WO2004085635A1 - Melan-a peptide analogue-virus-like-particle conjugates - Google Patents
Melan-a peptide analogue-virus-like-particle conjugates Download PDFInfo
- Publication number
- WO2004085635A1 WO2004085635A1 PCT/EP2004/003164 EP2004003164W WO2004085635A1 WO 2004085635 A1 WO2004085635 A1 WO 2004085635A1 EP 2004003164 W EP2004003164 W EP 2004003164W WO 2004085635 A1 WO2004085635 A1 WO 2004085635A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- particle
- composition
- virus
- antigen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/21—Retroviridae, e.g. equine infectious anemia virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
- C07K14/08—RNA viruses
- C07K14/15—Retroviridae, e.g. bovine leukaemia virus, feline leukaemia virus human T-cell leukaemia-lymphoma virus
- C07K14/155—Lentiviridae, e.g. human immunodeficiency virus [HIV], visna-maedi virus or equine infectious anaemia virus
- C07K14/16—HIV-1 ; HIV-2
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5258—Virus-like particles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
- A61K2039/6031—Proteins
- A61K2039/6075—Viral proteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/18—Type of nucleic acid acting by a non-sequence specific mechanism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/20011—Papillomaviridae
- C12N2710/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2730/00—Reverse transcribing DNA viruses
- C12N2730/00011—Details
- C12N2730/10011—Hepadnaviridae
- C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
- C12N2730/10122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2730/00—Reverse transcribing DNA viruses
- C12N2730/00011—Details
- C12N2730/10011—Hepadnaviridae
- C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
- C12N2730/10123—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2730/00—Reverse transcribing DNA viruses
- C12N2730/00011—Details
- C12N2730/10011—Hepadnaviridae
- C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
- C12N2730/10134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16211—Human Immunodeficiency Virus, HIV concerning HIV gagpol
- C12N2740/16222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16211—Human Immunodeficiency Virus, HIV concerning HIV gagpol
- C12N2740/16234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/10011—Arenaviridae
- C12N2760/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/10011—Arenaviridae
- C12N2760/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2795/00—Bacteriophages
- C12N2795/00011—Details
- C12N2795/18011—Details ssRNA Bacteriophages positive-sense
- C12N2795/18111—Leviviridae
- C12N2795/18122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2795/00—Bacteriophages
- C12N2795/00011—Details
- C12N2795/18011—Details ssRNA Bacteriophages positive-sense
- C12N2795/18111—Leviviridae
- C12N2795/18123—Virus like particles [VLP]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention is related to the fields of vaccinology, immunology and medicine.
- the invention provides compositions and methods for enhancing immunological responses against MelanA peptide analogues which are coupled, fused or attached otherwise to virus-like particles (VLPs) by binding, preferably by packaging immunostimulatory substances, in particular immunostimulatory nucleic acids, and even more particular oligonucleotides containing at least one non-methylated CpG sequence, into the VLPs.
- VLPs virus-like particles
- the invention can be used to induce strong and sustained T cell responses particularly useful for the treatment of tumors.
- the essence of the immune system is built on two separate foundation pillars: one is specific or adaptive immunity which is characterized by relatively slow response- kinetics and the ability to remember; the other is non-specific or innate immunity exhibiting rapid response-kinetics but lacking memory.
- viruses Unlike isolated proteins, viruses induce prompt and efficient immune responses in the absence of any adjuvants both with and without T-cell help (Bachmann & Zinkemagel, Ann. Rev. Immunol. 15:235-270 (1997)). Many viruses exhibit a quasi- crystalline surface that displays a regular array of epitopes which efficiently crosslinks epitope-specific immunoglobulins on B cells (Bachmann & Zinkemagel, Immunol. Today 17:553-558 (1996)). Viral structure is even linked to the generation of anti-antibodies in autoimmune disease and as a part of the natural response to pathogens (see Fehr, T., et al., J. Exp. Med. 185:1785-1792 (1997)). Thus, antigens on viral particles that are organized in an ordered and repetitive array are highly immunogenic since they can directly activate B cells and induce the generation of a cytotoxic T cell response, another crucial arm of the immune system.
- Viral particles as antigens exhibit two advantages over their isolated components: (1) due to their highly repetitive surface structure, they are able to directly activate B cells, leading to high antibody titers and long-lasting B cell memory; and (2) viral particles, but not soluble proteins, have the potential to induce a cytotoxic T cell response, even if the viruses are non-infectious and adjuvants are absent.
- CpG non-methylated CG motifs
- DNA rich in non-methylated CG motifs exhibits a potent stimulatory activity on B cells, dendritic cells and other APC's in vitro as well as in vivo.
- bacterial DNA is immunostimulatory across many vertebrate species, the individual CpG motifs may differ.
- CpG motifs that stimulate mouse immune cells may not necessarily stimulate human immune cells and vice versa.
- immunostimulatory CpG- oligodeoxynucleotides induce strong side effects by causing extramedullary hemopoiesis accomponied by splenomegaly and lymphadenopathy in mice (Sparigan et al., J. Immunol. (1999), 162:2368-74 and Example 18).
- Melanomas are aggressive, frequently metastatic tumors derived from either melanocytes or melanocyte related nevus cells. Melanomas make up approximately three percent of all skin cancers and the worldwide increase in melanoma is unsurpassed by any other neoplasm with the exception of lung cancer in women. Even when melanoma is apparently localized to the skin, up to 30% of the patients will develop systemic metastasis and the majority will die. In the past decade immunotherapy and gene therapy have eterged as new and promising methods for treating melanoma, for example, treatment of Melanoma patients with the Melan A/MART- 1 peptide with or without adjuvants. These Strategies are usually of limited succsess.
- Another way of immunotherapy is the loading of dendritic cells with either the MelanA/MART-1 Peptide, or transfection of dendritic cells with MelanA/MART-1-RNA and re-injection onto patients.
- Drawback of this procedure is the purification and incubation of autologous dendritic cells from each individual patient for several days with cytokines in vitro. This is very delicate because the dendritic cells have to be in the right state of maturation for being immunogenic and not tolerogenic that could lead to T cells no responding to the tumor anymore.
- Characterization of potent melanoma vaccines is, therefore, important for the development of new strategies for cancer immunotherapy, in particular for melanoma.
- This invention is based on the finding that particular human MelanA peptide analogues when bound to a core particle having a structure with an inherent repetitive organization, and hereby in particular to virus-like-particles (VLPs) and subunits of VLPs, respectively, which VLPs are packaged with immunostimulatory substances (ISSs) such as DNA oligonucleotides, represent potent immunogens for the induction of specific antibodies.
- VLPs virus-like-particles
- ISSs immunostimulatory substances
- DNA oligonucleotides represent potent immunogens for the induction of specific antibodies.
- the invention is further based on the finding that immunostimulatory substances such as DNA oligonucleotides can be packaged into VLPs which renders them more immunogenic.
- nucleic acids and oligonucleotides, respectively, present in VLPs can be replaced specifically by the immunostimulatory substances and DNA-oligonucleotides containing CpG motifs, respectively.
- these packaged immunostimulatory substances in particular immunostimulatory nucleic acids such as unmethylated CpG-containing oligonucleotides retained their immunostimulatory capacity without widespread activation of the innate immune system.
- the compositions comprising VLP's and the immunostimulatory substances in accordance with the present invention, and in particular the CpG- VLPs are dramatically more immunogenic than their CpG-free counterparts and induce enhanced B and T cell responses.
- T cell responses against both the VLPs and MelanA peptide analogues are especially directed to the Thl type.
- Human MelanA peptide analogues attached to CpG-loaded VLPs may therefore be ideal vaccines for prophylactic or therapeutic vaccination against tumors.
- the invention provides a composition, typically and preferably for enhancing an immune response in an animal, comprising a virus-like particle ,an immunostimulatory substance, preferably an immunostimulatory nucleic acid, and even more preferably an unmethylated CpG-containing oligonucleotide, and at least one antigen or antigenic determinant, where the immunostimulatory substance, nucleic acid or oligonucleotide is coupled, fused, or otherwise attached to or enclosed by, i.e., bound, to the virus-like particle and wherein said antigen or antigenic determinant is bound to said virus-like particle and wherein said antigen comprises, alternatively consists essentially of, or alternatively consists, of a human melanoma MelanA peptide analogue.
- the immunostimulatory nucleic acids in particular the unmethylated CpG-containing oligonucleotides are stabilized by phosphorothioate modifications of the phosphate backbone.
- the immunostimulatory nucleic acids, in particular the unmethylated CpG- containing oligonucleotides are packaged into the VLPs by digestion of RNA within the VLPs and simultaneous addition of the DNA oligonucleotides containing CpGs of choice.
- the VLPs can be disassembled before they are reassembled in the presence of CpGs.
- the immunostimulatory nucleic acids do not contain CpG motifs but nevertheless exhibit immunostimulatory activities. Such nucleic acids are described in WO 01 22972. All sequences described therein are hereby incorporated by way of reference.
- the virus-like particle is a recombinant virus- like particle.
- the virus-like particle is free of a lipoprotein envelope.
- the recombinant virus-like particle comprises, or alternatively consists of, recombinant proteins of Hepatitis B virus, BK virus or other human Polyoma virus, measles virus, Sindbis virus, Rotavirus, Foot-and-Mouth-Disease virus, Retrovirus, Norwalk virus or human Papilloma vims, RNA-phages, Q ⁇ -phage, GA-phage, fr-phage and Ty.
- the viras-like particle comprises, or alternatively consists of, one or more different Hepatitis B virus core (capsid) proteins (HBcAgs).
- the viras-like particle comprises recombinant proteins, or fragments thereof, of a RNA-phage.
- Preferred RNA-phages are Q ⁇ -phage, AP 205- phage, GA-phage, fr-phage.
- the antigen comprises, or alternatively consists of, a cytotoxic T cell epitope.
- the viras-like particle comprises the Hepatitis B virus core protein and the cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein. In one embodiment, they are fused by a leucine linking sequence.
- the antigen is a polypeptide suited to induce an immune response against cancer cells.
- a method of enhancing an immune response in a human or other animal species comprising introducing into the animal a composition comprising a viras-like particle, an immunostimulatory substance, preferably an immunostimulatory nucleic acid, and even more preferably an unmethylated CpG- containing oligonucleotide, and at least one antigen or antigenic determinant, where the immunostimulatory substance, preferably the nucleic acid, and even more preferally the oligonucleotide is bound (i.e.
- said antigen comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA peptide analogue, and wherein said human melanoma MelanA peptide analogue is bound to said viras-like particle.
- the composition is introduced into an animal subcutaneously, intramuscularly, intranasally, intradermally, intravenously or directly into a lymph node.
- the immune enhancing composition is applied locally, near a tumor or local viral reservoir against which one would like to vaccinate.
- the immune response is a T cell response, and the T cell response against the antigen is enhanced.
- the T cell response is a cytotoxic T cell response, and the cytotoxic T cell response against the MelanA peptide is enhanced.
- the present invention also relates to a vaccine comprising an immunologically effective amount of the immune enhancing composition of the present invention together with a pharmaceutically acceptable diluent, carrier or excipient.
- the vaccine further comprises at least one adjuvant.
- the invention also provides a method of immunizing and/or treating an animal comprising administering to the animal an immunologically effective amount of the disclosed vaccine.
- the immunostimulatory substance- containing VLPs preferably the immunostimulatory nucleic acid-containing VLP's, an even more preferably the unmethylated CpG-containing oligonucleotide VLPs are used for vaccination of animals, typically and preferably humans, against melanoma, or MelanA peptides, respectively.
- the modified VLPs can typically and preferably be used to vaccinate against tumors.
- the vaccination can be for prophylactic or therapeutic purposes, or both.
- the route of injection is preferably subcutaneous or intramuscular, but it would also be possible to apply the CpG-containing VLPs intradermally, intranasally, intravenously or directly into the lymph node.
- the CpG-containing MelanA peptide analogue-coupled or free VLPs are applied locally, near a tumor or local viral reservoir against which one would like to vaccinate.
- Figure 1 shows the SDS-PAGE analysis of Qb-MelanA VLPs.
- MelanA-peptides were coupled to Qb VLPs, as described in Example 20.
- the final products were mixed with sample buffer and separated under reduced conditions on 16 % Novex®Tris-Glycine gels for 1.5 hours at 125 V.
- the separated proteins were stained by soaking the gel in Coomassie blue solution. Background staining was removed by washing the gel in 50 % methanol, 8% acetic acid.
- the Molecular weight marker (P 77085, New England BioLabs, Beverly, USA) was used as reference for Qb-MelanA migration velocity (lane 1).
- G10 is used for the the oligonucleotide G10-PO
- G3 is used for the oligonucleotide G3-6.
- Supernatants were collected and IFN alpha was measured by ELISA, using a set of antibodies provided by PBL Biomedical Laboratories.
- Figure 2 B shows the upregulation of CD69 on human CD8+ PBMC treated with ISS.
- PBMC were obtained from buffy coat and incubated with fivefold dilution of the indicated ISS for 18h. Cells were washed and incubated with anti-CD8-FITC, anti-CD19- PE and anti-CD69-APC (all from BD PharMingen) for 20 min on ice. After washing, cells were analysed on a FACS Calibur using CellQuest software.
- Figure 3 shows the virus titers after immunizing mice with Qbx33 packaged with poly (I:C), G3-6, or G6.
- C57B16 mice were immunized by injecting either 100 ⁇ g Qbx33, 100 ⁇ g Qb VLPs packaged with poly (I:C) and coupled to ⁇ 33 (Qb-pIC-33, also termed QbxZnxpolyICxp33GGC) , 90 ⁇ g Qbx33 packaged with G3-6 (Qbx33/G3-6), or 90 ⁇ g Qbx33 packaged with G6 (Qbx33/G6). After eight days, mice were challenged with 1.5 xl06 plaque forming units Vaccinia virus, carrying the LCMV-p33 epitope.
- mice Five days later, mice were sacrificed and the ovaries were collected. A single cell suspension from the ovaries was prepared and added to BCS40 cells in serial dilutions. One day later, the cell layer was stained with a solution containing 50% Ethanol, 2% formaldehyde, 0.8% NaCl and 0.5% Crystal violet) and the viral plaques were counted.
- amino acid linker An "amino acid linker”, or also just termed “linker” within this specification, as used herein, either associates the antigen or antigenic determinant with the second attachment site, or more preferably, already comprises or contains the second attachment site, typically - but not necessarily - as one amino acid residue, preferably as a cysteine residue.
- amino acid linker does not intend to imply that such an amino acid linker consists exclusively of amino acid residues, even if an amino acid linker consisting of amino acid residues is a preferred embodiment of the present invention.
- amino acid residues of the amino acid linker are, preferably, composed of naturally occuring amino acids or unnatural amino acids known in the art, all-L or all-D or mixtures thereof.
- an amino acid linker comprising a molecule with a sulfhydryl group or cysteine residue is also encompassed within the invention.
- Such a molecule comprise preferably a C1-C6 alkyl-, cycloalkyl (C5,C6), aryl or heteroaryl moiety.
- a linker comprising preferably a C1-C6 alkyl-, cycloalkyl- (C5,C6), aryl- or heteroaryl- moiety and devoid of any amino acid(s) shall also be encompassed within the scope of the invention.
- Association between the antigen or antigenic determinant or optionally the second attachment site and the amino acid linker is preferably by way of at least one covalent bond, more preferably by way of at least one peptide bond.
- Animal As used herein, the term “animal” is meant to include, for example, humans, sheep, horses, cattle, pigs, dogs, cats, rats, mice, mammals, birds, reptiles, fish, insects and arachnids.
- Antibody As used herein, the term “antibody” refers to molecules which are capable of binding an epitope or antigenic determinant. The term is meant to include whole antibodies and antigen-binding fragments thereof, including single-chain antibodies.
- the antibodies are human antigen binding antibody fragments and include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a VL or VH domain.
- the antibodies can be from any animal origin including birds and mammals.
- the antibodies are human, murine, rabbit, goat, guinea pig, camel, horse or chicken.
- human antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulins and that do not express endogenous immunoglobulins, as described, for example, in U.S. Patent No. 5,939,598 by Kucherlapati et al.
- Antigen refers to a molecule capable of being bound by an antibody or a T cell receptor (TCR) if presented by MHC molecules.
- TCR T cell receptor
- An antigen is additionally capable of being recognized by the immune system and/or being capable of inducing a humoral immune response and/or cellular immune response leading to the activation of B- and/or T-lymphocytes. This may, however, require that, at least in certain cases, the antigen contains or is linked to a T helper cell epitope (Th cell epitope) and is given in adjuvant.
- An antigen can have one or more epitopes (B- and T- epitopes). The specific reaction referred to above is meant to indicate that the antigen will preferably react, typically in a highly selective manner, with its corresponding antibody or TCR and not with the multitude of other antibodies or TCRs which may be evoked by other antigens.
- Antigens as used herein may also be mixtures of several individual antigens.
- a "tumor antigen” as used herein is a compound, such as a peptide, associated with a tumor or cancer and which is capable of provoking an immune response. In particular, the compound is capable of provoking an immune response when presented in the context of an MHC molecule.
- Tumor antigens can be prepared from cancer cells either by preparing crude extracts of cancer cells, for example, as described in Cohen, et al., Cancer Research, 54:1055 (1994), by partially purifying the antigens, by recombinant technology or by de novo synthesis of known antigens.
- Tumor antigens include antigens that are antigenic portions of or are a whole tumor or cancer polypeptide.
- Cancers or tumors include, but are not limited to, biliary tract cancer; brain cancer; breast cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver cancer; lung cancer (e.g. small cell and non-small cell); melanoma; neuroblastomas; oral cancer; ovarian cancer; pancreas cancer; prostate cancer; rectal cancer; sarcomas; skin cancer; testicular cancer; thyroid cancer; and renal cancer, as well as other carcinomas and sarcomas.
- Antigenic determinant As used herein, the term “antigenic determinant” is meant to refer to that portion of an antigen that is specifically recognized by either B- or T- lymphocytes. B-lymphocytes respond to foreign antigenic determinants via antibody production, whereas T-lymphocytes are the mediator of cellular immunity. Thus, antigenic determinants or epitopes are those parts of an antigen that are recognized by antibodies, or in the context of an MHC, by T-cell receptors.
- Antigen presenting cell As used herein, the term “antigen presenting cell” is meant to refer to a heterogenous population of leucocytes or bone marrow derived cells which possess an immunostimulatory capacity.
- these cells are capable of generating peptides bound to MHC molecules that can be recognized by T cells.
- the term is synonymous with the term "accessory cell” and includes, for example, Langerhans' cells, interdigitating cells, B cells, macrophages and dendritic cells.
- epithelial cells, endothelial cells and other, non-bone marrow derived cells may also serve as antigen presenting cells.
- association refers to the binding of the first and second attachment sites that is preferably by way of at least one non-peptide bond.
- the nature of the association may be covalent, ionic, hydrophobic, polar or any combination thereof, preferably the nature of the association is covalent, and again more preferably the association is through at least one, preferably one, non-peptide bond.
- first and second attachment sites not only encompass the direct binding or association of the first and second attachment site forming the compositions of the invention but also, alternatively and preferably, the indirect association or binding of the first and second attachment site leading to the compositions of the invention, and hereby typically and preferably by using a heterobifunctional cross-linker.
- Attachment Site, First refers to an element of non-natural or natural origin typically and preferably being comprised by the viras-like particle, to which the second attachment site typically and preferably being comprised by the MelanA peptide analogue of the invention may associate.
- the first attachment site may be a protein, a polypeptide, an amino acid, a peptide, a sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound
- the first attachment site is located, typically and preferably on the surface, of the viras-like particle. Multiple first attachment sites are present on the surface of virus-like particle typically in a repetitive configuration. Preferably, the first attachment site is an amino acid or a chemically reactive group thereof.
- the phrase "second attachment site” refers to an element associated with, typically and preferably being comprised by, the MelanA peptide analogue of the invention to which the first attachment site located on the surface of the viras-like particle may associate.
- the second attachment site of the MelanA peptide analogue of the invention may be a protein, a polypeptide, a peptide, a sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride), or a combination thereof, or a chemically reactive group thereof.
- At least one second attachment site is present on the MelanA peptide analogue of the invention.
- the term "MelanA peptide analogue with at least one second attachment site” refers, therefore, to an antigen or antigenic construct comprising at least the MelanA peptide analogue of the invention and the second attachment site.
- these antigen or antigenic constructs comprise an "amino acid linker".
- bound refers to binding that may be covalent, e.g., by chemically coupling, or non-covalent, e.g., ionic interactions, hydrophobic interactions, hydrogen bonds, etc. Covalent bonds can be, for example, ester, ether, phosphoester, amide, peptide, imide, carbon-sulfur bonds, carbon-phosphorus bonds, and the like.
- bound is broader than and includes terms such as “coupled”, “fused”, “associated” and “attached”.
- bound also includes the enclosement, or partial enclosement, of the immunostimulatory substance.
- the term "bound” is broader than and includes terms such as “coupled,” “fused,” “enclosed”, “packaged” and “attached.”
- the immunostimulatory substance such as the unmethylated CpG-containing oligonucleotide can be enclosed by the VLP without the existence of an actual binding, neither covalently nor non-covalently.
- Coat protein(s) refers to the protein(s) of a bacteriophage or a RNA-phage capable of being incorporated within the capsid assembly of the bacteriophage or the RNA-phage.
- the term "CP” is used.
- the specific gene product of the coat protein gene of RNA-phage Q ⁇ is referred to as "Q ⁇ CP”
- the "coat proteins” of bacteriophage Q ⁇ comprise the "Q ⁇ CP” as well as the Al protein.
- the capsid of Bacteriophage Q ⁇ is composed mainly of the Q ⁇ CP, with a minor content of the Al protein.
- the VLP Q ⁇ coat protein contains mainly Q ⁇ CP, with a minor content of Al protein.
- Coupled refers to attachment by covalent bonds or by non-covalent interactions. With respect to the coupling of the antigen to the viras-like particle the term “coupled” preferably refers to attachment by covalent bonds. Moreover, with respect to the coupling of the antigen to the viras-like particle the term “coupled” preferably refers to association and attachment, respectively, by at least one non-peptide bond. Any method normally used by those skilled in the art for the coupling of biologically active materials can be used in the present invention. Fusion: As used herein, the term “fusion” refers to the combination of amino acid sequences of different origin in one polypeptide chain by in- frame combination of their coding nucleotide sequences.
- CpG refers to an oligonucleotide which contains at least one unmethylated cytosine, guanine dinucleotide sequence (e.g. "CpG DNA” or DNA containing a cytosine followed by guanosine and linked by a phosphate bond) and stimulates/activates, e.g. has a mitogenic effect on, or induces or increases cytokine expression by, a vertebrate cell.
- CpGs can be useful in activating B cells, NK cells and antigen-presenting cells, such as monocytes, dendritic cells and macrophages, and T cells.
- the CpGs can include nucleotide analogs such as analogs containing phosphorothioester bonds and can be double-stranded or single-stranded. Generally, double-stranded molecules are more stable in vivo, while single-stranded molecules have increased immune activity.
- Epitope As used herein, the term "epitope" refers to portions of a polypeptide having antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably in a human.
- an "immunogenic epitope,” as used herein, is defined as a portion of a polypeptide that elicits an antibody response or induces a T-cell response in an animal, as determined by any method known in the art. (See, for example, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998 4002 (1983)).
- the term "antigenic epitope,” as used herein, is defined as a portion of a protein to which an antibody can immunospecifically bind its antigen as determined by any method well known in the art. Immunospecific binding excludes non specific binding but does not necessarily exclude cross reactivity with other antigens.
- Antigenic epitopes need not necessarily be immunogenic. Antigenic epitopes can also be T-cell epitopes, in which case they can be bound immunospecifically by a T-cell receptor within the context of an MHC molecule.
- An epitope can comprise 3 amino acids in a spatial conformation which is unique to the epitope. Generally, an epitope consists of at least about 5 such amino acids, and more usually, consists of at least about 8-10 such amino acids. If the epitope is an organic molecule, it may be as small as Nitrophenyl. Preferred epitopes are the MelanA-peptide analogues of the invention.
- Immune response refers to a humoral immune response and/or cellular immune response leading to the activation or proliferation of B- and/or T-lymphocytes. In some instances, however, the immune responses may be of low intensity and become detectable only when using at least one substance in accordance with the invention. "Immunogenic” refers to an agent used to stimulate the immune system of a living organism, so that one or more functions of the immune system are increased and directed towards the immunogenic agent.
- immunogenic polypeptide is a polypeptide that elicits a cellular and/or humoral immune response, whether alone or linked to a carrier in the presence or absence of an adjuvant.
- Immunization refers to conferring the ability to mount a substantial immune response (comprising antibodies or cellular immunity such as effector CTL) against a target antigen or epitope. These terms do not require that complete immunity be created, but rather that an immune response be produced which is substantially greater than baseline. For example, a mammal may be considered to be immunized against a target antigen if the cellular and/or humoral immune response to the target antigen occurs following the application of methods of the invention.
- Immunostimulatory nucleic acid refers to a nucleic acid capable of inducing and/or enhancing an immune response.
- Immunostimulatory nucleic acids as used herein, comprise ribonucleic acids and in particular deoxyribonucleic acids.
- immunostimulatory nucleic acids contain at least one CpG motif e.g. a CG dinucleotide in which the C is unmethylated.
- the CG dinucleotide can be part of a palindromic sequence or can be encompassed within a non-palindromic sequence.
- Immunostimulatory nucleic acids not containing CpG motifs as described above encompass, by way of example, nucleic acids lacking CpG dinucleotides, as well as nucleic acids containing CG motifs with a methylated CG dinucleotide.
- the term "immunostimulatory nucleic acid” as used herein should also refer to nucleic acids that contain modified bases such as 4-bromo-cytosine.
- Immunostimulatory substance refers to a substance capable of inducing and/or enhancing an immune response.
- Immunostimulatory substances include, but are not limited to, toll-like receptor activing substances and substances inducing cytokine secretion.
- Toll-like receptor activating substances include, but are not limited to, immunostimulatory nucleic acids, peptideoglycans, lipopolysaccharides, lipoteichonic acids, imidazoquinoline compounds, flagellins, lipoproteins, and immunostimulatory organic substances such as taxol.
- natural human Melan A peptide or "normal human Melan A peptide” as used herein, shall refer to a peptide comprising, or alternatively consisting essentially of, or alternatively consisting of the amino acid sequence EAAGIGILTV (SEQ ID NO: 78) representing amino acids positions 26-35 of the normal human MelanA protein sequence or AAGIGILTV (SEQ ID NO: 79) representing amino acids positions 27-35 of the normal human MelanA protein sequence.
- MelanA peptide analogue or "human MelanA peptide analogue” or “human melanoma MelanA peptide analogue” as used herein shall be defined as a peptide in which the amino acid sequence of the corresponding normal MelanA peptide is altered by at least one amino acid or amino acid derivative, wherein this alteration may comprise an amino acid substitution and/or deletion and/or insertion or a combination thereof.
- MelanA peptide analogue as used herein shall be defined as a peptide in which the amino acid sequence of the corresponding normal MelanA peptide (SEQ ID NO: 91) is altered by three, preferably two, and even more preferably one, amino acid or amino acid derivative, wherein this alteration may comprise an amino acid substitution and/or deletion and/or insertion or a combination thereof.
- the term "MelanA peptide analogue" as used herein shall be defined as a peptide in which the amino acid sequence of the corresponding normal MelanA peptide is altered by three, preferably two, and even more preferably one, amino acid or amino acid derivative, wherein this alteration may comprise an amino acid substitution and/or deletion and or insertion or a combination thereof, and wherein this alteration is at position 26, 27, 28 and/or 35 of the normal human MelanA protein sequence (SEQ ID NO: 91), and wherein said alteration is preferably an amino acid substitution.
- MelanA peptide analogue human MelanA peptide analogue
- human melanoma MelanA peptide analogue human melanoma MelanA/MART-1 peptide analogue
- Natural origin As used herein, the term “natural origin” means that the whole or parts thereof are not synthetic and exist or are produced in nature.
- Non-natural As used herein, the term generally means not from nature, more specifically, the term means from the hand of man.
- Non-natural origin As used herein, the term “non-natural origin” generally means synthetic or not from nature; more specifically, the term means from the hand of man.
- Ordered and repetitive antigen or antigenic determinant array generally refers to a repeating pattern of antigen or antigenic determinant, characterized by a typically and preferably uniform spacial arrangement of the antigens or antigenic determinants with respect to the core particle and virus-like particle, respectively.
- the repeating pattern may be a geometric pattern.
- suitable ordered and repetitive antigen or antigenic determinant arrays are those which possess strictly repetitive paracrystalline orders of antigens or antigenic determinants, preferably with spacings of 0.5 to 30 nanometers, more preferably 3 to 15 nanometers, even more preferably 3 to 8 nanometers.
- Oligonucleotide refers to a nucleic acid sequence comprising 2 or more nucleotides, generally at least about 6 nucleotides to about 100,000 nucleotides, preferably about 6 to about 2000 nucleotides, and more preferably about 6 to about 300 nucleotides, even more preferably about 20 to about 300 nucleotides, and even more preferably about 20 to about 100 nucleotides.
- oligonucleotide or “oligomer” also refer to a nucleic acid sequence comprising more than 100 to about 2000 nucleotides, preferably more than 100 to about 1000 nucleotides, and more preferably more than 100 to about 500 nucleotides.
- Oligonucleotide also generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
- Oligonucleotide includes, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double- stranded or a mixture of single- and double-stranded regions.
- oligonucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
- an oligonucleotide can be synthetic, genomic or recombinant, e.g., ⁇ - DNA, cosmid DNA, artificial bacterial chromosome, yeast artificial chromosome and filamentous phage such as Ml 3.
- the oligonucleotide is a synthetic oligonucleotide.
- oligonucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.
- suitable nucleotide modifications/analogs include peptide nucleic acid, inosin, tritylated bases, phosphorothioates, alkylphosphorothioates, 5-nitroindole deoxyribofuranosyl, 5-methyldeoxycytosine and 5,6-dihydro-5,6- dihydroxydeoxythymidine.
- oligonucleotide embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. Other nucleotide analogs/modifications will be evident to those skilled in the art.
- the term "packaged” as used herein refers to the state of an immunostimulatory substance, preferably of an immunostimulatory nucleic acid, in relation to the VLP.
- the term “packaged” as used herein includes binding that may be covalent, e.g., by chemically coupling, or non-covalent, e.g., ionic interactions, hydrophobic interactions, hydrogen bonds, etc. Covalent bonds can be, for example, ester, ether, phosphoester, amide, peptide, imide, carbon-sulfur bonds such as thioether bonds, carbon-phosphorus bonds, and the like.
- the term also includes the enclosement, or partial enclosement, of a substance.
- the term “packaged” includes terms such as “coupled, "enclosed” and “attached.”
- the immunostimulatory substance such as the unmethylated CpG-containing oligonucleotide can be enclosed by the VLP without the existence of an actual binding, neither covalently nor non-covalently.
- the term “packaged” indicates that the immunostimulatory nucleic acid in a packaged state is not accessible to DNAse dr RNAse hydrolysis.
- the immunostimulatory nucleic acid is packaged inside the VLP capsids, most preferably in a non-covalent manner.
- compositions of the invention can be combined, optionally, with a pharmaceutically-acceptable carrier.
- pharmaceutically-acceptable carrier means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human or other animal.
- carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
- peptide as used herein, and in particular with respect to the human melanoma MelanA peptide or the normal human Melan A peptide, shall refer to a molecule composed of monomers (amino acids), typically and preferably linearly, linked by amide bonds (also known as peptide bonds). It indicates a molecular chain of amino acids and does not refer to a specific length of the product.
- organic molecule refers to any chemical entity of natural or synthetic origin.
- organic molecule as used herein encompasses, for example, any molecule being a member of the group of nucleotides, lipids, carbohydrates, polysaccharides, lipopolysaccharides, steroids, alkaloids, terpenes and fatty acids, being either of natural or synthetic origin.
- organic molecule encompasses molecules such as nicotine, cocaine, heroin or other pharmacologically active molecules contained in drags of abuse.
- an organic molecule contains or is modified to contain a chemical functionality allowing its coupling, binding or other method of attachment to the virus-like particle in accordance with the invention.
