WO2003086444A1 - Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins - Google Patents

Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins Download PDF

Info

Publication number
WO2003086444A1
WO2003086444A1 PCT/US2003/010443 US0310443W WO03086444A1 WO 2003086444 A1 WO2003086444 A1 WO 2003086444A1 US 0310443 W US0310443 W US 0310443W WO 03086444 A1 WO03086444 A1 WO 03086444A1
Authority
WO
WIPO (PCT)
Prior art keywords
ttr
biologically active
active agent
tmp
fusion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2003/010443
Other languages
English (en)
French (fr)
Inventor
Kenneth Walker
Fei Xiong
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Amgen Inc
Original Assignee
Amgen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Amgen Inc filed Critical Amgen Inc
Priority to AU2003224844A priority Critical patent/AU2003224844B2/en
Priority to JP2003583462A priority patent/JP4738743B2/ja
Priority to MXPA04009680A priority patent/MXPA04009680A/es
Priority to ES03721538T priority patent/ES2400341T3/es
Priority to EP03721538A priority patent/EP1496926B1/en
Priority to CA002480883A priority patent/CA2480883A1/en
Publication of WO2003086444A1 publication Critical patent/WO2003086444A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/043Kallidins; Bradykinins; Related peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/10Peptides having 12 to 20 amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/20Interleukins [IL]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22Hormones
    • A61K38/29Parathyroid hormone, i.e. parathormone; Parathyroid hormone-related peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/58Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained by reactions only involving carbon-to-carbon unsaturated bonds, e.g. poly[meth]acrylate, polyacrylamide, polystyrene, polyvinylpyrrolidone, polyvinylalcohol or polystyrene sulfonic acid resin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/61Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule the organic macromolecular compound being a polysaccharide or a derivative thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/643Albumins, e.g. HSA, BSA, ovalbumin or a Keyhole Limpet Hemocyanin [KHL]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/18Drugs for disorders of the endocrine system of the parathyroid hormones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/31Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin

