WO2002099095A2 - Improved isoprenoid production - Google Patents

Improved isoprenoid production Download PDF

Info

Publication number
WO2002099095A2
WO2002099095A2 PCT/EP2002/006171 EP0206171W WO02099095A2 WO 2002099095 A2 WO2002099095 A2 WO 2002099095A2 EP 0206171 W EP0206171 W EP 0206171W WO 02099095 A2 WO02099095 A2 WO 02099095A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
ofthe
amino acid
pbbr
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2002/006171
Other languages
English (en)
French (fr)
Other versions
WO2002099095A3 (en
Inventor
Alan Berry
Werner Bretzel
Markus Huembelin
Rual Lopez-Ulibarri
Anne Francoise Mayer
Alexei Yeliseev
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
DSM Nutritional Products AG
Original Assignee
Roche Vitamins AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Roche Vitamins AG filed Critical Roche Vitamins AG
Priority to JP2003502205A priority Critical patent/JP4280627B2/ja
Priority to AU2002316966A priority patent/AU2002316966B2/en
Priority to DE60228439T priority patent/DE60228439D1/de
Priority to CA002449885A priority patent/CA2449885A1/en
Priority to EP02745362A priority patent/EP1392824B1/en
Priority to KR1020037015938A priority patent/KR100704072B1/ko
Publication of WO2002099095A2 publication Critical patent/WO2002099095A2/en
Anticipated expiration legal-status Critical
Publication of WO2002099095A3 publication Critical patent/WO2002099095A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1022Transferases (2.) transferring aldehyde or ketonic groups (2.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/1029Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1085Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1229Phosphotransferases with a phosphate group as acceptor (2.7.4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90Isomerases (5.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01034Hydroxymethylglutaryl-CoA reductase (NADPH) (1.1.1.34)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01036Acetoacetyl-CoA reductase (1.1.1.36)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/03Acyl groups converted into alkyl on transfer (2.3.3)
    • C12Y203/0301Hydroxymethylglutaryl-CoA synthase (2.3.3.10)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01036Mevalonate kinase (2.7.1.36)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/04Phosphotransferases with a phosphate group as acceptor (2.7.4)
    • C12Y207/04002Phosphomevalonate kinase (2.7.4.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y401/00Carbon-carbon lyases (4.1)
    • C12Y401/01Carboxy-lyases (4.1.1)
    • C12Y401/01033Diphosphomevalonate decarboxylase (4.1.1.33), i.e. mevalonate-pyrophosphate decarboxylase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Definitions

