Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
  • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
  • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
  • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
  • C12N15/8277—Phosphinotricin
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
  • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
  • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
  • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6844—Nucleic acid amplification reactions
  • C12Q1/686—Polymerase chain reaction [PCR]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/13—Plant traits
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/16—Primer sets for multiplex assays
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
  • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
  • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
  • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
  • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y10S435/00—Chemistry: molecular biology and microbiology
  • Y10S435/975—Kit

Definitions

• the present invention relates to the field of plant molecular biology, specifically the invention relates to a DNA construct for conferring insect resistance to a plant.
• the invention more specifically relates to an insect resistant com plant TCI 507 and to assays for detecting the presence of com plant TCI 507 DNA in a sample and compositions thereof.
• This invention relates to the insect resistant com (Zea mays) plant TCI 507, also referred to as maize line TCI 507 or maize event TCI 507, and to the DNA plant expression construct of corn plant TC1507 and the detection of the transgene/flanking insertion region in com plant TCI 507 and progeny thereof.
• Zea mays insect resistant com
• Com is an important crop and is a primary food source in many areas of the world. Damage caused by insect pests is a major factor in the loss of the world's corn crops, despite the use of protective measures such as chemical pesticides. In view of this, insect resistance has been genetically engineered into crops such as com in order to control insect damage and to reduce the need for traditional chemical pesticides.
• One group of genes which have been utilized for the production of transgenic insect resistant crops are the delta-endotoxins from Bacillus thuringiensis (B.t.). Delta-endotoxins have been successfully expressed in crop plants such as cotton, potatoes, rice, sunflower, as well as com, and have proven to provide excellent control over insect pests. (Perlak, F.J et al.
• the expression of foreign genes in plants is known to be influenced by their location in the plant genome, perhaps due to chromatin structure (e.g., heterochromatin) or the proximity of transcriptional regulatory elements (e.g., enhancers) close to the integration site (Weising et al, Ann. Rev. Genet 22:421-477, 1988).
• chromatin structure e.g., heterochromatin
• transcriptional regulatory elements e.g., enhancers
• a method for detecting a particular event would be helpful for complying with regulations requiring the pre-market approval and labeling of foods derived from recombinant crop plants, for example, or for use in environmental monitoring, monitoring traits in crops in the field, or monitoring products derived from a crop harvest, as well as for use in ensuring compliance of parties subject to regulatory or contractual terms.
• This invention relates preferably to methods for producing and selecting an insect resistant monocot crop plant. More specifically, a DNA constract is provided that when expressed in plant cells and plants confers resistance to insects.
• a DNA construct capable of introduction into and replication in a host cell, is provided that when expressed in plant cells and plants confers insect resistance to the plant cells and plants.
• the DNA construct is comprised of a DNA molecule named PHI8999A and it includes two transgene expression cassettes.
• the first expression cassette comprises a DNA molecule which includes the promoter, 5' untranslated exon, and first intron of the maize ubiquitin (Ubi-1) gene (Chiistensen et al (1992) Plant Mol. Biol.
• the second transgene expression cassette of the DNA construct comprises a DNA molecule of the cauliflower mosaic virus (CaMV) 35S promoter (Odell J.T. et al.
• compositions and methods are provided for identifying a novel com plant designated TCI 507, which methods are based on primers or probes which specifically recognize the 5' and/or 3' flanking sequence of TCI 507.
• DNA molecules are provided that comprise primer sequences that when utilized in a PCR reaction will produce amplicons unique to the transgenic event TCI 507.
• These molecules may be selected from the group consisting of: 5'-GTAGTACTATAGATTATATTATTCGTAGAG-3' (SEQ ID NO: 1); 5 '-GCCATACAGAACTCAAAATCTTTTCCGGAG-3 ' (SEQ LD NO: 2); 5'- CTTCAAACAAGTGTGACAAA -3' (SEQ ID NO: 23 ); 5'-TGTGGTGTTTGTGGCTCTGTCCTAA-3' (SEQ ID NO: 3); 5'-AGCACCTTTTCATTCTTTCATATAC-3' (SEQ LD NO: 4); 5'-GACCTCCCCA CAGGCATGAT TGATC-3' (SEQ ID NO: 5); and complements thereof.
• the com plant and seed comprising these molecules is an aspect of this mvention. Further, kits utilizing these primer sequences for the identification of the TC1507 event are provided.
• An additional aspect of the invention relates to the specific flanking sequences of 5 TCI 507 described herein, which can be used to develop specific identification methods for TCI 507 in biological samples. More particularly, the invention relates to the 5' and/or 3' flanking regions of TC1507, SEQ ID NO:21 and SEQ ID NO:22, respectively, which can be used for the development of specific primers and probes. The invention further relates to identification methods for the presence of TCI 507 in biological samples based on the 10 use of such specific primers or probes.
• methods of detecting the presence of DNA corresponding to the com event TCI 507 in a sample comprise: (a) contacting the sample comprising DNA with a DNA primer set, that when used in a nucleic acid amplification reaction with genomic DNA extracted from com event [5 TC1507 produces an amplicon that is diagnostic for com event TC1507; (b) performing a nucleic acid amplification reaction, thereby producing the amplicon; and (c) detecting the amplicon.
• DNA molecules that comprise the novel transgene/flanking insertion region, SEQ ID NO: 26 and SEQ TD NO: 27 and are homologous or complementary to SEQ ID NO: 26 >0 and SEQ ID NO: 27 are an aspect of this invention.
• DNA sequences that comprise the novel transgene/flanking insertion region, SEQ ID NO:26 are an aspect of this invention.
• DNA sequences that comprise a sufficient length of polynucleotides of transgene insert sequence and a sufficient length of polynucleotides of maize genomic and/or flanking sequence from maize plant TCI 507 of ⁇ 5 SEQ ID NO:26 that are useful as primer sequences for the production of an amplicon product diagnostic for maize plant TCI 507 are included.
• DNA sequences that comprise the novel transgene/flanking insertion region, SEQ LD NO:27 are provided.
• DNA sequences that comprise a sufficient length of polynucleotides of transgene insert sequence and a sufficient length of polynucleotides of 10 maize genomic and/or flanking sequence from maize plant TC1507 of SEQ LD NO:27 that are useful as primer sequences for the production of an amplicon product diagnostic for maize plant TCI 507 are included.
• the DNA sequences that comprise at least 11 or more nucleo tides of the transgene portion of the DNA sequence of SEQ ID NO:26 or complements thereof, and a similar length of 5' flanking maize DNA sequence of SEQ LD NO:26 or complements thereof are useful as DNA primers in DNA amplification methods.