- Polypeptide refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). It indicates a molecular chain of amino acids and does not refer to a specific length of the product. Thus, peptides, oligopeptides and proteins are included within the definition of polypeptide. This term is also intended to refer to post-expression modifications of the polypeptide, for example, glycosolations, acetylations, phosphorylations, and the like. A recombinant or derived polypeptide is not necessarily translated from a designated nucleic acid sequence. It may also be generated in any manner, including chemical synthesis.
- a substance which "enhances" an immune response refers to a substance in which an immune response is observed that is greater or intensified or deviated in any way with the addition of the substance when compared to the same immune response measured without the addition of the substance.
- a substance which "enhances" an immune response refers herein (i) to a substance in which the frequency of MelanA-specific, preferably natural human MelanA peptide-specific or human melanoma MelanA peptide analogue-specific, T cells increases when compared to the frequency of MelanA-specific, preferably natural human MelanA peptide-specific or human melanoma MelanA peptide analogue-specific, T cells measured without the addition of the substance, or (ii) to a substance in which the functionality of MelanA-specific, preferably natural human MelanA peptide-specific or human melanoma MelanA peptide analogue-specific, T cells deviates, preferably improves, when compared to the functionality
- the frequency of MelanA-specific, preferably natural human MelanA peptide-specific T cells or human melanoma MelanA peptide analogue-specific, is measured by way of MHC-class I /peptide complexes such as tetramer or multimer staining, preferably tetramer staining as described in Suiter, DE. et al. Eur J Immunol. 2002, Vol.
- the functionality of MelanA-specific, preferably natural human MelanA peptide-specific or human melanoma MelanA peptide analogue-specific, T cells can also be measured by way of measuring MelanA-specific, preferably natural human MelanA peptide-specific or human melanoma MelanA peptide analogue-specific, cytolytic CD8+ T cell response in Chromium or Europium release assay as described in Valmori, D. et al. J. Immunol. 1998, 161, 6956-6962.
- the phenotyping of MelanA-specific, preferably natural human MelanA peptide-specific or human melanoma MelanA peptide analogue-specific, T cells is measured by way of using antibodies against cell surface or intracellular proteins such as cell activation markers, cell differentiation markers, homing markers, chemokine and cytokine receptors, costimulatory receptors, death receptors, killer activatory or inhibitory receptors, integrins, expression of anti-apoptotic proteins and absence of senescence markers and preferably by way of cell activation markers as described in Suiter, DE. et al. Eur J Immunol. 2002, Vol. 32, 731-741.
- Effective Amount refers to an amount necessary or sufficient to realize a desired biologic effect.
- An effective amount of the composition would be the amount that achieves this selected result, and such an amount could be determined as a matter of routine by a person skilled in the art.
- an effective amount for treating an immune system deficiency could be that amount necessary to cause activation of the immune system, resulting in the development of an antigen specific immune response upon exposure to antigen.
- the term is also synonymous with "sufficient amount.”
- the effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular composition being administered, the size of the subject, and/or the severity of the disease or condition.
- One of ordinary skill in the art can empirically determine the effective amount of a particular composition of the present invention without necessitating undue experimentation.
- Self antigen refers to proteins encoded by the hosfs genome or DNA and products generated by proteins or RNA encoded by the host's genome or DNA are defined as self.
- the tern "self antigen”, as used herein refers to proteins encoded by the human genome or DNA and products generated by proteins or RNA encoded by the human genome or DNA are defined as self.
- inventive compositions, pharmaceutical compositions and vaccines comprising self antigens are in particular capable of breaking tolerance against a self antigen when applied to the host.
- breaking tolerance against a self antigen shall refer to enhancing an immune response, as defined herein, and preferably enhancing a B or a T cell response, specific for the self antigen when applying the inventive compositions, pharmaceutical compositions and vaccines comprising the self antigen to the host.
- proteins that result from a combination of two or several self-molecules or that represent a fraction of a self-molecule and proteins that have a high homology two self- molecules as defined above may also be considered self.
- treatment refers to prophylaxis and/or therapy.
- the term refers to a prophylactic treatment which increases the resistance of a subject to infection with a pathogen or, in other words, decreases the likelihood that the subject will become infected with the pathogen or will show signs of illness attributable to the infection, as well as a treatment after the subject has become infected in order to fight the infection, e.g., reduce or eliminate the infection or prevent it from becoming worse.
- the term "vaccine” refers to a formulation which contains the composition of the present invention and which is in a form that is capable of being administered to an animal.
- the vaccine comprises a conventional saline or buffered aqueous solution medium in which the composition of the present invention is suspended or dissolved.
- the composition of the present invention can be used conveniently to prevent, ameliorate, or otherwise treat a condition.
- the vaccine Upon introduction into a host, the vaccine is able to provoke an immune response including, but not limited to, the production of antibodies, cytokines and/or the activation of cytotoxic T cells, antigen presenting cells, helper T cells, dendritic cells and/or other cellular responses.
- the vaccine of the present invention additionally includes an adjuvant which can be present in either a minor or major proportion relative to the compound of the present invention.
- adjuvant refers to non-specific stimulators of the immune response or substances that allow generation of a depot in the host which when combined with the vaccine of the present invention provide for an even more enhanced immune response.
- adjuvants can be used. Examples include incomplete Freund's adjuvant, aluminum hydroxide and modified muramyldipeptide.
- adjuvant as used herein also refers to typically specific stimulators of the immune response which when combined with the vaccine of the present invention provide for an even more enhanced and typically specific immune response. Examples include, but limited to, GM-CSF, IL-2, IL-12, IFN ⁇ . Further examples are within the knowledge of the person skilled in the art.
- Viras-like particle refers to a structure resembling a virus particle but which has not been demonstrated to be pathogenic. Typically, a viras-like particle in accordance with the invention does not carry genetic information encoding for the proteins of the viras-like particle. In general, viruslike particles lack the viral genome and, therefore, are noninfectious. Also, viras-like particles can often be produced in large quantities by heterologous expression and can be easily purified. Some virus-like particles may contain nucleic acid distinct from their genome.
- a viras-like particle in accordance with the invention is non replicative and noninfectious since it lacks all or part of the viral genome, in particular the replicative and infectious components of the viral genome.
- a viras-like particle in accordance with the invention may contain nucleic acid distinct from their genome.
- a typical and preferred embodiment of a virus-like particle in accordance with the present invention is a viral capsid such as the viral capsid of the corresponding virus, bacteriophage, or RNA-phage.
- the terms "viral capsid” or “capsid”, as interchangeably used herein, refer to a macromolecular assembly composed of viral protein subunits.
- the viral protein subunits assemble into a viral capsid and capsid, respectively, having a stracture with an inherent repetitive organization, wherein said stracture is, typically, spherical or tubular.
- the capsids of RNA-phages or HBcAg's have a spherical form of icosahedral symmetry.
- virus-like particle of a bacteriophage refers to a virus-like particle resembling the stracture of a bacteriophage, being non replicative and noninfectious, and lacking at least the gene or genes encoding for the replication machinery of the bacteriophage, and typically also lacking the gene or genes encoding the protein or proteins responsible for viral attachment to or entry into the host.
- This definition should, however, also encompass virus-like particles of bacteriophages, in which the aforementioned gene or genes are still present but inactive, and, therefore, also leading to non-replicative and noninfectious viras-like particles of a bacteriophage.
- VLP of RNA phage coat protein The capsid stracture formed from the self- assembly of 180 subunits of RNA phage coat protein and optionally containing host RNA is referred to as a "VLP of RNA phage coat protein".
- VLP of RNA phage coat protein A specific example is the VLP of Q ⁇ coat protein.
- the VLP of Q ⁇ coat protein may either be assembled exclusively from Q ⁇ CP subunits (SEQ ID: No 10) generated by expression of a Q ⁇ CP gene containing, for example, a TAA stop codon precluding any expression of the longer Al protein through suppression, see Kozlovska, T.M., et al., Intervirology 39: 9-15 (1996)), or additionally contain Al protein subunits (SEQ ID: No 11) in the capsid assembly.
- the readthrough process has a low efficiency and is leading to an only very low amount of Al protein in the VLPs. An extensive number of examples have been performed with different combinations of ISS packaged and antigen coupled.
- virus particle refers to the morphological form of a virus. In some virus types it comprises a genome surrounded by a protein capsid; others have additional structures (e.g., envelopes, tails, etc.).
- Non-enveloped viral particles are made up of a proteinaceous capsid that surrounds and protects the viral genome. Enveloped viruses also have a capsid stracture surrounding the genetic material of the virus but, in addition, have a lipid bilayer envelope that surrounds the capsid.
- the VLP's are free of a lipoprotein envelope or a lipoprotein-containing envelope. In a further preferred embodiment, the VLP's are free of an envelope altogether.
- One, a, or an When the terms “one,” “a,” or “an” are used in this disclosure, they mean “at least one” or “one or more " unless otherwise indicated.
- certain embodiments of the invention involve the use of recombinant nucleic acid technologies such as cloning, polymerase chain reaction, the purification of DNA and RNA, the expression of recombinant proteins in prokaryotic and eukaryotic cells, etc.
- Such methodologies are well known to those skilled in the art and can be conveniently found in published laboratory methods manuals (e.g., Sambrook, J. et al., eds., MOLECULAR CLONING, A LABORATORY MANUAL, 2nd.
- compositions of the invention comprise, or alternatively consist essentially of, or alternatively consist of, a viras-like particle, at least one immunostimulatory substance, preferably an immunostimulatory nucleic acid, and even more preferably an unmethylated CpG- containing oligonucleotide, and at least one antigen or antigenic determinant, wherein the immunostimulatory substance, the immunostimulatory nucleic acid or the oligonucleotide is bound to the virus-like particle, and wherein said antigen or antigenic determinant is bound to said virus-like particle, and wherein said antigen comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA peptide analogue.
- the invention conveniently enables the practitioner to construct such a composition for various treatment and/or prophylactic prevention purposes, which include the prevention and/or treatment of cancers, for example.
- Viras-like particles in the context of the present application refer to structures resembling a virus particle but which are not pathogenic. In general, viras-like particles lack the viral genome and, therefore, are noninfectious. Also, virus-like particles can be produced in large quantities by heterologous expression and can be easily purified.
- the virus-like particle is a recombinant virus-like particle.
- the skilled artisan can produce VLPs using recombinant DNA technology and viras coding sequences which are readily available to the public.
- the coding sequence of a viras envelope or core protein can be engineered for expression in a baculoviras expression vector using a commercially available baculoviras vector, under the regulatory control of a viras promoter, with appropriate modifications of the sequence to allow functional linkage of the coding sequence to the regulatory sequence.
- the coding sequence of a virus envelope or core protein can also be engineered for expression in a bacterial expression vector, for example.
- VLPs include, but are not limited to, the capsid proteins of Hepatitis B virus, measles viras, Sindbis viras, rotavirus, foot-and-mouth-disease virus, Norwalk viras, the retroviral GAG protein, the retrotransposon Ty protein pi, the surface protein of Hepatitis B viras, human papilloma viras, human polyoma viras, , BK viras (BKV), RNA phages, Ty, fr-phage, GA-phage, AP 205-phage and, in particular, Q ⁇ -phage.
- capsid proteins of Hepatitis B virus measles viras, Sindbis viras, rotavirus, foot-and-mouth-disease virus, Norwalk viras
- the retroviral GAG protein the retrotransposon Ty protein pi
- the surface protein of Hepatitis B viras human papillo
- the VLP of the invention is not limited to any specific form.
- the particle can be synthesized chemically or through a biological process, which can be natural or non-natural.
- this type of embodiment includes a virus-like particle or a recombinant form thereof.
- the VLP can comprise, or alternatively consist of, recombinant polypeptides of Rotavirus; recombinant polypeptides of Norwalk viras; recombinant polypeptides of Alphaviras; recombinant proteins which form bacterial pili or pilus like structures; recombinant polypeptides of Foot and Mouth Disease viras; recombinant polypeptides of measles viras, recombinant polypeptides of Sindbis virus, recombinant polypeptides of Retrovirus; recombinant polypeptides of Hepatitis B virus (e.g., a HBcAg); recombinant polypeptides of Tobacco mosaic virus; recombinant polypeptides of Flock House Viras; recombinant polypeptides of human Papillomavirus; recombinant polypeptides of Polyoma virus and, in particular, recombinant polypeptide
- the viras-like particle can further comprise, or alternatively consist of, one or more fragments of such polypeptides, as well as variants of such polypeptides. Variants of polypeptides can share, for example, at least 80%, 85%, 90%, 95%, 97%, or 99% identity at the amino acid level with their wild type counterparts.
- the viras-like particle comprises, consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of a RNA- phage.
- the RNA-phage is selected from the group consisting of a) bacteriophage Q ⁇ ; b) bacteriophage R17; c) bacteriophage fr; d) bacteriophage GA; e) bacteriophage SP; f) bacteriophage MS2; g) bacteriophage Ml 1; h) bacteriophage MX1; i) bacteriophage NL95; k) bacteriophage £2; 1) bacteriophage PP7; and m) bacteriophage AP205.
- the viras-like particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of the RNA-bacteriophage Q ⁇ or of the RNA- bacteriophage fr or of the RNA-bacteriophage AP205.
- the recombinant proteins comprise, or alternatively consist essentially of, or alternatively consist of coat proteins of RNA phages.
- RNA-phage coat proteins forming capsids or VLPs, or fragments of the bacteriophage coat proteins compatible with self-assembly into a capsid or a VLP are, therefore, further preferred embodiments of the present invention.
- Bacteriophage Q ⁇ coat proteins for example, can be expressed recombinantly in E. coli. Further, upon such expression these proteins spontaneously form capsids. Additionally, these capsids form a structure with an inherent repetitive organization.
- Specific preferred examples of bacteriophage coat proteins which can be used to prepare compositions of the invention include the coat proteins of RNA bacteriophages such as bacteriophage Q ⁇ (SEQ ID NO: 10; PIR Database, Accession No.
- VCBPQ ⁇ referring to Q ⁇ CP and SEQ ID NO: 11; Accession No. AAA16663 referring to Q ⁇ Al protein
- bacteriophage R17 PIR Accession No. VCBPR7
- bacteriophage fr SEQ ID NO:13; PIR Accession No. VCBPFR
- bacteriophage GA SEQ ID NO:14; GenBank Accession No. NP-040754
- bacteriophage SP GenBank Accession No. CAA30374 referring to SP CP and Accession No. NP_695026 referring to SP Al protein
- bacteriophage MS2 PIR Accession No. VCBPM2
- bacteriophage Ml 1 GenBank Accession No.
- bacteriophage MX1 GenBank Accession No. AAC14699
- bacteriophage NL95 GenBank Accession No. AAC14704
- bacteriophage f2 GenBank Accession No. P03611
- bacteriophage PP7 SEQ ID NO: 19
- bacteriophage AP205 SEQ ID NO: 31.
- Al protein of bacteriophage Q ⁇ or C-terminal truncated forms missing as much as 100, 150 or 180 amino acids from its C-terminus may be incorporated in a capsid assembly of Q ⁇ coat proteins.
- the percentage of Q ⁇ Al protein relative to Q ⁇ CP in the capsid assembly will be limited, in order to ensure capsid formation.
- bacteriophage coat proteins are described in WO 02/056905 on page 45 and 46 incorporated herein by way of reference.
- Further preferred viras-like particles of RNA-phages, in particular of Q ⁇ in accordance of this invention are disclosed in WO 02/056905, the disclosure of which is herewith incorporated by reference in its entirety.
- the virus-like particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of a RNA-phage, wherein the recombinant proteins comprise, consist essentially of or alternatively consist of mutant coat proteins of a RNA phage, preferably of mutant coat proteins of the RNA phages mentioned above.
- the mutant coat proteins of the RNA phage have been modified by removal of at least one lysine residue by way of substitution, or by addition of at least one lysine residue by way of substitution; alternatively, the mutant coat proteins of the RNA phage have been modified by deletion of at least one lysine residue, or by addition of at least one lysine residue by way of insertion.
- the deletion, substitution or addition of at least one lysine residue allows varying the degree of coupling, i.e. the amount of human melanoma MelanA peptide analogues per subunits of the VLP of the RNA-phages, in particular, to match and tailor the requirements of the vaccine.
- At least 1.0 human melanoma MelanA peptide analogue per subunit are linked to the VLP of the RNA-phage. This value is calculated as an average over all the subunits or monomers of the VLP of the RNA-phage.
- at least 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or at least 2.0 human melanoma MelanA peptide analogues are linked to the VLP of the RNA-phages as being calculated as a coupling average over all the subunits or monomers of the VLP of the RNA-phage.
- the viras-like particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of the RNA-bacteriophage Q ⁇ , wherein the recombinant proteins comprise, or alternatively consist essentially of, or alternatively consist of coat proteins having an amino acid sequence of SEQ ID NO: 10, or a mixture of coat proteins having amino acid sequences of SEQ ID NO: 10 and of SEQ ID NO: 11 or mutants of SEQ ID NO: 11 and wherein the N-terminal methionine is preferably cleaved.
- the virus-like particle comprises, consists essentially of or alternatively consists of recombinant proteins of Q ⁇ , or fragments thereof, wherein the recombinant proteins comprise, or alternatively consist essentially of, or alternatively consist of mutant Q ⁇ coat proteins.
- these mutant coat proteins have been modified by removal of at least one lysine residue- by way of substitution, or by addition of at least one lysine residue by way of substitution.
- these mutant coat proteins have been modified by deletion of at least one lysine residue, or by addition of at least one lysine residue by way of insertion.
- Q ⁇ mutants for which exposed lysine residues are replaced by arginines can also be used for the present invention.
- the following Q ⁇ coat protein mutants and mutant Q ⁇ VLPs can, thus, be used in the practice of the invention: "Q ⁇ -240" (Lys 13-Arg; SEQ ID NO:20), "Q ⁇ -243" (Asn 10-Lys; SEQ ID NO:21), "Q ⁇ -250” (Lys 2-Arg, Lysl3-Arg; SEQ ID NO:22), “Q ⁇ -251” (SEQ ID NO:23) and "Q ⁇ -259” (Lys 2-Arg, Lysl6-Arg; SEQ ID NO:24).
- the virus-like particle comprises, consists essentially of or alternatively consists of recombinant proteins of mutant Q ⁇ coat proteins, which comprise proteins having an amino acid sequence selected from the group of a) the amino acid sequence of SEQ ID NO: 20; b) the amino acid sequence of SEQ ID NO:21; c) the amino acid sequence of SEQ ID NO: 22; d) the amino acid sequence of SEQ ID NO:23; and e) the amino acid sequence of SEQ ID NO: 24.
- mutant Q ⁇ coat protein VLPs and capsids are disclosed in WO02/056905. In particular is hereby referred to Example 18 of above mentioned application.
- the viras-like particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins of Q ⁇ , or fragments thereof, wherein the recombinant proteins comprise, consist essentially of or alternatively consist of a mixture of either one of the foregoing Q ⁇ mutants and the corresponding Al protein.
- the viras-like particle comprises, or alternatively essentially consists of, or alternatively consists of recombinant proteins, or fragments thereof, of RNA-phage AP205.
- the AP205 genome consists of a maturation protein, a coat protein, a replicase and two open reading frames not present in related phages; a lysis gene and an open reading frame playing a role in the translation of the maturation gene (Klovins ., et al., J. Gen. Virol. 83: 1523-33 (2002)).
- AP205 coat protein can be expressed from plasmid ⁇ AP283- 58 (SEQ ID NO: 30), which is a derivative of pQblO (Kozlovska, T. M. et al, Gene 137:133-37 (1993)), and which contains an AP205 ribosomal binding site.
- AP205 coat protein may be cloned into pQbl85, downstream of the ribosomal binding site present in the vector. Both approaches lead to expression of the protein and formation of capsids as described in WO 04/007538 which is incorporated by reference in its entirety.
- Vectors pQblO and pQbl85 are vectors derived from pGEM vector, and expression of the cloned genes in these vectors is controlled by the trp promoter (Kozlovska, T. M. et al., Gene 137:133-37 (1993)).
- Plasmid pAP283-58 (SEQ ID NO:30) comprises a putative AP205 ribosomal binding site in the following sequence, which is downstream of the Xbal site, and immediately upstream of the ATG start codon of the AP205 coat protein: tctagaATTTTCTGCGCACCCAT CCCGGGTGGCGCCCAAAGTGAGGAAAATCACatg (bases 77-133 of SEQ ID NO: 30).
- the vector pQbl85 comprises a Shine Delagarno sequence downstream from the Xbal site and upstream of the start codon
- the virus-like particle comprises, or alternatively essentially consists of, or alternatively consists of recombinant coat proteins, or fragments thereof, of the RNA-phage AP205.
- This preferred embodiment of the present invention thus, comprises AP205 coat proteins that form capsids.
- Such proteins are recombinantly expressed, or prepared from natural sources.
- AP205 coat proteins produced in bacteria spontaneously form capsids, as evidenced by Electron Microscopy (EM) and immunodiffusion.
- EM Electron Microscopy
- SEQ ID NO: 31 The structural properties of the capsid formed by the AP205 coat protein (SEQ ID NO: 31) and those formed by the coat protein of the AP205 RNA phage are nearly indistinguishable when seen in EM.
- AP205 VLPs are highly immunogenic, and can be linked with antigens and/or antigenic determinants to generate vaccine constructs displaying the antigens and/or antigenic determinants oriented in a repetitive manner.
- the virus-like particle comprises, or alternatively essentially consists of, or alternatively consists of recombinant mutant coat proteins, or fragments thereof, of the RNA-phage AP205.
- Assembly-competent mutant forms of AP205 VLPs including AP205 coat protein with the subsitution of proline at amino acid 5 to threonine (SEQ ID NO: 32), may also be used in the practice of the invention and leads to a further preferred embodiment of the invention.
- AP205 P5-T mutant coat protein can be expressed from plasmid pAP281-32 (SEQ ID NO: 33), which is derived directly from pQbl 85, and which contains the mutant
- AP205 coat protein gene instead of the Q ⁇ coat protein gene.
- Vectors for expression of the AP205 coat protein are transfected into E. coli for expression of the AP205 coat protein.
- Suitable E. coli strains include, but are not limited to, E. coli K802, JM 109, RR1.
- Suitable vectors and strains and combinations thereof can be identified by testing expression of the coat protein and mutant coat protein, respectively, by SDS-PAGE and capsid formation and assembly by optionally first purifying the capsids by gel filtration and subsequently testing them in an immunodiffusion assay (Ouchterlony test) or Electron Microscopy (Kozlovska, T. M. et al. Gene 137:133-37 (1993)).
- AP205 coat proteins expressed from the vectors pAP283-58 and pAP281-32 may be devoid of the initial Methionine amino-acid, due to processing in the cytoplasm of E. coli. Cleaved, uncleaved forms of AP205 VLP, or mixtures thereof are further preferred embodiments of the invention.
- the virus-like particle comprises, or alternatively essentially consists of, or alternatively consists of a mixture of recombinant coat proteins, or fragments thereof, of the RNA-phage AP205 and of recombinant mutant coat proteins, or fragments thereof, of the RNA-phage AP205.
- the virus-like particle comprises, or alternatively essentially consists of, or alternatively consists of fragments of recombinant coat proteins or recombinant mutant coat proteins of the RNA-phage AP205.
- Recombinant AP205 coat protein fragments capable of assembling into a VLP and a capsid, respectively are also useful in the practice of the invention. These fragments may be generated by deletion, either internally or at the termini of the coat protein and mutant coat protein, respectively. Insertions in the coat protein and mutant coat protein sequence or fusions of antigen sequences to the coat protein and mutant coat protein sequence, and compatible with assembly into a VLP, are further embodiments of the invention and lead to chimeric AP205 coat proteins, and particles, respectively. The outcome of insertions, deletions and fusions to the coat protein sequence and whether it is compatible with assembly into a VLP can be determined by electron microscopy.
- the particles formed by the AP205 coat protein, coat protein fragments and chimeric coat proteins described above, can be isolated in pure form by a combination of fractionation steps by precipitation and of purification steps by gel filtration using e.g. Sepharose CL-4B, Sepharose CL-2B, Sepharose CL-6B columns and combinations thereof as described in WO 04/007538, which is incorporated by reference in its entirety.
- Other methods of isolating viras-like particles are known in the art, and may be used to isolate the viras-like particles (VLPs) of bacteriophage AP205.
- VLPs viras-like particles
- the use of ultracentrifugation to isolate VLPs of the yeast retrotransposon Ty is described in U.S. Patent No. 4,918,166, which is incorporated by reference herein in its entirety.
- the crystal stracture of several RNA bacteriophages has been determined
- modified RNA bacteriophages as well as variants of proteins and N- and C terminal truncation mutants which form capsids or capsid like structures, as well as methods for preparing such compositions and vaccine compositions, respectively, which are suitable for use in the present invention are described in WO 02/056905 on page 50, line 33 to page 52, line 29.
- the invention thus includes compositions and vaccine compositions prepared from proteins which form capsids or VLPs, methods for preparing these compositions from individual protein subunits and VLPs or capsids, methods for preparing these individual protein subunits, nucleic acid molecules which encode these subunits, and methods for vaccinating and/or eliciting immunological responses in individuals using these compositions of the present invention.
- the VLP's are free of a lipoprotein envelope or a lipoprotein-containing envelope.
- the VLP's are free of an envelope altogether.
- the lack of a lipoprotein envelope or lipoprotein-containing envelope and, in particular, the complete lack of an envelope leads to a more defined viras-like particle in its stracture and composition. Such more defined viras-like particles, therefore, may minimize side-effects.
- the lack of a lipoprotein-containing envelope or, in particular, the complete lack of an envelope avoids or minimizes incorporation of potentially toxic molecules and pyrogens within the viras-like particle.
- the invention provides a vaccine composition of the invention comprising a viras-like particle, wherein preferably said viras-like particle is a recombinant viras-like particle.
- the viras-like particle comprises, or alternatively consists essentially of, or alternatively consists of, recombinant proteins, or fragments thereof, of a RNA-phage, preferably of coat proteins of RNA phages.
- the recombinant proteins of the virus-like particle of the vaccine composition of the invention comprise, or alternatively consist essentially of, or alternatively consist of mutant coat proteins of RNA phages, wherein the RNA-phage is selected from the group consisting of: (a) bacteriophage Q(; (b) bacteriophage R17; (c) bacteriophage fr; (d) bacteriophage GA; (e) bacteriophage SP; (f) bacteriophage MS2; (g) bacteriophage Ml 1; (h) bacteriophage MX1; (i) bacteriophage NL95; (k) bacteriophage £; (1) bacteriophage PP7; and (m) bacteriophage AP205.
- the mutant coat proteins of said RNA phage have been modified by removal, or by addition of at least one lysine residue by way of substitution. In another preferred embodiment, the mutant coat proteins of said RNA phage have been modified by deletion of at least one lysine residue or by addition of at least one lysine residue by way of insertion.
- the virus-like particle comprises recombinant proteins or fragments thereof, of RNA-phage Q ⁇ , RNA-phage fr, or RNA- phage AP205.
- the invention includes viras-like particles or recombinant forms thereof. Skilled artisans have the knowledge to produce such particles and attach antigens thereto. Further preferred embodiments of the present invention hereto are disclosed in the Example Section.
- the virus-like particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of the BK viras (BKV), wherein the recombinant proteins comprise, or alternatively consist essentially of, or alternatively consist of proteins having an amino acid sequence of SEQ ID NO: 12.
- BK viras (BKV) is a non-enveloped double stranded DNA viras belonging to the polyoma virus subfamily of the papovaviridae.
- VP1 is the major capsid protein of BKV.
- VP1 has 362 amino acids (SEQ ID NO: 12, Gene Bank entry: AAA46882) and is 42 kDa in size.
- Virus-like particles as vaccines Berlin, September 26-29 (2001); Touze, A, et al, J Gen Virol. 82(Pt 12):3005-9 (2001).
- the capsid is organized in 72 VP1 pentamers forming an icosahedral stracture.
- the capsids have a diameter of approximately 45 ran.
- the particles used in compositions of the invention are composed of a Hepatitis B capsid (core) protein (HBcAg) or a fragment of a HBcAg which has been modified to either eliminate or reduce the number of free cysteine residues.
- core particles suitable for use in compositions of the invention include those comprising modified HBcAgs, or fragments thereof, in which one or more of the naturally resident cysteine residues have been either deleted or substituted with another amino acid residue (e.g., a serine residue).
- the HBcAg is a protein generated by the processing of a Hepatitis B core antigen precursor protein.
- a number of isotypes of the HBcAg have been identified and their amino acids sequences are readily available to those skilled in the art.
- the HBcAg protein having the amino acid sequence shown in SEQ ID NO: 16 is 185 amino acids in length and is generated by the processing of a 212 amino acid Hepatitis B core antigen precursor protein. This processing results in the removal of 29 amino acids from the N terminus of the Hepatitis B core antigen precursor protein.
- the HBcAg protein that is 185 amino acids in length is generated by the processing of a 214 amino acid Hepatitis B core antigen precursor protein.
- vaccine compositions of the invention will be prepared using the processed form of a HBcAg (i.e., a HBcAg from which the N terminal leader sequence of the Hepatitis B core antigen precursor protein have been removed).
- the HBcAgs when HBcAgs are produced under conditions where processing will not occur, the HBcAgs will generally be expressed in "processed" form.
- bacterial systems such as E. coli, generally do not remove the leader sequences, also referred to as "signal peptides," of proteins which are normally expressed in eukaryotic cells.
- leader sequences also referred to as “signal peptides”
- these proteins will generally be expressed such that the N terminal leader sequence of the Hepatitis B core antigen precursor protein is not present.
- Hepatitis B virus-like particles which can be used for the present invention, is disclosed, for example, in WO 00/32227, and hereby in particular in Examples 17 to 19 and 21 to 24, as well as in WO 01/85208, and hereby in particular in Examples 17 to 19, 21 to 24, 31 and 41, and in WO 02/056905.
- WO 00/32227 and hereby in particular in Examples 17 to 19 and 21 to 24, as well as in WO 01/85208, and hereby in particular in Examples 17 to 19, 21 to 24, 31 and 41, and in WO 02/056905.
- WO 02/056905 for the latter application, it is in particular referred to Example 23, 24, 31 and 51. All three documents are explicitly incorporated herein by reference.
- the present invention also includes HBcAg variants which have been modified to delete or substitute one or more additional cysteine residues.
- the vaccine compositions of the invention include compositions comprising HBcAgs in which cysteine residues not present in the amino acid sequence shown in SEQ ID NO: 16 have been deleted.
- HBcAgs in vaccine compositions which have been modified to remove naturally resident cysteine residues are attached would be reduced in number or eliminated altogether.
- a number of naturally occurring HBcAg variants suitable for use in the practice of the present invention have been identified. Yuan et al, (J. Virol. 73:10122 10128 (1999)), for example, describe variants in which the isoleucine residue at position corresponding to position 97 in SEQ ID NO:25 is replaced with either a leucine residue or a phenylalanine residue.
- the amino acid sequences of a number of HBcAg variants, as well as several Hepatitis B core antigen precursor variants, are disclosed in GenBank reports
- HBcAg variants differ in amino acid sequence at a number of positions, including amino acid residues which corresponds to the amino acid residues located at positions 12, 13, 21, 22, 24, 29, 32, 33, 35, 38, 40, 42, 44, 45, 49, 51, 57, 58, 59, 64, 66, 67, 69, 74, 77, 80, 81, 87, 92, 93, 97, 98, 100, 103, 105, 106, 109, 113, 116, 121, 126, 130, 133, 135, 141, 147, 149, 157, 176, 178, 182 and 183 in SEQ ID NO:28.
- HBcAg variants suitable for use in the compositions of the invention are described in WO 01/98333, WO 00/177158 and WO 00/214478.
- HBcAgs suitable for use in the present invention can be derived from any organism so long as they are able to enclose or to be coupled or otherwise attached to, in particular as long as they are capable of packaging, an unmethylated CpG-containing oligonucleotide and induce an immune response.
- HBcAgs As noted above, generally processed HBcAgs (i.e., those which lack leader sequences) will be used in the vaccine compositions of the invention.
- the present invention includes vaccine compositions, as well as methods for using these compositions, which employ the above described variant HBcAgs.
- HBcAg variants which are capable of associating to form dimeric or multimeric structures.
- the invention further includes vaccine compositions comprising HBcAg polypeptides comprising, or alternatively consisting of, amino acid sequences which are at least 80%, 85%), 90%, 95%, 97%) or 99%) identical to any of the wild-type amino acid sequences, and forms of these proteins which have been processed, where appropriate, to remove the N terminal leader sequence.