  • the present invention relates to novel polynucleotides and polypeptide sequences useful in the isoprenoid biosynthetic pathway. More particularly, the present invention provides recombinantly produced cells that exhibit improved production of zeaxanthin. Methods of making and using such cell lines are also provided.
  • Carotenoids are commercially important C-40 isoprenoid compounds used as nutritional supplements, pharmaceuticals and food colorants for humans and as pigments for animal feed.
  • industrially important carotenoids are produced mainly by chemical synthesis ( ⁇ -carotene, canthaxanthin and astaxanthin) or extraction from natural sources (lutein from marigold, capsanthin from paprika).
  • Production of carotenoids, however, using microorganisms has been achieved in some cases.
  • ⁇ -carotene is produced by fermentation with the fungus Blakeslea trispora (US 5,328,845) or by pond culture using the halotolerant alga Dun liella salina [Borowitzka, J. Biotechnol.
  • US 6,087,152 also disclosed that by modifying the carotenoid gene cluster or by adding a gene from an astaxanthin producing bacterium, it was possible to produce carotenoids other than zeaxanthin (EP 872,554). Moreover, EP 872,554 disclosed that carotenoid production was increased in strain R1534 by introducing cloned carotenoid gene clusters on a multi-copy plasmid.
  • IPP isopentenyl pyrophosphate
  • HMG-CoA reductase HMG-CoA - — * ⁇ * ⁇ Mevalonate
  • Diphosphomevalonate decarboxylase (mvd) isopentenyl Mevalonate-5-diphosphate diphosphate (IPP)
  • E. coli a non-carotenogenic bacterium
  • E. coli can be engineered to produce carotenoids by introducing the cloned carotenoid (crt) genes from the bacteria Agrobacterium aurantiacum, Erwinia herbicola or Erwinia uredovora (Misawa and Shimada, supra). Harker and Bramley [FEBS Lett.
  • IPP isomerase Two forms of IPP isomerase exist, the type 1 enzyme is well known in eukary- otes and some bacteria, and the newly identified type 2 enzyme that is FMN- and NADP(H)-dependent [Kaneda et al., Proc. Nat. Acad. Sci. 98:932-937 (2001)].
  • One embodiment ofthe present invention is an isolated polypeptide that includes an amino acid sequence selected from the following group: (a) an amino acid sequence shown as residues 1 to 340 of SEQ ID NO:43; (b) an amino acid sequence shown as residues 1 to 349 of SEQ ID NO:45; (c) an amino acid sequence shown as residues 1 to 388 of SEQ ID NO:47; (d) an amino acid sequence shown as residues 1 to 378 of SEQ ID NO:49; (e) an amino acid sequence shown as residues 1 to 305 of SEQ ID NO:51; (0 an amino acid sequence shown as residues 1 to 332 of SEQ ID NO:53; (g) a fragment of an amino acid sequence selected from the group consisting of SEQ ID NOs: 43, 45, 47, 49, 51, and 53, wherein said fragment has at least 30 contiguous amino acid residues; (h) an amino acid sequence of a fragment of a polypeptide selected from the group consisting of SEQ ID NOs: 43, 45, 47, 49, 51, and
  • the present invention includes SEQ ID Nos: 43, 45, 47, 49, 51, and 53, which are polypeptide sequences that correspond to the following enzymes ofthe mevalonate pathway: hydroxymethyl glutaryl CoA (HMG-CoA) reductase, isopentenyl diphosphate (IPP) isomerase, HMG-CoA synthase, mevalonate kinase, phosphomevalonate kinase, and diphosphomevalonate decarboxylase, respectively.
  • HMG-CoA hydroxymethyl glutaryl CoA reductase
  • IPP isopentenyl diphosphate
  • HMG-CoA synthase mevalonate kinase
  • phosphomevalonate kinase phosphomevalonate decarboxylase
  • the present invention also includes at least 30 contiguous amino acids of each identified sequence or a sufficient number of contiguous amino acids to define a biologically active molecule.
  • the present invention also includes fragments of a polypeptide selected from SEQ ID NOs: 43, 45, 47, 49, 51, and 53.
  • the fragment should be at least about 30 amino acids in length but must have the activity ofthe identified polypeptide, e.g., in the case of SEQ ID NO:43, a fragment thereof that falls within the scope ofthe present invention has the activity of HMG-CoA reductase.
  • a measure of activity ofthe respective fragments is set forth in Example 1.
  • a fragment having an activity above background in the assays set forth in Example 1 is considered to be biologically active and within the scope ofthe present invention.
  • the present invention also includes an amino acid sequence of a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions, as defined above, to a hybridization probe that contains at least 30 contiguous nucleotides of SEQ ID NO:42 (i.e., the mevalonate operon) or a complement of SEQ ID NO:42.
  • the polynucleotide must encode at least one of the enzymes in the mevalonate pathway.
  • a "hybridization probe” is a polynucleotide sequence containing from about 10- 9066 nucleotides of SEQ ID NO:42.
  • the isolated polypeptide may have the amino acid sequence of SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:51 or SEQ ID NO:53.
  • the isolated polypeptide may contain about 30 contiguous amino acids selected from an area ofthe respective amino acids sequences that have the least identity when compared to an enzyme with the same function from different species.
  • a polypeptide ofthe present invention may include amino acids 68-97 of SEQ ID NO:43, 1-30 of SEQ ID NO:45, 269-298 of SEQ ID NO:47, 109-138 of SEQ ID NO:49, 198-227 of SEQ ID NO:51 or 81-110 of SEQ ID NO:53.
  • Another embodiment ofthe invention is an isolated polypeptide having an amino acid sequence selected from: (a) an amino acid sequence shown as residues 1 to 287 of SEQ ID NO: 159; (b) at least 30 contiguous amino acid residues of SEQ ID NO: 159; (c) an amino acid sequence of a fragment of SEQ ID NO:159, the fragment having the activity of farnes- yl-diphosphate synthase (FPP synthase); (d) an amino acid sequence of a polypeptide en- coded by a polynucleotide that hybridizes under stringent conditions to a hybridization probe containing at least 30 consecutive nucleotides ofthe ispA gene (i.e., nucleotides 295- 1158 of SEQ ID NO: 157) or a complement thereof, wherein the polypeptide has the activity of FPP synthase; and (e) conservatively modified variants of SEQ ID NO:159.
  • FPP synthase farnes- yl-diphosphat
  • the amino acid may be encoded by the entire open reading frame that encodes FPP synthase, i.e, residues 1-287 of SEQ ID NO:159, at least 30 contiguous residues thereof, or a fragment of SEQ ID NO: 159 that has FPP synthase activity as measured by the assay set forth in Example 1.
  • this embodiment ofthe invention also includes amino acid sequence(s) encoded by polynucleotide(s) that hybridize under stringent conditions, as defined above, to a hybridization probe that includes at least 30 consecutive nucleotides ofthe ispA gene (i.e., nucleotides 295-1158 of SEQ ID NO: 157) or a complement thereof, wherein the polypeptide has FPP synthase activity as defined above.
  • the polypeptide has the amino acid sequence of SEQ ID NO:159.
  • Another embodiment ofthe invention is an isolated polypeptide having an amino acid sequence selected from the following group: (a) an amino acid sequence shown as residues 1 to 142 of SEQ ID NO: 160; (b) at least 30 contiguous amino acid residues of SEQ ID NO: 160; (c) an amino acid sequence of a fragment of SEQ ID NO: 160, the fragment having the activity of l-deoxyxylulose-5-phosphate synthase (DXPS); (d) an amino acid sequence of a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a hybridization probe containing at least 30 consecutive nucleotides spanning positions 1185-1610 of SEQ ID NO:157 or a complement thereof, wherein the polypeptide has the activity of DXPS; and (e) conservatively modified variants of SEQ ID NO: 160.
  • DXPS l-deoxyxylulose-5-phosphate synthase
  • the amino acid may be encoded by the entire open reading frame that encodes DXPS, i.e, residues 1-142 of SEQ ID NO:160, at least 30 contiguous residues thereof, or a fragment of SEQ ID NO: 160 that has DXPS activity as measured by as measured by the assay set forth in Example 1.
  • this embodiment ofthe invention also includes amino acid sequence(s) encoded by polynucleotide(s) that hybridize under stringent conditions, as defined above, to a hybridization probe that includes at least 30 consecutive nucleotides ofthe DXPS gene (i.e., nucleotides 1185-1610 of SEQ ID NO: 157) or a complement thereof, wherein the polypeptide has DXPS activity as defined above.
  • Another embodiment ofthe invention is an isolated polypeptide having an amino acid sequence selected from: (a) an amino acid sequence shown as residues 1 to 390 of SEQ ID NO:178; (b) at least 30 contiguous amino acid residues of SEQ ID NO:178; (c) an amino acid sequence of a fragment of SEQ ID NO: 178, the fragment having the activity of acetyl- CoA acetyltransferase; (d) an amino acid sequence of a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a hybridization probe containing at least 30 consecutive nucleotides of the phaA gene (i.e., nucleotides 1-1179 of SEQ ID NO: 177) or a complement thereof, wherein the polypeptide has the activity of acetyl-CoA acetyltransferase, and (e) conservatively modified variants of SEQ ID NO: 178.
  • the amino acid may be encoded by the entire open reading frame that encodes acetyl-CoA acetyltransferase, i.e, residues 1-143 of SEQ ID NO:178, at least 30 contiguous residues thereof, or a fragment of SEQ ID NO: 178 that has acetyl-CoA acetyltransferase activity as measured by the assay set forth in Example 1.
  • the amino acid may be encoded by the entire open reading frame that encodes acetoacetyl-CoA reductase, i.e, residues 1-240 of SEQ ID NO:179, at least 30 contiguous residues thereof, or a fragment of SEQ ID NO: 179 that has acetoacetyl- CoA reductase activity as measured by the assay set forth in Example 1.
  • this embodiment ofthe invention also includes amino acid sequence(s) encoded by polynucleotide ⁇ ) that hybridize under stringent conditions, as defined above, to a hybridiza- tion probe that includes at least 30 consecutive nucleotides ofthe phaB gene (i.e., nucleotides 1258-1980 of SEQ ID NO: 177) or a complement thereof, wherein the polypeptide has acetoacetyl-CoA reductase activity as defined above.
  • the polypeptide has the amino acid sequence of SEQ ID NO: 179.
  • isolated means a protein or a polypeptide that has been separated from components that accompany it in its natural state.
  • a monomeric protein is isolated when at least about 60 to 75% of a sample exhibits a single polypeptide sequence.
  • An isolated protein will typically comprise about 60 to 90% W/W of a protein sample, more usually about 95%, and preferably will be over about 99% pure. Protein purity or homogeneity may be indicated by a number of means well known in the art, such as polyacrylamide gel electrophoresis of a protein sample, followed by visualizing a single polypeptide band upon staining the gel. For certain purposes, using HPLC or other means well known in the art may provide higher resolution for purification.
  • biologically active refers to a protein having structural, regulatory, or biochemical functions of a naturally occurring molecule.
  • immunologically active refers to the capability ofthe natural, recombinant, or synthetic polypeptide, or of any oligopeptide thereof, to induce a specific immune response in appropriate animals or cells and to bind with specific antibodies.
  • Another embodiment ofthe invention is an isolated polynucleotide sequence having the nucleotide sequence ofthe mevalonate operon (SEQ ID NO:42), variants of SEQ ID NO:42 containing one or more substitutions according to the Paracoccus sp. strain 1534 codon usage table (see Table 14) or fragments of SEQ ID NO:42.
  • the variants and fragments of SEQ ID NO:42 must encode a polypeptide having an activity selected from: HMG-CoA reductase, isopentenyl diphosphate isomerase activity, hydroxymethylglutaryl- CoA synthase (HMG-CoA synthase), mevalonate kinase, phosphomevalonate kinase, and diphosphomevalonate decarboxylase.
  • HMG-CoA reductase isopentenyl diphosphate isomerase activity
  • HMG-CoA synthase hydroxymethylglutaryl- CoA synthase
  • mevalonate kinase mevalonate kinase
  • phosphomevalonate kinase phosphomevalonate decarboxylase
  • This embodiment also includes polynucleotide sequences that hybridize under stringent conditions, as defined above, to a hybridization probe, the nucleotide sequence of which consists of from about 10 to about 9066 nucleo- tides of SEQ ID NO:42, preferably at least 30 contiguous nucleotides of SEQ ID NO:42, or a complement of such sequences, which polynucleotide encodes a polypeptide having an activity selected from: HMG-CoA reductase, isopentenyl diphosphate isomerase, HMG- CoA synthase, mevalonate kinase, phosphomevalonate kinase, and diphosphomevalonate decarboxylase.
  • This embodiment also includes isolated polynucleotide sequences spanning the following residues of SEQ ID NO:42: 2622 to 3644, 3641 to 4690, 4687 to 5853, 5834 to 6970, 6970 to 7887, 7880 to 8878. Fragments of these sequences are also within the scope ofthe invention, so long as they encode a polypeptide having HMG-CoA reductase activity, isopentenyl diphosphate isomerase activity, HMG-CoA synthase activity, mevalonate kinase activity, phosphomevalonate kinase activity, and diphosphomevalonate decarboxylase activity, respectively.
  • This embodiment also includes polynucleotide sequences that hybridize under stringent conditions, as defined above, to a hybridization probe selected from a nucleotide sequence which consists of at least 30 contiguous nucleotides ofthe following residues of SEQ ID NO:42: 2622 to 3644, 3641 to 4690, 4687 to 5853, 5834 to 6970, 6970 to 7887, 7880 to 8878 or a complement thereof, wherein the polynucleotide encodes a polypeptide having HMG- CoA reductase activity, isopentenyl diphosphate isomerase activity, HMG-CoA synthase activity, mevalonate kinase activity, phosphomevalonate kinase activity, or diphospho- mevalonate decarboxylase activity, respectively.
  • a hybridization probe selected from a nucleotide sequence which consists of at least 30 contiguous nucleotides ofthe following residues of SEQ ID NO
  • the isolated polynucleotide consists of nucleotides 2622 to 3644, 3641 to 4690, 4687 to 5853, 5834 to 6970, 6970 to 7887 or 7880 to 8878 of SEQ ID NO:42.
  • Another embodiment ofthe invention is an isolated polynucleotide sequence having the nucleotide sequence of SEQ ID NO:157, variants of SEQ ID NO:157 containing one or more substitutions according to the Paracoccus sp. strain 1534 codon usage table (see Table 14) or fragments of SEQ ID NO: 157 that encode a polypeptide having FPP synthase activity, 1-deoxy-D-xylulose 5-phosphate synthase activity or the activity of XseB.
  • This embodiment also includes polynucleotide sequences that hybridize under stringent conditions, as defined above, to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides of SEQ ID NO: 157, or the complement of SEQ ID NO: 157, wherein the polynucleotide encodes a polypeptide having FPP synthase activity, 1-deoxy-D-xylulose 5-phosphate synthase activity or the activity of XseB.
  • the isolated polynucleotide consists of nucleotides 59-292, 295-1158 or 1185- 1610 ofSEQ ID NO:157.
  • An isolated polynucleotide sequence is also provided that has a nucleotide sequence selected from the following group: nucleotides spanning positions 59-292 of SEQ ID NO: 157, variants ofthe nucleotide sequence spanning positions of SEQ ID NO: 157 containing one or more substitutions according to the Paracoccus sp.
  • strain R1534 codon usage table (Table 14), fragments ofthe nucleotide sequence spanning positions 59-292 of SEQ ID NO: 157 that encode a polypeptide having a function of XseB, and polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning positions 59-292 of SEQ ID NO: 157, or the complement of such a sequence, wherein the polynucleotide encodes a polypeptide having a function of XseB.
  • the isolated polynucleotide consists of nucleotides 59 to 292 of SEQ ID NO: 157.
  • strain R1534 codon usage table (Table 14), fragments ofthe nucleotide sequence spanning positions 295-1158 of SEQ ID NO:157 that encode a FPP synthase activity, and polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning positions 295-1158 of SEQ ID NO:157, or the complement of such a sequence, wherein the polynucleotide encodes a polypeptide having FPP synthase activity.
  • the isolated nucleotide sequence consists of nucleotides 295-1158 of SEQ ID NO:157.
  • Another embodiment ofthe invention is an isolated polynucleotide sequence having the nucleotide sequence spanning positions 1185-1610 of SEQ ID NO:157, variants ofthe nucleotide sequence spanning positions 1185-1610 of SEQ ID NO:157 containing one or more substitutions according to the Paracoccus sp. strain 1534 codon usage table (see Table 14) or fragments ofthe nucleotide sequence spanning positions 1185-1610 of SEQ ID NO:157 that encode a polypeptide having l-deoxyxylulose-5-phosphate synthase activity.
  • This embodiment also includes polynucleotide sequences that hybridize under stringent conditions, as defined above, to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning positions 1185-1610 of SEQ ID NO: 157, or a complement thereof, wherein the polynucleotide encodes a polypeptide having l-deoxyxylulose-5-phosphate synthase activity.
  • the isolated polynucleotide consists of nucleotides 1185 to 1610 of SEQ ID NO:157.
  • Another embodiment ofthe invention is an isolated polynucleotide sequence having the nucleotide sequence of SEQ ID NO: 177, variants of SEQ ID NO: 177 containing one or more substitutions according to the Paracoccus sp. strain 1534 codon usage table (see Table 14) or fragments of SEQ ID NO:177 that encode a polypeptide having an activity selected from acetyl-CoA acetyltransferase and acetoacetyl-CoA reductase.
  • This embodiment also includes polynucleotide sequences that hybridize under stringent conditions, as defined above, to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides of SEQ ID NO: 177, or a complement thereof, which polynucleotide encodes a polypeptide having an activity selected from the group consisting of acetyl- CoA acetyltransferase and acetoacetyl-CoA reductase.
  • the isolated polynucleotide sequence may include nucleotides 1 to 1170 of SEQ ID NO: 177, variants of SEQ ID NO: 177 containing one or more substitutions according to the Paracoccus sp.
  • strain 1534 codon usage table (see Table 14) or fragments of SEQ ID NO: 177 that encode a polypeptide having acetyl-CoA acetyltransferase activity.
  • This embodiment also includes polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides of nucleotides 1 to 1170 of SEQ ID NO: 177, or a complement thereof, wherein the polynucleotide encodes a polypeptide having acetyl-CoA acetyltransferase activity.
  • the isolated polynucleotide sequence consists of nucleotides 1-1170 of SEQ ID NO:177.
  • the isolated polynucleotide sequence may alternatively be nucleotides 1258-1980 of SEQ ID NO:177, variants of SEQ ID NO:177 containing one or more substitutions according to the Paracoccus sp. strain 1534 codon usage table (see Table 14) or fragments of SEQ ID NO: 177 that encode a polypeptide having acetoacetyl-CoA reductase activity.
  • This embodiment also includes polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides of nucleotides 1258-1980 of SEQ ID NO: 177, or a complement thereof, wherein the polynucleotide encodes a polypeptide having acetoacetyl- CoA reductase activity.
  • the isolated polynucleotide consists of nucleotides 1258-1980 of SEQ ID NO:177.
  • the isolated polynucleotide sequence has a nucleotide sequence selected from SEQ ID NO:42, SEQ ID NO:157, SEQ ID NO:177, and combinations thereof.
  • the phrase "and combinations thereof when used in reference to nucleotide sequences means that any combination ofthe recited sequences may be combined to form the isolated polynucleotide sequence.
  • multiple copies ofthe same sequence i.e., concatamers maybe used.
  • multiple copies of plasmids containing the same polynucleotide sequence may be transferred into suitable host cells.
  • an "isolated" polynucleotide e.g., an RNA, DNA or a mixed polymer
  • an "isolated" polynucleotide is one which is substantially separated from other cellular components which naturally accompany a native sequence or polypeptide, e.g., ribosomes, polymerases, many other genome sequences and proteins.
  • the term embraces a polynucleotide that has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates and chemically synthesized analogs or analogs biologically synthesized by heterologous systems.
  • nucleic acid sequence refers to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. It includes chromosomal DNA, self-replicating plasmids, infectious polymers of DNA or RNA and DNA or RNA that performs a primarily structural role.
  • An "expression control sequence” is defined as an array of nucleic acid control sequences that direct transcription of an operably linked nucleic acid.
  • An example of such an expression control sequence is a “promoter.” Promoters include necessary nucleic acid sequences near the start site of transcription. A promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription.
  • a “constitutive” promoter is a promoter that is active under most environmental and developmental conditions.
  • An “inducible” promoter is a promoter that is active under environmental or developmental regulation.
  • operably linked refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription ofthe nucleic acid corresponding to the second sequence.
  • a nucleic acid expression control sequence such as a promoter or array of transcription factor binding sites
  • a polynucleotide sequence is "heterologous to" an organism or a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified from its original form.
  • a promoter operably linked to a heterologous coding sequence refers to a coding sequence from a species different from that from which the promoter was derived, or, if from the same species, a coding sequence which is different from any naturally occurring allelic variants.
  • polynucleotide sequence need not be identical, but may be only "substantially identical" to a sequence of the gene from which it was derived.
  • the present invention specifically includes those sequences that are substantially identical (determined as described below) to each other and that encode polypeptides that are either mutants of wild type polypeptides or retain the function ofthe polypeptide (e.g., resulting from con- servative substitutions of amino acids in the polypeptide).
  • variants can be those that encode dominant negative mutants as described below.
  • nucleic acid sequences or polypeptides are said to be “identical” if the sequence of nucleotides or amino acid residues, respectively, in the two sequences is the same when aligned for maximum correspondence as described below.
  • the terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence over a comparison window, as measured using one ofthe following sequence comparison algorithms or by manual alignment and visual inspection.
  • sequence identity When percentage of sequence identity is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acids residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties ofthe molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature ofthe substitution. Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity.
  • a conservative substitution is given a score between zero and 1.
  • the scoring of conservative substitutions is calculated according to, e.g., the algorithm of Meyers 8c Miller, Computer Applic. Biol. Sci. 4:11-17 (1988), e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif., USA).
  • substantially identical in the context of two nucleic acids or polypeptides, refers to sequences or subsequences that have at least 60%, preferably 80%, most preferably 90-95%, nucleotide or amino acid residue identity when aligned for maximum correspondence over a comparison window as measured using one ofthe following sequence comparison algorithms or by manual alignment and visual inspection. This definition also refers to a sequence of which the complement of that sequence hybridizes to the test sequence.
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • a “comparison window,” as used herein, includes reference to a segment of any one ofthe number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150, in which a sequence may be compared to a reference sequence ofthe same number of contiguous positions after the two sequences are optimally aligned.
  • Methods of alignment of sequences for com- parison are well known in the art.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol.
  • PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments to show relationship and percent sequence identity. It also plots a tree or dendogram showing the clustering relationships used to create the alignment.
  • PILEUP uses a simplification ofthe progressive alignment method of Feng and Doolittle, J. Mol. Evol. 35:351-360 (1987). The method used is similar to the method described by Higgins and Sharp, CABIOS 5:151-153 (1989).
  • the program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids.
  • the multiple alignment procedure begins with the pairwise alignment ofthe two most similar sequences, producing a cluster of two aligned sequences.
  • This cluster is then aligned to the next most related sequence or cluster of aligned sequences.
  • Two clusters of sequences are aligned by a simple extension ofthe pairwise alignment of two individual sequences.
  • the final alignment is achieved by a series of pro- gressive, pairwise alignments.
  • the program is run by designating specific sequences and their amino acid or nucleotide coordinates for regions of sequence comparison and by designating the program parameters. For example, a reference sequence can be compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps.
  • HSPs high scoring sequence pairs
  • initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
  • the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension ofthe word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed ofthe alignment.
  • the BLAST algorithm also performs a statistical analysis ofthe similarity between two sequences [see, e.g., Karlin and Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)].
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication ofthe probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison ofthe test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