• the amplicons produced using these primers are diagnostic for maize event TC1507. Therefore, the invention also includes the amplicons produced by DNA primers homologous or complementary to SEQ ID NO:26.
• the DNA sequences that comprise at least 11 or more nucleotides of the transgene portion of the DNA sequence of SEQ LD NO:27 or complements thereof, and a similar length of 3' flanking maize DNA sequence of SEQ LD NO:27 or complements thereof are useful as DNA primers in DNA amplification methods.
• the amplicons produced using these primers are diagnostic for maize event TCI 507. Therefore, the invention also includes the amplicons produced by DNA primers homologous or complementary to SEQ ID NO:27.
• amplicon comprising the DNA molecules of SEQ ID NO: 1 and SEQ LD NO: 2; the amplicon comprising the DNA molecules of SEQ ID NO: 2 and SEQ LD NO: 23; the amplicon comprising the DNA molecules of SEQ ID NO: 3 and SEQ ID NO: 5; and the amplicon comprising the DNA molecules of SEQ ID NO: 4 and SEQ LD NO: 5.
• methods of detecting the presence of a DNA molecule corresponding to the TCI 507 event in a sample comprising: (a) contacting the sample comprising DNA extracted from a com plant with a DNA probe, molecule that hybridizes under stringent hybridization conditions with DNA extracted from com event TCI 507 and does not hybridize under the stringent hybridization conditions with a control com plant DNA; (b) subjecting the sample and probe to stringent hybridization conditions; and (c) detecting hybridization of the probe to the DNA.
• a method for detecting the presence of a DNA molecule corresponding to the TCI 507 event in a sample consisting of (a) contacting the sample comprising DNA extracted from a com plant with a DNA probe molecule that consists of sequences that are unique to the event, e.g. junction sequences, wherein said DNA probe molecule hybridizes under stringent hybridization conditions with DNA extracted from com event TCI 507 and does not hybridize under the stringent hybridization conditions with a control com plant DNA; (b) subjecting the sample and probe to stringent hybridization conditions; and (c) detecting hybridization of the probe to the DNA.
• kits and methods for identifying event TCI 507 in a biological sample which detects a TCI 507 specific region within SEQ ID NO: 24 are provided.
• DNA molecules comprise at least one junction sequence of TC1507 selected from the group consisting of SEQ ID NO:45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56 and 57 and complements thereof; wherein a junction sequence spans the junction between heterologous DNA inserted into the genome and the DNA from the com cell flanking the insertion site, i.e. flanking DNA, and is diagnostic for the TCI 507 event.
• TC1507 selected from the group consisting of SEQ ID NO:45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56 and 57 and complements thereof; wherein a junction sequence spans the junction between heterologous DNA inserted into the genome and the DNA from the com cell flanking the insertion site, i.e. flanking DNA, and is diagnostic for the TCI 507 event.
• methods of producing an insect resistant com plant that comprise the steps of: (a) sexually crossing a first parental com line comprising the expression cassettes of the present invention, which confers resistance to insects, and a second parental com line that lacks insect resistance, thereby producing a plurality of progeny plants; and (b) selecting a progeny plant that is insect resistant.
• Such methods may optionally comprise the further step of back-crossing the progeny plant to the second parental com line to producing a true-breeding com plant that is insect resistant.
• the present invention provides a method of producing a com plant that is resistant to insects comprising transforming a com cell with the DNA construct PHI8999A (SEQ ID NO:25), growing the transformed com cell into a com plant, selecting the com plant that shows resistance to insects, and further growing the com plant into a fertile com plant.
• the fertile com plant can be self pollinated or crossed with compatible com varieties to produce insect resistant progeny.
• the invention further relates to a DNA detection kit for identifying maize event TCI 507 in biological samples.
• the kit of the invention comprises a first primer which specifically recognizes the 5' or 3' flanking region of TCI 507, and a second primer which specifically recognizes a sequence within the foreign DNA of TCI 507, or within the flanking DNA, for use in a PCR identification protocol.
• the invention also relates to a kit for identifying event TCI 507 in biological samples, which kit comprises a specific probe having a sequence which corresponds or is complementary to, a sequence having between 80% and 100% sequence identity with a specific region of event TCI 507.
• the sequence of the probe corresponds to a specific region comprising part of the 5' or 3' flanking region of event TCI 507.
• the methods and kits encompassed by the present invention can be used for different purposes such as, but not limited to the following: to identify event TCI 507 in plants, plant material or in products such as, but not limited to, food or feed products (fresh or processed) comprising, or derived from plant material; additionally or alternatively, the methods and kits of the present invention can be used to identify transgenic plant material for purposes of segregation between transgenic and non-transgenic material; additionally or alternatively, the methods and kits of the present invention can be used to detemiine the quality of plant material comprising maize event TCI 507.
• the kits may also contain the reagents and materials necessary for the performance of the detection method.
• This invention further relates to the TCI 507 com plant or its parts, including, but not limited to, pollen, ovules, vegetative cells, the nuclei of pollen cells, and the nuclei of egg cells of the com plant TCI 507 and the progeny derived thereof.
• the com plant and seed TCI 507 from which the DNA primer molecules of the present invention provide a specific amplicon product is an aspect of the invention.
• FIG. 1 Linear map showing the transgenic insert PHI8999A, as well as the sequences flanking the transgenic insert.
• the temi “comprising” means “including but not limited to”.
• the term “com” means Zea mays or maize and includes all plant varieties that can be bred with com, including wild maize species.
• TCI 507 specific refers to a nucleotide sequence which is suitable for discriminatively identifying event TCI 507 in plants, plant material, or in products such as, but not limited to, food or feed products (fresh or processed) comprising, or derived from plant material.
• the terms “insect resistant” and “impacting insect pests 5* ' refers to effecting changes in insect feeding, growth, and/or behavior at any stage of development, including but not limited to: killing the insect; retarding growth; preventing reproductive capability; and the like.
• the terms “pesticidal activity” and “insecticidal activity” are used synonymously to refer to activity of an organism or a substance (such as, for example, a protein) that can be measured by numerous parameters including, but not limited to, pest mortality, pest weight loss, pest attraction, pest repellency, and other behavioral and physical changes of a pest after feeding on and/or exposure to the organism or substance for an appropriate length of time.
• pesticidal proteins are proteins that display pesticidal activity by themselves or in combination with other proteins.
• Coding sequence refers to a nucleotide sequence that codes for a specific amino acid sequence.
