRRPSLKSL (SEQ ID NO: 1)
  • peptide 2 QRAITILDT (SEQ ID NO: 2)
  • peptide 3 RRPSL (SEQ ID NO: 3)
  • peptide 4 RAITI (SEQ ID NO: 4)
  • peptide 5 MHRQETVDC ( SEQ ID NO: 5)
  • Peptide 6 LKKFNARRKL (SEQ ID NO: 6)
  • Peptide 7 RQETV (SEQ ID NO: 7)
  • Peptide 8 KFNAR (SEQ ID NO: 8).
  • HaCaT an immortalized human keratinocyte line
  • DMEM Dulbecco's modified Eagle's media
  • penicillin 50 mg / mL streptomycin
  • FBS phosphate buffered saline
  • the HaCaT cells showed emission spectra in the range of 275 and 380 nm 30 minutes after each peptide was treated with HaCaT cells.
  • 310-315 nm was irradiated using Philips TL 20W / 12 RS fluorescent sunlight.
  • AKodacel filter (TA401 / 407; Kodak) having a wavelength of 290 nm or less was used to prevent UVC, and UV intensity was measured using a Waldmann UV meter.
  • UV irradiation the culture medium of the cells was replaced with fresh medium without FBS, and after further incubation, each peptide prepared in ⁇ Example 1> was added to the medium.
  • the UV irradiation group was found to increase the expression level of MMP-1 protein compared to the UV irradiation group, and in the UV irradiation and peptide treatment group, the expression of MMP-1 protein increased by UV was increased as the peptide concentration was increased. The amount was found to be significantly reduced (FIGS. 1A and 1B).
  • the primers of Table 1 were used, and PCR was performed under conditions of 2 minutes at 50 ° C, 2 minutes at 95 ° C, and then 15 seconds at 95 ° C of 40 cycles and 1 minute at 60 ° C.
  • Data were analyzed using 2-DDCT method, expressed as gene expression multiples by normalizing to the expression level of 36B4 gene, and normalized to the intensity of the 36B4 gene, and then increasing or decreasing the ratio compared to UV irradiation group or control group. It was. Each experiment was performed three times, each of which was repeated at least three times.
  • Example ⁇ 3-1> the expression level of the MMP-1 gene was significantly increased in the UV irradiation group compared to the UV irradiation group, and in each UV irradiation and peptide treatment group, The expression level of the MMP-1 gene was shown to decrease depending on the treatment concentration (FIGS. 1A and 1B). Therefore, the TRPV1 inhibitory peptide of the present invention was found to act to reduce the expression of MMP-1 by UV stimulation.
  • IL-1 ⁇ In order to confirm the cytokine expression change of the TRPV1 inhibitory protein on the UV-irradiated cells, IL-1 ⁇ , IL- in HaCaT cells treated with each TRPV1 peptide, according to the method of Example ⁇ 3-1>. 6, IL-8 and TNF- ⁇ protein expression was measured.
  • the TRPV1 inhibitory protein was shown to reduce the expression level of the cytokines increased by UV exposure (Figs. 2A-2H).
  • HaCaT cells were cultured in a cover glass, and then cultured in a serum-free medium to which 4 mM Fluo-4 AM (Molecular Probes) was added at room temperature for 45 minutes. After incubation, the cells were washed three times with serum-free medium, and then the cells on the cover glass were transferred to a customized observation chamber and left for 20 minutes. Subsequently, only capsaicin is treated to induce the activity of TRPV1, or the peptides of the present invention are combined with capsaicin to Tyrode's buffer (140 mM NaCl, 5 mM KCl, 1 mM MgCl 2 , 2 mM CaCl 2 , 10 mM glucose, respectively).
  • Tyrode's buffer 140 mM NaCl, 5 mM KCl, 1 mM MgCl 2 , 2 mM CaCl 2 , 10 mM glucose, respectively.
  • the TRPV1 inhibitory peptide treated group was found to have a significantly lower Ca 2+ intensity than the capsaicin-only peptide untreated group. Therefore, it was confirmed that the TRPV1 inhibitory peptides of the present invention inhibit the influx of Ca 2+ into keratinocytes (FIG. 3).
  • Irradiation intensity at the skin surface was measured using a UV meter (model 585100; Waldmann Co., Villingen-Schwenningen, Germany) and the irradiation intensity at 30 cm from the light source was 1.0 dl / cm 2.
  • the minimum erythema dose (MED) measured on the dorsal skin of the mouse for the first time was determined as the minimum irradiation dose required to form a sharp borderline erythema after 24 hours.
  • the Skh-1 mice were divided into six groups: (1) UV untreated and carrier treated group, (2) UV untreated and 1 mM peptide treated group, (3) UV irradiated and carrier treated group, (4 ) UV irradiation and 0.01 mM peptide treatment group, (5) 0.1 mM peptide treatment group, (6) UV irradiation and 1 mM peptide treatment group.
  • the carrier consisted of ethanol (30%) and polyethylene glycol (70%) and the carrier and peptides were treated on the dorsal skin surface of mice 0 and 24 hours after UV irradiation. The mice were then killed 48 hours after UV irradiation and the skin specimens were biopsied (FIG. 4).
  • Subcutaneous fat thickness was measured using a caliper (PEACOCK, Ozaki MFG Co. Ltd., Tokyo, Japan) 24 hours before and 24 hours after UV irradiation of Example ⁇ 5-2>. Specifically, the centerline skin was pinched upward at the neck and the lower part of the tail, and the subcutaneous fat thickness was measured midway between the neck and hips.
  • PEACOCK Ozaki MFG Co. Ltd., Tokyo, Japan
  • the thickness of the subcutaneous fat was rapidly increased by irradiation with UV, and the thickness of the subcutaneous fat was decreased when the 1 mM TRPV1 inhibitory peptide was treated (FIG. 5).
  • the mouse skin tissue of Example ⁇ 5-2> was cold lysis buffer [50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM ethylenediamine tetraacetic acid to which fresh protease inhibitor cocktail (Roche, Indianapolis, IN) was added. (ethylenediamine tetraacetic acid; EDTA), 5 mM phenylmethanesulfonyl fluoride (PMSF), and 1 mM dithiothreitol (DTT), 1% Triton X-100]. The homogenate was then centrifuged at 15,000 g for 30 minutes at 4 ° C. to obtain a supernatant and then stored at ⁇ 70 ° C.
  • EDTA ethylenediamine tetraacetic acid
  • PMSF phenylmethanesulfonyl fluoride
  • DTT dithiothreitol
  • Protein content in the lysate was determined by Bradford analysis. Equal amounts of protein were separated on 8-16% Tris-glycine SDS-PAGE gels and electrophoresed onto PVDF membranes. The blots were then blocked for 1 hour at room temperature with blocking buffer and then incubated with monoclonal anti-MMP-13 antibody (Neomarkers, Fremont, CA). As a control, ⁇ -actin levels were measured in the same cell lysates using ⁇ -actin antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). Signal strength was quantified using a densitometer program.
  • the expression level of MMP-13 protein was increased in comparison with the UV irradiating group, and in the UV irradiation and peptide treatment groups, the expression level of MMP-13 protein was significantly decreased as the peptide concentration was increased. (FIG. 6).
  • RNA was isolated from mouse skin tissue of Example ⁇ 5-2> to synthesize cDNA.
  • PCR was performed on a 7500 Real-time PCR System (Applied Biosystems, Foster City, CA) using SYBR_Premix Ex TaqTM (Takara Bio Inc., Shiga, Japan) for quantification of mRNA expression for MMP.
  • the primers of Table 2 were used, and PCR was carried out under conditions of 2 minutes at 50 ° C, 2 minutes at 95 ° C, and then 15 seconds at 95 ° C of 40 cycles and 1 minute at 60 ° C.
  • the data were analyzed using 2-DDCT method, and normalized to the expression level of 37B4 gene and expressed as a fold of gene expression, and after normalizing to the intensity of the 37B4 gene, yielding an increased or decreased ratio compared to the UV irradiation group or the control group. It was. Each experiment was performed three times, each of which was repeated at least three times.
  • the TRPV1 inhibitory peptide was shown to significantly reduce the expression of MMP-13 and MMP-9 genes increased by UV irradiation (FIG. 7). In addition, it was confirmed that expression of the procollagen gene reduced by UV irradiation was significantly increased by TRPV1 inhibitory peptide treatment (FIG. 8).
  • hematoxylin and eosin (H & E) staining was performed on the skin tissue of the mouse of Example ⁇ 5-2>. Specifically, mouse skin tissue was fixed in 10% buffered formalin for 24 hours and then embedded in paraffin. Continuous sections (4 ⁇ m) were mounted on silane coated slides, stained with hematoxylin solution for nuclear staining and eosin solution for cytoplasmic staining according to the general method presented in previous studies. Epithelial thickness was then measured using an image analysis program (BMI plus software, BumMi Universe Co., Kyungki, Korea).
  • TUNEL staining was performed on mouse skin tissues. Specifically, mouse skin tissue was fixed in 10% buffered formalin for 24 hours and then embedded in paraffin. Consecutive sections (4 ⁇ m) were mounted on silane coated slides and a typical TUNEL staining method using the ApopTagPlus Peroxidase In Situ Apoptosis Kit /S7101MAN.pdf (Millipore TM )] was confirmed apoptosis according to.
  • the flexible purified water containing the TRPV1 inhibitory peptide of the present invention as an active ingredient was prepared as shown in Table 3 below.
  • Nutritional cream containing the TRPV1 inhibitory peptide of the present invention as an active ingredient was prepared as shown in Table 4 below.
  • tablets were prepared by tableting according to a conventional method for producing tablets.
  • the capsule was prepared by filling in gelatin capsules according to the conventional method for producing a capsule.
  • the solution was filled into a 5 ml Type I ampoule made of clear glass, encapsulated under an upper grid of air by dissolving the glass, and sterilized by autoclaving at 120 ° C. for at least 15 minutes to prepare an injection solution.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Dermatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Birds (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)

Abstract

본 발명은 신규한 TRPV1 억제 펩티드 및 이를 유효성분으로 함유하는 피부노화 방지 및 피부주름 개선용 조성물에 관한 것으로서, 본 발명의 TRPV1 억제 펩티드는 UV 노출에 의해 유도된 MMP 및 전염증성 사이토카인의 발현을 억제하고, 세포내 Ca2+ 유입 및 피부 두께 증가를 억제하므로, 피부노화 방지, 피부 주름 증가 억제, 탄력성 증가, 피부미백 및 염증, 가려움증, 또는 통증의 개선을 위한 조성물의 유효성분으로서 유용하게 사용할 수 있다.