  • Constantly modified variants applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because ofthe degeneracy ofthe genetic code, a large number of functionally identical nucleic acid codons encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any ofthe corresponding codons described without altering the encoded polypeptide.
  • nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein that encodes a polypeptide also describes every possible silent variation ofthe nucleic acid.
  • each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine
  • each silent variation of a nucleic acid that encodes a polypeptide is implicit in each described sequence.
  • amino acid sequences As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, or substitutions to a peptide, polypeptide, or pro- tein sequence which alters a single amino acid or a small percentage of amino acids (i.e. less than 20%, such as 15%, 10%, 5%, 4%, 3%, 2% or 1%) in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art.
  • Isoleucine Isoleucine
  • Leucine L
  • Methionine M
  • Valine V
  • Phenylalanine F
  • Tyrosine Y
  • Tryptophan W
  • nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid.
  • a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
  • Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below.
  • the phrase "specifically hybridizes to” refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent hybridization conditions when that sequence is present in a complex mixture (e.g., total cellular or library DNA or RNA).
  • stringent hybridization conditions refers to conditions under which a probe will hybridize to its target sequence, typically in a complex mixture of nucleic acid sequences, but to no other sequences. Stringent conditions are sequence- dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Probes, “Overview of Principles of Hybridization and the Strategy of Nucleic Acid Assays” (1993). Generally, highly stringent conditions are selected to be about 5-10°C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
  • T m thermal melting point
  • Low stringency conditions are generally selected to be about 15-30°C below the T m .
  • the T m is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% ofthe probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at T m , 50% ofthe probes are occupied at equilibrium).
  • Stringent conditions will be those in which the salt concentration is less than about 1.0M sodium ion, typically about 0.01 to 1.0M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization.
  • nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides that they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions.
  • genomic DNA or cDNA containing nucleic acids ofthe invention can be identified in standard Southern blots under stringent conditions using the nucleic acid sequences disclosed here.
  • suitable stringent conditions for such hybridizations are those which include hybridization in a buffer of 40% formamide, IM NaCl, 1% sodium dodecyl sulfate (SDS) at 37°C, and at least one wash in 0.2X SSC at a temperature of at least about 50°C, usually about 55°C to about 60°C, for 20 minutes, or equivalent conditions.
  • a positive hybridization is at least twice background.
  • alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency.
  • a further indication that two polynucleotides are substantially identical is if the reference sequence, amplified by a pair of oligonucleotide primers, can then be used as a probe under stringent hybridization conditions to isolate the test sequence from a cDNA or genomic library, or to identify the test sequence in, e.g., a northern or Southern blot.
  • the present invention also includes expression vectors as defined above.
  • the expression vectors include one or more copies of each ofthe polynucleotide sequences set forth above.
  • the expression vectors ofthe present invention may contain any ofthe polynucleotide sequences defined herein, such as for example SEQ ID NO:42, or the following residues of SEQ ID NO:42: 2622 to 3644, 3641 to 4690, 4687 to 5853, 5834 to 6970, 6970 to 7887, 7880 to 8878, as well as residues 59-292, 295-1158 or 1185-1610 of SEQ ID NO:157 and residues 1-1170 or 1258-1980 of SEQ ID NO:177.
  • the expression vectors may contain combinations ofthe polynucleotide sequences identified herein, such as for example, SEQ ID NO:42, SEQ ID NO:157, and SEQ ID NO:177.
  • polynucleotide sequences in the expression vectors may optionally be operably linked to an expression control sequence as defined above and exemplified in the Examples.
  • the present invention also includes for example, the following expression vectors: pBBR- K-mev-opl6-l, pBBR-K-mev-opl6-2, pDS-mvaA, pDS-idi, pDS-hcs, pDS-mvk, pDS-pmk, pDS-mvd, pDS-His-mv A, pDS-His-iWz, pDS-His-/ ⁇ cs, pDS-His-mvfc, pDS-His-pra ⁇ :, pDS-His-mvd, pBBR-K-Zea4, pBBR-K-Zea4-up, pBBR-K-Zea4-down, pBBR-K-Pcrt£- crtE-3, pBBR-tK-Pcrt£- v «A, pBBR-tK-P crtE-idi,
  • the present invention also includes any expression vector that contains one ofthe sequences defined herein, which expression vector is used to express an isoprenoid compound, such as a carotenoid, preferably zeaxanthin, in a suitable host cell.
  • an isoprenoid compound such as a carotenoid, preferably zeaxanthin
  • expression vector is a replicatable vehicle that carries, and is capable of mediating the expression of, a DNA sequence encoding the polynucleotide sequences set forth herein.
  • the term "replicatable" means that the vector is able to replicate in a given type of host cell into which it has been introduced.
  • a sequence coding for a signal peptide there may be provided a sequence coding for a signal peptide, the presence of which ensures secretion ofthe encoded polypeptide expressed by host cells harboring the vector.
  • the signal sequence may be the one naturally associated with the selected polynucleotide sequence or of another origin.
  • the vector may be any vector that may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced.
  • the vector may be an autonomously replicating vector, i.e. a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication; examples of such a vector are a plasmid, phage, cosmid or mini- chromosome.
  • the vector may be one which, when introduced in a host cell, is integrated in the host cell genome and is replicated together with the chromosome(s) into which it has been integrated. Examples of suitable vectors are shown in the examples.
  • the expression vector ofthe invention may carry any ofthe DNA sequences ofthe invention as defined below and be used for the expression of any ofthe polypeptides ofthe in- vention defined below.
  • the present invention also includes cultured cells containing one or more ofthe polynucleotide sequences and/ or one or more ofthe expression vectors disclosed herein.
  • a "cultured cell” includes any cell capable of growing under defined conditions and expressing one or more of polypeptides encoded by a polynucleotide ofthe pre- sent invention.
  • the cultured cell is a yeast, fungus, bacterium, or alga. More preferably, the cultured cell is a Paracoccus, Flavobacterium, Agrobacterium, Alcaligenes, Erwinia, E. coli or B. subtilis.
  • the cell is a Paracoccus, such as for example, R-1506, R-1512, R1534 or Rl 14.
  • the present invention also includes the progeny of any ofthe cells identified herein that express a polypeptide disclosed herein.
  • a cell is a progeny of another cell if its AFLP DNA fingerprint is indistinguishable using the conditions set forth in Example 2 from the fingerprint ofthe putative parental cell.
  • the cultured cells according to the present invention may contain, for example, SEQ ID NO:42, or the following residues of SEQ ID NO:42: 2622 to 3644, 3641 to 4690, 4687 to 5853, 5834 to 6970, 6970 to 7887, 7880 to 8878, as well as residues 59-292, 295-1158 or 1185-1610 of SEQ ID NO:157 and residues 1-1170 or 1258-1980 of SEQ ID NO:177. These sequences may be transferred to the cells alone or as part of an expression vector. These sequences also may optionally be operatively linked to expression control sequence(s).
  • the cultured cells may also contain combinations ofthe polynucleotide sequences identified herein, such as for example, SEQ ID NO:42, SEQ ID NO:157, and SEQ ID NO: 177.
  • the cultured cells according to the present invention may further contain polynucleotides that encode one or more enzymes in the carotenoid biosynthetic pathway.
  • the cultured cells according to the present invention may contain one or more copies of SEQ ID NOs:180, 182, and 184 alone or in combination with any ofthe polynucleotide sequences identified herein.
  • the polynucleotide sequences disclosed herein may be transferred into a cultured cell alone or in combination with another polynucleotide sequence that would provide enhanced production ofthe target isoprenoid compound, such as, for example, carotenoids like zeaxanthin or astaxanthin.
  • the present invention includes the use of any polynucleotide encoding, for example, a polypeptide involved in carotenoid biosynthesis, such as GGPP synthase, ⁇ -carotene- ⁇ 4-oxygenase
  • ketolase and/or ⁇ -carotene hydroxylase.
  • combinations of polynucleotides encoding polypeptides involved in carotenoid biosynthesis may be used in combination with one or more ofthe polynucleotides identified herein on the same or different expression vectors.
  • Such constructs may be transferred to a cultured cell according to the present invention to provide a cell that expresses an isoprenoid of interest.
  • a cultured cell according to the present invention may contain one or more ofthe following expression vectors: pBBR-K-mev-opl6-l, pBBR-K-mev-opl6-2, pDS- mvaA, pOS-idi, pDS-hcs, pDS-mvk, pDS-pmk, pOS-mvd, pDS-His-rav A, pDS-His- ⁇ ft, pDS-His-/zc5, pDS-His- vfc, pDS-His-pmfc, pDS-His-m , pBBR-K-Zea4, pBBR-K-Zea4- up, pBBR-K-Zea4-down, pBBR-K-Pcrt£-crt£-3, pBBR-tK-Pcrt£-mv ⁇ A, pBBR-tK-
  • Another embodiment ofthe invention is a method of producing a carotenoid.
  • a cultured cell as defined above is cultured under conditions permitting expression of a polypeptide encoded by the polynucleotide sequence as defined above.
  • Culture conditions that permit expression of a polypeptide are provided in the Examples below, but may be modified, if required, to suit the particular intended use.
  • the carotenoid is then isolated from the cell or, if secreted, from the medium ofthe cell.
  • a "carotenoid” includes the following compounds: phytoene, lycopene, ⁇ -carotene, zeaxanthin, canthaxanthin, astaxanthin, adonixanthin, crypto- xanthin, echinenone, adonirubin, and combinations thereof.
  • the carotenoid is zeaxanthin.
  • Another embodiment ofthe invention is a method of making a carotenoid-producing cell.
  • This method includes (a) introducing into a cell a polynucleotide sequence encoding an enzyme in the mevalonate pathway, which enzyme is expressed in the cell; and (b) select- ing a cell containing the polynucleotide sequence of step (a) that produces a carotenoid at a level that is about 1.1-1,000 times the level ofthe carotenoid produced by the cell before introduction ofthe polynucleotide sequence.
  • an enzyme in the mevalonate pathway means the enzymes involved in the mevalonate pathway for IPP biosynthesis and encoded by the atoB or phaA, hcs, mvaA, mvk, pmk, and mvd genes.
  • an enzyme is "expressed in the cell” if it is detected using any one ofthe activity assays set forth in Example 1.
  • Assays for detecting the production of a carotenoid are well known in the art. Examples 1, 11, and 12 provide typical assay procedures for identifying the presence of zeaxanthin, lycopene, and astaxanthin, respectively.
  • assays for the other carotenoids may be used to detect the presence in the cell or medium of e.g. phytoene, canthaxanthin, adonixanthin, cryptoxanthin, echinenone, and adonirubin.
  • this method may be used to make the following exemplary carotenoids: phytoene, lycopene, ⁇ -carotene, zeaxanthin, canthaxanthin, astaxanthin, adonixanthin, cryptoxanthin, echinenone, adonirubin, and combinations thereof.
  • zeaxanthin is the preferred carotenoid.
  • This method includes producing cells capable of producing a carotenoid at a level that is about 1.1-1,000 times, preferably about 1.5-500 times, such as about 100 times or at least 10 times, the level ofthe carotenoid produced by the cell before introduction ofthe polynucleotide sequence.
  • the cell produces from about 1 mg/L to about 10 g/L of a carotenoid. It is preferred that the cell produces from about 100 mg/L to about 9 g/L, such as, for example, from about 500mg/L to about 8 g/L, or from about 1 g/L to about 5 g/L, of a carotenoid.
  • the cell may be selected from a yeast, fungus, bacterium, and alga.
  • the cell is a bacterium selected from Paracoccus, Flavobacterium, Agrobacterium, Alcaligenes, Erwinia, E. coli, and B. subtilis. More preferably, the bacterium is a Paracoccus.
  • the cell may be a mutant cell.
  • a "mutant cell” is any cell that contains a non-native polynucleotide sequence or a polynucleotide sequence that has been altered from its native form (e.g., by rearrangement or deletion or substitution of from 1-100, preferably 20-50, more preferably less than 10 nucleotides).
  • Such a non- native sequence may be obtained by random mutagenesis, chemical mutagenesis, UV-ir- radiation, and the like.
  • the mutation results in the increased expression of one or more genes in the mevalonate pathway that results in an increase in the production of a carotenoid, such as zeaxanthin.
  • Methods for generating, screening for, and identifying such mutant cells are well known in the art and are exemplified in the Examples below. Examples of such mutants are Rl 14 or R1534.
  • the mutant cell is Rl 14.
  • the polynucleotide sequence is SEQ ID NO:42, or the following residues of SEQ ID NO:42: 2622 to 3644, 3641 to 4690, 4687 to 5853, 5834 to 6970, 6970 to 7887, 7880 to 8878, as well as residues 59-292, 295-1158 or 1185-1610 of SEQ ID NO: 157 and residues 1-1170 or 1258-1980 of SEQ ID NO:177.
  • sequences maybe used in this method alone or as part of an expression vector.
  • sequences also may optionally be operatively linked to expression control sequence(s).
  • combinations ofthe polynucleotide sequences identified herein may be used, such as for example, SEQ ID NO:42, SEQ ID NO:157, and SEQ ID NO:177.
  • expression vector examples include pBBR- K-mev-opl6-l, pBBR-K-mev-opl6-2, pDS-mv , pDS-idi, pDS-hcs, pDS-mvk, pDS-pmk, pDS-mvd, pDS-His- v ⁇ A, pDS- is-idi, pDS-His-hcs, pDS-His-mvfc, pDS-His-pmfc, pDS-His-mvd, pBBR-K-Zea4, pBBR-K-Zea4-up, pBBR-K-Zea4-down, pBBR-K-Pot£- crtE-3, pBBR-tK-Pc/t£-mv ⁇ A, pBBR-tK-Pcrt£- ⁇ ' d ⁇
  • the polynucleotide sequence is introduced into the cell using any conventional means.
  • suitable methods for introducing a polynucleotide sequence into a cell include transformation, transduction, transfection, lipofection, electroporation [see e.g., Shigekawa and Dower, Biotechniques 6:742-751 (1988)], conjugation [see e.g., Koehler and Thorne, Journal of Bacteriology 169:5771-5278 (1987)], and biolistics.
  • conjugation to transfer a polynucleotide sequence, such as in the form of an expression vector, into recipient bacteria is generally effective, and is a well-known procedure, (e.g. US 5,985,623). Depending on the strain of bacteria, it may be more common to use transformation of competent cells with purified DNA.
  • Electroporation techniques function by applying a brief high voltage pulse to electrodes positioned around the treatment region, (e.g. US 6,208,893).
  • the electric field generated between the electrodes causes the cell membranes to temporarily become porous, whereupon molecules ofthe implant agent enter the cells.
  • this electric field comprises a single square wave pulse on the order of 1000 V/cm of about 100 ⁇ s duration.
  • Such a pulse may be generated, for example, in known applications ofthe Electro Square Porator T820, made by the BTX Division of Genetronics, Inc.
  • Biolistics is a system for delivering polynucleotides into a target cell using microprojectile bombardment techniques.
  • An illustrative embodiment of a method for delivering poly- nucleotides into target cells by acceleration is a Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with cultured target cells. The screen disperses the particles so that they are not delivered to the target cells in large aggregates. It is believed that a screen intervening between the projectile apparatus and the cells to be bombarded reduces the size of projectiles aggregate and may contribute to a higher frequency of transformation by reducing damage inflicted on the recipient cells by projectiles that are too large.
  • cells in suspension are preferably concentrated on filters or solid culture medium.
  • other target cells may be arranged on solid culture medium.
  • the cells to be bombarded are positioned at an appropriate distance below the microprojectile stopping plate.
  • one or more screens are also positioned between the acceleration device and the cells to be bombarded.
  • bombardment transformation one may optimize the prebombardment culturing conditions and the bombardment parameters to yield the maximum numbers of stable trans- formants.
  • Both the physical and biological parameters for bombardment are important in this technology. Physical factors are those that involve manipulating the polynucleotide/- microprojectile precipitate or those that affect the flight and velocity of either the macro- or microprojectiles.
  • Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature ofthe transforming DNA, such as linearized DNA or intact supercoiled plasmids.
  • TRFs trauma reduction factors
  • Another embodiment ofthe invention is a method for engineering a bacterium to produce an isoprenoid compound.
  • a bacterium is made by (a) culturing a parent bacterium in a medium under conditions permitting expression of an isoprenoid, and selecting a mutant bacterium from the culture medium that produces about 1.1-1,000 times more of an isoprenoid than the parent bacteria; (b) introducing into the mutant bacterium an expression vector containing a polynucleotide sequence represented by SEQ ID NO:42 operably linked to an expression control sequence; and (c) selecting a bacterium that con- tains the expression vector and produces at least about 1.1 times more of an isoprenoid than the mutant in step (a).
  • an isoprenoid compound means a compound structurally based on isopentenyl diphosphate (IPP) units ofthe formula:
  • Such compounds include the hemiterpenes, monoterpenes, sesquiterpenes, diterpenes, triterpenes (e.g., phytosterols, phytoestrogens, phytoecdysones, estrogens, phytoestrogens), tetraterpenes (carotenoids), and polyterpenes.
  • the isoprenoid is a carotenoid, such as for example, one ofthe carotenoids identified above, in particular zeaxanthin.
  • the bacterium may be any bacterium that is capable of producing an isoprenoid compound using the processes disclosed herein.
  • the bacterium is a Paracoccus, Flavobacterium, Agrobacterium, Alcaligenes, Erwinia, E. coli, or B. subtilis. Even more preferably, the bacterium is a Paracoccus.
  • the parent bacterium is R-1506 or R 1512
  • the mutant bacterium is R1534 or R114, preferably R114.
  • the bacterium is cultured in a media and under conditions that are optimized for the production ofthe isoprenoid.
  • the selection of media and culture conditions are well within the skill ofthe art.
  • the assays set forth in Examples 1, 11, and 12 provide exemplary methods for measuring the presence of certain carotenoids in a culture media. By optimizing the culture conditions and measuring for the production ofthe target isoprenoid, the culturing and selection of a mutant that meets the specific production parameters recited herein may be met. In this way, a mutant bacterium producing from about 1.1-1 ,000 times more of an isoprenoid than the parent bacterium may be selected.
  • the mutant bacterium produces from about 1.5-500 times more of an isoprenoid than the parent bacterium, such as for example, at least about 100 times or at least about 10 times more of an isoprenoid than the parent bacterium. That bacterium is then cultured and used in subsequent steps.
  • an expression vector is introduced into the bacterium using any ofthe methods set forth above or described in the examples. Any ofthe expression vectors defined herein may be introduced into the mutant cell.
  • the expression vector contains SEQ ID NO:42.
  • a stable transformant is selected that produces at least about 1.1 times, such as about 5 to about 20 times, more of an isoprenoid than the untransformed mutant.
  • the selected transformant is then cultured under conditions suitable for isoprenoid production, and then the isoprenoid is isolated from the cell or the culture medium.
  • a further step in this method is introducing a mutation into the mutant bacterium that results in the increased production of an isoprenoid compound by the bacterium.
  • the mutation may be selected from at least one ofthe following: inactivating the poly- hydroxyalkanoate (PHA) pathway, increasing expression of acetyl-CoA acetyltransferase, increasing expression of FPP synthase, increasing expression of an enzyme in a carotenoid biosynthetic pathway, and increasing the expression of an enzyme for converting isopentenyl diphosphate (IPP) to dimethylallyl diphosphate (DMAPP).
  • PHA poly- hydroxyalkanoate
  • IPP isopentenyl diphosphate
  • DMAPP dimethylallyl diphosphate
  • the inactivating ofthe PHA pathway may be achieved by selecting for a mutant bacterium that does not express a polypeptide encoded by phaB (nucleotide positions 1258-1980 of SEQ ID NO:177) or by disrupting expression ofthe wild type phaB gene by homologous recombination using SEQ ID NO: 177 or fragments thereof.
  • increasing expression of acetyl-CoA acetyltransferase maybe achieved by introducing into the mutant bacterium a vector containing a polynucleotide sequence represented by SEQ ID NO: 175 or nucleotide positions 1-1170 of SEQ ID NO: 177 operably linked to an expression control sequence.
  • increasing expression of FPP synthase may be achieved by introducing into the mutant bacterium a vector containing a polynucleotide sequence represented by nucleotides 295-1158 of SEQ ID NO: 157 operably linked to an expression control sequence.
  • increasing expression of a carotenoid gene may be achieved by introducing into the mutant bacterium a vector com- prising a polynucleotide sequence that encodes one or more enzymes in the carotenoid biosynthetic pathway, such as for example a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 180, 182, and 184 operably linked to an expression control sequence.
  • the isoprenoid compound is isopentenyl diphosphate (IPP). It is also preferred that the isoprenoid compound is a carotenoid, such as for example, phytoene, lycopene, ⁇ -carotene, zeaxanthin, canthaxanthin, astaxanthin, adonixanthin, cryptoxanthin, echinenone, adonirubin, and combinations thereof.
  • IPP isopentenyl diphosphate
  • a carotenoid such as for example, phytoene, lycopene, ⁇ -carotene, zeaxanthin, canthaxanthin, astaxanthin, adonixanthin, cryptoxanthin, echinenone, adonirubin, and combinations thereof.
  • Another embodiment ofthe invention is a microorganism ofthe genus Paracoccus, which microorganism has the following characteristics: (a) a sequence similiarity to SEQ ID NO: 12 of >97% using a similarity matrix obtained from a homology calculation using GeneCompar v.
  • Example 2 Methods for determining each of these characteristics are fully set forth in Example 2, and it is contemplated when these methods are used that microorganisms meeting the above criteria will be readily identifiable. It is preferred that a microorganism ofthe present invention have each characteristic set forth above (i.e., a-d). However, any combination of the characteristics a-d, which provides sufficient information to taxonomically validly describe a microorganism belonging to the same species as R114, R-1512, R1534, and R- 1506, with the exception of Paracoccus sp. (MBIC3966) is also within the scope ofthe invention.
  • a-d any combination of the characteristics a-d, which provides sufficient information to taxonomically validly describe a microorganism belonging to the same species as R114, R-1512, R1534, and R- 1506, with the exception of Paracoccus sp. (MBIC3966) is also within the scope ofthe invention.
  • Another embodiment ofthe invention is a microorganism ofthe genus Paracoccus, which microorganism has the following characteristics: (a) 18:lw7c comprising at least about 75% ofthe total fatty acids ofthe cell membranes; (b) an inability to use adonitol, i-ery- thritol, gentiobiose, ⁇ -methylglucoside, D-sorbitol, xylitol and quinic acid as carbon sources for growth; and (c) an ability to use L-asparagine and L-aspartic acid as carbon sources for growth, with the proviso that the microorganism is not Paracoccus sp. (MBIC3966).
  • Example 2 Methods for determining each of these characteristics are also fully set forth in Example 2, and it is contemplated when these methods are used that microorganisms meeting the above criteria will be readily identifiable. It is preferred that a microorganism ofthe present invention have each characteristic set forth above (i.e., a-c). However, any combina- tion ofthe characteristics a-c, which provides sufficient information to taxonomically validly describe a microorganism belonging to the same species as Rl 14, R-1512, R1534, and R-1506, with the exception of Paracoccus sp. (MBIC3966) is also within the scope of the invention.
  • a-c any combina- tion ofthe characteristics a-c, which provides sufficient information to taxonomically validly describe a microorganism belonging to the same species as Rl 14, R-1512, R1534, and R-1506, with the exception of Paracoccus sp. (MBIC3966) is also within the scope of the invention.
  • Another embodiment ofthe invention is a microorganism ofthe genus Paracoccus, which microorganism has the following characteristics: (a) an ability to grow at 40°C; (b) an ability to grow in a medium having 8% NaCl; (c) an ability to grow in a medium having a pH of 9.1; and (d) a yellow-orange colony pigmentation, with the proviso that the microorganism is not Paracoccus sp. (MBIC3966).
  • Example 2 Methods for determining each of these characteristics are also fully set forth in Example 2, and it is contemplated when these methods are used that microorganisms meeting the above criteria will be readily identifiable. It is preferred that a microorganism ofthe present invention have each characteristic set forth above (i.e., a-d). However, any combination ofthe characteristics a-d, which provides sufficient information to taxonomically validly describe a microorganism belonging to the same species as R114, R-1512, R1534, and R-1506, with the exception of Paracoccus sp. (MBIC3966) is also within the scope of the invention.