Definitions

  • Proteins, peptides and other drug molecules for therapeutic use are currently available in suitable forms in adequate quantities largely as a result of the advances in recombinant DNA technologies .
  • the availability of such peptides and proteins has engendered advances in protein formulation and chemical modification.
  • Chemical modification of biologically active peptides, proteins, oligonucleotides and other drugs for purposes of extending the serum half-life of such bioactive agents has been extensively studied. The ability to extend the serum half-life of such agents allows for the therapeutic potential of the agent to be realized without the need for high dosages and frequent administration.
  • Chemical modification used to extend the half-lives of proteins in vivo includes the chemical conjugation of a water soluble polymer, such as polyethylene glycol (PEG), to the protein of interest.
  • PEG polyethylene glycol
  • N-terminally chemically modified proteins and analogs thereof including G-CSF and consensus interferon.
  • Transthyretin (formerly called prealbumin) is a 56kDa tetrameric serum protein that plays important physiological roles as a transporter of thyroxine and retinol-binding protein; Hamilton and Benson, Cell . Mol . Life Sci . , 58:1491-1521 (2001), and references cited therein.
  • TTR Transthyretin
  • Blaney et al. in U.S. Patent No. 5,714,142, describe the exploitation of TTR by endowing the drug to be administered with functionality that allows it to bind specifically to the protein. Specifically, Blaney et al .
  • TTR or a TTR variant
  • a TTR or TTR variant which has been chemically modified via conjugation to a water soluble polymer, e . g. can be used as a fusion partner with a biologically active agent to increase the serum half- life of the biologically active agent.
  • the present invention provides a means for increasing the serum half-life of a selected biologically active agent .
  • the present invention thus relates to substantially homogenous preparations of TTR (or a TTR variant) -biologically active agent fusions and PEG-TTR (PEG-TTR variant) -biologically active agent fusions.
  • TTR or a TTR variant
  • PEG-TTR PEG-TTR variant
  • the TTR-biologically active agent fusion and/or PEG-TTR- biologically active agent fusion has substantially increased serum half-life.
  • the present invention further relates to TTR-biologically active agent fusions and PEG-TTR- biologically active agent fusions, in a pharmaceutically acceptable carrier, to provide a pharmacologically active compound.
  • the present invention further relates to the preparation of TTR variants. Specifically, TTR proteins are modified such that cysteine residue (s) are engineered into the TTR protein sequence .
  • the TTR variants are recoverable in high yield and are then chemically modified via conjugation of a water soluble polymer at the cysteine residue to provide a chemically modified TTR variant which can then be fused to a selected biologically active agent.
  • the present invention further relates to processes for preparing pharmacologically active compounds.
  • the principal embodiment of the method for making the substantially homogenous preparation of a PEG-TTR-peptide fusion comprises: (a) engineering a cysteine residue into a specific amino acid position within the amino acid sequence of said TTR to provide a variant of said TTR; (b) conjugating a polyethylene glycol to said TTR variant at said cysteine residue to provide a PEG-TTR; (c) fusing said PEG-TTR to a peptide of interest to provide a PEG-TTR- peptide fusion; and (d) isolating said PEG-TTR-peptide fusion.
  • the present invention also relates to methods of treatment of individuals using the pharmacologically active compounds as above.
  • Figure 1 is an SDS gel that depicts the purification of an E. coli expressed, recombinant human transthyretin (TTR) variant (C10A/G83C) with a Bradykinin peptide fused to the C-terminus of TTR.
  • Lane 1 contains Novex Mark 12 molecular weight standards, and lanes 2 - 7 contain the following respectively: cell lysate, post-heating supernatant, pool from Q-sepharose chromatography step, pool from phenyl sepharose chromatography step, pool from hydroxyapatite chromatography step, and pool from source Q chromatography step.
  • Figure 2 demonstrates by size exclusion chromatography that fusion of peptides to the amino- terminus or carboxy-terminus of a TTR variant, TTR(C10A/G83C) , does not alter its oligomeric structure.
  • Solid line is TTR(C10A/G83C)
  • dashed line is parathyroid hormone (PTH) fused to the amino- terminus of TTR(C10A/G83C)
  • PTH parathyroid hormone
  • the dotted line is Bradykinin fused to the carboxy-terminus of TTR(C10A/G83C) .
  • Figure 3 demonstrates by size exclusion chromatography that fusion of proteins to the amino- terminus or carboxy-terminus of a TTR variant, TTR(CIOA) , does not alter its oligomeric structure.
  • Solid line is TTR(CIOA)
  • dashed line is IL-l-ra fused to the carboxy-terminus of TTR(CIOA)
  • the dotted line is IL-l-ra fused to the amino-terminus of TTR(CIOA) .
  • FIG. 4 shows the binding observed using BIAcore of various TPO-mimetic peptide (TMP) constructs to human MPL receptor: ⁇ Fc-TMP, • TMP(m)-TTR, A TMP(m) -TTR-PEG5K, T TMP (m) -TTR-PEG20K.
  • TMP TPO-mimetic peptide
  • FIG. 5 shows that injection of TMP(m)-TTR- PEG5K induces platelet formation in mice.
  • the following symbols correspond to the corresponding constructs: ⁇ Carrier, • Fc-TMP, A TTR-TMP, T TMP (m) -TTR, and ⁇ TMP (m) -TTR-PEG5K.
  • Figure 6 demonstrates by size exclusion chromatography that native TTR and TTR(CIOA) maintain a similar oligomeric configuration (an apparent tetramer) . Solid line is native TTR and the dashed line is TTR(CIOA) .
  • Figure 7 demonstrates by size exclusion chromatography that conjugation of PEG to TTR increases its molecular size in a predictable uniform manner. Solid lines indicate no PEG conjugated, dashed lines indicate 5K PEG fused, and dotted lines indicate 20K PEG fused. The following constructs were used: A) TMP- TTR(C10A/A37C) , B) TMP-TTR(C10A/D38C) , C) TMP- TTR(C10A/A81C) , and D) TMP-TTR (C10A/G83C) .
  • Figure 8 is an SDS gel that depicts the extent of pegylation of various TMP-TTR constructs involving TTR variants having a non-native cysteine engineered in at one of four different locations.
  • Lane 1 contains Novex Mark 12 molecular weight standards;
  • lane 2 is unpegylated TMP-TTR (C10A/A37C) ;
  • lanes 3 - 6 are 5K pegylated versions of TMP-TTR (C10A/A37C) , TMP-TTR (C10A/D38C) , TMP-TTR (C10A/A81C) , and TMP-TTR(C10A/G83C) respectively;
  • lanes 7 - 10 are 20K pegylated versions of TMP-TTR (C10A/A37C) ,
  • TMP-TTR(C10A/D38C) TMP-TTR(C10A/A81C)
  • TMP-TTR C10A/G83C
  • Figures 9A-C compare the competitive binding of Fc-TMP and TMP-TTR to human MPL by BIAcore analysis.
  • FIGS 10A-C show that injection of TMP-TTR with PEG conjugated to engineered cysteines induces platelet formation in mice.
  • A) ⁇ TTR(CIOA), • Fc-TMP, A TMP-TTR(C10A/A37C) , T TMP-TTR (C10A/D38C) (carboxamidomethylated), ⁇ TMP-TTR (C10A/A81C) , 4 TMP- TTR(C10A/G83C) .
  • FIG. 11 shows that injection of PTH-TTR with PEG conjugated to engineered cysteines induces ionized calcium release in mice.
  • the following symbols correspond to the corresponding constructs: ⁇ TTR(CIOA), • PTH-Fc, A PTH-TTR, T PTH- TTR(C10A/K15A/A37C) (carboxamidomethylated), ⁇ 5K pegylated version of PTH-TTR (C10A/K15A/A37C) , ⁇ 20K pegylated version of PTH-TTR (C10A/K15A/A37C) , ⁇ PTH- TTR(C10A/K15A/G83C) (carboxamidomethylated), ⁇ 5K pegylated version of PTH-TTR (C10A/K15A/G83C) , and *20K pegylated version of PTH-TTR(C10A/K15A/G83C) .
  • Figure 12 shows that injection of Glucagon- like Peptide 1 (GLPl)-TTR with PEG conjugated to engineered cysteines lowers blood glucose levels in mice.
  • GLPl Glucagon- like Peptide 1
  • the following symbols correspond to the corresponding constructs: ⁇ TTR(CIOA) , • GLPl-Fc, A GLP1-TTR(C10A/K15A/G83C) (PEG 5K) , and T GLP1- TTR(C10A/K15A/G83C) (PEG 20K) .
  • FIG. 13 shows that injection of TMP-TTR conjugates with fused CH2 domains increase serum platelet levels in mice.
  • the following symbols correspond to the corresponding constructs : ⁇ TTR(CIOA), • Fc-TMP, A TMP-TTR (C10A) -CH2 , T TTR(C10A)-CH2-TMP, and ⁇ TMP-CH2-TTR(C10A) .
  • Figure 14 shows that injection of and carboxy-terminal fusions of TMP with pegylated TTR increases blood platelet counts in mice.
  • the following symbols correspond to the corresponding constructs: ⁇ TTR(CIOA), • Fc-TMP, A TTR (C10A/K15A/A37C) -TMP (PEG 20K) , T TTR(C10A/K15A/A81C)-TMP (PEG 20K) , ⁇ TTR(C10A/K15A/G83C)-TMP (PEG 20K) , ⁇ TMP- TTR(C10A/K15A/A37C) (PEG 20K) , ⁇ TMP- TTR(C10A/K15A/A81C) (PEG 20K) , • TMP- TTR(C10A/K15A/G83C) (PEG 20K) .
  • FIGS 15 A-C show that injection of pegylated TMP-TTR fusions containing a K15A alteration increases blood platelet counts in mice.
  • the following symbols correspond to the corresponding constructs: A) ⁇ TTR(CIOA), • Fc-TMP, A TMP-TTR (C10A/K15A/A37C) (carboxyamidomethylated) , and T TMP- TTR (C10A/K15A/A81C) (carboxyamidomethylated) ; B) ⁇ TTR(CIOA), • Fc-TMP, A TMP-TTR (C10A/K15A/A37C) (PEG 5K) , ⁇ TMP-TTR (C10A/K15A/A81C) (PEG 5K) , and ⁇ TMP- TTR(C10A/K15A/G83C) (PEG 5K) ; C) ⁇ TTR(CIOA), • Fc- TMP, A TMP
  • biologically active agent refers to any chemical material or compound useful for prophylactic, therapeutic or diagnostic application.
  • pharmaceutically active compound refers to a compound suitable for administration to a mammalian, preferably a human individual, which induces a desired local or systemic effect.
  • peptide refers to a type of biologically active agents, and the terms are used interchangeably herein to refer to a naturally occurring, recombinantly produced or chemically synthesized polymer of amino acids.
  • the terms are intended to include peptide molecules containing as few as 2 amino acids, chemically modified polypeptides, consensus molecules, analogs, derivatives or combinations thereof.
  • peptides may be used in conjunction with the present invention.
  • peptides that mimic the activity of erythropoietin (EPO) , thrombopoietin (TPO) , Glucagon- like Peptide 1 (GLP-1) , parathyroid hormone (PTH), granulocyte-colony stimulating factor (G-CSF) , granulocyte macrophage-colony stimulating factor (GM- CSF) , interleukin-1 receptor antagonist (IL-lra) , leptin, cytotoxic T-lymphocyte antigen 4 (CTLA4) , TNF- related apoptosis-inducing ligand (TRAIL) , tumor growth factor-alpha and beta (TGF- ⁇ and TGF- ⁇ , respectively) , and growth hormones.
  • EPO erythropoietin
  • TPO thrombopoietin
  • GLP-1 parathyroid hormone
  • G-CSF granulocyte-
  • -mimetic peptide and “-agonist peptide” refer to a peptide having biological activity comparable to a protein (e.g., GLP-1, PTH, EPO, TPO, G-CSF, etc.) that interacts with a protein of interest. These terms further include peptides that indirectly mimic the activity of a protein of interest, such as by potentiating the effects of the natural ligand of the protein of interest.
  • EPO-mimetic peptide comprises any peptides that can be identified or derived as having EPO-mimetic subject matter; see, for example, Wrighton et al . , Science, 273:458-63 (1996); and Naranda et al . , Proc . Natl .
  • TPO-mimetic peptide comprises peptides that can be identified or derived as having TPO-mimetic subject matter; see, for example, Cwirla et al . , Science, 276:1696-9 (1997); U.S. Patent Nos. 5,869,451 and 5,932,946; and PCT WO 00/24782 (Liu et al, and references cited therein) , hereby incorporated by reference in its entirety.
  • TPO-mimetic peptide comprises peptides that can be identified or derived as having TPO-mimetic subject matter; see, for example, Cwirla et al . , Science, 276:1696-9 (1997); U.S. Patent Nos. 5,869,451 and 5,932,946; and PCT WO 00/24782 (Liu et al, and references cited therein) , hereby incorporated by reference in its entirety.
  • each of these references enables one to select different peptides
  • G-CSF-mimetic peptide comprises any peptides that can be identified as having G-CSF- mimetic subject matter; see, for example, Paukovits et al., Hoppe-Seylers Z . Physiol . Chem . 365:303-11 (1984). Those of ordinary skill in the art appreciate that each of these references enables one to select different peptides than actually disclosed therein by following the disclosed procedures with different peptide libraries.
  • CTLA4-mimetic peptide comprises any peptides that can be identified or derived as described in Fukumoto et al . , Nature Biotech . 16 . : 267-70 (1998) . Those of ordinary skill in the art appreciate that each of these references enables one to select different peptides than actually disclosed therein by following the disclosed procedures with different peptide libraries.
  • Peptide antagonists are also of interest, particularly those antagonistic to the activity of TNF, leptin, any of the interleukins, and proteins involved in complement activation (e.g., C3b) .
  • - antagonist peptide or “inhibitor peptide” refers to a peptide that blocks or in some way interferes with the biological activity of the associated protein of interest, or has biological activity comparable to a known antagonist or inhibitor of the associated protein of interest.
  • the term "TNF-antagonist peptide” comprises peptides that can be identified or derived as having TNF-antagonistic subject matter; see, foe example, Takasaki et al . , Nature Biotech . , 15 : 1266-70 (1997).
  • IL-1 antagonist and "IL-lra- mimetic peptide” comprises peptides that inhibit or down-regulate activation of the IL-1 receptor by IL-1.
  • IL-1 receptor activation results from formation of a complex among IL-1, IL-1 receptor, and IL-1 receptor accessory protein.
  • IL-1 antagonist or IL-lra-mimetic peptides bind to IL-1, IL-1 receptor, or IL-1 receptor accessory protein and obstruct complex formation among any two or three components of the complex.
  • Exemplary IL-1 antagonist or IL-lra-mimetic peptides can be identified or derived as described in U.S. Pat. Nos . 5,608,035, 5,786,331, 5,880,096. Those of ordinary skill in the art appreciate that each of these references enables one to select different peptides than actually disclosed therein by following the disclosed procedures with different peptide libraries.
  • VEGF-antagonist peptide comprises peptides that can be identified or derived as having VEGF-antagonistic subject matter; see, for example, Fairbrother, Biochem. , 37:17754-64 (1998).
  • MMP inhibitor peptide comprises peptides that can be identified or derived as having MMP inhibitory subject matter; see, for example, Koivunen, Nature Biotech . , 17:768-74 (1999).
  • MMP inhibitor peptide comprises peptides that can be identified or derived as having MMP inhibitory subject matter; see, for example, Koivunen, Nature Biotech . , 17:768-74 (1999).
  • MMP inhibitor peptide comprises peptides that can be identified or derived as having MMP inhibitory subject matter; see, for example, Koivunen, Nature Biotech . , 17:768-74 (1999).
  • each of these references enables one to select different peptides than actually disclosed therein by following the disclosed procedures with different
  • Targeting peptides are also of interest, including tumor-homing peptides, membrane-transporting peptides, and the like.
  • Exemplary peptides may be randomly generated by various techniques known in the art.
  • solid phase synthesis techniques are well known in the art, and include those described in Merrifield, Chem. Polypeptides , pp. 335-61 (Katsoyannis and Panayotis eds. ) (1973) ; Merrifield, J. Am. Chem. Soc . , 85:2149 (1963); Davis et al., Biochem. Intl . , 10:394-414 (1985) ; Stewart and Young, Solid Phase Peptide Synthesis (1969); U.S. Pat. No. 3,941,763; Finn et al .
  • Solid phase synthesis is the preferred technique of making individual peptides since it is the most cost-effective method of making small peptides.
  • the peptides may also be made in transformed host cells using recombinant DNA techniques. To do so, a recombinant DNA molecule coding for the peptide is prepared. Methods of preparing such DNA and/or RNA molecules are well known in the art. For instance, sequences coding for the peptides could be excised from DNA using suitable restriction enzymes. The relevant sequences can be created using the polymerase chain reaction (PCR) with the inclusion of useful restriction sites for subsequent cloning. Alternatively, the DNA/RNA molecule could be synthesized using chemical synthesis techniques, such as the phosphoramidite method. Also, a combination of these techniques could be used.
  • Additional biologically active agents contemplated for use include recombinant or naturally occurring proteins, whether human or animal, hormones, cytokines, hematopoietic factors, growth factors, antiobesity factors, trophic factors, anti-inflammatory factors, and enzymes.
  • proteins would include but are not limited to interferons ( see, U.S. Patent Nos . 5,372,808, 5,541,293 4,897,471, and 4,695,623 hereby incorporated by reference including drawings) , interleukins ( see, U.S. Patent No. 5,075,222, hereby incorporated by reference including drawings), erythropoietins (see, U.S. Patent Nos.
  • IL-lra interleukin-1 receptor antagonist
  • OB protein leptin
  • biologically active agents can also include but are not limited to insulin, gastrin, prolactin, adrenocorticotropic hormone (ACTH) , thyroid stimulating hormone (TSH) , luteinizing hormone (LH) , follicle stimulating hormone (FSH) , human chorionic gonadotropin (HCG) , motilin, interferons (alpha, beta, gamma), interleukins (IL-1 to IL-12), tumor necrosis factor (TNF) , tumor necrosis factor-binding protein (TNF-bp) , brain derived neurotrophic factor (BDNF) , glial derived neurotrophic factor (GDNF) , neurotrophic factor 3 (NT3), fibroblast growth factors (FGF) , neurotrophic growth factor (NGF) , bone growth factors such as osteoprotegerin (OPG) , insulin-like growth factors (IGFs) , macrophage colony stimulating factor (M-CSF) , granulocyte
  • Transthyretin contemplated for use in the present invention will have the DNA and amino acid sequences of TTR as reported in Mita et al . , Biochem. Biophys . Res . Commun . , 124 (2 ): 558-564 (1984). These sequences have been deposited in Genbank as accession number K02091.
  • the 127 amino acid TTR sequence used herein does not include the signal sequence (amino acids 1-20) of the K02091 sequence and is depicted below as SEQ ID N0:1.
  • TTR variant refers to a molecule or sequence that is a modified form of a native TTR.
  • a native TTR comprises sites that may be removed because they provide structural features or biological activity that are not required for the fusion molecules of the present invention.
  • TR variant comprises a molecule or sequence that lacks one or more native TTR sites or residues or that has had one or more native TTR sites or residues replaced with a different amino acid or that has had one or more residues added to the sequence.
  • TTR variant wherein the Alanine residue at amino acid sequence position 37 has been replaced with a Cysteine residue
  • TTR variant A37C
  • TTR variant A37C/G83C
  • a TTR or TTR variant fused to a biologically active agent may be fused to a third protein or protein fragment that further stabilizes the TTR-biologically active agent fusion protein, and thereby increases the half-life of the resulting fusion in serum.