Description

신규한 ＴＲＰＶ１ 억제 펩티드 및 이를 함유하는 피부노화 방지 또는 주름 개선용 조성물
본 발명은 세포내 Ca2+ 유입에 영향을 미치는 TRPV1의 활성 억제 펩티드, 및 이를 함유하는 피부노화 방지, 피부주름 개선, 피부미백, 염증, 가려움증, 또는 통증 개선용 조성물에 관한 것이다.
피부 노화는 흔히 주름, 처짐 및 늘어짐의 증가와 관련된 외적 및 내적(자연적)인 과정에 의한 것으로서, 외적 노화는 반복되는 자외선(ultraviolet rays, UV) 노출에 의해 주로 발생하기 때문에 이를 일반적으로 '광노화'라고 한다. 자연적으로 노화된 피부는 매끄럽고 창백하며 잔주름이 있으나, 광노화된 피부는 굵은 주름이 생기며 색소침착 및 모세혈관 확장증을 야기한다.
피부의 주요 구조적 구성요소인 콜라겐의 손상은 피부 노화의 주된 요인으로 여겨지고 있으며 자연적인 노화 및 광노화 피부 모두에서 확인되었다. 콜라겐 손상은 부분적으로 메트릭스 메탈로프로테이나제(matrix metalloproteinase; MMP)의 유도와 관련된다. MMP는 매트릭스-분해 효소와 구조적으로 연관된 패밀리로서, 염증, 종양 침습 및 피부 노화와 같은 다양한 분해 과정에 중요한 역할을 수행한다. MMP의 수준은 자외선 광, 산화적 스트레스 및 사이토카인 등과 같은 다양한 자극에 의해 증가하고, 자외선 조사는 활성 단백질(activator protein-1; AP-1)의 DNA 결합을 촉진시키고, 콜라게나제(MMP-1), 스트로멜리신(MMP-3), 및 젤라티나제(MMP-9)와 같은 MMP를 유도한다. 콜라겐이 MMP-1에 의해 일단 분해되면 MMP-3 및 MMP-9에 의해 추가로 분해된다.
최근에, 칼슘이 MMP의 발현 및 활성을 조절할 수 있다고 제시되고 있다. 칼슘은 MMP-12의 활성화 조절에 관여하고, 증가된 세포외 칼슘 수준은 인간 각질세포에서 MMP-9 유전자 발현을 유도하며, Ca2+ 유입의 억제는 MMP-1 mRNA의 수준을 감소시킨다. 세포내 Ca2+ 수준의 조절은 각질세포로부터 MMP-1의 분비를 변화시킬 수 있다.
한편, TRPV1(transient receptor potential vanilloid type 1)은 칼슘 투과성의 비-선택적 양이온 채널 패밀리 중 하나로서, TRPV1의 활성은 Ca2+ 유입을 유도하고 캡사제핀(capsazepine)과 같은 특정 길항제에 의해 억제된다. 또한, TRPV1은 캡사이신(capsaicin), 열, 낮은 pH, 브래디키닌(bradykinin), PGE2, 또는 ATP 등에 의해 직접적으로 활성화된다. 이러한 활성 조건은 TRPV1이 열-화학적 자극 및 조직 손상에 대한 일차적인 생물학적 센서임을 의미한다. TRPV1은 뇌, 신장, 기관지 상피세포 및 표피 각질세포와 같은 다양한 조직에 존재하는 것으로 보고되고 있다. 또한, 캡사이신 자극은 각질세포의 세포질 내 Ca2+ 농도를 증가시키고 이는 캡사제핀에 의해 억제된다.
표피세포의 열에 의해 유도된 MMP-1 발현에서 TRPV1의 역할이 보고된 바 있고, UV 광은 MMP 발현 및 피부 노화를 유도하는 더욱 결정적인 인자이다. 본 발명자의 이전 연구에 따르면, TRPV1을 통한 Ca2+ 유입은 UV에 의해 유도된 MMP-1 발현에 결정적인 요인이 되고, Ca2+ 의존적 단백질 키나제 C(protein kinase C, PKC)가 신호 전달에 관련되어 있어, 표피 TRPV1은 자외선과 같은 유해한 자극에 대한 센서로서 기능할 것임을 제시하고 있다. 따라서, TRPV1은 자외선 노출 등에 의해 야기되는 피부 광노화의 방지를 위한 표적이 될 수 있으므로, 피부 노화를 방지하고 예방하기 위하여 신규한 TRPV1 활성 억제 물질을 발굴할 필요성이 대두되고 있다.
본 발명의 목적은 TRPV1 억제 펩티드 및 이를 함유하는 피부노화 방지, 피부주름 개선, 피부미백, 염증, 가려움증, 또는 통증 개선용 조성물을 제공하기 위한 것이다.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 1 내지 서열번호 8로 기재되는 펩티드를 제공한다.
본 발명의 바람직한 구현예에 있어서, 상기 펩티드는 신규한 TRPV1 활성 억제 펩티드로서 규명된 것이다.
상기 TRPV1은 TRP 패밀리에 속해 있는 비특이적 양이온 채널로서 고추의 매운 성분인 캡사이신에 의해 활성화되어 양이온이 유입되고 막 전압을 형성하여 자극이 신경계에 전달되는 막단백질이다. 상기 TRPV1은 여러 경로를 통해 활성이 조절되는데, PKA, PKC, Ca2+/calmodulin-dependent protein kinase(CaMK) 및 Src 인산화 효소를 포함하는 인산화 및 탈인산화에 의해 활성이 조절되는 것으로 알려져 있다. 또한, 인산화 외에 전사 후 조절 기작에 의해 조절될 수 있다. 이러한 TRPV1의 조절 과정에는 단백질-단백질 상호작용을 포함하지만, 아직까지 TRPV1과 상호작용하는 단백질은 매우 적은 수만이 알려져 있다.
본 발명의 바람직한 구현예에 있어서, TRPV1을 표적으로 하는 질환에 적용가능한 TRPV1 활성 억제제를 찾고자 연구한 결과, 서열번호 1 내지 8로 기재되는 신규한 펩티드들을 규명하였다. 상기 펩티드는 TRPV1 단백질의 인산화 아미노산 기반의 펩티드 서열, 또는 TRPV1 활성에 의해 세포내 Ca2+ 유입에 영향을 미치는 CaMK 활성부위를 억제할 수 있는 펩티드로서, TRPV1 활성을 효과적으로 억제함을 확인하였으므로 상기 신규한 펩티드들은 TRPV1 활성 억제제로서 유용하게 사용할 수 있다.
또한, 본 발명은 상기 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 함유하는 피부노화 방지 또는 주름 개선용 화장료 조성물을 제공한다.
상기 피부노화 방지는 광노화 또는 자연노화에 의한 피부노화 억제 작용을 의미하나, 상기 피부노화는 특히 UV 노출에 의한 광노화인 것이 바람직하다.
본 발명의 바람직한 구현예에 있어서, 상기 피부주름은 광노화 또는 자연노화에 의한 것일 수 있고, 광노화에 의한 것이 보다 바람직하며, UV 노출에 의한 광노화인 것이 더욱 바람직하나 이에 한정되지 않는다. 상기 피부노화 및 주름은 TRPV1 활성을 기반으로 하는 것이 바람직하나 이에 한정되지 않는다.
상기 펩티드는 화장료 조성물 내 0.001 내지 20 mM의 농도로 함유되는 것이 바람직하고, 0.01 내지 10 mM의 농도로 함유되는 것이 더욱 바람직하나 이에 한정되지 않는다. 상기 펩티드의 농도가 0.001 mM 미만이면 TRPV1 억제 및 이를 통한 항노화 및 피부주름 개선 효과를 얻을 수 없고, 20 mM을 초과하면 함유량 증가에 따른 뚜렷한 효과의 증가가 나타나지 않아서 생산 경제성이 떨어지는 문제점이 있다.
본 발명의 펩티드는 일반적인 화학합성, 예를 들어 고체상 펩티드 합성기술(solid-phase peptide synthesis)에 의해 제조될 수 있고, 상기 펩티드를 코딩하는 핵산을 함유하는 재조합 벡터로 형질전환된 미생물을 배양하여 상기 펩티드를 발현시킨 다음, 통상의 방법으로 정제하여 제조할 수도 있으나, 이에 한정되지 않는다.
본 발명에 따른 화장료 조성물은 상기 펩티드 외에 본 발명이 목적으로 하는 효과를 손상시키지 않는 범위 내에서, 바람직하게는 상기 펩티드의 효과에 상승 효과를 줄 수 있는 다른 성분 등을 추가로 함유할 수 있다. 예를 들어 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제, 또는 담체를 포함할 수 있다.
본 발명의 화장료 조성물은 그 제형에 있어서 특별히 한정되지 않고, 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들면, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있다. 보다 상세하게는, 화장수, 에센스, 로션, 크림, 팩, 젤, 연고, 패취 또는 분무제의 제형으로 제조될 수 있다.
상기 화장료 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있고, 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있으며, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸에테르와 같은 추진체를 포함할 수 있다.
본 발명의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용될 수 있고, 예를 들어 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸아세테이트, 벤질알코올, 벤질벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌글리콜 또는 소르비탄의 지방산 에스테르가 있다.
본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌글리콜과 같은 액상의 희석제, 에톡실화이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있으며, 계면-활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
일반적으로, UV 노출 후 TRPV1의 발현 및 활성이 증가하여 세포내 Ca2+ 유입을 유도한다는 것이 알려져 있고, CaMK가 Ca2+ 유입에 영향을 미치며, 이러한 UV 노출 이후 ECM 형성 관련 기질단백질인 MMP-1의 증가와 여러 사이토카인의 증가로 인하여 피부노화가 일어난다.
상기 TRPV1은 피부 증식 및 분화의 조절에 관여하고, 배양된 인간 각질세포에서 TRPV1이 매개된 칼슘 유입은 세포 증식을 억제하고 세포 사멸을 유도하는 것으로 보고된 바 있다. 더욱이, 캡사이신 또는 열에 의한 TRPV1의 활성화는 인간의 피부에서 상피의 투과 장벽의 형성을 변화시키는 것으로 알려졌다.