• the terms “encoding” or “encoded” when used in the context of a specified nucleic acid mean that the nucleic acid comprises the requisite information to guide translation of the nucleotide sequence into a specified protein. The information by which a protein is encoded is specified by the use of codons.
• a nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid or may lack such intervening non-translated sequences (e.g., as in cDNA).
• Gene refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence.
• “Native gene” refers to a gene as found in nature with its own regulatory sequences.
• “Chimeric gene” refers any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
• Endogenous gene refers to a native gene in its natural lqcation in the genome of an organism.
• Foreign refers to material not normally found in the location of interest.
• foreign DNA may comprise both recombinant DNA as well as newly introduced, rearranged DNA of the plant.
• a “foreign” gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer.
• Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes.
• a “transgene” is a gene that has been introduced into the genome by a transformation procedure. The site in the plant genome where a recombinant DNA has been inserted may be referred to as the "insertion site” or "target site”.
• insert DNA refers to the heterologous DNA within the expression cassettes used to transform the plant material while "flanking DNA” can exist of either genomic DNA naturally present in an organism such as a plant, or foreign (heterologous) DNA introduced via the transfomiation process which is extraneous to the original insert DNA molecule, e.g. fragments associated with the transformation event.
• a "flanking region” or “flanking sequence” as used herein refers to a sequence of at least 20 base pair, preferably at least 50 base pair, and up to 5000 base pair which is located either immediately upstream of and contiguous with or immediately downstream of and contiguous with the original foreign insert DNA molecule.
• Transfomiation procedures leading to random integration of the foreign DNA will result in transformants containing different flanking regions characteristic and unique for each transformant.
• Transformants will also contain unique junctions between a piece of heterologous insert DNA and genomic DNA, or 2 pieces of genomic DNA, or 2 pieces of heterologous DNA.
• a "junction" is a point where 2 specific DNA fragments join. For example, a junction exists where insert DNA joins flanking DNA.
• a junction point also exists in a transformed organism where 2 DNA fragments join together in a manner that is modified from that found in the native organism.
• “Junction DNA” refers to DNA that comprises a junction point.
• heterologous in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.
• a promoter operably linked to a heterologous nucleotide sequence can be from a species different from that from which the nucleotide sequence was derived, or, if from the same species, the promoter is not naturally found operably linked to the nucleotide sequence.
• a heterologous protein may originate from a foreign species, or, if from the same species, is substantially modified from its original form by deliberate human intervention.
• Regulatory sequences refer to nucleotide sequences located upstream (5' non- coding sequences), within, or downstream (3 ' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, and polyadenylation recognition sequences.
• Promoter refers to a nucleotide sequence capable of controlling the expression of a coding sequence or functional RNA.
• a coding sequence is located 3' to a promoter sequence.
• the promoter sequence consists of proximal and more distal upstream elements, the latter elements are often referred to as enhancers. Accordingly, an
• “enhancer” is a nucleotide sequence that can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleotide segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Promoters that cause a nucleic acid fragment to be expressed in most cell types at most times are commonly referred to as "constitutive promoters".
• translation leader sequence refers to a nucleotide sequence located between the promoter sequence of a gene and the coding sequence.
• the translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence.
• the translation leader sequence may affect numerous parameters including, processing of the primary transcript to mRNA, mRNA stability and/or translation efficiency. Examples of translation leader sequences have been described (Turner and Foster (1995) Mol. Biotechnol. 3:225-236).
• the "3' non-coding sequences” refer to nucleotide sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
• the polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor.
• the use of different 3' non-coding sequences is exemplified by Ingelbrecht et al. (1989) Plant Cell 1:671-680.
• a “protein” or “polypeptide” is a chain of amino acids arranged in a specific order determined by the coding sequence in a polynucleotide encoding the polypeptide.
• a DNA construct is an assembly of DNA molecules linked together that provide one or more expression cassettes.
• the DNA constract may be a plasmid that is enabled for self replication in a bacterial cell and contains various endonuclease enzyme restriction sites that are useful for introducing DNA molecules that provide functional genetic elements, i.e., promoters, introns, leaders, coding sequences, 3' termination regions, among others; or a DNA constract may be a linear assembly of DNA molecules, such as an expression cassette.
• the expression cassette contained within a DNA construct comprise the necessary genetic elements to provide transcription of a messenger RNA.
• the expression cassette can be designed to express in prokaryote cells or eukaryotic cells. Expression cassettes of the present invention are designed to express most preferably in plant cells.
• the DNA molecules of the invention are provided in expression cassettes for expression in an organism of interest.
• the cassette will include 5' and 3' regulatory sequences operably linked to a coding sequence of the invention.
• "Operably linked" means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame. Operably linked is intended to indicate a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence.
• the cassette may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional gene(s) can be provided on multiple expression cassettes or multiple DNA constructs.
• the expression cassette will include in the 5' to 3' direction of transcription: a transcriptional and translational initiation region, a coding region, and a transcriptional and translational termination region functional in the organism serving as a host.
• the transcriptional initiation region i.e., the promoter
• the expression cassettes may additionally contain 5' leader sequences in the expression cassette construct. Such leader sequences can act to enhance translation.
• transgenic includes any cell, cell line, callus, tissue, plant part, or plant the genotype of which has been altered by the presence of a heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic.
• the term "transgenic” as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
• a transgenic "event” is produced by transformation of plant cells with a heterologous DNA construct(s), including a nucleic acid expression cassette that comprises a transgene of interest, the regeneration of a population of plants resulting from the insertion of the transgene into the genome of the plant, and selection of a particular plant characterized by insertion into a particular genome location.
• An event is characterized phenotypically by the expression of the transgene.
• an event is part of the genetic makeup of a plant.
• the term “event” also refers to progeny produced by a sexual outcross between the transfom ant and another variety that include the heterologous DNA.
• vent also refers to DNA from the original transformant comprising the inserted DNA and flanking sequence immediately adjacent to the inserted DNA that would be expected to be transferred to a progeny that receives inserted DNA including the transgene of interest as the result of a sexual cross of one parental line that includes the inserted DNA (e.g., the original transformant and progeny resulting from selfing) and a parental line that does not contain the inserted DNA.
• An insect resistant TC1507 com plant can be bred by first sexually crossing a first parental com plant consisting of a com plant grown from the transgenic TCI 507 com plant and progeny thereof derived from transfomiation with the expression cassettes of the present invention that confers insect resistance, and a second parental com plant that lacks insect resistance, thereby producing a plurality of first progeny plants; and then selecting a first progeny plant that is resistant to insects; and selfing the first progeny plant, thereby producing a plurality of second progeny plants; and then selecting from the second progeny plants an insect resistant plant.
