WO2010057246A1 - Enzymes and methods for producing omega-3 fatty acids - Google Patents

Enzymes and methods for producing omega-3 fatty acids Download PDF

Info

Publication number
WO2010057246A1
WO2010057246A1 PCT/AU2009/001488 AU2009001488W WO2010057246A1 WO 2010057246 A1 WO2010057246 A1 WO 2010057246A1 AU 2009001488 W AU2009001488 W AU 2009001488W WO 2010057246 A1 WO2010057246 A1 WO 2010057246A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
desaturase
plant
elongase
fatty acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2009/001488
Other languages
English (en)
French (fr)
Inventor
James Robertson Petrie
Anne Maree Mackenzie
Qing Liu
Pushkar Shrestha
Peter David Nichols
Susan Irene Ellis Blackburn
Maged Peter Mansour
Stanley Suresh Robert
Dion Matthew Frederick Frampton
Xue-Rong Zhou
Surinder Pal Singh
Craig Christopher Wood
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Commonwealth Scientific and Industrial Research Organization CSIRO
Original Assignee
Commonwealth Scientific and Industrial Research Organization CSIRO
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=42197742&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2010057246(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to JP2011535839A priority Critical patent/JP6068800B2/ja
Priority to CN2009801548769A priority patent/CN102317459A/zh
Priority to BR122021003836-8A priority patent/BR122021003836B1/pt
Priority to CN202111172382.2A priority patent/CN113957105B/zh
Priority to AU2009317860A priority patent/AU2009317860B2/en
Priority to BRPI0921467-4A priority patent/BRPI0921467B1/pt
Priority to NZ593097A priority patent/NZ593097A/xx
Priority to ES09827035.8T priority patent/ES2644883T3/es
Priority to EP09827035.8A priority patent/EP2358882B1/en
Application filed by Commonwealth Scientific and Industrial Research Organization CSIRO filed Critical Commonwealth Scientific and Industrial Research Organization CSIRO
Priority to CA2743880A priority patent/CA2743880C/en
Priority to EP17182502.9A priority patent/EP3260544B1/en
Priority to BR122021003835-0A priority patent/BR122021003835B1/pt
Priority to CN202111172412.XA priority patent/CN113957054B/zh
Priority to NO09827035A priority patent/NO2358882T3/no
Priority to DK09827035.8T priority patent/DK2358882T3/da
Priority to US13/129,940 priority patent/US8809559B2/en
Publication of WO2010057246A1 publication Critical patent/WO2010057246A1/en
Anticipated expiration legal-status Critical
Priority to US14/332,202 priority patent/US9938486B2/en
Priority to US15/642,223 priority patent/US10648046B2/en
Priority to US15/644,635 priority patent/US9994792B2/en
Priority to US15/661,697 priority patent/US20180010141A1/en
Priority to US15/661,673 priority patent/US9976107B2/en
Priority to US16/860,936 priority patent/US11976287B2/en
Priority to US18/409,591 priority patent/US12195739B2/en
Priority to US18/409,596 priority patent/US12203087B2/en
Priority to US18/409,598 priority patent/US20240150781A1/en
Priority to US18/409,603 priority patent/US20240150782A1/en
Priority to US18/656,570 priority patent/US20240360464A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C11ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11BPRODUCING, e.g. BY PRESSING RAW MATERIALS OR BY EXTRACTION FROM WASTE MATERIALS, REFINING OR PRESERVING FATS, FATTY SUBSTANCES, e.g. LANOLIN, FATTY OILS OR WAXES; ESSENTIAL OILS; PERFUMES
    • C11B3/00Refining fats or fatty oils
    • C11B3/006Refining fats or fatty oils by extraction
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/02Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/18Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/24Antidepressants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/30Drugs for disorders of the nervous system for treating abuse or dependence
    • A61P25/32Alcohol-abuse
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/02Nutrients, e.g. vitamins, minerals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/24Drugs for disorders of the endocrine system of the sex hormones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/06Antiarrhythmics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205Agrobacterium mediated transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0083Miscellaneous (1.14.99)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/1029Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/64Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409Fatty acids
    • C12P7/6427Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/64Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409Fatty acids
    • C12P7/6427Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C12P7/6432Eicosapentaenoic acids [EPA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/64Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409Fatty acids
    • C12P7/6427Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C12P7/6434Docosahexenoic acids [DHA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/64Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436Fatty acid esters
    • C12P7/6445Glycerides
    • C12P7/6463Glycerides obtained from glyceride producing microorganisms, e.g. single cell oil
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/64Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436Fatty acid esters
    • C12P7/6445Glycerides
    • C12P7/6472Glycerides containing polyunsaturated fatty acid [PUFA] residues, i.e. having two or more double bonds in their backbone
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/19Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (1.14.19)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/19Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (1.14.19)
    • C12Y114/19003Linoleoyl-CoA desaturase (1.14.19.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y602/00Ligases forming carbon-sulfur bonds (6.2)
    • C12Y602/01Acid-Thiol Ligases (6.2.1)
    • C12Y602/01003Long-chain-fatty-acid-CoA ligase (6.2.1.3)