  • additional proteins or fragments thereof that can be used in such methods and compositions include the Fc domain or CH2 domain of an immunoglobulin, or any other protein domain that one of skill in the art would recognize as having properties that would increase protein stability (see, e.g., Example 29 below) .
  • Such protein groups can be fused to the carboxy or amino terminus of the TTR-biologically active agent fusion protein, or can be placed between the TTR and the biologically active agent. It is contemplated that linkers or spacers can be placed, as needed, between each of the domains of the fusion protein to facilitate their desired activity.
  • the TTR or TTR variant of the invention can be chemically crosslinked to the biologically active agent.
  • Cross-linking of proteins can be performed by using, for example, N-succinimidyl 3- (2-pyridyldithio) propionate (SPDP) according to established, published procedures. Additional cross- linking agents are readily available and can be identified by one of skill in the art. For details on the above procedure, see, e.g., Karpovsky et al, J. Exp. Med. 160, 1686-1701 (1984); Perez et al, Nature, 316, 354-356 (1985) or Titus et al, Journal of Immunology, 139, 3153-3158 (1987).
  • a molecule can be covalently linked to the fusion protein such that stability and/or half-life in serum are increased.
  • a preferred TTR or TTR variant may be chemically modified using water soluble polymers such as polyethylene glycol (PEG) .
  • PEG polyethylene glycol
  • the PEG group may be of any convenient molecular weight and may be straight chain or branched.
  • the average molecular weight of the PEG will preferably range from about 2 kDa to about 100 kDa, more preferably from about 5 kDa to about 50 kDa, most preferably about 20 kDa.
  • the PEG groups will generally be attached to the compounds of the invention via acylation, reductive alkylation, Michael addition, thiol alkylation or other chemoselective conjugation/ligation methods through a reactive group on the peg moiety (e.g., an aldehyde, amino, ester, thiol, -haloacetyl, maleimido or hydrazino group) to a reactive group on the target compound (e.g., an aldehyde, amino, ester, thiol, haloacetyl, maleimido or hydrazino group) .
  • a reactive group on the peg moiety e.g., an aldehyde, amino, ester, thiol, -haloacetyl, maleimido or hydrazino group
  • a reactive group on the target compound e.g., an aldehyde, amino, ester, thiol, haloacetyl
  • water soluble polymers used include copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1, 3-dioxolane, poly-1, 3 , 6-trioxane, ethylene/maleic anhydride copolymer, polyaminoacids (either homopolymers or random copolymers) , and dextran .
  • a DNA molecule encoding the peptide of interest, protein of interest, TTR or TTR variant can be prepared using well known recombinant DNA technology methods such as those set forth in Sambrook et al . (Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [1989]) and/or Ausubel et al . , eds , Current Protocols in Molecular Biology, Green Publishers Inc. and Wiley and Sons, NY (1994).
  • a gene or cDNA encoding the protein of interest or fragment thereof may be obtained for example by screening a genomic or cDNA library with a suitable probe.
  • Suitable probes include, for example, oligonucleotides, cDNA fragments, or genomic DNA fragments, that are expected to have some homology to the gene encoding the protein of interest, such that the probe will hybridize with the gene encoding the protein of interest under selected hybridization conditions .
  • An alternate means of screening a DNA library is by polymerase chain reaction "PCR” amplification of the gene encoding the protein of interest. PCR is typically accomplished using oligonucleotide "primers" which have a sequence that is believed to have sufficient homology to the gene to be amplified such that at least a sufficient portion of the primer will hybridize with the gene.
  • a gene encoding the peptide of interest or protein of interest may be prepared by chemical synthesis using methods well known to the skilled artisan such as those described by Engels et al . , Angew. Chem . Intl . Ed. , 28:716-734 (1989). These methods include, inter alia, the phosphotriester, phosphoramidite, and H-phosphonate methods for nucleic acid synthesis. A preferred method for such chemical synthesis is polymer-supported synthesis using standard phosphoramidite chemistry.
  • the DNA encoding the protein of interest will be several hundred nucleotides in length. Nucleic acids larger than about 100 nucleotides can be synthesized as several fragments using these methods.
  • the fragments can then be ligated together to form a gene coding for the full length protein of interest.
  • the DNA fragment encoding the amino terminus of the polypeptide will have an ATG, which encodes a methionine residue.
  • This methionine may or may not be present on the mature form of the protein of interest.
  • the methionine can be removed inside the cell or during the process of secretion.
  • Preferred TTR polypeptides may include TTR with the nucleic acid sequence altered to optimize expression in E. coli and to introduce convenient restriction sites. A general discussion of codon optimization for expression in E. coli is described in Kane, Curr. Opin . Biotechnol . , 6:494-500 (1995).
  • the genes encoding the protein of interest and the TTR polypeptide may be modified using standard methods to create restriction endonuclease sites at the 5' and/or 3' ends. Creation of the restriction sites permits the genes to be properly inserted into amplification and/or expression vectors. Addition of restriction sites is typically accomplished using PCR, where one primer of each PCR reaction typically contains, inter alia, the nucleotide sequence of the desired restriction site.
  • the gene or cDNA encoding the peptide of interest, or protein of interest can be inserted into an appropriate expression vector for expression in a host cell.
  • the vector is selected to be functional in the particular host cell employed ( i . e . , the vector is compatible with the host cell machinery such that amplification and/or expression of the gene encoding the protein of interest can occur) .
  • the vectors used in any of the host cells will contain a promoter (also referred to as a "5' flanking sequence") and other regulatory elements as well such as an enhancer(s), an origin of replication element, a transcriptional termination element, a ribosome binding site element, a polylinker region for inserting the nucleic acid encoding the polypeptide to be expressed, and a selectable marker element.
  • a promoter also referred to as a "5' flanking sequence”
  • other regulatory elements such as an enhancer(s), an origin of replication element, a transcriptional termination element, a ribosome binding site element, a polylinker region for inserting the nucleic acid encoding the polypeptide to be expressed, and a selectable marker element.
  • an enhancer(s) an origin of replication element
  • a transcriptional termination element such as a transcriptional termination element
  • a ribosome binding site element such as a promoter(s), an origin of replication element, a transcriptional termination element, a
  • the tag DNA encodes a molecule such as hexaHis, c-myc, FLAG (Invitrogen, San Diego, CA) or another small immunogenic sequence. When placed in the proper reading frame, this tag will be expressed along with the fusion protein, and can serve as an affinity tag for purification of the fusion protein from the host cell. Optionally, the tag can subsequently be removed from the purified fusion protein by various means such as using a selected peptidase for example.
  • the promoter may be homologous (i.e., from the same species and/or strain as the host cell), heterologous (i.e., from a species other than the host cell species or strain), hybrid (i.e., a combination of promoters from more than one source), synthetic, or it may be the native protein of interest promoter. Further, the promoter may be a constitutive or an inducible promoter. As such, the source of the promoter may be any unicellular prokaryotic or eukaryotic organism, any vertebrate or invertebrate organism, or any plant, provided that the promoter is functional in, and can be activated by, the host cell machinery.
  • the promoters useful in the vectors of this invention may be obtained by any of several methods well known in the art.
  • promoters useful herein will have been previously identified by mapping and/or by restriction endonuclease digestion and can thus be isolated from the proper tissue source using the appropriate restriction endonucleases .
  • the full nucleotide sequence of the promoter may be known.
  • the promoter may be synthesized using the methods described above for nucleic acid synthesis or cloning. Where all or only a portion of the promoter sequence is known, the complete promoter may be obtained using PCR and/or by screening a genomic library with suitable oligonucleotide and/or 5 ' flanking sequence fragments from the same or another species.
  • Suitable promoters for practicing this invention are inducible promoters such as the lux promoter, the lac promoter, the arabinose promoter, the trp promoter, the tac promoter, the tna promoter, synthetic lambda promoters (from bacteriophage lambda), and the T5 or T7 promoters.
  • Preferred promoters include the lux, and lac promoters.
  • the origin of replication element is typically a part of prokaryotic expression vectors whether purchased commercially or constructed by the user. In some cases, amplification of the vector to a certain copy number can be important for optimal expression of the protein or polypeptide of interest. In other cases, a constant copy number is preferred. In any case, a vector with an origin of replication that fulfills the requirements can be readily selected by the skilled artisan. If the vector of choice does not contain an origin of replication site, one may be chemically synthesized based on a known sequence, and ligated into the vector.
  • the transcription termination element is typically located 3 ' of the end of the fusion protein DNA construct, and serves to terminate transcription of the RNA message coding for the fusion polypeptide.
  • the transcription termination element in prokaryotic cells is a G-C rich fragment followed by a poly T sequence. While the element is easily cloned from a library or even purchased commercially as part of a vector, it can also be readily synthesized using methods for nucleic acid synthesis such as those described above .
  • Expression vectors typically contain a gene coding for a selectable marker. This gene encodes a protein necessary for the survival and growth of a host cell grown in a selective culture medium. Typical selection marker genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, tetracycline, chloramphenicol, or kanamycin for prokaryotic host cells, (b) complement auxotrophic deficiencies of the cell; or (c) supply critical nutrients not available from complex media.
  • Preferred selectable markers are the kanamycin resistance gene, the ampicillin resistance gene, the chloramphenicol resistance gene, and the tetracycline resistance gene.
  • the ribosome binding element commonly called the Shine-Dalgarno sequence in prokaryotes, is necessary for the initiation of translation of mRNA.
  • the element is typically located 3 ' to the promoter and 5 ' to the coding sequence of the fusion protein DNA construct.
  • the Shine-Dalgarno sequence is varied but is typically a polypurine (i.e., having a high A-G content) .
  • Many Shine-Dalgarno sequences have been identified, each of which can be readily synthesized using methods set forth above and used in a prokaryotic vector. Where one or more of the elements set forth above are not already present in the vector to be used, they may be individually obtained and ligated into the vector.
  • Each element may be individually ligated into the vector by cutting the vector with the appropriate restriction endonuclease (s) such that the ends of the element to be ligated in and the ends of the vector are compatible for ligation.
  • s restriction endonuclease
  • two or more of the elements to be inserted into the vector may first be ligated together (if they are to be positioned adjacent to each other) and then ligated into the vector.
  • Another method for constructing the vector is to conduct all ligations of the various elements simultaneously in one reaction mixture.
  • many nonsense or nonfunctional vectors may be generated due to improper ligation or insertion of the elements, however the functional vector may be identified by expression of the selectable marker.
  • Proper sequence of the ligation product can be confirmed by digestion with restriction endonucleases or by DNA sequencing.
  • the completed vector may be inserted into a suitable host cell for fusion protein expression.
  • Host cells suitable for the present invention are bacterial cells.
  • E. coli e . g. , HB101, JM109, DH5 ⁇ , DH10, and MC1061
  • the choice of bacterial strain is typically made so that the strain and the expression vector to be used are compatible.
  • Various strains of B . subtilis , Pseudomonas spp . , other Bacillus spp . , Streptomyces spp . , and the like may also be employed in practicing this invention in conjunction with appropriate expression vectors.
  • Insertion also referred to as "transformation” or “transfection" of the vector into the selected host cell may be accomplished using such methods as calcium phosphate precipitation or electroporation.
  • the method selected will in part be a function of the type of host cell to be used. These methods and other suitable methods are well known to the skilled artisan, and are set forth, for example, in Sambrook et al . , supra .
  • the host cells containing the vector i.e., transformed or transfected host cells
  • the selected medium will typically contain all nutrients necessary for the growth and survival of the host cells.
  • Suitable media for culturing E. coli cells are, for example, Luria broth (“LB”), YT broth, SOB, SOC, and/or Terrific Broth ("TB”) .
  • the DNA construct encoding the fusion protein which comprises the TTR gene, the gene encoding the peptide or protein of interest, and, optionally, a DNA molecule encoding a linker peptide which is located between the two genes.
  • the TTR gene and gene encoding the protein of interest can be ligated together in either orientation (e.g., TTR gene at the 5' or 3' end of the construct).
  • a linker DNA molecule is to be included, it can first be ligated to one of the fusion partner genes, and that construct can then be ligated to the other fusion partner gene. Ligations are typically accomplished using DNA ligase enzyme in accordance with the manufacturer's instructions.
  • a separate procedure provides for first ligating one fusion partner gene into the selected vector, after which the other fusion partner gene can be ligated into the vector in a position that is either 3' or 5 ' to the first fusion partner gene.
  • the linker DNA molecule may be ligated to either fusion partner gene either before or after that gene has been ligated into the vector.
  • the TTR-TMPs of the present invention can be used to treat conditions generally known as those that involve an existing megakaryocyte/platelet deficiency or an expected megakaryocyte/platelet deficiency (e.g., because of planned surgery or platelet donation) . Such conditions will usually be the result of a deficiency (temporary or permanent) of active Mpl ligand in vivo.
  • the generic term for platelet deficiency is thrombocytopenia, and hence the methods and compositions of the present invention are generally available for treating thrombocytopenia in patients in need thereof.
  • Thrombocytopenia may be present for various reasons, including chemotherapy and other therapy with a variety of drugs, radiation therapy, surgery, accidental blood loss, and other specific disease conditions.
  • Exemplary specific disease conditions that involve thrombocytopenia and may be treated in accordance with this invention are: aplastic anemia, idiopathic thrombocytopenia, metastatic tumors which result in thrombocytopenia, systemic lupus erythematosus , splenomegaly, Fanconi ' s syndrome, vitamin B12 deficiency, folic acid deficiency, May- Hegglin anomaly, Wiskott-Aldrich syndrome, and paroxysmal nocturnal hemoglobinuria.
  • certain treatments for AIDS result in thrombocytopenia (e.g., AZT) .
  • Certain wound healing disorders might also benefit from an increase in platelet numbers.
  • a compound of the present invention could be administered several days to several hours prior to the need for platelets.
  • a compound of this invention could be administered along with blood or purified platelets.
  • the TMP compounds of this invention may also be useful in stimulating certain cell types other than megakaryocytes if such cells are found to express Mpl receptor. Conditions associated with such cells that express the Mpl receptor, which are responsive to stimulation by the Mpl ligand, are also within the scope of this invention.
  • the TMP compounds of this invention may be used in any situation in which production of platelets or platelet precursor cells is desired, or in which stimulation of the c-Mpl receptor is desired.
  • the compounds of this invention may be used to treat any condition in a mammal wherein there is a need of platelets, megakaryocytes, and the like. Such conditions are described in detail in the following exemplary sources: W095/26746; W095/21919; W095/18858; WO95/21920 and are incorporated herein.
  • the TMP compounds of this invention may also be useful in maintaining the viability or storage life of platelets and/or megakaryocytes and related cells.
  • compositions and compounds of the present invention may also be employed, alone or in combination with other cytokines, soluble Mpl receptor, hematopoietic factors, interleukins, growth factors or antibodies in the treatment of disease states characterized by other symptoms as well as platelet deficiencies. It is anticipated that the inventive compound will prove useful in treating some forms of thrombocytopenia in combination with general stimulators of hematopoiesis, such as IL-3 or GM-CSF.
  • megakaryocytic stimulatory factors i.e., meg-CSF, stem cell factor (SCF) , leukemia inhibitory factor (LIF) , oncostatin M (OSM) , or other molecules with megakaryocyte stimulating activity may also be employed with Mpl ligand.
  • SCF stem cell factor
  • LIF leukemia inhibitory factor
  • OSM oncostatin M
  • Additional exemplary cytokines or hematopoietic factors for such co-administration include IL-1 alpha, IL-1 beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-11, colony stimulating factor-1 (CSF-1) , SCF, GM-CSF, granulocyte colony stimulating factor (G-CSF) , EPO, interferon- alpha (IFN-alpha) , consensus interferon, IFN-beta, or IFN-gamma.
  • a soluble mammalian Mpl receptor which appears to have an effect of causing megakaryocytes to fragment into platelets once the megakaryocytes have reached mature form.
  • administration of an inventive compound to enhance the number of mature megakaryocytes
  • administration of the soluble Mpl receptor to inactivate the ligand and allow the mature megakaryocytes to produce platelets
  • the appropriate dosage would be adjusted to compensate for such additional components in the therapeutic composition.
  • Progress of the treated patient can be monitored by conventional methods .
  • NIDDM non-insulin dependent diabetes mellitus
  • NIDDM non-insulin dependent diabetes mellitus