- the amino acid sequence of a polypeptide has an amino acid sequence that is at least 80%, 85%, 90%, 95%, 97% or 99% identical to one of the wild-type amino acid sequences, or a subportion thereof, can be determined conventionally using known computer programs such the Bestfit program.
- Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95%> identical to a reference amino acid sequence, the parameters are set such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
- amino acid sequences of the hereinabove mentioned HBcAg variants and precursors are relatively similar to each other.
- reference to an amino acid residue of a HBcAg variant located at a position which corresponds to a particular position in SEQ ID NO:28 refers to the amino acid residue which is present at that position in the amino acid sequence shown in SEQ ID NO:28.
- the homology between these HBcAg variants is for the most part high enough among Hepatitis B viruses that infect mammals so that one skilled in the art would have little difficulty reviewing both the amino acid sequence shown in SEQ ID NO:28, and that of a particular HBcAg variant and identifying "corresponding" amino acid residues.
- the HBcAg amino acid sequence shown in SEQ ID NO:27 which shows the amino acid sequence of a HBcAg derived from a virus which infect woodchucks, has enough homology to the HBcAg having the amino acid sequence shown in SEQ ID NO:28 that it is readily apparent that a three amino acid residue insert is present in SEQ ID NO:27 between amino acid residues 155 and l56 of SEQ ID NO:28.
- the invention also includes vaccine compositions which comprise HBcAg variants of Hepatitis B viruses which infect birds, as wells as vaccine compositions which comprise fragments of these HBcAg variants.
- one, two, three or more of the cysteine residues naturally present in these polypeptides could be either substituted with another amino acid residue or deleted prior to their inclusion in vaccine compositions of the invention.
- cysteine residues of the Hepatitis B viras capsid protein have been either deleted or substituted with another amino acid residue.
- Expression and purification of an HBcAg- Lys variant has been described in Example 24 of WO 02/056905 and the constraction of a HBcAg devoid of free cysteine residues and containing an inserted lysine residue has been described in Example 31 of WO 02/056905.
- compositions and vaccine compositions, respectively, of the invention will contain HBcAgs from which the C terminal region (e.g., amino acid residues 145 185 or 150 185 of SEQ ID NO: 28) has been removed.
- additional modified HBcAgs suitable for use in the practice of the present invention include C terminal truncation mutants. Suitable truncation mutants include HBcAgs where 1, 5, 10, 15, 20, 25, 30, 34, 35, amino acids have been removed from the C terminus.
- HBcAgs suitable for use in the practice of the present invention also include N terminal truncation mutants. Suitable truncation mutants include modified HBcAgs where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N terminus. Further HBcAgs suitable for use in the practice of the present invention include N and C terminal truncation mutants. Suitable truncation mutants include HBcAgs where 1, 2, 5, 7, 9, 10, 12, 14, 15, and 17 amino acids have been removed from the N terminus and 1, 5, 10, 15, 20, 25, 30, 34, 35 amino acids have been removed from the C terminus.
- the invention further includes compositions and vaccine compositions, respectively, comprising HBcAg polypeptides comprising, or alternatively essentially consisting of, or alternatively consisting of, amino acid sequences which are at least 80%, 85%, 90%, 95%, 97%, or 99% identical to the above described truncation mutants.
- a lysine residue is introduced into a HBcAg polypeptide, to mediate the binding of the MelanA peptide analogue of the invention to the VLP of HBcAg.
- compositions of the invention are prepared using a HBcAg comprising, or alternatively consisting of, amino acids 1- 144, or 1-149, 1-185 of SEQ ID NO:28, which is modified so that the amino acids corresponding to positions 79 and 80 are replaced with a peptide having the amino acid sequence of Gly-Gly-Lys-Gly-Gly (SEQ ID NO: 18) resulting in the HBcAg polypeptide having the sequence shown in SEQ ID NO:29).
- SEQ ID NO: 18 amino acid sequence of Gly-Gly-Lys-Gly-Gly
- the invention further includes compositions comprising the corresponding polypeptides having amino acid sequences shown in any of the hereinabove mentioned Hepatitis B core antigen precursor variants, which also have above noted amino acid alterations. Further included within the scope of the invention are additional HBcAg variants which are capable of associating to form a capsid or VLP and have the above noted amino acid alterations.
- compositions and vaccine compositions comprising HBcAg polypeptides which comprise, or alternatively consist of, amino acid sequences which are at least 80%>, 85%o, 90%), 95%), 97%> or 99%> identical to any of the wild-type amino acid sequences, and forms of these proteins which have been processed, where appropriate, to remove the N terminal leader sequence and modified with above noted alterations.
- Compositions or vaccine compositions of the invention may comprise mixtures of different HBcAgs.
- these vaccine compositions may be composed of HBcAgs which differ in amino acid sequence.
- vaccine compositions could be prepared comprising a "wild type" HBcAg and a modified HBcAg in which one or more amino acid residues have been altered (e.g., deleted, inserted or substituted).
- preferred vaccine compositions of the invention are those which present highly ordered and repetitive antigen arrays, wherein the antigen is a human melanoma MelanA peptide analog.
- the invention is partly based on the surprising finding that immunostimulatory substances, preferably immunostimulatory nucleic acids and even more preferably DNA oligonucleotides or alternatively poly (I:C) can be packaged into VLPs.
- the nucleic acids present in VLPs can be replaced specifically by the immunostimulatory substances, preferably by the immunostimulatory nucleic acids and even more preferably by the DNA-oligonucleotides containing CpG motifs or poly (I:C).
- the CpG- VLPs are more immunogenic and elicit more specific effects than their CpG-free counterparts and induce enhanced B and T cell responses.
- the immune response against antigens coupled, fused or attached otherwise to the VLPs is similarly enhanced as the immune response against the VLP itself.
- the T cell responses against both the VLPs and antigens are especially directed to the Thl type.
- the packaged nucleic acids and CpGs, respectively are protected from degradation, i.e., they are more stable. Moreover, non-specific activation of cells from the innate immune system is dramatically reduced.
- the innate immune system has the capacity to recognize invariant molecular pattern shared by microbial pathogens. Recent studies have revealed that this recognition is a crucial step in inducing effective immune responses.
- the main mechanism by which microbial products augment immune responses is to stimulate APC, expecially dendritic cells to produce proinflammatory cytokines and to express high levels costimulatory molecules for T cells. These activated dendritic cells subsequently initiate primary T cell responses and dictate the type of T cell-mediated effector function.
- RNA synthesized by various types of viruses represent important members of the microbial components that enhance immune responses.
- Synthetic double stranded (ds) RNA such as polyinosinic-polycytidylic acid (poly I:C) are capable of inducing dendritic cells to produce proinflammatory cytokines and to express high levels of costimulatory molecules.
- Preferred ribonucleic acid encompass polyinosinic-polycytidylic acid double- stranded RNA (poly I:C). Ribonucleic acids and modifications thereof as well as methods for their production have been described by Levy, H.B (Methods Enzymol. 1981, 78:242- 251), DeClercq, E (Methods Enzymol. 1981,78:227-236) and Torrence, P.F. (Methods Enzymol 1981;78:326-331) and references therein.
- ribonucleic acids comprise polynucleotides of inosinic acid and cytidiylic acid such poly (IC) of which two strands forms double stranded RNA.
- Ribonucleic acids can be isolated from organisms. Ribonucleic acids also encompass further synthetic ribonucleic acids, in particular synthetic poly (I:C) oligonucleotides that have been rendered nuclease resistant by modification of the phosphodiester backbone, in particular by phosphorothioate modifications. In a further embodiment the ribose backbone of poly (I:C) is replaced by a deoxyribose. Those skilled in the art know procedures how to synthesize synthetic oligonucleotides.
- TLR active toll-like receptors
- TLR2 is activated by peptidoglycans, lipoproteins, lipopolysacchrides, lipoteichonic acid and Zymosan, and macrophage-activating lipopeptide MALP-2
- TLR3 is activated by double-stranded RNA such as poly (I:C)
- TLR4 is activated by lipopolysaccharide, lipoteichoic acids and taxol and heat-shock proteins such as heat shock protein HSP-60 and Gp96
- TLR5 is activated by bacterial flagella, especially the flagellin protein
- TLR6 is activated by peptidoglycans
- TLR7 is activated by imiquimoid and imidazoquinoline compounds, such as R-848, loxoribine and bropirimine
- TLR9 is activated by a ligands.
- TLR2 is activated by peptidoglycans, lipoproteins, lipopoly
- the unmethylated CpG-containing oligonucleotide comprises the sequence:
- the oligonucleotide can comprise about 6 to about 100,000 nucleotides, preferably about 6 to about 2000 nucleotides, more preferably about 20 to about 2000 nucleotides, and even more preferably comprises about 20 to about 300 nucleotides.
- the oligonucleotide can comprise more than 100 to about 2000 nucleotides, preferably more than 100 to about 1000 nucleotides, and more preferably more than 100 to about 500 nucleotides.
- the CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone.
- a CpG- containing oligonucleotide having one or more phosphate backbone modifications or having all of the phosphate backbone modified and a CpG-containing oligonucleotide wherein one, some or all of the nucleotide phosphate backbone modifications are phosphorothioate modifications are included within the scope of the present invention.
- at least one of the nucleotide XI, X2, X3, and X4 has a phosphate backbone modification.
- the immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, wherein said unmethylated CpG-containing oligonucleotide has a nucleic acid sequence selected from the group consisting of (a) GGGGACGATCGTCGGGGGG ((SEQ ID NO: 2); and typically abbreviated herein as G3-6), (b) GGGGGACGATCGTCGGGGGG ((SEQ ID NO: 3); and typically abbreviated herein as G4-6), (c) GGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 4); and typically abbreviated herein as G5-6), (d) GGGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 5); and typically abbreviated herein as G6-6), (e) GGGGGGGGACGATCGTCGGGGGGG ((SEQ ID NO: 6); and typically abbreviated herein as G7-7), (f)
- GGGGGGGGGACGATCGTCGGGGGGGG ((SEQ ID NO: 7); and typically abbreviated herein as G8-8), (g) GGGGGGGGGGACGATCGTCGGGGGGGGG ((SEQ ID NO: 8); and typically abbreviated herein as G9-9), (h)
- GGGGGGCGACGACGATCGTCGTCGGGGGGG ((SEQ ID NO: 9); and typically abbreviated herein as G6), (i) tccatgacgttcctgaataat ((SEQ ID NO: 34); and typically abbreviated herein as CyCpGpt), (j) TCCATGACGTTCCTGAATAAT ((SEQ ID NO: 35); and typically abbreviated herein CyCpG), (k) tccatgacgttcctgacgtt ((SEQ ID NO: 36); and typically abbreviated herein as B-CpGpt), (1) TCCATGACGTTCCTGACGTT ((SEQ ID NO: 37); and typically abbreviated herein as B-CpG), (m) ggggtcaacgttgaggggg ((SEQ ID NO: 38); and typically abbreviated herein as NKCpGpt), (n) GGGGTCAA
- the immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, wherein said unmethylated CpG-containing oligonucleotide has a nucleic acid sequence of GGGGGGGGGGGACGATCGTCGGGGGGGGGG ((SEQ ID NO: 41); and typically abbreviated herein as gl Ogacga-PO or Gl 0-PO).
- the CpG-containing oligonucleotide can also be recombinant, genomic, synthetic, cDNA, plasmid-derived and single or double stranded.
- the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. For example, the ⁇ -cyanoethyl phosphoramidite method (Beaucage, S. L, and Carathers, M. H, Tet. Let. 22:1859 (1981); nucleoside H-phosphonate method (Garegg et al, Tet. Let. 27:4051-4054 (1986); Froehler et al, Nucl. Acid. Res.
- CpGs can be produced on a large scale in plasmids, (see Sambrook, T, et al, "Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor laboratory Press, New York, 1989) which after being administered to a subject are degraded into oligonucleotides.
- Oligonucleotides can be prepared from existing nucleic acid sequences (e.g., genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
- the immunostimulatory substances, the immunostimulatory nucleic acids as well as the unmethylated CpG-containing oligonucleotide can be bound to the VLP by any way known is the art provided the composition enhances an immune response in an animal.
- the oligonucleotide can be bound either covalently or non- covalently.
- the VLP can enclose, fully or partially, the immunostimulatory substances, the immunostimulatory nucleic acids as well as the unmethylated CpG- containing oligonucleotide.
- the immunostimulatory nucleic acid as well as the unmethylated CpG-containing oligonucleotide can be bound to a VLP site such as an oligonucleotide binding site (either naturally or non-naturally occurring), a DNA binding site or a RNA binding site.
- the VLP site comprises an arginine- rich repeat or a lysine-rich repeat.
- compositions of the invention are to activate dendritic cells for the purpose of enhancing a specific immune response against antigens.
- the immune response can be enhanced using ex vivo or in vivo techniques.
- the ex vivo procedure can be used on autologous or heterologous cells, but is preferably used on autologous cells.
- the dendritic cells are isolated from peripheral blood or bone marrow, but can be isolated from any source of dendritic cells.
- Ex vivo manipulation of dendritic cells for the purposes of cancer immunotherapy have been described in several references in the art, including Engleman, E. G, Cytotechnology 25:1 (1997); Van Schooten, W, et al. Molecular Medicine Today, June, 255 (1997); Steinman, R. M, Experimental Hematology 24:849 (1996); and Gluckman, J. C, Cytokines, Cellular and Molecular Therapy 3:187 (1997).
- the dendritic cells can also be contacted with the inventive compositions using in vivo methods.
- the CpGs are administered in combination with the VLP optionally coupled, fused or otherwise attached to an antigen directly to a subject in need of immunotherapy.
- the VLPs/CpGs be administered in the local region of the tumor, which can be accomplished in any way known in the art, e.g., direct injection into the tumor.
- a preferred embodiment of the present invention is to provide a composition for enhancing an immune response in an animal comprising (a) a viras-like particle; (b) at least one immunostimulatory substance; and (c) at least one antigen or antigenic determinant; wherein said antigen or said antigenic determinant is bound to said virus-like particle and wherein said antigen comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA peptide analogue, and wherein said immunostimulatory substance is bound to said virus-like particle, and wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence, wherein said palindromic sequence is GACGATCGTC (SEQ ID NO: 1), and wherein said palindromic sequence is flanked at its 3 '-terminus and at its 5
- the inventive immunostimulatory substances i.e. the unmethylated CpG-containing oligonucleotides, wherein the CpG motif of said unmethylated CpG- containing oligonucleotides are part of a palindromic sequence, wherein the palindromic sequence is GACGATCGTC (SEQ ID NO: 1), and wherein the palindromic sequence is flanked at its 3 '-terminus and at its 5 '-terminus by more than two and less than 11 guanosine entities, more preferably by 8-10 guanosine entities, or most preferably by 10 guanosine entities, are, in particular, effective at stimulating immune cells in vitro.
- the palindromic sequence comprises, or alternatively consist essentially of, or alternatively consists of or is GACGATCGTC (SEQ ID NO: 1), wherein said palindromic sequence is flanked at its 5'- terminus by at least 3 and at most 10 guanosine entities and wherein said palindromic sequence is flanked at its 3 '-terminus by at least 6 and at most 10 guanosine entities.
- the palindromic sequence is flanked at its 5 '-terminus by at least 3 and at most 10 guanosine entities and wherein said palindromic sequence is flanked at its 3 '-terminus by at least 6 and at most 10 guanosine entities.
- the immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence, wherein said unmethylated CpG-containing oligonucleotide has a nucleic acid sequence selected from (a) GGGGACGATCGTCGGGGGG ((SEQ ID NO: 2); and typically abbreviated herein as G3-6), (b) GGGGGACGATCGTCGGGGGG ((SEQ ID NO: 3); and typically abbreviated herein as G4-6), (c) GGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 4); and typically abbreviated herein as G5-6), (d) GGGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 5); and typically abbreviated herein as G6-6), (e) GGGGGGGGACGATC
- GGGGGGGGGACGATCGTCGGGGGGGG ((SEQ ID NO: 7); and typically abbreviated herein as G8-8), (g) GGGGGGGGGGACGATCGTCGGGGGGGGG ((SEQ ID NO: 8); and typically abbreviated herein as G9-9), (h) GGGGGGCGACGACGATCGTCGTCGGGGGGG ((SEQ ID NO: 9); and typically abbreviated herein as G6), and (i) GGGGGGGGGGGACGATCGTCGGGGGGGGGG ((SEQ ID NO: 41); and typically abbreviated herein as G10-PO).
- the immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence, wherein said palindromic sequence is GACGATCGTC (SEQ ID NO: 1), and wherein said palindromic sequence is flanked at its 5 '-terminus by at least 4 and at most 10 guanosine entities and wherein said palindromic sequence is flanked at its 3 '-terminus by at least 6 and at most 10 guanosine entities.
- the immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence, wherein said unmethylated CpG-containing oligonucleotide has a nucleic acid sequence selected from (a) GGGGGACGATCGTCGGGGGG ((SEQ ID NO: 3); and typically abbreviated herein as G4-6), (b) GGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 4); and typically abbreviated herein as G5-6), (c) GGGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 5); and typically abbreviated herein as G6-6), (d)
- GGGGGGGGACGATCGTCGGGGGGGGG ((SEQ ID NO: 6); and typically abbreviated herein as G7-7), (e) GGGGGGGGGACGATCGTCGGGGGGGG ((SEQ ID NO: 7); and typically abbreviated herein as G8-8), (f) GGGGGGGGGGACGATCGTCGGGGGGGGG ((SEQ ID NO: 8); and typically abbreviated herein as G9-9); and (g) GGGGGGGGGGGACGATCGTCGGGGGGGGGG ((SEQ ID NO: 41); and typically abbreviated herein as G10-PO).
- the immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence, wherein said palindromic sequence is GACGATCGTC (SEQ ID NO: 1), and wherein said palindromic sequence is flanked at its 5 '-terminus by at least 5 and at most 8 guanosine entities and wherein said palindromic sequence is flanked at its 3 '-terminus by at least 6 and at most 10 guanosine entities.
- the experimental data show that the ease of packaging of the preferred inventive immunostimulatory substances, i.e. the guanosine flanked, palindromic and unmethylated CpG-containing oligonucleotides, wherein the palindromic sequence is GACGATCGTC (SEQ ID NO: 1), and wherein the palindromic sequence is flanked at its 3'-terminus and at its 5 '-terminus by less than 11 or less than 10 guanosine entities, into VLP's increases if the palindromic sequences are flanked by fewer guanosine entities.
- decreasing the number of guanosine entities flanking the palindromic sequences leads to a decrease of stimulating blood cells in vitro.
- packagability is paid by decreased biological activity of the indicated inventive immunostimulatory substances.
- the present preferred embodiments represent, thus, a compromise between packagability and biological activity.
- the immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence, wherein said unmethylated CpG-containing oligonucleotide has a nucleic acid sequence selected from (a) GGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 4); and typically abbreviated herein as G5-6), (b) GGGGGGGACGATCGTCGGGGGG ((SEQ ID NO: 5); and typically abbreviated herein as G6-6), (c) GGGGGGGGGGACGATCGTCGGGGGGG ((SEQ ID NO: 6); and typically abbreviated herein as G7-7), (d)
- GGGGGGGGGACGATCGTCGGGGGGGG ((SEQ ID NO: 7); and typically abbreviated herein as G8-8); and (e) GGGGGGGGGGGACGATCGTCGGGGGGGGGG ((SEQ ID NO: 41); and typically abbreviated herein as G10-PO).
- the immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence, wherein said unmethylated has the nucleic acid sequence of SEQ ID NO: 7, i.e.the immunostimulatory substance is G8-8, or of SEQ ID NO: 41, i.e. G10-PO.
- the immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence, wherein said unmethylated has the nucleic acid sequence of SEQ ID NO: 41, i.e.the immunostimulatory substance is G10-PO.
- the present invention provides a composition for enhancing an immune response in an animal comprising (a) a virus-like particle; (b) at least one immunostimulatory substance; and (c) at least one antigen or antigenic determinant; wherein said antigen is bound to said viras- like particle and wherein said antigen comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA peptide analogue, and wherein said immunostimulatory substance is bound to said virus-like particle, and wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide, wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence, wherein said palindromic sequence is GACGATCGTC (SEQ ID NO: 1), and wherein said palindromic sequence is flanked at its 3'-terminus and at its 5'- terminus by 10
- the optimal sequence used to package into VLPs is a compromise between packagability and biological activity.
- the G8-8 immunostimulatoy substance is a preferred, and the G10-PO immunostimulatory substance a very preferred embodiment of the present invention since they are biologically highly active while still reasonably well packaged.
- the inventive composition further comprise a human melanoma MelanA peptide analogue of the invention bound to the virus-like particle.
- the at least one MelanA peptide analogue is fused to the viras-like particle.
- a VLP is typically composed of at least one subunit assembling into a VLP.
- the MelanA peptide analogue is fused to at least one subunit of the viras-like particle or of a protein capable of being incorporated into a VLP generating a chimeric VLP-subunit-antigen fusion.
- Fusion of the MelanA peptide analogue can be effected by insertion into the VLP subunit sequence, or by fusion to either the N- or C-terminus of the VLP-subunit or protein capable of being incorporated into a VLP.
- fusion proteins of a peptide to a VLP subunit the fusion to either ends of the subunit sequence or internal insertion of the peptide within the subunit sequence are encompassed.
- Fusion may also be effected by inserting MelanA peptide analogue sequences into a variant of a VLP subunit where part of the subunit sequence has been deleted, that are further referred to as truncation mutants.
- Trancation mutants may have N- or C-terminal, or internal deletions of part of the sequence of the VLP subunit.
- the specific VLP HBcAg with, for example, deletion of amino acid residues 79 to 81 is a truncation mutant with an internal deletion. Fusion of antigens or antigenic determinants to either the N- or C-terminus of the truncation mutants VLP-subunits also lead to embodiments of the invention.
- fusion of an epitope into the sequence of the VLP subunit may also be effected by substitution, where for example for the specific VLP HBcAg, amino acids 79-81 are replaced with a foreign epitope.
- fusion as referred to hereinafter, may be effected by insertion of the MelanA peptide analogue sequence in the sequence of a VLP subunit, by substitution of part of the sequence of the VLP subunit with the MelanA peptide analogue, or by a combination of deletion, substitution or insertions.
- the chimeric MelanA peptide analogue -VLP subunit will be in general capable of self-assembly into a VLP.
- VLP displaying epitopes fused to their subunits are also herein referred to as chimeric VLPs.
- the viras-like particle comprises or alternatively is composed of at least one VLP subunit.
- the viras-like particle comprises or alternatively is composed of a mixture of chimeric VLP subunits and non-chimeric VLP subunits, i.e. VLP subunits not having an antigen fused thereto, leading to so called mosaic particles. This may be advantageous to ensure formation of, and assembly to a VLP.
- the proportion of chimeric VLP-subunits may be 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95% or higher.
- Flanking amino acid residues may be added to either end of the sequence of the peptide or epitope to be fused to either end of the sequence of the subunit of a VLP, or for internal insertion of such peptidic sequence into the sequence of the subunit of a VLP.
- Glycine and serine residues are particularly favored amino acids to be used in the flanking sequences added to the peptide to be fused. Glycine residues confer additional flexibility, which may diminish the potentially destabilizing effect of fusing a foreign sequence into the sequence of a VLP subunit.
- the VLP is a Hepatitis B core antigen VLP.
- Fusion proteins to either the N-terminus of a HBcAg (Neyrinck, S. et al. Nature Med. 5:1157-1163 (1999)) or insertions in the so called major immunodominant region (MIR) have been described (Pumpens, P. and Grens, E, Intervirology 44:98-114 (2001)), WO 01/98333), and are preferred embodiments of the invention.
- MIR major immunodominant region
- HBcAg contains a long arginine tail (Pumpens, P. and Grens, E, Intervirology 44:98-114 (2001)) which is dispensable for capsid assembly and capable of binding nucleic acids (Pumpens, P. and Grens, E, Intervirology 44:98-114 (2001)).
- HBcAg either comprising or lacking this arginine tail are both embodiments of the invention.
- the VLP is a VLP of a RNA phage.
- the major coat proteins of RNA phages spontaneously assemble into VLPs upon expression in bacteria, and in particular in E. coli.
- Specific examples of bacteriophage coat proteins which can be used to prepare compositions of the invention include the coat proteins of RNA bacteriophages such as bacteriophage Q ⁇ (SEQ ID NO:10; PIR Database, Accession No. VCBPQ ⁇ referring to Q ⁇ CP and SEQ ID NO: 11; Accession No. AAA16663 referring to Q ⁇ Al protein) and bacteriophage fr (SEQ ID NO: 13; PIR Accession No. VCBPFR).
- the at least one MelanA peptide analogue is fused to a Q ⁇ coat protein.
- Fusion protein constructs wherein epitopes have been fused to the C-terminus of a truncated form of the Al protein of Q ⁇ , or inserted within the Al protein have been described (Kozlovska, T. M, et al, Intervirology, 39:9-15 (1996)).
- the Al protein is generated by suppression at the UGA stop codon and has a length of 329 aa, or 328 aa, if the cleavage of the N-terminal methionine is taken into account.
- embodiments comprising viras-like particles, and hereby in particular the VLPs of the RNA phage Q ⁇ coat protein, which are exclusively composed of VLP subunits having at least one MelanA peptide analogue fused thereto, are also within the scope of the present invention.
- the production of mosaic particles may be effected in a number of ways. Kozlovska et al, Intervirology, 39:9-15 (1996), describe three methods, which all can be used in the practice of the invention.
- efficient display of the fused epitope on the VLPs is mediated by the expression of the plasmid encoding the Q ⁇ Al protein fusion having a UGA stop codon between CP and CP extension in a E. coli strain harboring a plasmid encoding a cloned UGA suppressor tRNA which leads to translation of the UGA codon into Trp (pISM3001 plasmid (Smiley B.K, et al. Gene 134:33-40 (1993))).
- the CP gene stop codon is modified into UAA, and a second plasmid expressing the Al protein-antigen fusion is cotransformed.
- the second plasmid encodes a different antibiotic resistance and the origin of replication is compatible with the first plasmid (Kozlovska, T. M, et al, Intervirology 39:9-15 (1996)).
- CP and the Al protein-antigen fusion are encoded in a bicistronic manner, operatively linked to a promoter such as the Trp promoter, as described in Figure 1 of Kozlovska et al, Intervirology, 39:9-15 (1996).
- the MelanA peptide analogue is inserted between amino acid 2 and 3 (numbering of the cleaved CP, that is wherein the N-terminal methionine is cleaved) of the fr CP, thus leading to an MelanA peptide analogue -fr CP fusion protein.
- Vectors and expression systems for constraction and expression of fr CP fusion proteins self-assembling to VLP and useful in the practice of the invention have been described (Pushko P. et al, Prot. Eng. 6:883-891 (1993)).
- the MelanA peptide analogue sequence is inserted into a deletion variant of the fr CP after amino acid 2, wherein residues 3 and 4 of the fr CP have been deleted. Fusion of epitopes in the N-terminal protuberant ⁇ -hairpin of the coat protein of RNA phage MS-2 and subsequent presentation of the fused epitope on the self-assembled VLP of RNA phage MS-2 has also been described (WO 92/13081), and fusion of the MelanA peptide analogue of the invention by insertion or substitution into the coat protein of MS-2 RNA phage is also falling under the scope of the invention.
- the MelanA peptide analogues of the invention is fused to a capsid protein of papillomavirus.
- the MelanA peptide analogues of the invention is fused to the major capsid protein LI of bovine papillomavirus type 1 (BPV-1).
- BPV-1 bovine papillomavirus type 1
- Purification of the assembled particles displaying the fused MelanA peptide analogues of the invention can be performed in a number of ways, such as for example gel filtration or sucrose gradient ultracentrifugation (Chackerian, B. et al, Proc. Natl. Acad. Sci.USA 96:2373-2378 (1999), WO 00/23955).
- the MelanA peptide analogues of the invention are fused to a Ty protein capable of being incorporated into a Ty VLP.
- the MelanA peptide analogues of the invention are fused to the pi or capsid protein encoded by the TYA gene (Roth, J.F, Yeast 16:785-795 (2000)).
- the yeast retrofransposons Tyl, 2, 3 and 4 have been isolated from Saccharomyces Serevisiae, while the retrotransposon Tfl has been isolated from Schizosaccharomyces Pombae (Boeke, J.D.
- the retrotransposons Tyl and 2 are related to the copia class of plant and animal elements, while Ty3 belongs to the gypsy family of retrotransposons, which is related to plants and animal retroviruses.
- the pi protein also referred to as Gag or capsid protein, has a length of 440 amino acids.
- PI is cleaved during maturation of the VLP at position 408, leading to the p2 protein, the essential component of the VLP.
- a MelanA peptide analogue of the invention may be fused to pi by inserting a sequence coding for the MelanA peptide analogue into the BamHl site of the pMA5620 plasmid.
- the cloning of sequences coding for foreign epitopes into the pMA5620 vector leads to expression of fusion proteins comprising amino acids 1-381 of pi of Tyl -15, fused C-terminally to the N-terminus of the foreign epitope.
- N-terminal fusion of a MelanA peptide analogues of the invention or internal insertion into the pi sequence, or substitution of part of the pi sequence are also meant to fall within the scope of the invention.
- insertion of MelanA peptide analogues of the invention into the Ty sequence between amino acids 30-31, 67-68, 113-114 and 132-133 of the Ty protein pi leads to preferred embodiments of the invention.
- VLPs suitable for fusion of MelanA or MelanA peptide analogues of the invention are, for example, Retrovirus-like-particles (WO9630523), HIV2 Gag (Kang, Y.C, et al, Biol. Chem.
- chimeric VLPs suitable for the practice of the invention are also those described in Intervirology 39:1 (1996).
- VLPs contemplated for use in the invention are: HPV-1, HPV-6, HPV-11, HPV-16, HPV-18, HPV-33, HPV-45, CRPV, COPV, HIV GAG, Tobacco Mosaic Viras. Viras-like particles of SV-40, Polyomaviras, Adenovirus, Herpes Simplex Virus, Rotavirus and Norwalk viras have also been made, and chimeric VLPs of those VLPs are also within the scope of the present invention.
- antigens fused to the viras-like particle by insertion within the sequence of the virus-like particle building monomer are also within the scope of the present invention.
- antigens can be inserted in a form of the viras-like particle building monomer containing deletions.
- the viras- like particle building monomer may not be able to form virus-like structures in the absence of the inserted antigen.
- recombinant DNA technology can be utilized to fuse a heterologous protein to a VLP protein (Kratz, P.A, et al, Proc. Natl. Acad. Sci. USA 96:1915 (1999)).
- the present invention encompasses VLPs recombinantly fused or chemically conjugated (including both covalently and non covalently conjugations) to an antigen (or portion thereof, preferably at least 10, 20 or 50 amino acids) of the present invention to generate fusion proteins or conjugates.
- the fusion does not necessarily need to be direct, but can occur through linker sequences.
- linker sequences are typically added at one or both ends of the epitopes.
- linker sequences preferably comprise sequences recognized by the proteasome, proteases of the endosomes or other vesicular compartment of the cell.
- a peptide bond in which the conjugate can be a contiguous polypeptide, i.e. a fusion protein.
- a fusion protein according to the present invention, different peptides or polypeptides are linked in frame to each other to form a contiguous polypeptide.
- a first portion of the fusion protein comprises an antigen or immunogen and a second portion of the fusion protein, either N-terminal or C-terminal to the first portion, comprises a VLP.
- internal insertion into the VLP with optional linking sequences on both ends of the antigen, can also be used in accordance with the present invention.
- HBcAg When HBcAg is used as the VLP, it is preferred that the antigen is linked to the C- terminal end of the HBcAg particle.
- the hepatitis B core antigen (HBcAg) exhibiting a C- terminal fusion of the MHC class I restricted peptide p33 derived from lymphocytic choriomeningitis virus (LCMV) glycoprotein can be and was typically used as a model antigen (HBcAg-p33).
- the 185 amino acids long wild type HBc protein assembles into highly structured particles composed of 180 subunits assuming icosahedral geometry.
- a flexible linker sequence e.g. a polyglycine/polyserine-containing sequence such as [Gly4 Ser]2 (Huston et al, Meth. Enzymol 203:46-88 (1991)
- the fusion protein can be constructed to contain an "epitope tag", which allows the fusion protein to bind an antibody (e.g. monoclonal antibody) for example for labeling or purification purposes.