• steps can further include the back-crossing of the first insect resistant progeny plant or the second insect resistant progeny plant to the second parental com plant or a third parental com plant, thereby producing a com plant that is resistant to insects.
• plant includes reference to whole plants, plant organs
• transgenic plants e.g., leaves, stems, roots, etc.
• seeds e.g., plant cells, and progeny of same.
• transgenic plants understood to be within the scope of the invention comprise, for example, plant cells, protoplasts, tissues, callus, embryos as well as flowers, stems, fruits, leaves, and roots originating in transgenic plants or their progeny previously transformed with a DNA molecule of the invention and therefore consisting at least in part of transgenic cells, are also an aspect of the present invention.
• plant cell includes, without limitation, seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.
• the class of plants that can be used in the methods of the invention is generally as broad as the class of higher plants amenable to transfomiation techniques, including both monocotyledonous and dicotyledonous plants.
• Transformation refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic" organisms.
• isolated polynucleotides of the present invention can be incorporated into recombinant constructs, typically DNA constructs, which are capable of introduction into and replication in a host cell.
• a construct can be a vector that includes a replication system and sequences that are capable of transcription and translation of a polypeptide- encoding sequence in a given host cell.
• plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker.
• Such plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
• a promoter regulatory region e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific expression
• transgenic plants can also be mated to produce offspring that contain two independently segregating added, exogenous genes. Selfing of appropriate progeny can produce plants that are homozygous for both added, exogenous genes.
• Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is vegetative propagation. Descriptions of other breeding methods that are commonly used for different traits and crops can be found in one of several references, e.g., Fehr, in Breeding Methods for Cultivar Development, Wilcos J. ed., American Society of Agronomy, Madison Wis. (1987).
• a “probe” is an isolated nucleic acid to which is attached a conventional detectable label or reporter molecule, e.g., a radioactive isotope, ligand, chemiluminescent agent, or enzyme. Such a probe is complementary to a strand of a target nucleic acid, in the case of the present invention, to a strand of isolated DNA from corn event TCI 507 whether from a com plant or from a sample that includes DNA from the event. Probes according to the present invention include not only deoxyribonucleic or ribonucleic acids but also polyamides and other probe materials that bind specifically to a target DNA sequence and can be used to detect the presence of that target DNA sequence.
• Primers are isolated nucleic acids that are annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, then extended along the target DNA strand by a polymerase, e.g., a
• Primer pairs of the present invention refer to their use for amplification of a target nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other conventional nucleic-acid amplification methods.
• PCR polymerase chain reaction
• polymerase chain reaction is a technique used for the amplification of specific DNA segments (see, U.S. Patent Nos. 4,683,195 and 4,800,159; herein incorporated by reference).
• Probes and primers are of sufficient nucleotide length to bind to the target DNA sequence specifically in the hybridization conditions or reaction conditions determined by the operator. This length may be of any length that is of sufficient length to be useful in a detection method of choice. Generally, 11 nucleotides or more in length, preferably 18 nucleotides or more, and more preferably 22 nucleotides or more, are used. Such probes and primers hybridize specifically to a target sequence under high stringency hybridization conditions.
• probes and primers according to the present invention have complete DNA sequence similarity of contiguous nucleotides with the target sequence, although probes differing from the target DNA sequence and that retain the ability to hybridize to target DNA sequences may be designed by conventional methods. Probes can be used as primers, but are generally designed to bind to the target DNA or RNA and not be used in an amplification process.
• Specific primers can be used to amplify an integration fragment to produce an amplicon that can be used as a "specific probe" for identifying event TC1507 in biological samples.
• the specific probe is preferably a sequence which, under optimized conditions, hybridizes specifically to a region within the 5' or 3' flanking region of the event and preferably also comprises a part of the foreign DNA contiguous therewith.
• the specific probe comprises a sequence of at least 80%, preferably between 80 and 85%, more preferably between 85 and 90%, especially preferably between 90 and 95%, and most preferably between 95 and 100% identical (or complementary) to a specific region of the event.
• PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as the PCR primer analysis tool in Vector NTI version 6 (Informax Inc., Bethesda MD); PrimerSelect (DNASTAR Inc., Madison, WI); and Primer (Version 0.5, ⁇ 1991,
• kits refers to a set of reagents for the purpose of performing the method of the invention, more particularly, the identification of the event TCI 507 in biological samples.
• the kit of the invention can be used, and its components can be specifically adjusted, for purposes of quality control (e.g. purity of seed lots), detection of event TCI 507 in plant material, or material comprising or derived from plant material, such as but not limited to food or feed products.
• Plant material refers to material which is obtained or derived from a plant.
• Primers and probes based on the flanking DNA and insert sequences disclosed herein can be used to confirm (and, if necessary, to correct) the disclosed sequences by conventional methods, e.g., by re-cloning and sequencing such sequences.
• the nucleic acid probes and primers of the present invention hybridize under stringent conditions to a target DNA sequence. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA from a transgenic event in a sample.
• Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances.
• two nucleic acid molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid stracture.
• a nucleic acid molecule is said to be the "complement” of another nucleic acid molecule if they exhibit complete complementarity.
• molecules are said to exhibit "complete complementarity” when every nucleotide of one of the molecules is complementary to a nucleotide of the other.
• Two molecules are said to be “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional "low-stringency” conditions.
• the molecules are said to be “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional "high-stringency” conditions.
• the thermal melting point (Tm) is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe.
• Tm is reduced by about 1°C for each 1% of mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the Tm for the specific sequence and its complement at a defined ionic strength and pH.
• severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the Tm; moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the Tm; low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20°C lower than the Tm.
• a substantially homologous sequence is a nucleic acid molecule that will specifically hybridize to the complement of the nucleic acid molecule to which it is being compared under high stringency conditions.
• stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides).
• Stringent conditions may also be achieved with the addition of a destabilizing agent such as formamide.
• Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCI, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.
• Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCI, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C.
• a nucleic acid of the present invention will specifically hybridize to one or more of the nucleic acid molecules unique to the TCI 507 event or complements thereof or fragments of either under moderately stringent conditions.
• Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0); the ALIGN PLUS program (version 3.0, copyright 1997); and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 10 (available from Accelrys, 9685 Scranton Road, San Diego, CA 92121, USA). Alignments using these programs can be performed using the default parameters.