  • GLP-1 peptide can be varied such that it retains its insulinotropic effects.
  • Particular examples of such variations known in the art include, for example, GLP-1 (7-34) , (7-35), (7-36) or (7-37), Gln 9 -GLP-l(7-37) , D-Gln 9 -GLP-1 (7-37 ) , Thr 16 -Lys l ⁇ -GLP-1 (7- 37), and Lys 18 -GLP-1 (7-37 ) . Additional examples of GLP- 1 variants are described in U.S. Patent Nos.
  • any GLP-1 peptide can be used to generate fusion proteins of the invention, as long as the GLP-1 fusion protein is capable of binding and inducing a signal through it's cognate receptor. Receptor binding and activation can be measured by standard assays (U.S. Patent No. 5,120,712) .
  • the dose of fusion protein effective to normalize a patient's blood glucose will depend on a number of factors among which are included the subject's weight, age, severity of their inability to regulate blood glucose, the route of administration, the bioavailability, the pharmokinetic profile of the fusion protein and the formulation as is discussed more fully below.
  • the therapeutic methods, compositions and compounds of the present invention may also be employed, alone or in combination with other diabetes treatments, including but not limited to insulin, DPPIV-inhibitors and the like.
  • the dosage of the GLP-1 fusion protein would be adjusted to compensate for such additional components in the therapeutic composition.
  • Progress of the treated patient can be monitored by conventional methods, such as, for example, the monitoring of blood glucose levels.
  • compositions of the inventive compounds may be for administration for injection, or for oral, nasal, transdermal or other forms of administration, including, e . g. , by intravenous, intradermal, intramuscular, intramammary, intraperitoneal, intrathecal, intraocular, retrobulbar, intrapulmonary (e.g., aerosolized drugs) or subcutaneous injection (including depot administration for long term release) ; by sublingual, anal, vaginal, or by surgical implantation, e. g. , embedded under the splenic capsule, brain, or in the cornea.
  • the treatment may consist of a single dose or a plurality of doses over a period of time.
  • compositions comprising effective amounts of a compound of the invention together with pharmaceutically acceptable diluents, preservatives, stabilizers, solubilizers, emulsifiers, adjuvants and/or carriers.
  • compositions include diluents of various buffer content (e.g., Tris-HCl, acetate, phosphate, citrate, etc.), pH and ionic strength; additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80, etc.), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite) , preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol) ; incorporation of the material into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes.
  • buffer content e.g., Tris-HCl, acetate, phosphate, citrate, etc.
  • additives e.g., Tween 80, Polysorbate 80, etc.
  • anti-oxidants e.g., ascorbic acid, sodium metabisulfit
  • Hyaluronic acid may also be used, and this may have the effect of promoting sustained duration in the circulation.
  • the pharmaceutical compositions optionally may include still other pharmaceutically acceptable liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media, including but are not limited to, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl- and propylhydroxybenzoate, starches, sucrose, dextrose, gum acacia, calcium phosphate, mineral oil, cocoa butter, and oil of theobroma .
  • Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the present proteins and derivatives.
  • compositions may be prepared in liquid form, or may be in dried powder, such as lyophilized form.
  • Implantable sustained release formulations are also contemplated, as are transdermal formulations .
  • Controlled release formulation may be desirable.
  • the drug could be incorporated into an inert matrix which permits release by either diffusion or leaching mechanisms e . g. , gums.
  • Slowly degenerating matrices may also be incorporated into the formulation, e. g. , alginates, polysaccharides .
  • Another form of a controlled release of this therapeutic is by a method based on the Oros therapeutic system (Alza Corp.), i.e., the drug is enclosed in a semipermeable membrane which allows water to enter and push drug out through a single small opening due to osmotic effects. Some enteric coatings also have a delayed release effect.
  • pulmonary delivery of the present protein (or derivatives thereof) are also be pulmonary delivery of the present protein (or derivatives thereof) .
  • the protein (or derivative) is delivered to the lungs of a mammal while inhaling and traverses across the lung epithelial lining to the blood stream.
  • Adjei et al . Pharmaceutical Research 7:565-569 (1990); Adjei et al . , International Journal of Pharmaceutics 63:135-144 (1990) (leuprolide acetate); Braquet et al . , Journal of Cardiovascular Pharmacology 13 (suppl.5): s.143-146 (1989) (endothelin-1) ; Hubbard et al . , Annals of Internal Medicine 3:206-212 (1989) ( 1-antitrypsin) ;
  • Contemplated for use in the practice of this invention are a wide range of mechanical devices designed for pulmonary delivery of therapeutic products, including but not limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art.
  • Some specific examples of commercially available devices suitable for the practice of this invention are the Ultravent nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Missouri; the Acorn II nebulizer, manufactured by Marquest Medical Products,
  • each formulation is specific to the type of device employed and may involve the use of an appropriate propellant material, in addition to diluents, adjuvants and/or carriers useful in therapy.
  • the inventive compound should most advantageously be prepared in particulate form with an average particle size of less than lO ⁇ m (or microns) , most preferably 0.5 to 5 ⁇ m, for most effective delivery to the distal lung.
  • Carriers include carbohydrates such as trehalose, mannitol, xylitol, sucrose, lactose, and sorbitol .
  • Other ingredients for use in formulations may include DPPC, DOPE, DSPC and DOPC .
  • Natural or synthetic surfactants may be used. Polyethylene glycol may be used (even apart from its use in derivatizing the protein or analog) .
  • Dextrans such as cyclodextran, may be used.
  • Bile salts and other related enhancers may be used. Cellulose and cellulose derivatives may be used. Amino acids may be used, such as use in a buffer formulation.
  • the dosage regimen involved in a method for treating the above-described conditions will be determined by the attending physician, considering various factors which modify the action of drugs, e.g. the age, condition, body weight, sex and diet of the patient, the severity of any infection, time of administration and other clinical factors.
  • the dose should be in the range of 0.1 ⁇ g to 100 mg of the inventive compound per kilogram of body weight per day, preferably 0.1 to 1000 ⁇ g/kg; and more preferably 0.1 to 150 ⁇ g/kg, given in daily doses or in equivalent doses at longer or shorter intervals, e.g., every other day, twice weekly, weekly, or twice or three times daily.
  • inventive compounds may be administered by an initial bolus followed by a continuous infusion to maintain therapeutic circulating levels of drug product.
  • the inventive compounds may be administered as a one-time dose.
  • Those of ordinary skill in the art will readily optimize effective dosages and administration regimens as determined by good medical practice and the clinical condition of the individual patient. The frequency of dosing will depend on the pharmacokinetic parameters of the agents and the route of administration.
  • the optimal pharmaceutical formulation will be determined by one skilled in the art depending upon the route of administration and desired dosage. See for example, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, PA 18042) pages 1435-1712, the disclosure of which is hereby incorporated by reference.
  • a suitable dose may be calculated according to body weight, body surface area or organ size.
  • Appropriate dosages may be ascertained through use of established assays for determining serum levels in conjunction with appropriate dose-response data.
  • the final dosage regimen will be determined by the attending physician, considering various factors which modify the action of drugs, e.g. the drug's specific activity, the severity of the damage and the responsiveness of the patient, the age, condition, body weight, sex and diet of the patient, the severity of any infection, time of administration and other clinical factors. As studies are conducted, further information will emerge regarding the appropriate dosage levels and duration of treatment for various diseases and conditions.
  • TTR human transthyretin
  • TTR(CIOA) native recombinant human transthyretin
  • C10A/A37C TTR(C10A/D38C)
  • TTR(C10A/A81C) TTR(C10A/G83C)
  • TTR(C10A/K15A/G83C) TTR(C10A/K15A/G83C)
  • the expression plasmid pAMG21 is available from the ATCC under accession number 98113, which was deposited on July 24, 1996 (see PCT WO 97/23614, published 3 July 1997 for a description of pAMG21) .
  • DNA sequence coding for TTR, TTR variants or TTR- peptide fusions was placed under control of the LuxPR promoter in pAMG21.
  • the bacterial host GM221 is an E. coli K-12 strain that has been modified to contain both the temperature sensitive lambda repressor cI857s7 in the early ebg region and the lacI Q repressor in the late ebg region (68 minutes) .
  • the presence of these two repressor genes allows the use of this host with a variety of expression systems, however both of these repressors are irrelevant to the expression from luxP R .
  • the untransformed host has no antibiotic resistances.
  • the ribosomal binding site of the cl857s7 gene has been modified to include an enhanced RBS . It has been inserted into the eJbg operon between nucleotide position 1170 and 1411 as numbered in Genbank accession number M64441Gb_Ba with deletion of the intervening eJbg sequence.
  • the construct was delivered to the chromosome using a recombinant phage called MMebg- cI857s7 enhanced RBS #4 into F'tet/393. After recombination and resolution only the chromosomal insert described above remains in the cell. It was renamed F'tet/GMlOl.
  • F'tet/GMIOI was then modified by the delivery of a lacI Q construct into the ebg operon between nucleotide position 2493 and 2937 as numbered in the Genbank accession number M64441Gb_Ba with the deletion of the intervening ebg sequence.
  • the construct was delivered to the chromosome using a recombinant phage called AGebg-lacI Q #5 into F'tet/GMIOI. After recombination and resolution only the chromosomal insert described above remains in the cell. It was renamed F'tet/GM221.
  • the F'tet episome was cured from the strain using acridine orange at a concentration of 25 ⁇ g/ml in LB. The cured strain was identified as tetracyline sensitive and was stored as GM221.
  • Oligonucleotides (1.0 nm each) were synthesized by phosphoramidite method. Nucleotides were, in some cases, altered for optimized expression in E. coli . These codon changes did not result in changes in the amino acid sequence. Each of the oligonucleotides utilized in this example are listed in Table 1.
  • PCR was performed with the Expand Long Polymerase according to the manufacturer ' s protocol (Boehringer Mannheim) . PCR products were verified by agarose gel electrophoresis, purified and digested with Ndel and Xhol (New England Biolabs) . Expression vector pAMG21 was digested in the same manner and then treated with calf intestinal phosphatase (Boehringer Mannheim) . The vector and insert were purified from an agarose gel, then mixed and ligated by T4 DNA ligase (New England Biolabs) . Ligation was done at 4°C for 2 hrs.
  • Each ligation mixture was transformed by electroporation into the host strain GM221 described above with a Biorad GenePulser (Biorad Laboratories) using 2.5V, 25uFD, and 200 ohms in a cuvette with a gap length of about 2 mm. After electroporation, the cells were allowed to recover in 1 ml of Luria broth (LB) for about one hour at 37°C with gentle shaking. The entire transformation mix was plated on LB agar containing 50ug/ml kanamycin. Colonies were screened for presence of the desired molecular weight by PCR using oligonucleotides directed against flanking vector sequence. The PCR products were evaluated by agarose gel electrophoresis. Positive clones were further screened for the ability to produce the recombinant protein product and finally verified by nucleotide sequencing.
  • TTR DNA and amino acid sequences of TTR are known (Mita, S et al . , Biochem. Biophys. Res. Commun. 124 (2), 558-564 [1984]). These sequences have been deposited in Genbank as accession number K02091. The cDNA of native TTR excluding the signal peptide was cloned from a cDNA library derived from human liver (Clontech) .
  • an oligonucleotide encoding eight codons of the TTR 5' (Oligo 2693-79) end and an oligonucleotide encoding seven codons of TTR 3 ' end including a terminating codon (Oligo 2693-80) were synthesized and used to amplify the full-length mature TTR with Expand Long polymerase using human liver cDNA library as template.
  • the resulting PCR fragment was digested with Ndel and Xhol, gel purified and ligated with Ndel/Xhol restricted expression vector pAMG21. After 2 hours at 4°C, the ligation mixture was electroporated into GM221 cells. Single colonies were picked and plasmid DNA was prepared and sequenced.
  • One resulting plasmid (strain #5316) was shown to have the correct DNA sequence of native TTR (plus a methionine at the N-terminus) and was used for expression. This DNA sequence is identified in SEQ ID NO:2.
  • Mutant TTR(CIOA) was made by using oligonucleotide 2693-80 above and oligonucleotide 2820- 88 (encompasses the first 11 codons of native TTR in which the codon Cys at the tenth position was changed to Ala) .
  • the PCR procedure and the process for selecting the expression strain were similar to that described above.
  • the resulting strain (strain #5619) had the DNA sequence identified in SEQ ID NO : 3. Plasmid 5619 was further modified by replacing the amino acids at the following positions: A37, D38, A81 and G83, with the amino acid Cysteine.
  • each pair of the complementary oligonucleotides harboring the desired mutations was used in conjunction with TTR 5 ' and 3 ' primers described above in a standard two-step PCR procedure designed for site-specific mutagenesis.
  • Each of the forward primers were used with a TTR 3 ' primer and each of the reverse primers were used with a TTR 5 ' primer in a 20-cycle PCR in which plasmid derived from strain 5619 was used as the template.
  • the resulting PCR amplified 5' and 3' fragments were mixed and used as the template for the second step PCR to generate the full-length mutants. Subsequent cloning and sequencing procedures were similar to those already described.
  • TTR(A37C) forward (Oligo 2823-91); TTR(A37C) reverse (Oligo 2823- 92); TTR(D38C) forward (Oligo 2823-93); TTR(D38C) reverse (Oligo 2823-94); TTR(A81C) forward (Oligo 2823- 95); TTR(A81C) reverse (Oligo 2823-96); TTR(G83C) forward (Oligo 2823-97); TTR(G83C) reverse (Oligo 2823- 98).
  • the resulting E. coli strains containing the plasmids are described as follows:
  • TTR(C10A/A37C) (strain 5641) had the DNA sequence identified in SEQ ID NO : 4.
  • TTR(C10A/D38C) (strain 5642) had the DNA sequence identified in SEQ ID NO : 5.
  • TTR(C10A/A81C) (strain 5643) had the DNA sequence identified in SEQ ID NO:6.
  • TTR(C10A/G83C) (strain 5651) had the DNA sequence identified in SEQ ID NO : 7.
  • the Lys in the 15th position in strain 5651 was further mutagenized to Ala using oligonucleotides 2953-67 and 2953-68 by a procedure similar to that described for strains 5641, 5642, 5643 and 5651.
  • the resulting strain, TTR(C10A/K15A/G83C) (strain 5895) had the DNA sequence identified in SEQ ID NO : 8.
  • This example describes the preparation of various TMP-TTR fusions.
  • Several fusion proteins containing TTR and a TMP were prepared.
  • Each of the oligonucleotides utilized in this example are listed in Table 2.
  • a fragment containing the TMP was first amplified from a strain harboring a plasmid encoding a full-length TMP-Fc fusion (see PCT Publication No. 00/24770) using oligonucleotides 2743-96 which encodes the first 7 codons of the TMP plus a 12 nucleotide 5 ' extension including a Ndel site and 2743-97 which encodes the first 7 codons of native TTR and the last 7 codons of the TMP of interest.
  • TMP-TTR (strain 5513) had the DNA sequence identified in SEQ ID NO : 9.
  • TMP was then introduced to the N-terminus of strains 5641, 5642, 5643 and 5651, respectively.
  • Plasmid 5513 was digested with Xbal, the resulting Xbal/Xbal insert containing the TMP and the first 18 codons of TTR(CIOA) was gel purified and ligated with Xbal restricted, phosphatase treated and gel purified vector derived from 5641, 5642, 5643 and 5651.
  • DNA sequencing was performed to select the correct orientation for each fusion.
  • the resulting E. coli strains containing the plasmids are described as follows: TMP-TTR(C10A/A37C) (strain 5704) had the DNA sequence identified in SEQ ID NO: 10.
  • TMP- TTR(C10A/D38C) (strain 5705) had the DNA sequence identified in SEQ ID NO:ll.
  • TMP-TTR (C10A/A81C) (strain 5706) had the DNA sequence identified in SEQ ID NO: 12.
  • Example 3 This example describes the preparation of PTH (1-34) -TTR(C10A/K15A/G83C) fusion.
  • PTH 1-34
  • TTR TTR(C10A/K15A/G83C) fusion.
  • Each of the oligonucleotides utilized in this example are listed in Table 3.
  • oligonucleotide 2694- 01 which encodes the first 7 codons of human PTH
  • Oligonucleotide 2694-03 which encodes the first 7 codons of TTR and amino acids 28-34 of PTH
  • Oligonucleotides 2694- 01 and 2694-03 were used in a 20-cycle PCR procedure as described above to amplify PTH (1-34) with the TTR linker.
  • the template for this reaction was a strain which harbors a plasmid encoding a PTHl-34-Fc fusion (see PCT Publication No. 01/81415) .
  • the resulting PCR mixture was combined with strain 5895 and used as the template to amplify the full length PTH (1-34)- TTR(C10A/K15A/G83C) using primers 2694-01 and 2693-80.
  • the resulting expression strain containing the new plasmid was designated PTH- TTR(C10A/K15A/G83C) (strain 5920) and had the DNA sequence identified in SEQ ID NO: 14.
  • This example describes the preparation of an IL-lra-TTR(ClOA) fusion and a TTR(CIOA) -GSGS-IL-lra fusion.
  • Each of the oligonucleotides utilized in this example are listed in Table 4.
  • To prepare the IL-lra-TTR(ClOA) fusion two oligonucleotides, oligonucleotide 2823-13, which encodes the first 7 codons of the human protein IL-lra, and oligonucleotide 2823-14, which encodes the last 7 amino acids of IL-lra and the first 7 amino acids of TTR, were synthesized.
  • the plasmid derived from a strain which expresses IL-lra was amplified using oligonucleotides 2823-13 and 2823-14.
  • the resulting PCR product was mixed with plasmid purified from strain 5619 and used as a template to amplify full-length IL-l-ra-TTR(ClOA) using oligonucleotide primers 2823-13 and 2693-80.
  • the PCR product was cloned, sequenced and expressed as described above.
  • the resultant strain containing the new plasmid was designated IL-lra-TTR(ClOA) (strain 5644) and had the DNA sequence identified in SEQ ID NO: 15.
  • oligonucleotide 2787-32 which encodes the last 7 amino acids of TTR