본 발명의 바람직한 구현예에 있어서, 본 발명자들은 상기와 같은 TRPV1의 활성을 억제하는 새로운 억제제를 발굴하기 위해 연구한 결과, 신규한 TRPV1 억제 펩티드 (펩티드 1: QRRPSLKSL, 펩티드 2: QRAITILDT, 펩티드 3: RRPSL, 펩티드 4: RAITI, 펩티드 5: MHRQETVDC, 펩티드 6: LKKFNARRKL, 펩티드 7: RQETV 및 펩티드 8: KFNAR)를 확립하였고, 상기 펩티드에 의한 피부노화 억제 및 주름 개선 효과를 확인하고자 하였다.
본 발명의 구체적인 구현예에 따르면, 인간 각질세포주인 HaCaT 세포에 상기 펩티드를 처리한 결과, UV 노출에 의해 유도되는 MMP-1의 발현이 감소하는 것으로 나타났고(도 1a 및 도 1b 참조), IL-1β, IL-6, IL-8 및 TNF-α와 같은 전염증성(pro-inflammatory) 사이토카인의 발현이 억제되는 것으로 나타남으로써(도 2a 내지 도 2h 참조), 본 발명의 펩티드는 UV 조사에 의해 증가된 세포내 현상을 억제하는 것을 알 수 있었다. 또한, TRPV1의 활성화 유도제인 캡사이신만 처리한 컨트롤과 달리 캡사이신 처리 후 펩티드를 처리한 결과, 캡사이신에 의한 세포내 Ca2+의 유입을 억제하는 것으로 나타났다(도 3 참조).
또한, 본 발명의 TRPV1 억제 펩티드의 생체 내 효과를 확인하기 위하여, 무모 마우스의 피부에 UV를 조사하고 펩티드를 처리하였다(도 4 참조). 그 결과, 상기 펩티드는 UV 노출에 의해 증가된 피부 두께를 농도 의존적으로 감소시켰고(도 5 및 도 9 참조), MMP-13 및 MMP-9의 발현을 감소시켰으며(도 6 및 도 7 참조), 콜라겐의 전구물질인 프로콜라겐의 발현은 증가시키는 것으로 나타났다(도 8 참조). 또한, UV 노출에 의해 유도된 세포사멸을 억제하는 효과를 확인하였다(도 10 참조). 따라서, 본 발명의 신규한 펩티드는 피부노화에 관여하는 TRPV1의 활성을 억제함으로써 UV 노출 후 유도되는 피부노화 현상을 억제하고, MMP의 발현 및 활성을 억제시키고 프로콜라겐의 발현을 향상시키는 효과가 있어 피부 주름 및 탄력 개선에 기여할 수 있으므로, 상기 펩티드는 피부 노화 방지 및 주름 개선을 위한 화장료 조성물의 유효성분으로서 유용하게 사용할 수 있다.
또한, 본 발명은 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 함유하는 피부노화 방지 또는 주름 개선용 약학적 조성물을 제공한다.
본 발명의 바람직한 구현예에 따르면, 상기 피부노화는 광노화 또는 자연노화일 수 있고, 광노화인 것이 더욱 바람직하며, 상기 광노화는 UV 노출로 인한 것이 가장 바람직하나 이에 한정되지 않는다.
상기 약학적 조성물에 함유되는 상기 펩티드의 농도는 0.001 내지 20 mM인 것이 바람직하고, 0.01 내지 10 mM인 것이 더욱 바람직하나 이에 한정되지 않는다. 상기 펩티드의 농도가 0.001 mM 미만이면 피부노화 방지 또는 주름 개선 효과를 얻을 수 없고, 20 mM을 초과하면 필요 이상의 펩티드를 사용하는 문제점이 있다.
본 발명의 TRPV1 억제 펩티드를 투여하면 인간 각질세포 및 생체 내에서 UV 노출에 의해 유도되는 MMP 및 전염증성 사이토카인의 발현을 억제하고, 피부 두께 및 세포사멸을 감소시키며, UV 노출로 감소된 프로콜라겐의 발현을 증가시키므로, 피부노화 방지 또는 주름 개선용 약학적 조성물의 유효성분으로서 유용하게 사용할 수 있다.
또한, 본 발명은 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 함유하는 피부미백용 약학적 조성물을 제공한다.
상기 약학적 조성물에 함유되는 상기 펩티드의 농도는 0.001 내지 20 mM인 것이 바람직하고, 0.01 내지 10 mM인 것이 더욱 바람직하나 이에 한정되지 않는다. 상기 펩티드의 농도가 0.001 mM 미만이면 피부미백 효과를 충분히 얻을 수 없고, 20 mM을 초과하면 농도 대비 피부미백 효과가 상승하지 않는 경향이 있어 경제적이지 못한 문제점이 있다.
본 발명의 바람직한 구현예에 있어서, 본 발명의 TRPV1 억제 펩티드는 인간 각질세포 및 생체 내에서 UV 노출에 의해 유도되는 MMP의 발현을 억제하고, 피부 두께 및 세포사멸을 감소시키며, 프로콜라겐의 발현을 증가시킨다. TRPV1 억제 펩티드는 이러한 각질세포의 증식 및 재생 작용을 통해 UV 노출에 의한 피부 검어짐 및 피부미백 활성에 효과를 나타내므로, 피부미백용 약학적 조성물의 유효성분으로서 유용하게 사용할 수 있다.
또한, 본 발명은 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 함유하는 염증, 가려움증, 또는 통증 개선용 약학적 조성물을 제공한다.
상기 약학적 조성물에 함유되는 상기 펩티드의 농도는 0.001 내지 20 mM인 것이 바람직하고, 0.01 내지 10 mM인 것이 더욱 바람직하나 이에 한정되지 않는다.
상기 염증, 가려움증 및 통증은 UV 노출에 의한 자극에 의해 발생한 것일 수 있으나 이에 한정되지 않는다.
본 발명의 바람직한 구현예에 있어서, 본 발명의 TRPV1 억제 펩티드의 항염증 활성을 확인하기 위하여, 인간 각질세포 및 생체 내에서 UV 노출에 의해 유도되는 전염증성 사이토카인에 대한 TRPV1 억제 펩티드의 억제 효과를 알아본 결과, 전염증성 사이토카인인 IL-1β, IL-6, IL-8 및 TNF-α의 발현량이 현저히 감소하는 것으로 나타났다(도 2a 내지 도 2h 참조). 또한, 상기 TRPV1은 다양한 질환 및 손상 상태에서 염증 유발을 한다는 것이 보고된 바 있다. 구체적으로, TRVP1은 인간 상피 및 모낭 유래의 각질세포에서 캡사이신에 의해 활성이 유도되어 전염증성 사이토카인의 분비를 촉진하는 것이 확인됨으로써 TRPV1과 염증과의 관련성이 알려진바 있다. 또한, TRPV1 녹아웃 마우스에서는 열에 대한 역치가 증가하였고 관절염에서 감소된 조직 종창이 확인되었다(Pharmacology and Therapeutics 2010;125:181.95, Science 2000;288:306.13, Arthritis and Rheumatism 2005;52:3248.56 참조).
뿐만 아니라, 이전 연구들에서 TRPV1이 통증 전달 경로에서 중요한 역할을 하는 것을 확인하였다. 즉, TRPV1이 통증매개체에 의해 활성화되면 양이온 채널인 TRPV1을 통해 양이온이 유입되어 이에 따른 활동전위에 의해 중추신경계로 통증이 전달된다. 따라서, TRPV1은 이미 진통 및 소염제 개발에 중요한 표적분자로서 연구되고 있다(Journal of the Korea Academia-Industrial cooperation Society, 2011년, pp.3096-3102 참조).
또한, TRPV1은 피부 가려움증의 발생에 연관되어 있고, 이는 TRPV1을 발현하는 감각 구심성 뉴런의 가려움-특이 소군집(subpopulation)을 통해 발생하는 것으로 나타났다(J. Clin. Invest. 116, 11741186, 2006, Biochim. Biophys. Acta 1772, 10041021, 2007). TRPV1은 뉴런세포가 아닌 인간의 피부에서도 발현되는데, 특히 결절 가려움 발진을 앓고 있는 환자의 상피 각질세포에서 그 발현이 증가하는 것으로 보고되었다.
따라서, 본 발명의 TRPV1 억제 펩티드는 TRPV1 활성을 억제함으로써 TRPV1의 활성 증가에 의해 기반한 염증, 가려움증 또는 통증을 개선할 수 있으므로, 염증, 가려움증 또는 통증 약학적 조성물의 유효성분으로서 유용하게 사용할 수 있다.
본 발명에 따른 약학적 조성물의 투여 경로는 구강, 정맥내, 근육내, 동맥내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함되고, 경구 또는 비경구 투여가 바람직하나 이에 한정되지 않는다. 상기 '비경구'는 피하, 피내, 정맥내, 근육내, 병소내 주사 또는 주입기술을 포함한다.
본 발명의 조성물은 본 발명의 TRPV1 억제 펩티드에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수 있다. 상기 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.
경구투여를 위한 고형제제에는 산제, 과립제, 정제, 캡슐제, 연질캅셀제, 환 등이 포함된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제로는 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 멸균된 수용액, 액제, 비수성용제, 현탁제, 에멀젼, 시럽, 좌제, 에어로졸 등의 외용제 및 멸균 주사제제의 형태로 제형화하여 사용될 수 있으며, 바람직하게는 크림, 젤, 패취, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제의 피부 외용 약학적 조성물을 제조하여 사용할 수 있으나, 이에 한정하는 것은 아니다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
상기 조성물은 방부제, 안정화제, 수화제 또는 유화 촉진제, 삼투압 조절을 위한 염 및/또는 완충제 등의 보조제, 및 기타 치료적으로 유용한 물질을 추가로 함유할 수 있으며, 통상적인 방법인 혼합, 과립화 또는 코팅 방법에 따라 제형화할 수 있다.
본 발명의 약학적 조성물은 개체의 연령, 체중, 일반적인 건강, 성별, 투여시간, 투여 경로, 배출률, 약물 배합 및 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있다.
본 발명의 상기 펩티드를 유효성분으로 함유하는 약학적 조성물을 단위 용량 형태로 제형화하는 경우, 유효성분으로서 본 발명의 펩티드를 약 0.01 내지 1,500 ㎎의 단위용량으로 함유되는 것이 바람직하고, 성인 치료에 필요한 투여량은 투여의 빈도와 강도에 따라 하루에 약 1 내지 500 ㎎ 범위가 보통이나 이에 한정되지 않는다. 성인에게 근육 내 또는 정맥 내 투여 시 일 회 투여량으로는 하루에 보통 약 5 내지 300 ㎎의 전체 투여량이면 충분할 것이나, 일부 환자의 경우 더 높은 일일 투여량이 바람직할 수 있다.