• the ALIGN and the ALIGN PLUS programs are based on the algorithm of Myers and Miller (1988) supra.
• the BLAST programs of Altschul et al. (1990) J. Mol. Biol. 215:403 are based on the algorithm of Karlin and Altschul (1990) supra.
• the BLAST family of programs which can be used for database similarity searches includes: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for
• Alignment may also be performed manually by inspection.
• Gapped BLAST in BLAST 2.0
• PSI-BLAST in BLAST 2.0
• iterated search that detects distant relationships between molecules. See Altschul et al. (1997)
• BLAST Gapped BLAST
• PSI-BLAST the default parameters of the respective programs (e.g., BLASTN for nucleotide sequences, BLASTX for proteins) can be used. See www.ncbi.hlm.nih.gov.
• sequence identity or “identity” in the context of two nucleic acid or polypeptide sequences makes reference to the residues in the two sequences that are the 5 same when aligned for maximum correspondence over a specified comparison window.
• percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change
• sequence similarity or “similarity”.
• Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (hitelligenetics, Mountain View, California).
• percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
• stringent conditions are conditions that pemiit the primer pair to hybridize only to the target nucleic-acid sequence to which a primer having the corresponding wild-type sequence (or its complement) would bind and preferably to produce a unique amplification product, the amplicon, in a DNA thermal amplification reaction.
• the term "specific for (a target sequence)" indicates that a probe or primer hybridizes under stringent hybridization conditions only to the target sequence in a sample comprising the target sequence.
• amplified DNA refers to the product of nucleic acid amplification of a target nucleic acid sequence that is part of a nucleic acid template.
• DNA extracted from the com plant tissue sample may be subjected to a nucleic acid amplification method using a DNA primer pair that includes a first primer derived from flanking sequence adjacent to the insertion site of inserted heterologous DNA, and a second primer derived from the inserted heterologous DNA to produce an amplicon that is diagnostic for the presence of the event DNA.
• the second primer may be derived from the flanking sequence.
• the amplicon is of a length and has a sequence that is also diagnostic for the event.
• the amplicon may range in length from the combined length of the primer pairs plus one nucleotide base pair to any length of amplicon producible by a DNA amplification protocol.
• primer pairs can be derived from flanking sequence on both sides of the inserted DNA so as to produce an amplicon that includes the entire insert nucleotide sequence of the PHI8999A expression construct, see FIG. 1, approximately 6.2 Kb in size.
• a member of a primer pair derived from the flanking sequence may be located a distance from the inserted DNA sequence, this distance can range from one nucleotide base pair up to the limits of the amplification reaction, or about twenty thousand nucleotide base pairs.
• the use of the term "amplicon" specifically excludes primer dimers that may be formed in the DNA thermal amplification reaction.
• Nucleic acid amplification can be accomplished by any of the various nucleic acid amplification methods known in the art, including the polymerase chain reaction (PCR).
• PCR polymerase chain reaction
• a variety of amplification methods are known in the art and are described, inter alia, in U.S. Pat. Nos. 4,683,195 and 4,683,202 and in PCR Protocols: A Guide to Methods and Applications, ed. Innis et al, Academic press, San Diego, 1990.
• PCR amplification methods have been developed to amplify up to 22 Kb of genomic DNA and up to 42 Kb of bacteriophage DNA (Cheng et al, Proc. Natl. Acad. Sci. USA 91:5695-5699, 1994).
• the amplicon produced by these methods may be detected by a plurality of techniques, including, but not limited to. Genetic Bit Analysis (Nikiforov, et al. Nucleic Acid Res. 22:4167-4175, 1994) where a DNA oligonucleotide is designed which overlaps both the adjacent flanking DNA sequence and the inserted DNA sequence.
• the oligonucleotide is immobilized in wells of a microwell plate.
• a single-stranded PCR product can be hybridized to the immobilized oligonucleotide and serve as a template for a single base extension reaction using a DNA polymerase and labeled ddNTPs specific for the expected next base.
• Readout may be fluorescent or ELISA-based.
• a signal indicates presence of the insert/flanking sequence due to successful amplification, hybridization, and single base extension.
• Another detection method is the Pyrosequencing technique as described by Winge (Innov. Pharma. Tech. 00: 18-24, 2000). In this method an oligonucleotide is designed that overlaps the adjacent DNA and insert DNA junction.
• the oligonucleotide is hybridized to a single-stranded PCR product from the region of interest (one primer in the inserted sequence and one in the flanking sequence) and incubated in the presence of a DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5 ' phosphosulfate and luciferin.
• dNTPs are added individually and the incorporation results in a light signal which is measured.
• a light signal indicates the presence of the transgene insert/flanking sequence due to successful amplification, hybridization, and single or multi-base extension.
• Fluorescence Polarization as described by Chen et al, (Genome Res. 9:492-498, 1999) is a method that can be used to detect an amplicon of the present invention.
• an oligonucleotide is designed which overlaps the flanking and inserted DNA junction.
• the oligonucleotide is hybridized to a single-stranded PCR product from the region of interest (one primer in the inserted DNA and one in the flanking DNA sequence) and incubated in the presence of a DNA polymerase and a fluorescent-labeled ddNTP. Single base extension results in incorporation of the ddNTP. Incorporation can be measured as a change in polarization using a fluorometer. A change in polarization indicates the presence of the transgene insert/flanking sequence due to successful amplification, hybridization, and single base extension.
• Taqman® PE Applied Biosystems, Foster City, Calif.
• a FRET oligonucleotide probe is designed which overlaps the flanking and insert DNA junction.
• the FRET probe and PCR primers are cycled in the presence of a thermostable polymerase and dNTPs.
• Hybridization of the FRET probe results in cleavage and release of the fluorescent moiety away from the quenching moiety on the FRET probe.
• a fluorescent signal indicates the presence of the flanking/transgene insert sequence due to successful amplification and hybridization.
• Molecular Beacons have been described for use in sequence detection as described in Tyangi et al. (Nature Biotech. 14:303-308, 1996). Briefly, a FRET oligonucleotide probe is designed that overlaps the flanking and insert DNA junction. The unique structure of the FRET probe results in it containing secondary structure that keeps the fluorescent and quenching moieties in close proximity.
• the FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Following successful PCR amplification, hybridization of the FRET probe to the target sequence results in the removal of the probe secondary structure and spatial separation of the fluorescent and quenching moieties. A fluorescent signal results. A fluorescent signal indicates the presence of the flanking/transgene insert sequence due to successful amplification and hybridization.