  • a-d any combination ofthe characteristics a-d, which provides sufficient information to taxonomically validly describe a microorganism belonging to the same species as R114, R-1512, R1534, and R-1506, with the exception of Paracoccus sp. (MBIC3966) is also within the scope of the invention.
  • a microorganism ofthe present invention may also be identified using any combination of the 11 characteristics set forth above, which provide sufficient information to taxonomi- cally validly describe a microorganism belonging to the same species as Rl 14, R-1512, R1534, and R-1506, with the exception of Paracoccus sp. (MBIC3966).
  • an isolated polypeptide comprising an amino acid sequence selected from the group consisting of: (a) an amino acid sequence shown as residues 1 to 340 of SEQ ID NO:43, in particular an amino acid sequence corresponding to positions 68-97 of SEQ ID NO:43;
  • polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a hybridization probe comprising at least 30 consecutive nucleotides of SEQ ID NO:42 or a complement of SEQ ID NO:42, wherein the polypeptide has the activity of HMG-CoA reductase, isopentenyl diphosphate isomerase, HMG-CoA synthase, mevalonate kinase, phosphomevalonate kinase, or diphosphomevalonate decarboxylase; and
  • an amino acid sequence of a fragment of SEQ ID NO: 159 the fragment having the activity of farnesyl diphosphate synthase (FPP synthase);
  • an isolated polypeptide comprising an amino acid sequence selected from the group consisting of:
  • an isolated polynucleotide sequence comprising a polynucleotide sequence selected from the group consisting of nucleotides 2622 to 3644 of SEQ ID NO:42, fragments thereof that encode a polypeptide having HMG-CoA reductase activity, and poly- nucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning residues 2622 to 3644 of SEQ ID NO:42, or a complement thereof, wherein the polynucleotide encodes a polypeptide having HMG-CoA reductase activity, more particularly a polynucleotide sequence consisting of nucleotides 2622 to 3644 of SEQ ID NO:42;
  • strain R1534 codon usage table (Table 14), fragments of SEQ ID NO:42 that encode a polypeptide having isopentenyl diphosphate isomerase activity, and polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning residues 3641 to 4690 of SEQ ID NO:42, or a complement thereof, wherein the polynucleotide encodes a polypeptide having isopentenyl diphosphate isomerase activity, more particularly a polynucleotide sequence consisting of nucleotides 3641 to 4690 of SEQ ID NO:42.
  • an isolated polynucleotide sequence comprising a polynucleotide sequence selected from the group consisting of nucleotides 4687 to 5853 of SEQ ID NO:42, variants thereof containing one or more substitutions according to the Paracoccus sp.
  • strain R1534 codon usage table (Table 14), fragments of SEQ ID NO:42 that encode a polypeptide having HMG-CoA synthase activity, and polynucleotide sequences that hybri- dize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning residues 4687 to 5853 of SEQ ID NO:42, or a complement thereof, wherein the polynucleotide encodes a polypeptide having HMG-CoA synthase activity, more particularly a polynucleotide sequence consisting of nucleotides 3641 to 4690 of SEQ ID NO:42; (d) an isolated polynucleotide sequence comprising a polynucleotide sequence selected from the group consisting of nucleotides 5834 to 6970 of SEQ ID NO:42, variants thereof containing one or more substitutions according to the Paracoccus sp.
  • strain R1534 codon usage table (Table 14), fragments of SEQ ID NO:42 that encode a polypeptide having mevalonate kinase activity, and polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning residues 5834 to 6970 of SEQ ID NO:42, or a complement thereof, wherein the polynucleotide encodes a polypeptide having mevalonate kinase activity, more particularly a polynucleotide sequence consisting of nucleotides 3641 to 4690 of SEQ ID NO:42; (e) an isolated polynucleotide sequence comprising a polynucleotide sequence selected from the group consisting of nucleotides 6970 to 7887 of SEQ ID NO:42, variants thereof containing one or more substitutions according to the Paracoccus sp.
  • strain R1534 codon usage table (Table 14), fragments of SEQ ID NO:42 that encode a polypeptide having phosphomevalonate kinase activity, and polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning residues 6970 to 7887 of SEQ ID NO:42, or a complement thereof, wherein the polynucleotide encodes a polypeptide having phosphomevalonate kinase activity, more particularly a polynucleotide sequence consisting of nucleotides 3641 to 4690 of SEQ ID NO:42; or (f) an isolated polynucleotide sequence comprising a polynucleotide sequence selected from the group consisting of nucleotides 7880 to 8878 of SEQ ID NO:42, variants thereof containing one or more substitutions according to the Paracoccus sp. strain
  • R1534 codon usage table (Table 14), fragments of SEQ ID NO:42 that encode a polypeptide having diphosphomevalonate decarboxylase activity, and polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning residues 7880 to 8878 of SEQ ID NO:42, or a complement thereof, wherein the polynucleotide encodes a polypeptide having diphosphomevalonate decarboxylase activity, more particularly an isolated polynucleotide consisting of nucleotides 7880 to 8878 of SEQ ID NO:42, more particularly a polynucleotide sequence consisting of nucleotides 3641 to 4690 of SEQ ID NO:42; (7) an isolated polynucleotide sequence comprising a polynucleotide sequence selected from the group consisting ofthe nucleotide sequence of SEQ ID NO:
  • strain R1534 codon usage table (Table 14), fragments of SEQ ID NO:157 that encode a polypeptide having farnesyl diphosphate (FPP) synthase activity, 1-deoxy-D- xylulose 5-phosphate synthase activity or a polypeptide having the activity of XseB, and polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides of SEQ ID NO:157, or the complement of SEQ ID NO:157, which polynucleotide encodes a polypeptide having an activity selected from the group consisting of FPP synthase activity, 1-deoxy-D-xylulose 5-phosphate synthase activity, and the activity of XseB, in particular
  • strain R1534 codon usage table (Table 14), fragments ofthe nucleotide sequence spanning positions 59-292 of SEQ ID NO: 157 that encode a polypeptide having the function of XseB, and polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning positions 59-292 of SEQ ID NO: 157, or the complement of such a sequence, wherein the polynucleotide encodes a polypeptide having the function of XseB, more particularly an isolated polynucleotide consisting of nucleotides 59 to 292 of SEQ ID NO: 157; (b) an isolated polynucleotide sequence comprising a polynucleotide sequence selected from the group consisting ofthe nucleotide sequence spanning positions 295- 1158 of SEQ ID NO: 157, variants ofthe nucleotide sequence spanning positions
  • strain R1534 codon usage table (Table 14), fragments ofthe nucleotide sequence spanning positions 295-1158 of SEQ ID NO:157 that encode a FPP synthase activity, and polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning positions 295-1158 of SEQ ID NO: 157, or the complement of such a sequence, wherein the polynucleotide encodes a polypeptide having FPP synthase activity, more particularly an isolated polynucleotide consisting of nucleotides 295 to 1158 of SEQ ID NO: 157;
  • an isolated polynucleotide sequence comprising a polynucleotide sequence selected from the group consisting ofthe nucleotide sequence spanning positions 1185-1610 of SEQ ID NO:157, variants ofthe nucleotide sequence spanning positions 1185-1610 of
  • SEQ ID NO:157 containing one or more substitutions according to the Paracoccus sp. strain R1534 codon usage table (Table 14), fragments ofthe nucleotide sequence spanning positions 1185-1610 of SEQ ID NO: 157 that encode a polypeptide having 1-deoxyxylulose- 5 -phosphate synthase activity, and polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning positions 1185-1610 of SEQ ID NO: 157, or the complement of such a sequence, wherein the polynucleotide encodes a polypeptide having l-deoxyxylulose-5-phosphate synthase activity, more particularly an isolated polynucleotide consisting of nucleotides 1185 to 1610 of SEQ ID NO: 157;
  • an isolated polynucleotide sequence comprising a polynucleotide sequence selected from the group consisting ofthe nucleotide sequence of SEQ ID NO:177, variants of SEQ ID NO: 177 containing one or more substitutions according to the Paracoccus sp.
  • strain R1534 codon usage table (Table 14), fragments of SEQ ID NO:177 that encode a polypeptide having an activity selected from the group consisting of acetyl-CoA acetyltransferase and acetoacetyl-CoA reductase, and polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides of SEQ ID NO:177, or the complement of SEQ ID NO: 177, which polynucleotide encodes a polypeptide having an activity selected from the group consisting of acetyl-CoA acetyltransferase and acetoacetyl-CoA reductase, in particular (a) an isolated polynucleotide sequence comprising a polynucleotide sequence selected from the group consisting of nucleotides 1 to 1170 of SEQ ID NO:177, variants of S
  • strain R1534 codon usage table (Table 14), fragments of SEQ ID NO:177 that encode a polypeptide having acetyl-CoA acetyltransferase activity, and polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning residues 1 to 1170 of SEQ ID NO: 177, or a complement thereof, wherein the polynucleotide encodes a polypeptide having acetyl-CoA acetyltransferase activity, more particularly an isolated polynucleotide sequence consisting of nucleotides 1-
  • polynucleotide sequences that hybridize under stringent conditions to a hybridization probe the nucleotide sequence of which consists of at least 30 contiguous nucleotides spanning residues 1258-1980 of SEQ ID NO: 177, or a complement thereof, wherein the polynucleotide encodes a polypeptide having acetoacetyl-CoA reductase activity, more particularly an isolated polynucleotide sequence consisting of nucleotides 1258- 1980 of SEQ ID NO:177;
  • an isolated polynucleotide sequence comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:42, SEQ ID NO: 157, SEQ ID NO: 177, and combinations thereof;
  • an expression vector comprising the polynucleotide sequence of any one of (6) (a) to (6) (f), (7) (a) to (7) (c), (8) (a), (8) (b) or (9), in particular an expression vector wherein the polynucleotide sequence is operably linked to an expression control sequence, e.g. an expression vector further comprising a polynucleotide sequence that encodes an enzyme in the carotenoid biosynthetic pathway, more particularly an expression vector wherein the polynucleotide sequence is selected from the group consisting of SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO:184, and combinations thereof which are operably linked to an expression control sequence;
  • (11) an expression vector selected from the group consisting of pBBR-K-mev-opl6-l, pBBR-K-mev-opl6-2, pDS-mv ⁇ A, pOS-idi, pDS-hcs, pDS- vA:, pOS-pmk, pDS-mvd, pDS-His- v A, pDS-His- ⁇ fr, pDS-His- ⁇ cs, pDS-His- v , pDS-His-p /c, pDS-His- mvd, pBBR-K-Zea4, pBBR-K-Zea4-up, pBBR-K-Zea4-down, pBBR-K-P crtE-crtE-3, pBBR-tK-Pcrt£- v ⁇ A, pBBR-tK-Pcrt£-/ ⁇
  • the cell expresses a polypeptide encoded by the polynucleotide sequence, in particular a cell which is further characterized by a feature selected from (a) further comprising a polynucleotide sequence that encodes an enzyme in the carotenoid biosynthetic pathway, more particularly a cultured cell wherein the polynucleotide sequence that encodes an enzyme in the carotenoid biosynthetic pathway is selected from the group consisting of SEQ ID NOs: 180, 182, and 184, or a progeny of the cell, wherein the cell expresses polypeptides encoded by the polynucleotide sequences, and
  • a method of producing a carotenoid comprising culturing a cell of (12) under conditions permitting expression of a polypeptide encoded by the polynucleotide sequence, and isolating the carotenoid from the cell or the medium ofthe cell;
  • a method of making a carotenoid-producing cell comprising: (a) introducing into a cell a polynucleotide sequence encoding an enzyme in the mevalonate pathway, which enzyme is expressed in the cell; and (b) selecting a cell containing the polynucleotide sequence of step (a) that produces a carotenoid at a level that is about 1.1-1,000 times the level ofthe carotenoid produced by the cell before introduction ofthe polynucleotide sequence, in particular a method selected from a method characterized by a feature selected from
  • the selecting step comprising selecting a cell containing the polynucleotide sequence of step (a) that produces a carotenoid at a level that is about 1.5-500 times, particularly about 100 times, or at least about 10 times, the level ofthe carotenoid produced by the cell before introduction ofthe polynucleotide sequence; (ii) the cell producing from about 1 mg/L to about 10 g/L of a carotenoid.
  • the cell being selected from the group consisting of a yeast, fungus, bacterium, and alga, in particular selected from the group consisting of Paracoccus, Flavobacteri- um, Agrobacterium, Alcaligenes, Erwinia, E. coli, and B.
  • subtilis more particularly from Paracoccus
  • the cell in step (a) being a mutant cell, in particular being selected from the group consisting of R114 and R1534, in particular the mutant cell producing about 1.1-1,000 times, in particular about 1.5-500 times, more particularly at least about 100 times more or at least about 10 times more, the level of a carotenoid compared to its non- mutant parent
  • the polynucleotide sequence being selected from polynucleotide sequences of (6)
  • polynucleotide sequence is operably linked to an expression control sequence;
  • the polynucleotide sequence being an expression vector of (10) or (11);
  • the introducing step being selected from the group consisting of transformation, transduction, transfection, lipofection, electroporation, conjugation, and biolistics.
  • the carotenoid being selected from the group consisting of phytoene, lycopene, ⁇ -carotene, zeaxanthin, canthaxanthin, astaxanthin, adonixanthin, cryptoxanthin, echinenone, adonirubin, and combinations thereof, in particular the carotenoid being zeaxanthin;
  • a method for engineering a bacterium to produce an isoprenoid compound comprising:
  • step (c) selecting a bacterium that contains the expression vector and produces at least about 1.1 times more of an isoprenoid compound than the mutant in step (a), in particular
  • a method further comprising introducing a mutation into the mutant bacterium more particularly a method wherein the mutation causes an effect selected from at least one ofthe following: inactivating the polyhydroxyalkanoate (PHA) pathway, in- creasing expression of acetyl-CoA acetyltransferase, increasing expression of farnesyl diphosphate (FPP) synthase, increasing expression of an enzyme in a carotenoid pathway, increasing the expression of an enzyme for converting isopentenyl diphosphate (IPP) to dimethylallyl diphosphate (DMAPP), most particularly a method wherein inactivating ofthe PHA pathway comprises selecting for a mutant bacterium that does not express a polypeptide encoded h ⁇ phaB
  • the isoprenoid is a carotenoid, in particular a method wherein the carotenoid is selected from the group consisting of phytoene, lycopene, ⁇ -carotene, zeaxanthin, canthaxanthin, astaxanthin, adonixanthin, cryptoxanthin, echinen- one, adonirubin, and combinations thereof;
  • the parent bacterium is a Paracoccus, in particular R-1512 or R- 1506, or R1534 or R114, in particular wherein the mutant is Rl 14; (16) a microorganism ofthe genus Paracoccus, which microorganism has the following characteristics: (i) a sequence similiarity to SEQ ID NO: 12 of >97% using a similarity matrix obtained from a homology calculation using GeneCompar v.
  • HPLC HPLC.
  • a reversed phase HPLC method was developed for the simultaneous determination of astaxanthin, zeaxanthin, canthaxanthin, ⁇ -carotene, and lycopene. The method was also able to separate the main ⁇ s-isomers of zeaxanthin.
  • Chromatography was per- formed using an Agilent 1100 HPLC system equipped with a thermostatted autosampler and a diode array detector. The method parameters were as follows: Column: YMC Carotenoid C30 column, particle size 5 micron
  • Run time 28 min; Typical column pressure: 90 bar at start; Flow rate: 1.0 ml/min.; Detection: UV at 450 nm; Injection volume: 10 ⁇ l; Column temperature: 15°C
  • Methanol and TBME were HPLC grade and were obtained from EM Science and J.T. Baker, respectively.
  • DMSO (Omnisolve) was purchased from EM Science.
  • Limit of detection The lower limit of detection for zeaxanthin by this method was determined to be 60 ⁇ g/1. A higher injection volume and optimization ofthe integration para- meters made it possible to lower the detection limit to approximately 5 ⁇ g/1 .
  • Crude extracts of Paracoccus and £. coli were prepared by resuspending washed cell pellets in 1 ml of extraction buffer (buffer used depended on the enzyme being assayed - compositions are specified along with each enzyme assay procedure described below).
  • Cell suspensions were placed in a 2-ml plastic vial and disrupted by agitation with glass beads using a Mini Bead Beater 8 (Biospec Products, Bartlesville, OK, USA). Disruption was performed at 4°C using a medium agitation setting. The disrupted preparations were centrifuged at 21,000 x g for 20 minutes at 4°C to sediment the cell debris, and the supernatants were used directly for enzyme assays.
  • Protein determinations Protein concentrations in crude extracts were determined by the method of Bradford [Anal. Biochem. 72:248-254 (1976)] using the Bio-Rad Protein Assay Reagent (Bio-Rad, Hercules, CA, USA). Bovine serum albumin was used as the reference protein for construction of standard curves.
  • Acetyl-CoA acetyltransferase assays Crude extracts were prepared in 150 mM EPPS (N-[2-hydroxyethyl] piperizine-N'-[3-propanesulfonic acid] ) buffer, pH 8.0. Assays were performed in the thiolysis direction according to the method described by Slater et al. [J. Bacteriol. 180:1979-1987 (1998)]. This assay measures the disappearance of acetoacetyl- CoA spectrophotometrically at 304 nm.
  • Reaction mixtures contained 150 mM EPPS buffer (pH 8.0), 50 mM MgCl 2 , 100 ⁇ M CoA, 40 ⁇ M acetoacetyl-CoA and crude extract. Reactions were carried out at 30°C and were initiated by addition of crude extract. The disappearance of acetoacetyl-CoA at 304 nm was monitored using a SpectraMAX Plus plate reader (Molecular Devices Corp., Sunnyvale, CA, USA) and a quartz microtiter plate (any standard spectrophotometer can also be used).
  • Reaction mixtures contained 50 mM Tris-HCl buffer (pH 8.0), 0.1 mM EDTA, 20 mM MgCl 2 , 0.1 mM acetoacetyl-CoA, 0.8 mM acetyl-CoA and crude extract. Reactions were pre-incubated for 2 minutes at 30°C before adding the crude extract. After 5 minutes of reaction at 30°C, the reactions were stopped by adding 0.2 ml of 200 mM tetra-butyl ammonium phosphate (TBAP, dissolved in methanol-water (3:2, final pH was 5.5) and containing 0.2 mM propionyl-CoA as an internal recovery standard).
  • TBAP mM tetra-butyl ammonium phosphate
  • HMG-CoA and propionyl-CoA were separated from acetyl-CoA and acetoacetyl-CoA using a Nova-Pak C18 column (3.9 x 150 mm, Waters Corporation, Milford, MA, USA).
  • the injection volume was 20 ⁇ l
  • the mobile phase was 50 mM TBAP dissolved in methanol-water (1:1, final pH was 5.5), and the flow rate was 1.0 ml/min.
  • HMG-CoA and propionyl-CoA were detected by absorbance at 254 nm.
  • HMG-CoA reductase assays Crude extracts were prepared in 25 mM potassium phosphate buffer (pH 7.2) containing 50 mM KC1, 1 mM EDTA and a protease inhibitor cocktail (Sigma Chemical Co., St. Louis, MO, USA, catalog #P-2714). Assays were performed according to the method of Takahashi et al. [J. Bacteriol.
  • This assay measures the HMG-CoA dependent oxidation of NADPH spectrophotometrically at 340nm.
  • Reaction mixtures contained 25 mM potassium phosphate buffer (pH 7.2), 50 mM KC1, 1 mM EDTA, 5 mM dithiofhreitol, 0.3 mM NADPH, 0.3 mM i?,S-HMG-CoA and crude extract. Reactions were performed at 30°C and were initiated by the addition of HMG-CoA.
  • IPP isomerase assays Crude extracts were prepared in 50 mM Tris-HCl buffer (pH 7.5). Assays were performed using the method of Spurgeon et al. [Arch. Biochem. Biophys. 230:445-454 ( 1984)] . This assay is based on the difference in acid-lability of IPP and DMAPP. Reaction mixtures (0.1 ml final volume) contained 50 mM Tris-HCl buffer (pH 7.5), 2 mM dithiothreitol, 5 mM MgCl 2 , 20 ⁇ M [1- 14 C]-IPP and crude extract.
  • the lower limit of detection of IPP isomerase activity was 1 U/mg.
  • FPP synthase assays Crude extracts were prepared in 50 mM Tris-HCl buffer (pH 8.0). The FPP synthase assay procedure was similar to the IPP isomerase assay described above, being based on the difference in acid lability of IPP and FPP (Spurgeon et al., supra). Reaction mixtures (0.1 ml final volume) contained 50 mM Tris-HCl buffer (pH 8.0), 2 mM dithiothreitol, 5 mM MgCl 2 , 20 ⁇ M [1- 14 C]-IPP, 25 ⁇ M GPP (geranyl pyrophosphate) and crude extract.
  • Reaction mixtures (0.1 ml final volume) contained 50 mM Tris-HCl buffer (pH 8.0), 2 mM dithiothreitol, 5 mM MgCl 2 , 20 ⁇ M [ 1- 14 C] -IPP, 25 ⁇ M FPP and crude extract. All reaction conditions and subsequent treatment of samples for scintillation counting were identical to those described above for FPP synthase. Treatment of extract with iodoacetamide to inhibit IPP isomerase activity may also be used as above. Units of enzyme activity, and the lower limit of detection, were the same as defined above for IPP isomerase.
  • Acetoacetyl-CoA reductase assays Crude extracts are prepared in 50 mM Tris-HCl buffer (pH 7.5) containing 50 mM KC1 and 5 mM dithiothreitol. Acetoacetyl-CoA reductase was assayed according to the procedure of Chohan and Copeland [Appl. Environ. Microbiol. 64:2859-2863 (1998)]. This assay measures the acetoacetyl-CoA-dependent oxidation of NADPH spectrophotometrically at 340 nm.
  • Example 2 Taxonomic Reclassification of Flavobacterium sp. as Paracoccus
  • This Example describes the taxonomic re-classification ofthe zeaxanthin-producing bacterium formerly designated Flavobacterium sp. strain R-1512 (ATCC 21588) as Paracoccus sp. strain R-1512 (ATCC 21588).
  • a comprehensive genomic and biochemical/physiological analysis was performed by the Belgian Coordinated Collections of Microorganisms/Laboratorium voor Microbiologie, Universiteit Gent (BCCMTM/LMG), using state-of-the-art methods currently accepted as the scientific standards for bacterial classification.
  • BCCMTM/LMG Belgian Coordinated Collections of Microorganisms/Laboratorium voor Microbiologie, Universiteit Gent
  • Strains R1534 and R114 are mutants derived from strain R-1512 by classical mutagenesis and screening for improved zeaxanthin production. The primary screening was accomplished by selecting the highest color intensity producing colonies. A secondary screening was accomplished in liquid culture media by the HPLC methods according to Example 1.
  • Strain R-1506 is an independent isolate obtained from the same initial screening of environmental microorganisms that provided strain R-1512. Strains MBIC3024, MBIC3966, MBIC4017 and MBIC4020 were identified as members ofthe genus Paracoccus by the nucleotide sequences of their 16S rDNA genes (DNA sequences were deposited in the public EMBL database, see Table 5).
  • Paracoccus marcusii DSM 11574 ⁇ and Paracoccus carotinifaciens E-396 ⁇ are recently described type strains of carotenoid-producing bacteria [Harker et al., Int. J. Syst. Bacteriol. 48:543-548 (1998); Tsubokura et al., Int. J. Syst. Bacteriol. 49:277-282 (1999)].
  • Paracoccus solventivorans DSM 6637 ⁇ was included as a "control" strain, being a member ofthe genus Paracoccus but distantly related to the other bacteria used.
  • strain R1534 and R. capsulatus LMG2962 T and P. denitrificans LMG4218 confirmed that strain R1534 is neither R. capsulatus nor P. denitri- ficans.
  • 16S rDNA sequencing and phylogenetic study The bacteria set forth in Table 2 were grown in LMG medium 185 ((TSA) BBL 11768 supplemented where necessary with 1.5% Difco Bacto agar). Genomic DNA was prepared according to the protocol of Niemann et al. [J. Appl. Microbiol. 82:477-484 (1997)]. Genes coding for 16S rDNA were amplified from genomic DNA from strains R-1512, R1534, R114 and R-1506 by polymerase chain reaction (PCR) using the primers shown in Table 3.
  • PCR polymerase chain reaction
  • F orwar primer
  • R reverse primer
  • Forwar primer 16F27 Synonym: PA was used for strains R1534 and R-1506
  • forward primer 16F38 (Synonym: ARI C/T) was used for strains R-1512 and R114.
  • the reverse primer 16R1522 (Synonym: PH) was used for all strains.
  • b Hybridization position referring to £. coli 16S rDNA gene sequence numbering.
  • the PCR-amplified DNAs were purified using the Qiaquick PCR Purification Kit (Qiagen GmbH, Hilden, Germany). Complete sequencing was performed using an Applied Biosystems, Inc. 377 DNA Sequencer and the protocols ofthe manufacturer (Perkin-Elmer, Applied Biosystems Division, Foster City, CA, USA) using the "ABI PRISMTM Big DyeTM Terminator Cycle Sequencing Ready Reaction Kit (with AmpliTaq® DNA Polymerase, Fs)". The primers used for DNA sequencing are shown in Table 4.
  • Primer narne 3 /- Sequence (5'— >3') SEQ ID NO Position 13 Synonym a F, forward primer; R, reverse primer. Hybridization position referring to £. coli 16S rDNA gene sequence numbering.
  • Sequence assembly was performed using the program AutoAssembler (Perkin-Elmer, Applied Biosystems Division, Foster City, CA, USA). Phylogenetic analysis was performed using the software package Gene-
  • ComparTM (v. 2.0, Applied Maths B.V.B.A., Kortrijk, Belgium) after including the consensus sequences (from strains R-1512, R1534, R114 and R-1506) in an alignment of small ribosomal subunit sequences collected from the international nucleotide sequence library EMBL. This alignment was pairwise calculated using an open gap penalty of 100% and a unit gap penalty of 0%. A similarity matrix was created by homology calculation with a gap penalty of 0% and after discarding unknown bases. A resulting tree was constructed using the neighbor-joining method.