Definitions

  • the present invention relates to methods of synthesizing long-chain polyunsaturated fatty acids, especially eicosapentaenoic acid, docosapentaenoic acid and docosahexaenoic acid, in recombinant cells such as yeast or plant cells. Also provided are recombinant cells or plants which produce long-chain polyunsaturated fatty acids. Furthermore, the present invention relates to a group of new enzymes which possess desaturase or elongase activity that can be used in methods of synthesizing long-chain polyunsaturated fatty acids. In particular, the present invention provides ⁇ 3 destaurases, ⁇ 5 elongases and ⁇ 6 desaturases with novel activities. Also provided are methods and DNA constructs for transiently and/or stably transforming cells, particularly plant cells, with multiple genes.
  • Omega-3 long-chain polyunsaturated fatty acids are now widely recognized as important compounds for human and animal health.
  • These fatty acids may be obtained from dietary sources or by conversion of linoleic (LA, 18:2co6) or ⁇ -linolenic (ALA, 18:3 ⁇ 3) fatty acids, both of which are regarded as essential fatty acids in the human diet. While humans and many other vertebrate animals are able to convert LA or ALA, obtained from plant sources, to VLC-PUFA, they carry out this conversion at a very low rate.
  • VLC-PUFA polyunsaturated fatty acids
  • EPA eicosapentaenoic acid
  • DHA docosahexaenoic acid
  • the most common pathway that produces EPA in these organisms includes a ⁇ 6-desaturation, ⁇ 6-elongation and ⁇ 5-desaturation (termed the ⁇ 6-desaturation pathway) whilst a less common pathway uses a ⁇ 9-elongation, ⁇ 8- desaturation and ⁇ 5 -desaturation (termed the ⁇ 9-desaturation pathway).
  • VLC-PUFA synthesising organisms may convert ⁇ 6 fatty acids to ⁇ 3 fatty acids using an ⁇ 3-desaturase, shown as the ⁇ 17- desaturase step in Figure 1 for conversion of arachidonic acid (ARA, 20:4 ⁇ 6) to EPA.
  • Some members of the ⁇ 3-desaturase family can act on a variety of substrates ranging from LA to ARA. Plant ⁇ 3-desaturases often specifically catalyse the ⁇ 15- desaturation of LA to ALA, while fungal and yeast ⁇ 3-desaturases may be specific for the ⁇ 17-desaturation of ARA to EPA (Pereira et al, 2004a; Zank et al, 2005). Some reports suggest that non-specific ⁇ 3-desaturases may exist which can convert a wide variety of ⁇ 6 substrates to their corresponding ⁇ 3 products (Zhang et al., 2007). Other C ⁇ 3-desaturases may have a preference for ⁇ 3 substrates (Sayanova et al., 2003).
  • the front-end desaturases generally found in plants, mosses, microalgae, and lower animals such as Caenorhabditis elegans predominantly accept fatty acid substrates esterified to the sn-2 position of a phosphatidylcholine (PC) substrate. These desaturases are therefore known as acyl-PC, lipid- linked, front-end desaturases (Domergue et al., 2003). In contrast, higher animal front-end desaturases generally accept acyl-CoA substrates where the fatty acid substrate is linked to CoA rather than PC (Domergue et al, 2005).
  • Each PUFA and VLC-PUFA elongation reaction consists of four steps catalysed by a multi-component protein complex: first, a condensation reaction results in the addition of a 2C unit from malonyl-CoA to the fatty acid, resulting in the formation of a ⁇ -ketoacyl intermediate. This is then reduced by NADPH, followed by a dehydration to yield an enoyl intermediate. This intermediate is finally reduced a second time to produce the elongated fatty acid. It is generally thought that the condensation step of these four reactions is substrate specific whilst the other steps are not.
  • native plant elongation machinery is capable of elongating VLC-PUFA providing that the condensation enzyme (typically called an 'elongase') specific to the VLC-PUFA is introduced, although the efficiency of the native plant elongation machinery in elongating the non-native VLC-PUFA substrates may be low.
  • the condensation enzyme typically called an 'elongase'
  • VLC-PUFA desaturation in plants, mosses and microalgae naturally occurs to fatty acid substrates predominantly in the acyl-PC pool whilst elongation occurs to substrates in the acyl-CoA pool.
  • Transfer of fatty acids from acyl-PC molecules to a CoA carrier is performed by phospholipases (PLAs) whilst the transfer of acyl-CoA fatty acids to a PC carrier is performed by lysophosphatidyl-choline acyltransferases (LPCATs) ( Figure 2) (Singh et al., 2005).
  • VLC-PUFA metabolic engineering has been performed using the aerobic ⁇ 6-desaturation/elongation pathway.
  • the biosynthesis of ⁇ -linolenic acid (GLA, 18:3 ⁇ 6) in tobacco was first reported in 1996 using a ⁇ 6-desaturase from the cyanobacterium Synechocystis (Reddy and Thomas, 1996). More recently, GLA has been produced in crop plants such as safflower (73% GLA; Knauf et al., 2006) and soybean (28% GLA; Sato et al., 2004).
  • the production of VLC-PUFA such as EPA and DHA involves more complicated engineering due to the increased number of desaturation and elongation steps involved.
  • the present inventors have identified for the first time a ⁇ 5 elongase which efficiently converts EPA to DPA in a recombinant cell.
  • the present invention further provides a recombinant cell, preferably a plant cell and more preferably a plant seed cell, comprising an exogenous polynucleotide encoding a fatty acid elongase with ⁇ 5 elongase activity, wherein the elongase has activity on EPA to produce DPA with an efficiency of at least 60%, at least 65%, at least 70% or at least 75% when the elongase is expressed from the exogenous polynucleotide in the cell, preferably in a plant cell.
  • the elongase comprises amino acids having a sequence as provided in SEQ ID NO:6, a biologically active fragment thereof, or an amino acid sequence which is at least 47% identical to SEQ ID NO:6.
  • the cell further comprises exogenous polynucleotides encoding; i) a ⁇ 8 desaturase and/or a ⁇ 6 desaturase, ii) a ⁇ 9 elongase and/or a ⁇ 6 elongase, iii) a ⁇ 5 desaturase, and iv) optionally a ⁇ 4 desaturase and/or an ⁇ 3 desaturase, wherein each polynucleotide is operably linked to one or more promoters that are capable of directing expression of said polynucleotides in the cell.
  • the present inventors have also identified an ⁇ 3 desaturase with novel properties.
  • the C ⁇ 3 desaturase is useful in recombinant pathways designed to yield EPA, the downstream fatty acids DPA and DHA, and other ⁇ 3 VLC-PUFA.
  • the present invention provides a recombinant cell, preferably a plant cell and more preferably a plant seed cell, comprising an exogenous polynucleotide encoding a fatty acid desaturase with ⁇ 3 desaturase activity, wherein the desaturase is capable of desaturating at least one of ARA to EPA, DGLA to ETA, GLA to SDA, both ARA to EPA and DGLA to ETA, both ARA to EPA and GLA to SDA, or all three of these when the desaturase is expressed from the exogenous polynucleotide in the cell.
  • the desaturase is preferably a front-end desaturase.
  • the desaturase has ⁇ 17 desaturase activity on a C20 fatty acid which has at least three carbon-carbon double bonds in its acyl chain, preferably ARA.
  • the desaturase has ⁇ 15 desaturase activity on a Cl 8 fatty acid which has three carbon-carbon double bonds in its acyl chain, preferably GLA.
  • the desaturase preferably has greater activity on an acyl-CoA substrate than a corresponding acyl-PC substrate.
  • the acyl-CoA substrate is ARA-CoA and the acyl-PC substrate comprises ARA at the sn-2 position of PC.
  • the cell is a plant cell and the desaturase has activity on ARA to produce EPA with an efficiency of at least 40% when expressed from the exogenous polynucleotide in the cell.
  • the desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 15, 17 or 20, a biologically active fragment thereof, or an amino acid sequence which is at least 35% identical to SEQ ID NO: 15, at least 60% identical to SEQ ID NO: 17 and/or at least 60% identical to SEQ ID NO:20.
  • the present inventors have identified a gene encoding a ⁇ 6 desaturase which has greater conversion efficiency for ⁇ 3 fatty acid substrates than for the corresponding ⁇ 6 fatty acid substrate in plants and/or in yeast.
  • This ⁇ 6 desaturase also exhibits ⁇ 8 desaturase activity.
  • the use of this ⁇ 6 desaturase or other desaturases with high specificity for ⁇ 3 desaturated fatty acid substrates in recombinant LC-PUFA pathways in plants increases levels of EPA, DPA and DHA relative to the use of desaturases without preference for ⁇ 3 desaturated fatty acid substrates.
  • the present invention further provides a recombinant cell, preferably a plant cell and more preferably a plant seed cell, comprising an exogenous polynucleotide encoding a fatty acid desaturase with ⁇ 6 desaturase activity, wherein the desaturase is further characterised by having at least two, preferably all three, of the following; i) greater ⁇ 6 desaturase activity on ALA than LA as fatty acid substrate, preferably in a plant cell, ii) greater ⁇ 6 desaturase activity on ALA-CoA as fatty acid substrate than on ALA joined to the sn-2 position of PC as fatty acid substrate, preferably in a plant cell, and iii) ⁇ 8 desaturase activity on ETrA, preferably in a plant cell.
  • a recombinant cell preferably a plant cell and more preferably a plant seed cell, comprising an exogenous polynucleotide encoding a fatty acid desaturase with
  • the present invention further provides a recombinant cell, preferably a plant cell and more preferably a plant seed cell, comprising an exogenous polynucleotide encoding a fatty acid desaturase with ⁇ 6 desaturase activity, wherein the desaturase has greater activity on an ⁇ 3 substrate than the corresponding ⁇ 6 substrate, and wherein the desaturase has activity on ALA to produce SDA with an efficiency of at least 5%, at least 7.5%, or at least 10% when the desaturase is expressed from the exogenous polynucleotide in the cell, or at least 35% when expressed in a yeast cell.
  • a recombinant cell preferably a plant cell and more preferably a plant seed cell, comprising an exogenous polynucleotide encoding a fatty acid desaturase with ⁇ 6 desaturase activity, wherein the desaturase has greater activity on an ⁇ 3 substrate than the corresponding ⁇ 6 substrate, and wherein the desatura
  • the desaturase has greater ⁇ 6 desaturase activity on ALA than LA as fatty acid substrate, preferably in a plant cell.
  • the ⁇ 6 desaturase preferably has at least about a 2-fold greater ⁇ 6 desaturase activity, at least 3 -fold greater activity, at least 4-fold greater activity, or at least 5 -fold greater activity, on ALA as a substrate compared to LA, preferably in a plant cell.
  • the ⁇ 6 desaturase has greater activity on ALA-CoA as fatty acid substrate than on ALA joined to the sn-2 position of PC as fatty acid substrate, preferably in a plant cell.
  • the ⁇ 6 desaturase preferably has at least about a 5 -fold greater ⁇ 6 desaturase activity or at least 10-fold greater activity, on ALA-CoA as fatty acid substrate than on ALA joined to the sn-2 position of PC as fatty acid substrate, preferably in a plant cell.
  • the ⁇ 6 desaturase preferably is a front-end desaturase.
  • the cell according to the invention further comprises exogenous polynucleotides encoding; i) a ⁇ 6 elongase, ii) a ⁇ 5 desaturase, iii) a ⁇ 5 elongase, and iv) optionally a ⁇ 4 desaturase and/or an ⁇ 3 desaturase, wherein each polynucleotide is operably linked to one or more promoters that are capable of directing expression of said polynucleotides in the cell.
  • the ⁇ 6 desaturase in the cell of the invention preferably has no detectable ⁇ 5 desaturase activity on ETA.
  • the ⁇ 6 desaturase preferably comprises amino acids having a sequence as provided in SEQ ID NO: 10, a biologically active fragment thereof, or an amino acid sequence which is at least 77% identical to SEQ ID NO: 10.
  • the ⁇ 6 desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 8, a biologically active fragment thereof, or an amino acid sequence which is at least 67% identical to SEQ ID NO: 8 and has ⁇ 8 desaturase activity.
  • the present inventors have also found that recombinant cells expressing ⁇ 9 elongase, ⁇ 8 desaturase and ⁇ 5 desaturase are able to more efficiently convert fatty acid substrates to EPA, DPA and DHA.
  • the present invention further provides a recombinant cell, preferably a plant cell and more preferably a plant seed cell, comprising exogenous polynucleotides encoding; i) a ⁇ 9 elongase, ii) a ⁇ 8 desaturase, iii) a ⁇ 5 desaturase, iv) optionally a ⁇ 5 elongase, and v) if the ⁇ 5 elongase is present, optionally a ⁇ 4 desaturase, wherein each polynucleotide is operably linked to one or more promoters that are capable of directing expression of said polynucleotides in the cell, and wherein at least 15%, at least 20%, or at least 25%, of the total fatty acids in the cell comprise at least 20 carbons and at least 3 carbon-carbon double bonds in their acyl chains.
  • the sum total of ARA, EPA, DPA and DHA in the fatty acids in the cell of the invention comprises at least 15%, at least 20%, or at least 25% of the total fatty acids in the cell.
  • the cell according to the invention has reduced ability to convert oleic acid to eicosenoic acid (C20:l) when compared to a wild-type plant, and/or less than 5% of the oleic acid is converted to eicosenoic acid in the cell.
  • the total fatty acid in the cell has less than 1% C20:l.
  • the cell according to the invention has reduced endogenous ⁇ 15 desaturase activity when compared to a wild-type cell, and/or less than 10% of the LA is converted to ALA in the cell.
  • the endogenous ⁇ 15 desaturase has greater activity on an acyl-PC substrate than on the corresponding acyl-CoA substrate, preferably where the acyl group is LA.
  • the cell of the invention further comprises an increased conversion of GLA to SDA and/or ARA to EPA relative to the corresponding cell lacking the exogenous polynucleotides.
  • the amount of DHA in the fatty acids in the cell of the invention is at least 3%, at least 5%, or at least 10%, of the total fatty acids in the cell.
  • the efficiency of conversion of LA to ARA and/or ALA to EPA in the cell of the invention is at least 80% or at least 90%.
  • the ⁇ 9 elongase comprises amino acids having a sequence as provided in SEQ ID NO:22, a biologically active fragment thereof, or an amino acid sequence which is at least 80% identical to SEQ ID NO:22.
  • the ⁇ 8 desaturase comprises amino acids having a sequence as provided in SEQ ID NO:24, a biologically active fragment thereof, or an amino acid sequence which is at least 80% identical to SEQ ID NO:24.
  • the ⁇ 5 desaturase comprises amino acids having a sequence as provided in SEQ ID NO:26 or SEQ ID NO: 13, a biologically active fragment thereof, or an amino acid sequence which is at least 80% identical to SEQ ID NO:26 and/or SEQ ID NO: 13.
  • the present inventors have obtained results which indicate that a set of genes expressing the ⁇ 6-desaturase, ⁇ 6 elongase, ⁇ 5 desaturase, ⁇ 5 elongase, and ⁇ 4 desaturase, or a similar set of genes in particular where the desaturases are active on acyl-CoA substrates, can be used to synthesise substantial levels of EPA, DPA and DHA.
  • the present invention further provides a recombinant cell, preferably a plant cell and more preferably a plant seed cell, comprising exogenous polynucleotides encoding; i) a ⁇ 6 elongase and/or a ⁇ 9 elongase, ii) a ⁇ 6 desaturase and/or a ⁇ 8 desaturase, iii) a ⁇ 5 desaturase, iv) a ⁇ 5 elongase, v) a ⁇ 4 desaturase, and vi) optionally a diacylglycerol acyltransferase wherein each polynucleotide is operably linked to one or more promoters that are capable of directing expression of said polynucleotides in the cell, characterised by one or more or all of the following properties: a) the efficiency of conversion of ALA to EPA, DPA or DHA is at least 17.3%, or at least 23%,
  • At least 6%, at least 11% or at least 15% of the total fatty acid incorporated in triacylglycerol in the cell is DHA.
  • DHA constitutes 20-65%, preferably, 40-65%, of the total of SDA, ETA, EPA, DPA and DHA in the cell.
  • ⁇ 3 fatty acids in the cell 0.1-25% is SDA
  • 0.1-10% is ETA
  • 0.1-60% is EPA
  • 0.1-50% is DPA and 30-95% is DHA
  • more preferably of the ⁇ 3 fatty acids in the cell 0.1-25% is SDA
  • 0.1-10% is ETA
  • 0.1-50% is EPA
  • 0.1-50% is DPA and 40-95% is DHA.
  • the ⁇ 4 desaturase preferably comprises amino acids having a sequence as provided in SEQ ID NO: 73, a biologically active fragment thereof, or an amino acid sequence which is at least 80% identical to SEQ ID NO:73.
  • the present invention provides a recombinant cell, preferably a plant cell and more preferably a plant seed cell, comprising exogenous polynucleotides encoding; i) a ⁇ 6 elongase and/or a ⁇ 9 elongase, ii) a ⁇ 6 desaturase and/or a ⁇ 8 desaturase, iii) a ⁇ 5 desaturase, iv) a ⁇ 5 elongase, and v) optionally a diacylglycerol acyltransferase wherein each polynucleotide is operably linked to one or more promoters that are capable of directing expression of said polynucleotides in the cell, characterised by one or more or all of the following properties: a) the efficiency of conversion of ALA to EPA or DPA is at least 17.3%, or at least 23%, and b) the efficiency of conversion of ALA to DPA is
  • At least 6%, at least 11% or at least 15% of the total fatty acids incorporated in triacylglycerol in the cell is DPA.
  • the DPA preferably constitutes 20-65%, more preferably 40-65%, of the total of SDA, ETA, EPA and DPA in the cell.
  • ⁇ 3 fatty acids in the cell 0.1-35% is SDA
  • 0.1-15% is ETA
  • 0.1-60% is EPA
  • 30-75% is DPA
  • more preferably of the ⁇ 3 fatty acids in the cell 0.1-35% is SDA
  • 0.1-15% is ETA
  • 0.1-50% is EPA
  • 40-75% is DPA.
  • the ⁇ 6 elongase comprises amino acids having a sequence as provided in SEQ ID NO:4, a biologically active fragment thereof, or an amino acid sequence which is at least 55% identical to SEQ ID NO:4.
  • the ⁇ 6 desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 8, a biologically active fragment thereof, or an amino acid sequence which is at least 67% identical to SEQ ID NO: 8.
  • the ⁇ 5 desaturase comprises amino acids having a sequence as provided in SEQ ID NO:26, a biologically active fragment thereof, or an amino acid sequence which is at least 80% identical to SEQ ID NO:26.
  • the ⁇ 5 elongase comprises amino acids having a sequence as provided in SEQ ID NO:6, a biologically active fragment thereof, or an amino acid sequence which is at least 47% identical to SEQ ID NO: 6.
  • the diacylglycerol acyltransferase comprises amino acids having a sequence as provided in SEQ ID NO:75 or SEQ ID NO: 108, a biologically active fragment thereof, or an amino acid sequence which is at least 80% identical to SEQ ID NO:75 and/or SEQ ID NO: 108.
  • the cell preferably a plant cell and more preferably a plant seed cell, of the invention further comprises exogenous polynucleotides encoding; i) a ⁇ 17 desaturase, ii) a ⁇ 15 desaturase, and/or iii) a ⁇ 12 desaturase wherein each polynucleotide is operably linked to one or more promoters that are capable of directing expression of said polynucleotides in the cell,
  • one or more or all of the desaturases expressed from exogenous polynucleotides in the cell of the invention have greater activity on an acyl- CoA substrate than the corresponding acyl-PC substrate.
  • the other desaturases expressed from exogenous polynucleotides in the cell may or may not have greater activity on an acyl-CoA substrate than the corresponding acyl-PC substrate.
  • the preferred acyl-CoA substrate for each enzyme is different.
  • the present invention further provides a recombinant cell, preferably a plant cell and more preferably a plant seed cell, comprising an exogenous polynucleotide encoding a fatty acid elongase with ⁇ 6 elongase and ⁇ 9 elongase activity, wherein the elongase has greater ⁇ 6 elongase activity than ⁇ 9 elongase activity.
  • the elongase has an efficiency of conversion on SDA to produce ETA which is at least 50% or at least 60%, and/or an efficiency of conversion on ALA to produce ETrA which is at least 6% or at least 9%.
  • the elongase has at least about 6.5 fold greater ⁇ 6 elongase activity than ⁇ 9 elongase activity.
  • the elongase has no detectable ⁇ 5 elongase activity.
  • the elongase preferably comprises amino acids having a sequence as provided in SEQ ID NO:4, a biologically active fragment thereof, or an amino acid sequence which is at least 55% identical to SEQ ID NO:4.
  • the cell further comprises exogenous polynucleotides encoding; i) a ⁇ 8 desaturase and/or a ⁇ 6 desaturase, ii) a ⁇ 5 desaturase, iii) a ⁇ 5 elongase, and iv) optionally a ⁇ 4 desaturase and/or an ⁇ 3 desaturase, wherein each polynucleotide is operably linked to one or more promoters that are capable of directing expression of said polynucleotides in the cell.
  • the present invention further provides a recombinant cell, preferably a plant cell and more preferably a plant seed cell, comprising an exogenous polynucleotide encoding a fatty acid desaturase with ⁇ 5 desaturase activity, wherein the desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 13, a biologically active fragment thereof, or an amino acid sequence which is at least 53% identical to SEQ ID NO: 13.
  • the present invention further provides a recombinant cell, preferably a plant cell and more preferably a plant seed cell, comprising an exogenous polynucleotide encoding a fatty acid elongase with ⁇ 9 elongase activity, wherein the elongase comprises amino acids having a sequence as provided in any one of SEQ ID NOs:28, 94 and 96, a biologically active fragment thereof, an amino acid sequence which is at least 81% identical to SEQ ID NO:28, or an amino acid sequence which is at least 50% identical to SEQ ID NO:94 and/or SEQ ID NO:96.
  • the ⁇ 9 elongase comprises amino acids having a sequence as provided in SEQ ID NO:94 or SEQ ID NO:96, a biologically active fragment thereof, or an amino acid sequence which is at least 50% identical to SEQ ID NO: 94 and/or SEQ ID NO:96, and wherein the elongase has greater activity on an ⁇ 6 substrate than the corresponding ⁇ 3 substrate More preferably, the ⁇ 9 elongase has at least a 2 fold, more preferably at least a 4 fold greater activity on an ⁇ 6 substrate (for example LA) than the corresponding ⁇ 3 substrate (for example ALA).
  • the present invention provides a recombinant cell comprising an exogenous polynucleotide encoding a diacylglycerol acyltransferase, wherein the diacylglycerol acyltransferase comprises amino acids having a sequence as provided in SEQ ID NO: 108, a biologically active fragment thereof, or an amino acid sequence which is at least 54% identical to SEQ ID NO: 108.
  • the desaturase and/or elongase, or multiple desaturases and/or elongases can purified from microalga.
  • Preferred microalgae are Pavlova spp, Pyramimonas spp and Micromonas spp.
  • the cell according to the invention is a eukaryotic cell.
  • the cell may be a plant cell, a mammalian cell, an insect cell, a fungal cell or a yeast cell.
  • the cell may be a cell in tissue culture, in vitro and/or isolated.
  • the cell is in a plant and/or is a mature plant seed cell.
  • the plant may be in the field or harvested as a plant part, or the seed may be harvested seed.
  • the plant or plant seed is an oilseed plant or an oilseed respectively.
  • one of more of the defined elongases and/or desaturases can be co-expressed in the same cell.
  • the cell of the invention is capable of synthesising long chain polyunsaturated fatty acids (LC-PUFA), wherein the cell is derived from a cell that is not capable of synthesising said LC-PUFA.
  • LC-PUFA long chain polyunsaturated fatty acids
  • a cell of the invention preferably a plant cell and more preferably a plant storage organ cell or seed cell, comprises an exogenous polynucleotide encoding a silencing suppressor.
  • the exogenous polynucleotide encoding the silencing suppressor is operably linked to a plant storage organ specific promoter.
  • the plant storage organ specific promoter is a seed specific promoter, or a cotyledon-specific promoter or an endosperm-specific promoter that is preferentially expressed in the developing seed.
  • the present invention further provides a method of obtaining a cell, preferably a plant cell and more preferably a plant seed cell, capable of synthesising one or more long chain polyunsaturated fatty acids (LC-PUFAs), the method comprising a) introducing into a cell, preferably a cell which is not capable of synthesising said LC-PUFA, an exogenous polynucleotide encoding a fatty acid ⁇ 3 desaturase activity, wherein the polynucleotide is operably linked to a promoter that is capable of directing expression of said polynucleotide in the cell, b) expressing the exogenous polynucleotides in the cell, c) analysing the fatty acid composition of the cell, and d) selecting a cell capable of desaturating at least one of ARA to EPA, DGLA to ETA, GLA to SDA, both ARA to EPA and DGLA to ETA, both ARA to EPA and GLA to SDA,
  • the selected cell is a cell according to the invention.
  • the cell may further comprise a combination of desaturases and elongases as described herein.
  • the present invention further provides a method of obtaining a cell, preferably a plant cell and more preferably a plant seed cell, capable of synthesising one or more long chain polyunsaturated fatty acids (LC-PUFAs), the method comprising a) introducing into a cell, preferably a cell which is not capable of synthesising said LC-PUFA, an exogenous polynucleotide encoding a fatty acid ⁇ 5 elongase wherein the polynucleotide is operably linked to a promoter that is capable of directing expression of said polynucleotide in the cell, b) expressing the exogenous polynucleotide in the cell, c) analysing the fatty acid composition of the cell, and d) selecting a cell wherein the ⁇ 5 elongase has activity on EPA to produce DPA with an efficiency of at least 60%, at least 65%, at least 70% or at least 75%.
  • LC-PUFAs long chain polyun
  • the selected cell is a cell according to the invention.
  • the cell may further comprise a combination of desaturases and elongases as described herein.
  • the present invention further provides a method of obtaining a cell, preferably a plant cell and more preferably a plant seed cell, capable of synthesising one or more long chain polyunsaturated fatty acids (LC-PUFAs), the method comprising a) introducing into a cell, preferably a cell which is not capable of synthesising said LC-PUFA, an exogenous polynucleotide encoding a fatty acid ⁇ 6 desaturase, wherein the polynucleotide is operably linked to a promoter that is capable of directing expression of said polynucleotide in the cell, b) expressing the exogenous polynucleotide in the cell, c) analysing the fatty acid composition of the cell, and d) selecting a cell having at least two, preferably all three, of the following i) greater ⁇ 6 desaturase activity on ALA than LA as fatty acid substrate, preferably in a plant cell, ii) greater ⁇ 6 desaturase
  • the present invention further provides a method of obtaining a cell, preferably a plant cell and more preferably a plant seed cell, capable of synthesising one or more long chain polyunsaturated fatty acids (LC-PUFAs), the method comprising a) introducing into a cell, preferably a cell which is not capable of synthesising said LC-PUFA, an exogenous polynucleotide encoding a fatty acid ⁇ 6 desaturase, wherein the polynucleotide is operably linked to a promoter that is capable of directing expression of said polynucleotide in the cell, b) expressing the exogenous polynucleotide in the cell, c) analysing the fatty acid composition of the cell, and d) selecting a cell with ⁇ 6 desaturase activity which has greater activity on an ⁇ 3 substrate than the corresponding ⁇ 6 substrate, and with activity on ALA to produce SDA with an efficiency of at least 5%, at least 7.5%, or at least 10%
  • the selected cell is a cell according to the invention.
  • the cell may further comprise a combination of desaturases and elongases as described herein.
  • the present invention further provides a method of obtaining a cell, preferably a plant cell and more preferably a plant seed cell, capable of synthesising one or more long chain polyunsaturated fatty acids (LC-PUFAs), the method comprising a) introducing into the cell, preferably a cell which is not capable of synthesising said LC-PUFA, exogenous polynucleotides encoding; i) a ⁇ 9 elongase, ii) a ⁇ 8 desaturase, iii) a ⁇ 5 desaturase, iv) optionally a ⁇ 5 elongase, and v) if the ⁇ 5 elongase is present, optionally a ⁇ 4 desaturase, wherein each polynucleotide is operably linked to one or more promoters that are capable of directing expression of said polynucleotides in the cell, b) expressing the exogenous polynucleotides in
  • the selected cell is a cell according to the invention.
  • the present invention further provides a method of obtaining a cell, preferably a plant cell and more preferably a plant seed cell, capable of synthesising one or more long chain polyunsaturated fatty acids (LC-PUFAs), the method comprising a) introducing into the cell, preferably a cell which is not capable of synthesising said LC-PUFA, exogenous polynucleotides encoding; i) a ⁇ 6 elongase and/or a ⁇ 9 elongase, ii) a ⁇ 6 desaturase and/or a ⁇ 8 desaturase, iii) a ⁇ 5 desaturase, iv) a ⁇ 5 elongase, v) a ⁇ 4 desaturase, and vi) optionally a diacylglycerol acyltransferase, wherein each polynucleotide is operably linked to one or more promoters that are capable of directing expression of
  • the efficiency of conversion of ALA to EPA, DPA or DHA is at least 17.3%, or at least 23%;
  • the efficiency of conversion of ALA to DPA or DHA is at least 15.4%, or at least 21%;
  • the efficiency of conversion of ALA to DHA is at least 9.5%, or at least 10.8%;
  • the efficiency of conversion of EPA to DHA is at least 45%, or at least 50%; and preferably further characterised in that at least 4% of the total fatty acid in the cell is DHA.
  • the present invention provides a method of obtaining a cell, preferably a plant cell and more preferably a plant seed cell, capable of synthesising one or more long chain polyunsaturated fatty acids (LC-PUFAs), the method comprising a) introducing into the cell, preferably a cell which is not capable of synthesising said LC-PUFA, exogenous polynucleotides encoding; i) a ⁇ 6 elongase and/or a ⁇ 9 elongase, ii) a ⁇ 6 desaturase and/or a ⁇ 8 desaturase, iii) a ⁇ 5 desaturase, iv) a ⁇ 5 elongase, and v) optionally a diacylglycerol acyltransferase wherein each polynucleotide is operably linked to one or more promoters that are capable of directing expression of said polynucleotides in
  • the exogenous polynucleotides become stably integrated into the genome of the cell.
  • the method further comprises the step of regenerating a transformed plant from the cell of step a).
  • the exogenous polynucleotide(s) are expressed transiently in the cell.
  • the cell is a leaf cell in a plant.
  • the present invention further provides a process for selecting a nucleic acid molecule involved in fatty acid desaturation comprising: i) obtaining a nucleic acid molecule operably linked to a promoter, the nucleic acid molecule encoding a polypeptide which may be a fatty acid desaturase; ii) introducing the nucleic acid molecule into a cell in which the promoter is active; iii) expressing the nucleic acid molecule in the cell; iv) analysing the fatty acid composition of the cell; and v) selecting the nucleic acid molecule involved in fatty acid desaturation on the basis that the polypeptide has ⁇ 3 desaturase activity and is capable of desaturating at least one of ARA to EPA, DGLA to ETA, GLA to SDA, both ARA to EPA and DGLA to ETA, both ARA to EPA and GLA to SDA, or all three of these.
  • the amino acid sequence of the polypeptide is at least 35% identical to SEQ ID NO: 15, at least 60% identical to SEQ ID NO: 17 and/or at least 60% identical to SEQ ID NO:20.
  • the present invention further provides a process for selecting a nucleic acid molecule involved in fatty acid elongation comprising: i) obtaining a nucleic acid molecule operably linked to a promoter, the nucleic acid molecule encoding a polypeptide which may be a fatty acid elongase, ii) introducing the nucleic acid molecule into a cell in which the promoter is active, iii) expressing the nucleic acid molecule in the cell; iv) analysing the fatty acid composition of the cell; and v) selecting the nucleic acid molecule involved in fatty acid elongation on the basis that the polypeptide has ⁇ 5 elongase activity and an efficiency of conversion on EPA to produce DPA which is at least 60%, at least 65%, at least 70% or at least 75%.
  • amino acid sequence of the polypeptide is at least 47% identical to SEQ ID NO:6.
  • the present invention further provides a process for selecting a nucleic acid molecule involved in fatty acid desaturation comprising: i) obtaining a nucleic acid molecule operably linked to a promoter, the nucleic acid molecule encoding a polypeptide which may be a fatty acid desaturase, ii) introducing the nucleic acid molecule into a cell in which the promoter is active, iii) expressing the nucleic acid molecule in the cell; iv) analysing the fatty acid composition of the cell; and v) selecting a nucleic acid molecule involved in fatty acid desaturation on the basis that the polypeptide has ⁇ 6 desaturase activity and at least two, preferably all three, of the following: a) greater ⁇ 6 desaturase activity on ALA than LA as fatty acid substrate, preferably in a plant cell, b) greater ⁇ 6 desaturase activity on ALA-CoA as fatty acid substrate than on ALA joined to the sn-2
  • the present invention further provides a process for selecting a nucleic acid molecule involved in fatty acid desaturation comprising: i) obtaining a nucleic acid molecule operably linked to a promoter, the nucleic acid molecule encoding a polypeptide which may be a fatty acid desaturase, ii) introducing the nucleic acid molecule into a cell in which the promoter is active, iii) expressing the nucleic acid molecule in the cell; iv) analysing the fatty acid composition of the cell; and v) selecting a nucleic acid molecule involved fatty acid desaturation on the basis that the polypeptide has both ⁇ 6 desaturase and ⁇ 8 desaturase activities.
  • amino acid sequence of the polypeptide is at least 67% identical to SEQ ID NO:8.
  • step (v) of the process of the invention comprises selecting a nucleic acid molecule encoding a desaturase active on acyl-CoA substrates or a front-end desaturase.
  • the present invention further provides a combination of exogenous polynucleotides as defined herein when used to produce a recombinant cell, express a combination of at least two fatty acid desaturases and two fatty acid elongases in a recombinant cell, and/or to produce LC-PUFA in a recombinant cell.
  • the present invention further provides a substantially purified and/or recombinant fatty acid ⁇ 5 elongase, wherein the elongase has activity on EPA to produce DPA with an efficiency of at least 60%, at least 65%, at least 70% or at least 75% when expressed from an exogenous polynucleotide in a cell.
  • the ⁇ 5 elongase of is characterised by any one or more of the properties as defined herein.
  • the present invention further provides a substantially purified and/or recombinant fatty acid ⁇ 3 desaturase which is capable of desaturating at least one of ARA to EPA, DGLA to ETA, GLA to SDA, both ARA to EPA and DGLA to ETA, both ARA to EPA and GLA to SDA, or all three of these when expressed from an exogenous polynucleotide in a cell.
  • the ⁇ 3 desaturase of the invention is characterised by any one or more of the properties as defined herein.
  • the present invention further provides a substantially purified and/or recombinant fatty acid ⁇ 6 desaturase, wherein the desaturase is further characterised by having at least two, preferably all three, of the following; i) greater ⁇ 6 desaturase activity on ALA than LA as fatty acid substrate, preferably in a plant cell, ii) greater ⁇ 6 desaturase activity on ALA-CoA as fatty acid substrate than on ALA joined to the sn-2 position of PC as fatty acid substrate, preferably in a plant cell, and iii) ⁇ 8 desaturase activity on ETrA, preferably in a plant cell.
  • the present invention further provides a substantially purified and/or recombinant fatty acid ⁇ 6 desaturase, wherein the desaturase has greater activity on an ⁇ 3 substrate than the corresponding ⁇ 6 substrate, and wherein the desaturase has activity on ALA to produce SDA with an efficiency of at least 5%, at least 7.5%, or at least 10% when the desaturase is expressed from an exogenous polynucleotide in a cell, or at least 35% when expressed in a yeast cell.
  • the ⁇ 6 desaturase of the invention is characterised by any one or more of the properties as defined herein.
  • the present invention further provides a substantially purified and/or recombinant fatty acid ⁇ 6 elongase and ⁇ 9 elongase, wherein the elongase has greater ⁇ 6 elongase activity than ⁇ 9 elongase activity.
  • the ⁇ 6 elongase and ⁇ 9 elongase of the invention is characterised by any one or more of the properties as defined herein.
  • the present invention further provides a substantially purified and/or recombinant fatty acid ⁇ 5 desaturase which comprises amino acids having a sequence as provided in SEQ ID NO: 13, a biologically active fragment thereof, or an amino acid sequence which is at least 53% identical to SEQ ID NO: 13.
  • the present invention further provides a substantially purified and/or recombinant fatty acid ⁇ 9 elongase which comprises amino acids having a sequence as provided in any one of SEQ ID NOs: 28, 94 and 96, a biologically active fragment thereof, an amino acid sequence which is at least 81% identical to SEQ ID NO:28, or an amino acid sequence which is at least 50% identical to SEQ ID NO: 94 and/or SEQ ID NO:96.
  • the ⁇ 9 elongase comprises amino acids having a sequence as provided in SEQ ID NO:94 or SEQ ID NO:96, a biologically active fragment thereof, or an amino acid sequence which is at least 50% identical to SEQ ID NO: 94 and/or SEQ ID NO:96, and wherein the elongase has greater activity on an ⁇ 6 substrate than the corresponding ⁇ 3 substrate.
  • the present invention provides a substantially purified and/or recombinant diacylglycerol acyltransferase which comprises amino acids having a sequence as provided in SEQ ID NO: 108, a biologically active fragment thereof, or an amino acid sequence which is at least 54% identical to SEQ ID NO: 108.
  • the desaturase or elongase according to the invention can purified from microalga.
  • Preferred microalgae are Pavlova spp, Pyramimonas spp and Micromonas spp.
  • the present invention further provides an isolated and/or exogenous polynucleotide comprising: i) a sequence of nucleotides selected from any one of SEQ ID NOs:3, 5, 7, 9, 11, 12, 14, 16, 18, 19, 27, 29, 93, 95, 107 or 125 to 129, ii) a sequence of nucleotides encoding a desaturase or an elongase according to the invention, iii) a sequence of nucleotides which are at least 50% identical to one or more of the sequences set forth in SEQ ID NOs: 3, 5, 7, 9, 11, 12, 14, 16, 18, 19, 27, 29, 93, 95, 107 or 125 to 129 and/or iv) a sequence which hybridises to any one of i) to iii) under stringent conditions.
  • the isolated and/or exogenous polynucleotide comprises a sequence of nucleotides which is at least 57% identical to SEQ ID NO: 3 and/or SEQ ID NO: 126, and encodes a ⁇ 6 elongase.
  • the isolated and/or exogenous polynucleotide comprises a sequence of nucleotides which is at least 50% identical to SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18 and/or SEQ ID NO: 19, and encodes a ⁇ 3 desaturase.
  • the isolated and/or exogenous polynucleotide comprises a sequence of nucleotides which is at least 50% identical to SEQ ID NO:5 and/or SEQ ID NO: 128, and encodes a ⁇ 5 elongase.
  • the isolated and/or exogenous polynucleotide comprises a sequence of nucleotides which is at least 75% identical to SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11 and/or SEQ ID NO: 125, and encodes a ⁇ 6 desaturase.
  • the isolated and/or exogenous polynucleotide comprises a sequence of nucleotides which is at least 60% identical to SEQ ID NO: 12, and encodes a ⁇ 5 desaturase. In another embodiment, the isolated and/or exogenous polynucleotide comprises a sequence of nucleotides which is at least 50% identical to SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:93 and/or SEQ ID NO:96, and encodes a ⁇ 9 elongase.
  • the isolated and/or exogenous polynucleotide comprises a sequence of nucleotides which is at least 60% identical to SEQ ID NO: 107, and encodes a diacylglycerol acyltransferase.
  • the isolated and/or exogenous polynucleotide is at least 80%, or at least 90%, or at least 95%, or at least 99% identical to one of the sequences set forth in SEQ ID NOs: 3, 5, 7, 9, 11, 12, 14, 16, 18, 19, 27, 29, 93, 95, 107 or 125 to 129.
  • the present invention further provides a DNA construct for integration, and/or integrated, into the genome of a plant cell, the construct comprising a cluster of at least three open reading frames encoding proteins which modulate fatty acid synthesis in the plant cell, preferably each protein being a fatty acid desaturase or a fatty acid elongase, wherein each open reading frame having the same transcription orientation is separated by at least 750bp, at least l,OOObp or at least 1,250bp, and at least two of the open reading frames have different transcription orientations, wherein each open reading frame is operably linked to a promoter which is active in the plant cell and each promoter may independently be the same or different.
  • At least two of the promoters are in the DNA construct are different.
  • One or more or each open reading frame is preferably operably linked to a heterologous 5' leader sequence, each of which may independently be the same or different, wherein each heterologous 5' leader sequence enhances translation efficiency relative to the naturally occurring 5' leader sequence for the particular open reading frame.
  • the heterologous 5 ' leader sequence is preferably a tobacco mosaic virus (TMV) 5 ' leader sequence.
  • TMV tobacco mosaic virus
  • the proteins preferably are elongases and/or desaturases, more preferably a combination as described herein.
  • the DNA construct according to the invention has only three or four open reading frames that are translated into proteins.
  • the present invention further provides a vector comprising the polynucleotide according to the invention and/or the DNA construct according to the invention.
  • the polynucleotide is operably linked to a promoter.
  • the present invention further provides a method of producing the desaturase or elongase according to the invention, the method comprising expressing in a cell or cell free expression system the polynucleotide of the invention, the DNA construct of the invention and/or the vector of the invention.
  • the present inventors have also surprisingly found that at least three independent extrachromosomal transfer nucleic acids comprising different exogenous polynucleotides can be transiently tranfected into a eukaryotic cell and the activity of each exogenous polynucleotide detected in the cell, in combination.
  • the present invention further provides a method of transiently transfecting a eukaryotic cell with at least three different exogenous polynucleotides, the method comprising i) obtaining at least a) a first bacterium comprising an extrachromosomal transfer nucleic acid comprising a first exogenous polynucleotide, b) a second bacterium comprising an extrachromosomal transfer nucleic acid comprising a second exogenous polynucleotide, and c) a third bacterium comprising an extrachromosomal transfer nucleic acid comprising a third exogenous polynucleotide, and ii) contacting the cell with the bacteria of step i), wherein each of the extrachromosomal transfer nucleic acids are transferred from the bacteria to the cell to produce the transiently transfected cell, wherein each of the exogenous polynucleotides comprises a promoter which is active in the cell, wherein each promoter may independently
  • Step ii) may be conducted sequentially or simultaneously with one or more of the bacteria.
  • the cell can be contacted with the first bacteria, then the second bacteria and so on.
  • the cell is contacted with each bacterium at the same time, preferably as a mixture of the bacteria.
  • concentrations of the different bacteria may be varied relative to each other or may be the same or similar.
  • the bacteria may be pooled isolates, for example comprising a number of isolates from a library of strains.
  • the method further comprises obtaining, and then contacting the cell with, one or more additional bacteria each comprising an extrachromosomal transfer nucleic acid comprising different exogenous polynucleotides.
  • the method comprises obtaining, and then contacting the cell with, a fourth bacterium comprising an extrachromosomal transfer nucleic acid comprising a fourth exogenous polynucleotide.
  • the method comprises obtaining, and then contacting the cell with, a fifth bacterium comprising an extrachromosomal transfer nucleic acid comprising a fifth exogenous polynucleotide.
  • the method comprises obtaining, and then contacting the cell with, a sixth bacterium comprising an extrachromosomal transfer nucleic acid comprising a sixth exogenous polynucleotide.
  • the method comprises obtaining, and then contacting the cell with, a seventh bacterium comprising an extrachromosomal transfer nucleic acid comprising a seventh exogenous polynucleotide.
  • the method comprises obtaining, and then contacting the cell with, an eighth bacterium comprising an extrachromosomal transfer nucleic acid comprising an eighth exogenous polynucleotide.
  • the different exogenous polynucleotides encode different RNA molecules and/or polypeptides.
  • each exogenous polynucleotide encodes an enzyme which forms part of an enzymatic pathway or is a candidate for such an enzyme.
  • each exogenous polynucleotide encodes an enzyme, or is a candidate for such an enzyme, involved in fatty acid synthesis, fatty acid modification, diacylglycerol assembly, triacylglycerol assembly, or a combination of two or more thereof.
  • one or more of the bacteria is in the form of a protoplast.
  • bacterium useful for the invention include, but are not limited to, Agrobacterium sp., Rhizobium sp., Sinorhizobium meliloti, Mezorhizobium loti, Shigella flexneri, Salmonella typhimurium, Salmonella choleraesuis, Listeria monocytogenes, Escherichia coli, Yersinia pseudotuberculosis and Yersinia enter ocolitica.
  • extrachromosomal transfer nucleic acids useful for the invention include, but are not limited to, are P-DNA, Agrobacterium sp. T-DNA, or a combination thereof.
  • the cell of the above aspect is a plant cell or a mammalian cell.
  • the cell is part of a tissue or organ.
  • the cell is a plant cell, and the tissue or organ is a leaf, stem, root, meristem, callus, or ovule.
  • the present inventors have also determined that when the promoters are seed- specific promoters the expression of the exogenous polynucleotides in leaf cells can be enhanced by co-expression of a seed specific transcription factor such as leafy cotyledon 2, fusca3 or abscisic acid-senstive3.
  • a seed specific transcription factor such as leafy cotyledon 2, fusca3 or abscisic acid-senstive3.
  • leafy cotyledon 2 proteins include, but are not limited to, those described in WO 01/70777.
  • the plant cell is a plant leaf cell
  • at least one of the promoters is a seed- specific promoter and at least one of the exogenous polynucleotides encodes a seed- specific transcription such as leafy cotyledon 2.
  • none of the exogenous polynucleotides are a viral gene.
  • one or more of the exogenous polynucleotides are only present in the extrachromosomal transfer nucleic acid as a single copy, not as a multimer or partial multimer of a defined nucleic acid sequence.
  • at least one of the extrachromosomal transfer nucleic acids does not comprise an origin of replication which is functional in the cell, preferably not a viral origin of replication and more preferably not the FBNYV origin of replication.
  • none of the exogenous polynucleotides encodes a viral replicase or a viral movement protein such as those described in WO 2007/137788 and by Marillonnet et al. (2005).
  • Also provided is a method of screening a transiently transfected cell for a desired activity comprising performing the method of transiently transfecting a eukaryotic cell with at least three exogenous polynucleotides of the invention, and testing the cell for the desired activity.
  • the present invention provides a method of transforming a eukaryotic cell with at least six different exogenous polynucleotides, the method comprising i) obtaining at least a) a first bacterium comprising a first extrachromosomal transfer nucleic acid which comprises three, four, five or six different exogenous polynucleotides, and b) a second bacterium comprising a second extrachromosomal transfer nucleic acid different to the first which comprises three, four, five or six different exogenous polynucleotides, ii) contacting the cell with the bacteria of step i), and iii) optionally selecting a cell stably transformed with the exogenous polynucleotides of the first and second extrachromosomal transfer nucleic acids, wherein each of the exogenous poly
  • Steps i)a) and i)b) may be conducted sequentially or simultaneously with the two bacteria.
  • the cell can be contacted with the first bacteria and then the second bacteria.
  • the cell contacted with the second bacterium may be a progeny cell or derived from the cell contacted with the first bacterium.
  • the cell is contacted with both of the bacteria at the same time.
  • the i) first extrachromosomal transfer nucleic acid has only three to six, only three to five, only three to four, only four to six, only four to five, or only five to six different exogenous polynucleotides
  • the second extrachromosomal transfer nucleic acid has only three to six, only three to five, only three to four, only four to six, only four to five, or only five to six different exogenous polynucleotides.
  • each of the exogenous polynucleotides encode polypeptides, and wherein each of the polypeptides are different.
  • the first extrachromosomal transfer nucleic acid comprises two exogenous polynucleotides independently encoding polypeptides selected from the group consisting of a ⁇ 6 desaturase, a ⁇ 12 desaturase and a ⁇ 15 desaturase
  • the second extrachromosomal transfer nucleic acid comprises an exogenous polynucleotide which encodes a polypeptide which is the third enzyme from the group.
  • the cell is a plant cell and the method further comprises the step of generating a transformed plant from the stably transformed cell.
  • the present invention provides a method of producing a stably transformed plant with at least six different exogenous polynucleotides, the method comprising i) obtaining a first stably transformed plant comprising a first exogenous genomic region comprising three, four, five or six different exogenous polynucleotides, ii) obtaining a second stably transformed plant of a sexually compatible species with the first and comprising a second exogenous genomic region different to the first comprising three, four, five or six different exogenous polynucleotides, iii) crossing the first stably transformed plant with the second stably transformed plant, and iv) selecting a plant produced from step iii) or a progeny thereof which comprises the first and second genomic regions thereby producing the stably transformed plant, wherein each of the exogenous polynucleotides comprises a promoter which is active in the plant, and wherein each promoter may independently be the same or different.
  • the exogenous polynucleotides of the first and/or second exogenous genomic regions are orientated and spaced as outlined above for the DNA construct of the invention.
  • any one promoter sequence may be present multiple times, or may be used only once within the first and second exogenous genomic regions, or one or more promoters may be used multiple times and one or more other promoters be used only once in the first and second exogenous genomic regions.
  • Each plant promoter may be, independently, preferentially active in a tissue or organ of the plant, such as in the leaf or seed, relative to other tissues or organs. This may allow for simultaneous expression, or overlapping expression, of all of the introduced protein coding regions, in the plant organ or tissue.
  • one or more promoters are constitutively expressed in the plant and one or more other promoters are preferentially expressed in the plant organ or tissue.
  • step i) comprises producing the first stably transformed plant by a) contacting a plant cell with a first bacterium comprising a first extrachromosomal transfer nucleic acid which comprises three, four, five or six different exogenous polynucleotides, b) generating a stably transformed plant from the plant cell of step a), and optionally c) producing a progeny plant from the stably transformed plant of step b); and/or step ii) comprises producing the second stably transformed plant by d) contacting a plant cell with a second bacterium comprising a second extrachromosomal transfer nucleic acid which comprises three, four, five or six different exogenous polynucleotides, e) generating a stably transformed plant from the plant cell of step d), and optionally f) producing a progeny plant from the stably transformed plant of step e).
  • the present invention provides a method of producing a stably transformed plant with at least six different exogenous polynucleotides, the method comprising i) obtaining a first stably transformed plant or plant part comprising a first exogenous genomic region comprising three, four, five or six different exogenous polynucleotides, ii) contacting a cell of the first stably transformed plant or plant part with a bacterium comprising an extrachromosomal transfer nucleic acid which comprises three, four, five or six different exogenous polynucleotides, iii) producing a plant from the cell, and iv) optionally, selecting a plant produced from step iii) which comprises the at least six different exogenous polynucleotides.
  • step of "contacting the cell with the bacteria of step i)" of the above aspects as the skilled addressee would be aware this is preformed for a suitable time and under suitable conditions for the extrachromosomal transfer nucleic acids to be transferred from the bacteria to the cell.
  • the present invention provides a eukaryotic cell comprising at least a) a first extrachromosomal transfer nucleic acid comprising a first exogenous polynucleotide, b) a second extrachromosomal transfer nucleic acid comprising a second exogenous polynucleotide, and c) a third extrachromosomal transfer nucleic acid comprising a third exogenous polynucleotide.
  • the cell further one or more additional bacteria each comprising an extrachromosomal transfer nucleic acid comprising different exogenous polynucleotides.
  • a plant, or progeny thereof, or seed comprising a first exogenous genomic region comprising three, four, five or six different exogenous polynucleotides, and a second exogenous genomic region comprising three, four, five or six different exogenous polynucleotides.
  • the exogenous polynucleotides of the exogenous genomic region(s) are preferably oriented and spaced as described above for the DNA construct.
  • the present invention further provides a transgenic non-human organism comprising a cell according to the invention.
  • each cell of the organism is a cell according to the invention.
  • the transgenic non-human organism is a transgenic plant, more preferably a transgenic oilseed plant to produce the oil as listed below.
  • the transgenic plant comprises at least one additional exogenous polynucleotide encoding a silencing suppressor operably linked to a plant storage organ specific promoter, wherein the plant is phenotypically normal.
  • the present invention further provides a seed comprising the cell according to the invention or obtained from the transgenic plant of the invention.
  • the present invention further provides oil produced by, or obtained from, the cell according to the invention, the transgenic non-human organism of the invention, or the seed of the invention.
  • the oil is obtained by extraction of oil from an oilseed.
  • the oil is canola oil (Brassica napus, Brassica rapa ssp.), mustard oil ⁇ Brassica juncea), other Brassica oil, sunflower oil (Helianthus annus), linseed oil (Linum usitatissimum), soybean oil ⁇ Glycine max), safflower oil (Carthamus tinctorius), corn oil (Zea mays), tobacco oil (Nicotiana tabacum), peanut oil (Arachis hypogaea), palm oil, cottonseed oil (Gossypium hirsutum), coconut oil (Cocos nucifera), avocado oil (Persea americana), olive oil (Olea europaea), cashew oil (Anacardium occidentale), macadamia oil (Macadamia inter grifolia), almond oil (Prunus amygdalus) or Arabidopsis seed oil (Arabidopsis thaliana).
  • canola oil Brassica napus,
  • the present invention further provides a fatty acid produced by, or obtained from, the cell according to the invention, the transgenic non-human organism of the invention, or the seed of the invention.
  • the present invention further provides a method of producing oil containing unsaturated fatty acids, the method comprising extracting oil from the cell according to the invention, the transgenic non-human organism of the invention, or the seed of the invention.
  • the present invention further provides a composition
  • a composition comprising a cell according to the invention, the desaturase or elongase according to the invention, a polynucleotide according to the invention, a DNA construct according to the invention, a vector of the invention, an oil according to the invention or a fatty acid of the invention.
  • the present invention further provides feedstuffs, cosmetics or chemicals comprising the cell according to the invention, the transgenic non-human organism according to the invention, the seed according to the invention, the oil according to the invention and/or the fatty acid of the invention.
  • the present invention further provides a method of performing a desaturase reaction, the method comprising contacting a polyunsaturated fatty acid esterified to CoA with the desaturase of the invention.
  • the present invention further provides a substantially purified antibody, or fragment thereof, that specifically binds a desaturase or elongase of the invention.
  • the present invention further provides a method of treating or preventing a condition which would benefit from a PUFA, the method comprising administering to a subject a cell according to the invention, the desaturase or elongase according to the invention, a polynucleotide according to the invention, a DNA construct according to the invention, a vector of the invention, a transgenic non-human organism according to the invention, a seed according to the invention, an oil according to the invention or a fatty acid of the invention and/or a feedstuff of the invnetion.
  • the condition is cardiac arrhythmia's, angioplasty, inflammation, asthma, psoriasis, osteoporosis, kidney stones, AIDS, multiple sclerosis, rheumatoid arthritis, Crohn's disease, schizophrenia, cancer, foetal alcohol syndrome, attention deficient hyperactivity disorder, cystic fibrosis, phenylketonuria, unipolar depression, aggressive hostility, adrenoleukodystophy, coronary heart disease, hypertension, diabetes, obesity, Alzheimer's disease, chronic obstructive pulmonary disease, ulcerative colitis, restenosis after angioplasty, eczema, high blood pressure, platelet aggregation, gastrointestinal bleeding, endometriosis, premenstrual syndrome, myalgic encephalomyelitis, chronic fatigue after viral infections or an ocular disease.
  • the present invention further provides use of a cell according to the invention, the desaturase or elongase according to the invention, a polynucleotide according to the invention, a DNA construct according to the invention, a vector of the invention, a transgenic non-human organism according to the invention, a seed according to the invention, an oil according to the invention or a fatty acid of the invention and/or a feedstuff of the invention for the manufacture of a medicament for treating or preventing a condition which would benefit from a PUFA.
  • silencing suppressors can preferentially be expressed in plant storage organs to enhance the levels of transgene expression in plant cells without significantly effecting plant development.
  • the present invention provides a plant cell comprising i) a first exogenous polynucleotide encoding a silencing suppressor, operably linked to a plant storage organ specific promoter, and ii) a second exogenous polynucleotide encoding an RNA molecule, operably linked to a promoter which directs gene transcription in the plant storage organ.
  • the plant storage organ specific promoter is a seed specific promoter such as a cotyledon specific promoter or an endosperm specific promoter.
  • the silencing suppressor is a viral suppressor protein such as, but not limited to, Pl, P19, V2, P38, P15, Pe-Po and RPV-PO.
  • the plant when the viral suppressor protein is constitutively expressed in a plant the plant is phenotypically abnormal, but when the silencing suppressor is expressed specifically in the storage organ, the plant is phenotypically normal.
  • examples of such viral suppressor proteins include, but are not limited to, Pl, Pl 9 and P15.
  • the viral suppressor protein reduces microRNA accumulation and/or microRNA guided cleavage.
  • the RNA molecule may be functional per se such as, but not limited to, an antisense polynucleotide, catalytic polynucleotide, dsRNA and/or microRNA.
  • the RNA molecule may encode a polypeptide with a desired function such as, but not limited to, an enzyme involved in fatty acid synthesis or modification, a seed storage protein such as for example, a cereal glutenin or gliadin, an enzyme involved in carbohydrate synthesis or modification, secondary metabolism or a pharmaceutical.
  • Examples of pharmaceutical proteins include, but are not limited to, antibodies as well as antibody-related molecules and fragments thereof, antigenic polypeptides which can, for example, provide immune protection against cancer, an infectious agent, a cytokine such as, for example, granulocyte-macrophage colony stimulating factor, interferon- ⁇ , human serum albumin, and erythropoietin.
  • a cytokine such as, for example, granulocyte-macrophage colony stimulating factor, interferon- ⁇ , human serum albumin, and erythropoietin.
  • the cell comprises at least one, at least two, at least three, at least four or at least five or more additional different exogenous polynucleotides, each encoding an RNA molecule and being operably linked to a promoter which directs gene transcription in the storage organ.
  • Each exogenous polynucleotide may be operably linbed to the same promoter, different promorters or a combination thereof.
  • exogenous polynucleotides are DNA.
  • the cell is in a plant storage organ such as a seed.
  • the RNA moleceule is present at an increased level relative to an isogenic cell lacking the first exogenous polynucleotide.
  • the level is increased at least 10%, at least 20%, and more preferably at least 30%.
  • At least one RNA molecule encoded by at least of the additional exogenous polynucleotides is present at an increased level relative to an isogenic cell lacking the first exogenous polynucleotide.
  • transgenic plant comprising a cell of the above aspect.
  • each cell of the plant is as defined in the above aspect.
  • the plant is phenotypically normal when compared to a plant lacking said cell.
  • a plant storage organ comprising a cell of the above aspect and/or obtained from the transgenic plant defined above.
  • the plant storage organ is a seed.
  • a method of obtaining a phenotypically normal plant having increased levels of an RNA molecule in its storage organ comprising a) introducing into a plant cell i) a first exogenous polynucleotide encoding a silencing suppressor operably linked to a plant storage organ specific promoter, and ii) a second exogenous polynucleotide encoding an RNA molecule operably linked to a promoter which directs gene transcription in the plant storage organ, b) regenerating a transformed plant from the cell of step a), c) growing the transformed plant until it produces storage organs, d) determining the level of the RNA molecule in the storage organ, and e) selecting a plant which is phenotypically normal, and wherein the RNA molecule is present at an increased level in the storage organ relative to a corresponding storage organ lacking the first exogenous polynucleotide.
  • a method of obtaining a phenotypically normal plant having stabilized expression of an RNA molecule in its storage organ comprising a) introducing into a plant cell i) a first exogenous polynucleotide encoding a silencing suppressor operably linked to a plant storage organ specific promoter, and ii) a second exogenous polynucleotide encoding an RNA molecule operably linked to a promoter which directs gene transcription in the plant storage organ, b) regenerating a transformed plant from the cell of step a), c) producing a third generation progeny plant which comprises the storage organ from the plant of step b), and d) selecting a third generation progeny plant wherein the RNA molecule is present in the storage organ at a level which is at least 90% of the level in a storage organ of a previous generation of the plant.
  • the exogenous polynucleotides of the above aspects are stably integrated into the genome of the cell.
  • the present invention provides a method of stabilising expression of an RNA molecule in a storage organ of a transgenic plant, comprising i) expressing a first exogenous polynucleotide encoding a silencing suppressor operably linked to a plant storage organ specific promoter, and ii) expressing a second exogenous polynucleotide encoding an RNA molecule operably linked to a promoter which directs gene transcription in the plant storage organ, wherein the transgenic plant is at least a third generation progeny plant obtained from a parental plant transformed with the exogenous polynucleotides, and wherein the RNA molecule is present in the storage organ of the plant at a level which is at least 90% of the level in a storage organ of a previous generation of the plant.
  • the plant is grown in the field.
  • FIG. 3 Multiple alignment between the Micromonas CS-0170 ⁇ 6-elongase and related genes.
  • AAV33630 C20-polyunsaturated fatty acid elongating enzyme [Pavlova sp. CCMP459]; AAY15135, elongase 1 [Pavlova salina]; ABR67690, C20 elongase [Pavlova viridis]; AAV67797, polyunsaturated fatty acid elongase 1 [Ostreococcus tauri]; CAL55414, polyunsaturated fatty acid elongase 2 (ISS) [Ostreococcus tauri]; XP 001419791, predicted protein [Ostreococcus lucimarinus CCE9901]; MicCS0170- d6E, Micromonas CS-0170 ⁇ 6-elongase (this work); AAV67800,
  • FJN-IO polyunsaturated fatty acid elongase 1 [Thalassiosira pseudonana]
  • AAW70157 delta-6-elongase [Phaeodactylum tricornutum]
  • ABC 18314 polyunsaturated fatty acid elongase 2 [Thraustochytrium sp. FJN-IO]
  • CAD58540 unnamed protein product [Isochrysis galbana].
  • FIG. 4 Multiple alignment between the Pyramimonas CS-0140 ⁇ 6-elongase and related genes.
  • AAL84174 polyunsaturated fatty acid specific elongation enzyme 1 [Physcomitrella patens]; AAT85662, polyunsaturated fatty acid elongase [Marchantia polymorpha];
  • AAV67797 polyunsaturated fatty acid elongase 1 [Ostreococcus tauri];
  • ABO94747 predicted protein [Ostreococcus lucimarinus CCE9901];
  • Pyrco-d6E Pyramimonas CS-0140 ⁇ 6-elongase (this work); ABC 18313, polyunsaturated fatty acid elongase 1 [Thraustochytrium sp.
  • FJN-IO FJN-IO
  • BAF97073 polyunsaturated fatty acid elongation enzyme [Mortierella alpina]
  • XP 001567488 long chain polyunsaturated fatty acid elongation enzyme-like protein [Leishmania braziliensis MHOM/BR/75/M2904]
  • BAE71129 delta5 -elongase [Marchantia polymorpha]
  • XP OO 1779105 predicted protein [Physcomitrella patens].
  • FIG. 5 Multiple alignment between the Pyramimonas CS-0140 ⁇ 5-elongase and related genes.
  • AAI52204 Elovl4 protein [Danio rerio]; CAG01780, unnamed protein product [Tetraodon nigroviridis];
  • AAV67800 polyunsaturated fatty acid elongase 2 [Thalassiosira pseudonana];
  • AAV33630 C20-polyunsaturated fatty acid elongating enzyme [Pavlova sp.
  • CCMP459 C20 elongase [Pavlova viridis]; AAY15135, elongase 1 [Pavlova salina]; AAV67798, polyunsaturated fatty acid elongase 2 [Ostreococcus tauri]; ABO98084, predicted protein [Ostreococcus lucimarinus CCE9901]; Pyrco-d5E, Pyramimonas CS-0140 ⁇ 5-elongase (this work).
  • FIG. 6 Multiple alignment between the Micromonas CCMP 1545 ⁇ 6-desaturase and related genes.