• a hybridization reaction using a probe specific to a sequence found within the amplicon is yet another method used to detect the amplicon produced by a PCR reaction.
• the present invention is further defined in the following Examples. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention, in addition to those shown and described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. The disclosure of each reference set forth herein is incorporated herein by reference in its entirety.
• B.t. Cry IF maize plants were obtained by microprojectile bombardment using the Biolistics® PDS-lOOOHe particle gun manufactured by Bio-Rad, Hercules, CA; essentially as described by Klein et al. (1987) Nature, UK 327(6117):70-73. Immature embryos isolated from maize ears, harvested soon after pollination were cultured on callus initiation medium for several days. On the day of transformation, microscopic tungsten particles were coated with purified PHI8999A DNA (SEQ ID NO:25) and accelerated into the cultured embryos, where the insert DNA was incorporated into the cell chromosome.
• Those embryos that survived and produced healthy, glufosinate-resistant callus tissue were assigned unique identification codes representing putative transfomiation events, and continually transferred to fresh selection medium. Plants were regenerated from tissue derived from each unique event and transferred to the greenhouse. Leaf samples were taken for molecular analysis to verify the presence of the transgene by PCR and to confirm expression of the CrylF protein by ELISA. Plants were then subjected to a whole plant bioassay using European com borer insects. Positive plants were crossed with inbred lines to obtain seed from the initial transformed plants. A number of lines were evaluated in the field.
• the TCI 507 event was selected from a population of independent transgenic events based on a superior combination of characteristics, including insect resistance and agronomic performance (see Bing JW et al. (2000) Efficacy of CrylF Transgenic Maize, 14 th Biennial International Plant Resistance to Insects Workshop, fort Collins, CO, herein incorporated by reference).
• Example 2 Identification of nucleotides comprising the flanking sequence 5' to the transgenic insert DNA in Bacillus thuringiensis CrylF maize line TCI 507
• PCR primer pairs were designed to obtain overlapping PCR products extending from the 5' flanking region into the full-length PHI8999A transgenic insert.
• PCR products were successfully amplified from B.t. CrylF maize line TCI 507 genomic DNA, isolated, and sequenced for Region 1 through Region 6, shown in Table 1 , and confimied to match the previously determined sequence from the Spe I fragment, described in Example 2.
• the region from bp 2358 to bp 2829, immediately adjacent and 5' to the start of the full-length insert was recalcitrant to PCR amplification and appeared to be larger than the sequence obtained from the Spe I clone described above.
• Example 4 Event TC1507 5' flanking sequence. A description of each region is provided in Table 1.
• Region 1 (SEQ ID NO: 28) Ma e genomic (no significant homology) 1 ACTAGTTTCC TAGCCCGCGT CGTGCCCCTA CCCCACCGAC
• GGTGCCATTC CACGGTTCTT CGTGGCCGCC CCTAAGGATG TAAATGGTCG 15 101 GTAAAATCCG GTAAATTTCC GGTACCGTTT ACCAGATTTT TCCAGCCGTT 151 TTCGGATTTA TCGGGATATA CAGAAAACGA GACGGAAACG
• GAATAGGTTT 201 TTTTTCGAAA ACGGTACGGT AAACGGTGAG ACAAACTTAC 20 CGTCCGTTTT
• CCGTATTTTC 301 CCGACCCACG GACCTGCCAA TCAACCATCA GCCAGTCAGC CCATCCCCAC 25 351 AGCTATGGCC CATGGGGCCA TGTTGGCCAC ATGCCCACGC AACGCAAGGC 401 AGTAAGGCTG GCAGCCTGGC ACGCATTGAC GCATGTGGAC
• ACACACAGCC 451 GCCGCCTGTT CGTGTTTCTG TGCCGTTGTG CGAGACTGTG 30 ACTGCGAGTG
• Region 2 Undescribed maize genomic sequence (complement) r ⁇
• ACACGATCTC 1001 GCCTCGCCCG AGCCCAGCCT CGGGCAAGGG CGGCCGACCC CGAGGATTCA
• ATCACTTCGC 1251 CGCTCCACTG ACCGACCTGA CAAGAAGACA GCGCCGCCTG CGTCGCTCCG
• CGAACTCCGC 1601 CTCGCCCGAC CCCAGGGCTC GGACTCAGCC TCGGCCTCAG ACGATGGTCT 1651 CCGCCTCGCC CGACCCGGGG CTCGGACTCG A
• Region 4 Fragment of ci ⁇ lF gene
• Region 5 Fragment of maize chloroplast rpoC2 gene 2017 TCAT TCTTCAAGAA CTGCATATCT TGCCGAGATC
• Region 6 Fragment of maize chloroplast or ubiZMl(2) promoter 2338 GTG GCTATTTATC 2351 TATC
• Region 7b Fragment of pat gene (complement)
• Region 7c Fragment of ci ⁇ lF gene (complement) 2697 AGAG
• Region 9 (SEQ ID NO: 25) Full-length insert of PHI8999A
• the TCI 507 5' flanking sequence is numbered with base 1 being the furthest 5' to the insert and base 2830 at the starting point of the full-length PHI8999A transgenic insert (see FIG. 1).
• the percent identity values indicate the percentage of identical matches across the length of the sequences analyzed. In most cases, similarity searching with the event TCI 507 5' flanking sequence resulted in a match to one unique sequence based on a very high percent identity value. Those sequences are identified in Table 1.
• Reactions E and F were designed as specific primer pairs for the at gene region of the full-length insert of PHI8999A in TCI 507 and thus an amplicon in the unmodified Hi-II com line is not expected. The results indicate that both Reactions E and F are specific for a maize line transformed with a.pat gene region and produce the expected amplicon, whereas no amplicon was produced in the unmodified Hi-II corn line.
• Reaction G was also designed as a primer pair that would produce an amplicon of 366 bp in the maize event TC1507 and no amplicon in the unmodified Hi-II com line.
• Reactions H and I were designed as specific primer pairs for TCI 507 that would span the end of the transgenic insert into the 5' flanking region.
• the reverse primer was located in the ubiquitin promoter region of the full-length
• the PCR results show that the undescribed sequence (Region 1) is present in the unmodified com line Hi-II and that Regions 1, 2 and 3, are contiguous in the unmodified com line Hi-II.
• the DNA sequences amplified in Reactions A, B, C, and D are not unique to the 5' flanking region of maize event TCI 507 but are also present in the unmodified com line Hi-II.