  • the nucleotide sequence ofthe 16s rDNA gene from Paracoccus sp. strain R-1512 is illustrated as SEQ ID NO: 12.
  • the sequences from strains R-1512 and its mutant derivatives R1534 and R114 were identical.
  • the sequence from R-1506 differed by only one nucleotide from the sequence from latter strains. This demonstrated strains R-1512 and R-1506 are phylo- genetically highly related and likely belong to the same species (confirmed by DNA:DNA hybridization, see below).
  • strains R-1512, R1534, R114, R-1506, MBIC3966, and other members ofthe genus Paracoccus), strains R-1512, R1534, Rl 14, R- 1506 and four unnamed Paracoccus strains (MBIC3024, MBIC3966, MBIC4017 and MBIC4020) were selected for DNA:DNA hybridization experiments to analyze species relatedness.
  • DNA:DNA hybridizations were performed using the initial renaturation rate method as described by De Ley et al. [Eur. J. Biochem. 12:133-142 (1970)].
  • the hybridization temperature was 81.5°C.
  • an average deviation of +/-5.8% has been reported by Vauterin et al. [Int. J. Syst. Bacteriol. 45:472-489 (1995)].
  • the G+C content ofthe bacterial DNA's and the results ofthe DNA hybridization experiments are summarized in Table 6.
  • Strains R-1512, R1534, R114, R-1506 and MBIC3966 showed a DNA homology of >70% (the generally accepted limit for species delineation [Wayne et al., Int. J. Syst. Bacteriol. 37:463-464 (1987)], and therefore belong to the same species within the genus Paracoccus.
  • the G+C content of these five strains varied from 66.9%-67.7%, thus remaining within 1%, characteristic for a well defined species.
  • strains MBIC3024, MBIC4017 and MBIC4020 and strains R-1512, R1534, R114, R-1506 and MBIC3966 showed that MBIC3024, MBIC4017 and MBIC4020 each belong to a different genomic species within the genus Paracoccus.
  • AFLPTM DNA fingerprinting using AFLPTM.
  • AFLPTM is a PCR-based technique for whole genome DNA fingerprinting via the selective amplification and selective visualization of restriction fragments [Vos et al., Nucleic Acids Research 23:4407-4414 (1995); Janssen et al., supra].
  • Paracoccus sp. strains R-1512, R1534, R114, R-1506, MBIC3966, and Para- coccus marcusii DSM 11574 were compared to evaluate infraspecies relatedness. These bacteria were grown in LMG medium 185. Genomic DNA from each of these bacteria was prepared according to the protocol of Wilson (supra).
  • Adaptors small double-stranded DNA molecules of 15-20 bp
  • Both adaptors are restriction halfsite-specific, and have different sequences. These adaptors serve as binding sites for PCR primers.
  • the restriction enzymes used were Ap ⁇ l (a hexacutter, recognition sequence GGGCC/C) and Taql (a tetracutter, recognition sequence T/GCA).
  • the sequences ofthe adaptors ligated to the sticky ends generated by cleavage with the restriction enzymes are shown in Table 7 (SEQ ID Nos:13-22).
  • PCR was used for selective amplification ofthe restriction fragments.
  • the PCR primers specifically annealed with the adaptor ends ofthe restriction fragments. Because the primers contain, at their 3' end, one so-called “selective base” that extends beyond the restriction site into the fragment, only those restriction fragments that have the appropriate complementary sequence adjacent to the restriction site were amplified.
  • the sequences ofthe six PCR primer combinations used are also shown in Table 7.
  • PCR products were separated according to their length on a high resolution polyacrylamide gel using a DNA sequencer (ABI 377). Fragments that contained an adaptor specific for the restriction halfsite created by the 6-bp cutter were visualized by autoradiography due to the 5'-end labeling ofthe corresponding primer with 32 P. The electrophoretic patterns were scanned and numerically analyzed with Gel-
  • the five strains ofthe new species cluster at an average level of about 58% similarity (this value is the mean ofthe six values ofthe branching points ofthe new species in the six AFLPTM experiments (six primer combinations)), and the cluster can clearly be discriminated from the profile of Paracoccus marcusii DSM 11574 ⁇ , the type strain of a phylogenetically related carotenoid-producing Paracoccus species.
  • the mean similarity value ofthe six branching points for Paracoccus marcusii DSM 11574 ⁇ and the new species was about 11%.
  • the fatty acid composition ofthe cell membranes of Paracoccus sp. strains R-1512, R1534, R114, R-1506, MBIC3966 were compared to the type strains P. marcusii DSM 11574 ⁇ , P. carotinifaciens E-396 ⁇ and P. solventivorans DSM 6637 ⁇ .
  • the bacteria were grown for 24 hours at 28°C in LMG medium 185.
  • the fatty acid compositions were determined by gas chromatography using the commercial system MIDI (Microbial Identification System, Inc., DE , USA). Extraction and analysis of fatty acids was performed according to the recommendations ofthe MIDI system. Table 8 summarizes the results for all strains tested.
  • LMG medium 12 Marine Agar, Difco 0979.
  • a cell suspension with a density equivalent to 0.5 McFarland units was prepared in sterile distilled water. From this suspension, 18 drops were transferred into 21 ml of AUX medium (API 20NE, bioMerieux, France) and mixed gently. 0.1 Milliliters ofthe suspension was transferred to each well ofthe BIOLOG MicroPlates, and the plates were incubated at 30°C. Wells were visually checked for growth after 48 hours and after 6 days. Also, at 6 days the visual scoring was confirmed by reading the microtiter plates using the BIOLOG plate reader.
  • Results in parentheses are those obtained after 6 days if different from the results obtained after 48 hours. A question mark indicates an unclear result at 6 days. Ofthe 95 carbon sources tested, 12 could be used, and 47 could not be used, for growth by all five strains comprising the new Paracoccus species (R-1512, R1534, R114, R-1506 and MBIC3966). These five strains gave variable growth responses to the remaining 36 substrates. The new Paracoccus species could be distinguished from the two other carotenoid-producing bacteria (P. marcusii DSM 11574 and P.
  • carotinifaciens E-396 ⁇ by their inability to use seven carbon sources (adonitol, i-erythritol, gentiobiose, ⁇ -methylglucoside, D-sorbitol, xylitol and quinic acid).
  • Two carbon sources that were utilized by all five members ofthe new Paracoccus species were not used for growth by P. marcusii DSM 11574 ⁇ .
  • Biochemical tests Selected biochemical features were tested using the API 20NE strip (bioMerieux, France). Cells from each ofthe bacterial strains identified in Table 10 were grown for 24 hours at 28°C on LMG medium 12. Cell suspensions were prepared and strips inoculated according to the instructions ofthe manufacturer. Strips were incubated at 28°C and results determined after 24 and 48 hours. The results are summarized in Table 10. Ofthe nine features tested, only one (urease activity) gave a variable response among the five strains ofthe new Paracoccus species. These nine tests did not differentiate between the new Paracoccus species and Paracoccus marcusii DSM 11574 and P. carotini- faciens E-396 .
  • GalNAc N-Acetyl-D-galactosamine
  • GlucNAc N-Acetyl-D-glucosamine
  • ⁇ -Methylgluc ⁇ -Methylglucoside
  • MMSucc Mono-methylsuccinate
  • GalAlactone D-Galactonic acid lactone
  • GalacturonicA D-Galacturonic acid
  • GlucosaminicA D-Glucosaminic acid
  • GlucuronicA D-Glucuronic acid
  • AHBA ⁇ -Hydroxybutyric acid
  • BHBA ⁇ -Hydroxy- butyric acid
  • GHBA ⁇ -Hydroxybutyric acid
  • PHPAA p-Hydroxyphenylacetic acid
  • AKBA ⁇ -Ketobutyric acid
  • AKGA ⁇ -Ketoglutaric acid
  • AKVA ⁇ -Ketovaleric acid
  • LAME D,L-Lactic acid
  • PyroGluA L-Pyroglutamic acid
  • GABA ⁇ -Aminobutyric acid
  • PEA Phenylethylamine
  • GlycP D,L- ⁇ -Glycerolphosphate
  • Gluc-l-P Glucose- 1 -phosphate
  • Gluc-6-P Glucose-6- phosphate
  • the liquid cultures were incubated aerobically (with shaking) at 28°C. Growth was checked at 24 hours, 48 hours, 3 days and 6 days. Growth was determined as increased turbidity (measured as % transmission using the BIOLOG turbidimeter) compared to growth at pH 7.0 (control). Scoring was done (vs. the control) as follows; better growth (++), good (equivalent to the control) growth (+), weaker growth ( ⁇ ), poor growth ( ⁇ ), and no growth (-).
  • Starch hydrolysis Cells were grown for 24 hours at 28°C on LMG medium 12 plates. A loopful of cells was taken from the plate and transferred as one streak onto the agar surface of LMG medium 12 supplemented with 0.2% soluble starch. Plates were then incubated under aerobic conditions at 28°C. When the strains had developed good growth (after 48 hours), the plate was flooded with lugol solution (0.5% I 2 and 1% KI in distilled water). Hydrolysis was determined as a clear zone alongside the growth (in contrast to the blue color ofthe agar where starch was not hydrolyzed). Denitrification. Cells were grown for 24 hours at 28°C on LMG medium 12 plates.
  • a loopful of cells was taken from the plate and stabbed into tubes containing semi-solid (0.1% agar) LMG medium 12 supplemented with 1% KNO 3 .
  • the plates were incubated at 28°C for 5 days. Denitrification (N 2 from nitrate) was determined as gas formation alongside the stab.
  • Cell morphology and mot ⁇ lity Cells were grown for 24 hours at 28°C on LMG medium 12. Cell suspensions were made in sterile saline. Cell morphology and motility were observed microscopically using an Olympus light microscope equipped with phase contrast optics (magnification lOOOx).
  • T T from Paracoccus marcusii DSM 11574 and/ 'or Paracoccus carotinifaciens E-396 were: growth at 40°C, growth with 8% NaCl, growth at pH 9.1, and colony pigmentation.
  • strains R-1512, R1534 and R-1506 under these conditions were 0.85 hours, 1.15 hours and 1.05 hours, respectively.
  • Strain R114 reproducibly exhibited a bi- phasic growth profile; the doubling time of strain R114 in the initial phase was 1.4 hours while the doubling time in the second phase was 3.2 hours.
  • Table 12 shows the zeaxanthin production and Specific Formation (zeaxanthin production normalized to OD 66 o) by the Paracoccus sp. strains in ME medium. The data are averages of four independent experiments, and within each experiment each strain was tested in duplicate flasks. The improved zeaxanthin production in the classically-derived mutant strains R1534 and R114 compared to the parental strain R-1512 is clearly shown. Zea- xanthin production by strain R-1506 was approximately the same as strain R-1512. No other carotenoids were detected in any ofthe cultures.
  • Example 3 IPP Biosynthesis via the Mevalonate Pathway in the Zeaxanthin- Producing Paracoccus sp. strain Rl 14.
  • the pre-culture was incubated at 28°C with shaking at 200 rpm for 24 h, after which time the OD 66 o was about 22 absorbance units.
  • the main cultures were grown in Bioflo 3000 bioreactors (New Brunswick Scientific, Edison, NJ, USA) containing 362F/2 medium containing the following composition: 30 g/1 total D-glucose (see below for ratios of 13 C- labeled:unlabeled glucose), 20 g/1 yeast extract, 10 g/1 peptone, 10 g/1 NaCl, 5 g/1
  • MgSO 4 -7H 2 0, 1.5 g/1 (NH 4 ) 2 HPO 4 , 1.25 g/1 K 2 HPO 4 , 0.4 g/1 (NH 4 ) 2 Fe(SO 4 ) 2 -6H 2 O, 375 mg/1 CaCl 2H 2 O, 30 mg/1 ZnSO 4 -7H 2 O, 25 mg/1 FeCl 3 -6H 2 0, 10 mg/1 MnSO 4 -H 2 0, 1 mg/1 NiSO 4 -6H 2 O, 30 mg/1 Na-EDTA and 18.75 ⁇ l/1 HC1 (37% stock solution).
  • the bioreactors were inoculated with pre-culture (20 ml/1 initial volume) and cultivation proceeded for 22-24 hours, at which time no glucose was left in the medium.
  • Cultivation conditions were: 28°C, pH 7.2 (controlled with 25% H 3 PO 4 and 28% NH 4 OH), dissolved oxygen controlled (in a cascade with agitation) at a minimum of 40%, agitation rate and aeration rate 300 rpm (minimum) and 1 wm, respectively.
  • the main zeaxanthin product eluted in a broad band that moved slowly in the column. About 2 liters of solvent was needed to elute the main band completely.
  • the eluate was collected in a round-bottomed flask and the solvent was removed by rotary evaporation at 40°C. The residue was dissolved in a small amount of dichloroethane at 40°C and the solution was then allowed to cool slowly. Hexane was added to the mixture drop- wise until a turbidity was observed. The crystallization was complete within 48 hours at 4°C. The crystals were collected on a paper filter, washed with cold methanol and dried under vacuum.
  • ⁇ -NMR and 13 C-NMR spectra were recorded at 500.13 MHz and 125.6 MHz, respectively, with a Bruker DRX 500 spectrometer. Acquisition and processing parameters for one- dimensional experiments and two-dimensional INADEQUATE experiments were accord- ing to standard Bruker software (XWINNMR). The solvent was deuterated chloroform. The chemical shifts were referenced to solvent signals.
  • Zeaxanthin comprises a total of eight isoprenoid moieties (2 DMAPP units and 6 IPP units); only 20 13 C NMR signals are observed due to chemical shift degeneracy.
  • the 13 C abundance for all non-isochronous carbon atoms was determined by comparison with spectra of unlabeled zeaxanthin and by evaluation ofthe ⁇ 13 C coupling satellites in ⁇ NMR spectra (Table 13).
  • the fraction of jointly transferred carbon atom pairs in the experiment with [U- 13 C 6 ] glucose was determined by integration ofthe coupling satellites.
  • the labeling patterns ofthe IPP building block can be reconstructed accurately as shown by the standard deviations found for the reconstructed IPP precursor.
  • the reconstructed labeling patterns of DMAPP and IPP were identical within the experimental limits. Table 13. NMR results for 13 C labeled zeaxanthin produced by Paracoccus sp. strain Rl 14 supplied with 13 C labeled glucoses.
  • the experimental labeling patterns determined above can be compared with various predictions, taking into account not only the mevalonate pathway vs. the DXP pathway for isoprenoid biosynthesis, but also different pathways of glucose metabolism.
  • Eubacteria typically utilize glucose primarily via the glycolytic pathway or via the Entner-Doudoroff pathway. Glycolysis generates two triose phosphate molecules from glucose. The C-l and C-6 of glucose are both diverted to the 3-position ofthe triose phosphates produced during glycolysis.
  • glucose is converted to a mixture of glyceraldehyde 3-phosphate and pyruvate. The C-l of glucose is exclusively diverted to C-l of pyruvate, and the C-6 of glucose is exclusively diverted to C- 3 of glyceraldehyde 3-phosphate.
  • Paracoccus sp. strain R114 was grown at 28°C in F-medium (10 g/1 tryptone, 10 g/1 yeast extract, 30 g/1 NaCl, 10 g/1 D-glucose, 5 g/1 MgSO 4 -7H 2 O, pH 7.0) or in the pre-culture medium described in Example 3 above. Liquid cultures were grown in a rotary shaker at 200 rpm.
  • the lysate was extracted with one volume of buffer-saturated phenol, pH 7.5-7.8 (LifeTechnologies, Rockville, MD, USA) by gentle but thorough mixing.
  • the emulsion was centrifuged for 20 minutes at 30,000 x g and the aqueous phase was re- extracted with phenol.
  • the phases were separated as before and the aqueous phase was extracted twice with one volume phenohchloroform (1:1). At this step centrifugation for 20 minutes at 3,200 x g in a swinging bucket rotor was sufficient to obtain satisfactory phase separation.
  • PCR Polymerase chain reaction: Oligonucleotides were purchased from LifeTechnologies (Rockville, MD, USA). PCR was performed in a GeneAmp ® PCR system 9700 (PE Applied Biosystems, Foster City, CA, USA) using the GC-rich PCR system (Roche Molecular Biochemicals, Mannheim, Germany) according to the manufacturers instructions. Typically, the MgCl 2 concentration used was 1.5mM and the resolution solution was added to IM final concentration.
  • DNA Labeling and detection The PCR DIG Probe Synthesis Kit and the DIG Luminescent Detection Kit were used for DNA labeling and detection, respectively (both obtained from Roche Molecular Biochemicals, Mannheim, Germany)
  • DNA sequencing Sequencing reactions were performed using the BigDye DNA sequencing kit (PE Applied Biosystems, Foster City, CA, USA) according to the manufacturers instructions. Sequencing reactions were purified on DyeEx spin columns (Qiagen, Hilden, Germany) and fragment separation and detection was done with an ABI PrismTM 310 Genetic Analyzer (PE Applied Biosystems, Foster City, CA, USA).
  • ⁇ -library A custom made library with partially S w3AI digested Paracoccus sp.
  • strain Rl 14 DNA in lambda FIX* II was purchased from Stratagene (La Jolla, CA, USA). Cloning, sequencing and characterization ofthe mevalonate pathway gene cluster from Paracoccus sp. strain R114.
  • One ofthe enzymes ofthe mevalonate pathway, mevalonate diphosphate decarboxylase contains highly conserved regions spanning several amino acids. Three such regions were chosen from an alignment of all available eubacterial mevalonate diphosphate decarboxylases and oligonucleotides were designed using the preferred codon usage found in the carotenoid gene cluster of Paracoccus sp. strain R1534 (Table 14). The oligonucleotides designed from two homology regions are shown in Table 15.
  • oligonucleotides mvd-103a-d differ only in the third nucleotide from the 3' end, each accounting for one possible codon for glycine (GGA, although rarely used, was included because ofthe close proximity to the 3' end).
  • Alternate amino acids were accounted for by designing oligonucleotides to both residues, e.g. oligonucleotides mvd- 101a and mvd- 10 lb are specific for leucine or isoleucine, respectively, in the second position of peptide 1 (Table 15).
  • the PCR product was cloned in the vector pCR 2.1-TOPO (Invitrogen, Carlsbad, CA, USA) and sequenced. The cloned fragment was used as a probe for a Southern analysis of Paracoccus sp. strain R114 DNA and was found to hybridize to a BamH -Sall fragment of about 950 bp. Paracoccus sp. strain R114 DNA was cut with B ⁇ mHI and Sail and the fragments were separated by agarose gel electrophoresis.
  • the region around 950 bp was isolated and cloned in the vector pUC19. This partial library was then screened using the mvd-PCR fragment as a probe and the insert of a positive clone was sequenced.
  • a ⁇ -library prepared from Paracoccus sp. strain Rl 14 DNA was screened using the mvd-PCR fragment as a probe. DNA was isolated from two positive ⁇ -clones and cut with Bam l and Sail or £coRI and Sail. A number ofthe restriction fragments were isolated and cloned in the vector pUC19. Several ofthe fragments contained sequences homo- logous to genes encoding proteins ofthe mevalonate pathway.
  • SEQ ID Nos:42, 44, 46, 48, 50, and 52 The assembled sequence from all fragments (SEQ ID Nos:42, 44, 46, 48, 50, and 52) and the sequences ofthe encoded proteins are shown in the Sequence Listing (SEQ ID Nos:43, 45, 47, 49, 51, and 53). Due to a limitation ofthe Patentln Program, operons with overlapping genes cannot be shown as a single sequence. Thus, for each gene in the mevalonate operon, the entire nucleotide sequence ofthe operon is repeated for each gene. Accordingly, SEQ ID Nos:42, 44, 46, 48, 50, and 52 are identical. For purposes ofthe present invention, we use SEQ ID NO:42 to refer to the nucleotide sequence ofthe mevalonate operon.
  • the arrangement of the mevalonate pathway genes in the Paracoccus sp. strain Rl 14 is unique when compared to known mevalonate gene clusters of other bacteria. Besides Paracoccus sp. strain R114, only Borrelia burgdorferi and Streptomyces sp. strain CL190 (Takagi et al., supra) have all mevalonate genes in a single operon (Wilding et al., supra). In Streptococcus pyrogenes all mevalonate genes are clustered in a single locus but they are grouped in two operons.
  • All other species have two loci with the two kinases and the mevalonate diphosphate decarboxylase grouped in one operon and the HMG-CoA synthase and the HMG-CoA reductase on a second locus, either forming an operon (in Streptococcus pneumoniae) or as separate transcription units. All species except the members of Staphylococcus have an additional gene linked with the mevalonate cluster, which was recently identified as an IPP isomerase (idi gene in Streptomyces sp. strain CL190) (Kaneda et al., supra).
  • the two Enterococcus species and Staphylococcus haemolyticus have an acetyl-CoA acetyltransferase gene linked with the HMG-CoA reductase gene. In the Enterococcus species the latter two genes are fused.
  • Table 15 Oligonucleotides designed from two conserved bacterial Mvd peptides.
  • the genes ofthe mevalonate operon from Paracoccus sp. strain R114 were identified by homology ofthe gene products to proteins in general databases. An amino acid alignment ofthe HMG-CoA reductase from Paracoccus sp. strain R114 (SEQ ID NO:43) was performed with bacterial class I HMG-CoA reductases of Streptomyces sp. Strain CL190 (SEQ ID NO:54), S. griseolosporeus (SEQ ID NO:55), and Streptomyces sp. strain KO-3899 (SEQ ID NO:56). EMBL/GenBank/DDBJ database accession numbers are q9z9n4 for Streptomyces sp.
  • HMG-CoA reductases There are two classes of HMG-CoA reductases [Bochar et al., Mol. Genet. Metab. 66:122-127 (1999); Boucher et al., Mol. Microbiol. 37:703-716 (2000)].
  • Eubacte- rial HMG-CoA reductases are generally of class II, whereas class I enzymes are found in eukaryotes and archaea.
  • the Streptomyces and the Paracoccus HMG-CoA reductases together with the enzyme from Vibrio cholerae are the only eubacterial HMG-CoA reductases of class I known so far.
  • IPP isomerase isopentenyl diphosphate isomerase
  • CL190 (Q9KWG2) (SEQ ID NO:60), Streptomyces griseolosporeus (Q9KWF6) (SEQ ID NO:61), Sulfolobus solfataricus (P95997) (SEQ ID NO:62), Rickettsia prowazekii (Q9ZD90) (SEQ ID NO:63), Deinococcus radiodurans (Q9RVE2) (SEQ ID NO:64), Aeropyrum pernix (Q9YB30) (SEQ ID NO:65), Halobacterium sp.
  • NRC-1 (O54623) (SEQ ID NO:66), Archaeoglobus fulgidus (O27997) (SEQ ID NO:67), Pyrococcus abyssi (Q9UZS9) (SEQ ID NO:68), Pyrococcus horikoshii (058893) (SEQ ID NO:69), Methanobacterium thermoautotrophicum (026154) (SEQ ID NO:70), Methanococcus jannaschii (Q58272) (SEQ ID NO:71), Thermoplasma acidophilum (CAC11250) (SEQ ID NO:72) and Leishmania major (Q9NDJ5) (SEQ ID NO:73).
  • EMBL/GenBank/DDBJ database accession numbers are given after the organism's name in parentheses. The first nine sequences are from eubacteria and the next eight sequences are from archaea. Interesting- ly, one eukaryotic species, the protozoan parasite Leishmania major (SEQ ID NO:73), also has a protein that is highly homologous. This is unexpected because other eukaryotes have a different idi, designated type 1 (Kaneda et al., supra). A conserved hypothetical protein from Bacillus subtilis, YpgA, also has substantial homology but is considerably smaller than the type 2 id ⁇ s.
  • CL190 (Q9KWG1) (SEQ ID NO:82), Streptomyces griseolosporeus (Q9KWF5) (SEQ ID NO:83) and Borrelia burgdorferi (051626) (SEQ ID NO:84).
  • EMBL/GenBank DDBJ database accession numbers are given after each organism's name in parentheses. The first 43 amino acids ofthe sequence from Streptomyces griseolosporeus are missing in the database version.
  • CL190 (Q9KWG4) (SEQ ID NO:92), Streptomyces griseolosporeus (Q9KWF8) (SEQ ID NO:93) and Borrelia burgdorferi (051629) (SEQ ID NO:94).
  • EMBL/GenBank/DDBJ database accession numbers are given after each organism's name in parentheses.
  • Two proteins from Myxococcus xanthus, Tac and Taf have substantial homology to the Paracoccus sp. strain Rl 14 HMG-CoA synthase.
  • the homology between the Paracoccus sp. strain Rl 14 HMG-CoA synthase and the Tac and Taf proteins ofthe M. xanthus is greater than the homology between the HMG-CoA synthases from Paracoccus sp. strain Rl 14 and eukaryotes.
  • the bacterial HMG-CoA synthases and the bacterial mevalonate diphosphate decarboxylases share substantial homology with their eukaryotic orthologs.
  • Archaeal HMG-CoA synthases form a more distantly related group of enzymes (Wilding et al., supra) and no mevalonate diphosphate decarboxylase orthologs are found in archaea [Smit and Mushegian, Genome Res. 10:1468-1484 (2000)].
  • Streptococcus pneumoniae (AAG02455) (SEQ ID NO:95), Streptococcus pyrogenes (AAG02450) (SEQ ID NO:96), Entereococcus faecalis (AAG02440) (SEQ ID NO:97), Enterococcus faecium (AAG02445) (SEQ ID NO:98), Staphylococcus haemolyticus (AAG02430) (SEQ ID NO:99), Staphylococcus epidermis (AAG02435) (SEQ ID NO: 100), Staphylococcus aureus (AAG02424) (SEQ ID NO: 101), Streptomyces sp.
  • CL190 (Q9KWG5) (SEQ ID NO: 102), Streptomyces griseolosporeus (Q9KWF9) (SEQ ID NO:103) and Borrelia burgdorferi (051631) (SEQ ID NO:104)(Mvk); and Streptococcus pneumoniae (AAG02457) (SEQ ID NO: 105), Streptococcus pyrogenes (AAG02452) (SEQ ID NO:106), Entereococcus faecalis (AAG02442) (SEQ ID NO:107), Enterococcus faecium (AAG02447) (SEQ ID NO: 108), Staphylococcus haemolyticus (AAG02432) (SEQ ID NO: 109), Staphylococcus epidermis (AAG02437) (SEQ ID NO:l 10), Staphylococcus aureus (AAG02426) (SEQ ID NO: 111), Streptomyces sp
  • the mevalonate kinase from Paracoccus sp. strain R114 (SEQ ID NO:49) has a 37 amino acid insert in the amino-terminal region, which is lacking in other mevalonate kinases.
  • some archaeal enzymes e.g. from Archaeoglobus fulgidus, Methanobacterium thermoauto- trophicum and Pyrococcus abyssi, are among the best homologues to the Mvk from Paracoccus sp. strain R114.
  • the homology among bacterial phosphomevalonate kinases is even weaker than the homology among the bacterial mevalonate kinases.
  • the proteins with the best homologies to the Pmk from Paracoccus sp. strain R114 are Mvk's from archaea, e.g. Aeropyrum pernix, Pyrococcus horikoshii, M. thermoautotrophicum, P. abyssi and A. fulgidus. Since no Pmk's are found in archaea (Smit and Mushegian, supra), this suggests that the same kinase might perform both phosphorylations.
  • Example 5 Over-expression ofthe Mevalonate Pathway Genes and the idi Gene from Paracoccus sp. strain Rl 14 in E. coli
  • the resulting PCR product was cloned in TOPO-XL (Invitrogen, Carlsbad, CA, USA), resulting in plasmid TOPO-XL-mev-opl6.
  • the insert carrying the mevalonate operon was excised with H dIII and S ⁇ cl and cloned in the H dlll-S ⁇ cl cut vector pBBRlMCS2 [Kovach et al., Gene 166:175-176 (1995)], resulting in plasmid pBBR-K-mev-opl6. Plasmid pBBR-K-mev-opl6 was used to transform electroporation-competent E.
  • E. coli TGI/ pBBR-K-mev-opl6-l Two representative positive transformants (E. coli TGI/ pBBR-K-mev-opl6-l and E. coli TGI/ pBBR-K-mev- opl6-2) were grown in Luria Broth (LB, GibcoBRL, Life Technologies) containing 50 mg/1 kanamycin and tested for HMG-CoA reductase activity (encoded by the Paracoccus sp. strain R114 mvaA gene) using the methods described in Example 1.