- an epitope tag is a Glu-Glu-Phe tripeptide which is recognized by the monoclonal antibody YL1/2.
- the invention also relates to the chimeric DNA which contains a sequence coding for the VLP and a sequence coding for the MelanA peptide analogue.
- the DNA can be expressed, for example, in insect cells transformed with Baculovirases, in yeast or in bacteria. There are no restrictions regarding the expression system, of which a large selection is available for routine use. Preferably, a system is used which allows expression of the proteins in large amounts. In general, bacterial expression systems are preferred on account of their efficiency.
- a bacterial expression system suitable for use within the scope of the present invention is the one described by Clarke et al, J. Gen.
- the antigen to which an enhanced immune response is desired is coupled, fused or otherwise attached in frame to the Hepatitis B viras capsid (core) protein (HBcAg).
- core Hepatitis B viras capsid
- HcAg Hepatitis B viras capsid
- the at least one MelanA peptide analogue is bound to the viras-like particle by at least one covalent bond.
- the least one MelanA peptide analogue is bound to the viras-like particle by at least one covalent bond, said covalent bond being a non-peptide bond leading to an ordered and repetitive array and a MelanA peptide analogue -VLP conjugate, respectively.
- This MelanA peptide analogue array and conjugate, respectively has typically and preferably a repetitive and ordered stracture since the at least one MelanA peptide analogue is bound to the VLP in an oriented manner.
- MelanA-peptides of the invention are bound to the VLP.
- the formation of a repetitive and ordered MelanA peptide analogue - VLP array and conjugate, respectively, is ensured by an oriented and directed as well as defined binding and attachment, respectively, of the at least one MelanA peptide analogue to the VLP as will become apparent in the following.
- the typical inherent highly repetitive and organized stracture of the VLPs advantageously contributes to the display of the MelanA peptide analogue in a highly ordered and repetitive fashion leading to a highly organized and repetitive MelanA peptide analogue -VLP array and conjugate, respectively.
- the preferred inventive conjugates and arrays differ from prior art conjugates in their highly organized structure, dimensions, and in the repetitiveness of the antigen on the surface of the array.
- the preferred embodiment of this invention furthermore, allows expression of the particle in an expression host guaranteeing proper folding and assembly of the VLP, to which the antigen, i.e. the at least one MelanA peptide analogue of the invention, is then further coupled
- the present invention discloses methods of binding or association of MelanA peptide analogue of the invention to VLPs.
- the at least one MelanA peptide analogue of the invention is bound to the VLP by way of chemical cross-linking, typically and preferably by using a heterobifunctional cross- linker.
- a heterobifunctional cross-linker typically contains a functional group which can react with preferred first attachment sites, i.e. with the side-chain amino group of lysine residues of the VLP or at least one VLP subunit, and a further functional group which can react with a preferred second attachment site, i.e.
- the first step of the procedure is the reaction of the VLP with the cross-linker.
- the product of this reaction is an activated VLP, also called activated carrier.
- unreacted cross-linker is removed using usual methods such as gel filtration or dialysis.
- the MelanA peptide analogue of the invention is reacted with the activated VLP, and this step is typically called the coupling step. Unreacted MelanA peptide analogue may be optionally removed in a fourth step, for example by dialysis.
- hetero-bifunctional cross-linkers are known to the art. These include the preferred cross-linkers SMPH (Pierce), Sulfo-MBS, Sulfo-EMCS, Sulfo-GMBS, Sulfo-SIAB, Sulfo-SMPB, Sulfo-SMCC, SVSB, SIA and other cross-linkers available for example from the Pierce Chemical Company (Rockford, IL, USA) , and having one functional group reactive towards amino groups and one functional group reactive towards cysteine residues.
- SMPH Fastce
- Sulfo-MBS Sulfo-EMCS
- Sulfo-GMBS Sulfo-SIAB
- Sulfo-SMPB Sulfo-SMCC
- SVSB SIA and other cross-linkers available for example from the Pierce Chemical Company (Rockford, IL, USA) , and having one functional group reactive towards amino groups and one functional group reactive towards cysteine residues.
- the above mentioned cross-linkers all lead to formation of
- cross-linkers suitable in the practice of the invention is characterized by the introduction of a disulfide linkage between the MelanA peptide analogue and the VLP upon coupling.
- Preferred cross- linkers belonging to this class include for example SPDP and Sulfo-LC-SPDP (Pierce).
- the extent of derivatization of the VLP with cross-linker can be influenced by varying experimental conditions such as the concentration of each of the reaction partners, the excess of one reagent over the other, the pH, the temperature and the ionic strength.
- the degree of coupling, i.e. the amount of antigens or antigenic determinants per subunits of the VLP can be adjusted by varying the experimental conditions described above to match the requirements of the vaccine.
- a particularly favored method of binding of antigens or antigenic determinants to the VLP is the linking of a lysine residue on the surface of the VLP with a cysteine residue on the MelanA peptide analogue of the invention.
- fusion, coupling, attachment or binding of an amino acid linker containing a cysteine residue, as a second attachment site or as a part thereof, to the MelanA peptide analogue of the invention for coupling to the VLP may be required.
- Such constructs comprising said amino acid linker may also be obtained by simple peptide syntheses known in the art. Therefore, in a further preferred embodiment of the present invention, the antigen or antigenic determinant further comprises an amino acid linker, wherein preferably said amino acid linker comprises, or alternatively consists of, a second attachment site.
- amino acid linkers are favored.
- amino acid linkers are the hinge region of Immunoglobulins, glycine serine linkers (GGGGS)n (SEQ ID NO: 64), and glycine linkers (G)n all further containing a cysteine residue as second attachment site and optionally further glycine residues.
- amino acid linkers are N-terminal gammal: CGDKTHTSPP (SEQ ID NO: 65); C-terminal gamma 1: DKTHTSPPCG (SEQ ID NO: 66); N-terminal gamma 3: CGGPKPSTPPGSSGGAP (SEQ ID NO: 67); C-terminal gamma 3: PKPSTPPGSSGGAPGGCG (SEQ ID NO: 68); N-terminal glycine linker:
- GCGGGG (SEQ ID NO: 69); C-terminal glycine linker: GGGGCG (SEQ ID NO: 70); C- terminal glycine-lysine linker: GGKKGC (SEQ ID NO: 71); N-terminal glycine-lysine linker: CGKKGG (SEQ ID NO: 72).
- amino acid linkers particularly suitable in the practice of the invention when a hydrophobic antigen or antigenic determinant is bound to a VLP, are CGKKGG (SEQ ID NO: 73), or CGDEGG (SEQ ID NO: 74) for N-terminal linkers, or GGKKGC (SEQ ID NO: 75) and GGEDGC (SEQ ID NO: 76), for the C-terminal linkers.
- CGKKGG SEQ ID NO: 73
- CGDEGG SEQ ID NO: 74
- GGKKGC SEQ ID NO: 75
- GGEDGC SEQ ID NO: 76
- the terminal cysteine is optionally C-terminally amidated.
- linkers useful for this invention are amino acid sequences that allow the release of the antigenic peptide, i.e. the human melanoma MelanA peptide analogue, from the VLP. Examples for these linkers are described in Toes RE et al. J Exp Med. 2001 Jul 2;194(1):1-12. Moreover, the PAProC- a prediction algorithm for proteasomal cleavages might be used (Nussbaum AK, et. al. Immunogenetics. 2001 Mar;53(2):87-94) for prediction of aforementioned amino acid sequences that allow the release of the antigenic peptide, i.e. the human melanoma MelanA peptide analogue, from the VLP.
- GGCG SEQ ID NO: 77
- GGC GGC or GGC-NH2
- NH2 stands for amidation
- linkers at the C-terminus of the peptide or CGG at its N-terminus are preferred as amino acid linkers.
- glycine residues will be inserted between bulky amino acids and the cysteine to be used as second attachment site, to avoid potential steric hindrance of the bulkier amino acid in the coupling reaction.
- the amino acid linker GGC-NH2 is fused to the C-terminus of the MelanA peptide analogue of the invention.
- the cysteine residue added to the MelanA peptide analogue of the invention has to be in its reduced state to react with the hetero-bifunctional cross-linker on the activated VLP, that is a free cysteine or a cysteine residue with a free sulfhydryl group has to be available.
- the cysteine residue to function as binding site is in an oxidized form, for example if it is forming a disulfide bridge, reduction of this disulfide bridge with e.g. DTT, TCEP or ⁇ -mercaptoethanol is required.
- Other methods of binding the MelanA peptide analogue of the invention to the VLP include methods wherein the MelanA peptide analogue of the invention is cross-linked to the VLP using the carbodiimide EDC, and NHS.
- the MelanA peptide analogue of the invention is attached to the VLP using a homo- bifunctional cross-linker such as glutaraldehyde, DSG, BM[PEO]4, BS3, (Pierce Chemical Company, Rockford, IL, USA) or other known homo-bifunctional cross-linkers whith functional groups reactive towards amine groups or carboxyl groups of the VLP.
- a homo- bifunctional cross-linker such as glutaraldehyde, DSG, BM[PEO]4, BS3, (Pierce Chemical Company, Rockford, IL, USA) or other known homo-bifunctional cross-linkers whith functional groups reactive towards amine groups or carboxyl groups of the VLP.
- Other methods of binding the VLP to an MelanA peptide analogue of the invention include methods where the VLP is biotinylated, and the MelanA peptide analogue of the invention expressed as a streptavidin-fusion protein, or methods wherein both the MelanA peptide analogue of the invention and the VLP are biotinylated, for example as described in WO 00/23955.
- the MelanA peptide analogue of the invention may be first bound to streptavidin or avidin by adjusting the ratio of MelanA peptide analogue of the invention to streptavidin such that free binding sites are still available for binding of the VLP, which is added in the next step.
- the VLP is the VLP of a RNA phage, and in a more preferred embodiment, the VLP is the VLP of RNA phage Q ⁇ coat protein.
- One or several antigen molecules i.e. one or several antigens or antigenic determinants, can be attached to one subunit of the capsid or VLP of RNA phages coat proteins, preferably through the exposed lysine residues of the VLP of RNA phages, if sterically allowable.
- a specific feature of the VLP of the coat protein of RNA phages and in particular of the Q ⁇ coat protein VLP is thus the possibility to couple several antigens per subunit. This allows for the generation of a dense antigen array.
- the binding and attachment, respectively, of the at least one MelanA peptide analogue of the invention to the virus-like particle is by way of interaction and association, respectively, between at least one first attachment site of the virus-like particle and at least one second attachment of the MelanA peptide analogue of the invention.
- VLPs or capsids of Q ⁇ coat protein display a defined number of lysine residues on their surface, with a defined topology with three lysine residues pointing towards the interior of the capsid and interacting with the RNA, and four other lysine residues exposed to the exterior of the capsid.
- VLPs of other RNA phage coat proteins also have a defined number of lysine residues on their surface and a defined topology of these lysine residues.
- the first attachment site is a lysine residue and/or the second attachment comprises sulfhydryl group or a cysteine residue.
- the first attachment site is a lysine residue and the second attachment is a cysteine residue.
- the MelanA peptide analogue of the invention is bound via a cysteine residue, to lysine residues of the VLP of RNA phage coat protein, and in particular to the VLP of Q ⁇ coat protein.
- Another advantage of the VLPs derived from RNA phages is their high expression yield in bacteria that allows production of large quantities of material at affordable cost.
- the inventive conjugates and arrays, respectively differ from prior art conjugates in their highly organized stracture, dimensions, and in the repetitiveness of the antigen on the surface of the array.
- the use of the VLPs as carriers allow the formation of robust antigen arrays and conjugates, respectively, with variable antigen density.
- VLPs of RNA phages and hereby in particular the use of the VLP of RNA phage Q ⁇ coat protein allows to achieve very high epitope density.
- a density of more than 1.5 epitopes per subunit has been reached by coupling a peptide to the VLP of Q ⁇ coat protein (e.g. the human A ⁇ 1-6 peptide as described in WO 2004/016282).
- the preparation of compositions of VLPs of RNA phage coat proteins with a high epitope density can be effected using the teaching of this application.
- the second attachment site may be either naturally or non- naturally present with the MelanA peptide analogue of the invention. In the case of the absence of a suitable natural occurring second attachment site on the MelanA peptide analogue of the invention, such a, then non-natural second attachment can be engineered to the antigen.
- lysine residues are exposed on the surface of the VLP of Q ⁇ coat protein. Typically these residues are derivatized upon reaction with a cross-linker molecule. In the instance where not all of the exposed lysine residues can be coupled to an antigen, the lysine residues which have reacted with the cross-linker are left with a cross- linker molecule attached to the ⁇ -amino group after the derivatization step. This leads to disappearance of one or several positive charges, which may be detrimental to the solubility and stability of the VLP.
- a Q ⁇ mutant coat protein with one additional lysine residue suitable for obtaining even higher density arrays of antigens.
- This mutant Q ⁇ coat protein, Q ⁇ -243 (Asn 10-Lys; SEQ ID NO: 21) was cloned, the protein expressed, and the capsid or VLP isolated and purified, showing that introduction of the additional lysine residue is compatible with self-assembly of the subunits to a capsid or VLP.
- MelanA peptide analogue arrays and conjugates, respectively may be prepared using VLP of Q ⁇ coat protein mutants.
- a particularly favored method of attachment of antigens to VLPs, and in particular to VLPs of RNA phage coat proteins is the linking of a lysine residue present on the surface of the VLP of RNA phage coat proteins with a cysteine residue added to the antigen.
- a cysteine residue In order for a cysteine residue to be effective as second attachment site, a sulfhydryl group must be available for coupling. Thus, a cysteine residue has to be in its reduced state, that is, a free cysteine or a cysteine residue with a free sulfhydryl group has to be available.
- cysteine residue to function as second attachment site is in an oxidized form, for example if it is forming a disulfide bridge
- reduction of this disulfide bridge with e.g. DTT, TCEP or ⁇ - mercaptoethanol is required.
- concentration of reductand, and the molar excess of reductand over antigen has to be adjusted for each antigen.
- a titration range, starting from concentrations as low as 10 ⁇ M or lower, up to 10 to 20 mM or higher reductand if required is tested, and coupling of the antigen to the carrier assessed.
- the pH of the dialysis or equilibration buffer is lower than 7, preferably 6. The compatibility of the low pH buffer with antigen activity or stability has to be tested.
- Epitope density on the VLP of RNA phage coat proteins can be modulated by the choice of cross-linker and other reaction conditions.
- the cross-linkers Sulfo- GMBS and SMPH typically allow reaching high epitope density.
- Derivatization is positively influenced by high concentration of reactands, and manipulation of the reaction conditions can be used to control the number of antigens coupled to VLPs of RNA phage coat proteins, and in particular to VLPs of Q ⁇ coat protein.
- the position at which it should be fused, inserted or generally engineered has to be chosen.
- the selection of the position of the second attachment site may, by way of example, be based on a crystal stracture of the antigen.
- Such a crystal structure of the antigen may provide information on the availability of the C- or N-termini of the molecule (determined for example from their accessibility to solvent), or on the exposure to solvent of residues suitable for use as second attachment sites, such as cysteine residues.
- Exposed disulfide bridges as is the case for Fab fragments, may also be a source of a second attachment site, since they can be generally converted to single cysteine residues through mild reduction, with e.g.
- the second attachment site will be added such that it allows generation of antibodies against the site of interaction with the natural ligands.
- the location of the second attachment site will be selected such that steric hindrance from the second attachment site or any amino acid linker containing the same is avoided.
- an antibody response directed at a site distinct from the interaction site of the self-antigen with its natural ligand is desired.
- the second attachment site may be selected such that it prevents generation of antibodies against the interaction site of the self-antigen with its natural ligands.
- Other criteria in selecting the position of the second attachment site include the oligomerization state of the antigen, the site of oligomerization, the presence of a cofactor, and the availability of experimental evidence disclosing sites in the antigen structure and sequence where modification of the antigen is compatible with the function of the self- antigen, or with the generation of antibodies recognizing the self-antigen.
- the MelanA peptide analogue of the invention comprises an added single second attachment site or a single reactive attachment site capable of association with the first attachment sites on the core particle and the VLPs or VLP subunits, respectively.
- This further ensures a defined and uniform binding and association, respectively, of the at least one, but typically more than one, preferably more than 10, 20, 40, 80, 120, 150, 180, 210, 240, 270, 300, 360, 400, 450 MelanA peptide analogue of the invention to the core particle and VLP, respectively.
- the provision of a single second attachment site or a single reactive attachment site on the antigen thus, ensures a single and uniform type of binding and association, respectively leading to a very highly ordered and repetitive array.
- the binding and association, respectively is effected by way of a lysine- (as the first attachment site) and cysteine- (as a second attachment site) interaction, it is ensured, in accordance with this preferred embodiment of the invention, that only one cysteine residue per antigen, independent whether this cysteine residue is naturally or non-naturally present on the antigen, is capable of binding and associating, respectively, with the VLP and the first attachment site of the core particle, respectively.
- an amino acid linker is bound to the MelanA peptide analogue of the invention by way of at least one covalent bond.
- the amino acid linker comprises, or alternatively consists of, the second attachment site.
- the amino acid linker comprises a sulfhydryl group or a cysteine residue.
- the amino acid linker is cysteine.
- the attachment site is selected to be a lysine or cysteine residue that is fused in frame to the HBcAg.
- the antigen is fused to the C-terminus of HBcAg via a three leucine linker.
- an antigen or antigenic determinant is linked to the VLP through a lysine residue, it may be advantageous to either substitute or delete one or more of the naturally resident lysine residues, as ell as other lysine residues present in HBcAg variants.
- lysine residues when the naturally resident lysine residues are eliminated, another lysine will be introduced into the HBcAg as an attachment site for an antigen or antigenic determinant. Methods for inserting such a lysine residue are known in the art. Lysine residues may also be added without removing existing lysine residues.
- the C terminus of the HBcAg has been shown to direct nuclear localization of this protein. (Eckhardt et al, J. Virol. 65:575 582 (1991)). Further, this region of the protein is also believed to confer upon the HBcAg the ability to bind nucleic acids.
- HBcAgs suitable for use in the practice of the present invention also include N terminal trancation mutants. Suitable trancation mutants include modified
- HBcAgs where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N terminus.
- variants of virus-like particles containing internal deletions within the sequence of the subunit composing the viras-like particle are also suitable in accordance with the present invention, provided their compatibility with the ordered or particulate stracture of the viras-like particle.
- internal deletions within the sequence of the HBcAg are suitable (Preikschat, P, et al, J. Gen. Virol. 80:1777-1788 (1999)).
- HBcAgs suitable for use in the practice of the present invention include N— and C terminal truncation mutants.
- Suitable trancation mutants include HBcAgs where 1, 2, 5, 7, 9, 10, 12, 14, 15, and 17 amino acids have been removed from the N terminus and 1, 5, 10, 15, 20, 25, 30, 34, 35, 36, 37, 38, 3940, 41, 42 or 48 amino acids have been removed from the C terminus.
- Vaccine compositions of the invention can comprise mixtures of different HBcAgs.
- these vaccine compositions can be composed of HBcAgs which differ in amino acid sequence.
- vaccine compositions could be prepared comprising a "wild type" HBcAg and a modified HBcAg in which one or more amino acid residues have been altered (e.g., deleted, inserted or substituted). In most applications, however, only one type of a HBcAg will be used.
- the viras-like particle comprises at least one first attachment site and the antigen or antigenic determinant comprises at least one second attachment site.
- the first attachment site comprises, or preferably consists of, an amino group or a lysine residue.
- the second attachment site is preferably selected from the group consisting of (a) an attachment site not naturally occurring with said antigen or antigenic determinant; and (b) an attachment site naturally occurring with said antigen or antigenic determinant.
- the second attachment site comprises, or preferably consists of, a sulfhydryl group or a cysteine residue.
- the binding of the antigen or antigenic determinant to the virus-like particle is effected through association between the first attachment site and the second attachment site, wherein preferably the association is through at least one non-peptide bond, and wherein preferably the antigen or antigenic determinant and the virus-like particle interact through said association to form an ordered and repetitive antigen array.
- the first attachment site is a lysine residue and the second attachment site is a cysteine residue.
- the first attachment site is an amino group and the second attachment site is a sulfhydryl group.
- the antigen, and herein in particular, the melanoma MelanA peptide analogue comprises one or more cytotoxic T cell epitopes, Th cell epitopes, or a combination of the two epitopes.
- the antigen or antigenic determinant comprises one, two, or more cytotoxic T cell epitopes.
- the antigen or antigenic determinant comprises one, two, or more Th cell epitopes.
- the antigen or antigenic determinant comprises one, two or more cytotoxic T cell epitopes and one, two or more Th cell epitopes.
- the natural MelanA/Mart-1 epitopes and for example the MelanA/Mart-1 26-35 epitope bind with low affinity to human HLA-2 only.
- in vivo presentation of the natural MelanA epitopes and peptides, respectively, upon vaccination may be a limiting factor. This is particularly important if Melan A epitopes and peptides, respectively, bound, coupled or fused to VLPs are used for vaccination, since under these conditions, MelanA peptides load HLA molecules by cross-presentation.
- the process of cross- presentation is, however, not as efficient as classical pathways of antigen presentation and the affinity of the MelanA peptide for HLA is even more important.
- MelanA peptide analogues that bind with relatively high affinity to HLA.
- MelanA peptide analogues that are recognized with higher affinity by the natural T cell repertoire of the host.
- MelanA epitopes and peptide analogues are preferred that contain anchor residues at the proper positions allowing for efficient binding to MHC molecules.
- a further aspect of the present invention and a very preferred embodiment of the present invention is to provide a composition for enhancing an immune response in an animal comprising (a) a virus-like particle; and (b) an immunostimulatory substance, wherein said immunostimulatory substance is bound to said viras-like particle, and wherein said composition further comprises at least one antigen or antigenic determinant, wherein said antigen or antigenic determinant is bound to said virus-like particle, and wherein said at least one antigen or antigenic determinant comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA peptide analogue, and wherein said human melanoma MelanA peptide analogue is bound to said viras-like particle.
- the Melan A peptide analogue is capable of allowing an efficient binding to MHC molecules.
- the use of a MelanA peptide analogue thus, allows, in particular, the introduction of such anchor residues leading to an improved binding to MHC molecules.
- the introduction of such anchor residues leading to an improved binding to MHC molecules is in particular advantageous, if the natural and normal, respectively, MelanA peptide does not contain such anchor residues or does not contains only such anchor residues which are inferior to the newly introduced anchor residue(s) replacing the natural and normal, respectively anchor residue.
- the modification of the normal human MelanA peptide leading to the MelanA peptide analogue, and hereby preferably the introduction of these anchor residues is effected either by (i) induced mutation (e.g. chemical induction, irradiation or other procedures known to a person skilled in the art) and subsequent selection of modified peptides with improved binding to MHC or (ii) of selection of modified peptides with improved binding to MHC arising from natural mutations arising at any level of protein sythesis, including but not limited to mutations arising at the DNA, transcriptional, RNA or translational level of protein expression or (iii) or by systematic or random amino acid exchanges, deletions, substitutions or insertions by using classical peptide synthesis known by the person skilled in the art.
- induced mutation e.g. chemical induction, irradiation or other procedures known to a person skilled in the art
- selection of modified peptides with improved binding to MHC arising from natural mutations arising at any level of protein
- the identification of such anchor residues is typically and preferably effected by using the S YFPEITHI database as described by Rammensee et al. in Immunogenetics 50:213-219 (1999).
- the SYFPEITHI database allows calculating the efficiency of HLA binding for any peptide of choice and it is possible to optimize the peptides regarding the efficiency of HLA binding using this program.
- identification of preferred peptide analogues can be achieved by MHC-peptide binding assays involving but not limited to whole cell assays of T cell activation or recognition or MHC upregualtion in mutant cell lines, MHC-tetramer- peptide binding assays, competitive binding assays with labelled peptides, surface plasmon resonance assays, all known to the person skilled in the art.
- the MelanA peptide analogue is characterized by two, more preferably by a single amino acid substitution with respect to the corresponding normal MelanA peptide.
- the MelanA peptide analogue is protected from protease or peptidase mediated degradation.
- MelanA peptide analogues that are protected from protease or peptidase degradation leads to increased stability of the peptide in vivo after application of the peptide to a subject or and/or to increased stability of the peptide during storage in the presence of proteases or peptidases.
- the consequence of this increased stability is more efficient and prolonged presentation of the human melanoma MelanA peptide analogue on MHC and thus the enhanced stimulation of a specific T cell response.
- the human MelanA peptide analogue is protected by substitution of selected amino acid residues of the natural human MelanA peptide by non natural amino acid derivatives as exemplified in Blanchet et al, J. Immunol. 167:5852-5861 (2001) and references cited therein.
- This overcomes the limitation typically imposed by the fact that chemically modified MelanA peptides and MelanA peptide analogues, respectively, may not be recognized by the T cells equally well as compared to the natural and normal, respectively, MelanA peptide.
- the antigen comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA/MART-1 peptide analogue having an amino acid sequence which is selected without limitation from the group consisting of (a) LAGIGILTV (SEQ ID NO: 84); (b) MAGIGILTV (SEQ ID NO: 85), (c) EAMGIGILTV (SEQ ID NO: 86), (d) ELAGIGILTV (SEQ ID NO: 50), (e) EMAGIGILTV (SEQ ID NO: 87), (f) YAAGIGILTV (SEQ ID NO: 88), (g) FAAGIGILTV (SEQ ID NO: 89), (h) GHGHS YTTAE ELAGIGILTV (SEQ ID NO: 51) , (i) SYTTAEELAGIGILTVILGVL (SEQ ID NO: 52), and (j) ELAGIGILTVILGVL (SEQ ID NO: 53).
- LAGIGILTV S
- the antigen comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA/MART-1 peptide analogue having an amino acid sequence which is selected without limitation from the group consisting of (a) LAGIGILTV (SEQ ID NO: 84); (b) MAGIGILTV (SEQ ID NO: 85), (c) EAMGIGILTV (SEQ ID NO: 86), (d) ELAGIGILTV (SEQ ID NO: 50), (e) EMAGIGILTV (SEQ ID NO: 87), (f) YAAGIGILTV (SEQ ID NO: 88), and (g) FAAGIGILTV (SEQ ID NO: 89).
- the human melanoma MelanA/MART-1 peptide analogue comprises, alternatively consists essentially of, or alternatively consists of the sequence ELAGIGILTV (SEQ ID NO: 50).
- this very preferred embodiment induces expansion of functional MelanA-specific CD8+T cells in HLA-A2 transgenic mice and represents a good compromise between HLA-binding and TCR-recognition (cf. Valmori at al, J. Immunol. 160: 1750-1758 (1998)).
- the human melanoma MelanA/MART-1 peptide analogue with the second attachment site has an amino acid sequence selected without limitation from the group consisting of (a) CGHGHS YTTAE EAAGIGILTV (SEQ ID NO: 54); and typically abbreviated herein as 16-35, (b) CGHGHSYTTAEELAGIGILTV (SEQ ID NO: 55); and typically abbreviated herein as MelanA 16-35 A/L), (c) CGGEAAGIGILTV (SEQ ID NO: 56); and typically abbreviated herein as MelanA 26-35, (d) CGGELAGIGILTV (SEQ ID NO: 57); and typically abbreviated herein as MelanA 26-35 A/L), (e) CS YTTAEELAGIGILTVILGVL (SEQ ID NO: 58); and typically abbreviated herein as MelanA 20-40 A/L), (f) CGGELAGIGIL
- the human melanoma MelanA/MART-1 peptide analogue with the second attachment site has an amino acid sequence selected from (a) CGHGHSYTTAEELAGIGILTV (SEQ ID NO: 55); and typically abbreviated herein as MelanA 16-35 A/L), (b) CGGELAGIGILTV (SEQ ID NO: 57); and typically abbreviated herein as MelanA 26-35 A/L), (c) CS YTTAEELAGIGILTVILGVL (SEQ ID NO : 58); and typically abbreviated herein as MelanA 20-40 A/L), (d) CGGELAGIGILTVILGVL (SEQ ID NO: 59); and typically abbreviated herein as MelanA 26-40 A/L), (e) ELAGIGILTVGGC (SEQ ID NO: 60); and typically abbreviated herein as MelanA 26-35-C A/L).
- the human melanoma MelanA/MART-1 peptide analogue with the second attachment has an amino acid sequence of CGHGHS YTTAEELAGIGILTV (SEQ ID NO: 55) (MelanA 16-35 A/L).
- the inventive vaccine composition comprising this very preferred embodiment, i.e. the Q ⁇ MelanA 16-35 A/L vaccine, is processed by dendritic cells.
- the MelanA peptide analogue of the invention being coupled, fused or otherwise attached to the virus-like particle, is a T cell epitope, either a cytotoxic or a Th cell epitope.
- the antigen is a combination of at least two, being either similar or different, preferably different, epitopes, wherein the at least two epitopes are linked directly or by way of a linking sequence.
- These epitopes are preferably selected from the group consisting of cytotoxic and Th cell epitopes described for melanomas (gplOO , tyrosinase, MAGE- family or NY-ESO-1).
- said antigen comprises, or alternatively further comprises, a cytotoxic T cell epitope, a Th cell epitope or a combination of at least two of said epitopes, wherein said at least two epitopes are bound directly or by way of a linking sequence, and wherein preferably said cytotoxic T cell epitope is a viral or a tumor cytotoxic T cell epitope.
- cytotoxic T cell epitopes are MelanA epitopes: (16-36 A/L) (25-36 A/L);
- Tyrosinase epitopes (1-9) and (368-376) (Panelli, M.C. et.al, J. Immunol, 2000, 164, 495-504); GplOO epitopes: (154-162), (209-217 (T210M)), (280-288) and (280-288 (A288V)) and (457-466) (Nielsen,M.B. et. al, 2000. J Immunol, 164 (4), 2287-96 and Linette, G.P. et. al. J Immunol, 2000, 164, 3402-3412 and Skipper, J.C, Int. J.
- TRP2 epitopes (180-188) (288-296) (455-463) (Sun, Y. et.al. Int. J Cancer, 2000, 87 (3), 399- 404 and Parkhurst, M.R. et.al. Cancer Res, 1998, 58, 4895-8901 and Harada, M, et.al. Cancer Res, 2001, 61, 1089-1094)); NY-ESO-1 epitope: 157-165 (Chen, J.L, et. al, J. Immunol, 2000, 165, 948-955); and MAGE-A epitope: (248V9) (Graff-Dubois, S, et.al, 2002, J. Immunol, 169, 575-580)
- a preferred combination of cytotoxic T cell epitopes is the combination MelanA (25-36 A/L), Tyrosinase (368-376), GplOO (209-217 (T210M)) and (457-466), and NY- ESO-1 (157-165).
- Th cell epitopes are Mage-3 epitopes: (281-295), (141-155), and (146- 160) (Kobayashi, H, et.al, Cabcer Res, 2001, 61, 4773-4778); Tyrosinase epitopes: (188-208), (193-203) (Kobayashi H, et.al, Immunogenetics,1998, 47, 398-403); GP100 epitope: (44-59); and NY-ESO-1 epitopes: (115-132), (121-138), (139-156), (119-143), and (134-148) (Zarour, H.M, et.al. Cancer Res, 2002, 62, 213-218).
- cytotoxic and Th cell epitopes are MelanA epitopes (1- 118 A/L) (SEQ ID NO: 94); NY-ESO-1 epitopes 115-165; or the combination of MelanA (25-36 A7L), gplOO (209-217 (T210M), Mage-3(146-160), and gplOO (44-59).
- a mosaic viras-like particle e.g. a virus-like particle composed of subunits attached to different antigens and epitopes, respectively
- a composition of the present invention can be, for example, obtained by transforming E.coli with two compatible plasmids encoding the subunits composing the viras-like particle fused to different antigens and epitopes, respectively.
- the mosaic viras-like particle is assembled either directly in the cell or after cell lysis.
- such an inventive composition can also be obtained by attaching a mixture of different antigens and epitopes, respectively, to the isolated viras-like particle.
- the MelanA peptide analogue of the present invention can be synthesized or recombinantly expressed and coupled to the viras-like particle, or fused to the viras-like particle using recombinant DNA techniques.
- Exemplary procedures describing the attachment of antigens to viras-like particles are disclosed in WO 00/32227, in WO 01/85208 and in WO 02/056905, the disclosures of which are herewith incorporated by reference in its entirety.