  • AAM09687 ⁇ 5-fatty acid desaturase [Thraustochytrium sp. ATCC21685]; AAV33631, ⁇ 4-desaturase [Isochrysis galbana]; AAW70159, ⁇ 6- desaturase [Ostreococcus tauri]; ABO99366, predicted protein [Ostreococcus lucimarinus CCE9901]; Mic-d6D, Micromonas CCMP 1545 ⁇ 6-desaturase (this work); ABF58685, ⁇ 5-desaturase [Perkinsus marinus]; ABL96295, ⁇ 5-desaturase [Pavlova salina].
  • FIG. 7 Multiple alignment between the Ostreococcus lucimarinus ⁇ 6-desaturase and related genes.
  • AAM09687 ⁇ 5-fatty acid desaturase [Thraustochytrium sp. ATCC21685]; AAR27297, ⁇ 6-desaturase [Amylomyces rouxii]; AAS93682, ⁇ 6-fatty acid desaturase [Rhizopus oryzae]; AAV33631, ⁇ 4-desaturase [Isochrysis galbana]; AAW70159, ⁇ 6-desaturase [Ostreococcus tauri]; Ostlu-d6D, Ostreococcus lucimarinus ⁇ 6-desaturase (this work); ABF58685, ⁇ 5-desaturase [Perkinsus marinus]; ABL96295, ⁇ 5-desaturase [Pavlova salina]; EDQ92231, predicted protein
  • FIG. 8 Multiple alignment between the Pyramimonas CS-0140 ⁇ 5-desaturase and related genes.
  • AAM09687 ⁇ 5-fatty acid desaturase [Thraustochytrium sp. ATCC21685]; Pyrco-d5D, Pyramimonas CS-0140 ⁇ 5-desaturase (this work);
  • AAW70159 ⁇ 6-desaturase [Ostreococcus tauri];
  • FIG. 9 Multiple alignment of the Ostreococcus tauri (Ot) (SEQ ID NO:30), Ostreococcus lucimarinus (01) (SEQ ID NO: 10) and Micromonas (M) CCMP 1545 ⁇ 6- desaturase protein sequences (SEQ ID NO: 8).
  • FIG. 11 GC results from T2 Arabidopsis seed transformed with the linP-micl545- d6D-linT construct. SDA and GLA levels are shown for individual events 1-19, with the ratio of ⁇ 3 to ⁇ 6 conversion efficiencies displayed above each column. The M. pusilla ⁇ 6-desaturase shows clear preference for the ⁇ 3 substrate.
  • FIG. 12 Conversion efficiencies of enzymes constituting the EPA pathways infiltrated into N. benthamiana.
  • the EPA pathways contain a ⁇ 6-desaturase (Echium plantagineum ⁇ 6-desaturase, Ostreococcus tauri ⁇ 6-desaturase or Micromonas pusilla ⁇ 6-desaturase), the Pyramimonas cordata ⁇ 6-elongase and the Pavlova salina ⁇ 5- desaturase.
  • Panel a. shows the ⁇ 3 pool conversion efficiencies for each pathway; b. contains direct comparisons between the E. plantagineum pathway, the M. pusilla pathway and a pathway containing both these desaturases; c. contains direct comparisons between the O. tauri pathway, the M. pusilla pathway and a pathway containing both acyl-CoA desaturases.
  • FIG. 14 Map of the binary vector pJPlOlacq showing the key features of the binary vector including the promoter orientations, TMV leader sequence locations, spacer region locations and unique cloning sites for gene insertions.
  • NosT NOS terminator
  • FPl truncated napin terminator
  • LininT Linin terminator.
  • Figure 15. Map of the binary vector pJP107.
  • Figure 16. Determination of the Agrobacterium concentration required to achieve near-maximal gene activity in the leaf-based assay. Isochrysis galbana ⁇ 9-elongase (7g ⁇ 9elo) activity in N. benthamiana after infiltration with varying culture densities of Agrobacterium AGLl containing the binary expression construct 7g ⁇ 9elo. Co- infiltrated P19 was set at a concentration of ODeoonm 0.4. The y-axis displays the sum of both /g ⁇ 9elo activities to produce EDA and ETrA.
  • Figure 17 Comparison of transgenic expression of LC-PUFA pathways using either transient or stable expression in leaves. Conversion efficiencies are based on total fatty acid profiles. a results extracted from (Qi et al., 2004); b results extracted from (Robert et al, 2005).
  • Panel a. is a gas chromatography (GC) trace of fatty acid methyl esters (FAME) produced from tuna oil which contains only a small amount of EPA but a large amount of DHA.
  • Panels b. and c. are GC traces of FAME derived from the TAG fraction of N. benthamiana leaf tissue transiently transformed with single-gene CaMV 35S binary constructs containing the Micromonas pusilla ⁇ 6-desaturase, Pyramimonas cordata ⁇ 6-elongase, Pavlova salina ⁇ 5-desaturase, P. cordata ⁇ 5-elongase (b.) or P.
  • FIG. 19 Map of the region of vector pJP3075 comprising transgenes.
  • Figure 20 Map of the region of vector pJP3059 comprising transgenes.
  • Figure 21 Map of the region of vector pJP3060 comprising transgenes.
  • Figure 22 Map of the region of vector pJP3115 comprising transgenes.
  • FIG. 23 Map of the region of vector pJP3116 comprising transgenes. KEY TO THE SEQUENCE LISTING
  • SEQ ID NO:1 Open reading frame encoding Micromonas CS-0170 ⁇ 6-elongase.
  • SEQ ID NO: 3 Open reading frame encoding Pyramimonas C S-0140 ⁇ 6-elongase/ ⁇ 9- elongase.
  • SEQ ID NO:5 Open reading frame encoding Pyramimonas CS-0140 ⁇ 5-elongase.
  • SEQ ID NO:7 Open reading frame encoding Micromonas CCMP1545 ⁇ 6- desaturase/ ⁇ 8 -desaturase .
  • SEQ ID NO:8 Micromonas CCMP1545 ⁇ 6-desaturase/ ⁇ 8-desaturase.
  • SEQ ID NO:9 Open reading frame encoding Ostreococcus lucimarinus ⁇ 6- desaturase.
  • SEQ ID NO:11 Codon-optimized open reading frame for expression of Ostreococcus lucimarinus ⁇ 6-desaturase in plants.
  • SEQ ID NO: 12 Open reading frame encoding Pyramimonas CS-0140 ⁇ 5 -desaturase.
  • SEQ ID NO: 14 Partial open reading frame encoding Micromonas CS-0170 ⁇ 3- desaturase.
  • RCC299 co3 -desaturase in plants.
  • SEQ ID NO:20 Micromonas CCMP1545 ⁇ 3 -desaturase.
  • SEQ ID NO:21 Open reading frame encoding Isochrysis galbana ⁇ 9-elongase.
  • SEQ ID NO:23 Open reading frame encoding Pavlova salina ⁇ 8-desaturase.
  • SEQ ID NO:25 Open reading frame encoding Pavlova salina ⁇ 5 -desaturase.
  • SEQ ID NO:28 - Emiliania huxleyi CCMPl 516 ⁇ 9 elongase.
  • SEQ ID NO:29 Codon-optimized open reading frame for expression of Emiliania huxleyi ⁇ 9 elongase in plants.
  • SEQ ID NO:32 Elongase consensus domain 2.
  • SEQ ID NO:36 Elongase consensus domain 6.
  • SEQ ID NO:37 Desaturase consensus domain 1.
  • SEQ ID NO:38 Desaturase consensus domain 2.
  • SEQ ID NO:40 Desaturase consensus domain 4.
  • SEQ ID NO:72 Open reading frame encoding Pavlova salina ⁇ 4-desaturase.
  • SEQ ID NO:74 Open reading frame encoding Arabidopsis thaliana diacylglycerol acyltransferase 1.
  • SEQ ID NO: 75 Arabidopsis thaliana diacylglycerol acyltransferase 1.
  • SEQ ID NO: 76 Elongase consensus domain 7.
  • SEQ ID NO: 102 Open reading frame encoding P19 viral suppressor.
  • SEQ ID NO: 104 Open reading frame encoding P38 viral suppressor.
  • SEQ ID NO: 105 Open reading frame encoding Pe-PO viral suppressor.
  • SEQ ID NO: 106 Open reading frame encoding RPV-PO viral suppressor.
  • SEQ ID NO: 107 Codon optimized open reading frame encoding Micromonas
  • SEQ ID NO: 108 Micromonas CCMP1545 diacylglycerol acyltransferase 2.
  • CCMP 1545 ⁇ 6 desaturase/ ⁇ 8desaturase in plants.
  • SEQ ID NO: 127 Codon-optimized open reading frame for expression of Pavlova salina ⁇ 5 desaturase in plants.
  • SEQ ID NO: 129 Codon-optimized open reading frame for expression of Pavlova salina ⁇ 4 desaturase in plants.
  • fatty acid refers to a carboxylic acid (or organic acid), often with a long aliphatic tail, either saturated or unsaturated.
  • fatty acids typically have a carbon-carbon bonded chain of at least 8 carbon atoms in length, more preferably at least 12 carbons in length.
  • Most naturally occurring fatty acids have an even number of carbon atoms because their biosynthesis involves acetate which has two carbon atoms.
  • the fatty acids may be in a free state (non-esterified) or in an esterified form such as part of a triglyceride, diacylglyceride, monoacylglyceride, acyl- CoA (thio-ester) bound or other bound form.
  • the fatty acid may be esterified as a phospholipid such as a phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidylglycerol forms.
  • a phospholipid such as a phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidylglycerol forms.
  • saturated fatty acids do not contain any double bonds or other functional groups along the chain.
  • saturated refers to hydrogen, in that all carbons (apart from the carboxylic acid [-COOH] group) contain as many hydrogens as possible.
  • the omega ( ⁇ ) end contains 3 hydrogens (CH3-) and each carbon within the chain contains 2 hydrogens (-CH2-).
  • the term “monounsaturated fatty acid” refers to a fatty acid which comprises at least 12 carbon atoms in its carbon chain and only one alkene group (carbon-carbon double bond) in the chain.
  • the terms “polyunsaturated fatty acid” or “PUFA” refer to a fatty acid which comprises at least 12 carbon atoms in its carbon chain and at least two alkene groups (carbon-carbon double bonds).
  • long-chain polyunsaturated fatty acid and "LC- PUFA” refer to a fatty acid which comprises at least 20 carbon atoms in its carbon chain and at least two carbon-carbon double bonds, and hence include VLC-PUFAs.
  • very long-chain polyunsaturated fatty acid and “VLC- PUFA” refer to a fatty acid which comprises at least 22 carbon atoms in its carbon chain and at least three carbon-carbon double bonds.
  • the number of carbon atoms in the carbon chain of the fatty acids refers to an unbranched carbon chain. If the carbon chain is branched, the number of carbon atoms excludes those in sidegroups.
  • the long-chain polyunsaturated fatty acid is an ⁇ 3 fatty acid, that is, having a desaturation (carbon-carbon double bond) in the third carbon-carbon bond from the methyl end of the fatty acid.
  • the long-chain polyunsaturated fatty acid is an ⁇ 6 fatty acid, that is, having a desaturation (carbon- carbon double bond) in the sixth carbon-carbon bond from the methyl end of the fatty acid.
  • the long-chain polyunsaturated fatty acid is selected from the group consisting of; arachidonic acid (ARA, 20:4 ⁇ 5,8,l l,14; ⁇ 6), eicosatetraenoic acid (ETA, 20:4 ⁇ 8, 11,14,17, ⁇ 3) eicosapentaenoic acid (EPA, 20:5 ⁇ 5,8,l 1,14,17; co3), docosapentaenoic acid (DPA, 22:5 ⁇ 7,10,13, 16,19, co3), or docosahexaenoic acid (DHA, 22:6 ⁇ 4,7,10,13, 16,19, ⁇ 3).
  • ARA arachidonic acid
  • ETA eicosatetraenoic acid
  • EPA eicosapentaenoic acid
  • DPA docosapentaenoic acid
  • DHA docosahexaenoic acid
  • the LC-PUFA may also be dihomo- ⁇ -linoleic acid (DGLA) or eicosatrienoic acid (ETrA, 2O:3 ⁇ 11,14,17, co3). It would readily be apparent that the LC-PUFA that is produced according to the invention may be a mixture of any or all of the above and may include other LC-PUFA or derivatives of any of these LC-PUFA.
  • the ⁇ 3 fatty acid is EPA, DPA, and/or DHA, preferably, EPA and/or DPA, or preferably DPA and/or DHA.
  • long-chain polyunsaturated fatty acid and “very long-chain polyunsaturated fatty acid” refer to the fatty acid being in a free state (non-esterif ⁇ ed) or in an esterified form such as part of a triglyceride, diacylglyceride, monoacylglyceride, acyl-CoA bound or other bound form.
  • the fatty acid may be esterified as a phospholipid such as a phosphatidylcholine (PC), phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidylglycerol forms.
  • PC phosphatidylcholine
  • phosphatidylethanolamine phosphatidylethanolamine
  • phosphatidylserine phosphatidylglycerol
  • the LC-PUFA may be present as a mixture of forms in the lipid of a cell or a purified oil or lipid extracted from cells, tissues or organisms.
  • the invention provides oil comprising at least 75% or 85% triacylglycerols, with the remainder present as other forms of lipid such as those mentioned, with at least said triacylglycerols comprising the LC-PUFA.
  • the oil may be further purified or treated, for example by hydrolysis with a strong base to release the free fatty acid, or by fractionation, distillation or the like.
  • the desaturase, elongase and acyl transferease proteins and genes encoding them that may be used in the invention are any of those known in the art or homologues or derivatives thereof. Examples of such genes and encoded protein sizes are listed in Table 1.
  • the desaturase enzymes that have been shown to participate in LC-PUFA biosynthesis all belong to the group of so-called "front-end” desaturases. Table 1. Cloned enes involved in LC-PUFA biosnthesis
  • front-end desaturase refers to a member of a class of enzymes that introduce a double bond between the carboxyl group and a pre-existing unsaturated part of the acyl chain of lipids, which are characterized structurally by the presence of an N-terminal cytochrome b5 domain, along with a typical fatty acid desaturase domain that includes three highly conserved histidine boxes (Napier et al., 1997).
  • Activity of any of the elongases or desaturases for use in the invention may be tested by expressing a gene encoding the enzyme in a cell such as, for example, a yeast cell or a plant cell, and determining whether the cell has an increased capacity to produce LC-PUFA compared to a comparable cell in which the enzyme is not expressed.
  • the desaturase and/or elongase for use in the invention can purified from a microalga.
  • the term "desaturase” refers to an enzyme which is capable of introducing a carbon-carbon double bond into the acyl group of a fatty acid substrate which is typically in an esterified form such as, for example, fatty acid CoA esters.
  • the acyl group may be esterified to a phospholipid such as phosphatidylcholine (PC), or to acyl carrier protein (ACP), or in a preferred embodiment to CoA.
  • PC phosphatidylcholine
  • ACP acyl carrier protein
  • Desaturases generally may be categorized into three groups accordingly. In one embodiment, the desaturase is a front-end desaturase.
  • a " ⁇ 4 desaturase” refers to a protein which performs a desaturase reaction that introduces a carbon-carbon double bond at the 4 th position from the carboxyl end of a fatty acid substrate.
  • the " ⁇ 4 desaturase” is at least capable of converting DPA to DHA.
  • the desaturation step to produce DHA from DPA is catalysed by a ⁇ 4 desaturase in organisms other than mammals, and a gene encoding this enzyme has been isolated from the freshwater protist species Euglena gracilis and the marine species Thraustochytrium sp. (Qiu et al., 2001; Meyer et al., 2003).
  • the ⁇ 4 desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 73, a biologically active fragment thereof, or an amino acid sequence which is at least 80% identical to SEQ ID NO:73.
  • a " ⁇ 5 desaturase” refers to a protein which performs a desaturase reaction that introduces a carbon-carbon double bond at the 5 th position from the carboxyl end of a fatty acid substrate. Examples of ⁇ 5 desaturases are listed in Table 1.
  • the ⁇ 5 desaturase comprises amino acids having a sequence as provided in SEQ ID NO:26, a biologically active fragment thereof, or an amino acid sequence which is at least 80% identical to SEQ ID NO:26.
  • the ⁇ 5 desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 13, a biologically active fragment thereof, or an amino acid sequence which is at least 53% identical to SEQ ID NO: 13.
  • ⁇ 6 desaturase refers to a protein which performs a desaturase reaction that introduces a carbon-carbon double bond at the 6 th position from the carboxyl end of a fatty acid substrate. Examples of ⁇ 6 desaturases are listed in Table 1.
  • the ⁇ 6 desaturase is further characterised by having at least two, preferably all three and preferably in a plant cell, of the following: i) greater ⁇ 6 desaturase activity on ⁇ -linolenic acid (ALA, 18:3 ⁇ 9,12,15, ⁇ 3) than linoleic acid (LA, 18:2 ⁇ 9,12, ⁇ 6) as fatty acid substrate; ii) greater ⁇ 6 desaturase activity on ALA-CoA as fatty acid substrate than on ALA joined to the sn-2 position of PC as fatty acid substrate; and iii) ⁇ 8 desaturase activity on ETrA.
  • the ⁇ 6 desaturase has greater activity on an ⁇ 3 substrate than the corresponding ⁇ 6 substrate and has activity on ALA to produce octadecatetraenoic acid (stearidonic acid, SDA, 18:4 ⁇ 6,9,12, 15, ⁇ 3) with an efficiency of at least 5%, more preferably at least 7.5%, or most preferably at least 10% when expressed from an exogenous polynucleotide in a recombinant cell, or at least 35% when expressed in a yeast cell.
  • the ⁇ 6 desaturase has greater activity, for example, at least about a 2-fold greater ⁇ 6 desaturase activity, on ALA than LA as fatty acid substrate.
  • the ⁇ 6 desaturase has greater activity, for example, at least about 5 fold greater ⁇ 6 desaturase activity or at least 10- fold greater activity, on ALA-CoA as fatty acid substrate than on ALA joined to the sn- 2 position of PC as fatty acid substrate.
  • the ⁇ 6 desaturase has no detectable ⁇ 5 desaturase activity on ETA.
  • the ⁇ 6 desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 10, a biologically active fragment thereof, or an amino acid sequence which is at least 77% identical to SEQ ID NO: 10.
  • the ⁇ 6 desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 8, a biologically active fragment thereof, or an amino acid sequence which is at least 67% identical to SEQ ID NO:8.
  • the ⁇ 6 desaturase may also have ⁇ 8 desaturase activity.
  • a " ⁇ 8 desaturase” refers to a protein which performs a desaturase reaction that introduces a carbon-carbon double bond at the 8 th position from the carboxyl end of a fatty acid substrate.
  • the ⁇ 8 desaturase is at least capable of converting ETrA to ETA. Examples of ⁇ 8 desaturases are listed in Table 1.
  • the ⁇ 8 desaturase comprises amino acids having a sequence as provided in SEQ ID NO:24, a biologically active fragment thereof, or an amino acid sequence which is at least 80% identical to SEQ ID NO:24.
  • an " ⁇ 3 desaturase” refers to a protein which performs a desaturase reaction that introduces a carbon-carbon double bond at the 3rd position from the methyl end of a fatty acid substrate.
  • Examples of ⁇ 3 desaturases include those described by Pereira et al. (2004a), Horiguchi et al. (1998), Berberich et al. (1998) and Spychalla et al. (1997).
  • the ⁇ 3 desaturase is at least capable of converting one of ARA to EPA, dGLA to ETA, ⁇ -linolenic acid (GLA, 18:3 ⁇ 6,9,12, ⁇ 6) to SDA, both ARA to EPA and dGLA to ETA, both ARA to EPA and GLA to SDA, or all three of these.
  • the ⁇ 3 desaturase has ⁇ 17 desaturase activity on a C20 fatty acid which has at least three carbon-carbon double bonds, preferably ARA. In another embodiment, the ⁇ 3 desaturase has ⁇ 15 desaturase activity on a Cl 8 fatty acid which has three carbon-carbon double bonds, preferably GLA.
  • ⁇ 15 desaturase refers to a protein which performs a desaturase reaction that introduces a carbon-carbon double bond at the 15 th position from the carboxyl end of a fatty acid substrate.
  • ⁇ 17 desaturase refers to a protein which performs a desaturase reaction that introduces a carbon-carbon double bond at the 17 th position from the carboxyl end of a fatty acid substrate.
  • the ⁇ 3 desaturase has greater activity on an acyl-CoA substrate, for example, ARA-CoA, than a corresponding acyl-PC substrate.
  • a "corresponding acyl-PC substrate” refers to the fatty acid esterified at the sn-2 position of phosphatidylcholine (PC) where the fatty acid is the same fatty acid as in the acyl-CoA substrate.
  • the activity is at least two-fold greater.
  • the ⁇ 3 desaturase comprises amino acids having a sequence as provided in SEQ ID NO: 15, 17 or 20, a biologically active fragment thereof, or an amino acid sequence which is at least 35% identical to SEQ ID NO: 15, at least 60% identical to SEQ ID NO: 17 and/or at least 60% identical to SEQ ID NO:20.
  • a desaturase for use in the present invention has greater activity on an acyl-CoA substrate than a corresponding acyl-PC substrate.
  • a "corresponding acyl-PC substrate” refers to the fatty acid esterif ⁇ ed at the sn-2 position of phosphatidylcholine (PC) where the fatty acid is the same fatty acid as in the acyl-CoA substrate.
  • the activity is at least two-fold greater.
  • the desaturase is a ⁇ 5 or ⁇ 6 desaturase, examples of which are provided, but not limited to, those listed in Table 2.
  • an "elongase” refers to the polypeptide that catalyses the condensing step in the presence of the other members of the elongation complex, under suitable physiological conditions. It has been shown that heterologous or homologous expression in a cell of only the condensing component ("elongase") of the elongation protein complex is required for the elongation of the respective acyl chain. Thus, the introduced elongase is able to successfully recruit the reduction and dehydration activities from the transgenic host to carry out successful acyl elongations.
  • the specificity of the elongation reaction with respect to chain length and the degree of desaturation of fatty acid substrates is thought to reside in the condensing component. This component is also thought to be rate limiting in the elongation reaction.
  • a " ⁇ 5 elongase” is at least capable of converting EPA to DPA.
  • ⁇ 5 elongases include those disclosed in WO2005/103253.
  • the ⁇ 5 elongase has activity on EPA to produce DPA with an efficiency of at least 60%, more preferably at least 65%, more preferably at least 70% or most preferably at least 75%.
  • the ⁇ 5 elongase comprises an amino acid sequence as provided in SEQ ID NO:6, a biologically active fragment thereof, or an amino acid sequence which is at least 47% identical to SEQ ID NO: 6
  • a " ⁇ 6 elongase” is at least capable of converting SDA to ETA.
  • Examples of ⁇ 6 elongases include those listed in Table 1.
  • the elongase comprises amino acids having a sequence as provided in SEQ ID NO:4, a biologically active fragment thereof, or an amino acid sequence which is at least 55% identical to SEQ ID NO:4.
  • a " ⁇ 9 elongase” is at least capable of converting ALA to ETrA.
  • ⁇ 9 elongases include those listed in Table 1.
  • the ⁇ 9 elongase comprises amino acids having a sequence as provided in SEQ ID NO:22, a biologically active fragment thereof, or an amino acid sequence which is at least 80% identical to SEQ ID NO:22.
  • the ⁇ 9 elongase comprises amino acids having a sequence as provided in SEQ ID NO:28, a biologically active fragment thereof, or an amino acid sequence which is at least 81% identical to SEQ ID NO:28.
  • the ⁇ 9 elongase comprises amino acids having a sequence as provided in SEQ ID NO:94, a biologically active fragment thereof, or an amino acid sequence which is at least 50% identical to SEQ ID NO: 94. In another embodiment, the ⁇ 9 elongase comprises amino acids having a sequence as provided in SEQ ID NO:96, a biologically active fragment thereof, or an amino acid sequence which is at least 50% identical to SEQ ID NO: 96.
  • the ⁇ 9 elongase comprises amino acids having a sequence as provided in SEQ ID NO:94 or SEQ ID NO:96, a biologically active fragment thereof, or an amino acid sequence which is at least 50% identical to SEQ ID NO:94 and/or SEQ ID NO:96, and wherein the elongase has greater activity on an ⁇ 6 substrate than the corresponding ⁇ 3 substrate.
  • the term "has greater activity on an ⁇ 6 substrate than the corresponding ⁇ 3 substrate” refers to the relative activity on the enzyme on substrates that differ by the action of an ⁇ 3 desaturase.
  • the ⁇ 6 substrate is LA and the ⁇ 3 substrate is ALA.
  • an "elongase with ⁇ 6 elongase and ⁇ 9 elongase activity” is at least capable of (i) converting SDA to ETA and (ii) converting ALA to ETrA and has greater ⁇ 6 elongase activity than ⁇ 9 elongase activity.
  • the elongase has an efficiency of conversion on SDA to produce ETA which is at least 50%, more preferably at least 60%, and/or an efficiency of conversion on ALA to produce ETrA which is at least 6% or more preferably at least 9%.
  • the elongase has at least about 6.5 fold greater ⁇ 6 elongase activity than ⁇ 9 elongase activity.
  • the elongase has no detectable ⁇ 5 elongase activity.
  • the elongase comprises amino acids having a sequence as provided in SEQ ID NO:4, a biologically active fragment thereof, or an amino acid sequence which is at least 55% identical to SEQ ID NO:4.
  • DGAT diacylglycerol acyltransferase
  • DGAT activity refers to the transfer of acyl-CoA to diacylglycerol to produce triacylglycerol.
  • DGATl polypeptides typically have 10 transmembrane domains, DGAT2 typically have 2 transmembrane domains, whilst DGAT3 is typically soluble.
  • Examples of DGATl polypeptides include polypeptides encoded by DGATl genes from Aspergillus fumigatus (Accession No.
  • DGAT2 polypeptides include polypeptides encoded by DGAT2 genes from Arabidopsis thaliana (Accession No.
  • DGAT3 polypeptides include polypeptides encoded by DGAT3 genes from peanut (Arachis hypogaea, Saha, et al., 2006), as well as variants and/or mutants thereof.
  • the invention also provides for polypeptides which may be purified or recombinant.
  • substantially purified polypeptide or “purified polypeptide” we mean a polypeptide that has generally been separated from the lipids, nucleic acids, other peptides, and other contaminating molecules with which it is associated in a cell in which it is produced or in its native state.
  • the substantially purified polypeptide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components in the cell in which it is produced or with which it is naturally associated.
  • recombinant in the context of a polypeptide refers to the polypeptide when produced by a cell, or in a cell-free expression system, in an altered amount or at an altered rate, compared to its native state if it is produced naturally.
  • the cell is a cell that does not naturally produce the polypeptide.
  • the cell may be a cell which comprises a non-endogenous gene that causes an altered amount of the polypeptide to be produced.
  • a recombinant polypeptide of the invention includes polypeptides in the cell, tissue, organ or organism, or cell-free expression system, in which it is produced i.e. a polypeptide which has not been purified or separated from other components of the transgenic (recombinant) cell in which it was produced, and polypeptides produced in such cells or cell-free systems which are subsequently purified away from at least some other components.
  • polypeptide and “protein” are generally used interchangeably.
  • a polypeptide or class of polypeptides may be defined by the extent of identity (% identity) of its amino acid sequence to a reference amino acid sequence, or by having a greater % identity to one reference amino acid sequence than to another.
  • the query sequence is at least 15 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 15 amino acids. More preferably, the query sequence is at least 50 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 50 amino acids.
  • the query sequence is at least 100 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 100 amino acids. Even more preferably, the query sequence is at least 250 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. Even more preferably, the GAP analysis aligns two sequences over their entire length.
  • the polypeptide or class of polypeptides may have the same enzymatic activity as, or a different activity than, or lack the activity of, the reference polypeptide. Preferably, the polypeptide has an enzymatic activity of at least 10% of the activity of the reference polypeptide.
  • a "biologically active" fragment is a portion of a polypeptide of the invention which maintains a defined activity of a full-length reference polypeptide, for example possessing desaturase and/or elongase activity or other enzyme activity.
  • Biologically active fragments as used herein exclude the full-length polypeptide.
  • Biologically active fragments can be any size portion as long as they maintain the defined activity.
  • the biologically active fragment maintains at least 10% of the activity of the full length protein.
  • the polypeptide/enzyme comprises an amino acid sequence which is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 76%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at
  • the substantially purified and/or recombinant ⁇ 6 desturase of the invention does not comprise a sequence provided in accession no. EEH58637.1 or XP OO 1421073.1.
  • the substantially purified and/or recombinant ⁇ 3 desturase of the invention does not comprise a sequence provided in accession no. XP 002505536.1.
  • the substantially purified and/or recombinant DGAT of the invention does not comprise a sequence provided in accession no. EEH54819.1.
  • Amino acid sequence mutants of the polypeptides of the defined herein can be prepared by introducing appropriate nucleotide changes into a nucleic acid defined herein, or by in vitro synthesis of the desired polypeptide.
  • Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence.
  • a combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final peptide product possesses the desired characteristics.
  • Mutant (altered) peptides can be prepared using any technique known in the art.
  • a polynucleotide of the invention can be subjected to in vitro mutagenesis.
  • in vitro mutagenesis techniques include sub-cloning the polynucleotide into a suitable vector, transforming the vector into a "mutator" strain such as the E. coli XL-I red (Stratagene) and propagating the transformed bacteria for a suitable number of generations.
  • the polynucleotides of the invention are subjected to DNA shuffling techniques as broadly described by Harayama (1998). Products derived from mutated/altered DNA can readily be screened using techniques described herein to determine if they possess desaturase and/or elongase activity.
  • the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified.
  • the sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.
  • Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.
  • Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place.
  • the sites of greatest interest for substitutional mutagenesis include sites identified as the active site(s).
  • Other sites of interest are those in which particular residues obtained from various strains or species are identical. These positions may be important for biological activity. These sites, especially those falling within a sequence of at least three other identically conserved sites, are preferably substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 3 under the heading of "exemplary substitutions".
  • a mutant/variant polypeptide has only, or not more than, one or two or three or four conservative amino acid changes when compared to a naturally occurring polypeptide. Details of conservative amino acid changes are provided in Table 3. As the skilled person would be aware, such minor changes can reasonably be predicted not to alter the activity of the polypeptide when expressed in a recombinant cell. Table 3. Exem lar substitutions.
  • polypeptides defined herein which are differentially modified during or after synthesis, for example, by biotinylation, benzylation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. These modifications may serve to increase the stability and/or bioactivity of the polypeptide of the invention.
  • Polypeptides can be produced in a variety of ways, including production and recovery of natural polypeptides, production and recovery of recombinant polypeptides, and chemical synthesis of the polypeptides.
  • a recombinant polypeptide is produced by culturing a cell capable of expressing the polypeptide under conditions effective to produce the polypeptide.
  • the recombinant polypeptide may subsequently be secreted from the cell and recovered, or extracted from the cell and recovered, and is preferably purified away from contaminating molecules. It may or may not be further modified chemically or enzymatically.
  • a preferred cell to culture is a recombinant cell defined herein.
  • Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit polypeptide production.
  • An effective medium refers to any medium in which a cell is cultured to produce a polypeptide defined herein.
  • Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins.
  • Cells defined herein can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.
  • a more preferred cell to produce the polypeptide is a cell in a plant, especially in a seed in a plant.
  • antibody includes fragments of whole antibodies which retain their binding activity for a target analyte, as well as compounds comprising said fragments. Such fragments include Fv, F(ab') and F(ab')2 fragments, as well as single chain antibodies (scFv). Antibodies of the invention may be monoclonal or polyclonal and can be produced using standard procedures in the art.
  • polynucleotides which may be, for example, a gene, an isolated polynucleotide, or a chimeric DNA. It may be DNA or RNA of genomic or synthetic origin, double-stranded or single-stranded, and combined with carbohydrate, lipids, protein or other materials to perform a particular activity defined herein.
  • polynucleotide is used interchangeably herein with the term “nucleic acid molecule”.
  • isolated polynucleotide we mean a polynucleotide which, if obtained from a natural source, has been separated from the polynucleotide sequences with which it is associated or linked in its native state, or a non-naturally occurring polynucleotide.
  • the isolated polynucleotide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated.
  • the term "gene” is to be taken in its broadest context and includes the deoxyribonucleotide sequences comprising the transcribed region and, if translated, the protein coding region, of a structural gene and including sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of at least about 2 kb on either end and which are involved in expression of the gene.
  • the gene includes control signals such as promoters, enhancers, termination and/or polyadenylation signals that are naturally associated with a given gene, or heterologous control signals in which case the gene is referred to as a "chimeric gene".
  • sequences which are located 5 ' of the protein coding region and which are present on the mRNA are referred to as 5' non-translated sequences.
  • sequences which are located 3 ' or downstream of the protein coding region and which are present on the mRNA are referred to as 3' non-translated sequences.
  • the term "gene” encompasses both cDNA and genomic forms of a gene.
  • a genomic form or clone of a gene contains the coding region which may be interrupted with non-coding sequences termed "introns" or "intervening regions” or “intervening sequences.”
  • Introns are segments of a gene which are transcribed into nuclear RNA (hnRNA). Introns may contain regulatory elements such as enhancers.
  • Introns are removed or "spliced out” from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript.
  • the mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
  • the term "gene” includes a synthetic or fusion molecule encoding all or part of the proteins of the invention described herein and a complementary nucleotide sequence to any one of the above.
  • a "chimeric DNA” refers to any DNA molecule that is not a native DNA molecule in its native location, also referred to herein as a "DNA construct".
  • a chimeric DNA or chimeric gene comprises regulatory and transcribed or protein coding sequences that are not found together in nature.
  • a chimeric DNA or chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
  • endogenous is used herein to refer to a substance that is normally present or produced in an unmodified plant at the same developmental stage as the plant under investigation.
  • An “endogenous gene” refers to a native gene in its natural location in the genome of an organism.
  • recombinant nucleic acid molecule refers to a nucleic acid molecule which has been constructed or modified by recombinant DNA technology.
  • foreign polynucleotide or “exogenous polynucleotide” or “heterologous polynucleotide” and the like refer to any nucleic acid which is introduced into the genome of a cell by experimental manipulations.
  • Foreign or exogenous genes may be genes that are inserted into a non-native organism, native genes introduced into a new location within the native host, or chimeric genes.
  • a "trans gene” is a gene that has been introduced into the genome by a transformation procedure.
  • the terms “genetically modified”, “transgenic” and variations thereof include introducing genes into cells by transformation or transduction, mutating genes in cells and altering or modulating the regulation of a gene in a cell or organisms to which these acts have been done or their progeny.
  • a “genomic region” as used herein refers to a position within the genome where a transgene, or group of transgenes (also referred to herein as a cluster), have been inserted into a cell, or an ancestor thereof. Such regions only comprise nucleotides that have been incorporated by the intervention of man such as by methods described herein.
  • exogenous in the context of a polynucleotide refers to the polynucleotide when present in a cell in an altered amount compared to its native state.
  • the cell is a cell that does not naturally comprise the polynucleotide.
  • the cell may be a cell which comprises a non-endogenous polynucleotide resulting in an altered amount of production of the encoded polypeptide.
  • An exogenous polynucleotide of the invention includes polynucleotides which have not been separated from other components of the transgenic (recombinant) cell, or cell-free expression system, in which it is present, and polynucleotides produced in such cells or cell-free systems which are subsequently purified away from at least some other components.
  • the exogenous polynucleotide (nucleic acid) can be a contiguous stretch of nucleotides existing in nature, or comprise two or more contiguous stretches of nucleotides from different sources (naturally occurring and/or synthetic) joined to form a single polynucleotide.
  • chimeric polynucleotides comprise at least an open reading frame encoding a polypeptide of the invention operably linked to a promoter suitable of driving transcription of the open reading frame in a cell of interest.
  • the term "different exogenous polynucleotides" or variations thereof means that the nucleotide sequence of each polynucleotide are different by at least one, preferably more, nucleotides.
  • the polynucleotides encode RNAs which may or may not be translated to a protein within the cell. In an example, it is preferred that each polynucleotide encodes a protein with a different activity. In another example, each exogenous polynucleotide is less than 95%, less than 90%, or less than 80% identical to the other exogenous polynuclotides. Preferably, the exogenous polynucleotides encode functional proteins/enzymes.
  • each polynucleotide is a distinct region of the, for example, extrachromosomal transfer nucleic acid which does not overlap with another exogenous polynucleotide.
  • each exogenous polnucleotide has a transcription start and stop site, as well as the designated promoter.
  • An individual exogenous polynucloeotide may or may not comprise introns.
  • the polynucleotide comprises a polynucleotide sequence which is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.
  • the isolated and/or exogenous polynucleotide encoding a ⁇ 6 desturase of the invention does not comprise the sequence from the Micromonas or Ostreococcus genome predicted to encode the amino acid sequence provided in accession no. EEH58637.1 or XP OO 1421073.1 respectively.
  • the isolated and/or exogenous polynucleotide encoding a ⁇ 3 desturase of the invention does not comprise the sequence from the Micromonas genome predicted to encode the amino acid sequence provided in accession no. XP 002505536.1.
  • the isolated and/or exogenous polynucleotide encoding a DGAT of the invention does not comprise the sequence from the Micromonas genome predicted to encode the amino acid sequence provided in accession no. EEH54819.1.
  • a polynucleotide of the present invention may selectively hybridise, under stringent conditions, to a polynucleotide that encodes a polypeptide of the present invention.
  • stringent conditions are those that (1) employ during hybridisation a denaturing agent such as formamide, for example, 50% (v/v) formamide with 0.1% (w/v) bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C; or (2) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 niM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x S
  • Polynucleotides of the invention may possess, when compared to naturally occurring molecules, one or more mutations which are deletions, insertions, or substitutions of nucleotide residues.
  • Polynucleotides which have mutations relative to a reference sequence can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis or DNA shuffling on the nucleic acid as described above). It is thus apparent that polynucleotides of the invention can be either from a naturally occurring source or recombinant.
  • One embodiment of the present invention includes a recombinant vector, which comprises at least one polynucleotide molecule defined herein, inserted into any vector capable of delivering the polynucleotide molecule into a host cell.
  • Recombinant vectors include expression vectors.
  • Recombinant vectors contain heterologous polynucleotide sequences, that is polynucleotide sequences that are not naturally found adjacent to polynucleotide molecules defined herein that preferably are derived from a species other than the species from which the polynucleotide molecule(s) are derived.
  • the vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a viral vector, derived from a virus, or a plasmid.
  • Plasmid vectors typically include additional nucleic acid sequences that provide for easy selection, amplification, and transformation of the expression cassette in prokaryotic cells, e.g., pUC-derived vectors, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, pBS- derived vectors, or binary vectors containing one or more T-DNA regions.
  • Additional nucleic acid sequences include origins of replication to provide for autonomous replication of the vector, selectable marker genes, preferably encoding antibiotic or herbicide resistance, unique multiple cloning sites providing for multiple sites to insert nucleic acid sequences or genes encoded in the nucleic acid construct, and sequences that enhance transformation of prokaryotic and eukaryotic (especially plant) cells.
  • the recombinant vector may comprise more than one polynucleotide defined herein, for example three, four, five or six polynucleotides of the invention in combination, each operably linked to expression control sequences that are operable in the cell of interest.
  • Such more than one polynucleotide of the invention are preferably covalently joined together in a single recombinant vector, which may then be introduced as a single molecule into a cell to form a recombinant cell according to the invention, and preferably integrated into the genome of the recombinant cell, for example in a transgenic plant.
  • the polynucleotides which are so joined will be inherited together as a single genetic locus in progeny of the recombinant cell or plant.
  • the recombinant vector or plant may comprise two or more such recombinant vectors, each containing multiple polynucleotides, for example wherein each recombinant vector comprises 3, 4, 5 or 6 polynucleotides.
  • operably linked refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of transcriptional regulatory element (promoter) to a transcribed sequence.
  • a promoter is operably linked to a coding sequence, such as a polynucleotide defined herein, if it stimulates or modulates the transcription of the coding sequence in an appropriate cell.
  • promoter transcriptional regulatory elements that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are c ⁇ -acting.
  • some transcriptional regulatory elements, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
  • each promoter may independently be the same or different.
  • Recombinant molecules such as the chimeric DNAs may also contain (a) one or more secretory signals which encode signal peptide sequences, to enable an expressed polypeptide defined herein to be secreted from the cell that produces the polypeptide or which provide for localisation of the expressed polypeptide, for example for retention of the polypeptide in the endoplasmic reticulum (ER) in the cell or transfer into a plastid, and/or (b) contain fusion sequences which lead to the expression of nucleic acid molecules as fusion proteins.
  • suitable signal segments include any signal segment capable of directing the secretion or localisation of a polypeptide defined herein.
  • Preferred signal segments include, but are not limited to, Nicotiana nectarin signal peptide (US 5,939,288), tobacco extensin signal or the soy oleosin oil body binding protein signal.
  • Recombinant molecules may also include intervening and/or untranslated sequences surrounding and/or within the nucleic acid sequences of nucleic acid molecules defined herein.
  • the nucleic acid construct desirably comprises a selectable or screenable marker gene as, or in addition to, the foreign or exogenous polynucleotide.
  • marker gene is meant a gene that imparts a distinct phenotype to cells expressing the marker gene and thus allows such transformed cells to be distinguished from cells that do not have the marker.
  • a selectable marker gene confers a trait for which one can "select” based on resistance to a selective agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment damaging to untransformed cells).
  • a screenable marker gene confers a trait that one can identify through observation or testing, i.e., by "screening” (e.g., ⁇ -glucuronidase, luciferase, GFP or other enzyme activity not present in untransformed cells).
  • the marker gene and the nucleotide sequence of interest do not have to be linked.
  • the actual choice of a marker is not crucial as long as it is functional (i.e., selective) in combination with the cells of choice such as a plant cell.
  • the marker gene and the foreign or exogenous polynucleotide of interest do not have to be linked, since co-transformation of unlinked genes as, for example, described in US 4,399,216 is also an efficient process in plant transformation.
  • bacterial selectable markers are markers that confer antibiotic resistance such as ampicillin, erythromycin, chloramphenicol or tetracycline resistance, preferably kanamycin resistance.
  • exemplary selectable markers for selection of plant transformants include, but are not limited to, a hyg gene which encodes hygromycin B resistance; a neomycin phosphotransferase (nptll) gene conferring resistance to kanamycin, paromomycin, G418; a glutathione-S-transferase gene from rat liver conferring resistance to glutathione derived herbicides as, for example, described in EP 256223; a glutamine synthetase gene conferring, upon overexpression, resistance to glutamine synthetase inhibitors such as phosphinothricin as, for example, described in WO 87/05327, an acetyltransferase gene from Streptomyces viridochromo genes conferring resistance to the selective agent
  • a bar gene conferring resistance against bialaphos as, for example, described in WO91/02071; a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker et al., 1988); a dihydrofolate reductase (DHFR) gene conferring resistance to methotrexate (Thillet et al., 1988); a mutant acetolactate synthase gene (ALS), which confers resistance to imidazolinone, sulfonylurea or other ALS-inhibiting chemicals (EP 154,204); a mutated anthranilate synthase gene that confers resistance to 5 -methyl tryptophan; or a dalapon dehalogenase gene that confers resistance to the herbicide.
  • a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (
  • Preferred screenable markers include, but are not limited to, a uidA gene encoding a ⁇ -glucuronidase (GUS) enzyme for which various chromogenic substrates are known, a ⁇ -galactosidase gene encoding an enzyme for which chromogenic substrates are known, an aequorin gene (Prasher et al., 1985), which may be employed in calcium-sensitive bioluminescence detection; a green fluorescent protein gene (Niedz et al., 1995) or derivatives thereof; a luciferase (luc) gene (Ow et al., 1986), which allows for bioluminescence detection, and others known in the art.
  • reporter molecule as used in the present specification is meant a molecule that, by its chemical nature, provides an analytically identifiable signal that facilitates determination of promoter activity by reference to protein product.
  • the nucleic acid construct is stably incorporated into the genome of the cell, such as the plant cell.
  • the nucleic acid may comprise appropriate elements which allow the molecule to be incorporated into the genome, or the construct is placed in an appropriate vector which can be incorporated into a chromosome of the cell.
  • an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of one or more specified polynucleotide molecule(s).
  • the expression vector is also capable of replicating within the host cell.
  • Expression vectors can be either prokaryotic or eukaryotic, and are typically viruses or plasmids.
  • Expression vectors of the present invention include any vectors that function (i.e., direct gene expression) in recombinant cells of the present invention, including in bacterial, fungal, endoparasite, arthropod, animal, and plant cells. Particularly preferred expression vectors of the present invention can direct gene expression in yeast and/or plant cells.
  • Expression vectors of the present invention contain regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of polynucleotide molecules of the present invention.
  • polynucleotides or vectors of the present invention include transcription control sequences.
  • Transcription control sequences are sequences which control the initiation, elongation, and termination of transcription.
  • Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences.
  • Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention.
  • the choice of the regulatory sequences used depends on the target organism such as a plant and/or target organ or tissue of interest. Such regulatory sequences may be obtained from any eukaryotic organism such as plants or plant viruses, or may be chemically synthesized. A variety of such transcription control sequences are known to those skilled in the art. Particularly preferred transcription control sequences are promoters active in directing transcription in plants, either constitutively or stage and/or tissue specific, depending on the use of the plant or parts thereof.
  • plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5 ' and 3 ' regulatory sequences and a dominant selectable marker.
  • Such plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally- regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
  • a promoter regulatory region e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally- regulated, or cell- or tissue-specific expression
  • Suitable promoters for constitutive expression in plants include, but are not limited to, the cauliflower mosaic virus (CaMV) 35S promoter, the Figwort mosaic virus (FMV) 35 S, the sugarcane bacilliform virus promoter, the commelina yellow mottle virus promoter, the light-inducible promoter from the small subunit of the ribulose-1,5-bis-phosphate carboxylase, the rice cytosolic triosephosphate isomerase promoter, the adenine phosphoribosyltransferase promoter of Arabidopsis, the rice actin 1 gene promoter, the mannopine synthase and octopine synthase promoters, the Adh promoter, the sucrose synthase promoter, the R gene complex promoter, and the chlorophyll ⁇ / ⁇ binding protein gene promoter. These promoters have been used to create DNA vectors that have been expressed in plants; see,
  • promoters utilized in the present invention have relatively high expression in these specific tissues.
  • promoters for genes with tissue- or cell-specific or -enhanced expression. Examples of such promoters reported in the literature include the chloroplast glutamine synthetase GS2 promoter from pea, the chloroplast fructose- 1,6- biphosphatase promoter from wheat, the nuclear photosynthetic ST-LS 1 promoter from potato, the serine/threonine kinase promoter and the glucoamylase (CHS) promoter from Arabidopsis thaliana.
  • chloroplast glutamine synthetase GS2 promoter from pea the chloroplast fructose- 1,6- biphosphatase promoter from wheat, the nuclear photosynthetic ST-LS 1 promoter from potato, the serine/threonine kinase promoter and the glucoamylase (CHS) promoter from Arabidopsis thaliana.
  • CHS glucoamy
  • ribulose-1,5-bisphosphate carboxylase promoter from eastern larch (Larix laricina), the promoter for the Cab gene, Cab6, from pine, the promoter for the Cab-1 gene from wheat, the promoter for the Cab-1 gene from spinach, the promoter for the Cab IR gene from rice, the pyruvate, orthophosphate dikinase (PPDK) promoter from Zea mays, the promoter for the tobacco Lhcbl*2 gene, the Arabidopsis thaliana Suc2 sucrose-H 30 symporter promoter, and the promoter for the thylakoid membrane protein genes from spinach (PsaD, PsaF, PsaE, PC, FNR, AtpC, AtpD, Cab, RbcS).
  • PPDK orthophosphate dikinase
  • promoters for the chlorophyll ⁇ / ⁇ -binding proteins may also be utilized in the present invention, such as the promoters for LhcB gene and PsbP gene from white mustard (Sinapis alba).
  • plant storage organ specific promoter refers to a promoter that preferentially, when compared to other plant tissues, directs gene transcription in a storage organ of a plant.
  • the promoter only directs expression of a gene of interest in the storage organ, and/or expression of the gene of interest in other parts of the plant such as leaves is not detectable by Northern blot analysis and/or RT-PCR.
  • the promoter drives expression of genes during growth and development of the storage organ, in particular during the phase of synthesis and accumulation of storage compounds in the storage organ.
  • Such promoters may drive gene expression in the entire plant storage organ or only part thereof such as the seedcoat, embryo or cotyledon(s) in seeds of dicotyledonous plants or the endosperm or aleurone layer of a seeds of monocotyledonous plants.
  • sink tissues of the plant such as the tuber of the potato plant, the fruit of tomato, or the seed of soybean, canola, cotton, Zea mays, wheat, rice, and barley, it is preferred that the promoters utilized in the present invention have relatively high expression in these specific tissues.
  • a number of promoters for genes with tuber-specific or -enhanced expression are known, including the class I patatin promoter, the promoter for the potato tuber ADPGPP genes, both the large and small subunits, the sucrose synthase promoter, the promoter for the major tuber proteins including the 22 kD protein complexes and proteinase inhibitors, the promoter for the granule bound starch synthase gene (GBSS), and other class I and II patatins promoters.
  • Other promoters can also be used to express a protein in specific tissues, such as seeds or fruits.
  • the promoter for ⁇ -conglycinin or other seed-specific promoters such as the napin, zein, linin and phaseolin promoters, can be used. Root specific promoters may also be used. An example of such a promoter is the promoter for the acid chitinase gene. Expression in root tissue could also be accomplished by utilizing the root specific subdomains of the CaMV 35 S promoter that have been identified.
  • the promoter directs expression in tissues and organs in which fatty acid and oil biosynthesis take place. Such promoters act in seed development at a suitable time for modifying oil composition in seeds.
  • the promoter is a plant storage organ specific promoter.
  • the plant storage organ specific promoter is a seed specific promoter.
  • the promoter preferentially directs expression in the cotyledons of a dicotyledonous plant or in the endosperm of a monocotyledonous plant, relative to expression in the embryo of the seed or relative to other organs in the plant such as leaves.
  • Preferred promoters for seed-specific expression include i) promoters from genes encoding enzymes involved in fatty acid biosynthesis and accumulation in seeds, such as desaturases and elongases, ii) promoters from genes encoding seed storage proteins, and iii) promoters from genes encoding enzymes involved in carbohydrate biosynthesis and accumulation in seeds.
  • Seed specific promoters which are suitable are the oilseed rape napin gene promoter (US 5,608,152), the Vicia faba USP promoter (Baumlein et al., 1991), the Arabidopsis oleosin promoter (WO 98/45461), the Phaseolus vulgaris phaseolin promoter (US 5,504,200), the Brassica Bce4 promoter (WO 91/13980) or the legumin B4 promoter (Baumlein et al., 1992), and promoters which lead to the seed-specific expression in monocots such as maize, barley, wheat, rye, rice and the like.
  • promoters which are suitable are the barley Ipt2 or lptl gene promoter (WO 95/15389 and WO 95/23230) or the promoters described in WO 99/16890 (promoters from the barley hordein gene, the rice glutelin gene, the rice oryzin gene, the rice prolamin gene, the wheat gliadin gene, the wheat glutelin gene, the maize zein gene, the oat glutelin gene, the sorghum kasirin gene, the rye secalin gene).
  • Other promoters include those described by Broun et al. (1998), Potenza et al. (2004), US 20070192902 and US 20030159173.
  • the seed specific promoter is preferentially expressed in defined parts of the seed such as the cotyledon(s) or the endosperm.
  • cotyledon specific promoters include, but are not limited to, the FPl promoter (Ellerstrom et al., 1996), the pea legumin promoter (Perrin et al., 2000), and the bean phytohemagglutnin promoter (Perrin et al., 2000).
  • endosperm specific promoters include, but are not limited to, the maize zein-1 promoter (Chikwamba et al., 2003), the rice glutelin-1 promoter (Yang et al., 2003), the barley D-hordein promoter (Horvath et al., 2000) and wheat HMW glutenin promoters (Alvarez et al., 2000).
  • the seed specific promoter is not expressed, or is only expressed at a low level, in the embryo and/or after the seed germinates.
  • the plant storage organ specific promoter is a tuber specific promoter.
  • tuber specific promoter examples include, but are not limited to, the potato patatin B33, PAT21 and GBSS, promoters, as well as the sweet potato sporamin promoter (for review see Potenza et al., 2004).
  • the promoter directs expression preferentially in the pith of the tuber, relative to the outer layers (skin, bark) or the embryo of the tuber.
  • the plant storage organ specific promoter is a fruit specific promoter.
  • fruit specific promoter examples include, but are not limited to, the tomato polygalacturonase, E8 and Pds promoters, as well as the apple ACC oxidase promoter (for review see Potenza et al., 2004).
  • the promoter preferentially directs expression in the edible parts of the fruit, for example the pith of the fruit, relative to the skin of the fruit or the seeds within the fruit.
  • the 5' non-translated leader sequence can be derived from the promoter selected to express the heterologous gene sequence of the polynucleotide of the present invention, or may be heterologous with respect to the coding region of the enzyme to be produced, and can be specifically modified if desired so as to increase translation of mRNA.
  • the 5' non-translated regions can also be obtained from plant viral RNAs (Tobacco mosaic virus, Tobacco etch virus, Maize dwarf mosaic virus, Alfalfa mosaic virus, among others) from suitable eukaryotic genes, plant genes (wheat and maize chlorophyll a/b binding protein gene leader), or from a synthetic gene sequence.
  • the present invention is not limited to constructs wherein the non-translated region is derived from the 5' non-translated sequence that accompanies the promoter sequence.
  • the leader sequence could also be derived from an unrelated promoter or coding sequence.
  • Leader sequences useful in context of the present invention comprise the maize Hsp70 leader (US 5,362,865 and US 5,859,347), and the TMV omega element as exemplified in Example 8.
  • the termination of transcription is accomplished by a 3' non-translated DNA sequence operably linked in the chimeric vector to the polynucleotide of interest.
  • the 3' non-translated region of a recombinant DNA molecule contains a polyadenylation signal that functions in plants to cause the addition of adenylate nucleotides to the 3' end of the RNA.
  • the 3' non-translated region can be obtained from various genes that are expressed in plant cells.
  • the nopaline synthase 3' untranslated region, the 3' untranslated region from pea small subunit Rubisco gene, the 3' untranslated region from soybean 7S seed storage protein gene are commonly used in this capacity.
  • the 3' transcribed, non-translated regions containing the polyadenylate signal of Agrobacterium tumor-inducing (Ti) plasmid genes are also suitable.
  • Recombinant DNA technologies can be used to improve expression of a transformed polynucleotide molecule by manipulating, for example, the number of copies of the polynucleotide molecule within a host cell, the efficiency with which those polynucleotide molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications.
  • Recombinant techniques useful for increasing the expression of polynucleotide molecules defined herein include, but are not limited to, operatively linking polynucleotide molecules to high-copy number plasmids, integration of the polynucleotide molecule into one or more host cell chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals (e.g., promoters, operators, enhancers), substitutions or modifications of translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modification of polynucleotide molecules to correspond to the codon usage of the host cell, and the deletion of sequences that destabilize transcripts.
  • transcription control signals e.g., promoters, operators, enhancers
  • translational control signals e.g., ribosome binding sites, Shine-Dalgarno sequences
  • Transfer nucleic acids of the invention at least comprise one, preferably two, border sequences and an exogenous polynucleotide.
  • the transfer nucleic acid may or may not encode a selectable marker.
  • the transfer nucleic acid forms part of a binary vector in the bacterium, where the binary vector further comprises elements which allows replication of the vector in the bacterium or allows selection or maintenance of bacterial cells containing the vector.
  • the transfer nucleic acid component of the binary vector is capable of integration into the genome of the eukaryotic cell.
  • extrachromosomal transfer nucleic acid refers to a nucleic acid molecule that is capable of being transferred from a bacterium, such as Agrobacterium sp., to a eukaryotic cell, such as a plant leaf cell.
  • An extrachromosomal transfer nucleic acid is a genetic element that is well-known as an element capable of being transferred with the subsequent integration of a nucleotide sequence contained within its borders into the genome of the recipient cell.
  • a transfer nucleic acid is flanked, typically, by two "border” sequences, although in some instances a single border at one end can be used and the second end of the transferred nucleic acid is generated randomly in the transfer process.
  • a desired exogenous polynucleotide is typically positioned between the left border-like sequence and the right border-like sequence of a transfer nucleic acid.
  • the desired polynucleotide contained within the transfer nucleic acid may be operably linked to a variety of different promoter and terminator regulatory elements that facilitate its expression, i.e., transcription and/or translation of the polynucleotide.
  • T-DNAs from Agrobacterium sp. such as Agrobacterium tumefaciens or Agrobacterium rhizogenes, and man made variants/mutants thereof are probably the best characterized examples of transfer nucleic acids.
  • P-DNA plant-DNA
  • T-DNA border-like sequences from plants is another example.
  • T-DNA refers to, for example, T-DNA of an Agrobacterium tumefaciens Ti plasmid or from an Agrobacterium rhizogenes Ri plasmid, or a man made variants thereof which function as T-DNA (trans ferred-DNA).
  • the T-DNA may comprise an entire T-DNA including both right and left border sequences, but need only comprise the minimal sequences required in cis for transfer i.e., the right and T- DNA border sequence.
  • the T-DNAs of the invention have inserted into them, anywhere between the right and left border sequences (if present), the exogenous polynucleotide flanked by target sites for a site-specific recombinase.
  • sequences encoding factors required in trans for transfer of the T-DNA into a plant cell may be inserted into the T-DNA, or may be present on the same replicon as the T-DNA, or preferably are in trans on a compatible replicon in the Agrobacterium host.
  • Such "binary vector systems" are well known in the art.
  • P-DNA refers to a transfer nucleic acid isolated from a plant genome, or a man made variants/mutants thereof, and comprises at each end, or at only one end, a T-DNA border-like sequence.
  • the border-like sequence preferably shares at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90% or at least 95%, but less than 100% sequence identity, with a T-DNA border sequence from an Agrobacterium sp., such as Agrobacterium tumefaciens or Agrobacterium rhizogenes.
  • P-DNAs can be used instead of T-DNAs to transfer a nucleotide sequence contained within the P-DNA from, for example Agrobacterium, to another cell.
  • the P- DNA before insertion of the exogenous polynucleotide which is to be transferred, may be modified to facilitate cloning and should preferably not encode any proteins.
  • the P- DNA is characterized in that it contains, at least a right border sequence and preferably also a left border sequence.
  • a "border" sequence(s) of a transfer nucleic acid can be isolated from selected organism such as a plant or bacteria, or be a man made variant/mutant thereof.
  • the border sequence promotes and facilitates the transfer of the exogenous polynucleotide to which it is linked and may facilitate its integration in the recipient cell genome.
  • a border-sequence is between 5-100 bp in length, 10-80 bp in length, 15-75 bp in length, 15-60 bp in length, 15-50 bp in length, 15-40 bp in length, 15-30 bp in length, 16-30 bp in length, 20-30 bp in length, 21-30 bp in length, 22-30 bp in length, 23-30 bp in length, 24-30 bp in length, 25-30 bp in length, or 26-30 bp in length.
  • Border sequences from T-DNA from Agrobacterium sp. are well known in the art and include those described in Lacroix et al. (2008), Tzfira and Citovsky (2006) and Glevin (2003).
  • the border sequences of P-DNA can be isolated from any plant, such as from potato and wheat.
  • the P-DNA has the nucleic acid sequence ANGATNTATN6GT (SEQ ID NO: 109), where "N" is any nucleotide, such as those represented by "A,” “G,” “C,” or "T”.
  • border sequences useful for the invention include, but are not limited to, TGACAGGATATATTGGCGGGTAAAC (SEQ ID NO: 110); TGGCAGGATATATTGTGGTGTAAAC (SEQ ID NO: 111); TGGCAGGATATATACCGTTGTAATT (SEQ ID NO: 112); CGGCAGGATATATTCAATTGTAATT (SEQ ID NO: 113); TGGTAGGATATATACCGTTGTAATT (SEQ ID NO: 114); TGGCAGGATATATGGTACTGTAATT (SEQ ID NO: 115); YGRYAGGATATATWSNVBKGTAAWY (SEQ ID NO:116); CGGCAGGATATATCCTGATGTAAAT (SEQ ID NO: 117); TGGCAGGAGTTATTCGAGGGTAAAC (SEQ ID NO: 118); TGACAGGATATATCGTGATGTCAAC (SEQ ID NO: 119); GGGAAGTACATATTGGCGGGTAAAC (SEQ ID NO: 120);
  • Agrobacterium sp. Whilst traditionally only Agrobacterium sp. have been used transfer genes to plants cells, there are now a large number of systems which have been identified/developed which act in a similar manner to Agrobacterium sp.
  • Several non- Agrobacterium species have recently been genetically modified to be competent for gene transfer (Chung et al., 2006; Broothaerts et al., 2005). These include Rhizobium sp. NGR234, Sinorhizobium meliloti and Mezorhizobium loti.
  • the bacteria are made competent for gene transfer by providing the bacteria with the machinery needed for the transformation process: i.e.
  • Bacteria engineered in this way are capable of transforming different plant tissues (leaf disks, calli and oval tissue), monocots or dicots, and various different plant species (eg. tobacco, rice).
  • Attenuated Shigella flexneri Salmonella typhimurium or E. coli that had been rendered invasive by the virulence plasmid (p WRl 00) of S. flexneri have been shown to be able to transfer expression plasmids after invasion of host cells and intracellular death due to metabolic attenuation. Mucosal application, either nasally or orally, of such recombinant Shigella or Salmonella induced immune responses against the antigen that was encoded by the expression plasmids. In the meantime, the list of bacteria that was shown to be able to transfer expression plasmids to mammalian host cells in vitro and in vivo has been more then doubled and has been documented for S. typhi, S.
  • the transfer process using extrachromosomal transfer elements typically transfers multiple copies of the element into the recipient cell.