• PCR primer pairs were designed to amplify a product that spanned the junction between the full-length insert and the inverted ORF25 terminator, see FIG. 1 for a depiction of the inverted ORF25 terminator.
• a forward primer was located at the end of the full-length PHI8999A insert and a series of reverse primers were located at 100 bp intervals in the inverted sequence.
• the length of the inverted fragment present in the maize event TCI 507 could be determined within a 100 bp region based on the successful PCR reactions. This method indicated the inverted fragment contained the majority of the ORF25 temiinator but no CrylF sequence. PCR fragments were isolated and sequenced from this region.
• PCR primers were designed to walk out into the flanking DNA sequence from the inverted ORF25 terminator region as determined in the PCR experiment described above.
• Genomic DNA isolated from two to three individual plants of event TCI 507 and an unmodified control com line was digested with various restriction enzymes and then ligated to adaptors specific for the restriction enzyme used for digestion (Universal Genome WalkerTM Kit, Clontech Laboratories, Inc. and Devon et al. (1995) Nucleic Acids Res. 23 : 1644- 1645).
• Primary PCR was carried out using an ORF25 temiinator specific primer and a primer homologous to the adaptor sequence ligated onto the digested DNA.
• a nested secondary PCR was perfo ⁇ ned again with another ORF25 temiinator specific primer and a secondary primer homologous to the adaptor sequence with the secondary primers being internal to the respective primers used in the primary PCR.
• Products produced by the nested PCR were analyzed by agarose gel electrophoresis and fragments unique to TCI 507 DNA samples were isolated and sequenced. Fragments were amplified from both the ORF25 terminator contained within the full-length insert and from the targeted (inverted) ORF25 terminator on the 3' end of the full-length PHI8999A insert.
• Fragments from the full- length insert were of a predicted size based on the knowledge of the restriction enzyme sites located in the full-length insert. Fragments produced from the 3' inverted ORF25 terminator appeared as fragments of unexpected size. Sequence analysis of amplified fragments from the 3' inverted ORF25 terminator resulted in flanking DNA sequence of 1043 bp. Resultant sequence from the above series of genome walking experiments was used to design additional primers to walk further out from the insert into the bordering maize genome with a final 3' flanking sequence, of 2346 bp. h order to describe the TCI 507 3' flanking sequence, homology searching was done against the GenBank public databases using the Basic Local Alignment Search Tool (BLAST).
• BLAST Basic Local Alignment Search Tool
• the BLAST program performs sequence similarity searching and is particularly useful for identifying homologs to an unknown sequence.
• alignments were performed using SeqMan 4.05TM, Martinez and Needleman-Wunsch alignment algorithms (DNASTAR Inc.) to look for homology between the TC1507 3' flanking sequence and the PHI8999A transgenic insert.
• the results of these homology searches are presented in Table 1.
• the percent identity values indicate the percentage of identical matches across the length of the sequences analyzed.
• the results of similarity searching for the 3' flanking sequence indicate high homology with three regions of maize chloroplast DNA, a 188 bp fragment of the at gene, and 254 bp of DNA (Region 15, Table 1) with no significant homology.
• Region 10 Fragment of ORF25 Terminator (complement)
• TTTTCTATTC 9101 GATCTTTATG TAATTCGTTA CAATTAATAA ATATTCAAAT CAGATTATTG
• TTATAATATT 9201 GATGATATCT CAATCAAAAC GTAGATAATA ATAATATTTA TTTAATATTT 9251 TTGCGTCGCA CAGTGAAAAT CTATATGAGA TTACAAAATA CCGACAACAT 9301 TATTTAAGAA ACATAGACAT TAACCCTGAG ACTGTTGGAC
• ATCAACGGGT 9351 AGATTCCTTC ATGCATAGCA CCTCATTCTT GGGGACAAAA GCACGGTTTG
• Region 11 Fragment of maize chloroplast rpsl2 rRNA gene (complement)
• Region 12 Fragment of maize chloroplast genome
• TTCATCAAAA 10001 ATTTCCATGA AAAAAGAAAA GATGAATTTG TCCATTCATT GAACCCTAGT 10051 TCGGGACTGA CGGGGCTCGA ACCCGCAGCT TCCGCCT
• Region 13 Fragment of pat gene (complement)
• ATCCACTCTT 10201 GTGGTGTTTG TGGCTCTGTC CTAAAGTTCA CTGTAGACGT CTCAATGTAA
• Nucleotides 10276-10277 connect Region 13 to Region 14.
• Region 14 Fragment of maize chloroplast ORF241 (complement)
• Region 15 Maize genomic (no significant homology)
• CGCTCTTCGG 10801 ACCGGGACCC CGACGTCCCG GCCCCGGATA CCGACGGCAC CAGCCCGCTC 10851 GGGGGCTGGC TTGACGACCC CTGGCCCAGC CTCAGATCTG
• PCR analysis was used to determine if the undescribed region of sequence on the end of the 3' flanking sequence (Region 15 in Table 1) is present in the unmodified control com line used for transformation to produce maize event TCI 507 and thus represents a border with com genomic DNA.
• Successful PCR amplification of Region 15 in both maize line TCI 507 and the unmodified Hi-II control com line revealed that Region 15 was indeed present in com genomic DNA.
• Five different PCR analyses were carried out on genomic DNA prepared from TCI 507 and the unmodified Hi-II control com line as outlined in Table 7 below using the primer sequences shown in Table 8.
• Reaction L Three reactions were designed to amplify DNA within Region 15 of the 3' flanking region; Reaction L - producing a 175 bp amplicon, Reaction M - producing a 134 bp amplicon, and Reaction N - producing a 107 bp amplicon.
• the expected amplicons were present in both the unmodified control com line and in maize line TCI 507.
• Reactions J and K were designed as specific primer pairs for TCI 507 that would span the end of the insert into the 3' flanking region.
• the forward primer was located in the pat gene fi-agment on the 3' end of the full-length PHI8999A insert (Region 13 in Table 1) and the reverse primer was located in the undefined Region 15.
• Reaction K the forward primer was located in the chloroplast hypothetical protein gene on the 3' end of the full-length insert (Region 14 in Table 1) and the reverse primer was located in the undefined Region 15. Both Reaction J and Reaction K produced an amplicon in maize line TCI 507 and did not produce an amplicon in the unmodified control com line. The results indicate that both Reactions J and K are specific for the TCI 507 event.
• the PCR results indicate that the undescribed sequence (Region 15) of the 3' flanking sequence of TCI 507 is also present in genomic DNA isolated from the unmodified Hi-II control com line.