- the invention also provides a method of producing a composition for enhancing an immune response in an animal comprising a VLP and an immunostimulatory substance, preferably an unmethylated CpG-containing oligonucleotide bound to the VLP which comprises incubating the VLP with the immunostimulatory substance and oligonucleotide, respectively, adding RNase and purifying said composition.
- the method further comprises the step of binding an antigen or antigenic determinant to said viras-like particle, wherein said antigen comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA peptide analogue.
- the anigen or antigenic determinant is bound to the viras-like particle before incubating the viras-like particle with the immunostimulatory substance.
- the anigen or antigenic determinant is bound to the viras- like particle after purifying the composition.
- the method comprises incubating the VLP with RNase, adding the immunostimulatory substance and oligonucleotide, respectively, and purifying the composition.
- the method further comprises the step of binding an antigen or antigenic determinant to said viras-like particle, wherein said antigen comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA peptide analogue.
- the anigen or antigenic determinant is bound to the viras-like particle before incubating the virus-like particle with the RNase. In another preferred embodiment, the anigen or antigenic determinant is bound to the virus-like particle after purifying the composition.
- the VLP is produced in a bacterial expression system.
- the RNase is RNase A.
- the invention further provides a method of producing a composition for enhancing an immune response in an animal comprising a VLP bound to an immunostimulatory substance, preferably to an unmethylated CpG-containing oligonucleotide which comprises disassembling the VLP, adding the immunostimulatory substance and oligonucleotide, respectively, and reassembling the VLP.
- the method can further comprise removing nucleic acids of the disassembled VLP and or purifying the composition after reassembly.
- the method further comprises the step of binding an antigen or antigenic determinant to the viras-like particle, wherein said antigen comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA peptide analogue.
- said antigen comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA peptide analogue.
- the anigen or antigenic determinant is bound to the virus-like particle before disassembling the virus-like particle.
- the anigen or antigenic determinant is bound to the viras-like particle after reassembling the viras-like particle, and preferably after purifying the composition.
- the invention also provides vaccine compositions which can be used for preventing and/or attenuating diseases or conditions.
- Vaccine compositions of the invention comprise, or alternatively consist of, an immunologically effective amount of the inventive immune enhancing composition together with a pharmaceutically acceptable diluent, carrier or excipient.
- the vaccine can also optionally comprise an adjuvant.
- the invention provides a vaccine comprising an immunologically effective amount of the inventive immune response enhancing composition together with a pharmaceutically acceptable diluent, carrier or excipient, wherein the composition comprises, (a) a virus-like particle; (b) at least one immunostimulatory substance; and (c) at least one antigen or antigenic determinant; wherein the antigen or antigenic determinant is bound to the viras-like particle, and wherein the immunostimulatory substance is bound to the virus-like particle, and wherein the antigen comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA peptide analogue.
- the vaccine further comprises an adjuvant.
- the invention further provides vaccination methods for preventing and/or attenuating diseases or conditions in animals.
- the invention provides vaccines for the prevention of cancer in a wide range of species, particularly mammalian species such as human, monkey, cow, dog, cat, horse, pig, etc, preferably human.
- Vaccines can be designed to treat all types of cancer, preferably melanomas.
- RNA-phage derived VLPs in particular the VLP derived from Q ⁇ , do very efficiently induce a memory CD8 + T cell response in a homologous prime-boost vaccination scheme.
- live vaccinia virus immunizations are very ineffective for the induction of a primary CD8 T cell response and homologous boosting with vaccinia does hardly lead to an expansion of memory CD8 + T cells.
- the invention provides a method of immunizing or treating an animal comprising priming a T cell response in the animal by administering an immunologically effective amount of the inventive vaccine.
- the method further comprises the step of boosting the immune response in the animal, wherein preferably the boosting is effected by administering an immunologically effective amount of a vaccine of the invention or an immunologically effective amount of a heterologous vaccine, wherein even more preferably the heterologous vaccine is a DNA vaccine, peptide vaccine, recombinant viras or a dendritic cell vaccine.
- the invention further provides a method of immunizing or treating an animal comprising the steps of priming a T cell response in the animal, and boosting a T cell response in the animal, wherein the boosting is effected by administering an immunologically effective amount of the vaccine of the invention.
- the primimg is effected by administering an immunologically effective amount of a vaccine of the invention or an immunologically effective amount of a heterologous vaccine, wherein even more preferably said heterologous vaccine is a DNA vaccine, peptide vaccine, recombinant viras or a dendritic cell vaccine.
- the invention further provides for a composition
- a composition comprising a viras-like particle, at least one immunostimulatory substance; and at least one antigen or antigenic determinant; wherein said antigen or antigenic determinant is bound to said viras-like particle, and wherein said immunostimulatory substance is bound to said virus-like particle, and wherein said antigen comprises a cytotoxic T cell epitope, a Th cell epitope or a combination of at least two of said epitopes, wherein said at least two epitopes are bound directly or by way of a linking sequence, and wherein preferably said cytotoxic T cell epitope is a viral or a tumor cytotoxic T cell epitope.
- the present invention provides a composition, typically and preferably for enhancing an immune response in an animal comprising: (a) a viras- like particle; (b) an immunostimulatory substance; wherein said immunostimulatory substance (b) is bound to said viras-like particle (a); and (c) an antigen, wherein said antigen is mixed with said viras-like particle (a), and wherein said antigen comprises, alternatively consists essentially of, or alternatively consists of a human melanoma MelanA peptide analogue.
- compositions of the invention when administered to an animal, they can be in a composition which contains salts, buffers, adjuvants or other substances which are desirable for improving the efficacy of the composition.
- materials suitable for use in preparing pharmaceutical compositions are provided in numerous sources including REMINGTON'S PHARMACEUTICAL SCIENCES (Osol, A, ed. Mack Publishing Co, (1990)).
- adjuvants can be used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette Guerin) and Corynebacterium parvum. Such adjuvants are also well known in the art.
- compositions of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS 21, QS 18, CRL1005, Aluminum salts, MF 59, and Virosomal adjuvant technology.
- the adjuvants can also comprise a mixture of these substances.
- compositions of the invention are said to be “pharmacologically acceptable” if their administration can be tolerated by a recipient individual. Further, the compositions of the invention will be administered in a "therapeutically effective amount” (i.e., an amount that produces a desired physiological effect).
- compositions of the present invention can be administered by various methods known in the art.
- the particular mode selected will depend of course, upon the particular composition selected, the severity of the condition being treated and the dosage required for therapeutic efficacy.
- the methods of the invention generally speaking, can be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects.
- modes of administration include oral, rectal, parenteral, intracistemal, intravaginal, intraperitoneal, topical (as by powders, ointments, drops or transdermal patch), bucal, or as an oral or nasal spray.
- parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrastemal, subcutaneous and intraarticular injection and infusion.
- the composition of the invention can also be injected directly in a lymph node.
- compositions for administration include sterile aqueous (e.g., physiological saline) or non-aqueous solutions and suspensions.
- non- aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption.
- Combinations can be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially.
- Administration "in combination” further includes the separate administration of one of the compounds or agents given first, followed by the second.
- Dosage levels depend on the mode of administration, the nature of the subject, and the quality of the carrier/adjuvant formulation. Typical amounts are in the range of about 0.1 ⁇ g to about 20 mg per subject. Preferred amounts are at least about 1 ⁇ g to about 1 mg, more preferably at least about 10 to about 400 ⁇ g per subject. Multiple administration to immunize the subject is preferred, and protocols are those standard in the art adapted to the subject in question.
- compositions can conveniently be presented in unit dosage form and can be prepared by any of the methods well-known in the art of phannacy. Methods include the step of bringing the compositions of the invention into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compositions of the invention into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
- compositions suitable for oral administration can be presented as discrete units, such as capsules, tablets or lozenges, each containing a predetermined amount of the compositions of the invention.
- Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, an elixir or an emulsion.
- Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compositions of the invention described above, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art.
- Other embodiments of the invention include processes for the production of the compositions of the invention and methods of medical treatment for cancer and allergies using said compositions.
- HBcAg containing peptide p33 from LCMV is given in SEQ ID NO: 15.
- the p33-HBcAg VLPs were generated as follows: Hepatitis B clone pEco63 containing the complete viral genome of Hepatitis B viras was purchased from ATCC. The gene encoding HBcAg was introduced into the EcoRI/Hindlll restriction sites of expression vector pkk223.3 (Pharmacia) under the control of a strong tac promoter.
- the p33 peptide (KAVYNFATM) (SEQ ID NO: 80) derived from lymphocytic choriomeningitis virus (LCMV) was fused to the C-terminus of HBcAg (1-185) via a three leucine-linker by standard PCR methods.
- a clone of E. coli K802 selected for good expression was transfected with the plasmid, and cells were grown and resuspended in 5 ml lysis buffer (10 mM Na2HPO4, 30 mM NaCl, 10 mM EDTA, 0.25 % Tween-20, pH 7.0). 200 ⁇ l of lysozyme solution (20 mg/ml) was added.
- Flow through (which contains purified p33-VLP capsids) was collected and loaded onto a reducing SDS-PAGE gel for monomer molecular weight analysis . Electron microscopy was performed according to standard protocols. Thus, the stracture of the p33-VLPs was assessed by electron microscopy and SDS PAGE .
- Recombinantly produced HBcAg wild-type VLPs (composed of HBcAg [aa 1- 185] monomers) and p33-VLPs were loaded onto a Sephacryl S-400 gel filtration column (Amersham Pharmacia Biotechnology AG) for purification. Pooled fractions were loaded onto a Hydroxyapatite column.
- Flow through (which contains purified p33-VLPs) was collected and loaded onto a reducing SDS-PAGE gel for monomer molecular weight analysis.
- p33-HBcAg VLP HBcAg-p33 VLP
- ⁇ 33- VLPs HBc33
- the cDNA of GA phage coat protein was amplified from GA phage by reverse transcription followed by a PCR amplification step, using the RevertAid First strand cDNA synthesis Kit (Fermentas).
- the cDNA was cut with the enzymes Ncol and Hindlll, and cloned in vector pQ ⁇ 185 previously cut with the same enzymes, leading to plasmid 355.24, harboring GA cDNA.
- the sequence of the inserted cDNA was checked by DNA sequencing.
- Plasmid 355.24 was transformed in E. coli JM109. Expression was performed essentially as described for Q ⁇ VLP. A single colony was inoculated in LB medium containing 20 mg/L Ampicillin overnight without shaking. This inoculum was transferred the next day into a larger flask containing M9 medium supplemented with 1% casaminoacids, 0.2% glucose and 20 mg/L Ampicillin, and incubated under shaking for 14-20 h.
- GA VLP was isolated essentially as described for Q ⁇ VLP. Cells were lysed, and the cleared lysate was loaded onto a Sepharose CL-4B column (Amersham Pharmacia). The eluate was concentrated by ammonium sulphate precipitation, and rechromatographed onto a Sepharose CL-6B column (Amersham Pharmacia). The final step was either an ultracentrifugation on sucrose gradient (20-50%> w/v), or on CsCl. The isolated VLPs were subsequently dialysed against 20 mM Tris, 150 mMNaCl, pH 8.0. EXAMPLE 3
- Fluorescein labeled CpG-containing oligonucleotides can be packaged into BKV, HBcAg and Q ⁇ -VLPs.
- VLPs produced in yeast contain small amounts of RNA which can be easily digested and so eliminated by incubating the VLPs with RNase A.
- RNase A enzyme has a molecular weight of about 14 kDa and is small enough to enter the VLPs to eliminate the undesired ribonucleic acids.
- Recombinantly produced BKV VLPs (SEQ ID NO: 12) were concentrated to 1 mg/ml in PBS buffer pH7.2 and incubated in the absence or presence of RNase A (200 ⁇ g/ml, Roche Diagnostics Ltd, Switzerland) for 3 h at 37°C.
- BKV VLPs were supplemented with 75 nmol/ml 5'- fluorescein labeled phosphorothioate CpG-FAM oligonucleotide (oligonucleotide from SEQ ID NO: 34) and incubated for 3 h at 37°C. Subsequently BKV VLPs were subjected to DNasel digestion for 3 h at 37°C (40 u/ml AMPD1, Sigma, Division of Fluka AG, Switzerland) or loaded without DNasel digestion.
- the samples were complemented with 6-fold concentrated DNA-loading buffer (10 mM Tris pH7.5, 10% v/v glycerol, 0.4% orange G) and run for 1 h at 65 volts in a 0.8%> native tris-acetate pH 7.5 agarose gel.
- 6-fold concentrated DNA-loading buffer (10 mM Tris pH7.5, 10% v/v glycerol, 0.4% orange G)
- run for 1 h at 65 volts in a 0.8%> native tris-acetate pH 7.5 agarose gel Upon staining with ethidium bromide nucleic acids are detected, while in the absence of ethidium bromide UV excitation leads to fluorescence of the fluorescein-label in the CpG- FAM.
- BKV VLPs (15 ⁇ g) was analyzed by a native 0.8%) agarose gel electrophoresis after control incubation or after digestion with RNase A and subsequent incubation with double stranded (ds) DNA (246 bp) (SEQ ID NO: 17), upon staining with ethidium bromide or Coomassie Blue.
- the following samples were loaded on the gel: 1: BKV VLPs untreated; 2: BKV VLPs RNase A treated; 3: BKV VLPs treated with RNase A and incubated with dsDNA; lane M: Gene Ruler 1 kb DNA ladder (MBI Fermentas GmbH, Heidelberg, Germany).
- BKV VLPs (15 ⁇ g) was analyzed by a native 0.8% agarose gel electrophoresis after control incubation or after digestion with RNase A and subsequent incubation with CpG-oligonucleotides (with phosphate- or with phosphorothioate (pt) backbone) upon staining with ethidium bromide or Coomassie Blue.
- the RNase A treated recombinant BKV VLPs (Example 3) were supplemented with 50 ⁇ g/ml (ds) DNA fragments (246 bp in length, dsDNA, SEQ ID NO: 17) and incubated for 3 h at 37°C.
- the samples were complemented with 6-fold concentrated DNA-loading buffer (10 mM Tris pH8.0, 10% v/v glycerol, 0.4%o orange G) and ran for 1 h at 65 volts in a 0.8% native tris- acetate pH8.0 agarose gel.
- BKV VLPs (15 ⁇ g) were loaded on a native 0.8%o agarose gel electrophoresis and analyzed after control incubation or after digestion with RNase A and subsequent incubation with (ds) DNA upon staining with ethidium bromide or Coomassie Blue in order to assess the presence of RNA/DNA or protein.
- Packaged DNA molecules are visible in the presence of ethidium bromide as a band with the same migration as the VLP band visualized with Coomassie Blue.
- CpG-containing oligonucleotides can be packaged into BKV VLPs.
- the RNase A treated recombinant BKV VLPs (Example 3) were supplemented with 150 nmol/ml CpG- oligonucleotides CyCpG with phosphodiester backbone or CyCpGpt with phosphorothioate backbone and incubated for 3 h at 37°C.
- VLP preparations for mouse immunization were extensively dialysed (10,000-fold diluted) for 24 h against PBS pH7.2 with a 300 kDa MWCO dialysis membrane (Spectrum Medical industries Inc., Houston, USA) to eliminate RNase A and the excess of CpG-oligonucleotides.
- the samples were complemented with 6-fold concentrated DNA-loading buffer (10 mM Tris pH7.5, 10%> v/v glycerol, 0.4% orange G) and run for 1 h at 65 volts in a 0.8%o native tris-acetate pH7.5 agarose gel.
- BKV VLPs (15 ⁇ g) were loaded on a native 0.8%> agarose gel electrophoresis and analyzed after control incubation or after digestion with RNase A and subsequent incubation with CpG-oligonucleotides (with phosphodiester- or with phosphorothioate backbone) upon staining with ethidium bromide or Coomassie Blue in order to assess the presence of RNA/DNA or protein and the reduction of unbound CpG- oligonucleotides after dialysis. Unbound CpG-oligonucleotides are visible as a low molecular weight ethidium bromide stained band.
- VLPs containing CpG-oligonucleotides induce enhanced Thl directed immune response.
- Female BALB/c mice three mice per group were subcutaneously injected with
- mice 10 ⁇ g BKV VLPs containing phosphorothioate CpG-oligonucleotide CyCpGpt (SEQ ID NO: 34).
- mice were subcutaneously injected with either 10 ⁇ g of RNase treated BKV VLPs alone or BKV VLPs mixed with 0.3 nmol or 20 nmol phosphorothioate CpG-oligonucleotides in 200 ⁇ l PBS pH7.2 or were left untreated.
- BKV VLPs were prepared as described in Example 5 and before immunization extensively purified from unbound CpG-oligonucleotide by dialysis. On day 14 after immunization blood was taken and IgGl and IgG2a antibody response to BKV VLPs was determined (see Table 1).
- Table 1 Mouse IgGl and IgG2a OD50% antibody titers to BKV VLPs on day 14 after immunization with BKV VLPs and phosphorothioate (pt) CpG-oligonucleotides.
- CyCpGpt results in a decreased IgGl and an increased anti-BKV VLP IgG2a titer as compared to immunization with the same amount (0.3 nmol) of CpG- oligonucleotides mixed with BKV VLPs or BKV VLPs alone.
- Mice immunized with BKV VLPs mixed with 20 nmol phosphorothioate CpG-oligonucleotide CyCpGpt show very low IgGl and high IgG2a titers.
- Immunostimulatory nucleic acids can be packaged into HBcAg VLPs comprising fusion proteins with antigens.
- HBcAg VLPs when produced in E. coli by expressing the Hepatitis B core antigen fusion protein p33 -HBcAg (HBc33) (see Example 1) or the fusion protein to the peptide PI A (HBcPlA), contain RNA which can be digested and so eliminated by incubating the VLPs with RNase A.
- the gene PI A codes for a protein that is expressed by the mastocytoma tumor cell line P815.
- the dominant CTL epitope termed PI A peptide, binds to MHC class I (Ld) and the complex is recognized by specific CTL clones (Brandle et al, 1998, Eur. J.
- HBcP 1 A The fusion protein of HBcAg with P 1 A, termed HBcP 1 A, formed capsids when expressed in E. coli which could be purified similar to the procedure described in Example 1.
- Enzymatic RNA hydrolysis Recombinantly produced HBcAg-p33 (HBc33) and HBcAg-PlA (HBcPlA) VLPs at a concentration of 1.0 mg/ml in 1 x PBS buffer (KC1 0.2g/L, KH2PO4 0.2g/L, NaCl 8 g/L, Na2HPO4 1.15 g/L) pH 7.4, were incubated in the presence of 300 ⁇ g/ml RNase A (Qiagen AG, Switzerland) for 3 h at 37°C in a thermomixer at 650 rpm.
- RNase A Qiagen AG, Switzerland
- RNAse A HBcAg-p33 VLPs were supplemented with 130 nmol/ml CpG-oligonucleotides B- CpG, NKCpG, G10-PO (Table 2).
- the 150mer single-stranded Cyl50-1 and 253mer double stranded dsCyCpG-253, both containing multiple copies of CpG motifs were added at 130 nmol/ml or 1.2 nmol/ml, respectively, and incubated in a thermomixer for 3 h at 37°C.
- Double stranded CyCpG-253 DNA was produced by cloning a double stranded multimer of CyCpG into the EcoRV site of pBluescript KS-.
- the resulting plasmid produced in E. coli XL 1 -blue and isolated using the Qiagen Endofree plasmid Giga Kit, was digested with restriction endonucleases Xhol and Xbal and resulting restriction products were separated by agarose electrophoresis.
- the 253 bp insert was isolated by electro-elution and ethanol precipitation. Sequence was verified by sequencing of both strands.
- DNAse I treatment Packaged HBcAg-p33 VLPs were subsequently subjected to DNasel digestion (5 U/ml) for 3 h at 37°C (DNasel, RNase free Fluka AG, Switzerland) and were extensively dialysed (2 x against 200-fold volume) for 24 h against PBS pH 7.4 with a 300 kDa MWCO dialysis membrane (Spectrum Medical industries Inc., Houston, USA) to eliminate RNAse A and the excess of CpG-oligonucleotides.
- Benzonase treatment Since some single stranded oligodeoxynucleotides were partially resistant to DNasel treatment, Benzonase treatment was used to eliminate free oligonucleotides from the preparation. 100-120 U/ml Benzonase (Merck KGaA, Darmstadt, Germany) and 5 mM MgC12 were added and incubated for 3 h at 37°C before dialysis.
- VLP preparations packaged with immunostimulatroy nucleic acids used in mouse immunization experiments were extensively dialysed (2x against 200fold volume) for 24 h against PBS pH 7.4 with a 300 kDa MWCO dialysis membrane (Spectrum Medical Industries, Houston, US) to eliminate added enzymes and free nucleic acids.
- capsid 2-30 ⁇ g of capsid were mixed with 1 volume of 2x loading buffer (lxTBE, 42% w/v urea, 12% w/v Ficoll, 0.01 % Bromphenolblue), heated for 3 min at 95°C and loaded on a 10%> (for oligonucleotides of about 20 nt length) or 15%) (for > than 40 mer nucleic acids) TBE/urea polyacrylamid gel (Invitrogen). Alternatively samples were loaded on a 1% agarose gel with 6x loading dye (10 mM Tris pH 7.5, 50 mM EDTA, 10% v/v glycerol, 0.4 % orange G). TBE/urea gels were stained with SYBRGold and agarose gels with stained with ethidium bromide.
- 2x loading buffer lxTBE, 42% w/v urea, 12% w/v Ficoll, 0.01 % Bromphenolblue
- the oligonucleotides B-CpG, NKCpG and G10-PO were packaged into HBc33.
- the analysis of B-CpG packaged into HBc33 VLPs was done on a 1%> agarose gel stained with ethidium bromide and Coomassie Blue. Loaded on the gel were 50 ⁇ g of the following samples: 1. HBc33 VLP untreated; 2. HBc33 VLP treated with RNase A; 3. HBc33 VLP treated with RNase A and packaged with B-CpG; 4. HBc33 VLP treated with RNase A, packaged with B-CpG and treated with DNasel; 5.
- the amount of packaged B-CpG extracted from the VLP was analyzed on a 1.5 %> agarose gel stained with ethidium bromide: Loaded on gel were the following samples: 1. 0.5 nmol B-CpG control; 2. 0.5 nmol B-CpG control; 3. B-CpG oligo content HBc33 after phenol / chloroform extraction; 4. B-CpG oligo content HBc33 after phenol / chloroform extraction and RNase A treatment; 5. B-CpG oligo content HBc33 after phenol/ chloroform extraction and DNasel treatment; 6. empty; 7. MBI Fermentas 100 bp DNA ladder.
- NKCpG packaged into HBc33 VLPs was done on a 1% agarose gel stained with ethidium bromide and Coomassie Blue. Loaded on the gel were 15 ⁇ g of the following samples: 1. HBc33 VLP untreated; 2. HBc33 VLP treated with RNase A; 3. HBc33 VLP treated with RNase A and packaged with NKCpG; 4. HBc33 VLP treated with RNase A, packaged with NKCpG, treated with DNasel and dialysed; 5. 1 kb MBI Fermentas DNA ladder.
- the analysis of the amount of packaged NKCpG extracted from the VLP was analyzed on a 15% TBE/urea gel stained with SYBR Gold. Loaded on gel were the following samples: 1. NKCpG oligo content HBc33 after proteinase K digestion and RNase A treatment; 2. 20 pmol NKCpG control; 3. 10 pmol NKCpG control; 4. 40 pmol NKCpG control.
- glOgacga-PO packaged into HBc33 VLPs was done on a 1%> agarose gel stained with ethidium bromide and Coomassie Blue. Loaded on the gel were 15 ⁇ g of the following samples: 1. 1 kb MBI Fermentas DNA ladder; 2. HBc33 VLP untreated; 3. HBc33 VLP treated with RNase A; 4. HBc33 VLP treated with RNase A and packaged with glOgacga-PO; 5. HBc33 VLP treated with RNase A, packaged with glOgacga-PO, treated with Benzonase and dialysed.
- RNA content in the VLPs was strongly reduced after RNaseA treatment while most of the capsid migrated as a a slow migrating smear presumably due to the removal of the negatively charged RNA.
- the capsids contained a higher amount of nucleic acid than the RNAse A treated capsids and therefore migrated at similar velocity as the untreated capsids. Additional treatment with DNAse I or Benzonase degraded the free oligonucleotides while oligonucleotides packaged in the capsids did not degrade, clearly showing packaging of oligonucleotides.
- oligonucleotides released from the capsid with the procedure described above were of the same size than the oligonucleotide used for packaging clearly demonstrated packaging of oligonucleotides.
- Cyl50-1 was packaged into HBc33.
- Cyl50- 1 contains 7.5 repeats of CyCpG and was synthesized according standard oligonucleotide synthesis methods (IBA, G ⁇ ttingen, Germany).
- the analysis of Cyl50-1 packaged into HBc33 VLPs was analyzed on a 1% agarose gel stained with ethidium bromide and Coomassie Blue. Loaded on the gel were 15 ⁇ g of the following samples: 1. 1 kb MBI Fermentas DNA ladder; 2. HBc33 VLP untreated; 3. HBc33 VLP treated with RNase A; 4. HBc33 VLP treated with RNase A and packaged with Cyl 50-1; 5.
- the analysis of the amount of packaged Cyl 50-1 extracted from the VLP was analyzed on a 10 % TBE/urea gel stained with SYBR Gold. Loaded on gel are the following samples: 1. 20 pmol Cyl 50-1 control; 2. 10 pmol Cyl50-1 control; 3. 4 pmol Cyl50-1 control; 4. Cyl 50-1 oligo content of 4 ⁇ g HBc33 after 3 min at 95°C with 1 volume TBE/urea sample buffer.
- RNA content in the capsid was strongly reduced after RNaseA treatment while most of the capsid migrated as a slow migrating smear.
- Capsid were diluted with 4 volumes of water and concentrated to 1 mg/ml. After incubation with an excess of Cyl 50- 1 the capsid contained a bigger amount of nucleic acid and thus migrated at similar velocity as the untreated capsids. Additional treatment with DNAsel degraded the free, not packaged oligonucleotides while oligonucleotides in capsids were not degraded. Release of the DNAsel-resistant nucleic acid from the packaged VLPs by heating for 3 min at 95°C in TBE/urea loading buffer revealed the presence of the 150 mer.
- the oligonucleotide NKCpGpt was also packaged into HBcPlA.
- the analysis of NKCpGpt packaged into HBcPlA VLPs was done on a 1% agarose gel stained with ethidium bromide and Coomassie Blue. Loaded on the gel were 15 ⁇ g of the following samples: 1. 1 kb MBI Fermentas DNA ladder; 2. HBcPlA VLP untreated; 3. HBcPlA VLP treated with RNase A; 4. HBcP 1 A VLP treated with RNase A and packaged with NKCpGpt. Treatment with RNAse reduced nucleic acid content and slowed migration of the capsids. Addition of NKCpGpt restored nucleic acid content in capsids and fast migration.
- Immunostimulatory nucleic acids can be packaged in HBcAg-wt coupled with antigens.
- HBcAg-wt VLPs were packaged after coupling with peptide p33 (CGG-KAVYNFATM) (SEQ ID NO: 81), derived from lymphocytic choriomeningitis viras (LCMV).
- CGG-KAVYNFATM CGG-KAVYNFATM
- LCMV lymphocytic choriomeningitis viras
- VLPs were dialyzed to Mes buffer (2-(N-morpholino) ethanesulphonic acid) pH 7.4 for 2 x 2 h using MWCO 10.000 kD dialysis membranes at 4°C.
- VLPs (50 ⁇ M) were subsequently coupled to the N-terminal cysteine of the p33 peptide (250 ⁇ M) during a 2 h incubation in a thermomixer at 25°C.
- Samples were dialyzed (MWCO 300.000) extensively to lx PBS pH 7.4 to eliminate undesired free peptide.
- HBcAg-wt VLPs derivatization with SMPH and coupling to p33 peptide was analyzed on SDS-PAGE. Samples were analysed by 16% SDS PAGE and stained with Coomassie Blue. Loaded on the gel were the following samples: 1.NEB Prestained Protein Marker, Broad Range (# 7708S), 10 ⁇ l; 2. ⁇ 33 peptide; 3. HBcAg-wt VLP derivatized with SMPH, before dialysis; 4. HBcAg-wt VLP derivatized with SMPH, after dialysis; 5. HBcAg- wt VLP coupled with p33, supernatant; 6.
- HBcAg-wt was visible as a 21 kD protein band. Due to the low molecular weigth of SMPH is the derivatised product only slightly larger and can not be distinguished by SDS-PAGE. Peptide alone was visible as a 3 kD band and coupled product, termed HBx33, showed a strong secondary band at approximately 24 kD accounting for more than 50%> of total HBcAg-wt.
- Enzymatic RNA hydrolysis HBx33 VLPs (0.5-1.0 mg/ml, lxPBS buffer pH7.4) in the presence of RNase A (300 ⁇ g/ml, Qiagen AG, Switzerland) were diluted with 4 volumes H2O to decrease salt concentration to a final 0.2xPBS concentration and incubated for 3 h at 37°C in a thermomixer at 650 rpm.
- VLP preparations for mouse immunization were extensively dialysed (2x against 200-fold volume) for 24 h against PBS pH 7.4 with a 300 kDa MWCO dialysis membrane (Spectrum Medical industries Inc., Houston, USA) to eliminate RNase A and the excess of CpG-oligonucleotides.
- VLPs was done on a 1%> agarose gel stained with ethidium bromide and Coomassie Blue. Loaded on the gel were 50 ⁇ g of the following samples: 1. HBx33 VLP untreated; 2. HBx33 VLP treated with RNase A; 3. HBx33 VLP treated with RNase A and packaged with B-CpGpt; 4. HBx33 VLP treated with RNase A, packaged with B-CpGpt and treated with DNasel; 5. HBx33 VLP treated with RNase A, packaged with B-CpGpt, treated with DNasel and dialysed; 6. 1 kb MBI Fermentas DNA ladder.
- RNAse treatment reduced the nucleic acid content of the capsids and slowed their migration.
- Addition of B-CpGpt restored nucleic acid content and fast migration of capsids.
- DNAse I only digested the free oligonucleotides while the packaged oligonucleotides remained in the VLP also after dialysis.
- Immunostimulatory nucleic acids can be packaged into Q ⁇ VLPs coupled with antigens.
- VLPs were used untreated or after coupling to p33 peptides containing an N-terminal CGG or and C-terminal GGC extension (CGG-KAVYNFATM (SEQ ID NO: 81) and KAVYNFATM-GGC (SEQ ID NO: 82)).
- Recombinantly produced Q ⁇ VLPs were derivatized with a 10 molar excess of SMPH (Pierce) for 0.5 h at 25°C, followed by dialysis against 20 mM HEPES, 150 mM NaCl, pH 7.2 at 4°C to remove unreacted SMPH.
- Q ⁇ VLPs when produced in E. coli by expressing the bacteriophage Q ⁇ capsid protein, contain RNA which can be digested and so eliminated by incubating the VLPs with RNase A.
- Q ⁇ VLPs at a concentration of 1.0 mg/ml in 20mM Hepes/150mM NaCl buffer (HBS) pH 7.4 were either digested directly by addition of RNase A (300 ⁇ g/ml, Qiagen AG, Switzerland) or were diluted with 4 volumes H2O to a final 0.2 x HBS concentration and then incubated with RNase A (60 ⁇ g/ml, Qiagen AG, Switzerland). Incubation was allowed for 3 h at 37°C in a thermomixer at 650 rpm.
- RNA hydrolysis from Qb VLPs by RNase A under low and high ionic strength was analyzed on a 1 %> agarose gel stained with ethidium bromide and Coomassie Blue.
- Q ⁇ VLPs Low ionic strength increases nucleic acid packaging in Q ⁇ VLPs: After RNase A digestion in 0.2 x HBS the Q ⁇ VLPs were concentrated to 1 mg/ml using Millipore Microcon or Centriplus concentrators and aliquots were dialysed against lx HBS or 0.2 x HBS. Q ⁇ VLPs were supplemented with 130 nmol/ml CpG- oligonucleotide B-CpG and incubated in a thermomixer for 3 h at 37°C. Subsequently Q ⁇ VLPs were subjected to Benzonase digestion (100 U/ml) for 3 h at 37°C.