본 발명의 조성물은 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
또한, 본 발명은 약학적으로 유효한 양의 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 개체에 처리 또는 투여하는 단계를 포함하는 피부노화 방지 또는 주름 개선 방법을 제공한다.
또한, 본 발명은 약학적으로 유효한 양의 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 개체에 처리 또는 투여하는 단계를 포함하는 피부미백 방법을 제공한다.
또한, 본 발명은 약학적으로 유효한 양의 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 개체에 처리 또는 투여하는 단계를 포함하는 염증, 가려움증, 또는 통증 개선 방법을 제공한다.
상기 약학적으로 유효한 양이란 0.0001 내지 100 ㎎/㎏이고, 바람직하게는 0.001 내지 10 ㎎/㎏이며, 이에 제한되는 것은 아니다. 처리 또는 투여량은 특정 환자의 체중, 연령, 성별, 건강상태, 식이, 투여기간, 투여방법, 제거율, 질환의 중증도 등에 따라 조절될 수 있다. 처리 또는 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 실시할 수도 있다.
상기 개체는 척추동물이고 바람직하게는 포유동물이며, 보다 바람직하게는 쥐, 토끼, 기니아피크, 햄스터, 개, 고양이와 같은 실험동물이고, 가장 바람직하게는 침팬지, 고릴라와 같은 유인원류 동물이다.
상기 처리 또는 투여 방법은 도포, 경구 또는 비경구 투여할 수 있으며, 비경구 투여시 복강내주사, 직장내주사, 피하주사, 정맥주사, 근육내 주사, 자궁내 경막 주사, 뇌혈관내 주사 또는 흉부내 주사에 의해 투여될 수 있다.
상기 염증은 피부염, 알레르기, 아토피, 천식, 결막염, 치주염, 비염, 중이염, 인후염, 편도염, 폐렴, 위궤양, 위염, 크론병, 대장염, 치질, 통풍, 강직성 척추염, 류마티스 열, 루푸스, 섬유근통 (fibromyalgia), 건선관절염, 골관절염, 류마티스 관절염, 견관절주위염, 건염, 건초염, 건주위염, 근육염, 간염, 방광염, 신장염, 쇼그렌 증후군(sjogren's syndrome), 다발성 경화증, 및 급성 및 만성 염증 질환으로 구성된 군으로부터 선택되는 어느 하나일 수 있으나 이에 한정되는 것은 아니다.
따라서, 본 발명의 TRPV1 억제 펩티드는 TRPV1의 활성을 효과적으로 억제하므로, TRPV1의 활성화에 기반한 질환인, 피부노화, 주름, 미백 및, 염증, 가려움증 및 통증의 완화 및 개선을 위해 유용하게 사용할 수 있다.
또한, 본 발명은
1) TRPV1 단백질에 피검물질을 처리하는 단계; 및
2) 실험군으로서 상기 피검물질이 처리된 TRPV1 단백질과 대조군으로서 상기 피검물질이 처리되지 않은 TRPV1 단백질의 활성을 측정하여 대조군에 비해 단백질의 활성을 감소시키는 피검물질을 선별하는 단계를 포함하는, 피부노화 방지 또는 주름 개선용 후보물질의 스크리닝 방법을 제공한다.
아울러, 본 발명은 본 발명의 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 이용한 스크리닝 방법을 제공한다.
구체적으로,
1) TRPV1을 암호화하는 폴리뉴클레오티드를 포함하는 플라스미드가 숙주세포에 형질도입된 형질전환체를 제조하는 단계;
2) 상기 형질전환체에 실험군으로 TRPV1 특이적 활성제와 TRPV1 활성 억제제 후보물질을 처리하고, 대조군으로 상기 TRPV1 특이적 활성제와 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나를 처리하는 단계;
3) 단계 2)의 실험군과 대조군의 TRPV1 이온 채널 활성을 각각 측정하는 단계; 및,
4) 단계 3)의 각각의 측정치를 비교하여 대조군보다 낮거나 유사한 TRPV1 이온 채널 활성을 나타내는 TRPV1 활성 억제제 후보물질을 선별하는 단계를 포함하는 TRPV1 활성 억제제 스크리닝 방법을 제공한다.
또 다른 스크리닝 방법으로,
1) TRPV1을 암호화하는 폴리뉴클레오티드를 포함하는 플라스미드가 숙주세포에 형질도입된 형질전환체를 제조하는 단계;
2) 상기 형질전환체에 실험군으로 TRPV1 특이적 활성제와 피검물질을 처리하고, 대조군으로 상기 TRPV1 특이적 활성제와 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나를 처리하는 단계;
3) 단계 2)의 실험군과 대조군의 TRPV1 이온 채널 활성을 각각 측정하는 단계; 및,
4) 단계 3)의 각각의 측정치를 비교하여 대조군보다 낮거나 유사한 TRPV1 이온 채널 활성을 나타내는 피검물질을 선별하는 단계를 포함하는 피부노화 방지 또는 주름 개선용 후보물질의 스크리닝 방법을 제공한다.
본 발명의 바람직한 구현예에 있어서, 단계 1)의 숙주세포는 인간 각질세포주일 수 있고, HaCaT 세포주인 것이 보다 바람직하나 이에 한정하지 않으며, 이온 채널 활성 연구 및 고효율 억제제 검색에 이용할 수 있는 세포주라면 모두 이용가능하다.
상기 방법에 있어서, 단계 2)의 TRPV1 특이적 활성제는 UV 또는 캡사이신인 것이 바람직하고, 본 발명의 서열번호 1 내지 서열번호 8로 기재되는 TRPV1 억제 펩티드는 0.001 내지 20 mM의 농도로 처리하는 것이 바람직하며, 0.01 내지 10 mM로 처리하는 것이 더욱 바람직하나 이에 한정되지 않는다.
상기 단계 2)의 후보물질은 천연화합물, 합성화합물, RNA, DNA, 폴리펩티드, 효소, 단백질, 리간드, 항체, 항원, 박테리아 또는 진균의 대사산물 또는 생활성 분자일 수 있다.
상기 단계 3)의 TRPV1 이온 채널 활성의 측정은 칼슘 이미지화에 의해 수행될 수 있으나 이에 한정되지 않으며, TRPV1의 활성을 확인할 수 있는 실험법이면 모두 사용가능하다.
본 발명의 서열번호 1 내지 서열번호 8로 기재되는 펩티드는 TRPV1 활성제로 알려진 UV 또는 캡사이신에 의해 증가된 TRPV1 활성을 억제하고, 동물모델에서 TRPV1 활성 기반의 피부노화 및 피부주름 개선 효과를 가지므로, TRPV1 활성에 대한 서열번호 1 내지 서열번호 8로 기재되는 펩티드의 억제 효과와 비교하여 이와 유사하거나 더욱 높은 억제 효과를 갖는 TRPV1 활성 억제제 및 피검물질을 선별함으로써, TRPV1에 의해 매개되는 피부노화 또는 주름 방지제의 후보물질을 스크리닝할 수 있다.
본 발명은 피부노화 방지 및 주름 개선 효과가 있는 신규한 펩티드를 개발한 것으로, 상기 펩티드는 인간 각질세포 및 생체 내에서 UV 노출에 의해 유도되는 MMP 및 전염증성 사이토카인의 발현을 억제하고 피부 두께 및 세포사멸을 감소시키며, UV 노출로 감소된 프로콜라겐의 발현을 증가시키므로, 피부노화에 따른 피부 주름 및 탄력을 개선하고 항노화 효능이 있는 조성물의 효능물질로서 효과적이다.
도 1a 및 도 1b는 각각의 TRPV1 억제 펩티드에 의한 UV에 의해 유도된 MMP-1의 발현량 변화를 나타내는 도면이다.
도 2a 내지 도 2h는 각각의 TRPV1 억제 펩티드에 의한 UV에 의해 유도된 전염증성 사이토카인 발현량의 변화를 나타내는 도면이다.
도 3은 TRPV1 억제 펩티드에 의한 캡사이신에 의해 유도된 Ca2+ 유입 변화를 나타내는 도면이다.
도 4는 무모 마우스 피부에 대한 TRPV1 억제 펩티드의 처리 방법을 나타내는 도면이다.
도 5는 TRPV1 억제 펩티드에 의한 무모 마우스 피부의 UV에 의해 증가된 피부 두께 변화를 나타내는 도면이다.
도 6은 TRPV1 억제 펩티드에 의한 무모 마우스 피부의 UV에 의해 유도된 MMP-13의 발현량 변화를 나타내는 도면이다.
도 7은 TRPV1 억제 펩티드에 의한 무모 마우스 피부의 UV에 의해 유도된 MMP-13 및 MMP-9 유전자의 발현량 변화를 나타내는 도면이다.
도 8은 TRPV1 억제 펩티드에 의한 무모 마우스 피부의 UV에 의해 감소된 프로콜라겐 유전자의 발현량 변화를 나타내는 도면이다.
도 9는 TRPV1 억제 펩티드에 의한 무모 마우스 피부의 UV에 의해 증가된 세포 두께의 변화를 나타내는 도면이다.
도 10은 TRPV1 억제 펩티드에 의한 무모 마우스 피부의 UV에 의해 증가된 세포사멸의 변화를 나타내는 도면이다.
이하, 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
<실시예 1> 신규한 TRPV1 억제 펩티드의 준비
신규한 TRPV1 억제 펩티드의 서열을 합성하였고[peptron(www.peptron.com)], 각 펩티드의 분자량에 따라 농도를 계산하여 1M 농도로 맞추어 운반체(에탄올 : 폴리에틸렌글리콜(PEG) = 3:7)에 녹였다.
그 결과, 신규한 펩티드 1: QRRPSLKSL (서열번호 1), 펩티드 2: QRAITILDT (서열번호 2), 펩티드 3: RRPSL (서열번호 3), 펩티드 4: RAITI (서열번호 4), 펩티드 5: MHRQETVDC (서열번호 5), 펩티드 6: LKKFNARRKL (서열번호 6), 펩티드 7: RQETV (서열번호 7) 및 펩티드 8: KFNAR (서열번호 8)을 수득하였다.
<실시예 2> 인간 각질세포의 배양 및 펩티드 처리
<2-1> 인간 각질세포주의 배양
불멸화된 인간 각질세포주인 HaCaT를 글루타민 2 mM, 페니실린 400 U/㎖, 스트렙토마이신 50 ㎎/㎖ 및 10% FBS가 첨가된 DMEM(Dulbecco's modified Eagle's media) 배지에 5% CO2가 포함된 37℃의 습한 대기에서 배양하였다. 펩티드의 처리를 위하여, 상기 세포는 80% 컨플루언스로 배양하였고 그런 다음 FBS 첨가 없이 24시간 동안 배양하였다. 배양 후 세포를 인산염완충식염수(PBS)로 세척한 후 상기 <실시예 1>에서 준비한 각 펩티드를 배지에 첨가하였다.