  • the term "transiently transfected" means that although some of the exogenous polynucleotides may become stably integrated into the genome of the cell, the cells are not selected for stable integration. As a result, much of the transfer nucleic acid remains extrachromosomal in the cell, for example greater than 90% of the copies of the exogenous polynucleotide that are transferred into the recipient cell are not integrated into the genome.
  • Transfection As used herein, the terms “transfection”, “transformation” and variations thereof are generally used interchangeably. “Transfected” or “transformed” cells may have been manipulated to introduce the exogenous polynucleotide(s), or may be progeny cells derived therefrom.
  • the invention also provides a recombinant cell, preferably a recombinant plant cell, which is a host cell transformed with one or more recombinant molecules, such as the polynucleotides, chimeric DNAs or recombinant vectors defined herein.
  • the recombinant cell may comprise any combination thereof, such as two or three recombinant vectors, or a recombinant vector and one or more additional polynucleotides or chimeric DNAs.
  • Suitable cells of the invention include any cell that can be transformed with a polynucleotide, chimeric DNA or recombinant vector of the invention, such as for example, a molecule encoding a polypeptide or enzyme described herein.
  • the cell is preferably a cell which is thereby capable of being used for producing LC-PUFA.
  • the recombinant cell may be a cell in culture, a cell in vitro, or in an organism such as for example a plant, or in an organ such as for example a seed or a leaf.
  • the cell is in a plant, more preferably in the seed of a plant.
  • Host cells into which the polynucleotide(s) are introduced can be either untransformed cells or cells that are already transformed with at least one nucleic acid molecule. Such nucleic acid molecules may be related to LC-PUFA synthesis, or unrelated.
  • Host cells of the present invention either can be endogenously (i.e., naturally) capable of producing proteins defined herein, in which case the recombinant cell derived therefrom has an enhanced capability of producing the polypeptides, or can be capable of producing such proteins only after being transformed with at least one polynucleotide of the invention.
  • a recombinant cell of the invention has a enhanced capacity to synthesize a long chain polyunsaturated fatty acid.
  • the term "cell with an enhanced capacity to synthesize a long chain polyunsaturated fatty acid” is a relative term where the recombinant cell of the invention is compared to the host cell lacking the polynucleotide(s) of the invention, with the recombinant cell producing more long chain polyunsaturated fatty acids, or a greater concentration of LC-PUFA such as EPA, DPA or DHA (relative to other fatty acids), than the native cell.
  • the cell with an enhanced capacity to synthesize another product such as for example another fatty acid, a lipid, a carbohydrate such as starch, an RNA molecule, a polypeptide, a pharmaceutical or other product has a corresponding meaning.
  • Host cells of the present invention can be any cell capable of producing at least one protein described herein, and include bacterial, fungal (including yeast), parasite, arthropod, animal and plant cells.
  • the cells may be prokaryotic or eukaryotic.
  • Preferred host cells are yeast and plant cells.
  • the plant cell is a seed cell, in particular a cell in a cotyledon or endosperm of a seed .
  • the cell is an animal cell or an algal cell.
  • the animal cell may be of any type of animal such as, for example, a non-human animal cell, a non-human vertebrate cell, a non-human mammalian cell, or cells of aquatic animals such as, fish or Crustacea, invertebrates, insects, etc.
  • arthropod cells include insect cells such as Spodoptera frugiperda (Sf) cells, e.g. Sf9, Sf21, Trichoplusia ni cells, and Drosophila S2 cells.
  • An example of a bacterial cell useful as a host cell of the present invention is Synechococcus spp. (also known as Synechocystis spp.), for example Synechococcus elongatus.
  • the cells may be of an organism suitable for a fermentation process.
  • the term the "fermentation process" refers to any fermentation process or any process comprising a fermentation step.
  • a fermentation process includes, without limitation, fermentation processes used to produce alcohols (e.g., ethanol, methanol, butanol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H 2 and CO 2 ); antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, beta-carotene); and hormones.
  • alcohols e.g., ethanol, methanol, butanol
  • organic acids e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid
  • ketones e
  • Fermentation processes also include fermentation processes used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry and tobacco industry.
  • Preferred fermentation processes include alcohol fermentation processes, as are well known in the art.
  • Preferred fermentation processes are anaerobic fermentation processes, as are well known in the art.
  • Suitable fermenting cells typically microorganisms are able to ferment, i.e., convert, sugars, such as glucose or maltose, directly or indirectly into the desired fermentation product.
  • fermenting microorganisms include fungal organisms, such as yeast.
  • yeast includes Saccharomyces spp., Saccharomyces cerevisiae, Saccharomyces carlbergensis, Candida spp., Kluveromyces spp., Pichia spp., Hansenula spp., Trichoderma spp., Lipomyces starkey, and Yarrowia lipolytica.
  • Preferred yeast include strains of the Saccharomyces spp., and in particular, Saccharomyces cerevisiae.
  • the invention also provides a plant comprising a cell of the invention, such as a transgenic plant comprising one or more polynucleotides of the invention.
  • plant as used herein as a noun refers to whole plants, but as used as an adjective refers to any substance which is present in, obtained from, derived from, or related to a plant, such as for example, plant organs (e.g. leaves, stems, roots, flowers), single cells (e.g. pollen), seeds, plant cells and the like.
  • plant part refers to all plant parts that comprise the plant DNA, including vegetative structures such as, for example, leaves or stems, roots, floral organs or structures, pollen, seed, seed parts such as an embryo, endosperm, scutellum or seed coat, plant tissue such as, for example, vascular tissue, cells and progeny of the same.
  • transgenic plant refers to a plant that contains a gene construct ("transgene") not found in a wild-type plant of the same species, variety or cultivar.
  • Transgenic plants as defined in the context of the present invention include plants and their progeny which have been genetically modified using recombinant techniques to cause production of at least one polypeptide defined herein in the desired plant or plant organ.
  • Transgenic plant cells and transgenic plant parts have corresponding meanings.
  • a “transgene” as referred to herein has the normal meaning in the art of biotechnology and includes a genetic sequence which has been produced or altered by recombinant DNA or RNA technology and which has been introduced into a cell of the invention, preferably a plant cell.
  • the transgene may include genetic sequences derived from a plant cell which may be of the same species, variety or cultivar as the plant cell into which the transgene is introduced or of a different species, variety or cultivar, or from a cell other than a plant cell.
  • the transgene has been introduced into the cell, such as a plant, by human manipulation such as, for example, by transformation but any method can be used as one of skill in the art recognizes.
  • seed and “grain” are used interchangeably herein.
  • “Grain” refers to mature grain such as harvested grain or grain which is still on a plant but ready for harvesting, but can also refer to grain after imbibition or germination, according to the context. Mature grain commonly has a moisture content of less than about 18-20%.
  • "Developing seed” as used herein refers to a seed prior to maturity, typically found in the reproductive structures of the plant after fertilisation or anthesis, but can also refer to such seeds prior to maturity which are isolated from a plant.
  • plant storage organ refers to a part of a plant specialized to storage energy in the form of, for example, proteins, carbohydrates, fatty acids and/or oils.
  • plant storage organs are seed, fruit, tuberous roots, and tubers.
  • a preferred plant storage organ of the invention is seed.
  • the term "phenotypically normal” refers to a genetically modified plant or plant organ, particularly a storage organ such as a seed, tuber or fruit of the invention not having a significantly reduced ability to grow and reproduce when compared to an unmodified plant or plant organ.
  • the genetically modified plant or plant organ which is phenotypically normal comprises an exogenous polynucleotide encoding a silencing suppressor operably linked to a plant storage organ specific promoter and has an ability to grow or reproduce which is essentially the same as an isogenic plant or organ not comprising said polynucleotide.
  • the biomass, growth rate, germination rate, storage organ size, seed size and/or the number of viable seeds produced is not less than 90% of that of a plant lacking said exogenous polynucleotide when grown under identical conditions.
  • This term does not encompass features of the plant which may be different to the wild-type plant but which do not effect the usefulness of the plant for commercial purposes such as, for example, a ballerina phenotype of seedling leaves.
  • Plants provided by or contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons.
  • the plants of the present invention are crop plants (for example, cereals and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley, or pea), or other legumes.
  • the plants may be grown for production of edible roots, tubers, leaves, stems, flowers or fruit.
  • the plants may be vegetables or ornamental plants.
  • the plants of the invention may be: corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum ⁇ Sorghum bicolour, Sorghum vulgare), sunflower ⁇ Helianthus annus), wheat ⁇ Tritium aestivum), soybean ⁇ Glycine max), tobacco ⁇ Nicotiana tabacum), potato ⁇ Solarium tuberosum), peanuts ⁇ Arachis hypogaea), cotton ⁇ Gossypium hirsutum), sweet potato ⁇ Lopmoea batatus), cassava ⁇ Manihot esculenta), coffee ⁇ Cofea spp.), coconut ⁇ Cocos nucifera), pineapple ⁇ Anana comosus), citris tree ⁇ Cit
  • the plant is an angiosperm.
  • the plant is an oilseed plant, preferably an oilseed crop plant.
  • an "oilseed plant” is a plant species used for the commercial production of oils from the seeds of the plant.
  • the oilseed plant may be oil-seed rape (such as canola), maize, sunflower, soybean, sorghum, flax (linseed) or sugar beet.
  • the oilseed plant may be other Brassicas, cotton, peanut, poppy, mustard, castor bean, sesame, safflower, or nut producing plants.
  • the plant may produce high levels of oil in its fruit, such as olive, oil palm or coconut.
  • Horticultural plants to which the present invention may be applied are lettuce, endive, or vegetable brassicas including cabbage, broccoli, or cauliflower.
  • the present invention may be applied in tobacco, cucurbits, carrot, strawberry, tomato, or pepper.
  • the non-transgenic plant used to produce a transgenic plant of the invention produces oil, especially in the seed, which has i) less than 20%, less than 10% or less than 5% 18:2 fatty acids and/or ii) less than 10% or less than 5% 18:3 fatty acids.
  • the transgenic plant is homozygous for each and every gene that has been introduced (transgene) so that its progeny do not segregate for the desired phenotype.
  • the transgenic plant may also be heterozygous for the introduced transgene(s), preferably uniformly heterozygous for the transgene, such as for example in Fl progeny which have been grown from hybrid seed.
  • Such plants may provide advantages such as hybrid vigour, well known in the art.
  • the transgenic plants may also comprise additional transgenes encoding enzymes involved in the production of LC-PUFAs such as, but not limited to, a ⁇ 6 desaturase, a ⁇ 9 elongase, a ⁇ 8 desaturase, a ⁇ 6 elongase, a ⁇ 5 desaturase, an ⁇ 3 desaturase, a ⁇ 4 desaturase, a ⁇ 5 elongase, diacylglycerol acyltransferase, a ⁇ 17 desaturase, a ⁇ 15 desaturase and/or a ⁇ 12 desaturase.
  • additional transgenes encoding enzymes involved in the production of LC-PUFAs such as, but not limited to, a ⁇ 6 desaturase, a ⁇ 9 elongase, a ⁇ 8 desaturase, a ⁇ 6 elongase, a ⁇ 5 desaturase,
  • the transgenic plant at least comprises exogenous polynucleotides encoding; a) a ⁇ 4 desaturase, a ⁇ 5 desaturase, a ⁇ 6 desaturase, a ⁇ 5 elongase and a ⁇ 6 elongase, b) a ⁇ 4 desaturase, a ⁇ 5 desaturase, a ⁇ 8 desaturase, a ⁇ 5 elongase and a ⁇ 9 elongase, c) a ⁇ 4 desaturase, a ⁇ 5 desaturase, a ⁇ 6 desaturase, a ⁇ 5 elongase, a ⁇ 6 elongase, and a ⁇ 15 desaturase
  • Transgenic plants can be produced using techniques known in the art, such as those generally described in A. Slater et al., Plant Biotechnology - The Genetic Manipulation of Plants, Oxford University Press (2003), and P. Christou and H. Klee, Handbook of Plant Biotechnology, John Wiley and Sons (2004).
  • stably transforming As used herein, the terms “stably transforming”, “stably transformed” and variations thereof refer to the integration of the exogenous nucleic acid molecules into the genome of the cell such that they are transferred to progeny cells during cell division without the need for positively selecting for their presence. Stable transformants, or progeny thereof, can be selected by any means known in the art such as Southern blots on chromosomal DNA or in situ hybridization of genomic DNA.
  • Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because DNA can be introduced into cells in whole plant tissues or plant organs or explants in tissue culture, for either transient expression or for stable integration of the DNA in the plant cell genome.
  • the use of Agrobacterium -mediated plant integrating vectors to introduce DNA into plant cells is well known in the art (see, for example, US 5177010, US 5104310, US 5004863 or US 5159135).
  • the region of DNA to be transferred is defined by the border sequences, and the intervening DNA (T- DNA) is usually inserted into the plant genome. Further, the integration of the T-DNA is a relatively precise process resulting in few rearrangements.
  • Agrobacterium-mQdiatQd transformation In those plant varieties where Agrobacterium-mQdiatQd transformation is efficient, it is the method of choice because of the facile and defined nature of the gene transfer.
  • Preferred Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations as described (Klee et al., In: Plant DNA Infectious Agents, Hohn and Schell, eds., Springer-Verlag, New York, pp. 179-203 (1985).
  • Acceleration methods include, for example, microprojectile bombardment and the like.
  • microprojectile bombardment One example of a method for delivering transforming nucleic acid molecules to plant cells is microprojectile bombardment. This method has been reviewed by Yang et al., Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994).
  • Non-biological particles that may be coated with nucleic acids and delivered into cells by a propelling force.
  • Exemplary particles include those comprised of tungsten, gold, platinum, and the like.
  • An illustrative embodiment of a method for delivering DNA into Zea mays cells by acceleration is a biolistics ⁇ -particle delivery system, that can be used to propel particles coated with DNA through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with corn cells cultured in suspension.
  • a particle delivery system suitable for use with the present invention is the helium acceleration PDS- 1000/He gun available from Bio-Rad Laboratories.
  • cells in suspension may be concentrated on filters.
  • Filters containing the cells to be bombarded are positioned at an appropriate distance below the microprojectile stopping plate. If desired, one or more screens are also positioned between the gun and the cells to be bombarded.
  • immature embryos or other target cells may be arranged on solid culture medium.
  • the cells to be bombarded are positioned at an appropriate distance below the microprojectile stopping plate.
  • one or more screens are also positioned between the acceleration device and the cells to be bombarded.
  • bombardment transformation one may optimize the pre-bombardment culturing conditions and the bombardment parameters to yield the maximum numbers of stable trans formants.
  • Both the physical and biological parameters for bombardment are important in this technology. Physical factors are those that involve manipulating the DNA/microprojectile precipitate or those that affect the flight and velocity of either the macro- or microprojectiles.
  • Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature of the transforming DNA, such as linearized DNA or intact supercoiled plasmids. It is believed that pre-bombardment manipulations are especially important for successful transformation of immature embryos.
  • plastids can be stably transformed.
  • Methods disclosed for plastid transformation in higher plants include particle gun delivery of DNA containing a selectable marker and targeting of the DNA to the plastid genome through homologous recombination (US 5, 451,513, US 5,545,818, US 5,877,402, US 5,932479, and WO 99/05265).
  • the execution of other routine adjustments will be known to those of skill in the art in light of the present disclosure.
  • Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments. Application of these systems to different plant varieties depends upon the ability to regenerate that particular plant strain from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts are described (Fujimura et al., 1985; Toriyama et al, 1986; Abdullah et al, 1986). Other methods of cell transformation can also be used and include but are not limited to introduction of DNA into plants by direct DNA transfer into pollen, by direct injection of DNA into reproductive organs of a plant, or by direct injection of DNA into the cells of immature embryos followed by the rehydration of desiccated embryos.
  • This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.
  • the development or regeneration of plants containing the foreign, exogenous gene is well known in the art.
  • the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants.
  • a transgenic plant of the present invention containing a desired exogenous nucleic acid is cultivated using methods well known to one skilled in the art.
  • transgenic wheat or barley plants are produced by Agrobacterium tumefaciens mediated transformation procedures.
  • Vectors carrying the desired nucleic acid construct may be introduced into regenerable wheat cells of tissue cultured plants or explants, or suitable plant systems such as protoplasts.
  • the regenerable wheat cells are preferably from the scutellum of immature embryos, mature embryos, callus derived from these, or the meristematic tissue.
  • a polymerase chain reaction (PCR) amplification or Southern blot analysis can be performed using methods known to those skilled in the art.
  • Expression products of the transgenes can be detected in any of a variety of ways, depending upon the nature of the product, and include Western blot and enzyme assay.
  • One particularly useful way to quantitate protein expression and to detect replication in different plant tissues is to use a reporter gene, such as GUS.
  • a transgenic plant formed using Agrobacterium or other transformation methods typically contains a single genetic locus on one chromosome. Such transgenic plants can be referred to as being hemizygous for the added gene(s). More preferred is a transgenic plant that is homozygous for the added gene(s); i.e., a transgenic plant that contains two added genes, one gene at the same locus on each chromosome of a chromosome pair.
  • a homozygous transgenic plant can be obtained by self-fertilising a hemizygous transgenic plant, germinating some of the seed produced and analyzing the resulting plants for the gene of interest.
  • transgenic plants that contain two independently segregating exogenous genes or loci can also be crossed (mated) to produce offspring that contain both sets of genes or loci.
  • Selfing of appropriate Fl progeny can produce plants that are homozygous for both exogenous genes or loci.
  • Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is vegetative propagation. Descriptions of other breeding methods that are commonly used for different traits and crops can be found in Fehr, In: Breeding Methods for Cultivar Development, Wilcox J. ed., American Society of Agronomy, Madison Wis. (1987).
  • transgenic non-human animal refers to an animal, other than a human, that contains a gene construct ("transgene") not found in a wild-type animal of the same species or breed.
  • a "transgene” as referred to in this context has the normal meaning in the art of biotechnology and includes a genetic sequence which has been produced or altered by recombinant DNA or RNA technology and which has been introduced into an animal cell.
  • the transgene may include genetic sequences derived from an animal cell, which may be of the same or different species or breed as the cell into which the transgene is introduced.
  • the transgene has been introduced into the animal by human manipulation such as, for example, by transformation but any method can be used as one of skill in the art recognizes.
  • Transformation of a polynucleotide molecule into a cell can be accomplished by any method by which a polynucleotide molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and cell fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism.
  • Transformed polynucleotide molecules can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained.
  • Heterologous DNA can be introduced, for example, into fertilized mammalian ova.
  • totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal.
  • developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo.
  • the appropriate DNAs are coinjected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals.
  • Another method used to produce a transgenic animal involves microinjecting a nucleic acid into pro-nuclear stage eggs by standard methods. Injected eggs are then cultured before transfer into the oviducts of pseudopregnant recipients.
  • Transgenic animals may also be produced by nuclear transfer technology. Using this method, fibroblasts from donor animals are stably transfected with a plasmid incorporating the coding sequences for a binding domain or binding partner of interest under the control of regulatory sequences. Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients. Enhancing Exogenous RNA Levels and Stabilized Expression Silencing Suppressors
  • Post-transcriptional gene silencing is a nucleotide sequence-specific defense mechanism that can target both cellular and viral mRNAs for degradation PTGS occurs in plants or fungi stably or transiently transformed with foreign (heterologous) or endogenous DNA and results in the reduced accumulation of RNA molecules with sequence similarity to the introduced nucleic acid.
  • RNA molecule levels can be increased, and/or RNA molecule levels stabilized over numerous generations, by limiting the expression of the silencing suppressor to a storage organ of a plant or part thereof.
  • a "silencing suppressor” is any polynucleotide or polypeptide that can be expressed in a plant cell that enhances the level of expression product from a different transgene in the plant cell, particularly over repeated generations from the initially transformed plant.
  • the silencing suppressor is a viral silencing suppressor or mutant thereof.
  • a large number of viral silencing suppressors are known in the art and include, but are not limited to P19, V2, P38, Pe-Po and RPV- PO.
  • the viral silencing suppressor comprises amino acids having a sequence as provided in any one of SEQ ID NOs 97 to 101, a biologically active fragment thereof, or an amino acid sequence which is at least 50% identical to any one or more of SEQ ID NOs 97 to 101 and which has activity as a silencing suppressor.
  • the terms “stabilising expression”, “stably expressed”, “stabilised expression” and variations thereof refer to level of the RNA molecule being essentially the same or higher in progeny plants over repeated generations, for example at least three, at least five or at least 10 generations, when compared to isogenic plants lacking the exogenous polynucleotide encoding the silencing suppressor.
  • this term(s) does not exclude the possibility that over repeated generations there is some loss of levels of the RNA molecule when compared to a previous generation, for example not less than a 10% loss per generation.
  • the suppressor can be selected from any source e.g. plant, viral, mammal etc.
  • the suppressor may be, for example:
  • Multiple copies of a suppressor may be used. Different suppressors may be used together (e. g., in tandem).
  • RNA Molecules Essentially any RNA molecule which is desirable to be expressed in a plant storage organ can be co-expressed with the silencing suppressor.
  • the RNA molecule may influence an agronomic trait, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics, and the like.
  • the encoded polypeptides may be involved in metabolism of oil, starch, carbohydrates, nutrients, etc., or may be responsible for the synthesis of proteins, peptides, fatty acids, lipids, waxes, oils, starches, sugars, carbohydrates, flavors, odors, toxins, carotenoids. hormones, polymers, flavonoids, storage proteins, phenolic acids, alkaloids, lignins, tannins, celluloses, glycoproteins, glycolipids, etc.
  • the plants produced increased levels of enzymes for oil production in plants such as Brassicas, for example oilseed rape or sunflower, safflower, flax, cotton, soya bean or maize; enzymes involved in starch synthesis in plants such as potato, maize, and cereals such as wheat barley or rice; enzymes which synthesize, or proteins which are themselves, natural medicaments, such as pharmaceuticals or veterinary products.
  • plants such as Brassicas, for example oilseed rape or sunflower, safflower, flax, cotton, soya bean or maize
  • enzymes involved in starch synthesis in plants such as potato, maize, and cereals such as wheat barley or rice
  • enzymes which synthesize, or proteins which are themselves, natural medicaments, such as pharmaceuticals or veterinary products are themselves, natural medicaments, such as pharmaceuticals or veterinary products.
  • Types of polypeptitdes that are contemplated for production in a method of the present invention include pharmaceutical proteins for use in mammals, including man, such as insulin, preproinsulin, proinsulin, glucagon, interferons such as ⁇ -interferon and ⁇ -interferon, blood-clotting factors such as Factor VII, VIII, IX, X, XI, and XII, fertility hormones such as luteinising hormone, follicle stimulating hormone growth factors such as epidermal growth factor, platelet-derived growth factor, granulocyte colony stimulating factor, prolactin, oxytocin, thyroid stimulating hormone, adrenocorticotropic hormone, calcitonin, parathyroid hormone, somatostatin, erythropoietin (EPO), enzymes such as ⁇ -glucocerebrosidase, haemoglobin, serum albumin, collagen, growth hormone, human serum albumin, human-secreted alkaline phosphatase, a
  • the method of the invention can be used for the production of specific antibodies, including antibody-related molecules or active fragments thereof which bind, for example, bone morphogenetic protein receptor-type IB; E16; STEAPl; MPF; Napi3b; Sema 5b; PSCA; Endothelin type B receptor; MSG783; STEAP2; TrpM4; CRIPTO; CD21; CD79b; FcRH2; HER2; NCA; MDP; IL20R ⁇ ; Brevican; EphB2R; ASLG659; PSCA; GEDA; B cell -activating factor receptor; CD22; CD79a; CXCR5; HLA-DOB; P2X5; CD72; LY64; FcRHl; IRTA2; TENB2; CD20; VEGF including VEGF A, B, C or D; p53; EGFR; progesterone receptor; cathepsin D; Bcl-2; E cadherin;
  • the method of the invention can be used for the production of an antigen, which may or may not be delivered by consumption of the storage organ, examples of which include Hepatitis B virus envelope protein, rabies virus glycoprotein, Escherichia coli heat-labile entertoxin, Norwalk virus capsid protein, diabetes autoantigen, cholera toxin B subunit, cholera toxin B and A2 subunits, rotavirus entertoxin and enterotoxigenic E.
  • an antigen which may or may not be delivered by consumption of the storage organ, examples of which include Hepatitis B virus envelope protein, rabies virus glycoprotein, Escherichia coli heat-labile entertoxin, Norwalk virus capsid protein, diabetes autoantigen, cholera toxin B subunit, cholera toxin B and A2 subunits, rotavirus entertoxin and enterotoxigenic E.
  • coli f ⁇ mbrial antigen fusions porcine transmissible gastroenteritis virus glycoprotein S, human rhino virus 15 (HRV- 14) and human immunodeficiency virus type (HIV-I) epitopes, Mink Enteritis Virus epitopes, foot and mouth disease virus VPl structural protein, human cytomegalovirus glycoprotein B, dental caries (S. mutans) antigens, and respiratory syncytial virus antigens.
  • the levels of the LC-PUFA or combination of LC-PUFAs that are produced in the recombinant cell are of importance.
  • the levels may be expressed as a composition (in percent) of the total fatty acid that is a particular LC-PUFA or group of related LC- PUFA, for example the ⁇ 3 LC-PUFA or the ⁇ 6 LC-PUFA, or the VLC-PUFA, or other which may be determined by methods known in the art.
  • the level may also be expressed as a LC-PUFA content, such as for example the percentage of LC-PUFA in the dry weight of material comprising the recombinant cells, for example the percentage of the dry weight of seed that is LC-PUFA.
  • LC-PUFA that is produced in an oilseed may be considerably higher in terms of LC- PUFA content than in a vegetable or a grain that is not grown for oil production, yet both may have similar LC-PUFA compositions, and both may be used as sources of LC-PUFA for human or animal consumption.
  • the levels of LC-PUFA may be determined by any of the methods known in the art.
  • total lipid is extracted from the cells, tissues or organisms and the fatty acid converted to methyl esters before analysis by gas chromatography (GC).
  • GC gas chromatography
  • the peak position in the chromatogram may be used to identify each particular fatty acid, and the area under each peak integrated to determine the amount.
  • the percentage of particular fatty acid in a sample is determined as the area under the peak for that fatty acid as a percentage of the total area for fatty acids in the chromatogram. This corresponds essentially to a weight percentage (w/w).
  • the identity of fatty acids may be confirmed by GC-MS.
  • Total lipid may be separated by techniques known in the art to purify fractions such as the TAG fraction. For example, thin-layer chromatography (TLC) may be performed at an analytical scale to separate TAG from other lipid fractions such as DAG, acyl-CoAs or phospholipid in order to determine the fatty acid composition specifically of TAG.
  • TLC thin-layer chromatography
  • the sum total of ARA, EPA, DPA and DHA in the fatty acids in the cell comprises at least 15%, more preferably at least 20% or at least 25% of the total fatty acids in the cell. In a more preferred embodiment, the sum total of those fatty acids is at least 29%, at least 30% or at least 31% of the total fatty acids in the cell. In a further embodiment, the total fatty acid in the cell has less than 1% C20: 1. In another embodiment, the amount of DHA in the fatty acids in the cell is at least 3%, more preferably at least 4%, more preferably at least 5% or at least 7%, or most preferably at least 10%, of the total fatty acids in the cell.
  • the extractable TAG in the cell comprises the fatty acids at the levels referred to in this paragraph.
  • the sum total of ARA, EPA, DPA and DHA in the fatty acids in the cell may comprises at least 15%, at least 20%, at least 25%, at least 29%, at least 30% or at least 31% of the total fatty acids in the cell, of which at least 3%, at least 4%, at least 5%, at least 7% or at least 10% of the total fatty acids in the cell is DHA, while the level of C20:l may be less than 1%.
  • the recombinant cell may be a cell of an organism that is suitable for fermentation such as, for example, a unicellular microorganism which may be a prokaryote or a eukaryote such as yeast, or a plant cell.
  • the cell is a cell of an angiosperm (higher plant).
  • the cell is a cell in a seed such as, for example, an oilseed or a grain or cereal.
  • the level of production of LC-PUFA in the recombinant cell may also be expressed as a conversion ratio, i.e., the amount of the LC-PUFA formed as a percentage of one or more substrate PUFA or LC-PUFA.
  • a conversion ratio i.e., the amount of the LC-PUFA formed as a percentage of one or more substrate PUFA or LC-PUFA.
  • this may be expressed as the ratio of the level of EPA (as a percentage in the total fatty acid) to the level of a substrate fatty acid (ALA, SDA, ETA or ETrA).
  • the efficency of conversion of ALA to EPA is at least 80%, or more preferably at 90%.
  • the efficiency of conversion of ALA to EPA, DPA or DHA (calculated as the sum of the percentages for EPA, DPA and DHA/ the sum of the percentages for ALA and all ⁇ 6-desaturated fatty acid products from ALA) is at least 17.3%, or at least 23%.
  • the efficiency of conversion of ALA to DPA or DHA (calculated as the sum of the percentages for DPA and DHA/ the sum of the percentages for ALA and all ⁇ 6- desaturated fatty acid products from ALA) is at least 15.4%, or at least 21%.
  • the efficiency of conversion of ALA to DHA (calculated as the percentage for DHA/ the sum of the percentages for ALA and all ⁇ 6-desaturated fatty acid products from ALA) is at least 9.5%, or at least 10.8%.
  • the efficiency of conversion of EPA to DHA (calculated as the percentage for DHA/ the sum of the percentages for EPA and all ⁇ 5-elongated fatty acid products from EPA) is at least 45%, or at least 50%.
  • the efficiency of conversion of SDA to produce ETA (calculated as the sum of the percentages for ETA and ⁇ 5- desaturated fatty acid products from ETA / the sum of the percentages for SDA and all ⁇ 6-elongated fatty acid products from SDA) is at least 50%, more preferably at least 60%. In another embodiment, the efficiency of conversion of ALA to ETrA is at least 6%, more preferably at least 9%.
  • the conversion efficency of EPA to DPA (calculated as the sum of the percentages for DPA and DHA/ the sum of the percentages for EPA, DPA and DHA) through a ⁇ 5 elongase step is at least 60%, more preferably at least 65%, more preferably at least 70% or most preferably at least 75%.
  • the content of the LC-PUFA in the recombinant cell may be maximized if the parental cell used for introduction of the genes is chosen such that the level of fatty acid substrate that is produced or provided exogenously is optimal.
  • the level of LC-PUFA may also be maximized by growing or incubating the cells under optimal conditions, for example at a slightly lower temperature than the standard temperature for that cell, which is thought to favour accumulation of polyunsaturated fatty acid.
  • some desaturases expressed heterologously in yeast or plants have relatively low activity in combination with some elongases.
  • This may be alleviated by providing a desaturase with the capacity of to use an acyl-CoA form of the fatty acid as a substrate in LC-PUFA synthesis, and this is thought to be advantageous in recombinant cells other than yeast such as plant cells.
  • oilseeds can be tempered by spraying them with water to raise the moisture content to, e.g., 8.5%, and flaked using a smooth roller with a gap setting of 0.23 to 0.27 mm.
  • water may not be added prior to crushing.
  • Heat deactivates enzymes, facilitates further cell rupturing, coalesces the oil droplets, and agglomerates protein particles, all of which facilitate the extraction process.
  • the majority of the seed oil is released by passage through a screw press. Cakes expelled from the screw press are then solvent extracted, e.g., with hexane, using a heat traced column.
  • crude oil produced by the pressing operation can be passed through a settling tank with a slotted wire drainage top to remove the solids that are expressed with the oil during the pressing operation.
  • the clarified oil can be passed through a plate and frame filter to remove any remaining fine solid particles. If desired, the oil recovered from the extraction process can be combined with the clarified oil to produce a blended crude oil.
  • Degumming can be performed by addition of concentrated phosphoric acid to the crude oil to convert non- hydratable phosphatides to a hydratable form, and to chelate minor metals that are present. Gum is separated from the oil by centrifugation. The oil can be refined by addition of a sufficient amount of a sodium hydroxide solution to titrate all of the fatty acids and removing the soaps thus formed.
  • Deodorization can be performed by heating the oil to 26O°C under vacuum, and slowly introducing steam into the oil at a rate of about 0.1 ml/minute/100 ml of oil. After about 30 minutes of sparging, the oil is allowed to cool under vacuum. The oil is typically transferred to a glass container and flushed with argon before being stored under refrigeration. If the amount of oil is limited, the oil can be placed under vacuum, e.g., in a Parr reactor and heated to 26O°C for the same length of time that it would have been deodorized. This treatment improves the color of the oil and removes a majority of the volatile substances.
  • feedstuffs include any food or preparation for human or animal consumption (including for enteral and/or parenteral consumption) which when taken into the body (a) serve to nourish or build up tissues or supply energy; and/or (b) maintain, restore or support adequate nutritional status or metabolic function.
  • Feedstuffs of the invention include nutritional compositions for babies and/or young children.
  • Feedstuffs of the invention comprise, for example, a cell of the invention, a plant of the invention, the plant part of the invention, the seed of the invention, an extract of the invention, the product of the method of the invention, the product of the fermentation process of the invention, or a composition along with a suitable carrier(s).
  • carrier is used in its broadest sense to encompass any component which may or may not have nutritional value. As the skilled addressee will appreciate, the carrier must be suitable for use (or used in a sufficiently low concentration) in a feedstuff such that it does not have deleterious effect on an organism which consumes the feedstuff.
  • the feedstuff of the present invention comprises an oil, fatty acid ester, or fatty acid produced directly or indirectly by use of the methods, cells or plants disclosed herein.
  • the composition may either be in a solid or liquid form. Additionally, the composition may include edible macronutrients, vitamins, and/or minerals in amounts desired for a particular use. The amounts of these ingredients will vary depending on whether the composition is intended for use with normal individuals or for use with individuals having specialized needs, such as individuals suffering from metabolic disorders and the like.
  • suitable carriers with nutritional value include, but are not limited to, macronutrients such as edible fats, carbohydrates and proteins.
  • edible fats include, but are not limited to, coconut oil, borage oil, fungal oil, black current oil, soy oil, and mono- and diglycerides.
  • carbohydrates include (but are not limited to): glucose, edible lactose, and hydro lyzed search.
  • proteins which may be utilized in the nutritional composition of the invention include (but are not limited to) soy proteins, electrodialysed whey, electrodialysed skim milk, milk whey, or the hydro lysates of these proteins.
  • vitamins and minerals may be added to the feedstuff compositions of the present invention: calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine, and Vitamins A, E, D, C, and the B complex. Other such vitamins and minerals may also be added.
  • the components utilized in the feedstuff compositions of the present invention can be of semi-purified or purified origin.
  • semi-purified or purified is meant a material which has been prepared by purification of a natural material or by de novo synthesis.
  • a feedstuff composition of the present invention may also be added to food even when supplementation of the diet is not required.
  • the composition may be added to food of any type, including (but not limited to): margarine, modified butter, cheeses, milk, yogurt, chocolate, candy, snacks, salad oils, cooking oils, cooking fats, meats, fish and beverages.
  • the genus Saccharomyces spp is used in both brewing of beer and wine making and also as an agent in baking, particularly bread.
  • Yeast is a major constituent of vegetable extracts. Yeast is also used as an additive in animal feed. It will be apparent that genetically engineered yeast strains can be provided which are adapted to synthesise LC-PUFA as described herein. These yeast strains can then be used in food stuffs and in wine and beer making to provide products which have enhanced fatty acid content.
  • fatty acids produced in accordance with the present invention or host cells transformed to contain and express the subject genes may also be used as animal food supplements to alter an animal's tissue or milk fatty acid composition to one more desirable for human or animal consumption. Examples of such animals include sheep, cattle, horses and the like.
  • feedstuffs of the invention can be used in aquaculture to increase the levels of fatty acids in fish for human or animal consumption.
  • Preferred feedstuffs of the invention are the plants, seed and other plant parts such as leaves and stems which may be used directly as food or feed for humans or other animals. For example, animals may graze directly on such plants grown in the field or be fed more measured amounts in controlled feeding.
  • the invention includes the use of such plants and plant parts as feed for increasing the LC-PUFA levels in humans and other animals.
  • compositions particularly pharmaceutical compositions, comprising one or more of the fatty acids and/or resulting oils produced using the methods of the invention.
  • a pharmaceutical composition may comprise one or more of the fatty acids and/or oils, in combination with a standard, well-known, non-toxic pharmaceutically- acceptable carrier, adjuvant or vehicle such as phosphate-buffered saline, water, ethanol, polyols, vegetable oils, a wetting agent or an emulsion such as a water/oil emulsion.
  • the composition may be in either a liquid or solid form.
  • the composition may be in the form of a tablet, capsule, ingestible liquid or powder, injectible, or topical ointment or cream. Proper fluidity can be maintained, for example, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.
  • composition can also include isotonic agents, for example, sugars, sodium chloride, and the like.
  • isotonic agents for example, sugars, sodium chloride, and the like.
  • the composition can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents and perfuming agents.
  • Suspensions in addition to the active compounds, may comprise suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth or mixtures of these substances.
  • suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth or mixtures of these substances.
  • Solid dosage forms such as tablets and capsules can be prepared using techniques well known in the art.
  • fatty acids produced in accordance with the present invention can be tableted with conventional tablet bases such as lactose, sucrose, and cornstarch in combination with binders such as acacia, cornstarch or gelatin, disintegrating agents such as potato starch or alginic acid, and a lubricant such as stearic acid or magnesium stearate.
  • Capsules can be prepared by incorporating these excipients into a gelatin capsule along with antioxidants and the relevant fatty acid(s).
  • the fatty acids produced in accordance with the present invention or derivatives thereof may be incorporated into commercial formulations.
  • a typical dosage of a particular fatty acid is from 0.1 mg to 20 g, taken from one to five times per day (up to 100 g daily) and is preferably in the range of from about 10 mg to about 1, 2, 5, or 10 g daily (taken in one or multiple doses).
  • any amount of fatty acid will be beneficial to the subject.
  • Possible routes of administration of the pharmaceutical compositions of the present invention include, for example, enteral (e.g., oral and rectal) and parenteral.
  • enteral e.g., oral and rectal
  • parenteral e.g., a liquid preparation may be administered orally or rectally.
  • a homogenous mixture can be completely dispersed in water, admixed under sterile conditions with physiologically acceptable diluents, preservatives, buffers or propellants to form a spray or inhalant.
  • the dosage of the composition to be administered to the patient may be determined by one of ordinary skill in the art and depends upon various factors such as weight of the patient, age of the patient, overall health of the patient, past history of the patient, immune status of the patient, etc.
  • compositions of the present invention may be utilized for cosmetic purposes. It may be added to pre-existing cosmetic compositions such that a mixture is formed or a fatty acid produced according to the subject invention may be used as the sole "active" ingredient in a cosmetic composition.
  • Micromonas CS-0170 and Pyramimonas CS-0140 isolates from the CSIRO Collection of Living Microalgae were cultivated under standard culture conditions.
  • a stock culture from the Collection was sub-cultured and scaled-up in a dilution of 1 in 10 over consecutive transfers in 1 L Erlenmeyer flasks and then into 10 L polycarbonate carboys.
  • the culture medium was f/2, a modification of Guillard and Ryther's (1962) f medium containing half-strength nutrients, with a growth temperature of 20 ⁇ l°C.
  • Other culturing conditions included a light intensity of 100 ⁇ mol. photons PAR.m-2.s-l, 12:12 hour lightdark photoperiod, and bubbling with 1% CO 2 in air at a rate of 200 mL.L -1 .min -1 .
  • Genomic DNA from Micromonas CS-0170 and Pyramimonas CS-0140 was isolated using the DNeasy Plant Mini Kit system as described in the accompanying instruction manual (QIAGEN, catalogue #69106).
  • Total RNA was isolated from Micromonas CS-0170 and Pyramimonas CS-0140 cells using the following method. 2 g (wet weight) of cells were powdered using a mortar and pestle in liquid nitrogen and sprinkled slowly into a beaker containing 22 mL of extraction buffer that was being stirred constantly. To this, 5% insoluble polyvinylpyrrolidone, 90 mM 2-mercaptoethanol, and 10 mM dithiothreitol were added and the mixture stirred for a further 10 minutes prior to being transferred to a CorexTM tube. 18.4 mL of 3 M ammonium acetate was added and mixed well. The sample was then centrifuged at 6000 ⁇ g for 20 minutes at 4°C.
  • the supernatant was transferred to a new tube and nucleic acid precipitated by the addition of 0.1 volume of 3 M NaAc (pH 5.2) and 0.5 volume of cold isopropanol. After a 1 hour incubation at -20°C, the sample was centrifuged at 6000 ⁇ g for 30 minutes in a swing rotor. The pellet was resuspended in 1 mL of water extracted with phenol/chloroform. The aqueous layer was transferred to a new tube and nucleic acids were precipitated once again by the addition of 0.1 volume 3 M NaAc (pH 5.2) and 2.5 volumes of ice cold ethanol. The pellet was resuspended in water and the concentration of nucleic acid determined by spectrophotometer.
  • Plasmid pYES2 and yeast strain INVSCl were obtained from Invitrogen, plasmid vector pGEMT-Easy from Promega, plasmid vector pBluescript II KS- from Stratagene.
  • Agrobacterium tumefaciens strain AGLl was referred to by Lazo et al. (1991) and the pORE binary vector series by Coutu et al. (2007).
  • reaction conditions were as follows.
  • reaction mixtures were treated for 20-40 cycles of denaturation/annealing/extension with denaturation at 94°C for 30-60sec, primer annealing at 40-60°C for 30sec, and polymerase extension for 30-60sec at 70-72°C, followed by a further extension step of 3min at 70-72°C .
  • Reverse transcription-PCR (RT-PCR) amplification was typically carried out using the Superscript III One-Step RT-PCR system (Invitrogen) in a volume of 25 ⁇ L using 10 pmol of the forward primer and 30 pmol of the reverse primer, MgSO 4 to a final concentration of 2.5 mM, 400 ng of total RNA with buffer and nucleotide components according to the manufacturer's instructions.
  • Typical temperature regimes were: 1 cycle of 45 °C for 30 minutes for the reverse transcription to occur; then 1 cycle of 94°C for 2 minutes followed by 40 cycles of 94°C for 30 seconds, 52°C for 30 seconds, 70°C for 1 minute; then 1 cycle of 72°C for 2 minutes before cooling the reaction mixtures to 5°C. 5' and 3 '-RACE
  • cDNAs corresponding to partial length gene fragments were obtained by 5'- and 3'-RACE (Rapid Amplification of cDNA Ends) methods.
  • the 3' end of a cDNA was isolated using a gene specific forward primer as specified in the Examples and an oligo-dT reverse primer 5'- ATTTAGGTGACACTATAGTTTTTTTTTTTTTTTTV-3' (SEQ ID NO:41), where
  • V represents either A, G or C, which was in common to all of the 3'-RACE reactions.
  • An RT-PCR amplification was carried out using the Superscript III One-Step RT-PCR system (Invitrogen) in a volume of 25 ⁇ L using 10 pmol of the forward primer and 30 pmol of the reverse primer, MgSO 4 to a final concentration of 2.5 mM, 400 ng of total RNA as template for cDNA synthesis, and buffer and nucleotide components as specified by the supplier.
  • the cycling conditions were typically: 1 cycle of 45°C for 30 minutes for reverse transcription; then 1 cycle of 94°C for 2 minutes; followed by 40 cycles of 94°C for 30 seconds, 52°C for 30 seconds, 70°C for 1 minute and 1 cycle of 72°C for 2 minutes before cooling to 5°C.
  • the amplicons generated in the reaction were ligated into pGEM-T Easy, cloned into E. coli and sequenced by standard methods.
  • cDNAs were isolated using a modified terminal-transferase method with 2 ⁇ g of total RNA as template for cDNA synthesis.
  • 10 pmol of a gene specific reverse primer was added to the total RNA and 10.8 ⁇ L water before the mixture was heated at 65 °C for 5 minutes and chilled on ice for 2 minutes.
  • the following components were then added: 4 ⁇ L of Superscript III first- strand cDNA buffer (Invitrogen), 1 ⁇ L of 0.1 M dithiothreitol, 1 ⁇ L RNAseOUT (Invitrogen) and 1 ⁇ L of Superscript III reverse transcriptase.
  • the mixture was then incubated at 55°C for 60 minutes and the reaction terminated by a further incubation at 70°C for 15 minutes. After being cooled briefly on ice the reaction was then treated with 2 units of RNAseH at 37°C for 20 minutes.
  • the cDNA was then purified using the QIAQUICK PCR Purification Kit (QIAGEN, catalogue #28106). 25 ⁇ L of the eluate was then A-tailed using 10 units of TdT (NEB), 5 ⁇ L of NEB Buffer #4, 5 ⁇ L of 2.5 mM CoCl 2 , 0.5 ⁇ L of 10 mM dATP in a total of 50 ⁇ L.
  • reaction was performed at 37°C for 30 minutes followed by inactivation of the enzyme at 70°C for 10 minutes.
  • a PCR reaction was then performed using 2.5 units of Taq DNA polymerase (NEB) in the reaction mixture including 5 ⁇ L of the A-tailed cDNA, 10 pmol of the gene specific reverse primer, 30 pmol of a modified oligo-dT primer 5'- ATTTAGGTGACACTATAGTTTTTTTTTTTTTTTTTTTTTTTTV-3' (SEQ ID NO:41), where
  • V represents either A, G or C, and buffer and nucleotide components as specified in the accompanying manual.
  • the cycling conditions were typically: 1 cycle of 94°C for 2 minutes; 5 cycles of 94°C for 20 seconds, 54°C for 1 minute, 72°C for 1 minute; 30 cycles of 94°C for 20 seconds, 60°C for 30 seconds, 72°C for 1 minute; 1 cycle of 72°C for 5 minutes; 4°C hold. If no clear product band was visible in the expected size range after gel electrophoresis, the region of the gel was excised and DNA products purified from the gel. A sample of 1 ⁇ L of a 1 :20 dilution of the eluate was used as template in a second round of PCR. The amplicons generated in the reaction were ligated into pGEM-T Easy and sequenced.
  • Plasmids were introduced into yeast by heat shock and transformants were selected on yeast minimal medium (YMM) plates containing 2% raffmose as the sole carbon source. Clonal inoculum cultures were established in liquid YMM with 2% raffinose as the sole carbon source. Experimental cultures in were inoculated from these, in YMM + 1% NP-40, to an initial OD600 of - 0.3. Cultures were grown at 30°C with shaking ( ⁇ 60 rpm) until OD600 was approximately 1.0. At this point galactose was added to a final concentration of 2% and precursor fatty acids were added to a final concentration of 0.5 mM.
  • Genes were expressed in plant cells in a transient expression system essentially as described by Voinnet et al. (2003). Plasmids containing the coding region to be expressed from a strong constitutive promoter such as the 35 S promoter were introduced into Agrobacterium tumefaciens strain AGLl. A chimeric gene 35 S :p 19 for expression of the pl9 viral silencing suppressor was separately introduced into AGLl. The recombinant cells were grown at 28°C in LB broth supplemented with 50 mg/mL kanamycin and 50 mg/mL rifampicin to stationary phase.
  • the cells were then incubated at 28°C with shaking for 3 hours before equal volumes of Agrobacterium cultures containing 35S:pl9 and the test chimeric gene(s) of interest were mixed prior to infiltration into leaf tissue.
  • the plants were typically grown for a further five days after infiltration before leaf discs were taken for GC analysis of the fatty acids.
  • the fatty acids were prepared by heating the appropriate fatty acid in 2M ammonium hydroxide solution for 20 minutes at 60°C after which the solution was evaporated, also at 60°C. The resulting salt was then resuspended in 0.1M phosphate buffer (pH 7.2) to a final concentration of 0.5 ⁇ g/mL. The fatty acid salt was injected into the leaf four days after Agrobacterium infiltration and leaf discs taken at various time points after feeding, for example from 2-48 hours after addition of the exogenous fatty acid, for analysis of the fatty acid composition. Controls were included where the exogenous fatty acid was omitted, or where the Agrobacterium strain used for the infiltration did not contain the gene of interest.
  • FAME were analysed by gas chromatography (GC) using an Agilent Technologies 6890N GC (Palo Alto, California, USA) equipped with an EquityTM- 1 fused silica capillary column (15 m x 0.1 mm i.d., 0.1 ⁇ m film thickness), an FID, a split/splitless injector and an Agilent Technologies 7683 Series auto sampler and injector. Helium was used as the carrier gas. Samples were injected in splitless mode at an oven temperature of 120°C. After injection, the oven temperature was raised to 270°C at 10°CmUi -1 and finally to 310°C at 5°CmUi -1 . Peaks were quantified with Agilent Technologies ChemStation software (Rev B.03.01 (317), ⁇ Palo Alto, California, USA). Gas chromatography-mass spectrometry (GC-MS)
  • GC-MS was carried out on a Finnigan GCQ Plus GC-MS ion-trap fitted with on-column injection set at 4°C. Samples were injected using an AS2000 auto sampler onto a retention gap attached to an HP-5 Ultra 2 bonded-phase column (50 m x 0.32 mm i.d. x 0.17 ⁇ m film thickness). The initial temperature of 45°C was held for 1 minute, followed by temperature programming at 30°CmUi '1 to 140°C then at 3°C.min- 1 to 310°C where it was held for 12 minutes. Helium was used as the carrier gas.
  • Mass spectrometer operating conditions were: electron impact energy 70 eV; emission current 250 ⁇ amp, transfer line 310°C; source temperature 240°C; scan rate 0.8 scans. s 1 and mass range 40-650 Dalton. Mass spectra were acquired and processed with XcaliburTM software.
  • Plasmids were introduced into yeast by heat shock and transformants were selected on yeast minimal medium (YMM) plates containing 2% raffinose as the sole carbon source. Clonal inoculum cultures were established in liquid YMM with 2% raffinose as the sole carbon source. Experimental cultures in were inoculated from these, in YMM + 1% NP-40, to an initial OD 6 oo of - 0.3. Cultures were grown at 30°C with shaking ( ⁇ 60 rpm) until OU6oo was approximately 1.0. At this point galactose was added to a final concentration of 2% and precursor fatty acids were added to a final concentration of 0.5mM.
  • YMM yeast minimal medium
  • the Micromonas CS-0170 strain in the CSIRO Living Collection of Microalgae was identified as a microalgal strain that had a high native level of ⁇ 5- and ⁇ 6-elongation (Table 4).
  • Table 4 Conversion of fatty acids in the CSIRO Collection of Living Microalgae strains Micromonas CS-0170 and Pyramimonas CS-0140.
  • RT-PCR amplification was carried out using the Superscript III One-Step RT-PCR system (Invitrogen) in a volume of 50 ⁇ L using 20 pmol of each primer, MgSO 4 to a final concentration of 2.5 mM, 200 ng of Micromonas CS-0170 total RNA with buffer and nucleotide components as specified.
  • the cycling conditions were: initial 48°C for 30 minutes for reverse transcription, then 1 cycle of 94°C for 2 minutes, followed by 5 cycles of 94°C for 30 seconds, 40°C for 30 seconds, 70°C for 30 seconds; then 40 cycles of 94°C for 30 seconds, 45°C for 30 seconds, 70°C for 30 seconds and then 72°C for 2 minutes.
  • a 209 bp amplicon was generated, ligated into pGEM-T Easy and sequenced.
  • Primers were designed to extend the 209 bp fragment by 5'- and 3'-RACE.
  • the 3' end of the gene was isolated as described in Example 1 using the gene specific forward primer 5'-GAACAACGACTGCATCGACGC-3' (SEQ ID NO:44) and 200 ng of Micromonas CS-0170 total RNA.
  • a 454 bp amplicon was generated, ligated into pGEM-T Easy and sequenced.
  • the 5' end of the gene was isolated using the GeneRacer Kit (Invitrogen, catalogue #L1500-01) with a reverse-transcription incubation of 55°C for 1 hour to generate 5'-adapted cDNA as described in the accompanying manual.
  • CGACTGGAGC ACGAGGAC ACTGA-3' SEQ ID NO:45
  • gene specific reverse primer 5'-TTGCGCAGCACCATAAAGACGGT-3' SEQ ID NO:46
  • the cycling conditions were: 1 cycle of 94°C for 2 minutes; 35 cycles of 94°C for 20 seconds, 55°C for 30 seconds, 72°C for 30 seconds; then 72°C for 2 minutes before cooling to 4°C.
  • This product was then diluted 1 :10 and 1 ⁇ l used as template in a second round of PCR using the GeneRacer 5' Nested Primer 5'- GGACACTGACATGGACTGAAGGAGTA-3' (SEQ ID NO:47) and the gene specific reverse primer 5'-TTGCGCAGCACCATAAAGACGGT-3' (SEQ ID NO:46) using the same PCR conditions as used in the first round of amplification.
  • a 522 bp amplicon was generated, ligated into pGEM-T Easy and sequenced.
  • the nucleotide sequences of the three amplicons were assembled into one sequence which was predicted to be the full-length sequence.
  • the full length coding region with a short region of 5' UTR was then amplified from genomic DNA from Micromonas strain CS-0170 using forward primer 5'-CAGGCGACG CGCGCC AGAGTCC-3' (SEQ ID NO:48), reverse primer 5'- TTATTAGTTACTTGGCCTTTACCTTC-3' (SEQ ID NO:49) and PFU Ultra II Fusion DNA polymerase (Stratagene).
  • An 860 bp amplicon was generated, ligated into pGEM-T Easy and sequenced.
  • the sequence of the open reading frame of the gene is presented in having the sequence of SEQ ID NO: 1.
  • the full-length amino acid sequence encoded by the gene is presented as SEQ ID NO:2.
  • BLAST analysis of the protein sequence revealed that the isolated cDNA encoded either a ⁇ 5- or ⁇ 6-elongase. These two types of elongases are similar at the amino acid level and it was uncertain from amino acid sequence alone which activity was encoded.
  • the maximum degree of identity between the Micromonas CS-0170 elongase and other elongases was 65% with Accession No. CAL55414 which is the sequence for Ostreococcus tauri polyunsaturated fatty acid elongase 2.
  • the conserved GNS1/SUR4 family domain (NCBI conserved domain pfamO1151) is represented in this sequence at amino acids 49 to 274, which typically indicates that the protein is involved in long chain fatty acid elongation systems.
  • Cells of yeast strain INVSCl were transformed with pYES2+MicElol and transformants were selected on medium without uracil.
  • the yeast cells containing pYES2+MicElol were grown in culture and the GAL promoter induced by galactose for expression of the MicElol gene.
  • the degenerate primers 5'- AARATMTAYGAGTTYGTIGATAC-3' (SEQ ID NO:50) and 5'- T AIGTGT ACATGCACACRTGWACCC-3' (SEQ ID NO:51) (abbreviations as above) were synthesised based on the sequences of these two blocks.
  • An RT-PCR amplification was carried out using the Superscript III One-Step RT-PCR system with 100 ng of Pyramimonas CS-0140 total RNA.
  • a 191 bp amplicon was generated, ligated into pGEM-T Easy and sequenced. Isolation of a full length Pyramimonas CS-0140 ⁇ 6-elongase gene
  • Primers were designed to extend the 191 bp fragment by 5'- and 3'-RACE.
  • the 3' end of the gene was isolated using the gene specific forward primer 5'- TTCGTGGATACGTTCATCATGC-3' (SEQ ID NO:52) as described in Example 1.
  • a 945 bp amplicon was generated, ligated into pGEM-T Easy and sequenced.
  • the 5' end of the gene was isolated from 1 ⁇ g of Pyramimonas CS-0140 total RNA using the GeneRacer Kit with a reverse-transcription incubation of 55°C for 1 hour to generate 5 '-adapted cDNA as described in the accompanying manual.
  • the GeneRacer 5' Primer and the gene specific reverse primer 5'-AGTTGAGCGCCGCCGAGAAGTAC-3' were used in a PCR amplification using PFU Ultra II Fusion DNA polymerase. This product was then diluted 1 :10 and 1 ⁇ l used as template in a second round of PCR using the GeneRacer 5' Nested Primer 5'- GGACACTGACATGGACTGAAGGAGTA-3' (SEQ ID NO:47) and the gene specific reverse primer 5'-ACCTGGTTGACGTTGCCCTTCA-3' (SEQ ID NO:54) using the same PCR conditions as used in the first round of amplification. A 743 bp amplicon was generated, ligated into pGEM-T Easy and sequenced. The three partial sequences were then assembled into one predicted full length sequence.
  • the full length coding region with a short region of 5' UTR was then amplified from total RNA by RT-PCR.
  • the forward primer 5'- GCTATGGAGTTCGCTCAGCCT-3' (SEQ ID NO:55) and the reverse primer 5'- TTACTACTGCTTCTTGCTGGCCAGCT-3' (SEQ ID NO:56) were used with 100 ng of Pyramimonas CS-0140 total RNA.
  • a 900 bp amplicon generated, ligated into pGEM-T Easy and sequenced.
  • the nucleotide sequence of the open reading frame of the amplicon is given as SEQ ID NO: 3 and the amino acid sequence of the encoded protein is given as SEQ ID NO:4.
  • BLAST analysis indicated that the full-length amino acid sequence provided as SEQ ID NO:4) has similarity to other ⁇ 5- and ⁇ 6-elongases.
  • the maximum degree of identity between the Pyramimonas CS-0140 elongase and other proteins (BLASTX) was 54% with AAV67797, the Ostreococcus tauri polyunsaturated fatty acid elongase 1.
  • the conserved GNS1/SUR4 family domain (NCBI conserved domain pfamOl 151) is represented in this sequence at amino acids 52 to 297, which typically indicates that the protein is involved in long chain fatty acid elongation systems.
  • Cells of yeast strain INVSCl were transformed with pYES2+Pyrco-Elol and transformants were selected on medium without uracil.
  • the yeast cells containing pYES2+Pyrco-Elol were grown in culture and then induced by galactose to express the Pyrco-Elol cDNA.
  • Fatty acids were added to the culture medium to a final concentration of 0.5 mM and further cultured at 30°C for 48 hrs, after which the fatty acids in total cellular lipids were analysed.
  • ALA was added to the medium
  • ETrA in the cellular lipid of the yeast transformants
  • SDA was added to the medium
  • ETA in the cellular lipid of the yeast transformants was detected at 34.1%, representing 65.6% conversion efficiency, a high level of ⁇ 6-elongase activity.
  • the Pyramimonas CS-0140 strain in the CSIRO Living Collection of Microalgae was identified as a microalgal strain that had a high native level of ⁇ 5- and ⁇ 6-elongation (Table 4).
  • RT-PCR amplification was carried out using the Superscript III One-Step RT-PCR system as described in Example 1. 0.5 ⁇ l of this reaction was then used as template in a second round of PCR using Taq DNA polymerase (NEB) with the same primers. A 200 bp amplicon was generated, ligated into pGEM-T Easy and sequenced.
  • Primers were designed to extend the 200 bp fragment by 5'- and 3'-RACE.
  • the 3' end of the gene was isolated using the gene specific forward primer 5'- CATCATACCCTGTTGATCTGGTC-3' (SEQ ID NO:59) and an oligo-dT reverse primer as in Example 1.
  • a 408 bp amplicon was generated, ligated into pGEM-T Easy (Promega) and sequenced.
  • the 5' end of the gene was isolated from 1 ⁇ g of Pyramimonas CS-0140 total RNA using the GeneRacer Kit with a reverse-transcription incubation of 55°C for 1 hour to generate 5 '-adapted cDNA as described in the accompanying manual.
  • CCAGATCAACAGGGTATGATGGT-3' (SEQ ID NO:60) was used in the PCR amplification using PFU Ultra II Fusion DNA polymerase as specified by the manufacturer. This product was then diluted 1 : 10 and 1 ⁇ l used as template in a second round of PCR using the GeneRacer 5' Nested Primer 5'- GGACACTGACATGGACTGAAGGAGTA-3' (SEQ ID NO:47) and the gene specific reverse primer 5'-CGAAAGCTGGTCAAACTTCTTGCGCAT-3' (SEQ ID NO:61). A 514 bp amplicon was generated, ligated into pGEM-T Easy (Promega) and sequenced. The full length sequence was assembled from the three partial sequences.
  • the full length coding region with a short region of 5' UTR was then amplified from total RNA by RT-PCR.
  • AACATGGCGTCTATTGCGATTCCGGCT-3' (SEQ ID NO:62) and the reverse primer 5'-TTATTACTGCTTCTTGGCACCCTTGCT-3' (SEQ ID NO:63) were used in a RT-PCR amplification as described in Example 1.
  • An 810 bp amplicon was generated, ligated into pGEM-T Easy and sequenced.
  • the nucleotide sequence of the open reading frame of the insert as provided as SEQ ID NO:5, and the predicted amino acid sequence encoded by the cDNA is shown as SEQ ID NO:6.
  • BLAST analysis indicated that the full-length amino acid sequence had homology with other ⁇ 5- and ⁇ 6-elongases.
  • BLASTP analysis showed that the maximum degree of identity between the Pyramimonas CS-0140 elongase and other proteins in the Genbank database was 46%, with Accession No. ABR67690 corresponding to a Pavlova viridis C20 elongase.
  • a sequence relationship tree based on multiple alignment of sequences similar to the Pyramimonas CS-0140 elongase, including those used to design the original degenerate primers, is provided in Figure 5.
  • Cells of yeast strain INVSCl were transformed with pYES2+Pyrco-Elo2 and transformants were selected on medium without uracil.
  • the yeast cells containing pYES2+Pyrco-Elo2 were grown in culture and then induced by galactose to express the cDNA. After the addition of fatty acids to the culture medium and 48 hours of further culturing at 30°C, the fatty acids in cellular lipids were analysed.
  • the present inventors believe such efficient conversion of EPA to DPA in a recombinant cell has not been reported previously. It is predicted that the conversion efficiency in planta for this enzyme will be similarly high.
  • the conserved GNS1/SUR4 family domain (NCBI conserved domain pfamO1151) is represented in this sequence at amino acids 50 to 267, which typically indicates that the protein is involved in long chain fatty acid elongation systems.
  • the Micromonas CCMP 1545 predicted protein sequence was used to design and synthesize a codon-optimized nucleotide sequence that was most suitable for expression in dicotyledonous plants such as Brassica napus.
  • the nucleotide sequence of the protein coding region is given in SEQ ID NO:7.
  • the plasmid construct was designated pGA4.
  • the amino acid sequence is shown as SEQ ID NO:8.
  • This front-end desaturase contains a cytochrome b5 domain (NCBI conserved domain pfam00173) at amino acids 54 to 104 and the ⁇ 6- FADS-like conserved domain (NCBI conserved domain cd03506) at amino acids 172 to 428.
  • the three histidine boxes indicative of a front-end desaturase are present in this sequence at 190-195, 227-232 and 401-405, respectively. Proteins containing both of these domains are typically front-end desaturases required for the synthesis of highly unsaturated fatty acids.
  • this desaturase clusters closely with AAW70159, the only biochemically confirmed plant-like acyl-CoA desaturase published to date.