- Samples were analysed on 1%> agarose gels after staining with ethidium bromide or Coomassie Blue. Loaded on the gel were the following samples: 1. Qb VLP untreated; 2. Qb VLP treated with RNase A; 3. Qb VLP treated with RNase A and packaged with B-CpG in 0.2x HBS buffer pH7.2 and treated with Benzonase; 4. HBx33 VLP (see example 12) treated with RNase A, packaged with B-CpG in lx HBS buffer pH7.2 and treated with Benzonase.
- Different immunostimulatory nucleic acids can be packaged in Q ⁇ and Qbx33 VLPs: After RNase A digestion in 0.2 x HBS the Q ⁇ VLPs or Qbx33 VLPs were concentrated to 1 mg/ml using Millipore Microcon or Centriplus concentrators and supplemented with 130 nmol/ml CpG-oligonucleotides B-CpGpt, glOgacga and the 253 mer dsCyCpG-253 (Table 2) and incubated in a thermomixer for 3 h at 37°C.
- Q ⁇ VLPs or Qbx33 VLPs were subjected to DNAse I digestion (5 U/ml) or Benzonase digestion (100 U/ml) for 3 h at 37°C. Samples were analysed on 1%> agarose gels after staining with ethidium bromide or Coomassie Blue.
- Loaded on the gel were 50 ⁇ g of the following samples: 1. Qbx33 VLP untreated; 2. Qbx33 VLP treated with RNase A; 3. Qbx33 VLP treated with RNase A and packaged with B-CpGpt; 4. Qbx33 VLP treated with RNase A, packaged with B-CpGpt, treated with DNasel and dialysed; 5. 1 kb MBI Fermentas DNA ladder.
- C depicts the analysis of the amount of packaged oligo extracted from the VLP on a 15% TBE/urea stained with SYBR Gold. Loaded on gel are the following samples: 1. BCpGpt oligo content of 2 ⁇ g Qbx33 VLP after proteinase K digestion and RNase A treatment; 2. 20 pmol B-CpGpt control; 3. 10 pmol B-CpGpt control; 4. 5 pmol B-CpGpt control.
- Loaded on another gel were 15 ⁇ g of the following samples: 1. MBI Fermentas 1 kb DNA ladder; 2. Qbx33 VLP untreated; 3. Qbx33 VLP treated with RNase A; 4. Qbx33 VLP treated with RNase A and packaged with glOgacga-PO; 5. Qbx33 VLP treated with RNase A, packaged with glOgacga-PO, treated with Benzonase and dialysed.
- Loaded on a third gel were 15 ⁇ g of the following samples: 1. MBI Fermentas 1 kb DNA ladder; 2. Qbx33 VLP untreated; 3. Qbx33 VLP treated with RNase A; 4. Qbx33 VLP treated with RNase A, packaged with dsCyCpG-253 and treated with DNasel; 5. Qbx33 VLP treated with RNase A, packaged with dsCyCpG-253, treated with DNasel and dialysed.
- the different nucleic acids B-CpGpt, glOgacga and the 253mer dsDNA could be packaged into Qbx33.
- Packaged nucleic acids were resistant to DNAse I digestion and remained packaged during dialysis.
- Packaging of B-CpGpt was confirmed by release of the nucleic acid by proteinase K digestion followed by agarose electrophoresis and ethidium bromide staining.
- Disassembly 40 mg of lyophilized purified AP205 VLP (SEQ-ID: 80 or 81) were resolubilized in 4 ml 6 M GuHCl, and incubated overnight at 4°C. The disassembly mixture was centrifuged at 8000 rpm (Eppendorf 5810 R, in fixed angle rotor F34-6-38, used in all the following steps). The pellet was resolubilized in 7 M urea, while the supernatant was dialyzed 3 days against NET buffer (20 mM Tris-HCl, pH 7.8 with 5mM EDTA and 150 mM NaCl) with 3 changes of buffer. Alternatively, dialysis was conducted in continuous mode over 4 days.
- NET buffer 20 mM Tris-HCl, pH 7.8 with 5mM EDTA and 150 mM NaCl
- the dialyzed solution was centrifuged at 8000 rpm for 20 minutes, and the pellet was resolubilized in 7 M urea, while the supernatant was pelletted with ammonium sulphate (60% saturation), and resolubilized in a 7 M urea buffer containing 10 mM DTT.
- the previous pellets all resolubilized in 7 M urea were joined, and precipitated with ammonium sulphate (60%> saturation), and resolubilized in a 7 M urea buffer containing 10 mM DTT.
- Reassembly 1.1 ml beta-mercaptoethanol was added to the sample, and the following reassembly reactions were set up:
- the EM procedure was as follows: A suspension of the proteins was absorbed on carbon-formvar coated grids and stained with 2% phosphotungstic acid (pH 6,8). The grids were examined with a JEM 100C (JEOL, Japan) electron microscope at an accelerating voltage of 80 kV. Photographic records (negatives) were performed on Kodak electron image film and electron micrographs were obtained by printing of negatives on Kodak Polymax paper. The VLP reassembled in the presence of the CyCpG was purified over a Sepharose 4B column (1 X 50 cm), eluted with NET buffer (1 ml/h). The fractions were analyzed by Ouchterlony assay, and the fractions containing VLP were pooled.
- a band migrating at the same height than intact AP205 VLP and staining both for ethidium-bromide and Coomassie blue staining could be obtained, showing that AP205 VLP containing oligodeoxynucleotide had been reassembled.
- the extensive dialysis steps following the reassembly procedure are likely to have led to diffusion of the oligodeoxynucleotide outside of the VLPs.
- the AP205 VLPs could also be reassembled in the absence of detectable oligodeoxynucleotide, as measured by agarose gel electrophoresis using ethidium bromide staining.
- Oligodeoxynucleotides could thus be successfully bound to AP205 VLP after initial disassembly of the VLP, purification of the disassembled coat protein from nucleic acids and subsequent reassembly of the VLP in the presence of oligodeoxynucleotide.
- the ratio of absorbance at 280 nm to the absorbance at 260 nm of the sample was of 0.16 to 0.125.
- the sample was diluted 50 times for the measurement.
- Reassembly The protein preparation resulting from the Sephadex G-75 gel filtration purification step was precipitated with ammonium sulphate at 60%> saturation, and the resulting pellet solubilized in 2 ml 7 M urea, 10 mM DTT.
- the sample was diluted with 8 ml of 10%> 2-mercaptoethanol in NET buffer, and dialyzed for 1 hour against 40 ml of 10%o 2-mercaptoethanol in NET buffer.
- Reassembly was initiated by adding 0.4 ml of a CyCpG solution (109 nmol/ml) to the protein sample in the dialysis bag. Dialysis in continous mode was set up, and NET buffer used as eluting buffer. Dialysis was pursued for two days and a sample was taken for EM analysis after completion of this dialysis step. The dialyzed reassembly solution was subsequently dialyzed against 50%) v/v Glycerol in NET buffer, to achieve concentration. One change of buffer was effected after one day of dialysis. The dialysis was pursued over a total of three days.
- the dialyzed and concentrated reassembly solution was purified by gel filtration over a Sepharose 4-B column (1X60 cm) at a flow rate of 1 ml/hour, in NET buffer. Fractions were tested in an Ouchterlony assay, and fractions containing capsids were dried, resuspended in water, and rechromatographed on the 4-B column equilibrated in 20 mM Hepes pH 7.6. Using each of the following three formula:
- the reassembled AP205 VLPs were analyzed by EM as described above, agarose gel electrophoresis and SDS-PAGE under non-reducing conditions.
- the EM analysis of disassembled material shows that the treatment of AP205 VLP with guanidinium-chloride essentially disrupts the capsid assembly of the VLP.
- Reassembly of this disassembled material with an oligonucleotide yielded capsids, which were purified and further enriched by gel filtration. Two sizes of particles were obtained; particles of about 25 nm diameter and smaller particles are visible in the electron micrograph. No reassembly was obtained in the absence of oligonucleotides. Loading of the reassembled particles on agarose electrophoresis showed that the reassembled particles contained nucleic acids.
- 150 mM NaCl, pH 7.4 was reacted at a concentration of 1.4 mg/ml with a 5-fold excess of the crosslinker SMPH diluted from a 50 mM stock in DMSO for 30 minutes at 15 °C.
- the obtained so-called derivatized AP205 VLP was dialyzed 2 X 2 hours against at least a 1000-fold volume of 20 mM Hepes, 150 mM NaCl, pH 7.4 buffer.
- the derivatized AP205 was reacted at a concentration of 1 mg/ml with either a 2.5-fold, or with a 5-fold excess of peptide, diluted from a 20 mM stock in DMSO, for 2 hours at 15 °C.
- the sample was subsequently flash frozen in liquid nitrogen for storage.
- the coupling reaction was analyzed on an SDS-PAGE. Loaded on a gel were the following samples: protein marker; derivatized AP205 VLP (d); AP205 VLP coupled with a 2.5-fold excess of peptide, supernatant (s); AP205 VLP coupled with a 2.5-fold excess of peptide, pellet (p); AP205 VLP coupled with a 5-fold excess of peptide, supernatant (s); AP205 VLP coupled with a 5-fold excess of peptide, pellet (p).
- the result of the coupling reaction revealed that a higher degree of coupling could be achieved by using a 5-fold excess of peptide rather than with a 2.5 fold excess of peptide in the coupling reaction.
- Non-enzymatic hydrolysis of the RNA content of VLPs and packaging of immunostimulatory nucleic acids are included in the RNA content of VLPs and packaging of immunostimulatory nucleic acids.
- ZnSO4 dependent degradation of the nucleic acid content of a VLP 5 mg Q ⁇ VLP (as determined by Bradford analysis) in 20 mM HEPES, pH 7.4, 150 mM NaCl was dialysed either against 2000 ml of 50 mM TrisHCl pH 8.0, 50 mM NaCl, 5% glycerol, 10 mM MgC12 or 2000 ml of 4 mM HEPES, pH 7.4, 30 mM NaCl for 2 h at 4°C in SnakeSkinTM pleated dialysis tubing (Pierce, Cat. No. 68035). Each of the dialysis buffers was exchanged once and dialysis was allowed to continue for another 16 h at 4°C.
- the dialysed solution was clarified for 10 minutes at 14 000 rpm (Eppendorf 5417 R, in fixed angle rotor F45-30-11, used in all the following steps) and proteinconcentration was again determined by Bradford analysis.
- Q ⁇ VLPs in 50 mM TrisHCl pH 8.0, 50 mM NaCl, 5% glycerol, 10 mM MgC12 were diluted with the corresponding buffer to a final protein concentration of 1 mg/ml whereas Q ⁇ VLPs in 4 mM HEPES pH 7.4, 30 mM NaCl were diluted with the corresponding buffer to a final protein concentration of 0.5 mg/ml.
- This capsid-containing solutions were centrifuged again for 10 minutes at 14 000 rpm at 4°C. The supernatants were than incubated with ZnSO4 which was added to a final concentration of 2.5 mM for 24 h at 60°C in an
- ZnSO4-treated Q ⁇ VLPs was analyzed by agarose gelelectrophoresis: Q ⁇ VLPs which had been purified from E.coli and dialysed either against buffer 1 (50 mM TrisHCl pH 8.0, 50 mM NaCl, 5% glycerol, 10 mM MgC12) or buffer 2 (4 mM HEPES, pH 7.4, 30 mM aCl) were incubated either without or in the presence of 2.5 mM zinc sulfate (ZnSO4) for 24 hrs at 60°C.
- buffer 1 50 mM TrisHCl pH 8.0, 50 mM NaCl, 5% glycerol, 10 mM MgC12
- buffer 2 4 mM HEPES, pH 7.4, 30 mM aCl
- ZnSO4-treated and dialysed Q ⁇ capsids with a protein concentration (as determined by Bradford analysis) beween 0.4 mg/ml and 0.9 mg/ml (which corresponds to a concentration of capsids of 159 nM and 357.5 nM, respectively) were used for the packaging of the oligodeoxynucleotides.
- the oligodeoxynucleotides were added at a 300- fold molar excess to the of Q ⁇ -VLP capsids and incubated for 3 h at 37°C in an
- VLPs 25 ⁇ g of these VLPs were digested with 25 ⁇ l Benzonase (Merck, Cat. No. 1.01694.0001) according to the manufactures instructions. After heat- inactivation of the nuclease (30 minutes at 80°C) the VLPs were treated with Proteinase K (final enzyme concentration was 0.5 mg/ml) according to the manufactures instructions. After 3 hrs the equivalent of 2 ug Q ⁇ VLPs which had been digested by Benzonase and proteinase K were mixed with TBE-Urea sample buffer and loaded on a 15%> polyacrylamide TBE-Urea gel (Novex®, Invitrogen Cat. No. EC6885).
- the capsids loaded in lane 2 were treated with 2.5 mM ZnSO4 in presence of buffer 1 (see above), while the capsids loaded in lane 3 were treated with 2.5 mM ZnSO4 in presence of buffer 2 (see above).
- 1 pmol, 5 pmol and 10 pmol of the oligodeoxynucleotide which was used for the reassembly reaction was loaded onto the same gel (lanes 4 - 6).
- Q ⁇ capsids which had been purified from E.coli were treated exactly the same and analyzed on the same polyacrylamide TBE-Urea gel (lane 1).
- RNaseA and ZnSO4 mediated degradation of the nucleic acid content of a VLP.
- Q ⁇ VLPs were treated with RNaseA as described in Example 9 under low ionic strength conditions (20 mM Hepes pH 7.4 or 4 mM Hepes, 30 mM NaCl, pH 7.4 ).
- other VLPs such as described in Examples 2, 3, 7, and 10, i.e. GA, BKV, HBcAg, and AP205 are treated.
- Q ⁇ VLPs and AP205 VLPs were treated with ZnSO4 under low ionic strength conditions (20 mM Hepes pH 7.4 or 4 mM Hepes, 30 mM NaCl pH 7.4) as described in Example 11.
- AP205 VLP (1 mg/ml) in either 20 mM Hepes pH 7.4 or 20 mM Hepes, 1 mM Tris, pH 7.4 was treated for 48 h with 2.5 mM ZnSO4 at 50°C in an Eppendorf Thermomixer comfort at 550 rpm.
- Q ⁇ and AP205 VLP samples were clarified as described in Example 11 and supernatants were dialysed in 10.000 MWCO Spectra/Por® dialysis tubing (Spectrum, Cat. nr. 128 118) against first 2 1 20 mM Hepes, pH 7.4 for 2 h at 4°C and, after buffer exchange, overnight. Samples were clarified after dialysis as described in Example 11 and protein concentration in the supernatants was determined by Bradford analysis.
- RNA hydrolysis and dialysis Q ⁇ and AP205 VLPs (1-1.5 mg/ml) were mixed with 130 ⁇ l of CpG oligonucleotides (NKCpG, G10-PO - cf. Table 2; G3-6, G8-8 - cf. Table 3; 1 mM oligonucleotide stock in 10 mM Tris pH 8) per ml of VLPs. Samples were incubated for 3 h at 37°C in a thermoshaker at 650 rpm.
- samples were treated with 125 U Benzonase/ml VLPs (Merck KGaA, Darmstadt, Germany) in the presence of 2 mM MgC12 and incubated for 3 h at 37°C before dialysis.
- Samples were dialysed in 300.000 MWCO Spectra/Por® dialysis tubing (Spectrum, Cat. nr. 131 447) against 20 mM Hepes, pH 7.4 for 2 h at 4°C, and after buffer exchange overnight against the same buffer. After dialysis samples were clarified as described in Example 11 and protein concentration in the supernatants were determined by Bradford analysis.
- Q ⁇ VLPs, packaged with ISS were coupled to p33 peptides containing a C- terminal GGC extension (KAVYNFATM-GGC) (SEQ ID NO: 82), resulting in Qb VLPs termed Qb-ISS-33 VLPs.
- Qb-ISS-33 VLPs a C- terminal GGC extension
- Packaged Q ⁇ VLPs in 20 mM Hepes, pH 7.4 were derivatized with a 10-fold molar excess of SMPH (Pierce) for 0.5 h at 25°C, followed by two dialysis steps of 2 hours each against 20 mM HEPES pH 7.4 at 4°C to remove unreacted SMPH.
- AP205 VLPs (1.24 mg/ml) packaged with G8-8 oligonucleotide as described above are derivatized and coupled to MelanA 16-35 A/L containing a N-terminal C extension (c GHGHSYTTAE ELAGIGILTV) (SEQ ID NO: 55), resulting in AP205-G8- 8-MelanA VLPs.
- AP205 VLPs (packaged with G8-8), in 20 mM Hepes pH 7.4, are derivatized with a 20-fold molar excess of SMPH for 0.5 h at 25°C, and subsequently dialysed two times against 20 mM HEPES, pH 7.4 at 4°C to remove unreacted SMPH.
- Peptide is added to the dialyzed derivatization mixture in a 10-fold molar excess and allowed to react for 2 h in a thermomixer at 25°C.
- Samples were dialysed in 10.000 MWCO dialysis tubing against 20 mM Hepes pH 7.4 for 2 h at 4°C, and after buffer exchange, overnight against the same buffer. After dialysis, samples are clarified as described in Example 11 and protein concentration in the supernatants are determined by Bradford analysis. Coupling efficiency of peptide MelanA 16-35 A/L to AP205 is analysed by SDS-PAGE on 16% PAGE Tris-Glycine gels.
- G8-8 oligonucleotide packaging in AP205 is analysed on 1% agarose gels and, after proteinase K digestion, G8- 8 oligonucleotide amount in AP205-G8-8- MelanA 16-35 A/L is analysed on TBE/urea gels as described in Example 7.
- Packaging of RNAseA and ZnSO4-treated Q ⁇ VLPs with NKCpG before as well as after coupling to p33 peptide was analyzed by agarose gelelectrophoresis.
- Q ⁇ VLPs containing NKCpG oligonucleotides and subsequently coupled to p33 peptide were termed Qb-NKCpG-33 VLPs.
- both RNaseA and ZnSO4 treated Q ⁇ VLPs contain NKCpG oligonucleotides before as well as after coupling to p33 peptide. Coupling efficiency of the p33 peptide is maintained as can be judged from the multiple coupling products visible after SDS-PAGE analysis on a 16 % PAGE Tris-Glycine gel, as bands migrating slower than residual Q ⁇ VLP subunit monomers which have not reacted with peptide.
- the packaging efficiency can be estimated from the analysis of the TBE/urea gel by comparison of the signal of the oligonucleotide from the packaged Qb-NKCpG-33 lane with the signal of the oligonucleotide standard loaded on the same gel.
- Packaged amounts of NKCPG were between 1 and 4 nmol/100 ⁇ g Qb-NKCpG-33 VLPs.
- Q ⁇ VLPs containing G8-8 oligonucleotides and subsequently coupled to p33 peptide were termed Qb-G8-8-33 VLPs.
- Ethidium bromide staining of G8-8 packaged Q ⁇ VLPs can be seen on a 1 %> agarose gel stained with ethidium bromide. Comigration of the ethidium bromide fluorescent band with the Q ⁇ VLP protein band visible on the same gel subsequently stained with Coomassie Blue demonstrates packaging.
- Coupling efficiency can be estimated to be 30%> by SDS-PAGE analysis on a 16 % PAGE Tris-Glycine gel. Analysis of the G8-8 content of Qb-G8-8-33 VLPs was done on a 1% agarose gel, where the amount of oligonucleotide packaged was of approximately 1 nmol/100 ⁇ g Qb-G8-8-33 VLPs.
- Packaging of G8-8 oligonucleotides into AP205 VLPs was analyzed by agarose gelelectrophoresis. Staining of G8-8 packaged AP205 VLPs can be seen on a 1 %> agarose gel stained with ethidium bromide. Comigration of the AP205 VLPs protein band detected on the same gel subsequently stained with Coomassie Blue demonstrated packaging. Coupling efficiency with the MelanA 16-35 A/L peptide can be estimated from the SDS-PAGE analysis on a 16 % PAGE Tris-Glycine gel where multiple coupling bands migrating slower than the residual AP205 VLP monomer subunits, which did not react with peptide, cam be visible.
- Coupling efficiency is compared to the coupling efficiency obtained for the Qb-G8-8-33 VLPs.
- Analysis of the G8-8 oligonucleotide content of AP205 VLPs after coupling to MelanA 16-35 A/L can be seen on TBE/urea gel electrophoresis.
- Qbx33 VLPs (Q ⁇ VLPs coupled to peptide p33, see Example 9) were treated with RNaseA under low ionic conditions (20 mM Hepes pH 7.4) as described in Example 9 to hydrolyse RNA content of the Qbx33 VLP.
- RNaseA low ionic conditions
- Qbx33 VLPs were mixed with guanosine flanked oligonucleotides (Table 2: G10-PO, Table 3: G3-6, G7-7, G8-8, G9-9 or G6, from a 1 mM oligonucleotide stock in 10 mM Tris pH 8) and incubated as described in Example 12.
- Qbx33 VLPs were treated with Benzonase and dialysed in 300.000 MWCO tubing.
- Samples with oligos G7- 7, G8-8 and G9-9 were extensively dialysed over 3 days with 4 buffer exchanges to remove free oligo.
- Packaging was analysed on 1% agarose gels and, after proteinase K digestion, on TBE/urea gels as described in Example 7.
- the amount of the G3-6 oligonucleotide (approximately 4 nmol/100 ⁇ g Qbx33 VLPs) packaged is much higher than the amount of packaged G8-8 oligonucleotide (approximately 1 nmol/100 ⁇ g Qbx33 VLPs). This indicates a dependence of packaging ability on the length of the guanosine nucleotides tail flanking the CpG motif.
- Q ⁇ VLPs were treated with ZnSO4 under low ionic strength conditions (20 mM Hepes pH 7.4 or 4 mM Hepes, 30 mM NaCl, pH 7.4) as described in Example 11.
- AP205 VLPs (1 mg/ml) in either 20 mM Hepes pH 7.4 or 20 mM Hepes, 1 mM Tris, pH 7.4 were treated for 48 h with 2.5 mM ZnSO4 at 50°C in an Eppendorf Thermomixer comfort at 550 rpm.
- Q ⁇ and AP205 VLP samples were clarified as in Example 11 and dialysed against 20 M Hepes, pH 7.4 as in Example 12.
- the immunostimulatory ribonucleic acid poly (I:C), (Cat. nr. 27-4732-01, poly(I) # poly(C), Pharmacia Biotech) was dissolved in PBS (Invitrogen cat. nr. 14040) or water to a concentration of 4 mg/ml (9 ⁇ M).
- Poly (I:C) was incubated for 10 minutes at 60°C and then cooled to 37°C. Incubated poly (I:C) was added in a 10-fold molar excess to either ZnSO4-treated Q ⁇ or AP205 VLPs (1-1.5 mg/ml) and the mixtures were incubated for 3 h at 37°C in a thermomixer at 650 rpm.
- Q ⁇ VLPs (1 mg/ml) packaged with poly (I:C) were derivatized and coupled either to p33 peptide (KAVYNFATM-GGC) (SEQ ID NO: 82) as described in Example 12, or to MelanA peptide (MelanA 16-35A/L CGHGHSYTTAEELAGIGILTV) (SEQ ID NO: 55), resulting in Qb-pIC-33 and Qb-pIC-MelanA VLPs, respectively.
- the packaged Q ⁇ VLP was derivatized with a 2.1 -fold molar excess of SMPH (Pierce) for 0.5 h at 25°C, followed by two dialysis steps against 20 mM HEPES, pH 7.4 at 4°C to remove unreacted SMPH. Peptides were added in a 2.1 -fold molar excess and allowed to react for 1.5 h in a thermomixer at 25°C. Samples were dialysed in 300.000 MWCO Spectra/Por® CE Dispo Dialyzer against 20 mM Hepes, pH 7.2 for 3 h at 4°C, and after buffer exchange, overnight against the same buffer.
- the packaging efficiency into Qb-pIC-MelanA could be estimated from the TBE/urea gel; the packaged amount of poly (I:C) in Q ⁇ was approximately 25 pmol and remained the same upon MelanA coupling.
- AP205 VLPs (1 mg/ml) packaged with poly (I:C) are derivatized and coupled to
- AP205 VLPs in 20 mM Hepes, pH 7.4 are derivatized with a 20-fold molar excess of SMPH for 0.5 h at 25°C, and subsequently dialysed two times against 20 mM HEPES, pH 7.4 at 4°C to remove unreacted SMPH. Peptide is added to the dialyzed derivatization mixture in a 10-fold molar excess and allowed to react for 2 h in a thermomixer at 25°C.
- Packaging of poly (I:C) into ZnSO4 treated AP205 VLPs and the coupling product AP205-pIC -MelanA after coupling to MelanA is analyzed by agarose gelelectrophoresis. Coupling efficiency of the MelanA peptide is estimated from the appearance of multiple coupling products visible as bands migrating slower than AP205 VLP subunit monomer, which do not react with peptide, after SDS-PAGE analysis on a 16 %> PAGE Tris-Glycine gel electrophoresis. The packaging efficiency can be estimated from the TBE gel.
- HBcAg VLPs are treated with RNaseA under low ionic strength conditions (20 mM Hepes pH 7.4) as described in Example 9 to hydrolyse RNA content of the VLP.
- VLPs are mixed with guanosine flanked oligonucleotides (Table 3; G3-6, G7-7, G8-8, G9-9, G10-PO or G6, 1 mM stock in 10 mM Tris pH 8) and incubated as described in Example 12.
- VLPs are treated with Benzonase and dialysed in 300.000 MWCO tubing. Packaging is analysed on 1% agarose gels and on TBE/urea gels after proteinase K digestion as described in Example 7.
- GA VLPs are treated with RNaseA under low ionic conditions (20 mM Hepes pH 7.4) as described in Example 9 to hydrolyse RNA content of the VLP.
- VLPs are mixed with guanosine flanked oligonucleotides (Table 3; G3-6, G7-7, G8-8, G9-9, G10-PO or G6, 1 mM stock in 10 mM Tris pH8) and incubated as described in Example 12.
- VLPs are treated with Benzonase and dialysed in 300.000 MWCO tubing. Packaging is analysed on 1%> agarose gels and on TBE/urea gels after proteinase K digestion as described in Example 7.
- HBcAg VLPs are treated with ZnSO4 under low ionic strength conditions (20 mM Hepes pH 7.4 or 4 mM Hepes, 30 mM NaCl, pH 7.4 ) as described in Example 11 and are dialysed against 20 mM Hepes pH 7.4 as in Example 12.
- Poly (I:C) is added in a 10-fold molar excess to HBcAg VLPs (1-1.5 mg/ml) and incubated for 3 h at 37°C in a thermomixer at 650 rpm as described in Example 14.
- GA VLPs are treated with ZnSO4 under low ionic strength conditions (20 mM Hepes pH 7.4 or 4 mM Hepes, 30 mM NaCl, pH 7.4 ) as described in Example 11 and are dialysed against 20 mM Hepes, pH 7.4 as in Example 12.
- Poly (I:C) is added in a 10-fold molecular excess to GA VLPs (1-1.5 mg/ml) and incubated for 3 h at 37°C in a thermomixer at 650 rpm as described in Example 14.
- the column was equilibrated with 20 mM sodium phosphate buffer pH 7 and the sample was diluted 1 :15 in water to adjust a conductivity below 10 mS/cm in order to achieve proper binding of the coat protein to the column.
- the elution of the bound coat protein was accomplished by a step gradient to 20 mM sodium phosphate / 500 mM sodium chloride and the protein was collected in a fraction volume of approx. 25 ml.
- the column was regenerated with 0.5 M NaOH.
- the isolated Q ⁇ coat protein dimer (the eluted fraction from the cation exchange column) was applied (in two runs) onto a Sephacryl S-100 HR column (xk26/60, 320 ml, Amersham Bioscience) equilibrated with 20 mM sodium phosphate / 250 mM sodium chloride; pH 6.5. Chromatography was performed at RT with a flow rate of 2.5 ml/min. Absorbance was monitored at 260 nm and 280 nm. Fractions of 5 ml were collected. The column was regenerated with 0.5 M NaOH.
- Reassembly by dialysis A stock solution of purified Q ⁇ coat protein dimer at a concentration of 2 mg/ml was used for the reassembly of Q ⁇ VLP in the presence of the oligodeoxynucleotide G8-8 or G10-PO.
- the concentration of oligodeoxynucleotide in the reassembly mixture was 10 ⁇ M.
- the concentration of coat protein dimer in the reassembly mixture was 40 ⁇ M (approx. 1.13 mg/ml).
- Stock solutions of urea and DTT were added to the solution to give final concentrations of 1 M urea and 5 mM DTT respectively.
- the oligodeoxynucleotide was added as last component, together with H 2 O, giving a final volume of the reassembly reaction of 3 ml.
- This solution was dialysed at 4 °C for 72 h against 1500 ml buffer containing 20 mM TrisHCl, 150 mMNaCl, pH 8.0.
- the dialysed reassembly mixture was centrifuged at 14 000 rpm for 10 minutes at 4 °C. A negligible sediment was discarded while the supernatant contained the reassembled and packaged VLPs.
- Reassembled and packaged VLPs were concentrated with centrifugal filter devices (Millipore, UFV4BCC25, 5K NMWL) to a final protein concentration of 3 mg/ml. Protein concentration was determined by Bradford analysis.
- Reassembly by diafiltration 20 ml of a stock solution of purified coat protein (1.5 mg/ml) was mixed with stock solutions of urea, DTT, oligodeoxynucleotide G10-PO and water. The oligodeoxynucleotide was added as last component. The volume of the mixture was 30 ml and the final concentrations of the components are 35 ⁇ M dimeric coat protein (reflecting 1 mg/ml), 35 ⁇ M oligodeoxynucleotide, 1 M urea and 2.5 mM DTT.
- the mixture was then diafiltrated against 300 ml of 20 mM sodium phosphate / 250 mM sodium chloride, pH 7.2, in a tangential flow filtration apparatus at RT, using a Pellicon XL membrane cartridge (Biomax 5K, Millipore).
- the total flow rate was set to 10 ml/min and the permeate flow rate set to 2.5 ml/min.
- H 2 O 2 was added to the solution to a final concentration of 7 mM and the solution was further incubated at RT for 60 min, to accelerate the formation of the structural disulfide bonds in the formed VLPs.
- A) Hydrodynamic size of reassembled capsids Q ⁇ capsids, which had been reassembled in the presence of oligodeoxynucleotide G8-8, were analyzed by dynamic light scattering (DLS) and compared to intact Q ⁇ VLPs, which had been purified from E.coli. Reassembled capsids showed the same hydrodynamic size (which depends both on mass and conformation) as the intact Q ⁇ VLPs.
- DLS dynamic light scattering
- the reactions were then mixed with a TBE-Urea sample buffer and loaded on a 15 % polyacrylamide TBE-Urea gel (Novex ® , Invitrogen Cat. No. EC6885).
- a qualitative as well as quantitative standard 1 pmol, 5 pmol and 10 pmol of the oligodeoxynucleotide which was used for the reassembling reaction, was loaded on the same gel. This gel was stained with SYBR ® -Gold (Molecular Probes Cat. No. S- 11494).
- the SYBR ® -Gold stain showed that the reassembled Q ⁇ capsids contained nucleic acid co-migrating with the oligodeoxynucleotides which were used in the reassembly reaction.
- resistance to benzonase digestion of the nucleic acid content of the Q ⁇ VLPs which had been reassembled in the presence of oligodeoxynucleotides and isolation of the oligodeoxynucleotide from purified particles by proteinase K digestion demonstrate packaging of the oligodeoxynucleotide.
- the reaction mixture was subsequently dialyzed 2x 2 hours against 2 liters of 20 mM Hepes, pH 7.2 at 4°C.
- the coupled product was named Qb-MelanA 26-35 A/L.
- For MelanA 20-40 A/L SEQ ID NO: 58: A solution of 2 ml of 3.06 mg/ml Qb
- VLPs in 20 mM Hepes, pH 7.2 was reacted for 30 minutes with 18.4 ⁇ l of a solution of 50 mM SMPH in DMSO at 25°C on a rocking shaker.
- the reaction solution was subsequently dialyzed twice for 2 hours against 2 L of 20 mM Hepes, pH 7.2 at 4°C.
- 2 ml of the dialyzed reaction mixture was then reacted with 184 ⁇ l of 5 mM peptide stock solution (in DMSO) for 4 hours at 25oC on a rocking shaker.
- the reaction mixture was subsequently dialyzed 2x 2 hours against 2 liters of 20 mM Hepes, pH 7.2 at 4°C.
- the coupled product was named Qb-MelanA 20-40 A/L.