  • oligonucleotide 2787-33 which encodes the last 7 codons of IL-l-ra
  • This example describes the preparation of TTR(C10A/G83C) -Bradykinin.
  • Each of the oligonucleotides utilized in this example are listed in Table 5.
  • Plasmid purified from strain 5651 was used for PCR with oligonucleotide primer 2693-79 and oligonucleotide primer 2943-47, which is a TTR 3' primer containing a Pstl restriction site.
  • This PCR product was gel purified and restriction digested with Ndel and Pstl.
  • the resulting DNA fragment was used in a ligation mixture containing AMG21, digested with Ndel and Xhol, and the annealed oligonucleotide linkers 2943-48, which encodes the GSGSG linker, and oligonucleotide 2943-49, which encodes the Bradykinin antagonist peptide KRPPGFSPL with Pstl 5' and Xhol 3' overlapping ends.
  • GM121 was transformed with this ligation product and DNA was purified from the kanamycin resistant colonies . The DNA sequence was then confirmed in the resistant colonies . The confirmed strain was grown at 30°C and induced for expression in a 10-liter fermentation described below. The new strain was designated TTR (C10A/G83C) -Bradykinin (strain 5914) and had the DNA sequence identified in SEQ ID NO: 17.
  • EXAMPLE 6 This example describes the recombinant expression of TTR and the TTR fusion constructs in E. coli .
  • Each of the newly constructed TTR or TTR fusions were first examined for soluble expression at temperatures ranging from 16°C to 37°C.
  • cultures (25 ml) of GM221 expressing each of the TTR or TTR fusions were grown in LB medium supplemented with 50 ⁇ g/ml kanamycin at 37°C until the optical density (OD) at 600nm reached 0.5 to 1.0. The cultures were then placed in shakers with temperature settings at 16°C, 20°C, 25°C, 30°C, 34°C and 37°C, respectively.
  • the induction of gene product expression from the luxPR promoter was achieved following the addition of the synthetic autoinducer N-(3- oxohexanoyl) -DL-homoserine lactone to the culture media to a final concentration of 20 ng/ml .
  • the bacterial cultures were examined by microscopy for the presence of inclusion bodies. Often soluble or partial soluble expression could be achieved by growing the cultures at temperatures lower than 30°C for TTR and its fusions, and this temperature was used for large-scale expression. In cases where soluble expression could not be achieved, temperatures at which the level of expression was at the highest were used for large-scale shakers or fermentors .
  • the fermentation stage begins with the inoculation from a seed culture of strains produced in a shake flask containing 500 mL of sterilized Luria broth.
  • this culture obtained the appropriate cell density (0.8 - 2 at 600nm)
  • the contents were used to inoculate a 20 liter fermentor containing 10 liter of complex based growth medium.
  • the fermentor is maintained at 30°C and pH 7 with dissolved oxygen levels kept at 30% saturation.
  • the cell density reached an optical density of 10- 12 OD units at 600 nm, at which point the culture was induced by the addition of N- (3-oxo-hexanoyl) homoserine lactone.
  • the cells were harvested from the fermentor by centrifugation .
  • TTR C10A/G83C
  • TTR C10A/G83C
  • E. coli paste from clone 5914 stored at -80°C was defrosted in 1447 ml of 50 mM tris HC1, 5 mM EDTA, pH 8.0.
  • 50 tablets of Sigma protease inhibitor cocktail 1-873-580 (Saint Louis, MO) was dissolved in the cell suspension and the suspension was passed through a model 110-Y microfluidizer (Microfluidics, Newton, MA) twice at 12,000 PSI.
  • the lysate ( Figure 1, Lane 2) was centrifuged at 11,325 x g for 50 min 4°C. The supernatant was removed as the soluble fraction.
  • the soluble fraction was heated in a 65°C water bath for 30 minutes in polypropylene bottles, at which time the temperature of the contents was 63°C.
  • the soluble fraction was centrifuged at 11,325 x g for 50 minutes 4°C .
  • the supernatant was removed as Heat Soluble ( Figure 1, Lane 3) .
  • the heat soluble fraction was filtered through a 0.45 ⁇ m cellulose acetate filter with two prefilters and then loaded on to a 240 ml Q-sepharose fast flow (5 cm ID) column (Amersham Pharmacia Biotech, Piscataway, NJ) at 20 ml/min equilibrated in Q-Buffer A (20 mM tris HC1, 2.5 mM EDTA, pH 8.0) at room temperature (about 23°C) . Column was washed with about 2300 ml Q-Buffer A at 20 ml/min.
  • Q-column was eluted with a 15 column volume linear gradient to 60% Q-Buffer B (20 mM tris HC1, 1 M NaCl, 2.5 mM EDTA, pH 8.0) followed by a 2 column volume step to 100% Q-Buffer B. Fractions containing the TTR fusion as determined by SDS-PAGE were pooled into a single Q-pool (1150 ml) ( Figure 1, Lane 4) and 1.77 g of DTT was added. The Q-pool was gently stirred for 30 min at room temperature (about 23°C) .
  • the dialysis buffer was changed with a fresh 4 L of HA-Buffer A and dialysis was continued for approximately an additional 15 hours.
  • the P-pool was removed from dialysis and 600 ⁇ l of 1 M DTT was added followed by incubation at room temperature (about 23 °C) for about 1 hour.
  • P-pool was loaded on to a 105 ml (2.6 cm) type 1 ceramic hydroxyapatite column (Bio-Rad Inc., Hercules, CA) at 10 ml/min in HA-Buffer A.
  • HA-pool About one-half of the HA-pool was loaded on to a 47 ml source 15Q (2.6 cm ID) column (Amersham Pharmacia Biotech) at 10 ml/min followed by a wash with about 250 ml Q-Buffer A. Column was eluted with a 20 column volume linear gradient from 10% to 50% Q-Buffer B followed a step of 2 column volumes of 100% Q-Buffer B. The remaining half of the HA-Pool was then processed using the same protocol as the first half. Fractions containing the TTR fusion as determined by SDS-PAGE were pooled into a single Q2-pool (260 ml) and concentrated to about 75 ml using a stirred cell with a 10 kDa membrane. Q2-pool ( Figure 1, Lane 7) was then filtered through a 0.22 ⁇ m cellulose acetate filter and the protein concentration was determined to be 16.9 mg/ml using a calculated extinction coefficient of
  • the pyrogen level was determined to be ⁇ 1 EU/mg of protein using the Limulus Ameboycyte Lysate assay (Associates of Cape Cod, Falmouth, MA) .
  • the nucleic acid content was determined to be negligible, since the ratio of the absorbance at 260 nm over 280 nm was determined to be 0.52.
  • EXAMPLE 8 This example demonstrates that fusing a peptide to either the C-terminus or N-terminus of TTR (C10A/G83C) does not have a significant impact on its oligomeric structure.
  • Biosep-Sec-S 3000 column (7.8 mm ID X 300 mm) (Phenomenex, Torrance, CA) in SEC-Buffer (50 mM NaH 2 P0 4 , 500 mM NaCl, pH 6.7 ) at 1 ml/min.
  • Bio-Rad molecular weight standards (151-1901) were used to calibrate the column and calculate the approximate molecular size of the injected samples.
  • TTR(C10A/G83C) eluted at approximately 8.8 min corresponding to a molecular size of 49 kDa, which is comparable to the calculated molecular weight of the tetramer at 55 kDa.
  • PTH-TTR (C10A/K15A/G83C) eluted at about 8.6 min corresponding to a molecular size of 67 kDa, which is close to the calculated 71 kDa for the tetramer.
  • TTR C10A/G83C
  • -Bradykinin eluted at about 8.7 min corresponding to a molecular size of 57 kDa, which is also close to the calculated 60 kDa for the tetramer.
  • TTR(CIOA) IL-l-ra-TTR(ClOA)
  • TTR(CIOA) -IL-l-ra was injected on to a Biosep-Sec-S 3000 column (7.8 mm ID X 300 mm) (Phenomenex) in SEC- Buffer at 1 ml/min.
  • Bio-Rad molecular weight standards (151-1901) were used to calibrate the column and calculate the approximate molecular weight of the injected samples.
  • TTR(CIOA) elutes at approximately 8.8 min, which corresponds to a molecular size of 49 kDa which is comparable to the calculated molecular weight of the tetramer at 55 kDa.
  • the IL-l-ra-TTR(ClOA) fusion eluted at about 7.9 min corresponding to a molecular size of 188 kDa, which is noticeably larger than that expected for the tetramer at 124 kDa.
  • TTR(CIOA) -IL-l-ra eluted at about 7.9 min, again corresponding to a molecular size of 188 kDa compared to the 124 kDa expected for the tetramer.
  • size discrepancies are likely due to differences in the shape of the molecule, since size exclusion chromatography is shape dependant and the standards are calibrated for globular proteins .
  • This example compares the binding of a TMP sequence fused to the carboxy-terminus of human immunoglobulin Fc (Fc-TMP) and TMP(m)-TTR to soluble human myeloproliferative leukemia (MPL) receptor.
  • Fc-TMP human immunoglobulin Fc
  • MPL myeloproliferative leukemia
  • this example shows the effect of pegylation of the native TTR cysteine on the binding of the TMP fusion to the MPL receptor.
  • the preparation of the pegylated TTR fusions is described in detail in Example 13.
  • TMP(m) -TTR-PEG5K showed a significantly repressed binding response compared to its non-pegylated counterpart, and TMP (m) -TTR-PEG20K showed an even more severe inhibition. This indicates that the presence of PEG on cysteine 10 likely causes steric interference for binding of the fused TMP to the MPL receptor, and larger PEGs produce more interference.
  • This example shows the effect of injecting TMP (m) -TTR into mice on blood platelet count.
  • 50 BDF1 mice (Charles River Laboratories, Wilmington, Massachusetts) were split into 5 groups and injected (day 0) subcutaneously with either diluting agent (Dulbecco's PBS with 0.1% bovine serum albumin) or diluting agent with 50 ⁇ g test protein per kg animal. Each group was divided in half and bled (140 ⁇ l) on alternate time points (day 0, 3, 5, 7, 11, 12, 14, and 17). Mice were anesthetized with isoflurane prior to collection.
  • diluting agent Dulbecco's PBS with 0.1% bovine serum albumin
  • TMP (m) -TTR-PEG 5K was a moderate responder peaking at 2.3 X 10 12 platelets L "1 which is just under twice the baseline level.
  • the non-pegylated form of TMP (m) -TTR shows very little response at 1.5 X 10 12 platelets L "1 which is only 20% over the baseline level.
  • TMP (m) -TTR shows better binding in vi tro than its pegylated counterparts ( Figure 4), but it has poor performance in vivo compared to TMP (m) -TTR- PEG 5K. This indicates that PEG is required to improve the biological half-life of the TTR construct, and this more than compensates for the reduced affinity for the receptor.
  • TTR(CIOA) elutes at approximately 8.8 min, which corresponds to a molecular size of 57 kDa which is similar to the calculated molecular weight of the tetramer at 55 kDa.
  • This data combined with the observation that both forms of TTR are resistant to precipitation at 65°C (data not shown) indicates that mutation of cysteine 10 to alanine does not have a significant impact on the structure or stability of TTR.
  • EXAMPLE 13 This example demonstrates that mutation of alanine 37 to cysteine TMP-TTR(C10A/A37C) , aspartate 38 to cysteine TMP-TTR (C10A/D38C) , alanine 81 to cysteine TMP-TTR (C10A/A81C) , or glycine 83 to cysteine TMP- TTR(C10A/G83C) in a cysteine 10 to alanine background does not have a significant impact on the oligomeric structure of TTR.
  • this example demonstrates that pegylation of these mutant forms of TTR with a 5K or 2OK PEG produces two distinct species of TTR with significantly greater molecular size than the unpegylated form.
  • the pegylation of TTR was carried out by first reducing about 8 ml of the TTR (7.28 mg/ml) with 10 mM DTT for 30 minutes at 30 °C in the presence of 50 mM tris HC1, pH 8.5. The reduced TTR was then desalted using a 26 ml SEPHADEXTM G25 medium column (2.6 cm ID) (Amersham Pharmacia Biotech) at 2.5 ml/min in 20 mM tris HC1, pH 8.5.
  • the concentration was then determined by measuring the absorbance of the reduced TTR at 280 nm and using the calculated extinction coefficient (29,450 M "1 for TMP- TTR(C10A/A37C) (5.14 mg/ml).
  • One-half (4.6 ml) of the reduced sample was then immediately mixed with 810 ⁇ l of 5 mM methoxy-PEG-maleimide 5K (Shearwater Corporation, Huntsville, AL) and the remaining half was mixed with 1620 ⁇ l 2.5 mM methoxy-PEG-maleimide 20K
  • Biosep- Sec-S 3000 column (7.8 mm ID X 300 mm) (Phenomenex) in SEC-Buffer at 1 ml/min.
  • Bio-Rad molecular weight standards (151-1901) were used to calibrate the column and calculate the approximate molecular size of the injected samples.
  • the apparent molecular size of the 4 non-pegylated TMP-TTR constructs is between 40 and 45 kDa which is noticeably lower than the expected 70 kDa tetramer.
  • Fc-TMP TMP- TTR(C10A/A37C)
  • TMP-TTR(C10A/D38C) TMP-TTR (C10A/A81C)
  • TMP-TTR(C10A/G83C) have similar affinities for binding human MPL receptor in vi tro .
  • Fc-TMP was bound to a BIAcore protein G chip at high density as per the manufacturer's instructions (BIAcore, Uppsula, Sweden) .
  • Test proteins were preincubated with 5 nM MPL receptor in Binding Buffer (Dulbecco's PBS (Gibco BRL, Gaithersburg, MD) with 0.1 ⁇ mg/ml bovine serum albumin and 0.005% P20
  • This example shows the effect of injecting pegylated TMP-TTR constructs into mice on blood platelet count.
  • 170 BDF1 mice were split into 17 groups and injected (day 0) subcutaneously with 50 ⁇ g test protein per kg animal (TMP fusion construct, Fc-TMP, or a TTR(CIOA) control) . Each group was divided in half and bled (140 ⁇ l) on alternate time points (day 0, 3, 5, 7, 10, 12, and 14). Mice were anesthetized with isoflurane prior to collection.
  • the collected blood was analyzed for a complete and differential count using an ADVIA 120 automated blood analyzer with murine software (Bayer
  • TMP-TTR constructs substantially improves efficacy with platelet counts between 3.7 and 4.4 X 10 12 platelets L "1 (2.8 to 3.4 times baseline).
  • This example shows the effect of injecting pegylated PTH-TTR constructs into mice on blood ionized calcium release.
  • 60 male, BDF1, 4 week-old mice were split into 12 groups and injected (day 0) subcutaneously with 8.91 mg test protein per kg animal (PTH fusion construct, PTH-Fc, or a TTR(CIOA) control) .
  • Each group was bled (75 ⁇ l) at time points 0, 24, 48, and 72 hours. Mice were anesthetized with isoflurane prior to collection.
  • PTH-Fc PTH-TTR (C10A/K15A/A37C) (PEG 5K)
  • PTH-TTR (C10A/K15A/A37C) PEG 20K
  • PTH- TTR(C10A/K15A/G83C) PEG 5K
  • PTH- TTR(C10A/K15A/G83C) PEG 20K
  • PEG 20K showed the greatest response with ionized calcium levels rising between 2.2 and 2.7 mmol per L at 24 hours post-injection, which is 1.7 times baseline at 1.3 mmol per L.
  • the ionized calcium levels of all groups returned to baseline, except PTH-TTR (C10A/K15A/A37C) (PEG 5K) , PTH-TTR(C10A/K15A/G83C) (PEG 5K) , and PTH- TTR (C10A/K15A/G83C) (PEG 20K) treated groups that maintained elevated ionized calcium levels between 1.8 and 1.9 mmol per L.
  • the non-pegylated PTH-TTR constructs were equivalent to or slightly better than the TTR(CIOA) control at raising serum ionized calcium levels .
  • This example describes the construction of a
  • PTH-TTR(C10A/K15A/A81C) containing plasmid The Xbal/Xbal fragment of 5920 was ligated with the purified vector derived from digesting plasmid 5643 (described in example 1) with Xbal.
  • the E. coli strain containing the resulting plasmid is described as 5933 PTH-TTRC10A/K15A/A81C .
  • This example describes the preparation of a GLP-1-TTR(C10A/G83C) fusion and a GLP-1-
  • TTR(C10A/K15A/G83C) fusion were cloned using plasmid pAMG21, which is described in example 1.
  • plasmid pAMG21 which is described in example 1.
  • Each of the oligonucleotides utilized in this example are listed in Table 6.
  • the bacterial host GM121 is an E. coli K-12 strain that has been modified to contain the lacI Q repressor in the late ebg region (68 minutes) . The presence of this repressor gene allows the use of this host with a variety of expression systems, however this repressor is irrelevant to the expression from luxPR. The untransformed host has no antibiotic resistances.
  • F'tet/393 was modified by the delivery of a lacI Q construct into the ebg operon between nucleotide position 2493 and 2937 as numbered in the Genbank accession number M64441Gb_Ba with the deletion of the intervening ebg sequence.
  • the construct was delivered to the chromosome using a recombinant phage called AGebg- lacl s #5.
  • F'tet/GM120 After recombination and resolution only the chromosomal insert described above remains in the cell. It was renamed F'tet/GM120. F'tet/GM120 was then mutated in the hsdR gene to inactivate it. This was renamed F'tet/GM121. The F'tet episome was cured from the strain, verified as tetracyline sensitive and was stored as GM121 (ATCC #202174) .
  • PCR was performed with Roche PCR Core Kit (Cat. No. 1 578 553) in 80 ul reactions containing 2-4 ul mini-prep plasmid DNA template, 1 uM each oligonucleotide, 0.2 mM each oligonucleotide, 5% DMSO (Sigma) , and 2U Taq DNA polymerase in order to amplify the GLP-1 sequence and a linker. Reaction cycles were 94° C for 5 min followed by 35 cycles of [94° C for 20 sec, 45° C for 30 sec, 72° C for 1 min] . PCR products were purified with QIAquick® PCR Purification Kit according to the manufacturer's protocol (QIAGEN) .
  • PCR products and vectors were then digested with Ndel and Kpnl (New England Biolabs) .
  • Digested DNA was purified from an agarose gel, then mixed and ligated by T4 DNA ligase (New England Biolabs) for 1.5-2 hours at room temperature.
  • Each ligation mixture was transformed by electroporation into the host strain GM121 described above with a Biorad E. coli Pulser at 2.5KV in a cuvette with a gap length of 2 mm.
  • the cells were allowed to recover in 2 ml Terrific Broth (TB) for about 3 hours at 37°C at 250 rpm. 70-100 ⁇ l of the recovery culture was plated on LB agar containing 40 ug/ml kanamycin. DNA mini-preps were prepared and correct clones were verified by nucleotide sequencing.
  • oligonucleotide 1209-85 which binds the luxR promoter region
  • 3131-63 which encodes the last 12 amino acids of the fusion linker and the first 8 amino acids of TTR
  • the PCR product was cloned and sequenced as described above.
  • the resultant strain containing the new plasmid was designated GLP-1-TTR(C10A/G83C) (strain 6298) and had the DNA sequence identified in SEQ ID NO: 47.
  • oligonucleotide 3183-83 which contains and Ndel site and encodes the purification and cleavage sequence described above plus the first six amino acids of GLP-1 (A2G), and 3183-84, which encodes the last 6 amino acids of the fusion linker and the first 8 amino acids of TTR, were synthesized.
  • the PCR product was cloned and sequenced as described above.
  • the resultant strain containing the new plasmid was designated GLP-1-TTR(C10A/K15A/G83C) (strain 6450) and had the DNA sequence identified in SEQ ID NO: 48.
  • This example describes the preparation of a GLP-1 (A2G) -K-Fc fusion.
  • This construct was cloned using plasmid pAMG33*, which differs from pAMG21 in that the lux protein and promoters are replaced with lad binding sites and an IPTG inducible promoter and the ribosomal binding site sequence is shorter (the sequence between the Aatll and Clal recognition sites is replaced with AATTGTGAGCGGATAACAATTGAC AAATGCTAAAATTCTTGATTAATTGTGAGCGGATAACAATTTATCGATTTGATTC TAGAAGGAGGAATAA) and some of the sequence after the SacII recognition site was deleted (leaving ATAAATAAGTAACGATCCGGTCCAGTAATGACCTCAGAAC
  • oligonucleotide 2985-92 which contains and Ndel site and encodes the purification and cleavage sequence described above plus the first eight amino acids of GLP-1 (A2G) , and 2687-50, which encodes the amino acids 18 through 23 of the Fc, were synthesized.