  • the entire coding region of the Micromonas desaturase, contained within a Kpnl-Sacl fragment from plasmid pGA4 was inserted into yeast vector pYES2 at the Kpnl-Sacl site, generating pYES2+Micd6D for introduction and functional characterisation in yeast.
  • Cells of yeast strain INVSCl were transformed with pYES2+Micd6D and transformants were selected on medium without uracil.
  • the yeast cells containing pYES2+Micd6D were grown in culture and then induced by galactose.
  • a vector designated 35S-pORE04 was made by inserting a Pstl fragment containing a 35 S promoter into the Sfol site of vector pORE04 after T4 DNA polymerase treatment to blunt the ends (Coutu et al., 2007).
  • a genetic construct 35S:Micl545-d6D was made by inserting the entire coding region of pGA4, contained within a Swal fragment, into 35S-pORE04 at the Smal-EcoRV site, generating pJP2064.
  • These chimeric vectors were introduced into Agrobacterium tumefaciens strain AGLl and cells from cultures of these infiltrated into leaf tissue of Nicotiana benthamiana plants in the greenhouse. The plants were grown for a further five days after infiltration before leaf discs were taken for GC analysis which revealed that both genes were functioning as ⁇ 6-desaturases in Nicotiana benthamiana.
  • Leaf tissue transformed with the Echium plantagineum ⁇ 6-desaturase contained GLA (0.4%) and SDA (1.2%), which represented conversion efficiencies of 3.8% and 4.4%, respectively.
  • Leaf tissue transformed with the Micromonas CCMP 1545 ⁇ 6- desaturase contained SDA (2.2%) which represented a conversion efficiency of 6.9% but no detectable GLA.
  • the absence of GLA in the leaf tissue could be due to an extreme preference in planta for the ⁇ 3 substrate ALA compared with the ⁇ 6 substrate LA, or in part to the presence of native Nicotiana benthamiana ⁇ 3 desaturase activity which would convert some of the GLA produced by ⁇ 6-desaturation to SDA.
  • Such effects have been noted as likely in previous experiments describing acyl-PC ⁇ 6- desaturases with ⁇ 3 substrate preference (Sayanova et al., 2006), although the extent to which this occurs was not quantified in that study.
  • the ⁇ 6-desaturase isolated from Micromonas had a surprisingly strong preference for ⁇ 3 substrates in planta as well as in yeast.
  • the enzyme expressed in yeast cells was observed to have 3.5-fold greater activity on ⁇ 3-desaturated fatty acid substrates than the corresponding ⁇ 6-desaturated fatty acid substrates.
  • the observed preference for ⁇ 3 substrates was entirely surprising and unexpected based on the reported lack of preference for the O. tauri enzyme (Domergue et al., 2005). Reports on expression of the O. tauri ⁇ 6-desaturase in yeast or in plant seed indicate similar activity on LA and ALA.
  • Micromonas CCMP 1545 ⁇ 6-desaturase displayed a significant level of ⁇ 8-desaturase activity and so had significant dual activities, in contrast to the Ostreococcus lucimarinus enzyme which did not have detectable ⁇ 8-desaturase activity (below).
  • the dual desaturase activity is predicted to be useful in the construction of dual ⁇ 6/ ⁇ 8-desaturase pathways in planta, or where the elongase that is used in construction of such pathways has both ⁇ 9-elongase and ⁇ 6- elongase activities.
  • the use of such a gene would help to reduce the accumulation of ETrA by converting it to ETA, which would then be ⁇ 5-desaturated to EPA.
  • GenBank database of non-redundant protein sequences was analysed by BLASTX using the Ostreococcus tauri ⁇ 6-desaturase nucleotide sequence (Accession No. AY746357) as the query sequence. From this analysis, an Ostreococcus lucimarinus gene was identified which encoded a partial-length protein with amino acid sequence of Accession No. XP OO 1421073. The genomic DNA sequences flanking the region coding for XP OO 1421073 were then examined to identify putative translation start and stop codons to define the full-length protein coding region, the nucleotide sequence of which is given as SEQ ID NO:9.
  • the coding region was then translated into a protein sequence, given as SEQ ID NO: 10. This amino acid sequence was used to design and synthesize a codon-optimized nucleotide sequence that was most suitable for expression in Brassica napus and other dicotyledonous plants, having the nucleotide sequence shown in SEQ ID NO: 11.
  • This front-end desaturase contained a cytochrome b5 domain (NCBI conserved domain pfam00173) at amino acids 55 to 108 and the ⁇ 6-FADS-like conserved domain (NCBI conserved domain cd03506) at amino acids 198 to 444.
  • the three histidine boxes indicative of a front-end desaturase are present in this sequence at amino acids 207-212, 244-249 and 417-421. Proteins containing both of these domains are typically front-end desaturases required for the synthesis of highly unsaturated fatty acids.
  • this desaturase clusters closely with AAW70159, the only biochemically confirmed plant-like acyl-CoA desaturase published to date.
  • Cells of yeast strain INVSCl were transformed with pYES2+Ostlud6D and transformants were selected on medium without uracil.
  • the yeast cells containing pYES2+Ostlud6D were grown in culture and then induced by galactose.
  • M. pusilla (Micromonas CCMP 1545) ⁇ 6-desaturase is capable of using acyl-CoA fatty acids as substrates and thereby producing ⁇ 6- desaturated acyl-CoA fatty acids
  • S. cerevisiae was transformed with a gene construct encoding the desaturase alone and triplicate cultures of the transformant cell lines grown in the presence of 250 ⁇ M exogenous 18:3 A9 ' 12 ' 15 .
  • Total lipids were then extracted from the cultures and fractionated into neutral lipids (NL), phosphatidylcholine (PC), phosphatidylinositol (PI), phosphatidylserine (PS) and phosphatidylethanolamine (PE) classes by thin layer chromatography (TLC), after which FAME were produced from each class and analysed by GC.
  • NL neutral lipids
  • PC phosphatidylcholine
  • PI phosphatidylinositol
  • PS phosphatidylserine
  • PE phosphatidylethanolamine
  • Table 8 Fatty acid composition (percent of total fatty acids) of total lipid and fractionated neutral lipids (NL), phosphatidylcholine (PC), phosphatidylinositol (PI), phosphatidylserine (PS) and phosphatidylethanolamine (PE) of S. cerevisiae transformed with the M. pusilla ⁇ 6-desaturase cloned into pYES2.
  • the gene encoding the M. pusilla ⁇ 6-desaturase was also introduced into Arabidopsis plants by transformation.
  • a genetic construct Linin:Micpu-d6D was generated by inserting the entire coding region of the M. pusilla ⁇ 6-desaturase, contained within a Swal fragment, into Linin-pWVEC8 at the Smal site, generating linP-micl545-d6D-linT.
  • the promoter for this construct was the seed-specific linin promoter from flax. This construct was transformed into A. thaliana ecotype Columbia and the fatty acid composition in T2 seeds of the transformed plants analysed by GC ( Figure 11).
  • the degenerate primers 5'-GGTGGAAGAACAAGCACAACrdncaycaygc-3' (SEQ ID NO:64) and S'-GGGCATCGTGGGGwanarrtgrtg-3' (SEQ ID NO:65) were designed using the CODEHOP program (Rose et al, 1998) based on the sequences of these two blocks.
  • a touchdown PCR amplification was carried out using Taq DNA polymerase (NEB) in a volume of 20 ⁇ L using 10 pmol of each primer, 50 ng of Pyramimonas CS- 0140 genomic DNA with buffer and nucleotide components as specified in the accompanying manual.
  • the cycling conditions were: 1 cycle of 94°C for 3 minutes; 20 cycles of 94°C for 1 minute, 70°C for 2 minutes (-1°C per cycle), 72°C for 1 minute; 20 cycles of 94°C for 1 minute, 55°C for 1 minute, 72°C for 1 minute; 1 cycle of 72°C for 5 minutes; 4°C hold.
  • a 551 bp amplicon was generated, ligated into pGEM-T Easy (Promega) and sequenced.
  • Primers were designed to extend the 551 bp fragment by 5'- and 3'-RACE and used as described in Example 1.
  • the 3' end of the cDNA for the gene encoding the ⁇ 5- desaturase was isolated using the gene specific forward primer 5'- AGCGAGTACCTGCATTGGGT-3' (SEQ ID NO:66) and the modified oligo-dT reverse primer as in Example 1.
  • a 477 bp amplicon was generated, ligated into pGEM- T Easy and sequenced.
  • the 5' end of the gene was isolated by the modified terminal- transferase method as in Example 1.
  • the gene specific reverse primer was 5'- ATAGTGCTTGGTGCGCAAGCTGTGCCT-3' (SEQ ID NO:67).
  • a 317 bp amplicon was generated, ligated into pGEM-T Easy (Promega) and sequenced. The three partial sequences were assembled into the predicted sequence of the full length gene.
  • the full length protein coding region with a short region of 5' UTR was then amplified from genomic DNA.
  • the forward primer 5'- CACCATGGGAAAGGGAGGCAATGCT-3' (SEQ ID NO:68) and the reverse primer 5'-TTACTAGTGCGCCTTGGAGTGAGAT-3' (SEQ ID NO:69) were used in a PCR amplification using PFU Ultra II Fusion DNA polymerase (Stratagene) in a volume of 20 ⁇ L using 4 pmol of each primer and 50 ng of Pyramimonas CS-0140 genomic DNA with buffer components as specified in the accompanying PFU Ultra II Fusion manual.
  • An 1336 bp amplicon representing the full-length cDNA was generated, ligated into pGEM-T Easy and sequenced.
  • the nucleotide sequence of the open reading frame of the cDNA is given in SEQ ID NO: 12.
  • BLAST analysis showed that the full-length amino acid sequence encoded by the gene, given as SEQ ID NO: 13, encoded a protein with similarity to known ⁇ 5- or ⁇ 6-desaturases. These two types of desaturases are similar at the amino acid level and it was uncertain from amino acid sequence alone which activity was encoded. Analysis of enzyme activity was carried out as described below, showing the encoded protein had ⁇ 5-desaturase activity. The highest degree of identity between the Pyramimonas CS-0140 desaturase and other desaturases in the Genbank database as determined by BLASTP was 52%, to Accession No. EDQ92231, which was the amino acid sequence of a protein with undefined enzyme activity from Monosiga brevicollis MXl.
  • This front-end desaturase contains a cytochrome b5 domain (NCBI conserved domain pfam00173) at amino acids 16 to 67 and the ⁇ 6-FADS-like conserved domain (NCBI conserved domain cd03506) at amino acids 159 to 411.
  • the three histidine boxes indicative of a front-end desaturase are present in this sequence at amino acids 175-180, 212-217 and 384-388. Proteins containing these domains are typically front-end desaturases required for the synthesis of multiply unsaturated fatty acids.
  • the enzyme activities of the Micromonas CCMP 1545 ⁇ 6-desaturase (SEQ ID NO:8 encoded by SEQ ID NO:7), Pyramimonas CS-0140 ⁇ 6-elongase (SEQ ID NO:4 encoded by SEQ ID NO:3) and Pyramimonas CS-0140 ⁇ 5-desaturase (SEQ ID NO: 13 encoded by SEQ ID NO: 12) along with the Arabidopsis thaliana DGATl (SEQ ID NO:74 encoded by SEQ ID NO:75) were demonstrated in planta using an enhanced Nicotiana benthamiana transient expression system as described in Example 1.
  • a genetic construct 35S:Pyrco-d5D encoding the ⁇ 5-desaturase under the control of the constitutive 35 S promoter was made by inserting the entire coding region of the Pyramimonas CS-0140 ⁇ 5-desaturase, contained within an EcoKl fragment, into 35S-pORE04 (Example 4, above) at the EcoRl site, generating 35S:Pyrco-d5D.
  • the chimeric vectors 35S:Micl545-d6D (Example 10), 35S:Pyrco-d6E (Example 10) and 35S:Pyrco-d5D were introduced individually into Agrobacterium tumefaciens strain AGLl and transgenic cells from cultures of these were mixed and the mixture infiltrated into leaf tissue of Nicotiana benthamiana plants in the greenhouse. The plants were grown for a further five days after infiltration before leaf discs were taken for GC analysis which revealed that these genes were functioning to produce EPA in Nicotiana benthamiana. Leaf tissue transformed with these genes contained SDA (1.0%), ETA (0.1%), EPA (10.0%). The leaf tissue also contained trace levels of GLA, ETA and ARA. The ⁇ 5-desaturase conversion efficiency was calculated to be 98.8%.
  • microalgal ⁇ 5-desaturases are capable of converting ETA to EPA with an efficiency of at least 90% or at least 95% in plant cells.
  • an alignment of desaturase amino acid sequences from Genbank accession numbers BAD91495, ABL63813, BADl 1952 and AAR20444 identified the consensus amino acid sequence blocks WCIGHDCG (SEQ ID NO:39) and TFLQHHDEDM (SEQ ID NO:40) corresponding to amino acid positions 106-113 and 296-305, respectively, of BAD91495.
  • the degenerate primers 5'- TGTGGTGCATCGGCCAYGANKSNGG-3' (SEQ ID NO:70) and 5'- TGTCCTCGTCGTTGTGCTGNARRWANGT-3' (SEQ ID NO:71) were designed using the CODEHOP program based on the sequences of these two blocks.
  • a touchdown PCR amplification was carried out using Taq DNA polymerase (NEB) in a volume of 20 ⁇ L using 10 pmol of each primer, 50 ng of Micromonas CS-0170 genomic DNA with buffer and nucleotide components as specified in the accompanying manual.
  • the cycling conditions were: 1 cycle of 94°C for 3 minutes; 20 cycles of 94°C for 1 minute, 70°C for 2 minutes (-1°C per cycle), 72°C for 1 minute; 35 cycles of 94°C for 1 minute, 56°C for 1 minute, 72°C for 1 minute; 1 cycle of 72°C for 5 minutes; 4°C hold.
  • a 528 bp amplicon was generated, ligated into pGEM-T Easy (Promega) and sequenced.
  • the nucleotide sequence of this amplicon is provided as SEQ ID NO: 14, and the encoded partial protein sequence is provided as SEQ ID NO:15.
  • the 528 bp fragment generated by degenerate PCR was compared with the completed Micromonas RCC299 filtered protein models genome sequence (produced by the US Department of Energy Joint Genome Institute http ://www.j gj ,doe. gov/).
  • BLAST analysis revealed regions of high homology between a region of Micromonas RCC299 chromosome 13 and SEQ ID NO: 14. Based on the near identity of the two sequences it was likely that the Micromonas strains CS-0170 and RCC299 were very closely related (nucleotide sequence of Micromonas RCC299 provided as SEQ ID NO: 16).
  • the Micromonas RCC299 predicted protein sequence (SEQ ID NO: 17) was used to design and synthesize a codon-optimized nucleotide sequence that was most suitable for expression in Brassica napus or other dicotyledonous plants (SEQ ID NO: 18). A shorter version of this gene starting at nucleotide of 164 of SEQ ID NO: 18 was tested in yeast but no ⁇ 3 desaturase activity was detected.
  • the 35S:Mic299-w3D construct was built by cloning the entire protein coding region of SEQ ID NO: 18, contained within an EcoRI fragment, into vector 35S- pORE04 (Example 4) at the EcoRI site, generating the genetic construct designated pJP2073.
  • the 35S:Phyin-dl7D construct was made by cloning the entire coding region of the Phytophthora infestans ⁇ 17 desaturase, contained within an EcoRI fragment, into 35S-pORE04 at the EcoRI site, generating pJP2074.
  • a 35S:Arath- DGATl construct was built by cloning the entire coding region of the Arabidopsis thaliana DGATl (AF051849), contained within an EcoRI fragment, into 35S-pOR ⁇ 04 at the EcoRI site, generating pJP2078.
  • the cells were then incubated at 28°C with shaking for 3 hours before equal volumes of Agrobacterium cells containing 35S:pl9, 35S:Arath-DGATl and either 35S:Phyin- dl7D or 35S:Mic299-w3D cultures were mixed prior to infiltration into leaf tissue.
  • An arachidonic acid salt was prepared and fed to the transformed leaf tissue as described above with leaf discs being taken for analysis at both 5 hours and 24 hours after substrate feeding.
  • the Micromonas RCC299 ⁇ 3 desaturase described in this study is the first microalgal, i.e. plant-like, ⁇ 17 desaturase described, having activity on a C20 or longer fatty acid substrate.
  • Land plants are not known to have ⁇ 3 desaturases of the front-end desaturase type, but rather of the FAD3 type. It was therefore surprising to find that a microalgal strain, which is more related to plants than fungi, possessed an ⁇ 3 desaturase of the front-end desaturase type.
  • substrate preference can be further examined by substrate feeding studies where substrates such as ARA fed to the transformed tissue will be immediately available to the acyl-CoA pool but available to the acyl-PC pool only after conversion by native plant (e.g. Nicotiana benthamiana) acyltransferases.
  • native plant e.g. Nicotiana benthamiana
  • the Micromonas RCC299 ⁇ 3 desaturase gene will be very useful in the construction of recombinant pathways designed to yield EPA and downstream fatty acids DPA and DHA, and other ⁇ 3 VLC-PUFA in plants, in particular because of its ability to convert ⁇ 6 substrates such as ARA to ⁇ 3 products.
  • Activity on acyl-CoA substrates enhances this usefulness when combined with elongases such as ⁇ 5- elongases that also operate in the acyl-CoA pool.
  • the fatty acid profile of Micromonas strains indicated that the Micromonas enzyme may also have the capability to convert ⁇ 6 C 18 fatty acids such as GLA or LA to their ⁇ 3 counterparts such as SDA or ALA, respectively. Conversion of GLA to SDA can be demonstrated in either yeast cells or in planta by substrate feeding as described above for substrate ARA, while conversion of LA to ALA is better demonstrated in yeast cells because of the presence of endogenous ⁇ 15 desaturases in plants.
  • the open reading frame sequence is provided in SEQ ID NO: 19 and the protein sequence is provided in SEQ ID NO:20.
  • Example 7 Isolation and characterisation of further genes encoding ⁇ 9-elongase from microalgae
  • the Emiliania huxleyi CCMP 1516 filtered protein models genome sequence produced by the US Department of Energy Joint Genome Institute (http ://www .j gi.doe. gov/) was analysed with the BLASTP program using the amino acid sequence of GenBank Accession No. AF390174 as the query sequence. This analysis revealed the presence of a predicted gene in Emiliania huxleyi CCMPl 516 that had homology with AF390174.
  • the protein sequence is provided in SEQ ID NO:28 and the encoding nucleotide sequence as SEQ ID NO:27.
  • BLAST analysis indicated that the full-length amino acid sequence has homology with PUFA elongases.
  • the maximum degree of identity between the Emiliania huxleyi CCMPl 516 elongase and other proteins was 80% with AF390174.
  • the conserved GNS1/SUR4 family domain (NCBI conserved domain pfamOl 151) was represented in this sequence, which typically indicated that the protein was involved in long chain fatty acid elongation systems.
  • the Emiliania huxleyi CCMPl 516 predicted protein sequence was used to design and synthesize a codon-optimized nucleotide sequence that was most suitable for expression in dicotyledonous plants such as Brassica napus (SEQ ID NO:29).
  • the plasmid construct was designated 0835668_Emihu-d9E_pMA.
  • a 641 basepair amplicon was generated from P. pinguis by RT-PCR, ligated into pGEM-T Easy ® and sequenced. Primers were designed to extend the 641 basepair fragment by 5'- and 3'-RACE, the 3' end of the gene being isolated by RT-PCR using the gene specific forward primer 5 '-GTCCTTGCTCCAGGGCTTCCACCA-3' (SEQ ID NO: 80) and the oligo-dT-SP6 reverse primer 5'- ATTTAGGTGACACTATAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-3' (SEQ ID NO:81).
  • This product was diluted 1 :10 and 1.0 ⁇ l used as template in a second round of PCR using Taq DNA polymerase (NEB) with the gene specific forward primer 5'- TTCCAGAACGAGGGCATCT ACGT-3' (SEQ ID NO:82) and the same reverse primer.
  • a 1079 basepair amplicon was generated, ligated into pGEM- T ® Easy and sequenced.
  • the 5' end of the gene was isolated from 1.0 ⁇ g of P. pinguis cDNA generated with the gene specific reverse primer 5'- TTGGGTGATCTGCATGAGCGTGATG-3' (SEQ ID NO:83) and A-tailed by terminal transferase.
  • This cDNA was then used as template for a PCR reaction using the oligo-dT-SP6 primer and the gene specific primer 5'- CGAAT ACTTGAAGAGCTTGTTGGAGA-3' (SEQ ID NO:84).
  • This product was diluted 1 :10 and 1.0 ⁇ l used as template in a second round of PCR using the oligo-dT- SP6 primer and the gene specific primer 5'-
  • GGGCT ACGAGCTGGCAGATGAAGC A-3' (SEQ ID NO: 85).
  • a 323 basepair amplicon was generated, ligated into pGEM-T ® Easy and sequenced. The full length sequence was assembled from the three partial sequences.
  • the full length coding region with a short region of 5' UTR was amplified from total RNA by RT-PCR using the forward primer 5 '-GAAAAAATGGTTGCGCCACCCATCA-3' (SEQ ID NO:86) and the reverse primer 5 '-TCACTACTTCTTCTTCTTGCCCGCGGC-3' (SEQ ID NO: 87).
  • a 425 basepair amplicon was generated from P. salina by PCR using the degenerate primers, ligated into pGEM-T Easy ® and sequenced. Primers were designed to extend the 425 basepair fragment by 5'- and 3'-RACE, the 3' end of the gene being isolated by RT-PCR using the gene specific forward primer 5'- TTCCGGTACTC AGCGGTGGCG-3' (SEQ ID NO:88) and the oligo-dT-SP6 reverse primer. A 776 basepair amplicon was generated, ligated into pGEM- T ® Easy and sequenced. The 5' end of the gene was isolated by PCR from the P.
  • the full length coding region with a short region of 5' UTR was amplified from total RNA by RT-PCR using the forward primer 5 '-CACCGAATGGCGACTGAAGGGATGCC-3' (SEQ ID NO:91) and the reverse primer 5 '-CTACTCGGTTTTCATGCGGTTGCTGGA-3' (SEQ ID NO:92).
  • An 846 basepair amplicon, Pavsa-Elo3, was generated and this was ligated into pGEM-T ® Easy and sequenced (SEQ ID NO:95).
  • the deduced amino acid sequence of the P. salina ⁇ 9-elongase is provided as SEQ ID NO:96.
  • chimeric vectors were introduced into Agrobacterium tumefaciens strain AGLl and cells from cultures of these infiltrated into leaf tissue of Nicotiana benthamiana plants in the greenhouse. The plants were grown for a further five days after infiltration before leaf discs were taken for GC analysis which revealed, by presence of the product fatty acid, that both genes were functioning as ⁇ 9-elongases in plant cells such as Nicotiana benthamiana.
  • Leaf tissue transformed with the Isochrysis galbana ⁇ 9- elongase contained 20:2 ⁇ 11 ' 14 (9.2%) and 20:3 ⁇ 11 ' 14 ' 17 (7.5%), which represented conversion efficiencies of 48.9% and 15.4%, respectively (Table 9).
  • the apparently high preference for the ⁇ 3 substrate ALA in the leaf tissue was expected since the bulk of the substrate ALA in N. benthamiana leaf is located in the plastid and thus unavailable for extra-plastidial elongation and since both the plastidial and cytoplasmic ALA are isolated from the leaf during direct methylation the ⁇ 3 conversion ratio artificially reduced.
  • the E. huxleyi and /. galbana ⁇ 9-elongases displayed identical substrate preferences in N. benthamiana with ⁇ 3 to ⁇ 6 conversion ratios of 0.31. The most efficient conversion in the ⁇ 6 pool was seen with the P. salina ⁇ 9-elongase with 56.0% of substrate being converted.
  • Example 8 Construction of a biosynthetic pathway including ⁇ 9 elongase to yield ARA
  • a binary vector containing the Isochrysis galbana ⁇ 9-elongase (amino acid sequence GenBank Accession No. AF390174 - open reading frame provided as SEQ ID NO:21, amino acid sequence as SEQ ID NO:22), Pavlova salina ⁇ 8-desaturase (Accession No. ABL96296 - open reading frame provided as SEQ ID NO:23, amino acid sequence as SEQ ID NO:24) and Pavlova salina ⁇ 5-desaturase (Accession No. ABL96295 - open reading frame provided as SEQ ID NO:25, amino acid sequence as SEQ ID NO:26) was constructed from the binary vector pJPlOlacq. The design of this vector without the gene inserts is shown schematically in Figure 14.
  • the Smal-EcoBN fragment of a pBluescript clone containing the Isochrysis galbana ⁇ 9-elongase was ligated into the Smal site of pJPlOlacq to yield pJP105.
  • the Xhol fragment of a pBluescript clone containing the Pavlova salina ⁇ 5-desaturase was ligated into the Xhol site of pJP105 to yield pJP106.
  • the Not! fragment of a pBluescript clone containing the Pavlova salina ⁇ 8-desaturase was ligated into the Not ⁇ site of p JP 106 to yield pJP107, which is shown schematically in Figure 15.
  • the 5'-UTR of each of the three genes was modified to include a TMV leader sequence which was known to provide for efficient translation. Any other 5'UTR sequence which is known to confer high translation efficiency could have been used instead of the TMV sequence.
  • pJP107 was introduced into Agrobacterium strain AGLI by electroporation and the transformed strain used to introduce the genetic construct into Arabidopsis thaliana, ecotype MC49, which was a fad3/fael mutant with high levels of LA as potential beginning fatty acid substrate for the ⁇ 8-desaturase. Plant transformation and analysis was carried out using the floral dipping method (Clough and Bent, 1998). Seeds (Tl seeds) from the treated plants (TO plants) were plated out on hygromycin (20 mg/L) selective media and transformed plants were selected and transferred to soil to establish 24 confirmed Tl transgenic plants. Most of these Tl plants were expected to be heterozygous for the introduced genetic construct.
  • T2 seed from the 24 transgenic plants were collected at maturity and analysed for fatty acid composition. These T2 lines included lines that were homozygous for the genetic construct as well as ones which were heterozygous. T2 plants were established from the T2 seed for the 6 lines containing the highest ARA levels, using selection on MS medium containing hygromycin (20 mg/mL) to determine the presence of the transgenes. For example, the T2 seeds were planted from the Tl plant designated FW-IO, containing 5.8% ARA and showing a 3:1 segregation ratio of resistant to susceptible progeny on the hygromycin medium, indicating that FW-IO contained the genetic construct at a single genetic locus. The fatty acid profiles of T3 seed lots from FW-10 were analysed and the data are presented in Table 10.
  • seed of untrans formed Arabidopsis contained significant amounts of the precursor ⁇ 6 substrate LA but did not contain any ARA or the intermediate fatty acids expected to occur along the ⁇ 9 elongase pathway.
  • seed from transformed plant FW 10-23 containing the pJP107 construct contained significant levels of 20:2n-6, 20:3n-6 and 20:4n-6 (ARA), including 21% ARA, the product of the three enzymatic steps starting with LA.
  • ARA 20:2n-6, 20:3n-6 and 20:4n-6
  • the product of the three enzymatic steps starting with LA was obtained.
  • the low level of ALA in the seedoil (1.0% in control MC49) was very efficiently converted to EPA, which was present at a level of 1.3% in transformed line FW 10-23. Discussion: Conversion efficiencies and biochemical implications
  • the relative efficiencies of the individual enzymatic steps encoded by the pJP107 construct could be assessed by examining the percentage conversion of substrate fatty acid to product fatty acids (including subsequent derivatives) in FW-IO- 23.
  • the Isochrysis galbana ⁇ 9 elongase showed 45% conversion of LA to EDA and subsequently desaturated fatty acids.
  • the Pavlova salina ⁇ 8-desaturase and ⁇ 5-desaturase showed conversion efficiencies of 90% and 95%, respectively of the ⁇ 6 fatty acids to their relevant products.
  • Pavlova salina ⁇ 8-desaturase was considerably more efficient in converting ETrA to ETA than other reported ⁇ 8-desaturases, in particular when co-expressed with the ⁇ 9 elongase and ⁇ 5 desaturase.
  • Elongases are known to only access substrates in the acyl-CoA pool.
  • transient expression of transgenes in leaves such as that first introduced by Kapila et al (1997).
  • nuclei of permissive leaf cells Zipfel et al., 2006
  • expression constructs within T DNA borders Expression of transgenes in leaves is significantly enhanced by the co-introduction of viral suppressor proteins, such as P19 (Voinnet et al., 2003) and HC-Pro (Johansen and Carrington, 2001; Kasschau et al., 2003), that inhibit the host cells' transgene silencing apparatus and extend transgene expression over a longer period of time.
  • Leaves have a complex lipid metabolism that is dominated by the large pools of plastidial galactolipids monogalactosyl diacylglycerols (MGDG) and digalactosyl diacylglycerols (DGDG). More minor pools of fatty acids exist outside the plastidial compartments including those esterified to phospatidylcholine (PC), coenzyme A (CoA) and mono- and di- acylglycerides (MAG, DAG; Ohlrogge and Browse, 1995).
  • PC phospatidylcholine
  • CoA coenzyme A
  • MAG, DAG phospatidylcholine
  • MAG mono- and di- acylglycerides
  • the enzymes of LC-PUFA synthesis used in this Example reside on the endoplasmic reticulum (ER; Napier, 2007) where they have access to the relatively minor leaf lipid pools esterified to PC and CoA.
  • TAG triacylglycerides
  • DGAT diacylglyceride-O-acyltrasferase
  • fatty acids residing on TAG are more metabolically inert and are less likely to re-enter lipid biosynthesis pathways or traffic into plastids.
  • TAG can be readily separated from the more abundant lipid classes residing in leaf plastids using standard thin-layer chromatography (TLC) techniques. Therefore a combination of enhanced TAG accumulation and TAG/lipid class purification could be helpful to more fully understand the LC-PUFA enzyme reactions on the leaf ER.
  • TLC thin-layer chromatography
  • Binary vectors were prepared by cloning the coding region of the gene into a modified version of the pORE04 binary vector described by Coutu et al (2007) in which the Cauliflower Mosaic Virus (CaMV) 35S promoter had been cloned into the Sfol site to yield 35S-pORE04.
  • the /. galbana ⁇ 9-elongase gene coding region (Genbank accession AAL37626) (SEQ ID NO:21) was amplified from genomic DNA cloned into 35S-pORE04 at the EcoRI site. Plant expression codon-optimised versions of the three P.
  • salina desaturases (Genbank accessions ABL96296, ABL96295 and AAY15136 - each described in WO 2005/103253) were cloned into the EcoRV-Smal sites of 35S-pORE04 as Swal inserts.
  • the non-optimised P. salina ⁇ 5-elongase (Genbank accession AAY15135) was cloned as an Xhol-Xbal fragment into 35S- pORE04 at the Xhol-Nhel sites.
  • a CaMV 35S-driven version of the P19 viral suppressor was kindly donated by Dr Peter Waterhouse. The A.
  • thaliana DGATl gene coding region (Genbank accession AAF 19262) (SEQ ID NO: 74) was obtained by RT- PCR and was cloned as a BamHI-EcoRV fragment into the corresponding sites in 35S- pORE04.
  • Total RNA was isolated from Phytophthora infestans using a RNeasy mini kit (QIAGEN) and Platinum Superscript III One-Step (QIAGEN) RT-PCR performed.
  • the resulting amplicon which contained the P. infestans ⁇ 17-desaturase protein coding region (WO 2005/012316) was cloned into pGEMT-Easy (Promega) and sequenced. The EcoRI fragment was then cloned into 35S-pORE04.
  • Agrobacterium tumefaciens strain AGLl harbouring each binary vector was grown at 28°C in LB broth supplemented with the appropriate antibiotics. Cultures were centrifuged and gently resuspended in two volumes of infiltration buffer (5 mM MES, 5 mM MgSO 4 , pH 5.7, 100 ⁇ M acetosyringone) and grown for a further 3 hours. Optical densities of each culture were measured and a final combination of cultures prepared so that each Agrobacterium construct equalled ODeoonm 0.2 or as otherwise indicated for Figure 16. The cells were infiltrated, as described by Voinnet et al. (2003), into the underside of leaves of one month-old N.
  • benthamiana plants that had been housed in a 23°C plant growth room with 10:14 lightdark cycle. Infiltrated areas were circled by a permanent marker. Following infiltration, the plants were left at 28°C for an hour after which they were transferred to a 24°C plant growth room until analysis. Unless otherwise indicated, all N. benthamiana agroinfiltrations were performed in the presence of a separate binary construct containing the P19 viral suppressor protein.
  • fatty acid profiles of leaf tissues, or lipid class samples were analysed in this Example by GC and GC-MS after transmethylating using a solution of methanol/ HCl/ dichloromethane (DCM; 10/1/1 by volume) at 80°C for 2 hr to produce fatty acid methylesters (FAME).
  • DCM methanol/ HCl/ dichloromethane
  • FAME fatty acid methylesters
  • lipid class analysis total lipids were extracted two times from approximately 50 mg fresh weight of infiltrated leaf tissue using the method described by Bligh and Dyer (1959).
  • Neutral lipids were purified by TLC on precoated silica gel plates (Silica gel 60, Merck) with hexane/ diethyl ether/ acetic acid (70/30/1 by vol.), while polar lipids were fractionated using two-dimensional TLC, chloroform/ methanol/ water (65/25/4 by vol.) for the first direction and chloroform/ methanol/ NH 4 OH/ ethylpropylamine (130/70/10/1 by vol.) for the second direction (Khozin et al., 1997).
  • the lipid spots were visualized by iodine vapour, collected into vials and transmethylated to produce FAME for GC analysis as described above.
  • TAG was quantified as the total amount of fatty acids present, which was estimated by GC analysis as mentioned above and according to known amount of external standards injected for each fatty acid.
  • GC was performed using an Agilent Technologies 6890N GC (Palo Alto, California, USA) equipped with a non-polar EquityTM- 1 fused silica capillary column (15 m x 0.1 mm i.d., 0.1 ⁇ m film thickness), an FID, a split/splitless injector and an Agilent Technologies 7683 Series autosampler and injector using helium as the carrier gas. Samples were injected in splitless mode at an oven temperature of 120°C and after injection the oven temperature was raised to 201°C at 10°CmUi '1 and finally to 270°C and held for 20 min.
  • Peaks were quantified with Agilent Technologies ChemStation software (Rev B.03.01 (317), Palo Alto, California, USA). Peak responses were similar for the fatty acids of authentic Nu-Check GLC standard-411 (Nu-Check Prep Inc, MN, USA) which contains equal proportions of 31 different fatty acid methyl esters, ranging from octanoate to DHA and several other LC-PUFAs. Slight variations of peak responses among peaks were balanced by multiplying the peak areas by normalization factors of each peak. The proportion of each fatty acid in total fatty acids was calculated on the basis of individual and total peaks areas of the fatty acids.
  • GC-MS was performed to confirm the identity of all new fatty acids formed and was carried out on a Finnigan GCQ Plus GC-MS ion-trap fitted with on-column injection set at 45°C.
  • Samples were injected using an AS2000 autosampler onto a retention gap attached to a non-polar HP-5 Ultra 2 bonded-phase column (50 m x 0.32 mm i.d. x 0.17 ⁇ m film thickness). The initial temperature of 45°C was held for 1 minute, followed by temperature programming an increase Of SO°CnIm '1 to 140°C then at 3°CmUi '1 to 310°C where it was held for 12 minutes. Helium was used as the carrier gas.
  • Mass spectrometer operating conditions were: electron impact energy 70 eV; emission current 250 ⁇ amp, transfer line 310°C; source temperature 240°C; scan rate 0.8 scans. s ⁇ l and mass range 40-650 Dalton. Mass spectra were acquired and processed with XcaliburTM software.
  • a gene was expressed which encodes the Isochrysis galbana ⁇ 9-elongase (Ig ⁇ 9elo; Qi et al., 2002), which was known to act on the CoA-linked linoleic acid (LA) and ALA substrates known to be abundant in N. benthamiana leaves.
  • LA CoA-linked linoleic acid
  • ALA substrates known to be abundant in N. benthamiana leaves.
  • this construct was agroinf ⁇ ltrated into N. benthamiana leaves in the presence of the P19 viral suppressor protein to suppress host-mediated transgene silencing and the level of ⁇ 9-elongation assessed.
  • Transient expression of the Arabidopsis thaliana DGATl resulted in the production of significantly more lipid bodies that were stained with Nile Blue and observed using confocal microscopy.
  • the increase in TAG was quantified by fractionating the total lipids into TAG, using neutral phase TLC separation from other leaf lipid classes, after which the amount of TAG was measured as the amount of total fatty acids in the TAG fraction.
  • Transient expression of P19 or P19 and ⁇ tDGATl together resulted in an increase in TAG from 46 ⁇ g.g '1 fresh weight to 206 ⁇ g.g '1 fresh weight, respectively, showing that addition of the DGATl gene increased the levels of TAG that accumulated in leaf tissue. Therefore, this gene was included in subsequent experiments unless indicated otherwise.
  • PsA5des P. salina ⁇ 5-desaturase
  • PsA5elo P. salina ⁇ 5-elongase
  • PsA4des P. salina ⁇ 4-desaturase
  • Ps ⁇ 5des P. salina ⁇ 5- desaturase
  • Ps ⁇ 5elo P. salina ⁇ 5 -elongase
  • Ps ⁇ 4des P. salina ⁇ 4-desaturase
  • saturated and minor fatty acids were not included in the table, but were used for calculation of percentages. (-) indicates no detectable amounts of fatty acid. Data are generated from 3 replicates and standard errors are shown.
  • N. benthamiana leaves transiently expressing the LC-PUFA pathway genes were subjected to lipid class fractionation as described above and their fatty acid profiles determined (Table 13).
  • N. benthamiana leaf lipids contain lipid classes and fatty acid profiles typical of leaves from higher plants (Fraser et al., 2004; Moreau et al., 1998).
  • Both newly-synthesised co6 and ⁇ 3 LC-PUFA were predominantly confined to lipid classes typically found outside the plastid while the plastidial lipids were essentially devoid of these fatty acids.
  • TAG and phospholipids (PC, PE and PA) - the dominant extraplastidial leaf lipids - contained up to 20.4% and 16.9 % of newly-synthesised ⁇ 6 and co3 LC-PUFA, respectively.
  • leaves expressing the full LC-PUFA pathways, ⁇ DGATl and P19 produced TAG enriched with 37% of LC-PUFA.
  • the accumulation of the nutritionally important fatty acids ARA, EPA and DHA present at 7.2%, 5.9% and 3%, respectively, in leaf TAG.
  • Lipid class fractionations were also used to calculate enzymatic efficiencies at each step of the LC-PUFA pathways that are associated with the ER for the fatty acids in TAG, which have no access to the plastidial lipids (Figure 17).
  • the removal of the plastidial lipid classes from these calculations had the most dramatic effect on the ⁇ 9- elongation step for ALA into ETrA, increasing the conversion efficiencies from 16% to 55%. This three-fold increase in the enzyme conversion efficiency at this step is due to the large pools of ALA in plastids that are unavailable to this ER-bound enzyme (Table 13).
  • transient expression of a series of pathway genes in N. benthamiana or other plant leaves mimicked expression in stably-transformed plants and was therefore well-suited and predictive of expression of the pathways in seeds for production of LC-PUFA oils.
  • the transient expression system provided an interchangeable expression platform that gave rapid and reliable results for the entire pathway, where single components could easily be exchanged in multi-step recombinant pathways.
  • the transient assembly of LC-PUFA biosynthesis was robust and reproducible. Assays were conducted in triplicate and produced tight data points, typically with a standard error less than 5%.
  • Lipid class analysis demonstrated that all of the newly-formed LC-PUFA were found in roughly equal ratios in both the PC pool and in TAG. There were slight variations in this ratio for the products of the second last step of the pathways, a ⁇ 5- elongation producing DTA and DPA, which were less abundant on TAG compared to PC. Conversely, the products of the final ⁇ 4 desaturation, DPA ⁇ 6 and DHA, were preferentially accumulated on TAG compared to PC. These variations may reflect subtle biases of the membrane editing enzymes or the AtDGATl for these products. It is worth noting that both ⁇ 5 -elongations and DGAT activities occur on CoA pools, and competition between these enzymes for substrate may alter the presence of fatty acids in these PC and TAG pools.
  • the transient leaf based assay was shown to be suitable for assaying fatty acid enzymes, either singly or in complex combinations. This is particularly apt for enzymes producing fatty acids that are easily distinguished from the endogenous fatty acid profile of N. benthamiana, such as the LC-PUFA in this study.
  • LC-PUFA oils are a current target of plant transformation technologies, leaf cells provide a range of advantages to other heterologous expression platforms.
  • Leaf cells provide a wide range of metabolites not available in other expression hosts, and these may now become targets for modification requiring recombinant pathways. Furthermore plants more faithfully process eukaryotic transgenes, including RNA editing, post-translation modifications and organelle localisation.
  • N. benthamiana assay could be suitable for cDNA library screening assays. This suggestion is based on the detection of near-maximal activity for seven different genes in a single infiltration zone on the leaf, suggesting that in this configuration cDNA libraries cloned within a binary expression vector could be systematically infiltrated into leaves. Calculations suggest that at least 7 different clones, including P19 at OD6oo nm 0.2, could be expressed in a single spot. Alternatively, genes forming incomplete or partial pathways could be added to each infiltration and thereby pooled library clones could be routinely tested for novel steps or improved fluxes.
  • the enzyme activities of the Micromonas CCMP 1545 ⁇ 6-desaturase (SEQ ID NO:8 encoded by SEQ ID NO:7), Pyramimonas CS-0140 ⁇ 6-elongase (SEQ ID NO:4 encoded by SEQ ID NO:3), Pavlova salina ⁇ 5-desaturase (SEQ ID NO:26 encoded by SEQ ID NO:25), Pyramimonas CS-0140 ⁇ 5-elongase (SEQ ID NO:6 encoded by SEQ ID NO:5) and Pavlova salina ⁇ 4-desaturase (SEQ ID NO:73 encoded by SEQ ID NO:72) along with the Arabidopsis thaliana DGATl (SEQ ID NO:74 encoded by SEQ ID NO:75) were demonstrated in planta using an enhanced Nicotiana benthamiana transient expression system as described in Example 1.
  • a genetic construct 35S:Micl545-d6D encoding the ⁇ 6-desaturase under the control of the constitutive 35 S promoter was made by inserting the entire coding region of pGA4, contained within a Swal fragment, into 35S-pORE04 (Example 4, above) at the Smal-EcoKV site, generating pJP2064.
  • a genetic construct 35S:Pyrco-d6E encoding the ⁇ 6-elongase was made by inserting the entire coding region of 0804673_Pyrco-elol_pGA18, contained within a Swal fragment, into 35S-pORE04 at the Smal-EcoBN site, generating pJP2060.
  • a genetic construct 35S:Pavsa-d5D encoding the ⁇ 5-desaturase was made by inserting the entire coding region of 0804674_Pavsa-d5D_pGA15, contained within a Swal fragment, into 35S-pORE04 at the Smal-EcoKV site, generating pJP2067.
  • a genetic construct 35S:Pyrco-d5E encoding the ⁇ 5-elongase was made by inserting the entire coding region of 0804675_Pyrco-elo2_pGA4, contained within a Swal fragment, into 35S-pORE04 at the Smal-EcoRV site, generating pJP2061.
  • a genetic construct 35S:Pavsa-d4D encoding the ⁇ 4-desaturase was made by inserting the entire coding region of 0804676_Pavsa-d4D_pGA15, contained within a Swal fragment, into 35S-pORE04 at the Smal-EcoRV site, generating pJP2068.
  • a genetic construct 35S:Arath-DGATl encoding the enzyme DGATl was made by inserting the entire coding region of pXZP513E, contained within a BamHl-EcoRV fragment, into 35S-pORE04 at the Bam ⁇ l-EcoRY site, generating pJP2078.
  • the conversion efficiencies were as follows: 17.4% of the ALA produced in the cell was converted to EPA (including EPA subsequently converted to DPA or DHA); 15.5% of ALA was converted to DPA or DHA; 9.6% of the ALA produced in the cell was converted to DHA; while 40% of the ALA produced in the cell that was ⁇ 6-desaturated was subsequently converted to DHA. Due to the transient expression of the transgenes in this experiment, higher efficiencies than the above would be expected in stably transformed cells.
  • This experiment also showed the use the Nicotiana benthamiana transient assay system for the rapid testing of various fatty acid biosynthesis pathways and for selecting optimal combinations of genes. This system could be used to rapidly compare the relative activities of genes with homologous function, as well as the comparison of entire biosynthetic pathways.
  • the enzyme activities of the Micromonas CCMP 1545 ⁇ 6-desaturase (SEQ ID NO:8 encoded by SEQ ID NO:7), Pyramimonas CS-0140 ⁇ 6-elongase (SEQ ID NO:4 encoded by SEQ ID NO:3), Pavlova salina ⁇ 5-desaturase (SEQ ID NO:26 encoded by SEQ ID NO:25), Pyramimonas CS-0140 ⁇ 5-elongase (SEQ ID NO:6 encoded by SEQ ID NO:5) and Pavlova salina ⁇ 4-desaturase (SEQ ID NO:73 encoded by SEQ ID NO:72) along with the Arabidopsis thaliana DGATl (SEQ ID NO:74 encoded by SEQ ID NO:75) were demonstrated in planta using an enhanced Nicotiana benthamiana transient expression system as described in Example 1 and Example 10. This experiment was optimised by using younger, healthier N. benthamiana plants.
  • the conversion efficiencies were as follows: 23.4% of the ALA produced in the cell was converted to EPA (including EPA subsequently converted to DPA or DHA); 21.6% of ALA was converted to DPA or DHA; 10.9% of the ALA produced in the cell was converted to DHA; while 37.2% of the ALA produced in the cell that was D6-desaturated was subsequently converted to DHA. Due to the transient expression of the transgenes in this experiment, higher efficiencies than the above would be expected in stably transformed cells.
  • Example 12 Transgenic assembly of an entire ALA to DHA pathway using genes from a single organism
  • the entire ALA to DHA pathway was reconstituted using genes encoding the enzymes from P. salina, consisting of the ⁇ 9-elongase, ⁇ 8-desaturase, ⁇ 5-desaturase, ⁇ 5-elongase and ⁇ 4-desaturase, and assembled in N. benthamiana.
  • GC analysis of the total leaf tissue five days after agroinfiltration demonstrated the production of 0.7% DHA (Table 17). This is the first time a transgenic pathway from ALA to DHA consisting of genes from a single organism has been reported.
  • Table 17 Fatty acid composition (percent of total fatty acids) of Nicotiana benthamiana leaf tissue transiently transformed with single-gene CaMV 35 S binary constructs.
  • the DHA pathway consists of the P. salina ⁇ 9-elongase, ⁇ 8-desaturase, ⁇ 5- desaturase, ⁇ 5-elongase and ⁇ 4-desaturase. Standard deviations between separate infiltrations performed in triplicate are indicated.
  • VSP viral suppressor proteins
  • P19 is a suppressor protein from Tomato Bushy Stunt Virus (TBSV) which binds to 21 nucleotide long siRNAs before they guide Argonaute-guided cleavage of homologous RNA (Voinnet et al., 2003).
  • TBSV Tomato Bushy Stunt Virus
  • V2 a suppressor protein from Tomato Yellow Leaf Roll Virus (TYLRV)
  • TYLRV Tomato Yellow Leaf Roll Virus
  • SGS3 Glick et al., 2008
  • P38 is a suppressor protein from Turnip Crinkle Virus (TCV) and inhibits the RNA dependent polymerase activity (RdRP) critical for the production of siRNA and binds to the Dicer protein DCL4 (Ding and Voinnet, 2007).
  • RdRP RNA dependent polymerase activity
  • PO proteins such as PePo and RPV-PO, from poleroviruses, target Argonaut proteins for enhanced degradation (Baumberger et al., 2007; Bortolamiol et al., 2007).
  • the five 35 S driven VSP constructs in Agrobacterium were co-infiltrated with a 35S-driven GFP construct into Nicotiana benthamiana leaves.
  • the presence of the VSP increased and extended expression of the GFP, conferring increased levels of GFP gene activity particularly after 4 days post-inoculation with the Agrobacterium strains, confirming the function of the proteins as silencing suppressors in this assay format.
  • VSP coding regions were each inserted into a second binary vector, pXRZ393, based on a pART27 backbone vector, so that expression of the VSPs was under the control of a seed-specific FPl promoter (Ellerstrom et al., 1996) providing expression of the VSPs in cotyledons of developing seed in dicotyledonous plants.
  • the constructs were used to generate transformed Arabidopsis plants according to the methods described in Example 1. At least 20 transformed plants were obtained for each chimeric gene encoding VSP. The plants were viable and phenotypically mostly normal as indicated by their growth on selection media and in soil, growing normally into fertile adult plants which set viable seed.
  • Plantlets transformed with the construct seed-specifically encoding P19 had flat club-shaped cotyledons with no downward curl distinctive of wild-type plantlets.
  • Plantlets transformed with the construct encoding PePo produced a 'ballerina' phenotype, where the cotyledons were up-ward pointing with an inward or concave curl. True leaves on these plants were normally developed.
  • Plantlets expressing RPV-PO were bushy, and tended to retain a bushy growth habit throughout vegetative growth. Plantlets of V2 and P38 displayed no apparent, significant phenotype.
  • VSP-related changes in cotyledon development do not impact on the overall development of the transgenic plants, and the normal subsequent growth and development of the plants indicated that any leaky expression of VSPs from the FPl promoter in tissues other than the developing seed was minor and insignificant. This was in contrast to previous studies where constitutive expression of many VSPs in plant tissues was highly deleterious (Mallory et al., 2002; Chapman et al., 2004; Chen et al., 2004; Dunoyer et al., 2004; Zhang et al., 2006; Lewsey et al., 2007: Meng et al., 2008).
  • VSPs V2 and P38 may reflect that these VSPs target small RNA metabolism in ways that do not affect developmental small RNA biogenesis or recognition.
  • the functionality of each VSP was checked using a GFP assay in Nicotiana benthamiana.
  • Example 13 The data described in Example 13 indicated that seeds, and the subsequent progeny plants, could tolerate the expression of VSPs from seed-specific promoters without significant deleterious effects.
  • the inventors also considered whether the transformed plants generated as described above were expressing only low levels of the VSPs, thereby allowing the seed to survive, effectively selecting against transformed seeds potentially expressing lethal amounts of VSP which would therefore not be recovered under the conditions used.
  • a visual marker of transformation and expression was developed for use in transgenic seed.
  • Arabidopsis seeds as for other dicot seeds contain a paternal embryo and endosperm surrounded by a maternal seed coat.
  • paternal tissue becomes transformed by the T-DNA whilst the maternal tissue remains untransformed.
  • Transformed maternal tissue is not obtained until the production of T2 seed of the next generation.
  • GFP green fluorescent protein
  • a chimeric gene encoding a secreted GFP was constructed as follows. The gene contained two introns, one in the 5 'untranslated region (5'UTR) and a second in the protein coding region of GFP. These introns were included to enhance expression of the chimeric gene (Chung et al., 2006) and to ensure that any GFP signal detected in the seeds could only result from expression of the gene in plant cells rather than leaky expression from the Agrobacterium cells.
  • chimeric GFP gene was performed by gene synthesis for the 5 ' region and PCR-mediated sequence modifications for the C-terminal glycine additions.
  • the coding region for this secreted GFP was inserted downstream of a FPl promoter which had an intron from a catalase gene in the 5'UTR.
  • the entire FPl -secreted GFP sequence was inserted upstream of a nos3' polyadenylation signal within a pORE series binary vector.
  • the construct containing the chimeric gene encoding the secreted GFP was designated pCW141.
  • the gene region encoding the secreted GFP sequence but without the FPl promoter or the 5'UTR of pCW141 was subcloned into a pCaMV35S-OCS3' expression cassette, to produce pCW228, and introduced by Agrobacterium-mediated transformation into N. benth ⁇ mi ⁇ n ⁇ leaves. Expression of the gene and secretion of GFP protein was confirmed using confocal microscopy (Leica).
  • pCW141 was introduced into plants of Ar ⁇ bidopsis CoI-O ecotype via Agrobacteria-mediated methods as described in Example 1. Seeds from Ar ⁇ bidopsis plants dipped with pCW141, the FPl -driven secreted GFP construct, were collected and screened for GFP-positive seeds using a dissecting microscope equipped for fluorescence detection (Leica MFZIII). Seeds that fluoresced green were easily identified even though the vast majority of Tl seeds in the populations were untransformed. These GFP-positive seeds were selected and grown on selective media to confirm the presence of the kanamycin-resistance selectable marker gene linked to the chimeric gene construct on the T-DNA. A further 20 positive seed were pooled and the expression of GFP protein was confirmed by Western Blotting using an antibody against GFP.
  • These binary vectors each had linked chimeric genes for the expression of a VSP and the secreted GFP, and thereby allowed transgenic seed transformed with the constructs to be identified, selected and analysed by the GFP phenotype without growth on selective media. It was expected that in the majority of transformants, the gene encoding the VSP would be integrated and therefore linked with the gene encoding GFP.
  • Such seeds might have been expected if some transformation events gave rise to cells in the developing seeds in which the expression levels of VSP was too high and caused lethality.
  • the absence of such seeds in the transformed populations indicated that the VSP expression was tolerated in seeds when expressed from the FPl promoter.
  • the absence of such deleterious effects was in contrast to reports of deleterious effects when many VSPs were expressed constitutively (Mallory et al., 2002; Chapman et al., 2004; Chen et al., 2004; Dunoyer et al., 2004; Zhang et al., 2006; Lewsey et al., 2007: Meng et al., 2008).
  • GFP visually-detectable marker
  • GFP expression was quantified in Tl and T2 seed expressing VSP from FPl promoter using fluorescent microscopy and digital image analysis. These analyses clearly showed that GFP expression was not affected by the co-introduction of a gene encoding VSP under the control of the developing cotyledon-specific promoter. Extended studies on the performance of GFP-VSP constructs over subsequent generations and in independent transformation events will be analysed. It is predicted that the presence of the VSP will result in more stable and higher average levels of expression in successive generations of seed.
  • VSPs are capable of protecting or enhancing transgene performance in seeds
  • some expression vectors were designed that were considered to be more prone to host-mediated suppression (silencing) than a vector with only a single gene, to increase the relative effectiveness of the VSPs.
  • a series of vectors each containing five destaurase or elongase genes for DHA synthesis in seeds were constructed, using the same configuration of the genes in each.
  • One factor that was thought to make these constructs more prone to silencing (reduced expression) was the use of the same promoter (FPl) to drive each gene.
  • the FPl promoter was used as it was relatively small and reduced the overall vector size and the spacing between each coding region.
  • each gene cassette had the same orientation, which we considered would enhance the likelihood of silencing.
  • Three genes of the LC-PUFA pathway had coding regions which had been codon-optimised (A-B-C) for optimal plant expression while two (E-D) were native sequences as obtained from the microalgae.
  • the same suite of five genes had previously been expressed in leaves to produce assemble a complete LC-PUFA biosynthetic pathway (Example 11).
  • a further gene encoding the VSP P19 was included in the first vector of the series, a gene encoding V2 was included in the second vector, while the third vector in the series had no VSP.
  • vectors pJP3057 ( Figure 19), pJP3059 ( Figure 20) and ( Figure 21) were constructed and transformed in parallel as follows. Desaturase or elongase genes or viral suppressor genes were first cloned between a FPl promoter and nos terminator contained within a cloning vector. The promoter-gene-terminator cassettes were then cloned sequentially and in the same orientation into a binary vector backbone. pJP3057 contained the entire DHA pathway whilst pJP3059 and pJP3060 differed only in the addition of a FP1-P19-NOS or FP1-V2-NOS cassette, respectively. The construction steps were as follows.
  • an Ascl-Pacl fragment containing the Micromonas pusilla ⁇ 6-desaturase was cloned into the Ascl-Pacl site of pJP2015 before a Swal fragment from this vector containing the entire promoter-gene-terminator cassette was cloned into the EcoRV site of pORE02 to generate pJP3050.
  • an Ascl-Pacl fragment containing the Pyramimonas cordata ⁇ 6-elongase was cloned into the Ascl-Pacl site of pJP2015TMV (a slightly modified version of pJP2015 where the TMV leader was present downstream of the promoter and upstream of the gene) before a Swal fragment from this vector containing the entire promoter-gene-terminator cassette was cloned into the T4 DNA polymerase-treated Sad site of pJP3050 to generate pJP3051.
  • an Ascl-Pacl fragment containing the Pavlova salina ⁇ 5 -desaturase was cloned into the Ascl-Pacl site of pJP2015TMV before a Swal fragment from this vector containing the entire promoter-gene-terminator cassette was cloned into the Smal site of pJP3051 to generate pJP3052.
  • an Ascl-Pacl fragment containing the Pavlova salina ⁇ 5- desaturase was cloned into the Ascl-Pacl site of pJP2015TMV before a Swal fragment from this vector containing the entire promoter-gene-terminator cassette was cloned into the Smal site of pORE02 to generate pJP3054.
  • an Ascl-Pacl fragment containing the Pyramimonas cordata ⁇ 5-elongase was cloned into the Ascl-Pacl site of pJP2015TMV before a Swal fragment from this vector containing the entire promoter- gene-terminator cassette was cloned into the Stul site of pJP3054 to generate pJP3055.
  • an Ascl-Pacl fragment containing the Pavlova salina ⁇ 4-desaturase was cloned into the Ascl-Pacl site of pJP2015TMV before a Swal fragment from this vector containing the entire promoter-gene-terminator cassette was cloned into the Sfol site of pJP3056 to generate pJP3056.
  • the Pmel-Notl fragment of pJP3056 was then cloned into the Pmel-Notl site of pJP3051 to generate pJP3057, a binary vector containing the five genes for production of DHA from ALA.
  • an Ascl-Pacl fragment containing the chimeric gene encoding the P19 viral suppressor was cloned into the Ascl-Pacl site of pJP2015TMV before a Swal fragment from this vector containing the entire promoter-gene-terminator cassette was cloned into the Zral site of pJP3057 to generate pJP3059.
  • an Ascl-Pacl fragment containing the chimeric gene encoding the V2 viral suppressor was cloned into the Ascl-Pacl site of pJP2015TMV before a Swal fragment from this vector containing the entire promoter-gene-terminator cassette was cloned into the Zral site of pJP3057 to generate pJP3060.
  • the transformed plants (Arabidopsis thaliana, ecotype Columbia) generated with the three constructs pJP3057, pJP3059 and pJP3060 were self-fertilised and Tl seeds were collected. These were sown on kanamycin-containing media to determine heterozygosity/homozygosity of the Tl plants, and the resultant T2 seed from each of the Tl plants were analysed for general morphological changes and LC-PUFA synthesis (Table 18).
  • Representative T2 seed of plants transformed with pJP3057 contained, in the total fatty acid in the seedoil, SDA (0.4%), ETA (0.6%), EPA (0.2%), DPA (0.3%) and DHA (2.4%).
  • the seedoil of the T2 plants also contained GLA (1.4%) and trace levels of ETrA and ARA.
  • the conversion efficiencies in the seed were as follows: 18.4% of the ALA produced in the cell was ⁇ 6-desaturated; 89.7% of the SDA produced in the cell was ⁇ 6-elongated; 82.9% of the ETA in the cell was ⁇ 5-desaturated; 93.1% of the EPA in the cell was ⁇ 5-elongated; 88.9% of the DPA in the cell was ⁇ 4-desaturated to produce DHA (Table 18).
  • T2 seed of plants transformed with pJP3059 contained SDA (0.7%), ETA (0.3%), EPA (0.2%), DPA (0.9%) and DHA (1.3%).
  • the seedoil also contained GLA (0.8%) and trace levels of ETrA and ARA.
  • the conversion efficiencies were as follows: 15.7% of the ALA produced in the cell was ⁇ 6-desaturated; 79.4% of the SDA produced in the cell was ⁇ 6-elongated; 88.9% of the ETA in the cell was ⁇ 5- desaturated; 91.7% of the EPA in the cell was ⁇ 5-elongated; 59.1% of the DPA in the cell was ⁇ 4-desaturated to produce DHA (Table 18).
  • Table 18 Representative fatty acid profiles of T2 Arabidopsis seeds transformed with pJP3057, pJP3059, JP3060.
  • Representative T2 seed of plants transformed with pJP3060 contained SDA (0.6%), ETA (0.7%), EPA (0.3%), DPA (0.2%) and DHA (1.0%).
  • the seedoil also contained trace levels of GLA, ETrA and ARA.
  • the conversion efficiencies were as follows: 13.3% of the ALA produced in the cell was ⁇ 6-desaturated; 78.6% of the SDA produced in the cell was ⁇ 6-elongated; 68.2% of the ETA in the cell was ⁇ 5- desaturated; 80.0% of the EPA in the cell was ⁇ 5-elongated; 83.3% of the DPA in the cell was ⁇ 4-desaturated to produce DHA (Table 18).
  • the presence of the silencing suppressor in the constructs pJP3057 and pJP3059 increased both the total level of the new fatty acids in the seedoil, and the level of the final product of the pathway, DHA.
  • introduced exogenous nucleic acids can be detected by plants as foreign DNA or RNA leading to reduced expression due to host- mediated transgene suppression mechanisms. These suppression mechanisms may target transgenes via the biogenesis of small RNA populations, and these small RNAs guide the suppression apparatus to limit expression of the transgene (Matzke et al., 2001). Transgene expression can be limited in various ways including direct modifications of the DNA at the site of insertion in the chromosome, such as by methylation, or by post-transcriptional silencing at the RNA (Hamilton and Baulcombe, 1999; Voinnet et al., 2003) or protein (Brodersen et al., 2008) level.
  • VSP viral suppressor proteins
  • VSP expression such as P19 and PePo after embryogenesis
  • endogenous developmental signals at least those using small RNAs
  • the four VSPs chosen for this study are likely to act upon different parts of the small RNA biogenesis and therefore function to different extents.
  • the same expression cassettes can be used repeatedly with less requirement to avoid sequence repetition between regulatory sequences or coding regions. This feature therefore can allow large multi-gene expression vectors to be built using the same promoter- polyadenylation signals.
  • multiple copies of a single gene can be used to increase expression levels with reduced likelihood or extent of silencing effects occurring, or with increased stability of expression over plant generations.
  • a chimeric vector, designated 35S:LEC2 was generated by cloning a codon-optimised Arabidopsis thaliana LEAFY COTYLEDON2 (Arath-LEC2) gene into the EcoRl site of 35S:pORE04.
  • the 35S:LEC2 construct was introduced separately into Agrobacterium tumefaciens strain AGLl.
  • Transgenic cells from separate cultures of AGLl containing either pJP3057 or 35S:LEC2 were mixed and the mixture infiltrated into leaf tissue of Nicotiana benthamiana plants.
  • the plants were grown for a further four days after infiltration before leaf discs were taken for GC analysis of the total fatty acids in the leaf lipid, and of separated lipid fractions. This revealed that these genes were functioning to produce DHA in Nicotiana benthamiana (Table 19).
  • Leaf tissue transformed with these genes contained SDA (1.2%), ETA (2.0%), EPA (0.6%), DPA (1.7%) and DHA (2.5%).
  • the leaf tissue also contained GLA (2.4%) and trace levels of other long-chain ⁇ 6 fatty acids.
  • the chimeric vectors pJP3115 and pJP3116 (Example 17) were introduced into Agrobacterium tumefaciens strain AGLl.
  • Transgenic cells from four separate cultures of AGLl containing one of pJP3115, pJP3116, 35S:P19 and 35S:LEC2 were mixed and the mixture infiltrated into leaf tissue of Nicotiana benthamiana plants.
  • the plants were grown for a further four days after infiltration before leaf discs were taken for GC analysis which revealed that these genes were functioning to produce DHA in Nicotiana benthamiana (Table 19).
  • Leaf tissue transformed with these genes contained SDA (5.6%), ETA (1.4%), EPA (0.2%), DPA (1.7%) and DHA (2.4%).
  • the leaf tissue also contained trace levels of long-chain ⁇ 6 fatty acids.
  • the vector pJP3115 ( Figure 22) was constructed as follows. First, the Sbfi-Apal fragment of vector pJPlOlacq ( Figure 14) was cloned into the Pstl-Apal site of pORE03 to yield pJP3011. Next, a Swal fragment containing the codon-optimised Micromonas pusilla ⁇ 6-desaturase (SEQ ID NO: 125) was cloned into a T4 DNA polymerase-treated Xhol site in pJP3011 to yield pJP3108.
  • a Swal fragment containing the codon-optimised Pavlova salina ⁇ 5-desaturase was then cloned into a T4 DNA polymerase-treated Notl site in pJP3108 to yield pJP3109.
  • a Swal fragment containing the codon-optimised Pyramimonas cordata ⁇ 6-elongase was cloned into the Smal site in pJP3109 to yield pJP3110.
  • the construct was then converted from a BASTA-resistant construct into a kanamycin- resistant construct by cloning the BsiWl-AsiSl fragment of pJP3110 into the BsiWl- AsiSl site of pORE04, yielding pJP3111.
  • An Ncol (T4 DNA polymerase-treated)- ⁇ /! fragment containing the truncated napin promoter FPl and the Crepis palestina ⁇ 12- desaturase was cloned into the EcoBN-Pstl site in pJP3111 to yield pJP3115.
  • the vector pJP3116 ( Figure 23) was constructed as follows. First, a Swal fragment containing the codon-optimised Pyramimonas cordata ⁇ 5-elongase (SEQ ID NO: 128) was cloned into a T4 DNA polymerase-treated Xhol site in pJP3011 to yield pJP3112. A Swal fragment containing the codon-optimised Pavlova salina ⁇ 4- desaturase (SEQ ID NO: 129) was cloned into the Smal site in pJP3112 to yield pJP3113.
  • a Notl fragment containing the Perilla frutescens ⁇ 15-desaturase was then cloned into the Notl site in pJP3113 to yield pJP3114.
  • the construct was then converted from a BASTA-resistant construct into a hygromycin-resistant construct by cloning a Xbal-Mlul fragment containing an hygromycin resistance cassette (consisting of the Cauliflower mosaic virus 35 S promoter followed by the CAT-I intron- interrupted hygromycin B phosphotransferase gene obtained from the binary vector pWVEC8 and the ⁇ OS terminator) into the Avrll-Mlul site of pJP3114 to yield pJP3116.
  • the chimeric vectors pJP3115 and pJP3116 were introduced individually into Agrobacterium tumefaciens strain AGLl and transgenic cells from cultures of these were mixed with AGLl transformed with 35S:P19 and the mixture infiltrated into leaf tissue of Nicotiana benthamiana plants in the greenhouse. The plants were grown for a further five days after infiltration before leaf discs were taken for GC analysis which revealed that these genes were functioning to produce DHA in Nicotiana benthamiana (Table 20). Leaf tissue transformed with these genes contained SDA (5.6%), ETA (1.4%), EPA (0.2%), DPA (1.7%) and DHA (2.4%). The leaf tissue also contained trace levels of GLA, ETA and ARA.
  • the conversion efficiencies were as follows: 98.9% of the oleic acid in the cell was ⁇ 12-desaturated (not significantly different from the control sample); 95.4% of the LA in the cell was ⁇ 15-desaturated; 18.1% of the ALA produced in the cell was ⁇ 6-desaturated; 50.4% of the SDA produced in the cell was ⁇ 6-elongated; 75.4% of the ETA in the cell was ⁇ 5-desaturated; 95.4% of the EPA in the cell was ⁇ 5-elongated; 58.5% of the DPA in the cell was ⁇ 4-desaturated to produce DHA.
  • Tl seeds will be collected and analysed for general morphological changes and levels of LC-PUFA synthesis.
  • Table 20 Fatty acid composition (percent of total fatty acids) of Nicotiana benthamiana leaf tissue transiently transformed with various constructs. Errors denote standard deviation between separate infiltrations performed in triplicate.
  • pJP3115 and pJP3116 were designed to provide, in combination, all of the genes for production of DHA, namely the two recombinant vectors complement each other to constitute the pathway.
  • the fatty acid produced by the ⁇ 12-desaturase encoded by pJP3115 was used as substrate by the ⁇ 15-desaturase encoded by pJP3116 which also contained genes for the subsequent ⁇ 6-desaturase, ⁇ 6-elongase and ⁇ 5-desaturase.
  • the combination of stable transformations of these constructs, either by super-transformation or by crossing two transgenic lines, will result in a transgenic plant containing the full complement of genes required for DHA synthesis.
  • construct pJP3115 contained four genes expressed in an inverted format i.e. two genes in one orientation and two genes in the other, so that the pairs of genes were transcribed in a divergent fashion (away from each other).
  • construct pJP107 Example 8
  • Example 18 Isolation and characterisation of a gene encoding a microalgal DGAT2