  • E. coli TGI/ pBBR-K-mev-opl6-l Two representative positive transformants (E. coli TGI/ pBBR-K-mev-opl6-l and E. coli TGI/ pBBR-K-mev- opl6-2) were grown in Luria Broth (LB, GibcoBRL, Life Technologies) containing 50 mg/1 kanamycin
  • the plasmid pDS-His was constructed from pDSNdeHis by deleting a 857 bp Nhel and Xbal fragment carrying a silent chloramphenicol acetyltransferase gene.
  • the plasmid pDS was constructed from pDS-His by replacing a small EcoRl-BamHl fragment with the annealed primers S/D-l (5' AATTAAAGGAGGGTTTCATATGAATTCG) (SEQ ID NO: 117) and S/D-2 (5' GATCCGAATTCATATGAAACCCTCCTTT) (SEQ ID NO:118).
  • the second codon TCA was changed to AGC (silent mutation - both codons encode serine).
  • E. coli strain M15 [Villarejo and Zabin, J. Bacteriol. 120:466-474 ( 1974)] carrying the lad (lac repressor) -containing plasmid pREP4 (EMBL/GenBank accession number A25856) was transformed with the ligation mixtures and recombinant cells were selected for by growth on LB-Agar plates supplemented with 100 mg/L ampicillin and 25 mg/L kanamycin. Positive clones containing the correct mevalonate operon gene insert were verified by PCR.
  • each ofthe E. coli strains were grown overnight at 37°C in LB medium containing 25 mg/L kanamycin and 100 mg/L ampicillin. The next day, 25 ml of fresh medium was inoculated with 0.5 ml ofthe overnight cultures and the new cultures were grown at 37°C. When the OD 600 ofthe cultures reached 0.4, expression ofthe cloned genes was induced by addition of isopropyl- ⁇ -D-thiogalactopyranoside (IPTG) to a final concentration of 1 mM, and the incubation ofthe cultures (with shaking) was continued for four hours, after which the cells were collected by centrifugation.
  • IPTG isopropyl- ⁇ -D-thiogalactopyranoside
  • Tables 21 and 22 show the HMG-CoA reductase and IPP isomerase activities, respectively, in the recombinant E. coli strains.
  • strains M15/pDS-mv A and M15/pDS- «ft contained high levels ofthe HMG- CoA reductase and IPP isomerase activity, respectively. This illustrates the ability to over- express the mevalonate pathway genes (and overproduce their cognate gene products in an active form) from Paracoccus sp. strain Rl 14 in E. coli.
  • Table 21 Induction of HMG-CoA reductase activity in E. coli strains over- expressing the cloned mvaA gene from Paracoccus sp. strain R114.
  • the crude extracts used for the enzyme assays were analyzed by sodium dodecylsulfate- polyacrylamide gel electrophoresis (SDS-PAGE).
  • SDS-PAGE sodium dodecylsulfate- polyacrylamide gel electrophoresis
  • E. coli M15/pDS-mraA and E. coli M15/pDS-His- v ⁇ A the presence or absence of a highly expressed protein ofthe expected molecular mass (36.3 kD) correlated with the HMG-CoA reductase activity measured in the extracts (Table 21).
  • the absence ofthe His-tagged protein could be explained by reduced expression at the level of transcription or translation by instability of the mRNA or the protein.
  • Example 6 Improved Zeaxanthin Production in Paracoccus sp. strain Rl 14 by Over- Expression of the crtE Gene
  • This fragment containing the crt gene cluster was ligated into the BamHl and PcoRI-cut vector pBBRlMCS-2 (GenBank accession #U23751) resulting in pBBR-K-Zea4. Plasmid pBBR- K-Zea4 was introduced into Paracoccus sp. strain Rl 14 by conjugation to test for improved zeaxanthin production. The control strain R114 and two independent isolates of strain R114/pBBR-K-Zea4 were tested for zeaxanthin production in shake flask cultures (using medium 362F/2, see Example 11).
  • Table 23 Zeaxanthin production by strains Rl 14 and Rl 14/pBBR-K-Zea4.
  • Plasmid pBBR-K-Zea4-down was constructed by digesting pBBR-K-Zea4 with these two enzymes and deleting the "upstream" region.
  • plasmid pBBR-K-Zea4-up was constructed by deletion ofthe "downstream" region within the cloned insert in pBBR-K-Zea4, using the restriction enzymes EcoRV and Stul.
  • the two new plasmids were transferred to Paracoccus sp. strain Rl 14 by conjugation.
  • Zeaxanthin production was compared (shake flask cultures, same conditions as described above) in strains Rl 14 (host control), Rl 14/pBBR-K (empty vector control), Rl 14/ pBBR-K-Zea4-down and Rl 14/pBBR-K- Zea4-up (Table 24).
  • Table 24 Zeaxanthin production by strains carrying deletion derivatives of plasmid pBBR-K-Zea4.
  • the vector pBBRlMCS-2 was cut with 5sfXI and Bsu36I and the larger fragment was ligated with the annealed oligonucleotides MCS-2 up (5' TCAGAATTCGGTACCATATGAAGCTTGGATCCGGGG 3') (SEQ ID NO: 145) and MCS-2 down (5' GGATCCAAGCTTCATATGGTACCGAATTC 3') (SEQ ID NO: 146), resulting in vector pBBR-K-Nde.
  • strain R114 which contains the putative crtE promoter (RcrtE ) including the ribosome binding site and the crtE start codon (Pasamontes et al., supra) was amplified from Paracoccus sp. strain Rl 14 DNA by PCR with primers crtE- up (5' GGAATTCGCTGCTGAACGCGATGGCG 3') (SEQ ID NO: 147) and crtE-down (5' GGGGTACCATATGTGCCTTCGTTGCGTCAGTC 3') (SEQ ID NO:148).
  • crtE- up 5' GGAATTCGCTGCTGAACGCGATGGCG 3'
  • crtE-down 5' GGGGTACCATATGTGCCTTCGTTGCGTCAGTC 3'
  • the PCR product was cut with EcoRl and Ndel and inserted into the EcoRl-Ndel cut backbone of pBBR-K-Nde, yielding plasmid pBBR-K-P ⁇ t£.
  • An Ndel site which contains the ATG start codon of crtE, was included in primer crtE-down. Hence, any introduced coding region with the start codon embedded in a Ndel site should be expressed using the ribosomal binding site of crtE.
  • the plasmid pBBR-K-PcrtE was cut with BamHl and the annealed oligonucleotides pha-t-up (5' GATCCGGCGTGTGCGCAATTTAATTGCGCACACGCCCCCTGCGTTTAAAC 3') (SEQ ID NO:149) andpha-t-down
  • crtE gene was amplified from plasmid p59-2 (Pasamontes et al., supra) by PCR using the primers crtE-Nde (5' AAGGCCTCATATGACGCCCAAGCAGCAATT 3') (SEQ ID NO:151) and crtE-Bam (5' CGGGATCCTAGGCGCTGCGGCGGATG 3') (SEQ ID NO: 152).
  • the amplified fragment was cloned in the pCR 2.1-TOPO vector, resulting in plasmid TOPO- crtE.
  • the Ndel-BamHl fragment from TOPO- ⁇ tE was subcloned in Ndel-BamHl- digested plasmid pBBR-K-Pcrt£ , yielding pBBR-K-PcrtE- «t£.
  • pBBR-K-Pot£- crtE-3 was constructed by replacing the smaller BgRl fragment from pBBR-K-Pcrr£-crt£ with the smaller Bglll fragment from pBBR-K-Zea4-up.
  • Plasmid pBBR-K-P ⁇ t£- ⁇ t£-3 was transferred to Paracoccus sp. strain Rl 14 by electroporation. Using the methods described in Example 1, GGPP synthase activity in crude extracts was found to be 2.9-fold higher in strain R114/pBBR-K-Pcrt£ -crtE -3 than in strain R114. This degree of elevated activity was similar to that observed in R114/pBBR-K-Zea4-up. Table 25 shows the zeaxanthin production by strain Rl 14/pBBR-K-Pc/t£ -crtE -3 was essentially identical to strain Rl 14/pBBR-K-Zea4-up.
  • Table 25 Comparison of zeaxanthin production by strains Rl 14/pBBR-K-Pcr ⁇ £ -crtE -3 and Rl 14/pBBR-K-Zea4-up.
  • Example 7 Expression of Individual Genes ofthe Paracoccus sp. strain Rl 14 Mevalonate Operon in the Native Host, Paracoccus sp. strain Rl 14
  • the resulting plasmids pBBR-tK-Pcrr£- mv ⁇ A, pBBR-tK-Pcrt£-i ⁇ , pBBR-tK-PcrtE-hcs, pBBR-tK- PcrtE-mvk, pBBR-tK-Pcrt£-pmfc and pBBR-tK-Pcrt£-mv ⁇ 2 were introduced into Paracoccus sp. strain Rl 14 by electroporation. Transformants were selected on agar medium containing 50 mg/1 kanamycin and verified by PCR.
  • HMG-CoA reductase activity was compared in crude extracts of strains R114/pBBR-K (control) and Rl 14/pBBR-tK-Pcrt£- mvaA (methods used are set forth in Example 1).
  • the specific activities of HMG-CoA reductase in strains R114/pBBR-K and R114/pBBR-tK-Pcrf£- mvaA were 2.37 U/mg and 6.0 U/mg, respectively.
  • Example 8 Construction of "Mini-Operons" for Simultaneous Over-Expression the Cloned Genes ofthe Mevalonate Pathway with the Paracoccus sp. strain Rl 14 crtE Gene Plasmid constructions. As was shown in Example 6, introduction of plasmid pBBR-K- PcrtE-crtE-3 into Paracoccus sp.
  • strain Rl 14 resulted in increased production of zeaxanthin, indicating that GGPP synthase activity was rate limiting for zeaxanthin biosynthesis in strain R114.
  • Example 7 further showed that genes coding for the enzymes ofthe mevalonate pathway could be over- expressed in the native host Paracoccus sp. strain Rl 14, and resulted in increased activity ofthe encoded enzyme.
  • none ofthe recombinant strains of Paracoccus sp. strain Rl 14 that carried plasmids containing each individual gene ofthe mevalonate operon showed increased zeaxanthin production compared to strain Rl 14. It is possible that the benefit of over-expression ofthe genes of the mevalonate operon in Paracoccus sp.
  • strain Rl 14 could be masked by the downstream "bottleneck" in the zeaxanthin pathway (GGPP synthase). Creation of plasmids that allow simultaneous over- expression of each mevalonate pathway gene (or perhaps combinations of these genes) together with crtE could relieve all rate limitations in the overall zeaxanthin biosynthetic pathway, thereby improving zeaxanthin production.
  • the next section describes the construction of "mini-operons" designed to allow co-over-expression of crtE and each ofthe genes coding for the five enzymes ofthe mevalonate pathway.
  • the crtE, mvaA, idi and mvk genes were excised from the respective TOPO-plasmids (described in Examples 5 and 6) with BamHl and Ndel and ligated with BamHl-Ndel- cleaved vector pOCV-1 (described in Example 12).
  • the crtE gene does not have an adenine as the last nucleotide ofthe coding region, and in addition, has a TAG rather than a TGA stop codon and an unsuitable distance between the stop codon and the BamHl site.
  • crtE does not meet the requirements ofthe operon construction vectors (refer to Example 12) and crtE must be the last gene in any operon constructed with pOCV-1 -crtE.
  • crtE must be the last gene in any operon constructed with pOCV-1 -crtE.
  • mutations had to be introduced in three genes ofthe mevalonate operon.
  • the second codon of pmk, GAT, encoding Asp was changed into AAT, encoding Asn.
  • the last codon of mvd ends with a T and the last codons of pmk and hcs end with C.
  • Oligonucleotides were designed to introduce the necessary changes by PCR.
  • the sequences ofthe oligonucleotides and the templates used for those PCR reactions are shown in Table 26. All PCR products were cloned in the pCR ⁇ 2.1-TOPO vector, resulting in plasmids TOPO-mv ⁇ , TOPO-p c and TQVO-hcs .
  • the inserts were excised with Ndel and B raHI and ligated with the Ndel-BamHl cut backbone of pOCV-2 (see Example 12).
  • the final cloning steps to assemble each ofthe "mini-operons" were analogous, and are illustrated by the representative scheme for construction of pBBR-K- RcrtE- mvaA- crtE- 3.
  • Table 26 Oligonucleotides and templates used for PCR in the construction of plasmids TOPO-mvd° cv , TOPO-pmfc ocv and TOPO-f ⁇ cs ocv .
  • Paracoccus sp. strain R114 Because FPP synthase lies in the central pathway for zeaxanthin biosynthesis in Paracoccus sp. strain Rl 14, increasing the activity of this enzyme by increasing the dosage ofthe ispA gene has the potential to improve zeaxanthin production. For this reason, the ispA gene from Paracoccus sp. strain Rl 14 was cloned and sequenced as follows. The amino acid sequences of six bacterial FPP synthases were obtained from public databases. These sequences have several highly conserved regions. Two such regions, and the oligonucleotides used for PCR, are shown in Table 27. PCR with oligonucleotides GTT-1 and GTT-2, using Paracoccus sp.
  • strain Rl 14 DNA as template, gave a product ofthe expected size.
  • the PCR product was cloned in the vector pCR 2.1-TOPO and sequenced.
  • the cloned fragment was used as a probe for a Southern analysis of Paracoccus sp. strain R114 DNA and was found to hybridize to a BamHl-Ncol fragment of about 1.9 kb.
  • Paracoccus sp. strain Rl 14 DNA was cut with BamHl and JVcoI and the fragments were separated by agarose gel electrophoresis. The region between 1.5 and 2.1 kb was isolated and cloned in the BamHl and Ncol sites of a cloning vector.
  • This partial library was then screened using the jspA-PCR fragment as a probe, and two positive clones were isolated. Sequencing con- firmed that the plasmids of both clones contained the ispA gene. Upstream of ispA (SEQ ID NO:159) is the gene for the small subunit of exonuclease VII, XseB (SEQ ID NO:158), and downstream is the dxs gene (SEQ ID NO: 160) encoding the l-deoxyxylulose-5-phos- phate synthase. This is the same gene arrangement as found in £. coli.
  • the sequence ofthe Ncol-BamHl fragment is illustrated in SEQ ID NO:157, the amino acid sequences of XseB, IspA and Dxs are illustrated in SEQ ID NO:158, SEQ ID NO:159, and SEQ ID NO:160, respectively.
  • the start codon of ispA may be GTG or ATG resulting in two or one methionine residues, respectively, at the amino-terminus ofthe native IspA.
  • a new plasmid, pBBR- tK-Pc ⁇ t£- ⁇ spA-2 was constructed to allow for over-expression ofthe ispA gene in the native host Paracoccus sp. strain Rl 14.
  • the plasmid was introduced into strain Rl 14 by electroporation, and transformants were confirmed by PCR.
  • Three representative transformants and a control strain (R114/pBBR-K) were grown in 362F/2 medium (Example 11), crude extracts were prepared and assayed for activity ofthe ispA gene product, FPP synthase according to the methods described in Example 1.
  • the basal (chromosomally-encoded) FPP synthase specific activity in R114/pBBR-K was 62.6 U/mg.
  • the FPP synthase activity in the three transformants was 108.3 U/mg (73% increase), 98.5 U/mg (57% increase) and 83.8 U/mg (34% increase), demonstrating the over-expression ofthe ispA gene and overproduction of its product, FPP synthase, in an active form in Paracoccus sp. strain R114.
  • Table 27 Oligonucleotides designed from two conserved bacterial IspA peptides.
  • Acetyltransferase from Paracoccus sp. strain Rl 14 The first committed step in IPP biosynthesis is the condensation of acetyl-CoA and aceto- acetyl-CoA to hydroxymethylglutaryl-CoA (HMG-CoA) by HMG-CoA synthase.
  • the substrate acetoacetyl-CoA is formed by the enzyme acetyl-CoA acetyltransferase (also known as acetoacetyl-CoA thiolase or ⁇ -ketothiolase) by condensation of two molecules of acetyl- CoA.
  • nucleotide sequence ofthe atoB gene and the corresponding amino acid sequence ofthe encoded acetyl-CoA acetyltransferase from Paracoccus sp. strain R1534 are illustrated in SEQ ID NO: 175 and SEQ ID NO:176, respectively.
  • the atoB gene was cloned in plasmids pDS and pDS-His.
  • the new plasmids, pDS- ⁇ to.B and pDS-His- ⁇ taB were introduced into £. coli strain Ml 5.
  • the resulting strains M15/pDS- ⁇ to£ and M15/pDS-His- atoB were grown with and without IPTG induction (as described in Example 5), and crude extracts were prepared for acetyl-CoA acetyltransferase assays (methods used were described in Example 1) and SDS-PAGE analysis.
  • Acetoacetyl-CoA is also the substrate for the first committed step in poly- hydroxyalkanoate (PHA) biosynthesis.
  • PHA poly- hydroxyalkanoate
  • the genes involved in PHA biosynthesis are grouped in operons [Madison and Huisman, Microbiol. Mol. Biol. Rev., 63:21-53 (1999)].
  • the phaA andphaB genes encoding the acetyl-CoA acetyltransferase and acetoacetyl-CoA reductase, respectively, are clustered in an operon [Yabutani et al., FEMS Microbiol. Lett.
  • phaC the gene encoding the last enzyme in the pathway, poly(3-hydroxyalkanoate) synthase, is not part of this operon [Ueda et al., J. Bacteriol. 178:774-779 (1995)].
  • PCR fragments containing parts of phaA from Paracoccus sp. strain R1534 and phaC from Paracoccus sp. strain Rl 14 were obtained using primers based on the P. denitrificans phaA and phaC gene sequences. The PCR fragments were then used as probes to screen a Paracoccus sp. strain Rl 14 ⁇ -library (see Example 4).
  • strain R114 and the deduced amino acid sequences ofthe acetyl-CoA acetyltransferase (PhaA) are illustrated in SEQ ID NO:177, and SEQ ID NOs:178 and 179, respectively.
  • the clustering of genes involved in PHA biosynthesis in operons suggests that at least phaA and phaB are expressed together when the cell produces poly(3- hydroxyalkanoates).
  • a putative transcriptional stop signal is found between the phaA and phaB genes from Paracoccus sp. strain Rl 14 which is absent in the P. denitrificans phaAB operon (Yabutani et al., supra).
  • the expression ofthe two genes might not be coupled in Paracoccus sp. strain Rl 14.
  • the phaA gene was cloned in plasmid pDS-His.
  • the new plasmid, pDS-His-p/zoA was introduced into £. coli strain M15.
  • the resulting strain M15/pDS-His-p/ ⁇ A was grown with and without IPTG induction (as described in Example 5) and crude extracts were prepared for SDS-PAGE analysis.
  • the cloned His-tagged Paracoccus sp. strain Rl 14 PhaA acetyl-CoA acetyltransferase is overproduced upon IPTG induction in the £. coli M15 host.
  • Example 11 Model for the Industrial Production of Lycopene Using Mutants Derived from Paracoccus sp. strain Rl 14 Lycopene is a red carotenoid that is an intermediate in the biosynthesis of zeaxanthin in the new Paracoccus species represented by strain R-1512 and its mutant derivatives R1534 and Rl 14.
  • lycopene itself has significant commercial potential, it was of interest to test the potential ofthe new Paracoccus species to produce lycopene by industrial fermentation.
  • Paracoccus sp. strain R114 was subjected to mutagenesis with ultraviolet (UV) light followed by screening for red colonies. The UV mutagenesis was performed as follows.
  • Table 29 shows the zeaxanthin production and lycopene production by the control strain Rl 14 and its mutant derivative UV7-1.
  • Strain Rl 14 produced only zeaxanthin.
  • Mutant UV7-1 produced mostly lycopene, but also produced a residual amount of zeaxanthin, suggesting that the mutational block in UV7-1 (presumably in the crtY gene) is not complete.
  • Table 28 Recipe and preparation for medium 362F/2
  • Table 29 Zeaxanthin and lycopene production by Paracoccus sp. strain Rl 14 and its red mutant derivative UV7-1.
  • Example 12 Model for the Industrial Production of Astaxanthin by Fermentation Using 5 Strains Derived from Paracoccus sp. strain Rl 14
  • Astaxanthin is a commercially important carotenoid used primarily in the aquaculture industry.
  • EP 872,554 showed that astaxanthin production could be achieved in £. coli by introducing plasmids containing combinations ofthe cloned carotenoid (crt) genes from Paracoccus sp. strain Rl 534 and Paracoccus carotinifaciens E-396 . Together, the cloned crt
  • the crt W gene was amplified by PCR from the cloned crt cluster of Paracoccus carotinifaciens strain E-396 ⁇ (Tsubokura et al., supra; EP 872,554) using the primers crtW-Nde and crtW-Bam (Table 30).
  • the primers were designed such that the ATG start codon constitutes the second half of an Ndel site (cleavage recognition site CATATG), and a B ⁇ mHI site (GGATCC) was introduced immediately after the stop codon.
  • the PCR product was cloned in the pCR 2.1-TOPO vector, resulting in plasmid TOPO-crt .
  • the crtWgene was excised with Ndel and £ ⁇ mHI and subcloned in the Ndel-B ⁇ mHI cut vector pBBR-K-Pcrt£ (described in Example 6) to create plasmid pBBR-K-Pcrt£-crt .
  • Plasmid pBBR-K-Pcrt£-crtW was transferred to Paracoccus sp. strain R114 using a standard bacterial conjugation procedure ⁇ £. coli strain S17 [Priefer et al., J. Bacteriol. 163:324-330 (1985)] was the donor organism ⁇ .
  • Transconjugants were selected on medium 362F/2 agar (Table 28) containing 50 mg/1 kanamycin and purified by restreaking on the same medium. The presence of plasmid pBBR-K-PcrtE-c/?W in the strain was confirmed by PCR.
  • ZXN zeaxanthin
  • AND adonixanthin
  • CXN canthaxanthin
  • AXN astaxanthin.
  • the first nucleotide after the start codon and the last nucleotide before the stop codon must be adenine and the gene must lack sites for at least one ofthe enzymes Bsgl, BseMII, BseRI and Gsul.
  • Four operon construction vectors were constructed, differing in the arrangements of their polylinker sequences (SEQ ID NOs: 190-197).
  • the cleavage sites ofthe first two enzymes are within the Ndel site.
  • the cleavage sites ofthe last two enzymes are before the BamHl site.
  • the BseRI site in pOCV-1 and pOCV-4 is not unique and cannot be used for operon construction.
  • the genes to be assembled in operons are first inserted individually between the Ndel and the B ⁇ mHI sites ofthe appropriate operon construction vectors.
  • the resulting plasmid with the upstream gene ofthe envisioned operon is then cut with one ofthe two enzymes at the end ofthe polylinker and with an enzyme, which has a unique site within the vector backbone.
  • the plasmid containing the downstream gene ofthe envisioned operon is cut with one ofthe first two enzymes ofthe polylinker and with the same enzyme (with a unique site in the vector backbone) used for the first plasmid (containing the desired upstream gene).
  • the fragments carrying the genes are isolated and ligated, resulting in a pOCV plasmid with both genes between the Ndel and the £ ⁇ mHI sites. More genes can be added in an analogous fashion.
  • the assembled genes overlap such that the first two nucleotides, TG, ofthe TGA stop codon ofthe upstream gene coincide the last two nucleotides ofthe ATG start codon ofthe downstream gene.
  • the same overlap is found between all genes in the carotenoid (crt) operon (crtZYIB) in Paracoccus sp. strain R1534 (Pasamontes et al., supra).
  • the pOCV backbone is derived from pCR 2.1-TOPO.
  • the remaining vector was blunt- end ligated after fill-in ofthe Ddel recessed end.
  • the poly- linkers were inserted between the BamHl and Xbal sites by means of annealed oligonucleotides with the appropriate 5' overhangs.
  • Plasmid pBBR-K- VcrtE-crtZW was constructed using the operon construction vector pOCV-2 as follows.
  • the crtZ gene was amplified by PCR from Paracoccus sp. strain Rl 14 using the primers crtZ-Nde and crtZ-Bam (Table 30).
  • the primers were designed such that the ATG start codon constitutes the second half of a Ndel site (cleavage recognition site CATATG) and a BamHl site (GGATCC) was introduced immediately after the stop codon.
  • the PCR product was cloned in the pCR 2.1-TOPO vector, resulting in plasmid TOPO-crtZ.
  • both genes, crtZ and crtW were excised with Ndel and 5 ⁇ mHI from the plasmids TOPO-crtZ and TOPO-crtWand sub- cloned in the Ndel-BamHl cut vector pOCV-2, creating plasmids pOCV-2-crtZ and pOCV-2-crtW.
  • Plasmid pOCV-2-c ⁇ Z was cut with BseM ⁇ l and Pstl (there is a unique Pstl site in the kanamycin resistance gene) and the 2.4 kb fragment (containing crtZ) was ligated with the crt W- containing 1876 bp £seRI-PsfI fragment from pOCV-2-crfW.
  • the resulting plasmid, pOCV-2-crtZW was cut with Ndel and BamHl and the crtZW fragment was ligated with the Ndel-BamHl backbone of pBBR-K-Pcrt£ to yield pBBR-K-Pcrt£- crtZW.
  • Plasmid pBBR-K- PcrtE-crtWZ was constructed in an analogous fashion.
  • strain R114 mevalonate operon (see Example 4). This fragment was subcloned in pUC19, yielding the plasmid pUC19mev-op-up'. To facilitate subcloning, the Kpnl-Hindl ⁇ l fragment of pUCl9mev- op-up' containing the mevalonate genes was recloned in the vector pBluescriptKS + , resulting in plasmid pBluKSp-mev-op-up'.
  • Plasmid pUCmev-op-up-3 was then obtained by combining the Bbsl-Bsal fragment from pUC19mev-op-up-2 carrying the beginning ofthe mevalonate operon with the Bbsl-Bsal fragment from pBluKSp-mev-op-up' containing idi and hcs .
  • a unique Mlul site was introduced between the iVsil and Kpnl sites ofthe vector pBBRlMCS-2 (refer to Example 5) by inserting an annealed primer containing an Mlul restriction site.
  • Plasmid pBBR-K-mev-op-up-4 was then constructed by insertion ofthe Sm ⁇ l fragment from plasmid 16SB3, which contains most ofthe mvk gene and the 5' end of pmk (plasmid 16SB3 is a pUC19-derived plasmid containing the Paracoccus sp.
  • strain R114 SaR-BamHl fragment A refer to Example 4.
  • the insert of plasmid pBBR-K-mev-op-up-4 contains the putative mevalonate operon promoter region, the first four genes ofthe mevalonate operon and the 5' end of pmk .
  • Plasmids pBBR-K-mev-opl6-2 and pBBR-K-mev-op-up-4 were each introduced into Paracoccus sp. strain R114 by electroporation. Production of zeaxanthin and mevalonate by the new strains were compared to the control strain R114. The strains were grown in baffled shake flasks in liquid medium 362F/2 (see Example 11) for 72 hours. For strains R114/pBBR-K-mev-opl6-2 and R114/pBBR-K-mev-op-up-4, kanamycin (50 mg/1) was also added to the cultures. The cultivation temperature was 28°C and shaking was at 200 rpm.
  • Zeaxanthin was measured by the method set forth in Example 1, while mevalonate in the culture supernatants was measured as follows: A 0.6 ml sample ofthe culture was centrifuged for 4 minutes at 13,000 x g. Four hundred microliters ofthe supernatant were added to 400 microliters of methanol and mixed by vortexing for 1 min. The mixture was centrifuged again for 4 minutes at 13,000 x g. The resulting supernatant was then analyzed directly by gas chromatography (GC) using the method of Lindemann et al. [J. Pharm. Biomed. Anal. 9:311-316 (1991)] with minor modification as follows.
  • GC gas chromatography
  • the GC was a Hewlett-Packard 6890plus instrument (Hewlett-Packard, Avondale, PA, USA) equipped with a cool-on-column injector and a flame ionization detector.
  • One microliter of sample prepared as described above was injected onto a fused silica capillary column (15m length x 0.32mm ID) coated with a 0.52 micron film of crosslinked modified polyethylene glycol (HP-FFAP, Agilent Technologies, USA).
  • Helium was used as the carrier gas at an inlet pressure of 0.6 bar.
  • the temperature ofthe programmable injector was ramped from 82°C to 250°C at a rate of 30°C/minute.
  • the column temperature profile was 80°C for 0.5 minutes, followed by a linear temperature gradient at 15°C/min to 250°C and finally held at 250°C for 5 minutes.
  • the detector temperature was maintained at 320°C.
  • Table 32 Zeaxanthin and mevalonate production in strains R114 and R114/pBBR-K- mev-opl6-2.
  • Table 33 Zeaxanthin and mevalonate production in strains Rl 14 and Rl 14/pBBR-K- mev-op-up-4.
  • accession numbers The following biological material was deposited under the terms ofthe Budapest Treaty with the American Type Culture Collection (ATCC) at 10801 University Boulevard., Manassas, VA 20110-2201, USA, and were assigned the following accession numbers:

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Compounds Of Unknown Constitution (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
PCT/EP2002/006171 2001-06-06 2002-06-05 Improved isoprenoid production Ceased WO2002099095A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
JP2003502205A JP4280627B2 (ja) 2001-06-06 2002-06-05 改善されたイソプレノイド産生法
AU2002316966A AU2002316966B2 (en) 2001-06-06 2002-06-05 Improved isoprenoid production
DE60228439T DE60228439D1 (de) 2001-06-06 2002-06-05 Verbesserte isoprenoid herstellung
CA002449885A CA2449885A1 (en) 2001-06-06 2002-06-05 Improved isoprenoid production
EP02745362A EP1392824B1 (en) 2001-06-06 2002-06-05 Improved isoprenoid production
KR1020037015938A KR100704072B1 (ko) 2001-06-06 2002-06-05 개선된 이소프레노이드 제조 방법

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US29629901P 2001-06-06 2001-06-06
US60/296,299 2001-06-06

Publications (2)

Publication Number Publication Date
WO2002099095A2 true WO2002099095A2 (en) 2002-12-12
WO2002099095A3 WO2002099095A3 (en) 2003-12-18

Family

ID=23141440

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/006171 Ceased WO2002099095A2 (en) 2001-06-06 2002-06-05 Improved isoprenoid production

Country Status (11)

Country Link
US (2) US6989257B2 (https=)
EP (1) EP1392824B1 (https=)
JP (1) JP4280627B2 (https=)
KR (1) KR100704072B1 (https=)
CN (1) CN1630718A (https=)
AT (1) ATE405638T1 (https=)
AU (1) AU2002316966B2 (https=)
CA (1) CA2449885A1 (https=)
DE (1) DE60228439D1 (https=)
ES (1) ES2311613T3 (https=)
WO (1) WO2002099095A2 (https=)

Cited By (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004065591A1 (en) * 2003-01-21 2004-08-05 Ecopia Biosciences Inc. Farnesyl dibenzodiazepinones, processes for their production and their use as pharmaceuticals
WO2004111214A1 (en) * 2003-06-12 2004-12-23 Dsm Ip Assets B.V. Feedback-resistant mevalonate kinases
WO2005005650A1 (en) * 2003-07-08 2005-01-20 Dsm Ip Assets B.V. Improved production of coenzyme q-10
WO2006018211A1 (en) * 2004-08-19 2006-02-23 Dsm Ip Assets B.V. Production of isoprenoids
WO2006063752A1 (en) * 2004-12-14 2006-06-22 Dsm Ip Assets B.V. Improved mevalonate kinase
US7172886B2 (en) 2001-12-06 2007-02-06 The Regents Of The University Of California Biosynthesis of isopentenyl pyrophosphate
WO2007028602A1 (en) 2005-09-08 2007-03-15 Dsm Ip Assets B.V. Novel gene sms 37
US7192751B2 (en) 2001-12-06 2007-03-20 The Regents Of The University Of California Biosynthesis of amorpha-4,11-diene
WO2009115629A1 (es) * 2008-03-19 2009-09-24 Vitatene, S.A. Método de producción de fitoeno y/o fitoflueno, o mezclas de carotenoides con alto contenido en los mismos
US7618819B2 (en) 2000-07-31 2009-11-17 University Of Hawaii Use of pseudogene insertion sites to create novel traits in transgenic organisms
WO2010001078A3 (fr) * 2008-07-04 2010-07-01 Philippe Marliere Production d'alcenes par decarboxylation enzymatique d'acides 3-hydroxy-alcanoïques
US7851199B2 (en) 2005-03-18 2010-12-14 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi
EP2308965A1 (en) 2005-02-11 2011-04-13 DSM IP Assets B.V. Fermentative vitamin C production
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
WO2011074954A2 (en) 2009-12-16 2011-06-23 Isobionics B.V. Valencene synthase
US8017358B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8026084B2 (en) 2005-07-21 2011-09-27 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8173410B2 (en) 2008-04-23 2012-05-08 Danisco Us Inc. Isoprene synthase variants for improved microbial production of isoprene
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8187814B2 (en) 2004-02-18 2012-05-29 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8214154B2 (en) 2001-03-02 2012-07-03 Ibis Biosciences, Inc. Systems for rapid identification of pathogens in humans and animals
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US8288148B2 (en) 2007-12-13 2012-10-16 Danisco Us Inc. Compositions and methods for producing isoprene
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US8518686B2 (en) 2009-04-23 2013-08-27 Danisco Us Inc. Three-dimensional structure of isoprene synthase and its use thereof for generating variants
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
WO2014096992A1 (en) * 2012-12-20 2014-06-26 Dsm Ip Assets B.V. Acetyl transferases and their use for producing carotenoids
US8822156B2 (en) 2002-12-06 2014-09-02 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US9163263B2 (en) 2012-05-02 2015-10-20 The Goodyear Tire & Rubber Company Identification of isoprene synthase variants with improved properties for the production of isoprene
US9193978B2 (en) 2010-10-19 2015-11-24 Scientist of Fortune, S.A. Production of alkenes by combined enzymatic conversion of 3-hydroxyalkanoic acids
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
WO2016008885A1 (en) * 2014-07-14 2016-01-21 Photanol B.V. Biosynthesis of sesquiterpenes in cyanobacteria
US9273298B2 (en) 2010-10-27 2016-03-01 Danisco Us Inc. Isoprene synthase variants for improved production of isoprene
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US9873906B2 (en) 2004-07-14 2018-01-23 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US9890408B2 (en) 2009-10-15 2018-02-13 Ibis Biosciences, Inc. Multiple displacement amplification
US10087424B2 (en) 2013-07-16 2018-10-02 Sumitomo Rubber Industries, Ltd. Method for adjusting expression of hydroxymethylglutaryl CoA reductase using bZIP-type transcription factor, isoprenoid-producing plant into which gene encoded for bZIP-type transcription factor is introduced, and method for manufacturing polyisoprenoid in which said plant is used
US10947515B2 (en) 2015-03-16 2021-03-16 Dsm Ip Assets B.V. UDP-glycosyltransferases