- Figure 1 shows the SDS-PAGE analysis of Qb-MelanA VLPs. MelanA-peptides were coupled to Qb VLPs. The final products were mixed with sample buffer and separated under reduced conditions on 16 % Novex®Tris-Glycine gels for 1.5 hours at 125 V. The separated proteins were stained by soaking the gel in Coomassie blue solution. Background staining was removed by washing the gel in 50 % methanol, 8% acetic acid. The Molecular weight marker (P 77085, New England BioLabs, Beverly, USA) was used as reference for Qb-MelanA migration velocity (lane 1).
- CD8 T cells were isolated from PBMC by magnetic sorting (Miltenyi Biotech), lxl 06/well CD8 T cells were added to antigen-pulsed DC.
- IL- 2 was supplemented in the cell culture at day 3 at a concentration of 10 U/ml and was increased up to 50 U/ml till day 12.
- CD8 positive T cells were selected for further analyses.
- the amount of MelanA-specific CD 8+ T cells was calculated as percentage of HLA- A2 -MelanA positive cells out of CD8+ lymphocytes.
- Qb-MelanA 16-35 A/L vaccine induced proliferation of MelanA 26-35 A/L-specific CTL (9.7% of CD8 T cells), demonstrating that the vaccine is efficiently taken up, processed to the CTL epitope (MelanA 26-35 A/L) and presented by human DC to T cells.
- 51Cr release assay was performed to analyze the functional activity of MelanA CTL clones.
- APC were incubated for 1.5h with 10-6M MelanA 26-35 A/L peptide or 10- 6M influenza Ml peptide as a negative control.
- APC were incubated with Cr51 to measure the unspecific uptake of radionucleotides at the time of peptide pulsing. After extensive washing to remove residual antigen and radioactivity, 104/well APC were incubated with varying numbers of MelanA-specific T cells for 5h.
- % Specific lysis ((cpm experimental - cpm spontaneous) / (cpm maximum - cpm spontaneous)) xlOO, where cpm experimental are the radioactive counts measured in the experimental sample, cpm spontaneous are the counts obtained from APC pulsed with 51Cr without adding T cells and cpm maximum are the counts obtained from 51Cr-pulsed APC lysed with 1% NP-40.
- cpm experimental are the radioactive counts measured in the experimental sample
- cpm spontaneous are the counts obtained from APC pulsed with 51Cr without adding T cells
- cpm maximum are the counts obtained from 51Cr-pulsed APC lysed with 1% NP-40.
- APC loaded with MelanA 26-35 A/L but not with the irrelevant Ml peptide were efficiently lysed by CTL (70-85%) specific lysis), which confirms the antigenic specificity of CTL clones.
- ISS immunostimulatory sequences
- CpG with different number of flanking Gs or double stranded RNA, such as poly (I:C) were tested for their ability to upregulate CD69 on human CD8 T cells and to induce secretion of IFN alpha and IL-12 in human PBMC.
- Human PBMC were isolated from buffy coats and treated with the indicated ISS in RPMI medium containing 10% FCS for 18h. IFN alpha in the supernatants was measured by ELISA, using an antibody set provided by PBL Biomedical Laboratories. PBMC were stained with mouse anti-human CD8-FITC, mouse anti-human CD19-PE and anti-human CD69-APC and analyzed by flow cytometry. G10-PO was the most active ISS in inducing IFN alpha secretion (Fig. 2A). G9-9 and G8-8 were a bit less active than G10- PO, although they induced high levels of IFN alpha secretion.
- B cells and plasmacytoid DC present in human PBMC are TLR-9 positive and respond to CpG treatment with production of cytokines (IFN alpha, IL-12).
- cytokines IFN alpha, IL-12
- antigen-pulsed DC were washed and incubated with 1x106 autologous PBMC in the presence or absence of 2 ⁇ M G10-PO for 2h.
- Autologous CD8 T cells (1x106), isolated by magnetic sorting were added to APC and incubated for 12 days using the cell culture conditions, described in Example 21.
- MelanA-specific CTL were detected by HLA-A2-MelanA-PE tetramer staining and flow cytometry analysis.
- Adding G10-PO to the Qb-MelanA-pulsed DC increased the frequency of specific CTL (from 10% to 14%), which indicates that the cytokine milieu, created by CpG stimulation is favourable for CTL expansion in vitro.
- Qbx33 VLPs loaded with G3-6, G6, G10-PO or poly (I:C) induces protection against p33 -recombinant Vaccinia virus challenge
- mice were subcutaneously immunized with Qbx33 alone or loaded with G3-6 or G6 or poly (I:C) (see Examples 12 and 14). Eight days later, mice were challenged with 1.5 x 106 pfu of recombinant Vaccinia virus, expressing the LCMV-p33 antigen. After 4 days, mice were sacrificed and the viral titers in ovaries were measured as previously described (Bachmann et al, Eur. J. Imunol. 1994, 24:2228). As depicted in Figure 3, all mice receiving the Qbx33 vaccine loaded with either G3-6 or G6 or poly (I:C) were protected from viral challenge.
- mice with Qbx33 loaded with G10-PO were priming ⁇ 33-specific CTL (6.2% +/- 1.4% vs 0.2% +/-0.1% in na ⁇ ve mice), as well as inducing protection from recombinant Vaccinia viras challenge.
- HHD mice express a chimeric monochain class I molecule with a human ⁇ 2- microglobulin covalently linked to the N-terminus of A2 ⁇ l and ⁇ 2 domains fused with Db ⁇ 3 domain (Firat, H. et al 1999, Eur.J.Immunol, 29:3112).
- the HLA-A2 transgene expression in these mice allows investigating the capacity of Q ⁇ MelanA 16-35 A/L VLPs to be processed and presented as the CTL epitope MelanA 26-35 and to prime CTL in vivo. Furthermore, the effect of adjuvants, as ISS can be studied in vivo.
- HHD mice were either left untreated or immunized by injecting subcutaneously 100 ⁇ g Qb-MelanA 16-35 A/L or Qb-pIC-MelanA 16-35 A/L. Eight days later spleenocytes were isolated, resuspended in FACS buffer ( PBS, 2% FCS, 5mM EDTA, pH 8.2) and stained with HLA-A2-MelanA-PE labelled tetramers for 30 min at room temperature. In a second step, rat anti-mouse CD8-APC (BD PharMingen, San Jose, USA) and anti mouse Mell4-FITC (BD PharMingen, San Jose, USA) were added for 30 min at 4°C.
- FACS buffer PBS, 2% FCS, 5mM EDTA, pH 8.2
- erythrocytes were lysed with BD-Lyzing Solution (BD Biosciences, San Jose, USA) for 10 min at room temperature. Finally, the spleen cells were analysed on a FACS Calibur using CellQuest software. First of all, the cells were acquired in the forward scatter and side scatter and the lymphocytes were gated. From this lymphocyte population, only the CD8 positive T cells were selected for further analyses.
- the HLA-A2-MelanA-PE and Mel 14— FITC labelled cells were measured with the FL2 and FL1 detector, respectively. The amount of MelanA-specific, activated CD8+ T cells was calculated as percent HLA-A2-MelanA positive, Mel 14 negative cells on total CD8+ lymphocytes.
- the human HLA-A2 -MelanA tetramer as used above does not bind very efficiently to mouse MelanA-specific T cells, as the protein is chimeric. Therefore we could assume a much higher degree of antigen specific T cells in these mice.
- Qbx33 loaded with CpG can be used in homologous as well in heterologous prime-boost regimen for the induction of a long lasting memory CD8+ T cell response
- mice were immunized with 150 ug Qbx33/NKCpG and 8 days later the frequencies of p33 -specific T cells increased from 0.4 %> +/- 0.2 % in na' ⁇ ve mice to 7.5% +/- 2.2% in immunized animals as measured with antigen.
- specific MHC/peptide tetramers 20 days later the peptide specific CD8+ T population dropped down to 1.6% +1-0.1%.
- a second-imunisaiton of these mice 30 days after the first immunisation with 150 ug Qbx33 NKPS could boost the memory T cell response to up to 8.4% +/-1.9% specific T cells. This response dropped slowly down but could be boosted again 4 months after the first boost with 150 ug Qbx33/NKPS reaching T cell levels of 23.8% +/-5.2 %.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Genetics & Genomics (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Oncology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Communicable Diseases (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Hematology (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Pulmonology (AREA)
- AIDS & HIV (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BRPI0408623-6A BRPI0408623A (pt) | 2003-03-26 | 2004-03-25 | conjugados de partìcula semelhante ao vìrus análogo de peptìdeo de melan-a |
| MXPA05009289A MXPA05009289A (es) | 2003-03-26 | 2004-03-25 | Conjugados de particulas tipo virus del analogo del peptido melan-a. |
| JP2006504862A JP5022028B2 (ja) | 2003-03-26 | 2004-03-25 | メラン−aペプチドアナログ−ウイルス様粒子コンジュゲート |
| US10/551,054 US7537767B2 (en) | 2003-03-26 | 2004-03-25 | Melan-A- carrier conjugates |
| NZ542323A NZ542323A (en) | 2003-03-26 | 2004-03-25 | Melan-A peptide analogue-virus-like-particle conjugates |
| EP04723203A EP1606398A1 (en) | 2003-03-26 | 2004-03-25 | Melan-a peptide analogue-virus-like-particle conjugates |
| CA002517839A CA2517839A1 (en) | 2003-03-26 | 2004-03-25 | Melan-a peptide analogue-virus-like-particle conjugates |
| AU2004223736A AU2004223736B2 (en) | 2003-03-26 | 2004-03-25 | Melan-A peptide analogue-virus-like-particle conjugates |
| US12/463,985 US20110097417A1 (en) | 2003-03-26 | 2009-05-11 | Melan-a-carrier conjugates |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US45734803P | 2003-03-26 | 2003-03-26 | |
| US60/457,348 | 2003-03-26 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/463,985 Continuation US20110097417A1 (en) | 2003-03-26 | 2009-05-11 | Melan-a-carrier conjugates |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2004085635A1 true WO2004085635A1 (en) | 2004-10-07 |
Family
ID=33098221
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2004/003164 Ceased WO2004085635A1 (en) | 2003-03-26 | 2004-03-25 | Melan-a peptide analogue-virus-like-particle conjugates |
| PCT/EP2004/003165 Ceased WO2004084940A1 (en) | 2003-03-26 | 2004-03-25 | Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use |
| PCT/EP2004/003163 Ceased WO2004084939A2 (en) | 2003-03-26 | 2004-03-25 | Hiv-peptide-carrier-conjugates |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2004/003165 Ceased WO2004084940A1 (en) | 2003-03-26 | 2004-03-25 | Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use |
| PCT/EP2004/003163 Ceased WO2004084939A2 (en) | 2003-03-26 | 2004-03-25 | Hiv-peptide-carrier-conjugates |
Country Status (13)
| Country | Link |
|---|---|
| US (2) | US7517520B2 (https=) |
| EP (3) | EP1605972A2 (https=) |
| JP (1) | JP5022028B2 (https=) |
| KR (1) | KR20050115913A (https=) |
| CN (2) | CN100560719C (https=) |
| AU (3) | AU2004224761A1 (https=) |
| BR (1) | BRPI0408623A (https=) |
| CA (3) | CA2519165A1 (https=) |
| MX (1) | MXPA05009289A (https=) |
| NZ (1) | NZ542323A (https=) |
| RU (1) | RU2351362C2 (https=) |
| WO (3) | WO2004085635A1 (https=) |
| ZA (3) | ZA200507063B (https=) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2009539907A (ja) * | 2006-06-12 | 2009-11-19 | サイトス バイオテクノロジー アーゲー | Rnaバクテリオファージのウイルス様粒子にオリゴヌクレオチドをパッケージ化するための方法 |
| US7959928B2 (en) | 2004-10-05 | 2011-06-14 | Cytos Biotechnology Ag | VLP-antigen conjugates and their uses as vaccines |
| US20110306113A1 (en) * | 2005-06-21 | 2011-12-15 | Cytos Biotechnology Ag | Scalable Process for Protein Purification |
| RU2440140C1 (ru) * | 2010-12-09 | 2012-01-20 | Иосиф Григорьевич Атабеков | Иммуногенная композиция, содержащая чужеродные антигены на поверхности сферических носителей, полученных при термической денатурации спиральных вирусов |
| RU2441667C1 (ru) * | 2010-12-09 | 2012-02-10 | Иосиф Григорьевич Атабеков | Новый тип частиц-носителей (платформ) для получения активных комплексов |
| RU2442604C1 (ru) * | 2010-12-09 | 2012-02-20 | Иосиф Григорьевич Атабеков | Способ усиления иммунного ответа |
| US8153426B2 (en) | 2004-08-19 | 2012-04-10 | University College Cardiff Consultants Limited | Preparation of antigen-presenting human gamma-delta T cells and use in immunotherapy |
| US8338173B2 (en) * | 2005-08-11 | 2012-12-25 | University College Cardiff Consultants Limited | Preparation of antigen-presenting human γδ T cells and use in immunotherapy |
| WO2013092720A1 (en) | 2011-12-22 | 2013-06-27 | F. Hoffmann-La Roche Ag | Full length antibody display system for eukaryotic cells and its use |
| CN108367066A (zh) * | 2015-09-10 | 2018-08-03 | 中央研究院 | 包括类病毒颗粒及新型佐剂的禽流感疫苗组合物 |
| US20180243409A1 (en) * | 2003-12-12 | 2018-08-30 | City Of Hope | SYNTHETIC CONJUGATE OF CpG DNA AND T-HELP/CTL PEPTIDE |
Families Citing this family (131)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030026782A1 (en) * | 1995-02-07 | 2003-02-06 | Arthur M. Krieg | Immunomodulatory oligonucleotides |
| US6207646B1 (en) * | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| US6406705B1 (en) | 1997-03-10 | 2002-06-18 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant |
| US20030022854A1 (en) | 1998-06-25 | 2003-01-30 | Dow Steven W. | Vaccines using nucleic acid-lipid complexes |
| US7264810B2 (en) * | 2001-01-19 | 2007-09-04 | Cytos Biotechnology Ag | Molecular antigen array |
| AU2002339224B2 (en) * | 2001-09-14 | 2008-10-09 | Kuros Us Llc | Packaging of immunostimulatory substances into virus-like particles: method of preparation and use |
| CA2488856A1 (en) * | 2002-06-20 | 2003-12-31 | Cytos Biotechnology Ag | Packaged virus-like particles for use as adjuvants: method of preparation and use |
| EP2351770A1 (en) * | 2002-07-17 | 2011-08-03 | Cytos Biotechnology AG | Molecular antigen arrays using a virus like particle derived from the ap205 coat protein |
| SI1524994T1 (sl) * | 2002-07-19 | 2011-08-31 | Cytos Biotechnology Ag | Sestavki cepiv, ki vsebujejo amiloidne beta 1-6 antigenske mreĹľe |
| PT2241325E (pt) | 2002-10-29 | 2012-04-12 | Coley Pharm Gmbh | Utilização de oligonucleótidos cpg no tratamento de infecção com vírus da hepatite c |
| US7537767B2 (en) * | 2003-03-26 | 2009-05-26 | Cytis Biotechnology Ag | Melan-A- carrier conjugates |
| EP1605972A2 (en) * | 2003-03-26 | 2005-12-21 | Cytos Biotechnology AG | Hiv-peptide-carrier-conjugates |
| KR100721928B1 (ko) * | 2004-11-05 | 2007-05-28 | 주식회사 바이오씨에스 | CpG 올리고데옥시뉴클레오티드를 함유하는 피부질환의치료 또는 예방용 약학적 조성물 |
| WO2006056142A1 (en) | 2004-11-29 | 2006-06-01 | Changchun Huapu Biotechnology Co., Ltd. | Cpg single-strand deoxynucleotides for use as adjuvant |
| CA2596248A1 (en) * | 2005-01-31 | 2006-08-10 | Vaxinnate Corporation | Method to identify polypeptide toll-like receptor (tlr) ligands |
| EP1868642B1 (en) * | 2005-03-18 | 2013-05-08 | Cytos Biotechnology AG | Cat allergen fusion proteins and uses thereof |
| EP1885847B1 (en) * | 2005-05-26 | 2011-07-06 | Cytos Biotechnology AG | Scalable fermentation process |
| KR20080015854A (ko) * | 2005-06-14 | 2008-02-20 | 사이토스 바이오테크놀로지 아게 | 항원 컨쥬게이트 및 그의 용도 |
| CN101687020A (zh) * | 2005-06-17 | 2010-03-31 | 曼康公司 | 用于癌症的多价引发-和-增强免疫治疗剂 |
| FR2887457B1 (fr) | 2005-06-23 | 2007-10-05 | Fond Bettencourt Schueller | Vaccination par ciblage transcutane |
| PL2179737T3 (pl) * | 2005-07-01 | 2014-01-31 | Index Pharmaceuticals Ab | Sposób do modulowania wrażliwości na steroidy |
| WO2007004977A1 (en) * | 2005-07-01 | 2007-01-11 | Index Pharmaceuticals Ab | Immunostimulatory method |
| US7468186B2 (en) * | 2005-07-22 | 2008-12-23 | City Of Hope | Polyomavirus cellular epitopes and uses therefor |
| BRPI0504117A (pt) * | 2005-09-05 | 2007-05-22 | Fundacao De Amparo A Pesquisa | epìtopos, combinação de epìtopos, usos de epìtopos ou sua combinação, composição, usos da composição, vacinas profiláticas anti-hiv-1, vacinas terapêuticas, método para a identificação de epìtopos e métodos para o tratamento ou prevenção |
| WO2007039458A2 (en) * | 2005-09-21 | 2007-04-12 | Cytos Biotechnology Ag | Hiv peptide conjugates and uses thereof |
| CA2625969A1 (en) * | 2005-10-28 | 2007-05-03 | Index Pharmaceuticals Ab | Composition and method for the prevention, treatment and/or alleviation of an inflammatory disease |
| WO2007109564A2 (en) * | 2006-03-17 | 2007-09-27 | University Of Massachusetts | Yeast cell particles as oral delivery vehicles for antigens |
| AU2013204383B2 (en) * | 2006-06-12 | 2016-09-22 | Kuros Us Llc | Processes for packaging oligonucleotides into virus-like particles of RNA bacteriophages |
| WO2008024427A2 (en) * | 2006-08-23 | 2008-02-28 | Science & Technology Corporation @ Unm | A virus-like platform for rapid vaccine discovery |
| CA2671873C (en) * | 2006-12-12 | 2018-10-09 | Brian Stephen Sproat | Oligonucleotides containing high concentrations of guanine monomers |
| WO2008071774A1 (en) * | 2006-12-14 | 2008-06-19 | Cytos Biotechnology Ag | Purification process for coat protein of rna bacteriophages |
| MX2010014026A (es) | 2008-06-27 | 2011-02-15 | Pfizer | Composiciones adyuvantes novedosas. |
| RU2572826C2 (ru) | 2008-12-02 | 2016-01-20 | Чиралджен, Лтд. | Способ синтеза модифицированных по атому фосфора нуклеиновых кислот |
| KR101413844B1 (ko) * | 2008-12-09 | 2014-06-30 | 화이자 백신스 엘엘씨 | IgE CH3 펩티드 백신 |
| WO2010122164A1 (en) | 2009-04-23 | 2010-10-28 | Cytos Biotechnology Ag | VIRUS-LIKE PARTICLES OF BACTERIOPHAGE φCB5 |
| CA2762653A1 (en) * | 2009-05-27 | 2010-12-02 | Selecta Biosciences, Inc. | Immunomodulatory agent-polymeric compounds |
| US8431530B2 (en) | 2009-06-12 | 2013-04-30 | Morehouse School Of Medicine | Compositions and methods for treating aids or cancer by inhibiting the secretion of microparticles |
| CA2767253A1 (en) | 2009-07-06 | 2011-01-13 | Ontorii, Inc. | Novel nucleic acid prodrugs and methods of use thereof |
| DE102009034779A1 (de) | 2009-07-25 | 2011-02-03 | Emc Microcollections Gmbh | Synthetische Analoga bakterieller Lipopeptide und ihre Anwendung zur Therapie und Prophylaxe allergischer Erkrankungen |
| US9109014B2 (en) | 2009-11-02 | 2015-08-18 | The Trustees Of The University Of Pennsylvania | Foot and mouth disease virus (FMDV) consensus proteins, coding sequences therefor and vaccines made therefrom |
| US8685416B2 (en) | 2010-03-02 | 2014-04-01 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Compositions and methods for the treatment of cancer |
| EP2547695B1 (en) | 2010-03-16 | 2018-05-09 | Biontech Protein Therapeutics GmbH | Tumor vaccination involving a humoral immune response against self-protein cldn18.2 |
| EP2366709A1 (en) * | 2010-03-16 | 2011-09-21 | BioNTech AG | Tumor vaccination involving a humoral immune response against self-proteins |
| AU2011258165B2 (en) | 2010-05-26 | 2016-11-17 | Selecta Biosciences, Inc. | Dose selection of adjuvanted synthetic nanocarriers |
| EP2407534A1 (en) | 2010-07-14 | 2012-01-18 | Neo Virnatech, S.L. | Methods and reagents for obtaining transcriptionally active virus-like particles and recombinant virions |
| WO2012037078A2 (en) | 2010-09-14 | 2012-03-22 | Stc.Unm | Immunogenic respiratory syncytial virus glycoprotein-containing vlps and related compositions, constructs, and therapeutic methods |
| JP5868324B2 (ja) | 2010-09-24 | 2016-02-24 | 株式会社Wave Life Sciences Japan | 不斉補助基 |
| WO2012061717A1 (en) | 2010-11-05 | 2012-05-10 | Selecta Biosciences, Inc. | Modified nicotinic compounds and related methods |
| GB201021867D0 (en) * | 2010-12-23 | 2011-02-02 | Mologen Ag | Non-coding immunomodulatory DNA construct |
| KR20140041505A (ko) | 2011-04-29 | 2014-04-04 | 셀렉타 바이오사이언시즈, 인크. | 조절 b 세포 유도를 위한 관용원성 합성 나노운반체 |
| AU2012284265B2 (en) | 2011-07-19 | 2017-08-17 | Wave Life Sciences Ltd. | Methods for the synthesis of functionalized nucleic acids |
| JP2014521687A (ja) | 2011-07-29 | 2014-08-28 | セレクタ バイオサイエンシーズ インコーポレーテッド | 体液性および細胞傷害性tリンパ球(ctl)免疫応答を生成する合成ナノキャリア |
| CN102336821B (zh) * | 2011-08-11 | 2014-10-15 | 北京永泰免疫应用科技有限公司 | Melan-A表位肽及其在预防和/或治疗肿瘤中的用途 |
| CN104769104A (zh) * | 2011-12-12 | 2015-07-08 | 细胞药物有限公司 | 扩大t细胞的方法 |
| RU2485973C1 (ru) | 2012-02-28 | 2013-06-27 | Общество с ограниченной ответственностью "НТфарма" | Рекомбинантная трехвалентная вакцина от гриппа человека |
| WO2013177440A2 (en) * | 2012-05-23 | 2013-11-28 | The Board Of Trustees Of The Leland Stanford Junior University | Ordered flagellin array as an immunostimulant |
| CN104684923B (zh) | 2012-07-13 | 2018-09-28 | 株式会社新日本科学 | 手性核酸佐剂 |
| JP6453212B2 (ja) | 2012-07-13 | 2019-01-16 | ウェイブ ライフ サイエンシズ リミテッドWave Life Sciences Ltd. | キラル制御 |
| SG11201500239VA (en) | 2012-07-13 | 2015-03-30 | Wave Life Sciences Japan | Asymmetric auxiliary group |
| WO2014116730A2 (en) | 2013-01-23 | 2014-07-31 | The Board Of Trustees Of The Leland Stanford Junior University | Stabilized hepatitis b core polypeptide |
| KR20210088754A (ko) | 2013-03-15 | 2021-07-14 | 더 트러스티스 오브 더 유니버시티 오브 펜실베니아 | 구제역 바이러스 (fmdv) 공통 단백질, 그에 대한 코딩 서열 및 그로부터 제조된 백신 |
| US9572815B2 (en) | 2013-03-15 | 2017-02-21 | St. Jude Children's Research Hospital | Methods and compositions of p27KIP1 transcriptional modulators |
| HUE052599T2 (hu) | 2013-05-03 | 2021-05-28 | Selecta Biosciences Inc | CD4+ szabályozó T-sejtek fokozására szolgáló eljárások és készítmények |
| IL295392A (en) | 2013-06-04 | 2022-10-01 | Selecta Biosciences Inc | Repeated administration of non-immunosupressive antigen specific immunotherapeutics |
| KR101943171B1 (ko) | 2013-09-19 | 2019-01-29 | 조에티스 서비시즈 엘엘씨 | 유성 아쥬반트 |
| JP6545177B2 (ja) | 2013-09-29 | 2019-07-17 | セント ジュード チルドレンズ リサーチ ホスピタル インコーポレイテッド | 抗菌薬としてのアリール置換アミノメチルスペクチノマイシン類似体 |
| JP2017500313A (ja) * | 2013-12-09 | 2017-01-05 | ブレット バイオテクノロジー, インコーポレーテッドBullet Biotechnology, Inc. | 特異的ウイルス様粒子−CpGオリゴヌクレオチドワクチンおよびその使用 |
| CN104761644A (zh) * | 2014-01-03 | 2015-07-08 | 百奇生物科技(苏州)有限公司 | 大肠杆菌表达的融合蛋白mbp-mart-1及其制备和应用 |
| WO2015108048A1 (ja) | 2014-01-15 | 2015-07-23 | 株式会社新日本科学 | 抗腫瘍作用を有するキラル核酸アジュバンド及び抗腫瘍剤 |
| JPWO2015108046A1 (ja) | 2014-01-15 | 2017-03-23 | 株式会社新日本科学 | 抗アレルギー作用を有するキラル核酸アジュバンド及び抗アレルギー剤 |
| WO2015108047A1 (ja) | 2014-01-15 | 2015-07-23 | 株式会社新日本科学 | 免疫誘導活性を有するキラル核酸アジュバンド及び免疫誘導活性剤 |
| ES2917473T3 (es) | 2014-01-16 | 2022-07-08 | Wave Life Sciences Ltd | Diseño quiral |
| GB2523187A (en) * | 2014-02-18 | 2015-08-19 | Mologen Ag | Covalently closed non-coding immunomodulatory DNA construct |
| AU2015279738A1 (en) | 2014-06-25 | 2016-12-22 | Selecta Biosciences, Inc. | Methods and compositions for treatment with synthetic nanocarriers and immune checkpoint inhibitors |
| AU2015311704B2 (en) | 2014-09-07 | 2021-12-09 | Selecta Biosciences, Inc. | Methods and compositions for attenuating gene editing anti-viral transfer vector immune responses |
| JP6715775B2 (ja) * | 2014-12-25 | 2020-07-01 | 国立研究開発法人医薬基盤・健康・栄養研究所 | 非凝集性免疫賦活化オリゴヌクレオチド |
| DK3240801T3 (da) | 2014-12-31 | 2021-02-08 | Checkmate Pharmaceuticals Inc | Kombinationstumorimmunterapi |
| WO2016112921A1 (en) | 2015-01-15 | 2016-07-21 | University Of Copenhagen | Virus-like particle with efficient epitope display |
| DK3244920T5 (da) * | 2015-01-16 | 2024-10-07 | Zoetis Services Llc | Mund- og klovsyge-vaccine |
| EP3786164B1 (en) | 2015-06-18 | 2024-08-14 | Ting Therapeutics LLC | Methods and compositions for the prevention and treatment of hearing loss |
| LU92821B1 (en) | 2015-09-09 | 2017-03-20 | Mologen Ag | Combination comprising immunostimulatory oligonucleotides |
| GB2542425A (en) | 2015-09-21 | 2017-03-22 | Mologen Ag | Means for the treatment of HIV |
| ES2854726T3 (es) | 2015-10-30 | 2021-09-22 | The Univ Of Copenhagen | Partícula similar a virus con presentación eficiente de epítopos |
| WO2017096262A1 (en) | 2015-12-04 | 2017-06-08 | Jomoco, Corp. | Compositions and methods to mitigate or prevent an immune response to an immunogenic therapeutic molecule in non-human primates |
| WO2017173334A1 (en) | 2016-04-01 | 2017-10-05 | Checkmate Pharmaceuticals, Inc. | Fc receptor-mediated drug delivery |
| EP4014967A1 (en) | 2016-04-29 | 2022-06-22 | Icahn School of Medicine at Mount Sinai | Targeting the innate immunesystem to induce long-term tolerance and to resolve macrophage accumulation in atherosclerosis |
| JP2019533718A (ja) | 2016-09-27 | 2019-11-21 | セレクタ バイオサイエンシーズ インコーポレーテッドSelecta Biosciences,Inc. | がんの処置における使用のための組換え免疫毒素 |
| GB201616365D0 (en) * | 2016-09-27 | 2016-11-09 | Helsingin Yliopisto | Non-genetic modification of enveloped viruses |
| US20180193482A1 (en) | 2017-01-07 | 2018-07-12 | Selecta Biosciences, Inc. | Patterned dosing of immunosuppressants coupled to synthetic nanocarriers |
| WO2018169811A1 (en) | 2017-03-11 | 2018-09-20 | Selecta Biosciences, Inc. | Methods and compositions related to combined treatment with anti-inflammatories and synthetic nanocarriers comprising an immunosuppressant |
| GB2571696B (en) | 2017-10-09 | 2020-05-27 | Compass Pathways Ltd | Large scale method for the preparation of Psilocybin and formulations of Psilocybin so produced |
| US12459965B2 (en) | 2017-10-09 | 2025-11-04 | Compass Pathfinder Limited | Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use |
| AU2018347583A1 (en) | 2017-10-13 | 2020-05-21 | Selecta Biosciences, Inc. | Methods and compositions for attenuating anti-viral transfer vector IgM responses |
| US12246031B2 (en) | 2018-02-13 | 2025-03-11 | Checkmate Pharmaceuticals, Inc. | Compositions and methods for tumor immunotherapy |
| KR102890791B1 (ko) | 2018-04-09 | 2025-11-24 | 체크메이트 파마슈티칼스, 인크. | 바이러스-유사 입자 내로의 올리고뉴클레오타이드의 포장 |
| WO2019204743A1 (en) | 2018-04-19 | 2019-10-24 | Checkmate Pharmaceuticals, Inc. | Synthetic rig-i-like receptor agonists |
| AU2019308567A1 (en) | 2018-07-16 | 2021-01-28 | Selecta Biosciences, Inc. | Methods and compositions of OTC constructs and vectors |
| US20200038463A1 (en) | 2018-07-16 | 2020-02-06 | Selecta Biosciences, Inc. | Methods and compositions of mma constructs and vectors |
| WO2020029968A1 (zh) * | 2018-08-07 | 2020-02-13 | 中国科学院生物物理研究所 | 活化cd4+t细胞的方法 |
| WO2020136657A1 (en) * | 2018-12-28 | 2020-07-02 | Ramot At Tel-Aviv University Ltd. | Polymeric nanovaccines and uses thereof |
| KR20220009954A (ko) | 2019-04-17 | 2022-01-25 | 컴퍼스 패쓰파인더 리미티드 | 신경인지 장애, 만성 통증을 치료하고 염증을 감소시키는 방법 |
| CN114126666A (zh) | 2019-04-28 | 2022-03-01 | 西莱克塔生物科技公司 | 用于治疗针对病毒转移载体具有预先存在的免疫力的对象的方法 |
| CA3141863A1 (en) | 2019-05-28 | 2020-12-03 | Selecta Biosciences, Inc. | Methods and compositions for attenuated anti-viral transfer vector immune response |
| CN114207440A (zh) | 2019-06-04 | 2022-03-18 | 西莱克塔生物科技公司 | 聚乙二醇化尿酸酶的制剂和剂量 |
| EP4048795A1 (en) | 2019-10-23 | 2022-08-31 | Checkmate Pharmaceuticals, Inc. | Synthetic rig-i-like receptor agonists |
| DE102020113731B4 (de) * | 2020-05-20 | 2024-02-08 | FiberBridge Photonics GmbH | Glasfaser und Glasfaserprodukt |
| AU2021286574A1 (en) * | 2020-06-09 | 2023-01-19 | Icosavax, Inc. | Method of making virus-like particle |
| IL302539A (en) | 2020-11-04 | 2023-07-01 | Selecta Biosciences Inc | Compositions for reducing immune responses against immunoglobulin proteases |
| EP4274571A1 (en) | 2021-01-05 | 2023-11-15 | Selecta Biosciences, Inc. | Viral vector dosing protocols |
| CN118459539B (zh) | 2021-03-19 | 2026-01-06 | 生物治疗探索股份有限公司 | 用于调节训练免疫的化合物及其使用方法 |
| EP4319747A1 (en) | 2021-04-09 | 2024-02-14 | Selecta Biosciences, Inc. | Synthetic nanocarriers comprising an immunosuppressant in combination with high affinity il-2 receptor agonists to enhance immune tolerance |
| US20230140196A1 (en) | 2021-10-12 | 2023-05-04 | Selecta Biosciences, Inc. | Viral vector dosing protocols |