  • the PCR product was cloned and sequenced as described above except the enzymes used were Ndel and EcoRI.
  • a colony screening step was included which verified the presence of insert by PCR with oligonucleotides directed against upstream vector sequence and the 5 His-Aspartic acid sequence which the insert introduced.
  • the resultant strain containing the new plasmid was designated GLP-1 (A2G) -K-Fc (strain
  • This example describes the cloning of the CH2 domain of an immunoglobulin molecule to the TTR(CIOA) to generate TMP-CH2-TTRC10A and TTRC10A-CH2-TMP.
  • the CH2 domain derived from TMP-Fc was linked to the C-terminal end of TTR(ClOA), i.e., strain 5619, by a two-step PCR procedure.
  • the CH2 domain (containing from 5' to 3 ' : the last 7 codons of TTR, CH2 and a
  • TTRC10A-CH2-TMP Construction of TTRC10A-CH2-TMP was done as follows: the TMP fragment containing a 5' BamHI linker and 3' Xhol linker was amplified by oligos 2694-19 and
  • the amplified fragment was digested with BamHI and Xhol and was subsequently ligated with similarly restricted 6017.
  • the resulting clone is described as strain 6104 (TTRC10A-CH2-TMP) .
  • SEQ ID NO: 59 ATGGGTCCAACTGGTACCGGTGAATCCAAGGCTCCTCTGATGGTCAAAGTTCTAG
  • TMP-CH2-TTR2 Another configuration of this fusion was made as TMP-CH2-TTR2.
  • the CH2 domain derived from TMP-Fc was first linked to N-terminus of TTRC10A by a two-step PCR.
  • the CH2 domain (containing from 5' to 3 ' : a Ndel- BamHI linker, CH2 and the first 7 codons of TTR C10A) was first amplified by oligos
  • the TMP fragment containing a Ndel linker at 5 ' end and a BamHI linker at 3' end was amplified by oligos
  • TMP was also cloned at the C- termini of TTR and variants thereof.
  • the full length TMP containing at its N- terminal end a 5-amino acids linker (gsgsg) plus the last 7 amino acids of wt TTR was amplified by the following set of oligonucleotides in a standard PCR procedure.
  • This PCR fragment was further linked to the 3 ' end of wt TTR by a second PCR utilizing oligos 2694-19 and 2693-79 as described in example 1.
  • the resulting clone was sequence confirmed and is described as strain 5365 (TTR-TMP) : SEQ ID NO: 68:
  • the Xbal/Xbal fragment of 5365 was then replaced by the corresponding Xbal/Xbal fragment of strain 5895 to make strain 5921 (TTRC10A/K15A-TMP) as described above :
  • Plasmid 5921 was subsequently modified by replacing the amino acids at the following positions: A37, A81 and G83, with the amino acid Cysteine as described in example 1, except that the TTR 3' oligo utilized with the mutation oligos (2693-80) in example 1 was replaced with 2694-19, resulting in Strain 5982, containing TTRC10A/K15A/A37C-TMP (SEQ ID NO:70), Strain 5983 containing TTRC10A/K15A/A81C-TMP (SEQ ID NO:71), and Strain 5984 containing TTRC10A/K15A/G83C-TMP (SEQ ID NO:70).
  • SEQ ID NO: 71 ATGGGTCCAACTGGTACCGGTGAATCCAAGGCTCCTCTGATGGTCGCAGTTCTAG
  • This example describes the construction of TMP- TTRC10A/K15A/A81C and TMP-TTRC10A/K15A/A37C .
  • the Lys at 15th position of TTR was mutagenized to Ala in strains 5704, 5706 and 5707 by the following methods. Plasmid 5513 was digested with Ndel/Kpnl, the insert harboring TMP fragment and the first 6 amino acids of TTR was purified and ligated with Ndel/Kpnl restricted and gel purified vector derived from strain 5895. The bacterial strain containing the resulting plasmid is described as 5919 (TMP-TTRC10A/K15A/G83C) .
  • Plasmid 5919 was then digested with Xbal, the resulting Xbal/Xbal fragment containing TMP and the first 18 codons of TTR including the C10A and K15A mutations was gel purified and ligated with Xbal digested, phosphatase treated and gel purified vectors derived from strain 5704 and 5706.
  • the new strains are described as 5918 (TMP-TTRC10A/K15A/A81C) and 6023 (TMP-TTRC10A/K15A/A37C) .
  • TMP-TTRC10A/K15A/G83C (SEQ ID O:73):
  • TMP-TTRC10A/K15A/A81C (SEQ ID NO: 74) : ATGATCGAAGGTCCGACTCTGCGTCAGTGGCTGGCTGCTCGTGCTGGCGGTGGTG
  • TMP-TTRC10A/K15A/A37C (SEQ ID NO:75): ATGATCGAAGGTCCGACTCTGCGTCAGTGGCTGGCTGCTCGTGCTGGCGGTGGTG GCGGAGGGGGTGGCATTGAGGGCCCAACCCTTCGCCAATGGCTTGCAGCACGCGC AGGTCCAACTGGTACCGGTGAATCCAAGGCTCCTCTGATGGTCGCAGTTCTAGAT GCTGTCCGAGGCAGTCCTGCCATCAATGTGGCCGTGCATGTGTTCAGAAAGGCTT GTGATGACACCTGGGAGCCATTTGCCTCTGGGAAAACCAGTGAGTCTGGAGAGCT GCATGGGCTCACAACTGAGGAGGAATTTGTAGAAGGGATATACAAAGTGGAAATA GACACCAAATCTTACTGGAAGGCACTTGGCATCTCCATTCCATGAGCATGCAG AGGTGGTATTCACAGCCAACGACTCCGGCCCGCCGCTACACCATTGCCGCCCT GCTGAGCCCCTACTCCTATTCCACCACGG
  • This example describes the expression of GLP- 1 fusions proteins in E. coli.
  • 25-100 ml of a saturated overnight culture was used to inoculate 50 ml TB with 20 ug/ml kanamycin in a 250 ml baffled flask and incubated at 37C, 250 rpm overnight.
  • 10-35 ml of these overnight cultures were used to inoculate 1L TB with 20 ug/ml kanamycin in a 2L baffled flask and incubated at 37C, 250 rpm until the optical density at 600 nm reached approximately 0.7.
  • the cultures were then induced to express recombinant protein by the addition of: 1 ml of ethanol containing 30 ug/ml N- (B - ketocaproyl) -DL-homoserine lactone (Sigma) in the case of pAMG21, or IPTG to 0.1 mM in the case of pAMG33*.
  • the incubation was continued for an additional 2-4 hours and the cells were collected by centrifugation.
  • TTR(C10A/K15A/A81C) About 197 g of E. coli paste from clone 5933 stored at -80°C was defrosted in 1480 ml of 50 mM tris HCl, 5 mM EDTA, pH 8.0. 60 tablets of Sigma protease inhibitor cocktail 1-873-580 (Saint Louis, MO) was dissolved in the cell suspension and the suspension was passed through a model 110-Y microfluidizer
  • the heat soluble fraction was filtered through a 0.45 ⁇ m cellulose acetate filter with two prefilters and then loaded on to a 240 ml Q-sepharose fast flow (5 cm ID) column (Amersham Pharmacia Biotech, Piscataway, NJ) at 25 ml/min equilibrated in Q-Buffer A (20 mM tris HCl, 2.5 mM EDTA, pH 8.0) at room temperature (about 23°C) . Column was washed with about 2200 ml Q-Buffer A at 30 ml/min.
  • Q-column was eluted with a 15 column volume linear gradient to 60% Q-Buffer B (20 mM tris HCl, 1 M NaCl, 2.5 mM EDTA, pH 8.0) followed by a 2 column volume step to 100% Q-Buffer B. Fractions containing the TTR fusion as determined by SDS-PAGE were pooled into a single Q-pool (1300 ml) . To the Q-pool, 464 ml of 3.8 M ammonium sulfate pH 7.2 was slowly added. The solution was centrifuged at 11,325 x g for 50 min 4°C .
  • the supernatant was removed as the ammonium sulfate soluble fraction and discarded, and the pellet was resuspended in 450 ml 10 mM NaH 2 P0 4 , pH 7.0 by gentle agitation at room temperature for about 30 min. The solution was centrifuged at 11,325 x g for 50 min 4°C. Supernatant was removed as phosphate buffer soluble fraction and filtered through a 0.45 ⁇ m cellulose acetate filter.
  • Fractions containing the TTR fusion as determined by SDS-PAGE were pooled into a single Q2-pool (170 ml) and filtered through a 0.22 ⁇ m cellulose acetate filter.
  • the protein concentration was determined to be 3.7 mg/ml using a calculated extinction coefficient of 23,950 M "1 cm "1 .
  • the pyrogen level was determined to be ⁇ 1 EU/mg of protein using the Limulus Ameboycyte Lysate assay (Associates of Cape Cod, Falmouth, MA) .
  • the nucleic acid content was determined to be negligible, since the ratio of the absorbance at 260 nm over 280 nm was determined to be 0.61.
  • EXAMPLE 25 This example describes the purification of TMP- TTR(C10A/D38C) .
  • the supernatant was removed as the soluble fraction and discarded.
  • the pellets were resuspended in 1200 ml water using a tissue grinder and 20 more Sigma protease inhibitor tablets were added.
  • the suspension was centrifuged at 11,325 x g for 30 min 4°C.
  • the supernatant was filtered through a Whatman GF/A filter and 2.1 g of dithiothreitol was added followed by incubation at 7 °C for 30 minutes.
  • the reduced sample was loaded on to a 240 ml Q-sepharose fast flow (5 cm ID) column (Amersham Pharmacia Biotech, Piscataway, NJ) at 30 ml/min equilibrated in Q-Buffer A (20 mM tris
  • the urea solublized pellet was then filtered through a Whatman GF/A filter and loaded on to a 240 ml Q-sepharose fast flow (5 cm ID) column (Amersham Pharmacia Biotech, Piscataway, NJ) at 30 ml/min equilibrated in Q-Buffer A (20 mM tris HCl, 0.02% sodium azide, pH 8.0) at 7 °C . Column was washed with about 1920 ml Q-Buffer A at 30 ml/min.
  • Q-column was eluted with 3 steps of 20%, 35%, and 100% Q-Buffer B (20 mM tris HCl, 1 M NaCl, 0.02% sodium azide, pH 8.0) at 15 ml/min. Fractions containing the 35% elution peak were pooled, filtered through a 0.22 ⁇ m cellulose acetate filter, and 0.5 g of dithiothreitol (10 mM final concentration) was added followed by incubation for 30 min at 7 °C .
  • the 35% Q-pool was then loaded on to a 45 ml (2.6 cm) type 1 ceramic hydroxyapatite column (Bio-Rad Inc., Hercules, CA) at 5 ml/min in 20 mM tris HCl, 350 mM NaCl, pH 8.0 at 7 °C .
  • Column was washed with approximately 70 ml 20 mM tris HCl, 350 mM NaCl, pH 8.0 at 5 ml/min followed by 3 steps of 2.5%, 25%, and 100% HA-Buffer B (400 mM NaH 2 P0 4 , pH 7.0).
  • the fractions from the 2.5% elution were pooled as HA-pool (80 ml) and filtered through a 0.22 ⁇ m cellulose acetate filter.
  • the protein concentration was determined to be 6.8 mg/ml using a calculated extinction coefficient of 29,450 M "1 cm "1 .
  • the pyrogen level was determined to be ⁇ 1 EU/mg of protein using the Limulus Ameboycyte Lysate assay (Associates of Cape Cod, Falmouth, MA) .
  • the nucleic acid content was determined to be negligible, since the ratio of the absorbance at 260 nm over 280 nm was determined to be 0.54.
  • This example describes the refolding and purification of TTR(CIOA) -CH2-TMP.
  • the pellet was resuspended in 200 ml 50 mM tris HCl, 5 mM EDTA, pH 8.0 using a tissue grinder.
  • the suspension was centrifuged at 15,344 x g for 50 min 4 °C . The supernatant was removed as the wash and discarded.
  • the pellet was resuspended in 50 ml 50 mM tris HCl, 5 mM EDTA, pH 8.0 using a tissue grinder.
  • the suspension was centrifuged at 14,000 x g for 10 min room temperature. The supernatant was removed as the wash and discarded.
  • the pellets were dissolved in 50 ml 8 M guanidine HCl, 50 mM tris HCl, pH 8.0 using a sonicator for about 1 min. Dissolved protein was reduced for 30 min room temperature by adding 500 ⁇ l 1 M DTT. Reduced protein was centrifuged for 30 min at 20 °C at 27,216 g. Supernatant was then added to 4 L 50 mM tris base, 160 mM arginine base, 1 M urea, 1 mM cystamine, 4 mM cysteine, pH 9.5 at 2 ml/min and incubated about 16 hours 4 °C.
  • Refolded protein was then filtered through a Gellman SUPORCAP® 50 and then concentrated to about 500 ml using a Pall Filtron 3 square foot YM10 membrane tangential flow system followed by diafiltration against 2 L 20 mM tris HCl pH 8.0. Concentrated protein was then loaded on to a 45 ml source 15Q (2.6 cm ID) column (Amersham Pharmacia Biotech) at 18 ml/min followed by a wash with about 150 ml Q-Buffer A (20 mM tris HCl pH 8.0) . Column was eluted with a 20 column volume linear gradient from 0% to 60% Q-Buffer B followed a step of 2 column volumes of 100% Q-Buffer B.
  • Fractions containing the TTR fusion as determined by SDS-PAGE were pooled into a single Q-pool (29 ml) .
  • the Q-Pool was then concentrated to about 6.3 ml using a Millipore CENTRIPREPTM 10 and then passed through a Pall ACRODISC® MUSTANGTM E membrane filter at 1 ml/min.
  • the protein concentration was determined to be 10.5 mg/ml using a calculated extinction coefficient of 46,410 M "1 cm "1 .
  • the pyrogen level was determined to be ⁇ 1 EU/mg of protein using the Limulus Ameboycyte Lysate assay (Associates of Cape Cod, Falmouth, MA) .
  • the nucleic acid content was determined to be negligible, since the ratio of the absorbance at 260 nm over 280 nm was determined to be 0.51.
  • GLP1-TTR C10A/K15A/G83C
  • E. coli paste from clone 6450 stored at -80°C was defrosted in 250 ml of 50 mM NaH 2 P0 4 , pH 7.0.
  • Cell suspension was passed through a microfluidizer (Microfluidics, Newton, MA) twice at 12,000 PSI.
  • the lysate was centrifuged at 15,344 x g for 50 min 4°C . The supernatant was discarded as the soluble fraction, and the pellet was resuspended in 200 ml deoxycholate using a tissue grinder.
  • the suspension was centrifuged at 15,344 x g for 50 min 4°C. The supernatant was discarded as the wash, and the pellet was resuspended in 200 ml water using a tissue grinder. The suspension was centrifuged at 15,344 x g for 50 min 4°C. The supernatant was discarded as the wash, and the pellet was resuspended in 100 ml water using a tissue grinder. The suspension was centrifuged at 27,216 x g for 30 min room temperature. The supernatant was discarded as the wash, and about 2/3 of the pellets were dissolved in 75 ml 8 M guanidine HCl, 50 mM tris HCl, pH 8.0 by agitation for about 15 min.
  • the suspension was centrifuged at 27,216 x g for 30 min room temperature, and the supernatant was diluted with 18 ml water.
  • Sample was then loaded on to a 50 ml chelating sepharose fast flow column (Amersham Pharmacia Biotech, Piscataway, NJ) , loaded with NiCl 2 , at 5 ml/min.
  • Ni-Buffer A (6 M guanidine HCl, 37.5 ml tris HCl, pH 8.0) at 10 ml/min, eluted with two step of 10% and 100% Ni-Buffer B (6 M guanidine HCl, 37.5 mM tris HCl, 400 mM imidazole, pH 8.0).
  • Reaction mixture was loaded on to a 5 ml HiTrap Q-sepharose HP column (Amersham Pharmacia Biotech, Piscataway, NJ) at 1 ml/min in 20 mM tris HCl pH 8.0 followed by about a 15 ml wash in the same buffer. Column was then developed at 5 ml/min using a linear gradient to 60% 20 mM tris HCl, 1 M NaCl, pH 8.0 followed by a step to 100% of the elution buffer. Fractions containing the TTR fusion as determined by SDS-PAGE were pooled into a single Q-pool (9.5 ml).
  • This example shows the effect of injecting pegylated GLP1-TTR constructs into mice on blood glucose levels.
  • 40 male, db/db, 9 week-old mice were split into 4 groups and injected (hour 0) intraperitoneal with 7.4 - 16.6 mg test protein per animal (538 pmol monomers for all groups) (5K pegylated GLPl-TTR fusion construct 10 mg, 20K pegylated GLPl-TTR fusion construct 10 mg, GLPl-Fc 16.6 mg, and a TTR(CIOA) control 7.4 mg) .
  • Each group was bled at time points 0 (baseline measurement), 1, 4, 6, 12, 24, and 48 hours post injection. Food was withheld from the mice for the first 6 hours of the experiment and replaced after the bleed at the 6 hour time point.
  • Each collected drop of blood per time point was analyzed for glucose content using a One Touch Profile glucose meter and the results are depicted in Figure 12.
  • This example shows the effect of injecting TMP-TTR constructs with fused antibody CH2 domains into mice on blood platelet count.
  • 50 female BDF1 mice were split into 5 groups and injected (day 0) subcutaneously with 50 mg test protein per kg animal (TMP fusion construct, Fc-TMP, or a TTR(CIOA) control) .
  • TMP fusion construct 50 mg test protein per kg animal
  • Fc-TMP 50 mg test protein per kg animal
  • TTR(CIOA) control 50 mg test protein per kg animal
  • the collected blood was analyzed for a complete and differential count using an ADVIA 120 automated blood analyzer with murine software (Bayer
  • Fc- TMP showed the greatest response with platelet count rising to over 4.2 X 1012 platelets L-l on day 5 which is 3 times baseline at 1.4 X 1012 platelets L-l. All three of the CH2 fused TMP-TTR constructs preformed better than the control, but not as well as Fc-TMP with platelet counts between 2.3 X 1012 and 2.6 X 1012 platelets L-l on day 5, which is between a 64% and 86% improvement over baseline.
  • This example shows the effect of injecting pegylated TTR constructs with TMP fused to the carboxy- terminus of pegylated TTR into mice on blood platelet count.
  • 80 BDF1 mice were split into 8 groups and injected (day 0) subcutaneously with 50 mg test protein per kg animal (TMP fusion constructs, Fc- TMP, or a TTR(CIOA) control) . Each group was divided in half and bled (140 ml) on alternate time points (day 0, 3, 5, 7, 10, and 12). Mice were anesthetized with isoflurane prior to collection.
  • This example shows the effect of injecting pegylated TTR-TMP constructs containing a K15A alteration into mice on blood platelet count.
  • 120 BDF1 mice were split into 12 groups and injected (day 0) subcutaneously with 50 mg test protein per kg animal (TMP fusion constructs, Fc-TMP, or a TTR(CIOA) control) (this study was split into two batches (PEG 2OK in one and the PEG 5K and non- pegylated samples in the other) completed at separate times with repeated controls) . Each group was divided in half and bled (140 ml) on alternate time points (day 0, 3, 5, 7, 10, and 12). Mice were anesthetized with isoflurane prior to collection.
  • the collected blood was analyzed for a complete and differential count using an ADVIA 120 automated blood analyzer with murine software (Bayer Diagnostics, New York, NY) .
  • the two non-pegylated constructs outperformed the baseline (1.3 X 10 12 platelets L-l) with platelet responses at day 5 rising between 1.8 X 10 12 and 2.0 X 10 12 platelets L-l.
  • Fc-TMP and the three 5K pegylated fusions showed equivalent responses at day 5 with platelet counts rising between 3.5 X 10 12 and 4.4 X 10 12 platelets L-l which is at least 2.7 times baseline (1.3 X 10 12 platelets L-l).
  • Fc- TMP and the three 2OK pegylated fusions showed equivalent responses at day 5 with platelet count rising between 4.3 X 10 12 and 4.6 X 10 12 platelets L-l which is over three times baseline at 1.3 X 10 12 platelets L-l.
  • the 2OK pegylated TTR constructs appear to have an improved sustained response with platelets at day 7 ranging from 3.7 X 10 12 to 4.9 X 10 12 platelets L-l compared to Fc-TMP at 3.1 X 10 12 platelets L-l.
  • This sustained response is maintained at day 10 for the three 20K pegylated TTR constructs with platelets ranging from 2.3 X 10 12 to 3.1 X 10 12 platelets L-l compared to Fc-TMP at 2.0 X 10 12 platelets L-l.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Endocrinology (AREA)
  • Zoology (AREA)
  • Diabetes (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Obesity (AREA)
  • Emergency Medicine (AREA)
  • Cardiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Medicinal Preparation (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medical Preparation Storing Or Oral Administration Devices (AREA)
  • Infusion, Injection, And Reservoir Apparatuses (AREA)
PCT/US2003/010443 2002-04-04 2003-04-03 Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins Ceased WO2003086444A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU2003224844A AU2003224844B2 (en) 2002-04-04 2003-04-03 Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins
JP2003583462A JP4738743B2 (ja) 2002-04-04 2003-04-03 薬理学的活性ペプチド/タンパク質の血清中半減期を上昇させるためのトランスサイレチンペプチド/タンパク質融合物の使用
MXPA04009680A MXPA04009680A (es) 2002-04-04 2003-04-03 Uso de fusiones de peptido/proteina con transtiretina para incrementar la vida media en suero de peptidos/proteinas farmacologicamente activos.
ES03721538T ES2400341T3 (es) 2002-04-04 2003-04-03 Uso de fusiones de proteína/péptido de transtiretina para aumentar la semivida sérica de péptidos/proteínas farmacológicamente activos
EP03721538A EP1496926B1 (en) 2002-04-04 2003-04-03 Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins
CA002480883A CA2480883A1 (en) 2002-04-04 2003-04-03 Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10/117,109 US20030191056A1 (en) 2002-04-04 2002-04-04 Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins
US10/117,109 2002-04-04