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Neurology (AREA)
  • Diabetes (AREA)
  • Neurosurgery (AREA)
  • Virology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Nutrition Science (AREA)
  • Hematology (AREA)
  • Rheumatology (AREA)
  • Psychiatry (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
PCT/AU2009/001488 2008-11-18 2009-11-17 Enzymes and methods for producing omega-3 fatty acids Ceased WO2010057246A1 (en)

Priority Applications (27)

Application Number Priority Date Filing Date Title
US13/129,940 US8809559B2 (en) 2008-11-18 2009-11-17 Enzymes and methods for producing omega-3 fatty acids
NO09827035A NO2358882T3 (enExample) 2008-11-18 2009-11-17
BR122021003836-8A BR122021003836B1 (pt) 2008-11-18 2009-11-17 Polinucleotídeo isolado e/ou exógeno que não ocorre de forma natural, vetor e método para produzir óleo contendo ácidos graxos insaturados
CN202111172382.2A CN113957105B (zh) 2008-11-18 2009-11-17 产生ω-3脂肪酸的酶和方法
AU2009317860A AU2009317860B2 (en) 2008-11-18 2009-11-17 Enzymes and methods for producing omega-3 fatty acids
BRPI0921467-4A BRPI0921467B1 (pt) 2008-11-18 2009-11-17 Processo para a produção de óleo compreendendo ácido eicosapentaenóico (epa), ácido docosapentaenóico (dpa) e ácido docosahexaenóico (dha)
NZ593097A NZ593097A (en) 2008-11-18 2009-11-17 Enzymes and methods for producing omega-3 fatty acids
ES09827035.8T ES2644883T3 (es) 2008-11-18 2009-11-17 Enzimas y métodos para producir ácidos grasos omega-3
EP09827035.8A EP2358882B1 (en) 2008-11-18 2009-11-17 Enzymes and methods for producing omega-3 fatty acids
CN2009801548769A CN102317459A (zh) 2008-11-18 2009-11-17 产生ω-3脂肪酸的酶和方法
CA2743880A CA2743880C (en) 2008-11-18 2009-11-17 Recombinant cells comprising exogenous a5 elongase and methods for producing docosapentaenoic acid
EP17182502.9A EP3260544B1 (en) 2008-11-18 2009-11-17 Enzymes and methods for producing omega-3 fatty acids
BR122021003835-0A BR122021003835B1 (pt) 2008-11-18 2009-11-17 Polinucleotídeo isolado e/ou exógeno que não ocorre de forma natural, vetor compreendendo o referido polinucleotídeo e método de produção de óleo contendo ácidos graxos insaturados
CN202111172412.XA CN113957054B (zh) 2008-11-18 2009-11-17 产生ω-3脂肪酸的酶和方法
DK09827035.8T DK2358882T3 (da) 2008-11-18 2009-11-17 Enzymer og fremgangsmåder til fremstilling af omega-3 fedtsyrer
JP2011535839A JP6068800B2 (ja) 2008-11-18 2009-11-17 オメガ−3脂肪酸を産生するための酵素および方法
US14/332,202 US9938486B2 (en) 2008-11-18 2014-07-15 Enzymes and methods for producing omega-3 fatty acids
US15/642,223 US10648046B2 (en) 2008-11-18 2017-07-05 Enzymes and methods for producing omega-3 fatty acids
US15/644,635 US9994792B2 (en) 2008-11-18 2017-07-07 Enzymes and methods for producing omega-3 fatty acids
US15/661,673 US9976107B2 (en) 2008-11-18 2017-07-27 Enzymes and methods for producing ω-3 fatty acids
US15/661,697 US20180010141A1 (en) 2008-11-18 2017-07-27 Enzymes and methods for producing omega-3 fatty acids
US16/860,936 US11976287B2 (en) 2008-11-18 2020-04-28 Enzymes and methods for producing ω-3 fatty acids
US18/409,591 US12195739B2 (en) 2008-11-18 2024-01-10 Enzymes and methods for producing omega-3 fatty acids
US18/409,596 US12203087B2 (en) 2008-11-18 2024-01-10 Enzymes and methods for producing omega-3 fatty acids
US18/409,598 US20240150781A1 (en) 2008-11-18 2024-01-10 Enzymes and methods for producing omega-3 fatty acids
US18/409,603 US20240150782A1 (en) 2008-11-18 2024-01-10 Enzymes and methods for producing omega-3 fatty acids
US18/656,570 US20240360464A1 (en) 2008-11-18 2024-05-06 Enzymes and methods for producing omega-3 fatty acids

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US19966908P 2008-11-18 2008-11-18
US61/199,669 2008-11-18
US27071009P 2009-07-09 2009-07-09
US61/270,710 2009-07-09

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/129,940 A-371-Of-International US8809559B2 (en) 2008-11-18 2009-11-17 Enzymes and methods for producing omega-3 fatty acids
US14/332,202 Continuation US9938486B2 (en) 2008-11-18 2014-07-15 Enzymes and methods for producing omega-3 fatty acids

Publications (1)

Publication Number Publication Date
WO2010057246A1 true WO2010057246A1 (en) 2010-05-27

Family

ID=42197742

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2009/001488 Ceased WO2010057246A1 (en) 2008-11-18 2009-11-17 Enzymes and methods for producing omega-3 fatty acids

Country Status (14)

Country Link
US (12) US8809559B2 (enExample)
EP (2) EP2358882B1 (enExample)
JP (4) JP6068800B2 (enExample)
CN (5) CN102317459A (enExample)
AR (1) AR074364A1 (enExample)
AU (1) AU2009317860B2 (enExample)
BR (3) BR122021003836B1 (enExample)
CA (3) CA3015426C (enExample)
CL (1) CL2011001162A1 (enExample)
DK (1) DK2358882T3 (enExample)
ES (1) ES2644883T3 (enExample)
NO (1) NO2358882T3 (enExample)
NZ (1) NZ593097A (enExample)
WO (1) WO2010057246A1 (enExample)

Cited By (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012000026A1 (en) 2010-06-28 2012-01-05 Commonwealth Scientific And Industrial Research Organisation Methods of producing lipids
US8106226B2 (en) 2004-04-22 2012-01-31 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
WO2013096993A1 (en) 2011-12-27 2013-07-04 Commonwealth Scientific And Industrial Research Organisation Processes for producing lipids
WO2013096991A1 (en) 2011-12-27 2013-07-04 Commonwealth Scientific And Industrial Research Organisation Production of dihydrosterculic acid and derivatives thereof
WO2013096992A1 (en) 2011-12-27 2013-07-04 Commonwealth Scientific And Industrial Reserach Organisation Simultaneous gene silencing and supressing gene silencing in the same cell
US8530724B2 (en) 2006-07-14 2013-09-10 Commonwealth Scientific And Industrial Research Organisation Altering the fatty acid composition of rice
WO2013185184A2 (en) 2012-06-15 2013-12-19 Commonwealth Scientific And Industrial Research Organisation Production of long chain polyunsaturated fatty acids in plant cells
EP2695936A1 (en) * 2010-10-21 2014-02-12 BASF Plant Science Company GmbH Novel fatty acid desaturases and uses thereof
WO2014053821A1 (en) * 2012-10-01 2014-04-10 Rothamsted Research Limited Recombinant organisms
US8716555B2 (en) 2008-07-21 2014-05-06 Commonwealth Scientific And Industrial Research Organisation Cottonseed oil and uses
US8809026B2 (en) 2011-12-27 2014-08-19 Commonwealth Scientific And Industrial Research Organisation Processes for producing lipids
US8921652B2 (en) 2008-07-21 2014-12-30 Commonwealth Scientific And Industrial Research Organisation Vegetable oils and uses therefor
EP2740797A4 (en) * 2011-08-04 2015-09-30 Suntory Holdings Ltd PROTEIN WITH MECHANISM FOR PROMOTING THE EXTRACTION OF FATTY ACID, AND GENE GENERATING THAT AND USE THEREOF
WO2015196250A1 (en) * 2014-06-27 2015-12-30 Commonwealth Scientific And Industrial Research Organisation Lipid comprising docosapentaenoic acid
EP2966157A1 (en) 2014-07-07 2016-01-13 Commonwealth Scientific and Industrial Research Organisation Processes for producing industrial products from plant lipids
US9453183B2 (en) 2004-04-22 2016-09-27 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US20160289692A1 (en) * 2012-09-18 2016-10-06 University Of Guelph Vectors and Methods For Enhancing Recombinant Protein Expression in Plants
US9624477B2 (en) 2004-02-27 2017-04-18 Basf Plant Science Gmbh Method for producing unsaturated omega-3-fatty acids in transgenic organisms
US9718759B2 (en) 2013-12-18 2017-08-01 Commonwealth Scientific And Industrial Research Organisation Lipid comprising docosapentaenoic acid
US9938486B2 (en) 2008-11-18 2018-04-10 Commonwealth Scientific And Industrial Research Organisation Enzymes and methods for producing omega-3 fatty acids
US10035989B2 (en) 2004-02-27 2018-07-31 Basf Plant Science Gmbh Method for producing polyunsaturated fatty acids in transgenic plants
US10190131B2 (en) 2006-02-21 2019-01-29 Basf Plant Science Gmbh Method for producing polyunsaturated fatty acids
US10323209B2 (en) 2012-04-25 2019-06-18 Commonwealth Scientific And Industrial Research Organisation High oleic acid oils
US10351870B2 (en) 2009-07-17 2019-07-16 Basf Plant Science Company Gmbh Uses of novel fatty acid desaturases and elongases and products thereof
EA037184B1 (ru) * 2014-06-27 2021-02-16 Коммонвелт Сайнтифик Энд Индастриэл Рисерч Организэйшн Липид, содержащий докозапентаеновую кислоту
US10941385B2 (en) 2016-09-23 2021-03-09 Wake Forest University Modified microorganisms as sustainable sources of omega-3 polyunsaturated fatty acid production
WO2021079142A1 (en) * 2019-10-25 2021-04-29 Nuseed Pty Ltd. Enriched polyunsaturated fatty acid compositions
US11180769B2 (en) 2003-08-01 2021-11-23 Basf Plant Science Gmbh Method for the production of multiple-unsaturated fatty acids in transgenic organisms
EP3935169A1 (en) 2019-03-08 2022-01-12 Commonwealth Scientific and Industrial Research Organisation Expression of nitrogenase polypeptides in plant cells
WO2022015699A1 (en) * 2020-07-14 2022-01-20 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods to produce very long chain fatty acids
US11639507B2 (en) 2011-12-27 2023-05-02 Commonwealth Scientific And Industrial Research Organisation Processes for producing lipids
KR20230074263A (ko) * 2014-06-27 2023-05-26 커먼웰쓰 사이언티픽 앤 인더스트리알 리서치 오거니제이션 도코사펜타에노산을 포함하는 지질
WO2023115116A1 (en) * 2021-12-20 2023-06-29 Commonwealth Scientific And Industrial Research Organisation Plants for producing cannabinoids
US11771728B2 (en) 2014-11-14 2023-10-03 Basf Plant Science Company Gmbh Materials and methods for increasing the tocopherol content in seed oil
US11859193B2 (en) 2016-09-02 2024-01-02 Nuseed Global Innovation Ltd. Plants with modified traits
US11872201B2 (en) 2018-06-21 2024-01-16 Nuseed Nutritional Us Inc. DHA enriched polyunsaturated fatty acid compositions
US11952581B2 (en) 2003-08-01 2024-04-09 Basf Plant Science Gmbh Process for the production of polyunsaturated fatty acids in transgenic organisms
US12137701B2 (en) 2018-06-21 2024-11-12 Nuseed Nutritional Us Inc. ALA enriched polyunsaturated fatty acid compositions
US12365909B2 (en) 2016-06-16 2025-07-22 Nuseed Nutritional Australia Pty Ltd Inbred transgenic canola line NS-B50027-4 and seeds thereof