<2-2> UV 조사
웨스턴 블랏, qRT-PCR 실험에 있어서, 상기 실시예 <2-1>에서와 같이, 각각의 펩티드를 HaCaT 세포에 처리한 후 30분 뒤에 상기 HaCaT 세포는 275 및 380 ㎚ 범위의 방출 스펙트럼 (피크, 310 ~ 315 ㎚)으로 Philips TL 20W/12 RS 형광 태양광을 사용하여 조사되었다. UVC를 막기 위해 290 ㎚ 이하의 파장을 갖는 AKodacel filter(TA401/407; Kodak)를 사용하였고, UV 세기는 Waldmann UV meter를 사용하여 측정하였다. UV 조사 후, 세포의 배양 배지는 FBS가 첨가되지 않은 신선한 배지로 교체하였고, 추가로 더 배양된 후 상기 <실시예 1>에서 준비한 각 펩티드를 배지에 첨가하였다.
<실시예 3> TRPV1 억제 펩티드의 UV에 의해 유도된 MMP-1 및 전염증성 사이토카인 발현 억제 활성 확인
<3-1> 웨스턴 블랏을 통한 MMP-1 단백질 발현량 확인
상기 UV가 조사된 세포의 배양 배지 내로 분비된 MMP-1 단백질의 양을 측정하기 위하여, 동일한 개수의 세포로부터 수득한 동일한 양의 배양 배지를 10% SDS-PAGE에 의해 분리하였고, Hybond ECL membrane (Amersham Biosciences, Buckinghamshire, England)으로 옮긴 후, MMP-1에 대한 토끼 모노클로날 항체(Lab Frontier)를 사용하여 증진된 화학발광계(Amersham Biosciences)에 의해 웨스턴 블랏팅 분석을 수행하였다. 신호 세기는 농도계 프로그램(TINA; Raytest Isotopenme b gerate, Straubenhardt, Germany)을 사용하여 정량하였다.
그 결과, UV 조사군은 UV 무조사군에 비해 MMP-1 단백질의 발현량이 증가하는 것으로 나타났고, UV 조사 및 펩티드 처리군에서는 펩티드의 처리 농도가 높아질수록 UV에 의해 증가된 MMP-1 단백질의 발현량이 현저히 감소하는 것으로 나타났다(도 1a 및 도 1b).
<3-2> qRT-PCR을 통한 MMP-1 유전자의 발현량 확인
MMP-1에 대한 mRNA 발현량을 확인하기 위하여, HaCaT 세포로부터 제조사의 지시에 따라 Trizol(Life Technologies, Rockville, MD) 시약을 사용하여 총 RNA를 분리하였다. 분리된 RNA는 정량 및 정성 분석을 위하여 1% 아가로즈 젤에 전기영동하였다. 1 ㎍의 총 RNA를 사용하여 20 ㎕의 반응 부피로 만든 후 RT-PCR을 위한 first-strand cDNA synthesis kit(MBI Fermentas, Vilnius, Lithuania)를 사용하여 제조사의 지시에 따라 제1가닥 cDNA를 합성하였다. 그런 다음, MMP-1에 대한 대한 mRNA 발현의 정량을 위하여, 1 ㎕의 제1가닥 cDNA 산물 및 SYBR_Premix Ex TaqTM (Takara Bio Inc., Shiga, Japan)을 사용하여 7500 Real-time PCR System (Applied Biosystems, Foster City, CA)상에서 PCR을 수행하였다. 이 실험법은 하류 공정 없이 바로 RT-PCR 산물을 검출할 수 있고, 내생적 대조군으로서 사용된 36B4 유전자에 특이적인 프로브와 함께, 각 인자에 대해 특이적인 염료 표지된 DNA 프로브의 형광에 증가를 모니터링함으로써 수행 가능하였다. 이때, 하기 표 1의 프라이머를 사용하였고, 50℃에서 2분, 95℃에서 2분, 이어서 40 사이클의 95℃에서 15초 및 60℃에서 1분의 조건하에서 PCR을 실시하였다. 데이터는 2-DDCT법을 사용하여 분석하여, 36B4 유전자의 발현량으로 표준화하여 유전자 발현 배수로서 나타냈고, 상기 36B4 유전자의 세기로 표준화한 후, UV 조사군 또는 대조군에 비하여 증가 또는 감소한 비율을 산출하였다. 각 실험은 3회 실시하였고, 각각 적어도 3회 반복하였다.
표 1
유전자 프라이머 서열(5'-3') 서열번호
36B4 정방향 프라이머 TGGGCTCCAAGCAGATGC 9
역방향 프라이머 GGCTTCGCTGGCTCCCAC 10
MMP-1 정방향 프라이머 ATTCTACTGATATCGGGGCTTTGA 11
역방향 프라이머 ATGTCCTTGGGGTATCCGTGTAG 12
그 결과, 상기 실시예 <3-1>의 결과와 같이, UV 조사군은 UV 무조사군에 비해 MMP-1 유전자의 발현량이 현저히 증가하는 것으로 나타났고, 각각의 UV 조사 및 펩티드 처리군에서는 펩티드의 처리 농도에 의존적으로 MMP-1 유전자의 발현량이 감소하는 것으로 나타났다(도 1a 및 1b). 따라서, 본 발명의 TRPV1 억제 펩타이드는 UV 자극에 의한 MMP-1의 발현을 감소시키는 작용을 하는 것을 알 수 있었다.
<3-3> 전염증성 사이토카인의 발현량 확인
UV가 조사된 세포에 대한 TRPV1 억제 단백질의 사이토카인 발현량 변화를 확인하기 위하여, 상기 실시예 <3-1>의 방법에 따라, 각각의 TRPV1 펩티드를 처리한 HaCaT 세포에서 IL-1β, IL-6, IL-8 및 TNF-α 단백질 발현양을 측정하였다.
그 결과, TRPV1 억제 단백질은 UV 노출에 의해 증가된 상기 사이토카인의 발현량을 감소시키는 것으로 나타났다(도 2a 내지 도 2h).
<실시예 4> TRPV1 억제 펩티드의 캡사이신에 의해 유도된 Ca 2+ 유입 억제 활성 확인
HaCaT 세포를 커버 글라스에 배양한 후, 4mM Fluo-4 AM (Molecular Probes)가 첨가된 무혈청 배지에 상온에서 45분간 배양하였다. 배양 후, 무혈청 배지로 3회 세척한 후, 커버 글라스 상에 있는 세포를 주문 제작한 관찰 챔버에 옮기고 20분간 방치하였다. 그런 다음, TRPV1의 활성을 유도하기 위해 캡사이신만 처리하거나, 또는 캡사이신과 함께 본 발명의 펩티드를 각각 Tyrode's buffer (140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 2 mM CaCl2, 10 mM 글루코스, 및 10 mM HEPES [pH 7.2])에 최종 농도 10 mM로 준비하여 3분간 상기 세포에 처리하였다. 형광 세기는 SCAN Ware 5.10 소프트웨어(Zeiss)로 조절되는 적절한 필터 및 PL Fluotar objective (200_, 0.5 NA)가 장착된 공초점 레이져스캐닝 현미경(confocal laserscanning microscope)(LSM 510 META, Zeiss)을 사용하여 측정하였다. 실험은 37℃의 습한 챔버 내에서 실시하였다. Ca2+ 측정을 20분간 계속하여, 1 또는 4초 마다 영상을 촬영하였다.
그 결과, TRPV1 억제 펩티드 처리군은 캡사이신만 처리한 펩티드 무처리군에 비해 Ca2+ 세기가 현저히 낮은 것으로 나타났다. 따라서, 본 발명의 TRPV1 억제 펩티드들은 각질세포 내 Ca2+의 유입을 억제하는 것을 확인하였다(도 3).
<실시예 5> 마우스에 대한 UV 조사 및 펩티드 처리
<5-1> 마우스 사육 및 UV 조사
TRPV1 억제 펩티드의 생체 내 피부 노화 억제 활성을 확인하기 위하여, 6주령 암컷 알비노 마우스(Skh-1)를 실험 전 1주일간 순화시켰고, 사료 및 물을 자유롭게 섭취시켰다. 모든 실험 프로토콜은 서울대학교의 동물운영위원회의 승인하에 실시하였다. 마우스에 UV 조사를 위하여, 275 내지 380 ㎚ (310-315 ㎚에서 피크)의 방출 스펙트럼을 갖는 F75/85W/UV21 형광 태양등을 UV 조사원으로 사용하였다. 파장＼290 ㎚를 제거하기 위하여 Kodacel filter (TA401/407; Kodak, Rochester, NY)를 UV 튜브의 앞쪽에 설치하였다. 피부 표면에서의 조사 세기는 UV 미터(모델 585100; Waldmann Co., Villingen-Schwenningen, Germany)를 사용하여 측정하였고, 광원으로부터 30 ㎝인 곳의 조사 세기를 1.0 ㎽/㎠로 하였다. 마우스의 등 피부 상에서 처음으로 측정된 최소홍반량(minimal erythema dose; MED)을 24시간 후 날카로운 경계를 갖는 홍반을 형성하는데 필요한 조사 최소량으로 결정하였다. UV를 2MED로(1MED = 100 mJ/㎠) 털이 없는 상기 Skh-1 마우스의 등에 조사하였다.
<5-2> 마우스에 대한 TRPV1 억제 펩티드의 처리
상기 Skh-1 마우스를 하기와 같은 6 그룹으로 나누었다: (1) UV 무처리 및 운반체 처리군, (2) UV 무처리 및 1 mM 펩티드 처리군, (3) UV 조사 및 운반체 처리군, (4) UV 조사 및 0.01 mM 펩티드 처리군, (5) 0.1 mM 펩티드 처리군, (6) UV 조사 및 1 mM 펩티드 처리군. 운반체는 에탄올(30%) 및 폴리에틸렌글리콜(70%)로 구성되었고, 운반체 및 펩티드를 UV조사 후 0 및 24 시간 후에 마우스의 등 피부 표면에 처리하였다. 그런 다음, 상기 마우스를 UV 조사 후 48시간 뒤에 살생하고 피부 표본을 조직 생검하였다(도 4).
<실시예 6> TRPV1 억제 펩티드의 피부 두께 감소 활성의 확인
상기 실시예 <5-2>의 UV 조사 전 24시간 및 조사 후 48시간 뒤에 캘리퍼(PEACOCK, Ozaki MFG Co. Ltd., Tokyo, Japan)를 사용하여 피하지방 두께를 측정하였다. 구체적으로, 목 부위와 꼬리의 아랫부분에서 중심선 피부를 위쪽으로 집고, 피하지방 두께를 목 및 엉덩이 사이의 중간에서 측정하였다.
그 결과, UV를 조사함으로써 피하지방 두께가 급격히 증가하였고, 1 mM의 TRPV1 억제 펩티드를 처리한 결과 피하지방 두께가 감소한 것으로 나타났다(도 5).
<실시예 7> 생체 내에서 TRPV1 억제 펩티드의 UV에 의해 유도된 MMP 발현 억제 활성 확인
<7-1> 웨스턴 블랏을 통한 MMP-13 단백질 발현량 확인