Publications (1)

Publication Number Publication Date
WO2003086444A1 true WO2003086444A1 (en) 2003-10-23

Family

ID=28674128

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/010443 Ceased WO2003086444A1 (en) 2002-04-04 2003-04-03 Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins

Country Status (9)

Country Link
US (4) US20030191056A1 (https=)
EP (2) EP2298331A3 (https=)
JP (2) JP4738743B2 (https=)
AU (1) AU2003224844B2 (https=)
CA (1) CA2480883A1 (https=)
ES (1) ES2400341T3 (https=)
MX (1) MXPA04009680A (https=)
PL (1) PL372849A1 (https=)
WO (1) WO2003086444A1 (https=)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005077976A3 (en) * 2004-02-13 2006-03-09 Avidis Sa Coiled-coil domains from c4b-binding protein
WO2006056492A1 (en) 2004-11-29 2006-06-01 Bioxell Spa Therapeutic peptides comprising sequences derived from cdr2 or cdr3 of trem-1 and uses thereof to inhibit sepsis
WO2006010057A3 (en) * 2004-07-08 2007-01-25 Amgen Inc Therapeutic peptides
JP2009508505A (ja) * 2005-09-22 2009-03-05 バイオコンパティブルズ ユーケー リミテッド ペプチダーゼに対する耐性が向上しているglp−1(グルカゴン様ペプチド−1)融合ペプチド
US8790705B2 (en) 2006-05-10 2014-07-29 Biocompatibles Uk Ltd. Spherical microcapsules comprising GLP-1 peptides, their production and use
US10851144B2 (en) 2015-04-10 2020-12-01 Amgen Inc. Interleukin-2 muteins for the expansion of T-regulatory cells
US11560415B2 (en) 2009-01-21 2023-01-24 Amgen Inc. Method of promoting regulatory T-cell proliferation
US12269898B2 (en) 2017-10-04 2025-04-08 Amgen Inc. Transthyretin immunoglobulin fusions
US12600758B2 (en) 2019-08-13 2026-04-14 Amgen Inc. Interleukin-2 muteins for the expansion of T-regulatory cells

Families Citing this family (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2261244A3 (en) 2003-04-15 2011-02-23 Glaxosmithkline LLC Human il-18 substitution mutants and their conjugates
ES2383300T3 (es) * 2003-11-13 2012-06-20 Hanmi Holdings Co., Ltd Fragmento Fc de IgG para un vehículo de fármacos y procedimiento para su preparación
US8263084B2 (en) * 2003-11-13 2012-09-11 Hanmi Science Co., Ltd Pharmaceutical composition for treating obesity-related disease comprising insulinotropic peptide conjugate
US20090238838A1 (en) * 2003-11-13 2009-09-24 Hanmi Pharm. Ind. Co. Ltd. Insulinotropic peptide conjugate using an immunoglobulin fc
JP2007516968A (ja) * 2003-12-05 2007-06-28 ベクトン・ディキンソン・アンド・カンパニー 皮内コンパートメントにおける免疫応答を増強する方法、およびそれらの方法で有用な化合物
ATE461217T1 (de) * 2003-12-18 2010-04-15 Novo Nordisk As Glp-1-verbindungen
CN100344323C (zh) * 2004-09-30 2007-10-24 华东师范大学 一种人胰高血糖素样肽-1的复合物及其制备方法
MY146381A (en) 2004-12-22 2012-08-15 Amgen Inc Compositions and methods relating relating to anti-igf-1 receptor antibodies
DK1831252T3 (da) * 2004-12-22 2009-10-05 Lilly Co Eli GLP-1 analog fusionsproteinformuleringer
US8008453B2 (en) 2005-08-12 2011-08-30 Amgen Inc. Modified Fc molecules
US8168592B2 (en) * 2005-10-21 2012-05-01 Amgen Inc. CGRP peptide antagonists and conjugates
EP2364735A3 (en) * 2005-12-16 2012-04-11 Nektar Therapeutics Branched PEG conjugates of GLP-1
PE20081140A1 (es) * 2006-10-25 2008-09-22 Amgen Inc Agentes terapeuticos a base de peptidos derivados de toxinas
EP1972349A1 (en) * 2007-03-21 2008-09-24 Biocompatibles UK Limited GLP-1 fusion peptides conjugated to polymer(s), their production and use
EP1975176A1 (en) * 2007-03-27 2008-10-01 Biocompatibles UK Limited Novel glp-1 fusion peptides, their production and use
EP2162540A2 (en) 2007-05-22 2010-03-17 Amgen Inc. Compositions and methods for producing bioactive fusion proteins
US20090054332A1 (en) * 2007-06-21 2009-02-26 Conjuchem Biotechnologies, Inc. Thombopoietin peptide conjugates
CL2008001887A1 (es) 2007-06-29 2008-10-03 Amgen Inc Proteinas de union a antigeno que se unen al receptor activado por proteasas 2 (par-2); acido nucleico que las codifica; vector y celula huesped; metodo de produccion; y composicion que las comprende.
EP2163243A1 (en) * 2008-09-12 2010-03-17 Biocompatibles UK Limited Treatment of acute myocardial infarction (AMI) using encapsulated cells encoding and secreting GLP-1 peptides or analogs thereof
MX360460B (es) 2008-10-20 2018-11-05 Alnylam Pharmaceuticals Inc Composiciones y metodos para inhibir la expresion de transtiretina.
WO2010091253A1 (en) * 2009-02-06 2010-08-12 Women & Infants' Hospital Of Rhode Island Compositions, formulations and methods of treating preeclampsia-type disorders of pregnancy
CN103382222B (zh) 2009-03-20 2016-12-28 安姆根有限公司 α-4-β-7异二聚体特异性拮抗剂抗体
CA2755336C (en) 2009-03-20 2015-07-14 Amgen Inc. Carrier immunoglobulins and uses thereof
MX2012001283A (es) 2009-07-31 2012-06-12 Amgen Inc Polipeptidos que se enlazan al inhibidor de tejidos de metaloproteinasa tipo tres (timp-3) composiciones y metodos.
SG187867A1 (en) 2010-08-16 2013-03-28 Amgen Inc Antibodies that bind myostatin, compositions and methods
MX360946B (es) 2010-09-22 2018-10-29 Amgen Inc Star Inmunoglobulinas portadoras y usos de las mismas.
MX2013008833A (es) 2011-02-02 2013-12-06 Amgen Inc Metodos y composiciones relacionadas con la inhibicion de receptor del factor de crecimiento similar a la insulina 1 (igf-1r).
CA2828405A1 (en) 2011-02-28 2012-09-07 Istituto Di Ricovero E Cura A Carattere Scientifico Materno-Infantile Bu Rlo Garofolo - Ospedale Di Alta Specializzazione E Di Rilievo Nazionale Apoptosis-inducing molecules and uses therefor
PH12013501865A1 (en) 2011-03-16 2014-01-06 Amgen Inc Potent and selective inhibitors of nav1.3 and nav1.7
JP2014132832A (ja) * 2011-05-10 2014-07-24 Sekisui Chem Co Ltd 医薬、機能性食品、目的蛋白質の安定化方法、融合蛋白質、核酸、並びに、組換え体
EP3730618A1 (en) 2011-11-18 2020-10-28 Alnylam Pharmaceuticals, Inc. Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases
JP2014533834A (ja) * 2011-11-18 2014-12-15 アルナイラム ファーマシューティカルズ, インコーポレイテッドAlnylam Pharmaceuticals, Inc. トランスサイレチンおよびそのアイソフォームの定量化
US9309318B2 (en) 2012-10-17 2016-04-12 Amgen, Inc. Compositions relating to anti-IL-21 receptor antibodies
US20160067347A1 (en) 2012-12-20 2016-03-10 Amgen Inc. Apj receptor agonists and uses thereof
WO2014165277A2 (en) 2013-03-12 2014-10-09 Amgen Inc. POTENT AND SELECTIVE INHIBITORS OF Nav1.7
EP2970483A2 (en) 2013-03-15 2016-01-20 Amgen Inc. Methods and compositions relating to anti-ccr7 antigen binding proteins
WO2015104711A1 (en) 2014-01-09 2015-07-16 Hadasit Medical Research Services And Development Ltd. Improved cell compositions and methods for cancer therapy
WO2015191781A2 (en) 2014-06-10 2015-12-17 Amgen Inc. Apelin polypeptides
WO2016025129A1 (en) 2014-08-14 2016-02-18 Alhamadsheh Mamoun M Conjugation of pharmaceutically active agents with transthyretin ligands through adjustable linkers to increase serum half-life
MX382490B (es) 2014-08-27 2025-03-13 Amgen Inc Variantes de inhibidor de tejido de metaloproteinasa tipo tres (timp-3), composiciones y metodos
PT3329002T (pt) 2015-07-31 2021-01-12 Alnylam Pharmaceuticals Inc Composições de iarn de transtirretina (ttr) e métodos de seu uso para tratamento ou prevenção de doenças associadas à ttr
WO2017155981A1 (en) * 2016-03-07 2017-09-14 Massachusetts Institute Of Technology Protein-chaperoned t-cell vaccines
WO2018132768A1 (en) 2017-01-13 2018-07-19 Sanna Pietro P Methods and compositions for treating hpa hyperactivity
CN108623690A (zh) * 2017-03-16 2018-10-09 兰州大学 一种促血小板生成素的融合蛋白及其制备方法和应用
CN106977609B (zh) * 2017-04-19 2020-07-28 刘崇东 一种融合蛋白、制备方法及其应用
LT3661562T (lt) 2017-08-04 2024-10-25 Amgen Inc. Cys-mab konjugavimo būdas
BR112020005230A2 (pt) 2017-09-19 2020-09-24 Alnylam Pharmaceuticals, Inc. composições e métodos para o tratamento da amiloidose mediada por transtiretina (ttr)
US20230051872A1 (en) 2019-03-22 2023-02-16 Reflexion Pharmaceuticals, Inc. Multivalent D-Peptidic Compounds for Target Proteins
KR20220044612A (ko) 2019-03-22 2022-04-08 리플렉시온 파마슈티컬스, 인크. Vegf에 대한 d-펩티드성 화합물
JP7360142B2 (ja) * 2019-05-21 2023-10-12 国立大学法人 熊本大学 アミロイドーシス治療薬の新規スクリーニング方法
IL267614A (en) 2019-06-24 2019-09-26 Lotem Michal Nucleic acids to modulate SLAMF6 isoforms
EP3997112A1 (en) 2019-07-08 2022-05-18 Amgen, Inc Multispecific transthyretin immunoglobulin fusions
PH12022550165A1 (en) 2019-07-26 2023-05-08 Visterra Inc Interleukin-2 agents and uses thereof
EP3988122A4 (en) * 2019-12-17 2023-01-18 Yizhou (Shanghai) Biological Medicine Co, Ltd. USE OF TRANSTHYRETIN FOR INTRODUCTION TO THE EYE AND MAKING DROPS
CN110960687A (zh) * 2019-12-17 2020-04-07 上海卡序生物医药科技有限公司 转甲状腺素蛋白转运融合蛋白进入眼内的应用
CN112043820B (zh) * 2020-09-16 2022-06-21 易舟(上海)生物医药有限公司 一种眼用制剂及其制备方法和应用
WO2022050401A2 (en) 2020-09-01 2022-03-10 Takeda Pharmaceutical Company Limited Interleukin-2 muteins and uses thereof
US12098178B2 (en) 2020-12-04 2024-09-24 Visterra, Inc. Methods of using interleukin-2 agents
CA3227852A1 (en) 2021-08-03 2023-02-09 Alnylam Pharmaceuticals, Inc. Transthyretin (ttr) irna compositions and methods of use thereof

Citations (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4002531A (en) 1976-01-22 1977-01-11 Pierce Chemical Company Modifying enzymes with polyethylene glycol and product produced thereby
US4179337A (en) 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
US4695623A (en) 1982-05-06 1987-09-22 Amgen Consensus human leukocyte interferon
US4703008A (en) 1983-12-13 1987-10-27 Kiren-Amgen, Inc. DNA sequences encoding erythropoietin
US4810643A (en) 1985-08-23 1989-03-07 Kirin- Amgen Inc. Production of pluripotent granulocyte colony-stimulating factor
US4904584A (en) 1987-12-23 1990-02-27 Genetics Institute, Inc. Site-specific homogeneous modification of polypeptides
US4999291A (en) 1985-08-23 1991-03-12 Amgen Inc. Production of human pluripotent granulocyte colony-stimulating factor
WO1991005795A1 (en) 1989-10-16 1991-05-02 Amgen Inc. Stem cell factor
US5075222A (en) 1988-05-27 1991-12-24 Synergen, Inc. Interleukin-1 inhibitors
US5118666A (en) 1986-05-05 1992-06-02 The General Hospital Corporation Insulinotropic hormone
US5120712A (en) 1986-05-05 1992-06-09 The General Hospital Corporation Insulinotropic hormone
WO1992017505A1 (en) 1991-04-05 1992-10-15 Board Of Regents Of The University Of Washington Monoclonal antibodies to stem cell factor receptors
WO1994002957A1 (en) 1992-07-17 1994-02-03 Saes Getters S.P.A. High capacity getter pump
WO1994017185A1 (en) 1993-01-28 1994-08-04 Amgen Inc. G-csf analog compositions and methods
US5372808A (en) 1990-10-17 1994-12-13 Amgen Inc. Methods and compositions for the treatment of diseases with consensus interferon while reducing side effect
WO1995017206A1 (en) 1993-12-22 1995-06-29 Amgen Inc. Lyophilized stem cell factor formulations
WO1995018858A1 (en) 1994-01-03 1995-07-13 Genentech, Inc. Thrombopoietin
US5441868A (en) 1983-12-13 1995-08-15 Kirin-Amgen, Inc. Production of recombinant erythropoietin
WO1995021920A1 (en) 1994-02-14 1995-08-17 Zymogenetics, Inc. Hematopoietic protein and materials and methods for making it
WO1995021919A2 (en) 1994-02-14 1995-08-17 Kirin Brewery Company, Limited Protein having tpo activity
WO1995026746A1 (en) 1994-03-31 1995-10-12 Amgen Inc. Compositions and methods for stimulating megakaryocyte growth and differentiation
WO1996005309A2 (en) 1994-08-17 1996-02-22 The Rockefeller University Modulators of body weight, corresponding nucleic acids and proteins, and diagnostic and therapeutic uses thereof
US5545618A (en) 1990-01-24 1996-08-13 Buckley; Douglas I. GLP-1 analogs useful for diabetes treatment
US5547933A (en) 1983-12-13 1996-08-20 Kirin-Amgen, Inc. Production of erythropoietin
WO1996040912A1 (en) 1995-06-07 1996-12-19 Amgen Inc. Ob protein compositions and method
WO1997000128A2 (en) 1995-06-16 1997-01-03 The Procter & Gamble Company Method for manufacturing cobalt catalysts
WO1997001010A1 (en) 1995-06-23 1997-01-09 Draftex Industries Limited Opening arrangements and methods for closure members
WO1997006816A1 (en) 1995-08-17 1997-02-27 Amgen Inc. Methods of reducing or maintaining reduced levels of blood lipids using ob protein compositions
WO1997023614A1 (en) 1995-12-22 1997-07-03 Amgen Inc. Osteoprotegerin
US5714142A (en) * 1994-02-23 1998-02-03 Blaney; Jeffrey M. Method and compositions for increasing the serum half-life of pharmacologically active agents by binding to transthyretin-selective ligands
US5869451A (en) 1995-06-07 1999-02-09 Glaxo Group Limited Peptides and compounds that bind to a receptor
US5932946A (en) 1995-08-11 1999-08-03 Hitachi Powdered Metals Co., Ltd Porous bearing system having internal grooves and electric motor provided with the same
US5977071A (en) 1993-12-09 1999-11-02 Eli Lilly And Company Glucagon-like insulinotropic peptides, compositions and methods
WO2000024782A2 (en) 1998-10-23 2000-05-04 Amgen Inc. Modified peptides, comprising an fc domain, as therapeutic agents
WO2002046227A2 (en) 2000-12-07 2002-06-13 Eli Lilly And Company Glp-1 fusion proteins