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BRPI0716075A2 (pt) 2006-08-29 2013-08-06 Commw Scient Ind Res Org sÍntese de Ácidos graxos
CA2722276A1 (en) * 2008-04-25 2009-10-29 Commonwealth Scientific Industrial Research Organisation Recombinant cells and methods for hydroxylating fatty acids
US20110218348A1 (en) * 2008-04-25 2011-09-08 Commonwealth Scientific Industrial Research Organisation Polypeptides and methods for producing triacylglycerols comprising modified fatty acids
BR112014025265A2 (pt) * 2012-04-12 2017-07-11 Rothamsted Res Ltd produção de ácidos graxos poli-insaturados ômega-3 de cadeia longa
CN102978177B (zh) * 2012-11-09 2015-06-03 浙江工业大学 冬虫夏草合成代谢二十碳五烯酸的△-5-脱氢酶、基因及应用
CN103173445B (zh) * 2013-04-15 2014-07-30 南京江辉生物科技有限公司 一种欧米伽3的合成基因、含有合成基因的大肠菌及其构建方法
KR20160023703A (ko) 2013-06-14 2016-03-03 제이.알.심프롯캄패니 식물에서의 단백질 생산
US11718577B2 (en) 2013-12-18 2023-08-08 Commonwealth Scientific And Industrial Research Organisation Lipid compositions comprising triacylglycerol with long-chain polyunsaturated fatty acids
US20180122021A1 (en) * 2015-03-03 2018-05-03 Uop Llc Chemical refinery performance optimization
JP2019129705A (ja) 2016-03-31 2019-08-08 日本たばこ産業株式会社 植物に物質を導入する方法
JP6959942B2 (ja) * 2016-05-03 2021-11-05 ロンザ リミテッドLonza Limited タンパク質生成のための脂質代謝のモジュレーション
AR109245A1 (es) * 2016-05-12 2018-11-14 Basf Plant Science Co Gmbh Métodos para optimizar la producción de metabolitos en plantas genéticamente modificadas y para procesar estas plantas
CA3026079C (en) 2016-06-01 2024-10-01 Cargill Inc FISH FOOD PREPARED FROM OILSEED PLANTS PRODUCING OMEGA-3 FATTY ACIDS
US11913006B2 (en) 2018-03-16 2024-02-27 Nuseed Global Innovation Ltd. Plants producing modified levels of medium chain fatty acids
CN108220167A (zh) * 2018-04-10 2018-06-29 中盐工程技术研究院有限公司 盐藻纯化分离方法及微藻纯化分离方法
CN112367971A (zh) 2018-06-11 2021-02-12 加利福尼亚大学董事会 用以治疗眼睛疾病的脱甲基化
US10916099B2 (en) * 2019-06-04 2021-02-09 Igt Gaming system and method with guaranteed symbol generation
US10896579B2 (en) * 2019-06-04 2021-01-19 Igt Gaming system and method with dynamically determined guaranteed awards
CN110218777B (zh) * 2019-06-14 2023-05-16 苏州天合优才生物科技有限公司 Pcr预混液
JPWO2022168958A1 (enExample) 2021-02-05 2022-08-11
JP2023102179A (ja) * 2022-01-11 2023-07-24 花王株式会社 脂質の製造方法
CN119614625A (zh) * 2025-02-17 2025-03-14 中国热带农业科学院三亚研究院 芜菁皱缩病毒蛋白p38在调控拟南芥双链结合蛋白上的应用

Citations (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4399216A (en) 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
WO1984002913A1 (en) 1983-01-17 1984-08-02 Monsanto Co Chimeric genes suitable for expression in plant cells
EP0154204A2 (en) 1984-03-06 1985-09-11 Mgi Pharma, Inc. Herbicide resistance in plants
WO1987005327A1 (en) 1986-02-27 1987-09-11 The General Hospital Corporation Plant cells resistant to herbicidal glutamine synthetase inhibitors
EP0256223A1 (de) 1986-05-19 1988-02-24 Ciba-Geigy Ag Herbizid-tolerante Pflanzen, enthaltend ein Glutathion-S-Transferase-Gen
EP0275957A2 (de) 1987-01-21 1988-07-27 Hoechst Aktiengesellschaft In Pflanzen wirksames Resistenzgen gegen Phosphinothricin und seine Verwendung
WO1991002071A2 (en) 1989-08-09 1991-02-21 Dekalb Plant Genetics Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US5004863A (en) 1986-12-03 1991-04-02 Agracetus Genetic engineering of cotton plants and lines
WO1991013980A1 (en) 1990-03-16 1991-09-19 Calgene, Inc. Novel sequences preferentially expressed in early seed development and methods related thereto
US5104310A (en) 1986-11-24 1992-04-14 Aga Aktiebolag Method for reducing the flame temperature of a burner and burner intended therefor
US5177010A (en) 1986-06-30 1993-01-05 University Of Toledo Process for transforming corn and the products thereof
AU6178194A (en) 1993-03-11 1994-09-26 National Research Council Of Canada Enhanced regeneration system for cereals
CA2092588A1 (en) 1993-03-26 1994-09-27 Narender S. Nehra Enhanced regeneration system for cereals
US5362865A (en) 1993-09-02 1994-11-08 Monsanto Company Enhanced expression in plants using non-translated leader sequences
US5416011A (en) 1988-07-22 1995-05-16 Monsanto Company Method for soybean transformation and regeneration
WO1995015389A2 (en) 1993-12-02 1995-06-08 Olsen Odd Arne Promoter
WO1995023230A1 (en) 1994-02-24 1995-08-31 Olsen Odd Arne Promoter from a lipid transfer protein gene
US5451513A (en) 1990-05-01 1995-09-19 The State University of New Jersey Rutgers Method for stably transforming plastids of multicellular plants
US5463174A (en) 1986-05-29 1995-10-31 Calgene Inc. Transformation and foreign gene expression in Brassica species
US5504200A (en) 1983-04-15 1996-04-02 Mycogen Plant Science, Inc. Plant gene expression
AU667939B2 (en) 1992-07-07 1996-04-18 Japan Tobacco Inc. Method of transforming monocotyledon
US5518908A (en) 1991-09-23 1996-05-21 Monsanto Company Method of controlling insects
US5545818A (en) 1994-03-11 1996-08-13 Calgene Inc. Expression of Bacillus thuringiensis cry proteins in plant plastids
WO1997006269A1 (en) 1995-08-03 1997-02-20 Zeneca Limited Inducible herbicide resistance
US5608152A (en) 1986-07-31 1997-03-04 Calgene, Inc. Seed-specific transcriptional regulation
WO1998045461A1 (en) 1997-04-09 1998-10-15 Rhone-Poulenc Agro An oleosin 5' regulatory region for the modification of plant seed lipid composition
US5859347A (en) 1992-03-19 1999-01-12 Monsanto Company Enhanced expression in plants
WO1999005265A2 (en) 1997-07-23 1999-02-04 Sanford Scientific, Inc. Improved plastid transformation of higher plants and production of transgenic plants with herbicide resistance
US5877402A (en) 1990-05-01 1999-03-02 Rutgers, The State University Of New Jersey DNA constructs and methods for stably transforming plastids of multicellular plants and expressing recombinant proteins therein
WO1999014314A1 (en) 1997-09-12 1999-03-25 Commonwealth Scientific And Industrial Research Organisation Regulation of gene expression in plants
WO1999016890A2 (en) 1997-09-30 1999-04-08 The Regents Of The University Of California Production of proteins in plant seeds
US5932479A (en) 1988-09-26 1999-08-03 Auburn University Genetic engineering of plant chloroplasts
US5939288A (en) 1995-06-07 1999-08-17 Iowa State University Research Foundation, Inc. Plant secretory signal peptides and nectarins
US6100447A (en) 1998-02-12 2000-08-08 Applied Phytologics, Inc. Method of barley transformation
WO2000052183A1 (en) * 1999-03-05 2000-09-08 Monsanto Technology Llc Multigene expression vectors for the biosynthesis of products via multienzyme biological pathways
WO2001038512A2 (en) * 1999-11-22 2001-05-31 Plant Bioscience Limited Enhanced transgene expression by co-expression with a suppressor of post-transcriptional gene silencing (ptgs)
WO2001070777A2 (en) 2000-03-16 2001-09-27 The Regents Of The University Of California Leafy cotyledon2 genes and their uses
US6541257B2 (en) 1997-04-29 2003-04-01 The Regents Of The University Of California Method for preparing barley green regenerative tissue
US20030159173A1 (en) 1999-10-20 2003-08-21 Wolter Frank P. Elongase promoters for tissue-specific expression of transgenes in plants
WO2004017467A2 (en) 2002-08-19 2004-02-26 Anderson Power Products A handle locking system for electrical connectors and methods thereof
WO2004071467A2 (en) 2003-02-12 2004-08-26 E. I. Du Pont De Nemours And Company Production of very long chain polyunsaturated fatty acids in oilseed plants
WO2005012316A2 (de) 2003-08-01 2005-02-10 Basf Plant Science Gmbh Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen
WO2005103253A1 (en) 2004-04-22 2005-11-03 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
WO2007005882A2 (en) * 2005-07-05 2007-01-11 North Carolina State University Methods and compositions for expressing proteins in plants
WO2007092460A2 (en) * 2006-02-03 2007-08-16 The Texas A & M University System Enhancing expression of value-added genes by transgenic expression of tombusvirus-based p19 gene mutants
US20070192902A1 (en) 2001-06-06 2007-08-16 Bioriginal Food & Science Corp. Flax (Linum usitatissimum I.) seed-specific promoters
WO2007096387A1 (de) 2006-02-21 2007-08-30 Basf Plant Science Gmbh Verfahren zur herstellung von mehrfach ungesättigten fettsäuren
WO2007137788A1 (en) 2006-05-29 2007-12-06 Icon Genetics Gmbh Plant virus-based inducible expression system
WO2008009600A1 (de) * 2006-07-21 2008-01-24 Basf Plant Science Gmbh Verfahren zur herstellung von arachidonsäure und/oder eicosapentaensäure in pflanzen
US9710621B1 (en) 2011-11-02 2017-07-18 Google Inc. Platform for cloud application software

Family Cites Families (209)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5861187A (en) 1990-08-30 1999-01-19 Cargill, Incorporated Oil from canola seed with altered fatty acid profiles and a method of producing oil
US7135614B1 (en) 1990-08-30 2006-11-14 Cargill, Incorporated Brassica or helianthus plants having mutant delta-12 or delta-15 sequences
US6355861B1 (en) 1991-10-10 2002-03-12 Rhone-Poulenc Agrochimie Production of gamma linolenic acid by a Δ6-desaturase
US6683232B1 (en) 1991-10-10 2004-01-27 Rhone-Poulenc Agrochimie Production of γ linolenic acid by a Δ6-desaturase
US5614393A (en) 1991-10-10 1997-03-25 Rhone-Poulenc Agrochimie Production of γ-linolenic acid by a Δ6-desaturase
PH31293A (en) 1991-10-10 1998-07-06 Rhone Poulenc Agrochimie Production of y-linolenic acid by a delta6-desaturage.
CA2124673C (en) 1991-12-04 2008-08-05 John Browse Fatty acid desaturase genes from plants
US5798259A (en) 1992-05-15 1998-08-25 Sagami Chemical Research Center Gene coding for eicosapentaenoic acid synthesizing enzymes and process for production of eicosapentaenoic acid
US5683898A (en) 1992-05-15 1997-11-04 Sagami Chemical Research Center Gene coding for eicosapentaenoic acid synthesizing enzymes and process for production of eicosapentaenoic acid
FI940203L (fi) 1992-05-15 1994-03-14 Sagami Chem Res Geeni, joka koodaa eikosapeutaanihappoa syntetisoivia entsyymejä, ja menetelmä eikospentaanihapon valmistamiseksi
US6372965B1 (en) 1992-11-17 2002-04-16 E.I. Du Pont De Nemours And Company Genes for microsomal delta-12 fatty acid desaturases and hydroxylases from plants
US6872872B1 (en) 1992-11-17 2005-03-29 E. I. Du Pont De Nemours And Company Genes for microsomal delta-12 fatty acid desaturases and related enzymes from plants
EP0880312B1 (en) 1995-12-14 2006-03-08 Cargill Incorporated Plants having mutant sequences that confer altered fatty acid profiles
US7541519B2 (en) 1995-12-14 2009-06-02 Cargill, Incorporated Fatty acid desaturases and mutant sequences thereof
US6342658B1 (en) 1995-12-14 2002-01-29 Cargill, Incorporated Fatty acid desaturases and mutant sequences thereof
TR199800294T1 (xx) 1996-06-21 1999-10-21 Monsanto Company Sabit transforme edilen verimli bu�day �retim y�ntemleri.
AU727694B2 (en) 1996-07-10 2000-12-21 Sagami Chemical Research Center Process for producing icosapentaenoic acid by genetic recombination
US7109392B1 (en) 1996-10-09 2006-09-19 Cargill, Incorporated Methods for increasing oleic acid content in seeds from transgenic plants containing a mutant delta 12 desaturase
WO1998018952A1 (en) 1996-10-30 1998-05-07 Nippon Suisan Kaisha, Ltd. Process for producing fats containing highly unsaturated fatty acids containing selectively concentrated docosahexaenoic acid
US6194167B1 (en) 1997-02-18 2001-02-27 Washington State University Research Foundation ω-3 fatty acid desaturase
DE69840022D1 (de) 1997-03-04 2008-10-30 Suntory Ltd Verfahren zur herstellung von hochungesättigten fettsäuren und hochungesättigte fettsäuren enthaltendes lipid
US6432684B1 (en) 1997-04-11 2002-08-13 Abbott Laboratories Human desaturase gene and uses thereof
US6428990B1 (en) 1997-04-11 2002-08-06 Abbott Laboratories Human desaturase gene and uses thereof
US6051754A (en) 1997-04-11 2000-04-18 Abbott Laboratories Methods and compositions for synthesis of long chain poly-unsaturated fatty acids in plants
US5968809A (en) * 1997-04-11 1999-10-19 Abbot Laboratories Methods and compositions for synthesis of long chain poly-unsaturated fatty acids
ATE297994T1 (de) 1997-04-11 2005-07-15 Calgene Llc Verfahren und zusammensetzungen für die synthese von langkettigen, mehrfach ungesättigten fettsäuren in pflanzen.
US5972664A (en) 1997-04-11 1999-10-26 Abbott Laboratories Methods and compositions for synthesis of long chain poly-unsaturated fatty acids
US6075183A (en) 1997-04-11 2000-06-13 Abbott Laboratories Methods and compositions for synthesis of long chain poly-unsaturated fatty acids in plants
US7589253B2 (en) 1997-04-15 2009-09-15 Commonwealth Scientific And Industrial Research Organisation Fatty acid epoxygenase genes from plants and uses therefor in modifying fatty acid metabolism
US6566583B1 (en) 1997-06-04 2003-05-20 Daniel Facciotti Schizochytrium PKS genes
IL133272A0 (en) 1997-06-04 2001-04-30 Calgene Llc Production of polyunsaturated fatty acid by expression of polyketide-like synthesis genes in plants
EP0987936A4 (en) 1997-06-12 2001-03-14 Cargill Inc FATTY ACID DESATURASES AND MUTED SEQUENCES THEREOF
CA2305570A1 (en) 1997-10-01 1999-04-08 Brian E. Busse Container handling system
GB9724783D0 (en) 1997-11-24 1998-01-21 Inst Arable Crops Research Novel polypeptides
EP1042485A2 (en) 1997-12-23 2000-10-11 University Of Bristol Desaturase
US20030152983A1 (en) 1997-12-23 2003-08-14 University Of Bristol Desaturase
AU763296B2 (en) 1998-03-20 2003-07-17 E.I. Du Pont De Nemours And Company Limanthes oil genes
US6838594B1 (en) 1998-03-20 2005-01-04 E. I. Du Pont De Nemours And Company Limnanthes oil genes
US6492108B1 (en) 1998-03-26 2002-12-10 Incyte Genomics, Inc. Delta-6 desaturase homologs
EP1080189A4 (en) 1998-05-29 2003-01-08 Univ Ohio COMPOSITIONS AND METHODS FOR THE PRODUCTION OF FATTY ACIDS, THEIR DERIVATIVES AND SUBSEQUENT PRODUCTS
EP1086236B1 (en) 1998-06-12 2007-09-05 Calgene LLC Polyunsaturated fatty acids in plants
AU4564399A (en) 1998-06-12 1999-12-30 Abbott Laboratories Polyunsaturated fatty acids in plants
WO2000011176A2 (en) 1998-08-20 2000-03-02 E.I. Du Pont De Nemours And Company Genes for plant fatty acid modifying enzymes associated with conjugated double bond formation
WO2000011012A1 (en) 1998-08-24 2000-03-02 Rutgers, The State University Of New Jersey Synthetic fatty acid desaturase gene for expression in plants
US6913916B1 (en) 1998-09-02 2005-07-05 Abbott Laboratories Elongase genes and uses thereof
US20030163845A1 (en) 1998-09-02 2003-08-28 Pradip Mukerji Elongase genes and uses thereof
US6403349B1 (en) 1998-09-02 2002-06-11 Abbott Laboratories Elongase gene and uses thereof
US6677145B2 (en) 1998-09-02 2004-01-13 Abbott Laboratories Elongase genes and uses thereof
WO2000020603A1 (en) 1998-10-05 2000-04-13 Abbott Laboratories Altered fatty acid biosynthesis in insect cells using delta five desaturase
AU1097900A (en) 1998-10-05 2000-04-26 Abbott Laboratories Delta 6 and delta 12 desaturases and modified fatty acid biosynthesis and products produced therefrom
JP2002527051A (ja) 1998-10-09 2002-08-27 メルク エンド カムパニー インコーポレーテッド デルタ6脂肪酸デサチュラーゼ
JP4182192B2 (ja) 1998-11-26 2008-11-19 独立行政法人産業技術総合研究所 イコサペンタエン酸及び/又はドコサヘキサエン酸の生合成に関与する酵素群をコードする遺伝子
US6864077B1 (en) 1998-12-03 2005-03-08 Edgar B. Cahoon Membrane-bound desaturases
JP2001095588A (ja) 1998-12-04 2001-04-10 Research Institute Of Innovative Technology For The Earth 緑藻のω3脂肪酸不飽和化酵素遺伝子及びその利用
US6825017B1 (en) 1998-12-07 2004-11-30 Washington State University Research Foundation Desaturases and methods of using them for synthesis of polyunsaturated fatty acids
US8003772B2 (en) 1999-01-14 2011-08-23 Martek Biosciences Corporation Chimeric PUFA polyketide synthase systems and uses thereof
US7211418B2 (en) 1999-01-14 2007-05-01 Martek Biosciences Corporation PUFA polyketide synthase systems and uses thereof
US7217856B2 (en) 1999-01-14 2007-05-15 Martek Biosciences Corporation PUFA polyketide synthase systems and uses thereof
US20070244192A1 (en) 1999-01-14 2007-10-18 Martek Biosciences Corporation Plant seed oils containing polyunsaturated fatty acids
US7247461B2 (en) 1999-01-14 2007-07-24 Martek Biosciences Corporation Nucleic acid molecule encoding ORFA of a PUFA polyketide synthase system and uses thereof
US7271315B2 (en) 1999-01-14 2007-09-18 Martek Biosciences Corporation PUFA polyketide synthase systems and uses thereof
EP1035207A1 (en) 1999-03-09 2000-09-13 MultiGene Biotech GmbH cDNA molecules of the members of gene family encoding human fatty acid desaturases and their use in diagnosis and therapy
WO2000055330A1 (en) 1999-03-18 2000-09-21 The University Of Bristol Polysaturated fatty acid (pufa) elongase from caenorhabditis elegans
IL146782A0 (en) 1999-06-07 2002-07-25 Basf Plant Science Gmbh 6-acetylenase and 6-desaturase from ceratodon purpureus
EP1190080A1 (de) 1999-07-06 2002-03-27 BASF Plant Science GmbH $g(D)6-DESATURASEGENE EXPRIMIERENDE PFLANZEN UND PUFAS ENTHALTENDE ÖLE AUS DIESEN PFLANZEN UND EIN VERFAHREN ZUR HERSTELLUNG UNGESÄTTIGTER FETTSÄUREN
AU6091600A (en) 1999-07-12 2001-01-30 Ohio University Mammalian cells expressing desaturases and elongases
US7070970B2 (en) 1999-08-23 2006-07-04 Abbott Laboratories Elongase genes and uses thereof
CN1378602A (zh) 1999-08-26 2002-11-06 卡尔根尼有限公司 含修饰的多不饱和脂肪酸的植物
US7067722B2 (en) 1999-08-26 2006-06-27 Monsanto Technology Llc Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids
US7531718B2 (en) 1999-08-26 2009-05-12 Monsanto Technology, L.L.C. Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids
DE10044468A1 (de) 1999-09-10 2001-03-15 Axiva Gmbh Neue Nukleinsäure aus Tetrahymena kodierend für eine delta-6Desaturase, ihre Herstellung und ihre Verwendung
FR2798391B1 (fr) 1999-09-15 2001-12-14 Inst Nat Sante Rech Med Enzyme thyroidienne nadph oxydase, acide nucleique codant pour cette enzyme et leurs applications
JP4221476B2 (ja) 1999-11-19 2009-02-12 独立行政法人産業技術総合研究所 イコサペンタエン酸生合成遺伝子群をクローニングしたプラスミド及びイコサペンタエン酸を産生するラン藻
AU1499601A (en) 1999-11-25 2001-06-04 Basf Plant Science Gmbh Moss genes from physcomitrella patents encoding proteins involved in the synthesis of polyunsaturated fatty acids and lipids
JP2001169780A (ja) 1999-12-15 2001-06-26 Natl Inst Of Advanced Industrial Science & Technology Meti ドコサヘキサエン酸生産細菌の遺伝子
GB9929897D0 (en) 1999-12-18 2000-02-09 Slabas Antoni R Improvements in or relating to conjugated fatty acids and related compounds
US20030172398A1 (en) 1999-12-21 2003-09-11 Browse John A. Novel delta-12 desaturase and methods of using it for synthesis of polyunsaturated fatty acids
PL207026B1 (pl) 2000-02-09 2010-10-29 Basf Ag Wyizolowany kwas nukleinowy, konstrukt genowy zawierający ten kwas, sekwencja aminokwasowa kodowana przez wyizolowaną sekwencję tego kwasu nukleinowego, wektor zawierający kwas nukleinowy lub konstrukt genowy, roślina transgeniczna lub mikroorganizm transgeniczny zawierający kwas nukleinowy, konstrukt genowy lub wektor, przeciwciało specyficznie wiążące się z polipeptydem kodowanym przez kwas nukleinowy, cząsteczka antysensownego kwasu nukleinowego oraz sposób wytwarzania wielonienasyconych kwasów tłuszczowych (PUFA)
US6686185B1 (en) 2000-03-07 2004-02-03 Millennium Pharmaceuticals, Inc. 25934, a novel fatty acid desaturase and uses therefor
US20020111307A1 (en) 2000-06-23 2002-08-15 Glucksmann Maria Alexandra 46508, a novel human peptidyl-tRNA hydrolase family member and uses thereof
US7411054B2 (en) 2000-03-07 2008-08-12 Millennium Pharmaceuticals, Inc. 25869, 25934, 26335, 50365, 21117, 38692, 46508, 16816, 16839, 49937, 49931 and 49933 molecules and uses therefor
US20040157221A9 (en) 2000-03-07 2004-08-12 Millennium Pharmaceuticals, Inc. Novel 25869, 25934, 26335, 50365, 21117, 38692, 46508, 16816, 16839, 49937, 49931 and 49933 molecules and uses therefor
WO2001073060A2 (en) 2000-03-24 2001-10-04 Millennium Pharmaceuticals, Inc. 18221, dual specificity phosphatase and uses thereof
CA2301158A1 (en) 2000-03-24 2001-09-24 Stephen J. Allen Screening methods for compounds useful for modulating lipid metabolism in disease
WO2001075069A1 (en) 2000-03-31 2001-10-11 Idemitsu Petrochemical Co., Ltd. Process for producing lipids and lipid-secreting microorganisms
DE60142734D1 (de) 2000-04-18 2010-09-16 Commw Scient Ind Res Org Verfahren zur modifizierung des baumwollölgehaltes
WO2001087140A2 (en) 2000-05-16 2001-11-22 Crosetto Dario B Method and apparatus for anatomical and functional medical imaging
US7091005B2 (en) 2000-05-16 2006-08-15 Merck & Co., Inc. Gene responsible for Stargardt-like dominant macular dystrophy
EP1404820A2 (en) 2000-05-19 2004-04-07 Millennium Pharmaceuticals, Inc. 50365, a hexokinase family member and uses therefor
WO2001092489A2 (en) 2000-05-26 2001-12-06 Washington State University Research Foundation Palmitate desaturase gene
WO2001096363A1 (en) 2000-06-12 2001-12-20 Boyce Thompson Institute For Plant Research Fatty acid desaturase gene and protein for modulating activation of defense signaling pathways in plants
EP1297155A2 (en) 2000-06-29 2003-04-02 Millennium Pharmaceuticals, Inc. 25869, a human carboxylesterase and uses thereof
WO2002006302A2 (en) 2000-07-17 2002-01-24 Millennium Pharmaceuticals, Inc. 16816 and 16839, novel human phospholipase c molecules and uses therefor
GB0316629D0 (en) 2003-07-16 2003-08-20 Univ York Transgenic cell
EP1339839A2 (en) 2000-08-21 2003-09-03 Millennium Pharmaceuticals, Inc. Human transporter family members and uses thereof
CA2430987A1 (en) 2000-09-26 2002-04-04 Xenon Genetics, Inc. Methods and compositions employing a novel stearoyl-coa desaturase-hscd5
ES2343106T3 (es) 2000-09-28 2010-07-23 BIORIGINAL FOOD & SCIENCE CORP. Fad4, fad5, fad5-2 y fad6, miembros de la familia de desaturasas de acidos grasos y usos de los mismos.
US7297523B2 (en) 2000-11-29 2007-11-20 Xenon Pharmaceuticals Inc. Human elongase genes and uses thereof
DE10102337A1 (de) 2001-01-19 2002-07-25 Basf Plant Science Gmbh Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren, neue Biosynthesegene sowie neue pflanzliche Expressionskonstrukte
DE10102338A1 (de) 2001-01-19 2002-07-25 Basf Plant Science Gmbh Verfahren zur Expression von Biosynthesegenen in pflanzlichen Samen unter Verwendung von neuen multiplen Expressionskonstrukten
EP1392823B1 (en) 2001-01-25 2011-11-30 Abbott Laboratories Desaturase genes and uses thereof
US6635451B2 (en) 2001-01-25 2003-10-21 Abbott Laboratories Desaturase genes and uses thereof
DE10106660A1 (de) 2001-02-12 2002-08-29 Celanese Ventures Gmbh Verfahren zur Herstellung von gamma-Linolensäure aus einer Ciliaten-Kultur durch Zusatz geeigneter Vorläufermoleküle zu dem Kulturmedium
GB0107510D0 (en) 2001-03-26 2001-05-16 Univ Bristol New elongase gene and a process for the production of -9-polyunsaturated fatty acids
WO2002081702A1 (fr) 2001-04-05 2002-10-17 Idemitsu Technofine Co., Ltd. Genes de desaturase en position $g(d)6 d'acide gras, plasmides et transformants contenant ces genes
CN1273271C (zh) 2001-04-11 2006-09-06 罗伯特·博施有限公司 具有减振手把的手持式工具机
TWI426126B (zh) 2001-04-16 2014-02-11 Dsm Ip Assets Bv 多不飽和脂肪酸(pufa)聚乙醯合成酶系統及其用途(二)
TWI324181B (en) 2001-04-16 2010-05-01 Martek Biosciences Corp Product and process for transformation of thraustochytriales microorganisms
US20030082754A1 (en) 2001-05-04 2003-05-01 Pradip Mukerji Delta4 - desaturase genes and uses thereof
US7045683B2 (en) 2001-05-04 2006-05-16 Abbott Laboratories Δ4-desaturase genes and uses thereof
EP2255668A3 (en) * 2001-05-14 2012-04-04 Martek Biosciences Corporation Production and Use of a Polar Lipid-Rich Fraction Containing Omega-3 and/or Omega-6 Highly Unsaturated Fatty Acids from Microbes, Genetically Modified Plant Seeds and Marine Organisms
DE10134660A1 (de) 2001-07-20 2003-02-06 Basf Plant Science Gmbh Fettsäure-Desaturase-Gene aus Granatapfel und Verfahren zur Herstellung von ungesättigten Fettsäuren
US20050089879A1 (en) 2001-07-31 2005-04-28 Ivo Feussner Method for producing arachidonic acid in transgenic organisms
US6875595B2 (en) 2001-09-13 2005-04-05 Divergence, Inc. Nematode fatty acid desaturase-like sequences
JP2003116566A (ja) 2001-10-12 2003-04-22 Osamu Suzuki n−3系ドコサペンタエン酸の製造方法
EP1472357B1 (de) 2002-01-30 2009-12-16 BASF Plant Science GmbH Verfahren zur herstellung mehrfach ungesättigter fettsäuren mittels eines neuen elongase-gens
US7211656B2 (en) 2002-01-30 2007-05-01 Abbott Laboratories Desaturase genes, enzymes encoded thereby, and uses thereof
GB2385852A (en) 2002-02-27 2003-09-03 Rothamsted Ex Station Delta 6-desaturases from Primulaceae
US7700833B2 (en) 2002-03-01 2010-04-20 Cornell University Process for the production of unsaturated fatty acids
EP2302060B1 (en) 2002-03-16 2012-07-25 The University of York Desaturases
DE10219203A1 (de) 2002-04-29 2003-11-13 Basf Plant Science Gmbh Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in Pflanzen
CA2883729C (en) 2002-05-22 2017-03-07 Virginia M. Ursin Fatty acid desaturases from fungi
WO2004005442A1 (de) 2002-07-03 2004-01-15 Basf Plant Science Gmbh Verfahren zur herstellung von konjugierten mehrfach ungesättigten fettsäuren mit mindestens zwei doppelbindungen in pflanzen
GB0229578D0 (en) * 2002-12-19 2003-01-22 Univ Bristol Novel method for the production of polyunsaturated fatty acids
BR0317304A (pt) 2002-12-19 2005-11-08 Univ Bristol Processo para a produção de compostos, sequência de ácido nucleico isolada, sequência de aminoácidos, construção gênica, vetor, e, organismo
US8084074B2 (en) 2003-02-12 2011-12-27 E. I. Du Pont De Nemours And Company Production of very long chain polyunsaturated fatty acids in oil seed plants
ATE517984T1 (de) * 2003-02-27 2011-08-15 Basf Plant Science Gmbh Verfahren zur herstellung mehrfach ungesättigter fettsäuren
EP3121269A1 (de) 2003-03-31 2017-01-25 University Of Bristol Neue pflanzliche acyltransferase spezifisch für langkettige mehrfach ungesättigte fettsäuren
DE10315026A1 (de) 2003-04-02 2004-10-14 Bioplanta Arzneimittel Gmbh Zusammensetzungen enthaltend omega-3-fettsäurehaltige Öle und Pflanzenextrakte
JP4732333B2 (ja) 2003-04-08 2011-07-27 ビーエーエスエフ プラント サイエンス ゲーエムベーハー ミドリムシ(Euglenagracilis)由来のΔ−4−デサチュラーゼを発現する植物およびPUFA含有油
ATE394483T1 (de) 2003-04-16 2008-05-15 Basf Plant Science Gmbh Verwendung von genen zur erhöhung des ölgehaltes in pflanzen
US8313911B2 (en) 2003-05-07 2012-11-20 E I Du Pont De Nemours And Company Production of polyunsaturated fatty acids in oleaginous yeasts
US7238482B2 (en) 2003-05-07 2007-07-03 E. I. Du Pont De Nemours And Company Production of polyunsaturated fatty acids in oleaginous yeasts
US7125672B2 (en) 2003-05-07 2006-10-24 E. I. Du Pont De Nemours And Company Codon-optimized genes for the production of polyunsaturated fatty acids in oleaginous yeasts
US20110059496A1 (en) 2003-06-25 2011-03-10 E. I. Du Pont De Nemours And Company Glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate mutase promoters for gene expression in oleaginous yeast
US7267976B2 (en) 2003-07-02 2007-09-11 E.I. Du Pont De Nemours And Company Acyltransferases for alteration of polyunsaturated fatty acids and oil content in oleaginous yeasts
AU2004268196B2 (en) 2003-08-21 2010-03-04 Monsanto Technology Llc Fatty acid desaturases from primula
US20050132441A1 (en) * 2003-11-12 2005-06-16 Damude Howard G. Delta15 desaturases suitable for altering levels of polyunsaturated fatty acids in oilseed plants and oleaginous yeast
US7504259B2 (en) 2003-11-12 2009-03-17 E. I. Du Pont De Nemours And Company Δ12 desaturases suitable for altering levels of polyunsaturated fatty acids in oleaginous yeast
MY140210A (en) 2003-12-22 2009-11-30 Suntory Holdings Ltd Marchantiales-derived unsaturated fatty acid synthetase genes and use of the same
WO2005080578A2 (en) * 2004-02-17 2005-09-01 The University Of York Desaturase enzymes
CN1930277B (zh) * 2004-02-27 2011-02-02 巴斯福植物科学有限公司 在转基因植物中产生多不饱和脂肪酸的方法
CA2558726C (en) 2004-02-27 2017-11-07 Basf Plant Science Gmbh Method for producing unsaturated .omega.-3-fatty acids in transgenic organisms
EP4219670A3 (de) 2004-02-27 2023-08-09 BASF Plant Science GmbH Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen pflanzen
US7217956B2 (en) 2004-03-29 2007-05-15 Articulated Technologies, Llc. Light active sheet material
DE102004017370A1 (de) 2004-04-08 2005-10-27 Nutrinova Nutrition Specialties & Food Ingredients Gmbh PUFA-PKS Gene aus Ulkenia
DE102004017369A1 (de) 2004-04-08 2005-11-03 Nutrinova Nutrition Specialties & Food Ingredients Gmbh Screeningverfahren zur Identifizierung von PUFA-PKS in Proben
JP2007533310A (ja) 2004-04-16 2007-11-22 モンサント テクノロジー エルエルシー トウモロコシにおける脂肪酸デサチュラーゼの発現
ES2529572T3 (es) 2004-04-22 2015-02-23 Commonwealth Scientific And Industrial Research Organisation Síntesis de ácidos grasos poliinsaturados de cadena larga por células recombinantes
AU2005235627B2 (en) 2004-04-22 2011-07-07 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
CN101018862B (zh) * 2004-04-22 2013-10-09 联邦科学技术研究组织 用重组细胞合成长链多不饱和脂肪酸
AU2005250074B2 (en) 2004-06-04 2011-04-14 Fluxome Sciences A/S Metabolically engineered cells for the production of polyunsaturated fatty acids
US7550651B2 (en) 2004-06-25 2009-06-23 E.I. Du Pont De Nemours And Company Delta-8 desaturase and its use in making polyunsaturated fatty acids
DE102004060340A1 (de) 2004-07-16 2006-02-09 Basf Plant Science Gmbh Verfahren zur Erhöhung des Gehalts an mehrfach ungesättigten langkettigen Fettsäuren in transgenen Organismen
US7270315B2 (en) 2004-09-28 2007-09-18 Amt International, Inc. Exchange column, perforated tray assembly
GB0421937D0 (en) 2004-10-02 2004-11-03 Univ York Acyl CoA synthetases
US7198937B2 (en) 2004-11-04 2007-04-03 E. I. Du Pont De Nemours And Company Mortierella alpina diacylglycerol acyltransferase for alteration of polyunsaturated fatty acids and oil content in oleaginous organisms
US8685679B2 (en) 2004-11-04 2014-04-01 E I Du Pont De Nemours And Company Acyltransferase regulation to increase the percent of polyunsaturated fatty acids in total lipids and oils of oleaginous organisms
US7189559B2 (en) 2004-11-04 2007-03-13 E. I. Du Pont De Nemours And Company Mortierella alpina lysophosphatidic acid acyltransferase homolog for alteration of polyunsaturated fatty acids and oil content in oleaginous organisms
US7273746B2 (en) 2004-11-04 2007-09-25 E.I. Dupont De Nemours And Company Diacylglycerol acyltransferases for alteration of polyunsaturated fatty acids and oil content in oleaginous organisms
US7192762B2 (en) 2004-11-04 2007-03-20 E. I. Du Pont De Nemours And Company Mortierella alpina glycerol-3-phosphate o-acyltransferase for alteration of polyunsaturated fatty acids and oil content in oleaginous organisms
US7550286B2 (en) 2004-11-04 2009-06-23 E. I. Du Pont De Nemours And Company Docosahexaenoic acid producing strains of Yarrowia lipolytica
US20060094102A1 (en) 2004-11-04 2006-05-04 Zhixiong Xue Ammonium transporter promoter for gene expression in oleaginous yeast
US20100120103A1 (en) 2004-12-14 2010-05-13 Avesthagen Limited Recombinant Production Docosahexaenoic Acid (DHA) in Yeast
DE102004062294A1 (de) 2004-12-23 2006-07-06 Basf Plant Science Gmbh Verfahren zur Herstellung von mehrfach ungesättigten langkettigen Fettsäuren in transgenen Organismen
DE102004063326A1 (de) 2004-12-23 2006-07-06 Basf Plant Science Gmbh Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Organismen
DE102005013779A1 (de) 2005-03-22 2006-09-28 Basf Plant Science Gmbh Verfahren zur Herstellung von mehrfach ungesättigten C20- und C22-Fettsäuren mit mindestens vier Doppelbindungen in transgenen Pflanzen
WO2006135866A2 (en) 2005-06-10 2006-12-21 Martek Biosciences Corporation Pufa polyketide synthase systems and uses thereof
DE102005038036A1 (de) 2005-08-09 2007-02-15 Basf Plant Science Gmbh Verfahren zur Herstellung von Arachidonsäure und/oder Eicosapentaensäure in transgenen Nutzpflanzen
GB2431158A (en) 2005-10-13 2007-04-18 Rothamsted Res Ltd Process for the production of arachidonic and/or eicosapentaenoic acid
DE102005052551A1 (de) 2005-11-02 2007-05-16 Rothamsted Res Harpenden Verfahren zur Herstellung von y-Linolensäure und/oder Stearidonsäure in transgenen Brassicaceae und Linaceae
WO2007061742A1 (en) 2005-11-23 2007-05-31 E. I. Du Pont De Nemours And Company Delta-9 elongases and their use in making polyunsaturated fatty acids
GB0603160D0 (en) 2006-02-16 2006-03-29 Rothamsted Res Ltd Nucleic acid
MX340759B (es) 2006-03-15 2015-03-11 Dsm Ip Assets B V * Aceites de semillas vegetales que contienen ácidos grasos poli-insaturados.
US7943823B2 (en) 2006-04-28 2011-05-17 E.I. Du Pont De Nemours And Company Delta-8 desaturase and its use in making polyunsaturated fatty acids
JP4230494B2 (ja) 2006-06-06 2009-02-25 日立建機株式会社 電気駆動ダンプトラックの駆動システム
JP2009542231A (ja) * 2006-07-11 2009-12-03 バイオリジナル フード アンド サイエンス コーポレーション 脂肪酸デサチュラーゼおよびその用途
CA2659993C (en) 2006-08-24 2016-01-05 Basf Plant Science Gmbh Isolation and characterization of a novel pythium omega 3 desaturase with specificity to all omega 6 fatty acids longer than 18 carbon chains
BRPI0716075A2 (pt) 2006-08-29 2013-08-06 Commw Scient Ind Res Org sÍntese de Ácidos graxos
WO2008040787A2 (de) 2006-10-06 2008-04-10 Basf Plant Science Gmbh Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen organismen
US8916361B2 (en) 2006-11-17 2014-12-23 Abbott Laboratories Elongase gene and uses thereof
US7709239B2 (en) 2006-12-07 2010-05-04 E.I. Du Pont De Nemours And Company Mutant Δ8 desaturase genes engineered by targeted mutagenesis and their use in making polyunsaturated fatty acids
WO2008104559A1 (de) * 2007-02-27 2008-09-04 Norddeutsche Pflanzenzucht Verfahren zur herstellung von mehrfach ungesättigten fettsäuren in transgenen organismen
DK2129777T3 (en) 2007-04-03 2016-01-25 Du Pont MULTIZYMER AND USE THEREOF FOR THE PRODUCTION OF polyunsaturated fatty acids
US8119860B2 (en) 2007-04-16 2012-02-21 E. I. Du Pont De Nemours And Company Delta-9 elongases and their use in making polyunsaturated fatty acids
US7943365B2 (en) 2007-05-03 2011-05-17 E.I. Du Pont De Nemours And Company Δ-5 desaturases and their use in making polyunsaturated fatty acids
CA2694661C (en) 2007-07-31 2017-10-03 Basf Plant Science Gmbh Desaturases and process for the production of polyunsaturated fatty acids in transgenic organisms
WO2009016208A2 (de) 2007-07-31 2009-02-05 Basf Plant Science Gmbh Elongasen und verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen organismen
US8119784B2 (en) 2008-04-02 2012-02-21 E. I. Du Pont De Nemours And Company Delta-4 desaturase and its use in making polyunsaturated fatty acids
US20110218348A1 (en) 2008-04-25 2011-09-08 Commonwealth Scientific Industrial Research Organisation Polypeptides and methods for producing triacylglycerols comprising modified fatty acids
CA2721879A1 (en) 2008-04-25 2009-10-29 Basf Plant Science Gmbh Plant seed oil
US8785727B2 (en) 2008-04-30 2014-07-22 Rothamsted Research Ltd. Desaturase and method for the production of polyunsaturated fatty acids in transgenic organisms
CA2726489A1 (en) 2008-06-03 2009-12-10 Basf Plant Science Gmbh Fatiy acid dehydratases and uses thereof
US8168858B2 (en) 2008-06-20 2012-05-01 E. I. Du Pont De Nemours And Company Delta-9 fatty acid elongase genes and their use in making polyunsaturated fatty acids
WO2010000708A2 (en) 2008-07-01 2010-01-07 Basf Plant Science Gmbh Promoters from brassica napus for seed specific gene expression
CA2768737A1 (en) 2008-07-21 2010-01-28 Commonwealth Scientific And Industrial Research Organisation Improved vegetable oils and uses therefor
ES2603530T3 (es) 2008-07-21 2017-02-28 Commonwealth Scientific And Industrial Research Organisation Aceite de semilla de algodón mejorado y usos
EP2331695B1 (en) 2008-08-26 2014-07-23 BASF Plant Science GmbH Nucleic acids encoding desaturases and modified plant oil
EP2337791B1 (en) 2008-10-14 2013-07-24 Monsanto Technology LLC Utilization of fatty acid desaturases from hemiselmis spp
CA3015426C (en) 2008-11-18 2020-01-14 Commonwealth Scientific And Industrial Research Organisation Recombinant cells comprising exogenous .delta.5 and .delta.6 desaturases, .delta.5 and .delta.6 elongases, and .delta.4 desaturases
DE112009003708T5 (de) 2008-12-12 2012-09-13 Basf Plant Science Gmbh Desaturasen und Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenenOrganismen
CA2760326A1 (en) 2009-05-13 2010-11-18 Basf Plant Science Company Gmbh Acyltransferases and uses thereof in fatty acid production
US8188335B2 (en) 2009-07-17 2012-05-29 Abbott Laboratories Δ9-elongase for production of polyunsaturated fatty acid-enriched oils
US9493520B2 (en) 2009-07-17 2016-11-15 Basf Plant Science Company Gmbh Fatty acid desaturases and elongases and uses thereof
US9428757B2 (en) 2009-08-31 2016-08-30 Basf Plant Science Company Gmbh Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis
CA2804025C (en) 2010-06-28 2023-02-21 Commonwealth Scientific And Industrial Research Organisation Methods of producing lipids
HUE033766T2 (en) 2012-06-15 2018-01-29 Commw Scient Ind Res Org Production of long chain polyunsaturated fatty acids in plant cells
EA037817B1 (ru) 2013-12-18 2021-05-25 Коммонвелт Сайнтифик Энд Индастриэл Рисерч Организэйшн Экстрагированный растительный липид, содержащий длинноцепочечные полиненасыщенные жирные кислоты
CA2953008C (en) 2014-06-27 2024-03-19 Nuseed Pty Ltd Lipid comprising docosapentaenoic acid