| WO2023064367A1 (en) | 2021-10-12 | 2023-04-20 | Selecta Biosciences, Inc. | Methods and compositions for attenuating anti-viral transfer vector igm responses |
| WO2023064887A1 (en) | 2021-10-15 | 2023-04-20 | The Board Of Trustees Of The University Of Illinois | Mechanochemical dynamic therapy for focal cancer treatment |
| CA3237037A1 (en) | 2021-11-14 | 2023-05-19 | Cartesian Therapeutics, Inc. | Multiple dosing with viral vectors |
| US20230263906A1 (en) | 2022-01-10 | 2023-08-24 | Selecta Biosciences, Inc. | High affinity il-2 receptor agonists and synthetic nanocarrier dose sparing |
| WO2023168023A1 (en) | 2022-03-04 | 2023-09-07 | Reset Pharmaceuticals, Inc. | Co-crystals or salts comprising psilocin |
| WO2023172628A1 (en) | 2022-03-09 | 2023-09-14 | Selecta Biosciences, Inc. | Immunosuppressant in combination with high affinity il-2 receptor agonists and related dosing |
| WO2023172624A1 (en) | 2022-03-09 | 2023-09-14 | Selecta Biosciences, Inc. | Immunosuppressants in combination with anti-igm agents and related dosing |
| US20230372535A1 (en) | 2022-03-25 | 2023-11-23 | Selecta Biosciences, Inc. | Synthetic nanocarriers comprising an immunosuppressant in combination with high affinity il-2 receptor agonists and anti-igm agents |
| US20230381277A1 (en) | 2022-04-08 | 2023-11-30 | Selecta Biosciences, Inc. | High affinity il-2 receptor agonists and immunosuppressants to enhance immune tolerance |
| WO2023242155A1 (en) * | 2022-06-14 | 2023-12-21 | Janssen Vaccines & Prevention B.V. | Compositions and methods for the diagnosis of hiv infection |
| CN120813689A (zh) | 2022-08-11 | 2025-10-17 | 笛卡尔疗法股份有限公司 | 与免疫球蛋白蛋白酶及其融合体相关的组合物和方法 |
| CN119789863A (zh) | 2022-08-30 | 2025-04-08 | 赛巴动物健康股份有限公司 | 经修饰的cmv病毒样颗粒 |
| WO2024229350A1 (en) | 2023-05-03 | 2024-11-07 | Cartesian Therapeutics, Inc. | Immunosuppressant in combination with high affinity il-2 receptor agonists for diabetes |
| WO2024229432A1 (en) | 2023-05-03 | 2024-11-07 | Cartesian Therapeutics, Inc. | Synthetic nanocarriers comprising an immunosuppressant in combination with high affinity il-2 receptor agonists to enhance immune tolerance |
| WO2024229370A1 (en) | 2023-05-03 | 2024-11-07 | Cartesian Therapeutics, Inc. | Compositions and methods for treating gvhd |
| WO2024229380A1 (en) | 2023-05-03 | 2024-11-07 | Cartesian Therapeutics, Inc. | Immunosuppressant in combination with high affinity il-2 receptor agonists in autoimmune liver diseases |
| WO2025054423A1 (en) * | 2023-09-08 | 2025-03-13 | University Of Massachusetts | Chimeric hpv-ng compositions and methods of use thereof |
| TW202536171A (zh) | 2024-03-04 | 2025-09-16 | 德商百靈佳殷格翰獸藥股份有限公司 | 用於治療ngf相關病症之主動疫苗接種 |
| TW202544252A (zh) | 2024-03-06 | 2025-11-16 | 美商禮藍美國股份有限公司 | 經修飾的CMV類病毒粒子及貓IL-1β突變蛋白抗原之獸醫組成物 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001016320A1 (en) * | 1999-08-30 | 2001-03-08 | Ludwig Institute For Cancer Research | Isolated nona and decapeptides which bind to hla molecules, and the use thereof |
| US6326200B1 (en) * | 1997-06-23 | 2001-12-04 | Ludwig Institute For Cancer Research | Isolated nona-and decapeptides which bind to HLA molecules, and the use thereof |
| US20030050268A1 (en) * | 2001-03-29 | 2003-03-13 | Krieg Arthur M. | Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases |
Family Cites Families (108)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0038154B1 (en) | 1980-04-15 | 1983-09-21 | Beecham Group Plc | Allergens modified with polysarcosines |
| US5204096A (en) | 1984-03-07 | 1993-04-20 | New York Blood Center, Inc. | Pre-S gene coded peptide hepatitis B immunogens, vaccines, diagnostics, and synthetic lipid vesicle carriers |
| US4722840A (en) | 1984-09-12 | 1988-02-02 | Chiron Corporation | Hybrid particle immunogens |
| US4959314A (en) | 1984-11-09 | 1990-09-25 | Cetus Corporation | Cysteine-depleted muteins of biologically active proteins |
| FR2581394B1 (fr) | 1985-05-02 | 1988-08-05 | Grp Genie Genetique | Particules ayant les proprietes immunogenes de l'antigene hbs et portant un site antigenique etranger aux epitopes portes par l'antigene hbs, vecteurs et cellules animales pour la production de telles particules et compositions contenant de telles particules pour la production de vaccins mixtes |
| US5374426A (en) | 1986-09-03 | 1994-12-20 | University Of Saskatchewan | Rotavirus nucleocapsid protein VP6 in vaccine compositions |
| US5143726A (en) | 1986-12-09 | 1992-09-01 | The Scripps Research Institute | T cell epitopes of the hepatitis B virus nucleocapsid protein |
| CN87100603A (zh) * | 1987-01-21 | 1988-08-10 | 昂科公司 | 抗黑素瘤疫苗 |
| US4918166A (en) | 1987-04-10 | 1990-04-17 | Oxford Gene Systems Limited | Particulate hybrid HIV antigens |
| US5057540A (en) | 1987-05-29 | 1991-10-15 | Cambridge Biotech Corporation | Saponin adjuvant |
| GB8903313D0 (en) | 1989-02-14 | 1989-04-05 | Wellcome Found | Conjugates |
| NZ235315A (en) | 1989-09-19 | 1991-09-25 | Wellcome Found | Chimaeric hepadnavirus core antigen proteins and their construction |
| EP1690934A3 (en) | 1990-01-12 | 2008-07-30 | Abgenix, Inc. | Generation of xenogeneic antibodies |
| US5334394A (en) | 1990-06-22 | 1994-08-02 | The Regents Of The University Of California | Human immunodeficiency virus decoy |
| EP0468520A3 (en) | 1990-07-27 | 1992-07-01 | Mitsui Toatsu Chemicals, Inc. | Immunostimulatory remedies containing palindromic dna sequences |
| GB9101550D0 (en) | 1991-01-24 | 1991-03-06 | Mastico Robert A | Antigen-presenting chimaeric protein |
| GB9114003D0 (en) | 1991-06-28 | 1991-08-14 | Mastico Robert A | Chimaeric protein |
| ZA934199B (en) | 1992-06-18 | 1994-01-10 | Akzo Nv | Carrier system against gnrh |
| GB9213601D0 (en) * | 1992-06-26 | 1992-08-12 | Mastico Robert A | Protein based delivery system |
| CA2140542A1 (en) | 1992-07-27 | 1994-02-03 | Abeysingle Padmapriya | Oligonucleotide alkylphosphonothioates |
| FR2695563B1 (fr) | 1992-09-11 | 1994-12-02 | Pasteur Institut | Microparticules portant des antigènes et leur utilisation pour l'induction de réponses humorales ou cellulaires. |
| GB9227068D0 (en) | 1992-12-29 | 1993-02-24 | British Bio Technology | Novel proteinaceous particles |
| US6727230B1 (en) * | 1994-03-25 | 2004-04-27 | Coley Pharmaceutical Group, Inc. | Immune stimulation by phosphorothioate oligonucleotide analogs |
| WO1995026204A1 (en) | 1994-03-25 | 1995-10-05 | Isis Pharmaceuticals, Inc. | Immune stimulation by phosphorothioate oligonucleotide analogs |
| AU706443B2 (en) | 1994-04-22 | 1999-06-17 | Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The | Melanoma antigens |
| US5874560A (en) | 1994-04-22 | 1999-02-23 | The United States Of America As Represented By The Department Of Health And Human Services | Melanoma antigens and their use in diagnostic and therapeutic methods |
| US6239116B1 (en) * | 1994-07-15 | 2001-05-29 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| ATE509102T1 (de) | 1994-07-15 | 2011-05-15 | Univ Iowa Res Found | Immunomodulatorische oligonukleotide |
| US6429199B1 (en) * | 1994-07-15 | 2002-08-06 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules for activating dendritic cells |
| US20030050263A1 (en) | 1994-07-15 | 2003-03-13 | The University Of Iowa Research Foundation | Methods and products for treating HIV infection |
| US6207646B1 (en) | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| US7935675B1 (en) | 1994-07-15 | 2011-05-03 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| US5935821A (en) | 1995-01-17 | 1999-08-10 | Board Of Trustees Of The University Of Kentucky | Polynucleotides related to monoclonal antibody 1A7 and use for the treatment of melanoma and small cell carcinoma |
| WO1996030523A2 (en) | 1995-03-31 | 1996-10-03 | Hans Wolf | Antigen presentation system based on retrovirus-like particles |
| US5780448A (en) | 1995-11-07 | 1998-07-14 | Ottawa Civic Hospital Loeb Research | DNA-based vaccination of fish |
| EP0879284B1 (en) | 1996-01-30 | 2009-07-29 | The Regents of The University of California | Gene expression vectors which generate an antigen specific immune response and methods of using the same |
| EP0855184A1 (en) | 1997-01-23 | 1998-07-29 | Grayson B. Dr. Lipford | Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination |
| GB9702021D0 (en) | 1997-01-31 | 1997-03-19 | Imperial College | Medicaments |
| US6406705B1 (en) * | 1997-03-10 | 2002-06-18 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant |
| AU753688B2 (en) * | 1997-03-10 | 2002-10-24 | Ottawa Civic Loeb Research Institute | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant |
| AU7350798A (en) * | 1997-04-29 | 1998-11-24 | Universiteit Utrecht | Corona virus-like particles as tools for vaccination and therapy |
| EP0980257A1 (en) | 1997-05-01 | 2000-02-23 | Chiron Corporation | Use of virus-like particles as adjuvants |
| AU7690898A (en) * | 1997-05-20 | 1998-12-11 | Ottawa Civic Hospital Loeb Research Institute | Vectors and methods for immunization or therapeutic protocols |
| WO1998055495A2 (en) | 1997-06-06 | 1998-12-10 | Dynavax Technologies Corporation | Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof |
| US6025470A (en) | 1997-06-23 | 2000-02-15 | Ludwig Institute For Cancer Research | Isolated nona- and decapeptides which bind to HLA molecules, and the use thereof |
| FR2764826B1 (fr) | 1997-06-24 | 1999-09-03 | Tempora O | Procede de nettoyage de surface poreuse, notamment en pierre et composition adaptee |
| US6169175B1 (en) | 1997-08-06 | 2001-01-02 | Centers For Disease Control And Prevention | Preparation and use of recombinant influenza A virus M2 construct vaccines |
| DK1009413T3 (da) | 1997-09-05 | 2007-06-11 | Univ California | Anvendelse af immunstimulerende oligonukleotider til forebyggelse eller behandling af astma |
| US5989868A (en) | 1997-09-12 | 1999-11-23 | The Board Of Regents Of The University Of Oklahoma | Fusion protein systems designed to increase soluble cytoplasmic expression of heterologous proteins in esherichia coli |
| US6171591B1 (en) | 1997-12-08 | 2001-01-09 | Pentamer Pharmaceuticals, Inc. | Recombinant nodavirus compositions and methods |
| WO1999040934A1 (en) | 1998-02-12 | 1999-08-19 | Immune Complex, Corporation | Strategically modified hepatitis b core proteins and their derivatives |
| ATE356630T1 (de) | 1998-04-03 | 2007-04-15 | Univ Iowa Res Found | Verfahren und produkte zur stimulierung des immunsystems mittels immunotherapeutischer oligonukleotide und zytokine |
| US6541438B1 (en) * | 1998-05-01 | 2003-04-01 | The Procter & Gamble Company | Laundry detergent and/or fabric care compositions comprising a modified cellulase |
| US5990085A (en) | 1998-05-04 | 1999-11-23 | Michigan State University | Inhibin-HBc fusion protein |
| ATE305507T1 (de) * | 1998-05-14 | 2005-10-15 | Coley Pharm Gmbh | Verfahren zur regulierung der hematopoiese mit hilfe von cpg oligonukleotide |
| DK1091928T3 (da) | 1998-06-30 | 2007-07-23 | Om Pharma | Nye acylerede pseudodipeptider, fremgangsmåde til disses fremstilling og sammensætninger, som indeholder dem |
| JP2002521489A (ja) | 1998-07-27 | 2002-07-16 | ユニバーシティ オブ アイオワ リサーチ ファウンデーション | CpGオリゴヌクレオチドの立体異性体および関連する方法 |
| US5962636A (en) | 1998-08-12 | 1999-10-05 | Amgen Canada Inc. | Peptides capable of modulating inflammatory heart disease |
| WO2000014217A2 (en) | 1998-09-03 | 2000-03-16 | Coley Pharmaceutical Gmbh | G-motif oligonucleotides and uses thereof |
| ATE314095T1 (de) * | 1998-10-21 | 2006-01-15 | Us Health | Virusähnliche partikel zur induktion von autoantikörpern |
| US6380364B1 (en) | 1998-11-23 | 2002-04-30 | Loyola University Of Chicago | Chimeric biotin-binding papillomavirus protein |
| NZ512456A (en) | 1998-11-30 | 2003-10-31 | Cytos Biotechnology Ag | Ordered molecular presentation of antigens |
| EA004497B1 (ru) | 1998-12-04 | 2004-04-29 | Байоджен, Инк. | Коровые антигенные частицы hbv с множественными иммуногенными компонентами, связанными посредством пептидных лигандов |
| CA2357004A1 (en) | 1998-12-23 | 2000-06-29 | Boyce Thompson Institute For Plant Research | Expression of immunogenic hepatitis b surface antigens in transgenic plants |
| AU2487300A (en) | 1998-12-31 | 2000-07-31 | Chiron Corporation | Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof |
| CN1520423A (zh) | 1999-02-25 | 2004-08-11 | ʷ��˿�������ȳ�ķ����˾ | 来源于IgE的Cε3或Cε4区的抗原决定基或拟表位,其拮抗物,及其治疗用途 |
| US6977245B2 (en) | 1999-04-12 | 2005-12-20 | The United States Of America As Represented By The Department Of Health And Human Services | Oligodeoxynucleotide and its use to induce an immune response |
| DE60014076T2 (de) | 1999-04-19 | 2005-10-13 | Glaxosmithkline Biologicals S.A. | Adjuvans-zusammensetzung, enthaltend saponin und ein immunstimulatorisches oligonukleotid |
| SK287400B6 (sk) * | 1999-09-25 | 2010-08-09 | University Of Iowa Research Foundation | Prostriedok s obsahom imunostimulačnej nukleovej kyseliny a jeho použitie na stimuláciu imunitnej reakcie |
| US6949520B1 (en) | 1999-09-27 | 2005-09-27 | Coley Pharmaceutical Group, Inc. | Methods related to immunostimulatory nucleic acid-induced interferon |
| EP1220684B2 (en) * | 1999-09-27 | 2010-07-14 | Coley Pharmaceutical Group, Inc. | Methods related to immunostimulatory nucleic acid-induced interferon |
| EP1311288A1 (en) | 2000-01-20 | 2003-05-21 | Ottawa Health Research Institute | Immunostimulatory nucleic acids for inducing a th2 immune response |
| EP1975182A1 (en) | 2000-02-01 | 2008-10-01 | PanGenetics B.V. | CD40-binding APC-activating molecules |
| US7585847B2 (en) | 2000-02-03 | 2009-09-08 | Coley Pharmaceutical Group, Inc. | Immunostimulatory nucleic acids for the treatment of asthma and allergy |
| US6756044B1 (en) | 2000-02-09 | 2004-06-29 | Genvec, Inc. | Antigenic complexes and methods |
| MXPA02009895A (es) | 2000-04-07 | 2004-09-06 | Univ Leeds Innovations Ltd | Proteinas de fusion de antigeno de nucleo de hepatitis b. |
| CA2407897A1 (en) | 2000-05-05 | 2001-11-15 | Cytos Biotechnology Ag | Molecular antigen arrays and vaccines |
| ATE320493T1 (de) | 2000-06-22 | 2006-04-15 | Ucb Pharma Ltd | Modifizierung des hepatitis b kernantigens |
| AUPQ912000A0 (en) | 2000-07-31 | 2000-08-24 | Crown In The Right Of The Queensland Department Of Health, The | Improved virus like particles |
| US20030138769A1 (en) | 2000-08-16 | 2003-07-24 | Birkett Ashley J. | Immunogenic HBc chimer particles having enhanced stability |
| WO2002053141A2 (en) | 2000-12-14 | 2002-07-11 | Coley Pharmaceutical Group, Inc. | Inhibition of angiogenesis by nucleic acids |
| US7094409B2 (en) * | 2001-01-19 | 2006-08-22 | Cytos Biotechnology Ag | Antigen arrays for treatment of allergic eosinophilic diseases |
| US7128911B2 (en) * | 2001-01-19 | 2006-10-31 | Cytos Biotechnology Ag | Antigen arrays for treatment of bone disease |
| US7264810B2 (en) | 2001-01-19 | 2007-09-04 | Cytos Biotechnology Ag | Molecular antigen array |
| WO2003040308A2 (en) | 2001-07-27 | 2003-05-15 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Use of sterically stabilized cationic liposomes to efficiently deliver cpg oligonucleotides in vivo |
| AU2002339224B2 (en) | 2001-09-14 | 2008-10-09 | Kuros Us Llc | Packaging of immunostimulatory substances into virus-like particles: method of preparation and use |
| JP4360906B2 (ja) * | 2001-09-14 | 2009-11-11 | サイトス バイオテクノロジー アーゲー | ウィルス様粒子によって誘導される免疫応答を高めるための、抗原提示細胞のインビボでの活性化 |
| US7115266B2 (en) * | 2001-10-05 | 2006-10-03 | Cytos Biotechnology Ag | Angiotensin peptide-carrier conjugates and uses thereof |
| EP1432443B1 (en) | 2001-10-05 | 2009-01-21 | Cytos Biotechnology AG | Angiotensin peptide-carrier conjugates and uses thereof |
| DK1455593T3 (da) | 2001-10-06 | 2013-08-26 | Merial Ltd | Fremgangsmåder og sammensætninger til fremme af vækst og medfødt immunitet hos unge dyr |
| ATE412428T1 (de) | 2001-11-07 | 2008-11-15 | Cytos Biotechnology Ag | Antigen-raster enthaltend rankl zur behandlung von knochenerkrankungen |
| WO2003040164A2 (en) | 2001-11-07 | 2003-05-15 | Cytos Biotechnology Ag | Antigen arrays presenting il-5, il-3 or eotaxin for treatment of allergic eosinophilic diseases |
| TW200303759A (en) | 2001-11-27 | 2003-09-16 | Schering Corp | Methods for treating cancer |
| US20030219459A1 (en) * | 2002-01-18 | 2003-11-27 | Cytos Biotechnology Ag | Prion protein carrier-conjugates |
| WO2003059386A2 (en) | 2002-01-18 | 2003-07-24 | Cytos Biotechnology Ag | Prion protein carrier-conjugates |
| CA2488856A1 (en) | 2002-06-20 | 2003-12-31 | Cytos Biotechnology Ag | Packaged virus-like particles for use as adjuvants: method of preparation and use |
| EP2351770A1 (en) | 2002-07-17 | 2011-08-03 | Cytos Biotechnology AG | Molecular antigen arrays using a virus like particle derived from the ap205 coat protein |
| MXPA04011247A (es) | 2002-07-19 | 2005-02-17 | Cytos Biotechnology Ag | Conjugados portadores de grelina. |
| SI1524994T1 (sl) | 2002-07-19 | 2011-08-31 | Cytos Biotechnology Ag | Sestavki cepiv, ki vsebujejo amiloidne beta 1-6 antigenske mreĹľe |
| WO2004071493A1 (en) | 2003-02-17 | 2004-08-26 | Peter Burkhard | Peptidic nanoparticles as drug delivery and antigen display systems |
| EP1605972A2 (en) * | 2003-03-26 | 2005-12-21 | Cytos Biotechnology AG | Hiv-peptide-carrier-conjugates |
| US20060210588A1 (en) * | 2003-03-26 | 2006-09-21 | Cytos Biotechnology Ag | Hiv-peptide-carrier-conjugates |
| US7537767B2 (en) * | 2003-03-26 | 2009-05-26 | Cytis Biotechnology Ag | Melan-A- carrier conjugates |
| EP1644034B1 (en) * | 2003-07-10 | 2011-01-12 | Cytos Biotechnology AG | Composition for enhancing an immune response comprising packaged virus-like particles |
| CA2544240A1 (en) | 2003-07-22 | 2005-02-17 | Cytos Biotechnology Ag | Cpg-packaged liposomes |
| GEP20094767B (en) | 2003-10-30 | 2009-09-10 | Coley Pharm Group Inc | C-class oligonucleotide analogs with enhanced immunostimulatory potency |
| CA2580208A1 (en) * | 2004-09-21 | 2006-03-30 | Cytos Biotechnology Ag | Virus-like particles comprising a fusion protein of the coat protein of ap205 and an antigenic polypeptide |
| EP1973608A1 (en) * | 2005-12-14 | 2008-10-01 | Cytos Biotechnology AG | Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity |
-
2004
- 2004-03-25 EP EP04723204A patent/EP1605972A2/en not_active Withdrawn
- 2004-03-25 MX MXPA05009289A patent/MXPA05009289A/es active IP Right Grant
- 2004-03-25 US US10/550,518 patent/US7517520B2/en not_active Expired - Lifetime
- 2004-03-25 EP EP04723207A patent/EP1605973B1/en not_active Expired - Lifetime
- 2004-03-25 KR KR1020057017197A patent/KR20050115913A/ko not_active Ceased
- 2004-03-25 NZ NZ542323A patent/NZ542323A/en unknown
- 2004-03-25 WO PCT/EP2004/003164 patent/WO2004085635A1/en not_active Ceased
- 2004-03-25 BR BRPI0408623-6A patent/BRPI0408623A/pt not_active IP Right Cessation
- 2004-03-25 EP EP04723203A patent/EP1606398A1/en not_active Withdrawn
- 2004-03-25 CA CA002519165A patent/CA2519165A1/en not_active Abandoned
- 2004-03-25 RU RU2005129727/13A patent/RU2351362C2/ru not_active IP Right Cessation
- 2004-03-25 CA CA002517839A patent/CA2517839A1/en not_active Abandoned
- 2004-03-25 CA CA002517675A patent/CA2517675A1/en not_active Abandoned
- 2004-03-25 AU AU2004224761A patent/AU2004224761A1/en not_active Abandoned
- 2004-03-25 CN CNB2004800079060A patent/CN100560719C/zh not_active Expired - Fee Related
- 2004-03-25 WO PCT/EP2004/003165 patent/WO2004084940A1/en not_active Ceased
- 2004-03-25 AU AU2004224762A patent/AU2004224762B2/en not_active Expired
- 2004-03-25 JP JP2006504862A patent/JP5022028B2/ja not_active Expired - Fee Related
- 2004-03-25 WO PCT/EP2004/003163 patent/WO2004084939A2/en not_active Ceased
- 2004-03-25 ZA ZA200507063A patent/ZA200507063B/en unknown
- 2004-03-25 CN CN200910175527A patent/CN101675993A/zh active Pending
- 2004-03-25 ZA ZA200507562A patent/ZA200507562B/en unknown
- 2004-03-25 AU AU2004223736A patent/AU2004223736B2/en not_active Ceased
-
2005
- 2005-08-16 ZA ZA200506541A patent/ZA200506541B/en unknown
-
2009
- 2009-03-24 US US12/410,085 patent/US20100098722A1/en not_active Abandoned
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6326200B1 (en) * | 1997-06-23 | 2001-12-04 | Ludwig Institute For Cancer Research | Isolated nona-and decapeptides which bind to HLA molecules, and the use thereof |
| WO2001016320A1 (en) * | 1999-08-30 | 2001-03-08 | Ludwig Institute For Cancer Research | Isolated nona and decapeptides which bind to hla molecules, and the use thereof |
| US20030050268A1 (en) * | 2001-03-29 | 2003-03-13 | Krieg Arthur M. | Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases |
Non-Patent Citations (15)
| Title |
|---|
| "REMINGTON'S PHARMACEUTICAL SCIENCES", 1990, MACK PUBLISHING CO. |
| BACHMANN; ZINKEMAGEL, ANN. REV. IMMUNOL., vol. 15, 1997, pages 235 - 270 |
| BACHMANN; ZINKEMAGEL, IMMUNOL. TODAY |
| BROWN W L ET AL: "RNA BACTERIOPHAGE CAPSID-MEDIATED DRUG DELIVERY AND EPITOPE PRESENTATION", INTERVIROLOGY, XX, XX, vol. 45, no. 4 - 6, July 2002 (2002-07-01), pages 371 - 380, XP009020412, ISSN: 0300-5526 * |
| DECLERCQ, E, METHODS ENZYMOL., vol. 78, 1981, pages 227 - 236 |
| FEHR T ET AL: "T cell-independent type I antibody response against B cell epitopes expressed repetitively on recombinant virus particles", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 95, no. 16, 4 August 1998 (1998-08-04), pages 9477 - 9481, XP002212229, ISSN: 0027-8424 * |
| GILBERT ET AL: "A protein particle vaccine containing multiple malaria epitopes", NATURE BIOTECHNOLOGY, NATURE PUBLISHING, US, vol. 15, 1 November 1997 (1997-11-01), pages 1280 - 1284, XP002096555, ISSN: 1087-0156 * |
| KOBAYASHI H., IMMUNOGENETICS, vol. 47, 1998, pages 398 - 403 |
| KOBAYASHI, H., CABCER RES., vol. 61, 2001, pages 4773 - 4778 |
| LECHNER F ET AL: "VIRUS-LIKE PARTICLES AS A MODULAR SYSTEM FOR NOVEL VACCINES", INTERVIROLOGY, XX, XX, vol. 45, no. 4-6, July 2002 (2002-07-01), pages 212 - 217, XP008023830, ISSN: 0300-5526 * |
| LEVY, H.B, METHODS ENZYMOL., vol. 78, 1981, pages 242 - 251 |
| OXENIUS A ET AL: "CpG-containing oligonucleotides are efficient adjuvants for induction of protective antiviral immune responses with T-cell peptide vaccines", JOURNAL OF VIROLOGY, THE AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 73, no. 5, May 1999 (1999-05-01), pages 4120 - 4126, XP002964289, ISSN: 0022-538X * |
| TORRENCE, P.F., METHODS ENZYMOL, vol. 78, 1981, pages 326 - 331 |
| YAMAMOTO ET AL., SPRINGER SEMIN IMMUNOPATHOL., vol. 22, pages 11 - 19 |
| ZAROUR, H.M., CANCER RES., vol. 62, 2002, pages 213 - 218 |
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10987420B2 (en) | 2003-12-12 | 2021-04-27 | City Of Hope | Synthetic conjugate of CpG DNA and T-help/CTL peptide |
| US10596254B2 (en) * | 2003-12-12 | 2020-03-24 | City Of Hope | Synthetic conjugate of CpG DNA and T-help/CTL peptide |
| US20180243409A1 (en) * | 2003-12-12 | 2018-08-30 | City Of Hope | SYNTHETIC CONJUGATE OF CpG DNA AND T-HELP/CTL PEPTIDE |
| US8153426B2 (en) | 2004-08-19 | 2012-04-10 | University College Cardiff Consultants Limited | Preparation of antigen-presenting human gamma-delta T cells and use in immunotherapy |
| US7959928B2 (en) | 2004-10-05 | 2011-06-14 | Cytos Biotechnology Ag | VLP-antigen conjugates and their uses as vaccines |
| US20140081008A1 (en) * | 2005-06-21 | 2014-03-20 | Cytos Biotechnology Ag | Scalable Process for Protein Purification |
| US20110306113A1 (en) * | 2005-06-21 | 2011-12-15 | Cytos Biotechnology Ag | Scalable Process for Protein Purification |
| US20120214976A1 (en) * | 2005-06-21 | 2012-08-23 | Cytos Biotechnology Ag | Scalable Process for Protein Purification |
| US9657065B2 (en) * | 2005-06-21 | 2017-05-23 | Kuros Biosciences Ag | Scalable process for protein purification |
| US20150315246A1 (en) * | 2005-06-21 | 2015-11-05 | Cytos Biotechnology Ag | Scalable process for protein purification |
| US8338173B2 (en) * | 2005-08-11 | 2012-12-25 | University College Cardiff Consultants Limited | Preparation of antigen-presenting human γδ T cells and use in immunotherapy |
| JP2014097057A (ja) * | 2006-06-12 | 2014-05-29 | Cytos Biotechnology Ag | Rnaバクテリオファージのウイルス様粒子にオリゴヌクレオチドをパッケージ化するための方法 |
| JP2009539907A (ja) * | 2006-06-12 | 2009-11-19 | サイトス バイオテクノロジー アーゲー | Rnaバクテリオファージのウイルス様粒子にオリゴヌクレオチドをパッケージ化するための方法 |
| RU2442604C1 (ru) * | 2010-12-09 | 2012-02-20 | Иосиф Григорьевич Атабеков | Способ усиления иммунного ответа |
| RU2441667C1 (ru) * | 2010-12-09 | 2012-02-10 | Иосиф Григорьевич Атабеков | Новый тип частиц-носителей (платформ) для получения активных комплексов |
| RU2440140C1 (ru) * | 2010-12-09 | 2012-01-20 | Иосиф Григорьевич Атабеков | Иммуногенная композиция, содержащая чужеродные антигены на поверхности сферических носителей, полученных при термической денатурации спиральных вирусов |
| WO2013092720A1 (en) | 2011-12-22 | 2013-06-27 | F. Hoffmann-La Roche Ag | Full length antibody display system for eukaryotic cells and its use |
| CN108367066A (zh) * | 2015-09-10 | 2018-08-03 | 中央研究院 | 包括类病毒颗粒及新型佐剂的禽流感疫苗组合物 |
| CN108367066B (zh) * | 2015-09-10 | 2023-08-11 | 台湾地区“中央研究院” | 包括类病毒颗粒及新型佐剂的禽流感疫苗组合物 |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2004223736B2 (en) | Melan-A peptide analogue-virus-like-particle conjugates | |
| US20110097417A1 (en) | Melan-a-carrier conjugates | |
| AU2009200115B2 (en) | Packaging of immunostimulatory substances into virus-like particles: method of preparation and use | |
| AU2002339224A1 (en) | Packaging of immunostimulatory substances into virus-like particles: method of preparation and use | |
| EP1425040A2 (en) | In vivo activation of antigen presenting cells for enhancement of immune responses induced by virus like particles | |
| US20060210588A1 (en) | Hiv-peptide-carrier-conjugates | |
| HK1067058B (en) | Packaging of immunostimulatory cpg into virus-like particles: method of preparation and use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 170281 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005/06541 Country of ref document: ZA Ref document number: 200506541 Country of ref document: ZA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3784/DELNP/2005 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2005/009289 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2517839 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004223736 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 542323 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020057017197 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006504862 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005129727 Country of ref document: RU Ref document number: 20048079060 Country of ref document: CN Ref document number: 10551054 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2004223736 Country of ref document: AU Date of ref document: 20040325 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004223736 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004723203 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020057017197 Country of ref document: KR |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004723203 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: PI0408623 Country of ref document: BR |
|
| WWP | Wipo information: published in national office |
Ref document number: 10551054 Country of ref document: US |