Families Citing this family (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7927794B2 (en) * 2003-09-29 2011-04-19 The Regents Of The University Of California Methods for identifying a biosynthetic pathway gene product
ATE537269T1 (de) * 2004-05-21 2011-12-15 Univ California Verfahren zur verbesserung der herstellung von isoprenoid-zusammensetzungen
JP2006280297A (ja) * 2005-04-01 2006-10-19 Tosoh Corp ゲラニルゲラニル2リン酸合成酵素及びその遺伝子等
JP5023474B2 (ja) * 2005-10-28 2012-09-12 東ソー株式会社 カロテノイド合成微生物の作製方法およびカロテノイドの製造方法
EP2471919A1 (en) 2005-10-28 2012-07-04 Tosoh Corporation Method of preparing carotenoid synthesizing microorganism and method of producing carotenoids
JP4887764B2 (ja) * 2005-12-06 2012-02-29 東ソー株式会社 新規微生物およびそれを用いたリコペンの製造法
JP2007151475A (ja) * 2005-12-06 2007-06-21 Tosoh Corp 新規微生物およびそれを用いたゼアキサンチンの製造方法
DE102006001868B4 (de) * 2006-01-13 2012-03-01 Austriamicrosystems Ag Schaltungsanordnung und Verfahren zur Ansteuerung einer elektrischen Last und eine Energieversorgungseinrichtung
US8114645B2 (en) * 2006-05-19 2012-02-14 The Regents Of The University Of California Methods for increasing isoprenoid and isoprenoid precursor production by modulating fatty acid levels
WO2007140339A2 (en) 2006-05-26 2007-12-06 Amyris Biotechnologies, Inc. Production of isoprenoids
BRPI0713105B8 (pt) * 2006-05-26 2021-05-25 Amyris Biotechnologies Inc método para produzir um isoprenóide
AU2012202630B2 (en) * 2006-05-26 2014-01-16 Amyris, Inc. Production of isoprenoids
CA2652801C (en) * 2006-05-26 2018-05-22 Amyris Biotechnologies, Inc. Apparatus for making bio-organic compounds
WO2008008256A2 (en) * 2006-07-07 2008-01-17 The Regents Of The University Of California Methods for enhancing production of isoprenoid compounds by host cells
EP2078092A2 (en) 2006-09-28 2009-07-15 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi
US7531980B2 (en) * 2007-03-02 2009-05-12 Honeywell International Inc. Aircraft cabin pressure controls: duty cycle offset to compensate for asymmetric motor loading in an open-loop motor control system
JP2009000046A (ja) * 2007-06-21 2009-01-08 Hitachi Zosen Corp トチュウのメバロン酸経路の酵素をコードする遺伝子
WO2009005704A1 (en) * 2007-07-03 2009-01-08 The Regents Of The University Of California Methods of increasing isoprenoid or isoprenoid precursor production
US9556456B2 (en) * 2008-09-09 2017-01-31 Battelle Memorial Institute Production of bio-based materials using photobioreactors with binary cultures
SG179032A1 (en) * 2009-09-15 2012-04-27 Wwcc Ltd Nucleic acid molecule encoding triterpenoid synthase
WO2011076261A1 (en) 2009-12-22 2011-06-30 Global Bioenergies Process for the production of isoprenol from mevalonate employing a diphosphomevalonate decarboxylase
EP2575432B1 (en) 2010-06-02 2019-08-14 Evolva, Inc. Recombinant production of steviol glycosides
CA3128532A1 (en) 2011-08-08 2013-02-14 Evolva Sa Recombinant production of steviol glycosides
US20130323820A1 (en) * 2012-06-01 2013-12-05 Lanzatech New Zealand Limited Recombinant microorganisms and uses therefor
WO2014052054A1 (en) * 2012-09-25 2014-04-03 Albert Einstein College Of Medicine Of Yeshiva University Enzymatic platform for the synthesis of isoprenoid precursors and uses thereof
US20150315599A1 (en) * 2012-12-07 2015-11-05 Ginkgo Bioworks, Inc Methods and Systems for Methylotrophic Production of Organic Compounds
MY199452A (en) 2013-02-06 2023-10-30 Evolva Sa Methods for improved production of rebaudioside d and rebaudioside m
BR112015019160A2 (pt) 2013-02-11 2017-08-22 Dalgaard Mikkelsen Michael Produção de glicosídeos de esteviol em hospedeiros recombinantes
EA035489B1 (ru) * 2013-03-15 2020-06-24 ДСМ АйПи АССЕТС Б.В. Применение термофильных нуклеаз для разрушения нуклеиновых кислот в клетках-хозяевах
CA2957331A1 (en) 2014-08-11 2016-02-18 Evolva Sa Production of steviol glycosides in recombinant hosts
CA2960693A1 (en) 2014-09-09 2016-03-17 Evolva Sa Production of steviol glycosides in recombinant hosts
EP3250686A1 (en) 2015-01-30 2017-12-06 Evolva SA Production of steviol glycosides in recombinant hosts
MX2018001620A (es) 2015-08-07 2018-06-11 Evolva Sa Produccion de glucosidos de esteviol en hospedadores recombinantes.
US20180291401A1 (en) * 2015-08-17 2018-10-11 Invista North America S.A.R.L. Methods, hosts, and reagents related thereto for production of unsaturated pentahydrocarbons, derivatives and intermediates thereof
EP3341490B1 (de) * 2015-08-28 2021-05-12 Phytowelt Greentechnologies GmbH Verfahren zur fermentativen alpha-ionon produktion
JP6357186B2 (ja) * 2016-03-31 2018-07-11 Jxtgエネルギー株式会社 カロテノイドの製造方法
US10982249B2 (en) 2016-04-13 2021-04-20 Evolva Sa Production of steviol glycosides in recombinant hosts
EP3458599A1 (en) 2016-05-16 2019-03-27 Evolva SA Production of steviol glycosides in recombinant hosts
WO2018083338A1 (en) 2016-11-07 2018-05-11 Evolva Sa Production of steviol glycosides in recombinant hosts
US11162115B2 (en) 2017-06-30 2021-11-02 Inv Nylon Chemicals Americas, Llc Methods, synthetic hosts and reagents for the biosynthesis of hydrocarbons
US11634733B2 (en) 2017-06-30 2023-04-25 Inv Nylon Chemicals Americas, Llc Methods, materials, synthetic hosts and reagents for the biosynthesis of hydrocarbons and derivatives thereof
US11505809B2 (en) 2017-09-28 2022-11-22 Inv Nylon Chemicals Americas Llc Organisms and biosynthetic processes for hydrocarbon synthesis
CN108285902A (zh) * 2017-11-03 2018-07-17 杭州爱蔻思生物科技有限公司 生产高价值天然产物的工程菌的构造方法
WO2019113387A1 (en) 2017-12-07 2019-06-13 Zymergen Inc. Engineered biosynthetic pathways for production of (6e)-8-hydroxygeraniol by fermentation
JP2021506316A (ja) 2017-12-21 2021-02-22 ザイマージェン インコーポレイテッド ネペタラクトールオキシドレダクターゼ、ネペタラクトールシンターゼ、及びネペタラクトンを産生する能力がある微生物
JP6810096B2 (ja) * 2018-05-09 2021-01-06 Eneos株式会社 カロテノイドの製造方法
CN109666683B (zh) * 2019-02-27 2021-10-29 昆明理工大学 乙酰辅酶A乙酰转移酶基因RKAcaT2及其应用
CN109880745A (zh) * 2019-03-15 2019-06-14 江苏大学 一种利用腌制废水、晒盐卤水分段培养盐藻的方法
CN109777815B (zh) * 2019-03-28 2021-10-29 昆明理工大学 HMG-CoA合成酶基因RKHMGCS及其应用
JP7527038B2 (ja) * 2019-12-26 2024-08-02 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア カンナビノイド及び他のプレニル化化合物を産生するための生合成プラットフォーム
CN115605589A (zh) * 2020-05-15 2023-01-13 巴斯夫欧洲公司(De) 改进的用于生产类异戊二烯的方法
JP2023147514A (ja) * 2022-03-30 2023-10-13 株式会社digzyme ポリエーテルジオールの製造方法
CN117965414B (zh) * 2024-04-01 2024-06-14 北京微构工场生物技术有限公司 一种重组盐单胞菌及其在生产异戊二烯中的应用

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3891504A (en) * 1970-07-31 1975-06-24 Hoffmann La Roche Process for the manufacture of zeaxanthin
US5015580A (en) * 1987-07-29 1991-05-14 Agracetus Particle-mediated transformation of soybean plants and lines
US5328845A (en) * 1992-03-27 1994-07-12 Universal Foods Corporation Fungal negative microorganism capable of producing high levels of beta-carotene
US5466599A (en) * 1993-04-19 1995-11-14 Universal Foods Corporation Astaxanthin over-producing strains of phaffia rhodozyma
US5985623A (en) * 1995-01-24 1999-11-16 Shin-Etsu Bio, Inc. DNA segments and methods for increasing polysaccharide production
DE69631924T2 (de) * 1995-06-09 2004-08-12 Dsm Ip Assets B.V. Fermentative Herstellung von Carotenoiden
DE69722766T2 (de) 1996-12-02 2004-04-22 Dsm Ip Assets B.V. Verbesserte fermentative Herstellung von Carotenoide
US5935808A (en) * 1997-07-29 1999-08-10 Yissum Research And Development Company Of The Hebrew University Of Jerusalem Carotenoid-producing bacterial species and process for production of carotenoids using same
US6208893B1 (en) * 1998-01-27 2001-03-27 Genetronics, Inc. Electroporation apparatus with connective electrode template
EP2175025A1 (en) * 1998-04-14 2010-04-14 Kyowa Hakko Bio Co., Ltd. Process for producing isoprenoid compounds by using microorganisms
CN1308623A (zh) 1998-07-06 2001-08-15 伊斯曼化学公司 生产维生素e的方法
JP4579415B2 (ja) * 1998-07-06 2010-11-10 ディーシーブイ・インコーポレイテッド・ドゥーイング・ビジネス・アズ・バイオ−テクニカル・リソーシィズ ビタミン製造方法
ES2156735B1 (es) 1999-06-09 2002-02-16 Antibioticos Sau Procedimiento de produccion de licopeno.
US6133785A (en) 1999-06-30 2000-10-17 Harris Corporation False carrier lock receiver and associated methods for detection

Cited By (105)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2281890A1 (en) 2000-07-31 2011-02-09 Danisco US Inc. Manipulation of genes of the mevalonate and isoprenoid pathways to create novel traits in transgenic organisms
US7618819B2 (en) 2000-07-31 2009-11-17 University Of Hawaii Use of pseudogene insertion sites to create novel traits in transgenic organisms
US8999682B2 (en) 2000-07-31 2015-04-07 Danisco Us Inc. Manipulation of genes of the mevalonate and isoprenoid pathways to create novel traits in transgenic organisms
US8802372B2 (en) 2001-03-02 2014-08-12 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US9752184B2 (en) 2001-03-02 2017-09-05 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US9416424B2 (en) 2001-03-02 2016-08-16 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
US8265878B2 (en) 2001-03-02 2012-09-11 Ibis Bioscience, Inc. Method for rapid detection and identification of bioagents
US8017358B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8815513B2 (en) 2001-03-02 2014-08-26 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents in epidemiological and forensic investigations
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US8214154B2 (en) 2001-03-02 2012-07-03 Ibis Biosciences, Inc. Systems for rapid identification of pathogens in humans and animals
US8380442B2 (en) 2001-06-26 2013-02-19 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8921047B2 (en) 2001-06-26 2014-12-30 Ibis Biosciences, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US7667017B2 (en) 2001-12-06 2010-02-23 The Regents Of The University Of California Isolated mevalonate pathway enzyme nucleic acids
US7622283B2 (en) 2001-12-06 2009-11-24 The Regents Of The University Of California Methods for synthesizing mevalonate
US7622282B2 (en) 2001-12-06 2009-11-24 The Regents Of The University Of California Biosynthesis of isopentenyl pyrophosphate
US7736882B2 (en) 2001-12-06 2010-06-15 The Regents Of The University Of California Host cells for production of isoprenoid compounds
US7192751B2 (en) 2001-12-06 2007-03-20 The Regents Of The University Of California Biosynthesis of amorpha-4,11-diene
US8288147B2 (en) 2001-12-06 2012-10-16 The Regents Of The University Of California Host cells for production of isoprenoid compounds
US7172886B2 (en) 2001-12-06 2007-02-06 The Regents Of The University Of California Biosynthesis of isopentenyl pyrophosphate
US7915026B2 (en) 2001-12-06 2011-03-29 The Regents Of The University Of California Host cells for production of isoprenoid compounds
US8822156B2 (en) 2002-12-06 2014-09-02 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US9725771B2 (en) 2002-12-06 2017-08-08 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
WO2004065591A1 (en) * 2003-01-21 2004-08-05 Ecopia Biosciences Inc. Farnesyl dibenzodiazepinones, processes for their production and their use as pharmaceuticals
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8476415B2 (en) 2003-05-13 2013-07-02 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US7422884B2 (en) 2003-06-12 2008-09-09 Dsm Ip Assetts B.V. Feedback-resistant mevalonate kinases
WO2004111214A1 (en) * 2003-06-12 2004-12-23 Dsm Ip Assets B.V. Feedback-resistant mevalonate kinases
CN100558889C (zh) * 2003-07-08 2009-11-11 帝斯曼知识产权资产管理有限公司 生产辅酶q-10的改进方法
JP2009513104A (ja) * 2003-07-08 2009-04-02 ディーエスエム アイピー アセッツ ビー.ブイ. コエンザイムq−10の向上した産生
WO2005005650A1 (en) * 2003-07-08 2005-01-20 Dsm Ip Assets B.V. Improved production of coenzyme q-10
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US8013142B2 (en) 2003-09-11 2011-09-06 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US9447462B2 (en) 2004-02-18 2016-09-20 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8187814B2 (en) 2004-02-18 2012-05-29 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US9449802B2 (en) 2004-05-24 2016-09-20 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8987660B2 (en) 2004-05-24 2015-03-24 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US9873906B2 (en) 2004-07-14 2018-01-23 Ibis Biosciences, Inc. Methods for repairing degraded DNA
WO2006018211A1 (en) * 2004-08-19 2006-02-23 Dsm Ip Assets B.V. Production of isoprenoids
KR101169824B1 (ko) * 2004-08-19 2012-07-30 디에스엠 아이피 어셋츠 비.브이. 아이소프레노이드의 제조
JP2008509689A (ja) * 2004-08-19 2008-04-03 ディーエスエム アイピー アセッツ ビー.ブイ. イソプレノイドの生成
US7572609B2 (en) 2004-08-19 2009-08-11 Dsm Ip Assets B.V. Production of isoprenoids
US8338155B2 (en) 2004-12-14 2012-12-25 Dsm Ip Assets B.V. Modified mevalonate kinase with reduced feedback inhibition
EP1824969B1 (en) * 2004-12-14 2011-03-02 DSM IP Assets B.V. Improved mevalonate kinase
WO2006063752A1 (en) * 2004-12-14 2006-06-22 Dsm Ip Assets B.V. Improved mevalonate kinase
EP2308965A1 (en) 2005-02-11 2011-04-13 DSM IP Assets B.V. Fermentative vitamin C production
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US7851199B2 (en) 2005-03-18 2010-12-14 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi
US9909130B2 (en) 2005-03-18 2018-03-06 Dsm Ip Assets B.V. Production of carotenoids in oleaginous yeast and fungi
US8026084B2 (en) 2005-07-21 2011-09-27 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
US8551738B2 (en) 2005-07-21 2013-10-08 Ibis Biosciences, Inc. Systems and methods for rapid identification of nucleic acid variants
WO2007028602A1 (en) 2005-09-08 2007-03-15 Dsm Ip Assets B.V. Novel gene sms 37
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US8709785B2 (en) 2007-12-13 2014-04-29 Danisco Us Inc. Compositions and methods for producing isoprene
US9260727B2 (en) 2007-12-13 2016-02-16 Danisco Us Inc. Compositions and methods for producing isoprene
US10626420B2 (en) 2007-12-13 2020-04-21 Danisco Us Inc. Compositions and methods for producing isoprene
US8288148B2 (en) 2007-12-13 2012-10-16 Danisco Us Inc. Compositions and methods for producing isoprene
US9909144B2 (en) 2007-12-13 2018-03-06 Danisco Us Inc. Compositions and methods for producing isoprene
ES2330602B1 (es) * 2008-03-19 2010-09-30 Vitatene, S.A Metodo de produccion de fitoeno y/o fitoflueno, o mezclas de carotenoides con alto contenido en los mismos.
ES2330602A1 (es) * 2008-03-19 2009-12-11 Vitatene, S.A Metodo de produccion de fitoeno y/o fitoflueno, o mezclas de carotenoides con alto contenido en los mismos.
WO2009115629A1 (es) * 2008-03-19 2009-09-24 Vitatene, S.A. Método de producción de fitoeno y/o fitoflueno, o mezclas de carotenoides con alto contenido en los mismos
US8916370B2 (en) 2008-04-23 2014-12-23 Danisco Us Inc. Isoprene synthase variants for improved microbial production of isoprene
US8173410B2 (en) 2008-04-23 2012-05-08 Danisco Us Inc. Isoprene synthase variants for improved microbial production of isoprene
WO2010001078A3 (fr) * 2008-07-04 2010-07-01 Philippe Marliere Production d'alcenes par decarboxylation enzymatique d'acides 3-hydroxy-alcanoïques
US9909146B2 (en) 2008-07-04 2018-03-06 Scientist Of Fortune S.A. Production of alkenes by enzymatic decarboxylation of 3-hydroxyalkanoic acids
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US9027730B2 (en) 2008-09-16 2015-05-12 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US9023655B2 (en) 2008-09-16 2015-05-05 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8252599B2 (en) 2008-09-16 2012-08-28 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8609430B2 (en) 2008-09-16 2013-12-17 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8796617B2 (en) 2009-02-12 2014-08-05 Ibis Biosciences, Inc. Ionization probe assemblies
US9165740B2 (en) 2009-02-12 2015-10-20 Ibis Biosciences, Inc. Ionization probe assemblies
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US8518686B2 (en) 2009-04-23 2013-08-27 Danisco Us Inc. Three-dimensional structure of isoprene synthase and its use thereof for generating variants
US9175313B2 (en) 2009-04-23 2015-11-03 Danisco Us Inc. Three-dimensional structure of isoprene synthase and its use thereof for generating variants
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9890408B2 (en) 2009-10-15 2018-02-13 Ibis Biosciences, Inc. Multiple displacement amplification
WO2011074954A2 (en) 2009-12-16 2011-06-23 Isobionics B.V. Valencene synthase
US9193978B2 (en) 2010-10-19 2015-11-24 Scientist of Fortune, S.A. Production of alkenes by combined enzymatic conversion of 3-hydroxyalkanoic acids
US9273298B2 (en) 2010-10-27 2016-03-01 Danisco Us Inc. Isoprene synthase variants for improved production of isoprene
US9163263B2 (en) 2012-05-02 2015-10-20 The Goodyear Tire & Rubber Company Identification of isoprene synthase variants with improved properties for the production of isoprene
WO2014096992A1 (en) * 2012-12-20 2014-06-26 Dsm Ip Assets B.V. Acetyl transferases and their use for producing carotenoids
US10465174B2 (en) 2012-12-20 2019-11-05 Dsm Ip Assets B.V. Acetyl transferases and their use for producing carotenoids
EA033724B1 (ru) * 2012-12-20 2019-11-20 Dsm Ip Assets Bv Трансформированные микроорганизмы, обладающие ацетилтрансферазной активностью и способные продуцировать ацетилированные каротиноиды, и их применение
US10865392B2 (en) 2012-12-20 2020-12-15 Dsm Ip Assets B.V. Acetyl transferases and their use for producing carotenoids
US10087424B2 (en) 2013-07-16 2018-10-02 Sumitomo Rubber Industries, Ltd. Method for adjusting expression of hydroxymethylglutaryl CoA reductase using bZIP-type transcription factor, isoprenoid-producing plant into which gene encoded for bZIP-type transcription factor is introduced, and method for manufacturing polyisoprenoid in which said plant is used
WO2016008885A1 (en) * 2014-07-14 2016-01-21 Photanol B.V. Biosynthesis of sesquiterpenes in cyanobacteria
US10947515B2 (en) 2015-03-16 2021-03-16 Dsm Ip Assets B.V. UDP-glycosyltransferases
US11459548B2 (en) 2015-03-16 2022-10-04 Dsm Ip Assets B.V. UDP-glycosyltransferases

Also Published As

Publication number Publication date
EP1392824B1 (en) 2008-08-20
US20030148416A1 (en) 2003-08-07
JP2004527265A (ja) 2004-09-09
ES2311613T3 (es) 2009-02-16
US6989257B2 (en) 2006-01-24
AU2002316966B2 (en) 2007-05-17
DE60228439D1 (de) 2008-10-02
KR20040010683A (ko) 2004-01-31
ATE405638T1 (de) 2008-09-15
CN1630718A (zh) 2005-06-22
EP1392824A2 (en) 2004-03-03
US20050266518A1 (en) 2005-12-01
US7232679B2 (en) 2007-06-19
JP4280627B2 (ja) 2009-06-17
WO2002099095A3 (en) 2003-12-18
CA2449885A1 (en) 2002-12-12
KR100704072B1 (ko) 2007-04-05

Similar Documents

Publication Publication Date Title
EP1392824B1 (en) Improved isoprenoid production
AU2002316966A1 (en) Improved isoprenoid production
EP1383864B1 (en) Isoprenoid production
CN103608454B (zh) 开发萜烯合酶变体的方法
US8741612B2 (en) Microorganisms and processes for the production of isoprene
US20160017374A1 (en) Compositions and methods for biological production of isoprene
EP1856251A1 (en) Metabolically engineered cells for the production of resveratrol or an oligomeric or glycosidically-bound derivative thereof
Wang et al. Cloning and characterization of the gene encoding 1-cyclohexenylcarbonyl coenzyme A reductase from Streptomyces collinus
CN110366595A (zh) 倍半萜和类胡萝卜素的共同生成
KR20060060657A (ko) 조효소 q-10의 개선된 생산
EP3303599A1 (en) Production of fragrant compounds
CN114599787A (zh) 利用酿酒酵母(Saccharomyces Cerevisiae)从简单前体原料可持续生产大麻素
US7435571B2 (en) Microbial production of COQ10
HK40075557A (en) Sustainable production of cannabinoids from simple precursor feedstocks using saccharomyces cerevisiae
HK1062580B (en) Isoprenoid production

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2002745362

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2002316966

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2003502205

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2449885

Country of ref document: CA

Ref document number: 028113802

Country of ref document: CN

Ref document number: 1020037015938

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2002745362

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 2002316966

Country of ref document: AU

WWG Wipo information: grant in national office

Ref document number: 2002745362

Country of ref document: EP