Patent Citations (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4399216A (en) 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
WO1984002913A1 (en) 1983-01-17 1984-08-02 Monsanto Co Chimeric genes suitable for expression in plant cells
US5504200A (en) 1983-04-15 1996-04-02 Mycogen Plant Science, Inc. Plant gene expression
EP0154204A2 (en) 1984-03-06 1985-09-11 Mgi Pharma, Inc. Herbicide resistance in plants
WO1987005327A1 (en) 1986-02-27 1987-09-11 The General Hospital Corporation Plant cells resistant to herbicidal glutamine synthetase inhibitors
EP0256223A1 (de) 1986-05-19 1988-02-24 Ciba-Geigy Ag Herbizid-tolerante Pflanzen, enthaltend ein Glutathion-S-Transferase-Gen
US5463174A (en) 1986-05-29 1995-10-31 Calgene Inc. Transformation and foreign gene expression in Brassica species
US5177010A (en) 1986-06-30 1993-01-05 University Of Toledo Process for transforming corn and the products thereof
US5608152A (en) 1986-07-31 1997-03-04 Calgene, Inc. Seed-specific transcriptional regulation
US5104310A (en) 1986-11-24 1992-04-14 Aga Aktiebolag Method for reducing the flame temperature of a burner and burner intended therefor
US5159135A (en) 1986-12-03 1992-10-27 Agracetus Genetic engineering of cotton plants and lines
US5004863B1 (enExample) 1986-12-03 1992-12-08 Agracetus
US5004863B2 (en) 1986-12-03 2000-10-17 Agracetus Genetic engineering of cotton plants and lines
US5159135B1 (en) 1986-12-03 2000-10-24 Agracetus Genetic engineering of cotton plants and lines
US5004863A (en) 1986-12-03 1991-04-02 Agracetus Genetic engineering of cotton plants and lines
EP0275957A2 (de) 1987-01-21 1988-07-27 Hoechst Aktiengesellschaft In Pflanzen wirksames Resistenzgen gegen Phosphinothricin und seine Verwendung
US5416011A (en) 1988-07-22 1995-05-16 Monsanto Company Method for soybean transformation and regeneration
US5569834A (en) 1988-07-22 1996-10-29 Monsanto Company Method for soybean transformation and regeneration
US5932479A (en) 1988-09-26 1999-08-03 Auburn University Genetic engineering of plant chloroplasts
WO1991002071A2 (en) 1989-08-09 1991-02-21 Dekalb Plant Genetics Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
WO1991013980A1 (en) 1990-03-16 1991-09-19 Calgene, Inc. Novel sequences preferentially expressed in early seed development and methods related thereto
US5877402A (en) 1990-05-01 1999-03-02 Rutgers, The State University Of New Jersey DNA constructs and methods for stably transforming plastids of multicellular plants and expressing recombinant proteins therein
US5451513A (en) 1990-05-01 1995-09-19 The State University of New Jersey Rutgers Method for stably transforming plastids of multicellular plants
US5518908A (en) 1991-09-23 1996-05-21 Monsanto Company Method of controlling insects
US5859347A (en) 1992-03-19 1999-01-12 Monsanto Company Enhanced expression in plants
AU667939B2 (en) 1992-07-07 1996-04-18 Japan Tobacco Inc. Method of transforming monocotyledon
AU6178194A (en) 1993-03-11 1994-09-26 National Research Council Of Canada Enhanced regeneration system for cereals
US5589617A (en) 1993-03-11 1996-12-31 National Research Council Of Canada Enhanced regeneration system
CA2092588A1 (en) 1993-03-26 1994-09-27 Narender S. Nehra Enhanced regeneration system for cereals
US5362865A (en) 1993-09-02 1994-11-08 Monsanto Company Enhanced expression in plants using non-translated leader sequences
WO1995015389A2 (en) 1993-12-02 1995-06-08 Olsen Odd Arne Promoter
WO1995023230A1 (en) 1994-02-24 1995-08-31 Olsen Odd Arne Promoter from a lipid transfer protein gene
US5545818A (en) 1994-03-11 1996-08-13 Calgene Inc. Expression of Bacillus thuringiensis cry proteins in plant plastids
US5939288A (en) 1995-06-07 1999-08-17 Iowa State University Research Foundation, Inc. Plant secretory signal peptides and nectarins
WO1997006269A1 (en) 1995-08-03 1997-02-20 Zeneca Limited Inducible herbicide resistance
WO1998045461A1 (en) 1997-04-09 1998-10-15 Rhone-Poulenc Agro An oleosin 5' regulatory region for the modification of plant seed lipid composition
US6541257B2 (en) 1997-04-29 2003-04-01 The Regents Of The University Of California Method for preparing barley green regenerative tissue
WO1999005265A2 (en) 1997-07-23 1999-02-04 Sanford Scientific, Inc. Improved plastid transformation of higher plants and production of transgenic plants with herbicide resistance
WO1999014314A1 (en) 1997-09-12 1999-03-25 Commonwealth Scientific And Industrial Research Organisation Regulation of gene expression in plants
WO1999016890A2 (en) 1997-09-30 1999-04-08 The Regents Of The University Of California Production of proteins in plant seeds
US6100447A (en) 1998-02-12 2000-08-08 Applied Phytologics, Inc. Method of barley transformation
WO2000052183A1 (en) * 1999-03-05 2000-09-08 Monsanto Technology Llc Multigene expression vectors for the biosynthesis of products via multienzyme biological pathways
US20030159173A1 (en) 1999-10-20 2003-08-21 Wolter Frank P. Elongase promoters for tissue-specific expression of transgenes in plants
WO2001038512A2 (en) * 1999-11-22 2001-05-31 Plant Bioscience Limited Enhanced transgene expression by co-expression with a suppressor of post-transcriptional gene silencing (ptgs)
WO2001070777A2 (en) 2000-03-16 2001-09-27 The Regents Of The University Of California Leafy cotyledon2 genes and their uses
US20070192902A1 (en) 2001-06-06 2007-08-16 Bioriginal Food & Science Corp. Flax (Linum usitatissimum I.) seed-specific promoters
WO2004017467A2 (en) 2002-08-19 2004-02-26 Anderson Power Products A handle locking system for electrical connectors and methods thereof
WO2004071467A2 (en) 2003-02-12 2004-08-26 E. I. Du Pont De Nemours And Company Production of very long chain polyunsaturated fatty acids in oilseed plants
WO2005012316A2 (de) 2003-08-01 2005-02-10 Basf Plant Science Gmbh Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen
WO2005103253A1 (en) 2004-04-22 2005-11-03 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
WO2007005882A2 (en) * 2005-07-05 2007-01-11 North Carolina State University Methods and compositions for expressing proteins in plants
WO2007092460A2 (en) * 2006-02-03 2007-08-16 The Texas A & M University System Enhancing expression of value-added genes by transgenic expression of tombusvirus-based p19 gene mutants
WO2007096387A1 (de) 2006-02-21 2007-08-30 Basf Plant Science Gmbh Verfahren zur herstellung von mehrfach ungesättigten fettsäuren
WO2007137788A1 (en) 2006-05-29 2007-12-06 Icon Genetics Gmbh Plant virus-based inducible expression system
WO2008009600A1 (de) * 2006-07-21 2008-01-24 Basf Plant Science Gmbh Verfahren zur herstellung von arachidonsäure und/oder eicosapentaensäure in pflanzen
US9710621B1 (en) 2011-11-02 2017-07-18 Google Inc. Platform for cloud application software

Non-Patent Citations (173)

* Cited by examiner, † Cited by third party
Title
A. SLATER ET AL.: "Plant Biotechnology - The Genetic Manipulation of Plants", 2003, OXFORD UNIVERSITY PRESS
ABBADI ET AL., PLANT CELL, vol. 16, 2004, pages 2734 - 2748
ABBOTT ET AL., SCIENCE, vol. 282, 1998, pages 2012 - 2018
ABDULLAH ET AL., BIOTECH., vol. 4, 1986, pages 1087
AGABA ET AL., MARINE BIOTECHNOL. (NY, vol. 6, 2004, pages 251 - 261
AL-MARIRI ET AL., INFECT. IMMUN., vol. 70, 2002, pages 1915 - 1923
ALVAREZ ET AL., THEOR APPL GENET, vol. 100, 2000, pages 319 - 327
BATES ET AL., J. BIOL. CHEM., vol. 282, 2007, pages 31206 - 31216
BAUMBERGER ET AL., CURR. BIOL., vol. 17, 2007, pages 1609 - 1614
BAUMLEIN ET AL., MOL. GEN. GENET., vol. 225, 1991, pages 459 - 467
BAUMLEIN ET AL., PLANT J., vol. 2, 1992, pages 233 - 239
BEAUDOIN ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 97, 2000, pages 6421 - 6426
BECLIN ET AL., CURR. BIOL., vol. 12, 2002, pages 684 - 688
BERBERICH. ET AL., PLANT MOL. BIOL., vol. 36, 1998, pages 297 - 306
BLIGH; DYER, CANADIAN J. BIOCHEM., vol. 37, 1959, pages 911 - 917
BORTOLAMIOL ET AL., CURR. BIOL., vol. 17, 2007, pages 1615 - 1621
BOUVIER-NAVE ET AL., EURO. J. BIOCHM., vol. 267, 2000, pages 85 - 96
BRODERSEN ET AL., SCIENCE, vol. 320, 2008, pages 1185 - 1190
BROOTHAERTS ET AL., NATURE, vol. 433, 2005, pages 629 - 633
BROSNAN ET AL., PROC. NATL. ACAD. SCI U.S.A., vol. 104, 2007, pages 14741 - 14746
BROUN ET AL., PLANT J., vol. 13, 1998, pages 201 - 210
CAPECCHI, CELL, vol. 22, 1980, pages 479 - 488
CHAPMAN ET AL., GEN. DEV., vol. 18, 2004, pages 1179 - 1186
CHEN ET AL., THE PLANT CELL, vol. 16, 2004, pages 1302 - 1313
CHENG ET AL., PLANT CELL REP., vol. 15, 1996, pages 653 - 657
CHIKWAMBA ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 100, 2003, pages 11127 - 11132
CHO ET AL., J. BIOL. CHEM., vol. 274, 1999, pages 37335 - 37339
CHO ET AL., J. BIOL. CHEM., vol. 274, 1999, pages 471 - 477
CHUNG ET AL., BMC GENOMICS, vol. 7, 2006, pages 120
CLAPP, CLIN. PERINATOL., vol. 20, 1993, pages 155 - 168
CLOUGH; BENT, PLANT J., vol. 16, 1998, pages 735 - 43
COURVALIN ET AL., LIFE SCI., vol. 318, 1995, pages 1209 - 1212
COUTU ET AL., TRANSGENIC RES., vol. 16, 2007, pages 771 - 781
CURIEL ET AL., HUM. GEN. THER., vol. 3, 1992, pages 147 - 154
DAFNY-YELIN, M. ET AL.: "Delivery of multiple transgenes to plant cells.", PLANT PHYSIOLOGY, vol. 145, 2007, pages 1118 - 1128, XP002614980 *
DARJI ET AL., CELL, vol. 91, 1997, pages 765 - 775
DENIC; WEISSMAN, CELL, vol. 130, 2007, pages 663 - 677
DIETRICH ET AL., NATURE BIOTECH., vol. 18, 1998, pages 181 - 185
DIETRICH ET AL., VACCINE, vol. 19, 2001, pages 2506
DING; VOINNET, CELL, vol. 130, 2007, pages 413 - 426
DOMERGUE ET AL., BIOCHEM. J., vol. 1389, 2005, pages 483 - 490
DOMERGUE ET AL., EUR. J. BIOCHEM., vol. 269, 2002, pages 4105 - 4113
DOMERGUE ET AL., J. BIOL. CHEM., vol. 278, 2003, pages 35115 - 35126
DUNOYER ET AL., THE PLANT CELL, vol. 16, 2004, pages 1235 - 1250
EGLITIS ET AL., BIOTECHNIQUES, vol. 6, 1988, pages 608 - 614
ELLERSTROM ET AL., PLANT MOL. BIOL., vol. 32, 1996, pages 1019 - 1027
FEHR: "Breeding Methods for Cultivar Development", 1987, AMERICAN SOCIETY OF AGRONOMY, MADISON WIS.
FENNELLY ET AL., J. IMMUNOL., vol. 162, 1999, pages 1603 - 1610
FRASER ET AL., PLANT PHYSIOL., vol. 135, 2004, pages 859 - 866
FUJI ET AL., PLANT CELL, vol. 19, 2007, pages 597 - 609
FUJIMURA ET AL., PLANT TISSUE CULTURE LETT., vol. 2, 1985, pages 74
GARCIA-MAROTO ET AL., LIPIDS, vol. 37, 2002, pages 417 - 426
GELVIN ET AL.: "Plant Molecular Biology Manual", 1990, KLUWER ACADEMIC PUBLISHERS
GIRKE ET AL., PLANT J., vol. 15, 1998, pages 39 - 48
GLEAVE, PLANT MOL. BIOL., vol. 20, 1992, pages 1203 - 1207
GLEVIN ET AL., MICROBIOL. MOL. BIOL. REV., vol. 67, 2003, pages 16 - 37
GLICK ET AL., PROC. NATL. ACAD. SCI U.S.A., vol. 105, 2008, pages 157 - 161
GRAHAM ET AL., VIROLOGY, vol. 54, 1973, pages 536 - 539
GRANT ET AL., PLANT CELL REP., vol. 15, 1995, pages 254 - 258
GRILLOT-COURVALIN ET AL., NATURE BIOTECH., vol. 16, 1998, pages 862 - 866
GRILLOT-COURVALIN, CURR. OPIN. BIOTECH., vol. 10, 1999, pages 477 - 481
GUILLARD; RYTHERS, CAN. J. MICROBIOL., vol. 8, 1962, pages 229 - 239
HAGAN ET AL., PLANT. BIOTECH. J., vol. 1, 2003, pages 479 - 490
HALPIN, C.: "Gene stacking in transgenic plants - the challenge for 21st century plant biotechnology.", PLANT BIOTECHNOLOGY JOURNAL, vol. 3, 2005, pages 141 - 155, XP002545970 *
HAMILTON; BAULCOMBE, SCIENCE, vol. 286, 1999, pages 950 - 952
HARAYAMA, TRENDS BIOTECHNOL., vol. 16, 1998, pages 76 - 82
HASTINGS ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 98, 2001, pages 14304 - 14309
HENSE ET AL., CELL MICROBIOL., vol. 3, 2001, pages 599 - 609
HINCHEE ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 915 - 922
HOFFMANN ET AL., J BIOL. CHEM., vol. 283, 2008, pages 22352 - 22362
HONG ET AL., LIPIDS, vol. 37, 2002, pages 863 - 868
HORIGUCHI ET AL., PLANT CELL PHYSIOL., vol. 39, 1998, pages 540 - 544
HORVATH ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 97, 2000, pages 1914 - 1919
HOUDEBINE: "Transgenic animals - Generation and Use", 1997, HARWOOD ACADEMIC
HUANG ET AL., BIOCHIMIE, vol. 86, no. 11, 2004, pages 793 - 8
HUANG ET AL., LIPIDS, vol. 34, 1999, pages 649 - 659
INAGAKI ET AL., BIOSCI. BIOTECHNOL. BIOCHEM., vol. 66, 2002, pages 613 - 621
JOHANSEN; CARRINGTON, PLANT PHYSIOL., vol. 126, 2001, pages 930 - 938
KAJIKAWA ET AL., FEBS LETT, vol. 580, 2006, pages 149 - 154
KAJIKAWA ET AL., PLANT MOL. BIOL., vol. 54, 2004, pages 335 - 52
KAPILA ET AL., PLANT SCI., vol. 122, 1997, pages 101 - 108
KASSCHAU ET AL., DEVEL. CELL, vol. 4, 2003, pages 205 - 217
KHOZIN ET AL., PLANT PHYSIOL., vol. 114, 1997, pages 223 - 230
KLEE ET AL.: "Plant DNA Infectious Agents", 1985, SPRINGER-VERLAG, NEW YORK, pages: 179 - 203
KNUTZON ET AL., J. BIOL CHEM., vol. 273, 1998, pages 29360 - 6
KOZIEL ET AL., PLANT MOL. BIOL., vol. 32, 1996, pages 393 - 405
KUNIK ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 98, 2001, pages 1871 - 1876
LACROIX ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 105, pages 15429 - 15434
LAZO ET AL., BIOTECHNOL., vol. 9, 1991, pages 693 - 697
LECHTENBERG ET AL., PLANT J., 2003, pages 507 - 517
LEONARD ET AL., BIOCHEM. J., vol. 347, 2000, pages 719 - 724
LEONARD ET AL., BIOCHEM. J., vol. 350, 2000, pages 765 - 770
LEONARD ET AL., LIPIDS, vol. 37, 2002, pages 733 - 740
LEWSEY ET AL., PLANT J., vol. 50, 2007, pages 240 - 252
LINDBO ET AL., PLANT CELL, vol. 5, 1993, pages 1749 - 1759
LO ET AL., GENOME RES., vol. 13, 2003, pages 455 - 466
LU ET AL., J. EXP. MED., vol. 178, 1993, pages 2089 - 2096
MALLORY ET AL., NAT. BIOTECH., vol. 20, 2002, pages 622 - 625
MARILLONNET ET AL., NATURE BIOTECHNOLOGY, vol. 23, 2005, pages 718 - 723
MATZKE ET AL., SCIENCE, vol. 293, 2001, pages 1080 - 1083
MENG ET AL., J. GEN. VIROL., vol. 89, 2008, pages 2349 - 2358
MEYER ET AL., BIOCHEM., vol. 42, 2003, pages 9779 - 9788
MEYER ET AL., LIPID RES, vol. 45, 2004, pages 1899 - 1909
MICHAELSON ET AL., FEBS LETT., vol. 439, 1998, pages 215 - 218
MICHAELSON ET AL., J. BIOL. CHEM., vol. 273, 1998, pages 19055 - 19059
MOREAU, PROGRESS LIP. RES., vol. 37, 1998, pages 371 - 391
NAPIER ET AL., BIOCHEM. J., vol. 330, 1998, pages 611 - 614
NAPIER, ANN. REV. PLANT. BIOL., vol. 58, 2007, pages 295 - 319
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
NIEDZ ET AL., PLANT CELL REPORTS, vol. 14, 1995, pages 403
NISHIZAWA ET AL., PLANT J., vol. 34, 2003, pages 647 - 659
OHLROGGE; BROWSE, PLANT CELL, vol. 7, 1995, pages 957 - 970
OW ET AL., SCIENCE, vol. 234, 1986, pages 856 - 859
P. CHRISTOU; H. KLEE: "Handbook of Plant Biotechnology", 2004, JOHN WILEY AND SONS
PARKER-BARNES ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 8284 - 8289
PEREIRA ET AL., BIOCHEM. J., vol. 378, 2004, pages 665 - 671
PEREIRA ET AL., BIOCHEM. J., vol. 384, 2004, pages 357 - 366
PERRIN ET AL., MOL BREED, vol. 6, 2000, pages 345 - 352
POTENZA ET AL., IN VITRO CELL DEV BIOL - PLANT, vol. 40, 2004, pages 1 - 22
POUWELS ET AL.: "Cloning Vectors: A Laboratory Manual", 1985
PRASHER ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 127, 1985, pages 31 - 36
QI ET AL., FEBS LETT., vol. 510, 2002, pages 159 - 165
QI ET AL., NAT. BIOTECH., vol. 22, 2004, pages 739 - 745
QIU ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 31561 - 31566
REDDY ET AL., PLANT MOL. BIOL., vol. 22, 1993, pages 293 - 300
REDDY; THOMAS, NAT. BIOTECH., vol. 14, 1996, pages 639 - 642
ROBERT ET AL., FUNC. PLANT BIOL., vol. 32, 2005, pages 473 - 479
ROBERT ET AL., MARINE BIOTECH, vol. 11, 2009, pages 410 - 418
ROBERT, S.S. ET AL.: "Metabolic engineering of Arabidopsis to produce nutritionally important DHA in seed oil.", FUNCTIONAL PLANT BIOLOGY., vol. 32, 2005, pages 473 - 479, XP008061225 *
ROSE ET AL., NUCLEIC ACIDS RES., vol. 26, 1998, pages 1628 - 1635
SAHA ET AL., PLANT PHYSIOL., vol. 141, 2006, pages 1533 - 1543
SAITO ET AL., EUR. J. BIOCHEM., vol. 267, 2000, pages 1813 - 1818
SAKURADANI ET AL., GENE, vol. 238, 1999, pages 445 - 453
SATO ET AL., CROP SCI., vol. 44, 2004, pages 646 - 652
SAYANOVA ET AL., FEBS LETT., vol. 542, 2003, pages 100 - 104
SAYANOVA ET AL., PLANT PHYSIOL, vol. 144, 2007, pages 455 - 467
SAYANOVA ET AL., PLANTA, vol. 224, 2006, pages 1269 - 1277
SAYANOVA ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 94, 1997, pages 4211 - 4216
SCHAFFNER ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 77, 1980, pages 2163 - 2167
SCHUBERT ET AL., PLANT CELL, vol. 16, 2004, pages 2561 - 2572
SHIANU ET AL., VACCINE, vol. 19, 2001, pages 3947 - 3956
SINGH ET AL., CURR. OPIN. IN PLANT BIOL., vol. 8, 2005, pages 197 - 203
SIZEMORE ET AL., SCIENCE, vol. 270, 1995, pages 299 - 302
SLATER, S. ET AL.: "Metabolic engineering ofArabidopsis and Brassica for poly (3- hydtoxybutyrate-co-3-hydroxyvlerate) copolymer production.", NATURE BIOTECHNOLOGY, vol. 17, 1999, pages 1011 - 1016, XP002142691 *
SPERLING ET AL., ARCH. BIOCHM. BIOPHYS., vol. 388, 2001, pages 293 - 8
SPERLING ET AL., EUR. J. BIOCHEM., vol. 267, 2000, pages 3801 - 3811
SPRECHER ET AL., J. LIPID RES., vol. 36, 1995, pages 2471 - 2477
SPYCHALLA ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 94, 1997, pages 1142 - 1147
STALKER ET AL., J. BIOL. CHEM., vol. 263, 1998, pages 6310 - 6314
THILLET ET AL., J. BIOL. CHEM, vol. 263, 1988, pages 12500 - 12508
TONON ET AL., FEBS LETT., vol. 553, 2003, pages 440 - 444
TORIYAMA ET AL., THEOR. APPL. GENET., vol. 205, 1986, pages 34
TRAUTWEIN, EUROPEAN J. LIPID SCI. AND TECH., vol. 103, 2001, pages 45 - 55
TVRDIK, J. CELL BIOL., vol. 149, 2000, pages 707 - 718
TZFIRA; CITOVSKY, CURR. OPIN. BIOTECH., vol. 17, 2006, pages 147 - 154
VOINNET ET AL., PLANT J., vol. 33, 2003, pages 949 - 956
WAGNER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 6099 - 6103
WALLIS; BROWSE, ARCH. BIOCHEM. BIOPHYS., vol. 365, 1999, pages 307 - 316
WATTS; BROWSE; 1999, ARCH. BIOCHEM. BIOPHYS., vol. 362, pages 175 - 182
WEISS ET AL., INT. J. MED. MICROBIOL., vol. 293, no. 95, 2003, pages 106
WEISSBACH ET AL.: "Methods for Plant Molecular Biology", 1988, ACADEMIC PRESS, SAN DIEGO, CALIF.
WEISSBACH; WEISSBACH: "Methods for Plant Molecular Biology", 1989, ACADEMIC PRESS
WHITNEY ET AL., PLANTA, vol. 217, 2003, pages 983 - 992
WU ET AL., NAT. BIOTECH., vol. 23, 2005, pages 1013 - 1017
YANG ET AL., PLANTA, vol. 216, 2003, pages 597 - 603
YANG ET AL.: "Particle Bombardment Technology for Gene Transfer", 1994, OXFORD PRESS, OXFORD, ENGLAND
YU ET AL., PROC. NATL. ACAD. SCI U.S.A., vol. 104, 2007, pages 8924 - 8929
ZANK ET AL., PLANT J., vol. 31, 2002, pages 255 - 268
ZHANG ET AL., FEBS LETT., vol. 556, 2004, pages 81 - 85
ZHANG ET AL., YEAST, vol. 25, 2007, pages 21 - 27
ZHOU ET AL., PHYTOCHEM., vol. 68, 2007, pages 785 - 796
ZHOU ET AL., PLANT SCI., vol. 170, 2006, pages 665 - 673
ZIPFEL ET AL., CELL, vol. 125, 2006, pages 749 - 760

Cited By (112)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11180769B2 (en) 2003-08-01 2021-11-23 Basf Plant Science Gmbh Method for the production of multiple-unsaturated fatty acids in transgenic organisms
US11952581B2 (en) 2003-08-01 2024-04-09 Basf Plant Science Gmbh Process for the production of polyunsaturated fatty acids in transgenic organisms
US10035989B2 (en) 2004-02-27 2018-07-31 Basf Plant Science Gmbh Method for producing polyunsaturated fatty acids in transgenic plants
US9624477B2 (en) 2004-02-27 2017-04-18 Basf Plant Science Gmbh Method for producing unsaturated omega-3-fatty acids in transgenic organisms
US10443079B2 (en) 2004-04-22 2019-10-15 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US8106226B2 (en) 2004-04-22 2012-01-31 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US11220698B2 (en) 2004-04-22 2022-01-11 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US9926579B2 (en) 2004-04-22 2018-03-27 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US11597953B2 (en) 2004-04-22 2023-03-07 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US9951357B2 (en) 2004-04-22 2018-04-24 Commonweatlh Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US9963723B2 (en) 2004-04-22 2018-05-08 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US10781463B2 (en) 2004-04-22 2020-09-22 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cells
US9970033B2 (en) 2004-04-22 2018-05-15 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US9458410B2 (en) 2004-04-22 2016-10-04 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US9453183B2 (en) 2004-04-22 2016-09-27 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US9994880B2 (en) 2004-04-22 2018-06-12 Commonwealth Scientific And Industrial Research Organisation Synthesis of long-chain polyunsaturated fatty acids by recombinant cell
US10533182B2 (en) 2006-02-21 2020-01-14 Basf Plant Science Gmbh Oils, lipids and fatty acids produced in transgenic brassica plant
US10301638B2 (en) 2006-02-21 2019-05-28 Basf Plant Science Gmbh Oils, lipids and fatty acids produced in transgenic Brassica plant
US10533183B2 (en) 2006-02-21 2020-01-14 Basf Plant Science Gmbh Oils, lipids and fatty acids produced in transgenic Brassica plant
US10190131B2 (en) 2006-02-21 2019-01-29 Basf Plant Science Gmbh Method for producing polyunsaturated fatty acids
US9351507B2 (en) 2006-07-14 2016-05-31 Commonwealth Scientific And Industrial Research Organisation Method of preparing food using rice oil
US10260021B2 (en) 2006-07-14 2019-04-16 Commonwealth Scientific And Industrial Research Organisation Rice plants and methods of producing rice grain
US8530724B2 (en) 2006-07-14 2013-09-10 Commonwealth Scientific And Industrial Research Organisation Altering the fatty acid composition of rice
US8921652B2 (en) 2008-07-21 2014-12-30 Commonwealth Scientific And Industrial Research Organisation Vegetable oils and uses therefor
US9057075B2 (en) 2008-07-21 2015-06-16 Commonwealth Scientific And Industrial Research Organisation Cottonseed oil and uses
US8716555B2 (en) 2008-07-21 2014-05-06 Commonwealth Scientific And Industrial Research Organisation Cottonseed oil and uses
US9938486B2 (en) 2008-11-18 2018-04-10 Commonwealth Scientific And Industrial Research Organisation Enzymes and methods for producing omega-3 fatty acids
US10351870B2 (en) 2009-07-17 2019-07-16 Basf Plant Science Company Gmbh Uses of novel fatty acid desaturases and elongases and products thereof
US11913007B2 (en) 2009-07-17 2024-02-27 Basf Plant Science Company Gmbh Uses of novel fatty acid desaturases and elongases and products thereof
US9127288B2 (en) 2010-06-28 2015-09-08 Commonwealth Scientific And Industrial Research Organisation Methods of producing lipids
WO2012000026A1 (en) 2010-06-28 2012-01-05 Commonwealth Scientific And Industrial Research Organisation Methods of producing lipids
US10925293B2 (en) 2010-06-28 2021-02-23 Commonwealth Scientific And Industrial Research Organisation Methods of producing lipids
EP2695936A1 (en) * 2010-10-21 2014-02-12 BASF Plant Science Company GmbH Novel fatty acid desaturases and uses thereof
EP2740797A4 (en) * 2011-08-04 2015-09-30 Suntory Holdings Ltd PROTEIN WITH MECHANISM FOR PROMOTING THE EXTRACTION OF FATTY ACID, AND GENE GENERATING THAT AND USE THEREOF
US9499829B2 (en) 2011-12-27 2016-11-22 Commonwealth Scientific And Industrial Research Organisation Processes for producing lipids
US10246641B2 (en) 2011-12-27 2019-04-02 The Commonwealth Scientific And Industrial Research Organisation Processes for producing hydrocarbon products
US9347067B2 (en) 2011-12-27 2016-05-24 Commonwealth Scientific And Industrial Research Organisation Production of dihydrosterculic acid and derivatives thereof
US10876127B2 (en) 2011-12-27 2020-12-29 Commonwealth Scientific And Industrial Research Organisation Production of dihydrosterculic acid and derivatives thereof
WO2013096993A1 (en) 2011-12-27 2013-07-04 Commonwealth Scientific And Industrial Research Organisation Processes for producing lipids
US10822615B2 (en) 2011-12-27 2020-11-03 Commonwealth Scientific And Industrial Research Organisation Simultaneous gene silencing and suppressing gene silencing in the same cell
US8735111B2 (en) 2011-12-27 2014-05-27 Commonwealth Scientific And Industrial Research Organisation Processes for producing hydrocarbon products
US8809026B2 (en) 2011-12-27 2014-08-19 Commonwealth Scientific And Industrial Research Organisation Processes for producing lipids
US9061992B2 (en) 2011-12-27 2015-06-23 Commonwealth Scientific And Industrial Research Organisation Processes for producing hydrocarbon products
WO2013096991A1 (en) 2011-12-27 2013-07-04 Commonwealth Scientific And Industrial Research Organisation Production of dihydrosterculic acid and derivatives thereof
EP2798063A4 (en) * 2011-12-27 2015-10-28 Commw Scient Ind Res Org PREPARATION OF DIHYDROSTERCULINIC ACID AND DERIVATIVES THEREOF
US9512438B2 (en) 2011-12-27 2016-12-06 Commonwealth Scientific And Industrial Research Organisation Processes for producing hydrocarbon products
US11560571B2 (en) 2011-12-27 2023-01-24 Commonwealth Scientific And Industrial Research Organisation Simultaneous gene silencing and suppressing gene silencing in ihe same cell
US11639507B2 (en) 2011-12-27 2023-05-02 Commonwealth Scientific And Industrial Research Organisation Processes for producing lipids
US10246718B2 (en) 2011-12-27 2019-04-02 The Commonwealth Scientific And Industrial Research Organisation Processes for producing lipids
AU2012324003B2 (en) * 2011-12-27 2016-05-26 Commonwealth Scientific And Industrial Research Organisation Simultaneous gene silencing and supressing gene silencing in the same cell
WO2013096992A1 (en) 2011-12-27 2013-07-04 Commonwealth Scientific And Industrial Reserach Organisation Simultaneous gene silencing and supressing gene silencing in the same cell
US10323209B2 (en) 2012-04-25 2019-06-18 Commonwealth Scientific And Industrial Research Organisation High oleic acid oils
US11124737B2 (en) 2012-04-25 2021-09-21 Commonwealth Scientific Andn Industrial Research Organisation High oleic acid oils
AU2013273934B2 (en) * 2012-06-15 2016-12-01 Commonwealth Scientific And Industrial Research Organisation Production of long chain polyunsaturated fatty acids in plant cells
US8946460B2 (en) * 2012-06-15 2015-02-03 Commonwealth Scientific And Industrial Research Organisation Process for producing polyunsaturated fatty acids in an esterified form
CN104853596B (zh) * 2012-06-15 2018-10-09 联邦科学技术研究组织 在植物细胞中产生长链多不饱和脂肪酸
US9999607B2 (en) 2012-06-15 2018-06-19 Commonwealth Scientific And Industrial Research Organisation Lipid comprising polyunsaturated fatty acids
US9969954B2 (en) 2012-06-15 2018-05-15 Commonwealth Scientific And Industrial Research Organisation Oil comprising polyunsaturated fatty acids
EP2861059B1 (en) 2012-06-15 2017-05-03 Commonwealth Scientific and Industrial Research Organisation Production of long chain polyunsaturated fatty acids in plant cells
US10899992B2 (en) 2012-06-15 2021-01-26 Commonwealth Scientific And Industrial Research Organisation Lipid comprising polyunsaturated fatty acids
US9550718B2 (en) 2012-06-15 2017-01-24 Commonwealth Scientific And Industrial Research Organisation Lipid comprising polyunsaturated fatty acids
US9932289B2 (en) 2012-06-15 2018-04-03 Commonwealth Scientific And Industrial Research Ogranisation Process for producing ethyl esters of polyunsaturated fatty acids
US10335386B2 (en) 2012-06-15 2019-07-02 Commonwealth Scientific And Industrial Research Organisation Lipid comprising polyunsaturated fatty acids
CN104853596A (zh) * 2012-06-15 2015-08-19 联邦科学技术研究组织 在植物细胞中产生长链多不饱和脂肪酸
US9932290B2 (en) 2012-06-15 2018-04-03 Commonwealth Scientific And Industrial Research Organisation Process for producing ethyl esters of polyunsaturated fatty acids
US11306271B2 (en) 2012-06-15 2022-04-19 Commonwealth Scientific And Industrial Research Organisation Process for producing extracted lipid comprising docosahexaenoic acid
US11834621B2 (en) 2012-06-15 2023-12-05 Nuseed Global Innovation Ltd. Lipid comprising polyunsaturated fatty acids
US9932541B2 (en) 2012-06-15 2018-04-03 Commonwealth Scientific And Industrial Research Organisation Process for producing ethyl esters of polyunsaturated fatty acids
US10655082B2 (en) 2012-06-15 2020-05-19 Commonwealth Scientific And Industrial Research Organisation Oil comprising polyunsaturated fatty acids
KR20200083595A (ko) * 2012-06-15 2020-07-08 커먼웰쓰 사이언티픽 앤 인더스트리알 리서치 오거니제이션 식물 세포에서 장쇄 다중불포화 지방산의 생성
US9556102B2 (en) 2012-06-15 2017-01-31 Commonwealth Scientific And Industrial Research Organisation Process for producing ethyl esters of polyunsaturated fatty acids
WO2013185184A2 (en) 2012-06-15 2013-12-19 Commonwealth Scientific And Industrial Research Organisation Production of long chain polyunsaturated fatty acids in plant cells
WO2013185184A3 (en) * 2012-06-15 2014-02-13 Commonwealth Scientific And Industrial Research Organisation Production of long chain polyunsaturated fatty acids in plant cells
EP3266316A1 (en) 2012-06-15 2018-01-10 Commonwealth Scientific and Industrial Research Organisation Production of long chain polyunsaturated fatty acids in plant cells
EA036786B1 (ru) * 2012-06-15 2020-12-21 Коммонвелт Сайнтифик Энд Индастриэл Рисерч Организэйшн Выработка длинноцепочечных полиненасыщенных жирных кислот в растительных клетках
US12421472B2 (en) 2012-06-15 2025-09-23 Commonwealth Scientific Industrial Research Organisation - Process for producing extracted lipid comprising docosahexaenoic acid
KR102197208B1 (ko) 2012-06-15 2021-01-04 커먼웰쓰 사이언티픽 앤 인더스트리알 리서치 오거니제이션 식물 세포에서 장쇄 다중불포화 지방산의 생성
US20160289692A1 (en) * 2012-09-18 2016-10-06 University Of Guelph Vectors and Methods For Enhancing Recombinant Protein Expression in Plants
WO2014053821A1 (en) * 2012-10-01 2014-04-10 Rothamsted Research Limited Recombinant organisms
US10125084B2 (en) 2013-12-18 2018-11-13 Commonwealth Scientific And Industrial Research Organisation Lipid comprising docosapentaenoic acid
US9725399B2 (en) 2013-12-18 2017-08-08 Commonwealth Scientific And Industrial Research Organisation Lipid comprising long chain polyunsaturated fatty acids
US9718759B2 (en) 2013-12-18 2017-08-01 Commonwealth Scientific And Industrial Research Organisation Lipid comprising docosapentaenoic acid
US11623911B2 (en) 2013-12-18 2023-04-11 Commonwealth Scientific And Industrial Research Organisation Lipid comprising docosapentaenoic acid
US10800729B2 (en) 2013-12-18 2020-10-13 Commonwealth Scientific And Industrial Research Organisation Lipid comprising long chain polyunsaturated fatty acids
US10190073B2 (en) 2013-12-18 2019-01-29 Commonwealth Scientific And Industrial Research Organisation Lipid comprising long chain polyunsaturated fatty acids
KR102673214B1 (ko) 2014-06-27 2024-06-10 커먼웰쓰 사이언티픽 앤 인더스트리알 리서치 오거니제이션 도코사펜타에노산을 포함하는 지질
US10793507B2 (en) 2014-06-27 2020-10-06 Commonwealth Scientific And Industrial Research Organisation Lipid compositions comprising triacylglycerol with long-chain polyunsaturated fatty acids at the SN-2 position
US10005713B2 (en) 2014-06-27 2018-06-26 Commonwealth Scientific And Industrial Research Organisation Lipid compositions comprising triacylglycerol with long-chain polyunsaturated fatty acids at the sn-2 position
KR20170039657A (ko) * 2014-06-27 2017-04-11 커먼웰쓰 사이언티픽 앤 인더스트리알 리서치 오거니제이션 도코사펜타에노산을 포함하는 지질
WO2015196250A1 (en) * 2014-06-27 2015-12-30 Commonwealth Scientific And Industrial Research Organisation Lipid comprising docosapentaenoic acid
KR20230074263A (ko) * 2014-06-27 2023-05-26 커먼웰쓰 사이언티픽 앤 인더스트리알 리서치 오거니제이션 도코사펜타에노산을 포함하는 지질
EA037184B1 (ru) * 2014-06-27 2021-02-16 Коммонвелт Сайнтифик Энд Индастриэл Рисерч Организэйшн Липид, содержащий докозапентаеновую кислоту
KR102527795B1 (ko) 2014-06-27 2023-05-02 커먼웰쓰 사이언티픽 앤 인더스트리알 리서치 오거니제이션 도코사펜타에노산을 포함하는 지질
EP4303288A3 (en) * 2014-07-07 2024-03-06 Nuseed Global Innovation Ltd Processes for producing industrial products from plant lipids
US11814600B2 (en) 2014-07-07 2023-11-14 Nuseed Global Innnovation Ltd. Process for producing industrial products from plant lipids
US11365369B2 (en) 2014-07-07 2022-06-21 Commonwealth Scientific And Industrial Research Organisation Processes for producing industrial products from plant lipids
EP4303288A2 (en) 2014-07-07 2024-01-10 Nuseed Global Innovation Ltd Processes for producing industrial products from plant lipids
EP2966157A1 (en) 2014-07-07 2016-01-13 Commonwealth Scientific and Industrial Research Organisation Processes for producing industrial products from plant lipids
US10472587B2 (en) 2014-07-07 2019-11-12 Commonwealth Scientific And Industrial Research Organisation Processes for producing industrial products from plant lipids
US11771728B2 (en) 2014-11-14 2023-10-03 Basf Plant Science Company Gmbh Materials and methods for increasing the tocopherol content in seed oil
US11813302B2 (en) 2014-11-14 2023-11-14 Basf Plant Science Company Gmbh Brassica events LBFLFK and LBFDAU and methods for detection thereof
US12365909B2 (en) 2016-06-16 2025-07-22 Nuseed Nutritional Australia Pty Ltd Inbred transgenic canola line NS-B50027-4 and seeds thereof
US12421523B2 (en) 2016-09-02 2025-09-23 Nuseed Global Innovation Ltd. Plants with modified traits
US11859193B2 (en) 2016-09-02 2024-01-02 Nuseed Global Innovation Ltd. Plants with modified traits
US10941385B2 (en) 2016-09-23 2021-03-09 Wake Forest University Modified microorganisms as sustainable sources of omega-3 polyunsaturated fatty acid production
US11872201B2 (en) 2018-06-21 2024-01-16 Nuseed Nutritional Us Inc. DHA enriched polyunsaturated fatty acid compositions
US12137701B2 (en) 2018-06-21 2024-11-12 Nuseed Nutritional Us Inc. ALA enriched polyunsaturated fatty acid compositions
EP3935169A1 (en) 2019-03-08 2022-01-12 Commonwealth Scientific and Industrial Research Organisation Expression of nitrogenase polypeptides in plant cells
TWI877244B (zh) * 2019-10-25 2025-03-21 美商努賽德營養美國股份有限公司 富集的多元不飽和脂肪酸組成物
WO2021079142A1 (en) * 2019-10-25 2021-04-29 Nuseed Pty Ltd. Enriched polyunsaturated fatty acid compositions
WO2022015699A1 (en) * 2020-07-14 2022-01-20 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods to produce very long chain fatty acids
WO2023115116A1 (en) * 2021-12-20 2023-06-29 Commonwealth Scientific And Industrial Research Organisation Plants for producing cannabinoids

Also Published As

Publication number Publication date
JP2019022492A (ja) 2019-02-14
BR122021003836B1 (pt) 2022-02-01
US20240150780A1 (en) 2024-05-09
DK2358882T3 (da) 2017-11-06
EP2358882A1 (en) 2011-08-24
BRPI0921467B1 (pt) 2021-12-14
EP3260544C0 (en) 2024-12-25
ES2644883T3 (es) 2017-11-30
CN102317459A (zh) 2012-01-11
US9938486B2 (en) 2018-04-10
US8809559B2 (en) 2014-08-19
CN107858204A (zh) 2018-03-30
US10648046B2 (en) 2020-05-12
US20240150782A1 (en) 2024-05-09
EP3260544B1 (en) 2024-12-25
CA2743880C (en) 2020-08-18
CN114045301A (zh) 2022-02-15
BR122021003835B1 (pt) 2022-02-08
CN107858204B (zh) 2021-10-29
EP2358882A4 (en) 2012-05-02
BRPI0921467A2 (pt) 2015-08-18
JP6749978B2 (ja) 2020-09-02
US9976107B2 (en) 2018-05-22
US9994792B2 (en) 2018-06-12
US11976287B2 (en) 2024-05-07
CN113957105A (zh) 2022-01-21
CN113957105B (zh) 2024-11-01
CN113957054A (zh) 2022-01-21
NZ593097A (en) 2013-02-22
US12203087B2 (en) 2025-01-21
BRPI0921467A8 (pt) 2018-06-26
US20180087004A1 (en) 2018-03-29
EP2358882B1 (en) 2017-07-26
AR074364A1 (es) 2011-01-12
US20120016144A1 (en) 2012-01-19
CA3082380A1 (en) 2010-05-27
JP6068800B2 (ja) 2017-01-25
JP2012509059A (ja) 2012-04-19
JP2019022493A (ja) 2019-02-14
AU2009317860A1 (en) 2010-05-27
JP6746648B2 (ja) 2020-08-26
US20150018571A1 (en) 2015-01-15
NO2358882T3 (enExample) 2017-12-23
AU2009317860B2 (en) 2014-03-27
CA3015426A1 (en) 2010-05-27
CA3015426C (en) 2020-01-14
US20180002633A1 (en) 2018-01-04
US20240150781A1 (en) 2024-05-09
CL2011001162A1 (es) 2011-08-19
CN113957054B (zh) 2024-07-16
US20170327767A1 (en) 2017-11-16
US12195739B2 (en) 2025-01-14
US20240360464A1 (en) 2024-10-31
CA2743880A1 (en) 2010-05-27
US20200385822A1 (en) 2020-12-10
US20180010141A1 (en) 2018-01-11
US20240150779A1 (en) 2024-05-09
EP3260544A1 (en) 2017-12-27
JP2016013126A (ja) 2016-01-28

Similar Documents

Publication Publication Date Title
US12195739B2 (en) Enzymes and methods for producing omega-3 fatty acids
AU2023241326A1 (en) Enzymes and methods for producing omega-3 fatty acids
AU2020277266B2 (en) Enzymes and methods for producing omega-3 fatty acids

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200980154876.9

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09827035

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2743880

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2011535839

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2011001162

Country of ref document: CL

WWE Wipo information: entry into national phase

Ref document number: 593097

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2009317860

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 3829/CHENP/2011

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2009317860

Country of ref document: AU

Date of ref document: 20091117

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2009827035

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2009827035

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13129940

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0921467

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20110518