상기 실시예 <5-2>의 마우스 피부 조직을 신선한 프로테아제 억제제 칵테일(Roche, Indianapolis, IN)이 첨가된 차가운 용해 버퍼[50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM 에틸렌디아민 테트라아세트산(ethylenediamine tetraacetic acid; EDTA), 5 mM 페닐메탄설포닐 플루오라이드(phenylmethanesulfonyl fluoride; PMSF), 및 1 mM 디티오트레이톨(dithiothreitol; DTT), 1% Triton X-100]에서 균질화하였다. 그런 다음, 균질화액을 4℃에서 30분간 15,000 g로 원심분리하여 상층액을 수득한 후 이를 -70℃에 보관하였다. 용해물에 포함된 단백질 함량은 Bradford 분석을 통해 측정하였다. 동량의 단백질을 8 내지 16%의 트리스-글리신 SDS-PAGE 젤에서 분리하여 PVDF 막에 전기영동법으로 옮겼다. 이어서 블랏을 블로킹 버퍼로 실온에서 1시간 동안 블로킹한 후 모노클로날 항-MMP-13 항체(Neomarkers, Fremont, CA)와 배양하였다. 대조군으로서, β-액틴 항체(Santa Cruz Biotechnology, Santa Cruz, CA)를 사용하여 동일한 세포 용해물에서 β-액틴 수준을 측정하였다. 신호 세기는 농도계 프로그램을 사용하여 정량하였다.
그 결과, UV 조사군은 UV 무조사군에 비해 MMP-13 단백질의 발현량이 증가하는 것으로 나타났고, UV 조사 및 펩티드 처리군에서는 펩티드의 처리 농도가 높아질수록 MMP-13 단백질의 발현량이 현저히 감소하는 것으로 나타났다(도 6).
<7-2> qRT-PCR을 통한 MMP 및 프로콜라겐 유전자의 발현량 확인
상기 실시예 <3-2>에서 실시한 방법에 따라, 상기 실시예 <5-2>의 마우스 피부 조직으로부터 총 RNA를 분리하여 cDNA를 합성하였다. MMP에 대한 mRNA 발현의 정량을 위하여 SYBR_Premix Ex TaqTM (Takara Bio Inc., Shiga, Japan)을 사용하여 7500 Real-time PCR System (Applied Biosystems, Foster City, CA)상에서 PCR을 수행하였다. 이때, 하기 표 2의 프라이머를 사용하였고, 50℃에서 2분, 95℃에서 2분, 이어서 40 사이클의 95℃에서 15초 및 60℃에서 1분의 조건하에서 PCR을 실시하였다. 데이터는 2-DDCT법을 사용하여 분석하여, 37B4 유전자의 발현량으로 표준화하여 유전자 발현 배수로서 나타냈고, 상기 37B4 유전자의 세기로 표준화한 후, UV 조사군 또는 대조군에 비하여 증가 또는 감소한 비율을 산출하였다. 각 실험은 3회 실시하였고, 각각 적어도 3회 반복하였다.
표 2
유전자 프라이머 서열(5'-3') 서열번호
마우스 36B4 정방향 프라이머 TGGGCTCCAAGCAGATGC 9
역방향 프라이머 GGCTTCGCTGGCTCCCAC 10
마우스 MMP-13 정방향 프라이머 CATCCATCCCGTGACCTTAT 13
역방향 프라이머 GCATGACTCTCACAATGCGA 14
마우스 MMP-9 정방향 프라이머 TTGAGTCCGGCAGACAATCC 15
역방향 프라이머 CCTTATCCACGCGAATGACG 16
마우스 프로콜라겐 정방향 프라이머 TCGTGACCGTGACCTTGCG 17
역방향 프라이머 GAGGCACAGACGGCTGAGTAG 18
그 결과, TRPV1 억제 펩티드는 UV 조사에 의해 증가한 MMP-13 및 MMP-9 유전자의 발현을 현저히 감소시키는 것으로 나타났다(도 7). 또한, UV 조사에 의해 감소된 프로콜라겐 유전자의 발현이 TRPV1 억제 펩티드 처리에 의해 유의적으로 증가하는 것을 확인하였다(도 8).
<실시예 8> TRPV1 억제 펩티드의 UV에 의해 증가된 피부 두께 감소 활성 확인
TRPV1 억제 펩티드에 의한 피부 두께의 변화를 측정하기 위하여, 상기 실시예 <5-2>의 마우스의 피부 조직을 대상으로 헤마톡실린 및 에오신(Hematoxylin and eosin; H&E) 염색을 실시하였다. 구체적으로, 마우스 피부 조직을 10% 완충된 포르말린에 24시간 동안 고정시킨 후, 파라핀에 포매하였다. 연속적인 섹션(4 ㎛)을 실란 코팅된 슬라이드에 마운팅하고, 이전 연구에서 제시된 일반적인 방법에 따라 핵 염색을 위해 헤마톡실린 용액으로 염색하였고, 세포질 염색을 위해 에오신 용액으로 염색하였다. 그런 다음 이미지 분석 프로그램(BMI plus software, BumMi Universe Co., Kyungki, Korea)을 사용하여 상피 두께를 측정하였다.
그 결과, 마우스 피부 조직은 UV 조사에 의해 상피 두께가 증가하는 것으로 나타났으며, UV 조사 및 펩티드 처리군에 있어서, 펩티드를 처리함으로써 UV에 의해 증가된 상피 두께가 감소한 것으로 나타났다(도 9).
<실시예 9> TRPV1 억제 펩티드의 UV에 의해 유도된 세포사멸 억제 활성 확인
TRPV1 억제 펩티드의 UV로 인한 세포사멸 억제 효과를 확인하기 위하여, 마우스 피부 조직에 대하여 TUNEL 염색을 실시하였다. 구체적으로, 마우스 피부 조직을 10% 완충된 포르말린에 24시간 동안 고정시킨 후, 파라핀에 포매하였다. 연속적인 섹션(4 ㎛)을 실란 코팅된 슬라이드에 마운팅하고, ApopTagPlus Peroxidase In Situ Apoptosis Kit를 이용하여 일반적인 TUNEL 염색 방법[http://www.millipore.com/userguides.nsf/a73664f9f981af8c852569b9005b4eee/c60bd329d558cd0e852577d80069e1d0/$FILE/S7101MAN.pdf (MilliporeTM) 참조]에 따라 세포사멸을 확인하였다.
그 결과, UV 노출에 의해 피부 조직의 세포사멸이 증가하였고, 상기 펩티드는 증가한 세포사멸을 억제하는 효과가 있는 것으로 나타났다(도 10).
<제조예 1> 화장료의 제조
<1-1> 유연 화장수의 제조
본 발명의 TRPV1 억제 펩티드를 유효성분으로 함유하는 유연 화정수는 하기 표 3과 같이 제조하였다.
표 3
원료 함량(중량부)
<실시예 1>의 펩티드 1 10.00
1,3-부틸렌글리콜 1.00
디소듐이디티에이 0.05
알란토인 0.10
디포타슘글리시리제이트 0.05
시트릭애씨드 0.01
소듐시트레이트 0.02
글리세레스-26 1.00
알부틴 2.00
하이드로제네이티드캐스터오일 1.00
에탄올 30.00
보존제 미량
착색제 미량
착향제 미량
정제수 잔량
<1-2> 영양 크림의 제조
본 발명의 TRPV1 억제 펩티드를 유효성분으로 함유한 영양크림은 하기 표 4의 조성과 같이 제조하였다.
표 4
원료 함량(중량부)
<실시예 1>의 펩티드 2 10.0
1,3-부틸렌 글리콜 7.0
글리세린 1.0
D-판테놀 0.1
식물 추출물 3.2
마그네슘알루미늄실리케이트 0.3
PEG-40 스테아레이트 1.2
스테아릭애씨드 2.0
폴리소르베이트 60 1.5
친유형글리세릴스테아레이트 2.0
소르비탄세스퀴올리에이트 1.5
세테아릴알코올 3.0
미네랄오일 4.0
스쿠알란 3.8
카르릴릭/카프릭트리글리세라이드 2.8
식물성 오일 1.8
디메치콘 0.4
디포타슘글리시리제이트 미량
알란토인 미량
소듐 히아루로네이트 미량
토코페릴아세테이트 적량
트리에탄올아민 적량
보존제 적량
착향제 적량
정제수 잔량
<1-3> 로션의 제조
표 5
원료 함량(중량부)
세토스테아릴알코올 1.6
스테아린산 1.4
친유형모노스테아린산글리세린 1.8
피이지-100 스테아레이트 2.6
세스퀴올레인산소르비탈 0.6
스쿠알렌 4.8
마카다이아오일 2
호호바오일 2
초산토코페롤 0.4
메칠폴리실록산 0.2
에칠파라벤 0.1
초산토코페롤 0.4
메칠폴리실록산 0.2
에칠파라벤 0.1
프로필파라벤 0.1
1,3-부칠렌글리콜 4
메칠파라벤 0.1
산탄검 0.1
글리세린 4
d-판데놀 0.15
알란토인 0.1
<실시예 1>의 펩티드 3 3.5
카르보머(2% aq. Sol) 4
트리에탄올아민 0.15
에탄올 3
pt 41891 0.1
p-H20 48.3
<제조예 2> 약학적 제제의 제조
<2-1> 산제의 제조
본 발명의 TRPV1 억제 펩티드 2 g
유당 1 g
상기의 성분을 혼합하고 기밀포에 충진하여 산제를 제조하였다.
<2-2> 정제의 제조
본 발명의 TRPV1 억제 펩티드 100 ㎎
옥수수전분 100 ㎎
유 당 100 ㎎
스테아린산 마그네슘 2 ㎎
상기의 성분을 혼합한 후, 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조하였다.
<2-3> 캡슐제의 제조
본 발명의 TRPV1 억제 펩티드 100 ㎎
옥수수전분 100 ㎎
유 당 100 ㎎
스테아린산 마그네슘 2 ㎎
상기의 성분을 혼합한 후, 통상의 캡슐제의 제조방법에 따라서 젤라틴 캡슐에 충전하여 캡슐제를 제조하였다.
<2-4> 환의 제조
본 발명의 TRPV1 억제 펩티드 1 g
유당 1.5 g
글리세린 1 g
자일리톨 0.5 g
상기의 성분을 혼합한 후, 통상의 방법에 따라 1환 당 4 g이 되도록 제조하였다.
<2-5> 과립의 제조
본 발명의 TRPV1 억제 펩티드 150 ㎎
대두추출물 50 ㎎
포도당 200 ㎎
전분 600 ㎎
상기의 성분을 혼합한 후, 30% 에탄올 100 ㎎을 첨가하여 섭씨 60 ℃에서 건조하여 과립을 형성한 후 포에 충진하였다.
<2-6> 주사액제의 제조
본 발명의 TRPV1 억제 펩티드 10 ㎍/㎖
묽은 염산 BP pH 3.5로 될 때까지
주사용 염화나트륨 BP 최대 1 ㎖
적당한 용적의 주사용 염화나트륨 BP 중에 본 발명의 TRPV1 억제 펩티드를 용해시키고, 생성된 용액의 pH를 묽은 염산 BP를 사용하여 pH 3.5로 조절한 후, 주사용 염화나트륨 BP를 사용하여 용적을 조절하고 충분히 혼합하였다. 용액을 투명유리로 된 5 ㎖ 타입 I 앰플 중에 충전시키고, 유리를 용해시킴으로써 공기의 상부 격자하에 봉입시켰으며, 120 ℃에서 15분 이상 오토클래이브시켜 살균하여 주사액제를 제조하였다.