Family Cites Families (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3941763A (en) 1975-03-28 1976-03-02 American Home Products Corporation PGlu-D-Met-Trp-Ser-Tyr-D-Ala-Leu-Arg-Pro-Gly-NH2 and intermediates
JPS5923252A (ja) * 1982-07-30 1984-02-06 Fuji Photo Film Co Ltd チロキシンの蛍光測定もしくは比色による定量分析法
US4902502A (en) * 1989-01-23 1990-02-20 Cetus Corporation Preparation of a polymer/interleukin-2 conjugate
EP0502956B1 (en) 1989-11-29 1997-04-23 Amgen Boulder Inc. Production of recombinant human interleukin-1 inhibitor
JP3507486B2 (ja) 1991-03-15 2004-03-15 アムジエン・インコーポレーテツド 顆粒球コロニー刺激因子の肺内投与
ATE240740T1 (de) 1991-03-15 2003-06-15 Amgen Inc Pegylation von polypeptiden
US5595732A (en) * 1991-03-25 1997-01-21 Hoffmann-La Roche Inc. Polyethylene-protein conjugates
US5716805A (en) * 1991-10-25 1998-02-10 Immunex Corporation Methods of preparing soluble, oligomeric proteins
US5962406A (en) * 1991-10-25 1999-10-05 Immunex Corporation Recombinant soluble CD40 ligand polypeptide and pharmaceutical composition containing the same
HU225496B1 (en) 1993-04-07 2007-01-29 Scios Inc Pharmaceutical compositions of prolonged delivery, containing peptides
CN1057534C (zh) 1993-08-17 2000-10-18 柯瑞英-艾格公司 促红细胞生成素类似物
US5880096A (en) 1994-02-02 1999-03-09 Affymax Technologies N.V. Peptides and compounds that bind to the IL-1 receptor
US5608035A (en) 1994-02-02 1997-03-04 Affymax Technologies N.V. Peptides and compounds that bind to the IL-1 receptor
US5786331A (en) 1994-02-02 1998-07-28 Affymax Technologies N.V. Peptides and compounds that bind to the IL-1 receptor
US5532166A (en) * 1994-04-18 1996-07-02 Ma; Yinfa Quantitative retinol assay for serum and dried blood spots
US5824784A (en) 1994-10-12 1998-10-20 Amgen Inc. N-terminally chemically modified protein compositions and methods
CA2275183A1 (en) 1996-12-20 1998-07-02 Amgen Inc. Ob fusion protein compositions and methods
MEP42108A (en) 1998-10-23 2011-02-10 Kiren Amgen Inc Dimeric thrombopoietin peptide mimetics binding to mp1 receptor and having thrombopoietic activity
KR100345214B1 (ko) 1999-08-17 2002-07-25 이강춘 생체적합성 고분자가 수식된 펩타이드의 비점막 전달
EP2213743A1 (en) * 2000-04-12 2010-08-04 Human Genome Sciences, Inc. Albumin fusion proteins
JP2003531149A (ja) * 2000-04-13 2003-10-21 ザ・ロツクフエラー・ユニバーシテイ 抗体由来の免疫応答の増強
US6756480B2 (en) 2000-04-27 2004-06-29 Amgen Inc. Modulators of receptors for parathyroid hormone and parathyroid hormone-related protein
WO2002059621A2 (en) * 2001-01-24 2002-08-01 Bayer Corporation Regulation of transthyretin to treat obesity
CA2511966A1 (en) * 2002-11-01 2004-07-22 Amgen Inc. Modulators of receptors for parathyroid hormone and parathyroid hormone-related protein

Patent Citations (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4179337A (en) 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
US4002531A (en) 1976-01-22 1977-01-11 Pierce Chemical Company Modifying enzymes with polyethylene glycol and product produced thereby
US4897471A (en) 1982-05-06 1990-01-30 Amgen Consensus human leukocyte interferon
US4695623A (en) 1982-05-06 1987-09-22 Amgen Consensus human leukocyte interferon
US5541293A (en) 1982-05-06 1996-07-30 Amgen Inc. Consensus human leukocyte interferon
US4703008A (en) 1983-12-13 1987-10-27 Kiren-Amgen, Inc. DNA sequences encoding erythropoietin
US5547933A (en) 1983-12-13 1996-08-20 Kirin-Amgen, Inc. Production of erythropoietin
US5618698A (en) 1983-12-13 1997-04-08 Kirin-Amgen, Inc. Production of erythropoietin
US5621080A (en) 1983-12-13 1997-04-15 Kirin-Amgen, Inc. Production of erythropoietin
US5441868A (en) 1983-12-13 1995-08-15 Kirin-Amgen, Inc. Production of recombinant erythropoietin
US5582823A (en) 1985-08-23 1996-12-10 Amgen Inc. Methods of treating bacterial inflammation and granulocytopoiesis by administering human pluripotent granulocyte colony-stimulating factor
US4999291A (en) 1985-08-23 1991-03-12 Amgen Inc. Production of human pluripotent granulocyte colony-stimulating factor
US4810643A (en) 1985-08-23 1989-03-07 Kirin- Amgen Inc. Production of pluripotent granulocyte colony-stimulating factor
US5118666A (en) 1986-05-05 1992-06-02 The General Hospital Corporation Insulinotropic hormone
US5120712A (en) 1986-05-05 1992-06-09 The General Hospital Corporation Insulinotropic hormone
US4904584A (en) 1987-12-23 1990-02-27 Genetics Institute, Inc. Site-specific homogeneous modification of polypeptides
US5075222A (en) 1988-05-27 1991-12-24 Synergen, Inc. Interleukin-1 inhibitors
WO1991005795A1 (en) 1989-10-16 1991-05-02 Amgen Inc. Stem cell factor
US5545618A (en) 1990-01-24 1996-08-13 Buckley; Douglas I. GLP-1 analogs useful for diabetes treatment
US5372808A (en) 1990-10-17 1994-12-13 Amgen Inc. Methods and compositions for the treatment of diseases with consensus interferon while reducing side effect
WO1992017505A1 (en) 1991-04-05 1992-10-15 Board Of Regents Of The University Of Washington Monoclonal antibodies to stem cell factor receptors
WO1994002957A1 (en) 1992-07-17 1994-02-03 Saes Getters S.P.A. High capacity getter pump
WO1994017185A1 (en) 1993-01-28 1994-08-04 Amgen Inc. G-csf analog compositions and methods
US5581476A (en) 1993-01-28 1996-12-03 Amgen Inc. Computer-based methods and articles of manufacture for preparing G-CSF analogs
US5977071A (en) 1993-12-09 1999-11-02 Eli Lilly And Company Glucagon-like insulinotropic peptides, compositions and methods
WO1995017206A1 (en) 1993-12-22 1995-06-29 Amgen Inc. Lyophilized stem cell factor formulations
WO1995018858A1 (en) 1994-01-03 1995-07-13 Genentech, Inc. Thrombopoietin
WO1995021919A2 (en) 1994-02-14 1995-08-17 Kirin Brewery Company, Limited Protein having tpo activity
WO1995021920A1 (en) 1994-02-14 1995-08-17 Zymogenetics, Inc. Hematopoietic protein and materials and methods for making it
US5714142A (en) * 1994-02-23 1998-02-03 Blaney; Jeffrey M. Method and compositions for increasing the serum half-life of pharmacologically active agents by binding to transthyretin-selective ligands
WO1995026746A1 (en) 1994-03-31 1995-10-12 Amgen Inc. Compositions and methods for stimulating megakaryocyte growth and differentiation
WO1996005309A2 (en) 1994-08-17 1996-02-22 The Rockefeller University Modulators of body weight, corresponding nucleic acids and proteins, and diagnostic and therapeutic uses thereof
WO1996040912A1 (en) 1995-06-07 1996-12-19 Amgen Inc. Ob protein compositions and method
US5869451A (en) 1995-06-07 1999-02-09 Glaxo Group Limited Peptides and compounds that bind to a receptor
WO1997000128A2 (en) 1995-06-16 1997-01-03 The Procter & Gamble Company Method for manufacturing cobalt catalysts
WO1997001010A1 (en) 1995-06-23 1997-01-09 Draftex Industries Limited Opening arrangements and methods for closure members
US5932946A (en) 1995-08-11 1999-08-03 Hitachi Powdered Metals Co., Ltd Porous bearing system having internal grooves and electric motor provided with the same
WO1997006816A1 (en) 1995-08-17 1997-02-27 Amgen Inc. Methods of reducing or maintaining reduced levels of blood lipids using ob protein compositions
WO1997023614A1 (en) 1995-12-22 1997-07-03 Amgen Inc. Osteoprotegerin
WO2000024782A2 (en) 1998-10-23 2000-05-04 Amgen Inc. Modified peptides, comprising an fc domain, as therapeutic agents
WO2002046227A2 (en) 2000-12-07 2002-06-13 Eli Lilly And Company Glp-1 fusion proteins

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING CO., pages: 1435 - 1712
ADELHORST ET AL., J. BIOL. CHEM., vol. 269, 1994, pages 6275
CWIRLA STEVEN E. ET AL.: "Peptide Agonist of the Thrombopoietin Receptor as Potent as the Natural Cytokine", SCIENCE, vol. 276, 13 June 1997 (1997-06-13), pages 1696 - 1699, XP008136351, DOI: doi:10.1126/science.276.5319.1696
DEDMAN ET AL., J. BIOL. CHEM., vol. 268, 1993, pages 23025 - 23030
HERZ ET AL., J. RECEPTOR & SIGNAL TRANSDUCTION RES., vol. 17, no. 5, 1997, pages 671 - 776
KAY ET AL., DRUG DISC. TODAY, vol. 3, 1998, pages 370 - 378
NARANDA ET AL., PROC. NATL. ACAD._SCI: USA, vol. 96, 1999, pages 7569 - 7574
PAUKOVITS ET AL., HOPPE=SEYLERS Z. PHYSIOL. CHEM., vol. 365, 1984, pages 303 - 311
SCHMIDT ET AL.: "Familial amyloidotic polyneuropathy: domino liver transplantation", JOURNAL OF HEPATOLOGY, vol. 30, 1999, pages 293 - 298, XP002965011 *
See also references of EP1496926A4
WILSON ET AL., CAN. J. MICROBIOL., vol. 44, 1998, pages 313 - 329
WRIGHTON ET AL., SCIENCE, vol. 273, 1996, pages 458 - 463

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005077976A3 (en) * 2004-02-13 2006-03-09 Avidis Sa Coiled-coil domains from c4b-binding protein
WO2006010057A3 (en) * 2004-07-08 2007-01-25 Amgen Inc Therapeutic peptides
WO2006056492A1 (en) 2004-11-29 2006-06-01 Bioxell Spa Therapeutic peptides comprising sequences derived from cdr2 or cdr3 of trem-1 and uses thereof to inhibit sepsis
US10603357B2 (en) 2004-11-29 2020-03-31 Bristol-Myers Squibb Company Therapeutic TREM-1 peptides
US8853159B2 (en) 2005-09-22 2014-10-07 Biocompatibles Uk Ltd GLP-1 Fusion Peptides
US8431533B2 (en) 2005-09-22 2013-04-30 Biocompatibles Uk Ltd. GLP-1 fusion peptides, their production and use
JP2009508505A (ja) * 2005-09-22 2009-03-05 バイオコンパティブルズ ユーケー リミテッド ペプチダーゼに対する耐性が向上しているglp−1(グルカゴン様ペプチド−1)融合ペプチド
US8790705B2 (en) 2006-05-10 2014-07-29 Biocompatibles Uk Ltd. Spherical microcapsules comprising GLP-1 peptides, their production and use
US11560415B2 (en) 2009-01-21 2023-01-24 Amgen Inc. Method of promoting regulatory T-cell proliferation
US10851144B2 (en) 2015-04-10 2020-12-01 Amgen Inc. Interleukin-2 muteins for the expansion of T-regulatory cells
US11976103B2 (en) 2015-04-10 2024-05-07 Amgen Inc. Interleukin-2 muteins for the expansion of T-regulatory cells
US12269898B2 (en) 2017-10-04 2025-04-08 Amgen Inc. Transthyretin immunoglobulin fusions
US12600758B2 (en) 2019-08-13 2026-04-14 Amgen Inc. Interleukin-2 muteins for the expansion of T-regulatory cells

Also Published As

Publication number Publication date
EP1496926A4 (en) 2006-10-18
AU2003224844A1 (en) 2003-10-27
JP2011136981A (ja) 2011-07-14
CA2480883A1 (en) 2003-10-23
JP4738743B2 (ja) 2011-08-03
AU2003224844B2 (en) 2009-05-21
ES2400341T3 (es) 2013-04-09
US20140234945A1 (en) 2014-08-21
EP2298331A3 (en) 2011-04-13
MXPA04009680A (es) 2005-01-11
US8633153B2 (en) 2014-01-21
JP2005529108A (ja) 2005-09-29
US20030191056A1 (en) 2003-10-09
EP1496926B1 (en) 2012-12-19
US20030195154A1 (en) 2003-10-16
EP2298331A2 (en) 2011-03-23
EP1496926A1 (en) 2005-01-19
US20090191624A1 (en) 2009-07-30
PL372849A1 (en) 2005-08-08

Similar Documents

Publication Publication Date Title
AU2003224844B2 (en) Use of transthyretin peptide/protein fusions to increase the serum half-life of pharmacologically active peptides/proteins
US8748571B2 (en) Thrombopoietic compounds
KR101028626B1 (ko) 혈소판신생 활성을 갖는 펩티드 및 관련 화합물
JP5591691B2 (ja) 生物活性を有する融合タンパク質を作製するための組成物及び方法
US7112659B2 (en) OB fusion protein compositions and methods
JP2003533187A (ja) 治療薬としてのFcドメインを含む修飾ペプチド
US20110071077A1 (en) Thrombopoietic Compounds
HK1122820A (en) Peptides and related compounds having thrombopoietic activity

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SK SL TJ TM TN TR TT TZ UA UG UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2480883

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2003583462

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 372849

Country of ref document: PL

Ref document number: PA/a/2004/009680

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2003224844

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2003721538

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2003721538

Country of ref document: EP