• the DNA sequences amplified in Reactions L, M, and N are not unique to the 3' flanking region of TCI 507 but are also present in the unmodified control com line.
• event primer pairs include, but are not limited to, SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 2 and SEQ ID NO: 23; SEQ ID NO: 3 and SEQ ID NO: 5; and SEQ ID NO: 4 and SEQ ID NO: 5.
• any primer pair derived from SEQ LD NO: 26 and SEQ ID NO: 27 that when used in a DNA amplification reaction produces a DNA amplicon diagnostic for TCI 507 is an aspect of the present invention.
• the amplification conditions for this analysis are illustrated in Table 9, however, any modification of these methods that use DNA primers or complements thereof to produce an amplicon DNA molecule diagnostic for TCI 507 is within the ordinary skill of the art.
• control primer pairs which include SEQ ID NOS: 10 and 11; SEQ ED NOS: 10 and 12; SEQ ID NOS: 13 and 14; SEQ ED NOS: 14 and 15; SEQ ID NOS: 5 and 16; SEQ ID NOS: 5 and 17; and SEQ ED NOS: 5 and 18; for amplification of an endogenous com gene are included as internal standards for the reaction conditions. Also included are primer pairs that will produce an amplicon in transgenic events containing a.
• the analysis of plant tissue DNA extracts to test for the presence of the TC1507 event should include a positive tissue DNA extract control (a DNA sample known to contain the transgenic sequences).
• a successful amplification of the positive control demonstrates that the PCR was run under conditions which allow for the amplification of target sequences.
• a negative, or wild-type, DNA extract control in which the template DNA provided is either genomic DNA prepared from a non-transgenic plant, or is a non- TC1507 transgenic plant, should also be included. Additionally a negative control that contains no template corn DNA extract will be a useful gauge of the reagents and conditions used in the PCR protocol.
• Additional DNA primer molecules of sufficient length can be selected from SEQ ED NO: 26 and SEQ ID NO: 27 by those skilled in the art of DNA amplification methods, and conditions optimized for the production of an amplicon that may differ from the methods shown in Table 9 or Table 10 but result in an amplicon diagnostic for event TCI 507.
• the use of these DNA primer sequences with modifications to the methods shown in Table 9 and Table 10 are within the scope of the invention.
• the amplicon wherein at least one DNA primer molecule of sufficient length derived from SEQ ED NO: 26 and SEQ ED NO: 27 that is diagnostic for event TCI 507 is an aspect of the invention.
• the amplicon wherein at least one DNA primer of sufficient length derived from any of the genetic elements of PHI8999A that is diagnostic for event TC1507 is an aspect of the invention.
• the assay for the TCI 507 amplicon can be performed by using a Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermocycler, or by methods and apparatus known to those skilled in the art.

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Biotechnology (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Molecular Biology (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Analytical Chemistry (AREA)
• Microbiology (AREA)
• General Health & Medical Sciences (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Biochemistry (AREA)
• Plant Pathology (AREA)
• Cell Biology (AREA)
• Botany (AREA)
• Mycology (AREA)
• Immunology (AREA)
• Insects & Arthropods (AREA)
• Pest Control & Pesticides (AREA)
• Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Agricultural Chemicals And Associated Chemicals (AREA)

Priority Applications (11)

Applications Claiming Priority (2)

Publications (2)

Family

ID=33435118

Family Applications (1)

Country Status (19)

Cited By (335)

Families Citing this family (68)

Family Cites Families (19)

• 2004
  • 2004-04-29 DK DK04751097.9T patent/DK1620571T3/en active
  • 2004-04-29 AU AU2004236718A patent/AU2004236718C1/en not_active Expired
  • 2004-04-29 CA CA2524493A patent/CA2524493C/en not_active Expired - Lifetime
  • 2004-04-29 PT PT47510979T patent/PT1620571E/pt unknown
  • 2004-04-29 EP EP04751097.9A patent/EP1620571B1/en not_active Expired - Lifetime
  • 2004-04-29 BR BRPI0410027-1A patent/BRPI0410027B1/pt active IP Right Grant
  • 2004-04-29 MX MXPA05011795A patent/MXPA05011795A/es active IP Right Grant
  • 2004-04-29 JP JP2006514201A patent/JP2006525028A/ja active Pending
  • 2004-04-29 NZ NZ543450A patent/NZ543450A/en not_active IP Right Cessation
  • 2004-04-29 WO PCT/US2004/013538 patent/WO2004099447A2/en not_active Ceased
  • 2004-04-29 HU HUE04751097A patent/HUE028375T2/en unknown
  • 2004-04-29 ES ES04751097.9T patent/ES2546267T3/es not_active Expired - Lifetime
  • 2004-04-29 KR KR1020057020845A patent/KR101152465B1/ko not_active Expired - Lifetime
  • 2004-04-29 EP EP15168051.9A patent/EP2942402A1/en not_active Withdrawn
  • 2004-04-29 PL PL04751097T patent/PL1620571T3/pl unknown
  • 2004-04-30 US US10/837,105 patent/US7288643B2/en not_active Expired - Lifetime
  • 2004-04-30 TW TW093112237A patent/TWI378103B/zh not_active IP Right Cessation
  • 2004-05-03 CL CL200400934A patent/CL2004000934A1/es unknown
  • 2004-05-03 AR ARP040101508A patent/AR044244A1/es not_active Application Discontinuation
• 2005
  • 2005-11-07 ZA ZA200508964A patent/ZA200508964B/en unknown
• 2007
  • 2007-07-06 US US11/774,236 patent/US7514544B2/en not_active Expired - Lifetime
  • 2007-07-06 US US11/774,204 patent/US7417132B2/en not_active Expired - Lifetime
  • 2007-07-06 US US11/774,254 patent/US7435807B1/en not_active Expired - Lifetime
  • 2007-10-16 US US11/872,757 patent/US7449564B2/en not_active Expired - Lifetime
• 2009
  • 2009-03-13 US US12/333,044 patent/US7989607B2/en not_active Expired - Lifetime
  • 2009-06-24 CL CL2009001482A patent/CL2009001482A1/es unknown
• 2010
  • 2010-10-28 US US12/914,271 patent/US8901378B2/en active Active
• 2012
  • 2012-12-12 JP JP2012271425A patent/JP5674753B2/ja not_active Expired - Lifetime
• 2014
  • 2014-11-19 US US14/547,589 patent/US10023921B2/en active Active
• 2018
  • 2018-06-19 US US16/011,908 patent/US20180363067A1/en not_active Abandoned