Claims (21)

  1. 서열번호 1 내지 서열번호 8로 기재되는, TRPV1 활성을 억제하는 펩티드.
  2. 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 함유하는 피부노화 방지 또는 주름 개선용 화장료 조성물.
  3. 청구항 2에 있어서,
    상기 피부노화는 광노화 또는 자연노화인 화장료 조성물.
  4. 청구항 3에 있어서,
    상기 광노화는 UV 노출로 인한 것인 화장료 조성물.
  5. 청구항 2에 있어서,
    상기 펩티드는 화장료 조성물에 0.001 내지 20 mM의 농도로 함유되는 화장료 조성물.
  6. 청구항 2에 있어서,
    상기 화장료 조성물은 화장수, 에센스, 로션, 크림, 팩, 젤, 연고, 패취 또는 분무제의 제형으로 구성된 군으로부터 선택되는 어느 하나의 제형을 갖는 화장료 조성물.
  7. 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 함유하는 피부노화 방지 또는 주름 개선용 약학적 조성물.
  8. 청구항 7에 있어서,
    상기 피부노화는 광노화 또는 자연노화인 약학적 조성물.
  9. 청구항 8에 있어서,
    상기 광노화는 UV 노출로 인한 것인 약학적 조성물.
  10. 청구항 7에 있어서,
    상기 펩티드는 약학적 조성물에 0.001 내지 20 mM의 농도로 함유되는 약학적 조성물.
  11. 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 함유하는 피부미백용 약학적 조성물.
  12. 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 유효성분으로 함유하는 염증, 가려움증, 또는 통증 개선용 약학적 조성물.
  13. 청구항 11 및 청구항 12 중 어느 한 항에 있어서,
    상기 펩티드는 약학적 조성물에 0.001 내지 20 mM의 농도로 함유되는 약학적 조성물.
  14. 약학적으로 유효한 양의 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 개체에 처리 또는 투여하는 단계를 포함하는 피부노화 방지 또는 피부주름 개선 방법.
  15. 약학적으로 유효한 양의 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 개체에 처리 또는 투여하는 단계를 포함하는 피부미백 방법.
  16. 약학적으로 유효한 양의 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나 이상을 개체에 처리 또는 투여하는 단계를 포함하는 염증, 가려움증, 또는 통증 개선 방법.
  17. 1) TRPV1 단백질에 피검물질을 처리하는 단계; 및
    2) 실험군으로서 상기 피검물질이 처리된 TRPV1 단백질과 대조군으로서 상기 피검물질이 처리되지 않은 TRPV1 단백질의 활성을 측정하여 대조군에 비해 단백질의 활성을 감소시키는 피검물질을 선별하는 단계를 포함하는, 피부노화 방지 또는 주름 개선용 후보물질의 스크리닝 방법.
  18. 1) TRPV1을 암호화하는 폴리뉴클레오티드를 포함하는 플라스미드가 숙주세포에 형질도입된 형질전환체를 제조하는 단계;
    2) 상기 형질전환체에 실험군으로 TRPV1 특이적 활성제와 TRPV1 활성 억제제 후보물질을 처리하고, 대조군으로 상기 TRPV1 특이적 활성제와 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나를 처리하는 단계;
    3) 단계 2)의 상기 실험군과 대조군의 TRPV1 이온 채널 활성을 각각 측정하는 단계; 및,
    4) 단계 3)의 각각의 측정치를 비교하여 대조군보다 낮거나 유사한 TRPV1 이온 채널 활성을 나타내는 TRPV1 활성 억제제 후보물질을 선별하는 단계를 포함하는 TRPV1 활성 억제제 스크리닝 방법.
  19. 1) TRPV1을 암호화하는 폴리뉴클레오티드를 포함하는 플라스미드가 숙주세포에 형질도입된 형질전환체를 제조하는 단계;
    2) 상기 형질전환체에 실험군으로 TRPV1 특이적 활성제와 피검물질을 처리하고, 대조군으로 상기 TRPV1 특이적 활성제와 서열번호 1 내지 서열번호 8로 기재되는 펩티드로 구성된 군으로부터 선택되는 어느 하나를 처리하는 단계;
    3) 단계 2)의 실험군과 대조군의 TRPV1 이온 채널 활성을 각각 측정하는 단계; 및,
    4) 단계 3)의 각각의 측정치를 비교하여 대조군보다 낮거나 유사한 TRPV1 이온 채널 활성을 나타내는 피검물질을 선별하는 단계를 포함하는 피부노화 방지 또는 주름 개선용 후보물질의 스크리닝 방법.
  20. 청구항 18 및 청구항 19 중 어느 한 항에 있어서,
    상기 TRPV1 특이적 활성제는 UV 또는 캡사이신인 스크리닝 방법.
  21. 청구항 18 및 청구항 19 중 어느 한 항에 있어서,
    상기 TRPV1 이온 채널 활성의 측정은 칼슘 이미지화에 의해 수행되는 스크리닝 방법.
PCT/KR2012/001932 2012-03-16 2012-03-16 신규한 ｔｒｐｖ１ 억제 펩티드 및 이를 함유하는 피부노화 방지 또는 주름 개선용 조성물 WO2013137505A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
KR1020147025534A KR101784766B1 (ko) 2012-03-16 2012-03-16 신규한 ｔｒｐｖ１ 억제 펩티드 및 이를 함유하는 피부노화 방지 또는 주름 개선용 조성물
JP2015500346A JP6185549B2 (ja) 2012-03-16 2012-03-16 新規のｔｒｐｖ１抑制ペプチド及びこれを含有する皮膚老化防止またはしわ改善用組成物
PCT/KR2012/001932 WO2013137505A1 (ko) 2012-03-16 2012-03-16 신규한 ｔｒｐｖ１ 억제 펩티드 및 이를 함유하는 피부노화 방지 또는 주름 개선용 조성물
US13/855,022 US9056889B2 (en) 2012-03-16 2013-04-02 TRPV1 inhibitory peptides and composition for skin-aging protection or wrinkle improvement comprising the same
US14/725,383 US9511011B2 (en) 2012-03-16 2015-05-29 TRPV1 inhibitory peptides and composition for skin-aging protection or wrinkle improvement comprising the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2012/001932 WO2013137505A1 (ko) 2012-03-16 2012-03-16 신규한 ｔｒｐｖ１ 억제 펩티드 및 이를 함유하는 피부노화 방지 또는 주름 개선용 조성물

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/855,022 Continuation US9056889B2 (en) 2012-03-16 2013-04-02 TRPV1 inhibitory peptides and composition for skin-aging protection or wrinkle improvement comprising the same

Publications (1)

Publication Number Publication Date
WO2013137505A1 true WO2013137505A1 (ko) 2013-09-19

Family

ID=49157843

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/001932 WO2013137505A1 (ko) 2012-03-16 2012-03-16 신규한 ｔｒｐｖ１ 억제 펩티드 및 이를 함유하는 피부노화 방지 또는 주름 개선용 조성물

Country Status (4)

Country Link
US (2) US9056889B2 (ko)
JP (1) JP6185549B2 (ko)
KR (1) KR101784766B1 (ko)
WO (1) WO2013137505A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160029159A (ko) * 2014-09-04 2016-03-15 동국대학교 경주캠퍼스 산학협력단 향부자 추출 피부 노화방지용 건강 기능 조성물
JP2017515816A (ja) * 2014-05-13 2017-06-15 ケアジェン カンパニー, リミテッドCaregen Co., Ltd. 抗炎症、骨形成及び発毛促進活性を有するペプチド及びその用途

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9597274B2 (en) * 2015-06-17 2017-03-21 Avon Products, Inc. Peptides and their use in the treatment of skin
KR101875394B1 (ko) * 2015-12-07 2018-07-06 엔프라니 주식회사 도파민을 함유하는 레티노이드 화합물 및 그의 제조방법
CN106868089B (zh) * 2015-12-11 2020-02-28 上海家化联合股份有限公司 一种利用皮肤成纤维细胞钾离子通道评价抗衰老功效的方法
WO2017119756A1 (ko) * 2016-01-08 2017-07-13 주식회사 젬백스앤카엘 주름개선, 노화방지, 미백, 항염증 기능성 신규 펩티드 및 이를 포함하는 조성물
KR101817250B1 (ko) * 2016-10-31 2018-01-10 차의과학대학교 산학협력단 신규의 펩타이드 및 이를 포함하는 피부노화 또는 피부 주름형성 억제를 위한 화장료 조성물
KR101967630B1 (ko) 2017-03-03 2019-04-11 서울대학교병원 아디포넥틴 유래 펩티드 및 이를 포함하는 피부노화 방지 또는 피부주름 개선용 조성물
MX2019010533A (es) * 2017-03-06 2019-12-19 Haplnscience Inc Composicion para la medicion, prevencion o alivio del envejecimiento de la piel, usando hapln1.
BR112019027282A2 (pt) 2017-06-20 2020-07-21 L'oreal método para induzir a diferenciação em células neuronais sensoriais periféricas e método de triagem de um agente biológico in vitro
JP7423250B2 (ja) * 2019-10-24 2024-01-29 株式会社マンダム 評価方法、スクリーニング方法および評価キット
CN115279392A (zh) * 2020-01-20 2022-11-01 鲁达库尔公司 治疗trpv1活性介导疾病的药物组合物
CN116970034A (zh) * 2022-10-14 2023-10-31 深圳市维琪科技股份有限公司 合成肽及其组合物和用途

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100000391A (ko) * 2008-06-24 2010-01-06 (주)아모레퍼시픽 뉴로코스메틱 피부 미용방법, 피부 미용 물질 스크리닝방법 및 피부 미용 물질
WO2011051349A1 (en) * 2009-10-27 2011-05-05 Ucb Pharma S.A. Antibodies to ion channels

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6482611B1 (en) * 1999-09-23 2002-11-19 Neurogen Corporation Human capsaicin receptor and uses thereof
US20040009537A1 (en) * 2002-01-11 2004-01-15 Jack Roos Methods of modulating and of identifying agents that modulate intracellular calcium
JP4403908B2 (ja) * 2004-07-27 2010-01-27 住友電気工業株式会社 ペプチドまたはタンパク質のリン酸化解析装置、リン酸化判別プログラム及びそのプログラムの記録媒体
EP2038074B1 (en) * 2006-06-29 2014-06-11 Xiaolian Gao Make and use of surface molecules of varied densities

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100000391A (ko) * 2008-06-24 2010-01-06 (주)아모레퍼시픽 뉴로코스메틱 피부 미용방법, 피부 미용 물질 스크리닝방법 및 피부 미용 물질
WO2011051349A1 (en) * 2009-10-27 2011-05-05 Ucb Pharma S.A. Antibodies to ion channels

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KUEPER ET AL.: "Inhibition of TRPVl for the treatment of sensitive skin", EXPERIMENTAL DERMATOLOGY, vol. 19, 2010, pages 980 - 986, XP002692505, DOI: doi:10.1111/j.1600-0625.2010.01122.x *
LEE ET AL.: "A novel role for the TRPV1 channel in UV-induced matrix metalloproteinase (MMP)-1 expression in HaCaT cells", JOURNAL OF CELLULAR PHYSIOLOGY, vol. 219, no. 3, 10 February 2009 (2009-02-10), pages 766 - 775 *
LEE ET AL.: "Increased expression of TRPV1 channel in intrinsically aged and photoaged human skin in vivo", EXPERIMENTAL DERMATOLOGY, vol. 18, 2009, pages 431 - 436 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017515816A (ja) * 2014-05-13 2017-06-15 ケアジェン カンパニー, リミテッドCaregen Co., Ltd. 抗炎症、骨形成及び発毛促進活性を有するペプチド及びその用途
US10238710B2 (en) 2014-05-13 2019-03-26 Caregen Co., Ltd. Peptide having anti-inflammatory, osteogenic and hair growth promoting activities, and use of same
KR20160029159A (ko) * 2014-09-04 2016-03-15 동국대학교 경주캠퍼스 산학협력단 향부자 추출 피부 노화방지용 건강 기능 조성물
KR101689156B1 (ko) 2014-09-04 2016-12-23 동국대학교 경주캠퍼스 산학협력단 향부자 추출 피부 노화방지용 외용제 조성물 제조 방법

Also Published As

Publication number Publication date
US9511011B2 (en) 2016-12-06
US20130243711A1 (en) 2013-09-19
JP6185549B2 (ja) 2017-08-23
KR20140138162A (ko) 2014-12-03
KR101784766B1 (ko) 2017-10-13
US9056889B2 (en) 2015-06-16
JP2015515455A (ja) 2015-05-28
US20150257998A1 (en) 2015-09-17

Similar Documents

Publication Publication Date Title
WO2013137505A1 (ko) 신규한 ｔｒｐｖ１ 억제 펩티드 및 이를 함유하는 피부노화 방지 또는 주름 개선용 조성물
WO2013129801A1 (ko) 트리펩타이드 및 이를 함유하는 노화방지, 주름개선, 미백 및 항염효능의 화장료 조성물
WO2017222345A1 (en) Novel autophagy activation-inducing compound for improving skin inflammation or aging
WO2013137569A1 (ko) 테트라펩타이드 및 이를 함유하는 피부노화 방지 및 항염효능의 화장료 조성물
WO2017142305A1 (ko) 발모 촉진 활성 및/또는 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도
WO2018056706A1 (ko) 티오레독신 결합단백질 유래 펩타이드 또는 이를 암호화 하는 폴리뉴클레오타이드를 유효성분으로 함유하는 노화 줄기세포의 역노화용 조성물 및 이의 용도
WO2022260454A1 (ko) 장수만리화 추출물을 포함하는 아토피 피부염 치료용 또는 피부 장벽 강화용 또는 노화 방지용 조성물
WO2014178653A1 (ko) 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도
WO2017119756A1 (ko) 주름개선, 노화방지, 미백, 항염증 기능성 신규 펩티드 및 이를 포함하는 조성물
WO2019088402A1 (ko) 뷔베리신 또는 뷔베리신 유도체를 유효성분으로 포함하는 피부 미백용 조성물
WO2020180059A1 (ko) 플라즈마 활성 배양액을 포함하는 멜라닌 생산용 조성물 및 이의 용도
WO2020159191A1 (ko) Mls-stat3를 포함하는 면역질환의 예방 또는 치료용 조성물
WO2019143145A1 (ko) 레졸빈 d2를 유효성분으로 함유하는 피부 염증 치료용 조성물
WO2010032976A2 (ko) 심부전 예방 또는 치료용 조성물
WO2022050634A1 (ko) 펩타이드 및 이를 포함하는 화장료 조성물 및 약학 조성물
WO2014038882A1 (ko) 신규 화합물 및 이의 인터루킨-1베타 또는 인터루킨-6 저해 용도
WO2021002664A1 (ko) 암의 예방, 개선 또는 치료용 조성물
WO2016159627A1 (ko) 항암 활성을 갖는 펩티드, 이를 유효성분으로 함유하는 암 예방 및 치료용 약학 조성물 및 건강기능식품 조성물
WO2015108372A1 (ko) 오스모틴을 포함하는 흥분독성 또는 시냅스 기능 장애에 의한 신경 질환의 예방 또는 치료용 조성물, 및 이를 이용한 신경 질환의 예방 또는 치료 방법
WO2020222315A1 (ko) 피부 또는 세포 투과능이 우수한 피부 주름 개선 또는 치료용 조성물
WO2020149538A1 (ko) 클로날 줄기세포를 포함하는 아토피 피부염 예방 또는 치료용 약학적 조성물
WO2020027534A1 (ko) 푸니칼라진을 포함하는 par2 활성 억제용 조성물
WO2019088648A1 (ko) 미도드린을 포함하는 조성물 및 이의 용도
WO2018056583A1 (ko) Sh3bp4 억제 물질을 포함하는 피부 미백용 조성물 및 sh3bp4 억제 물질의 스크리닝 방법
WO2022039345A1 (ko) 이소오카닌 또는 이의 염을 유효성분으로 포함하는 염증성 질환 예방, 개선 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12871427

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 20147025534

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2015500346

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12871427

Country of ref document: EP

Kind code of ref document: A1