WO2000001815A2 - Neurotrophic factors - Google Patents
Neurotrophic factors Download PDFInfo
- Publication number
- WO2000001815A2 WO2000001815A2 PCT/DK1999/000384 DK9900384W WO0001815A2 WO 2000001815 A2 WO2000001815 A2 WO 2000001815A2 DK 9900384 W DK9900384 W DK 9900384W WO 0001815 A2 WO0001815 A2 WO 0001815A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- neublastin
- seq
- polypeptide
- nucleic acid
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/4756—Neuregulins, i.e. p185erbB2 ligands, glial growth factor, heregulin, ARIA, neu differentiation factor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/02—Muscle relaxants, e.g. for tetanus or cramps
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/06—Anabolic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/02—Drugs for disorders of the nervous system for peripheral neuropathies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
- A61P27/06—Antiglaucoma agents or miotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P39/00—General protective or antinoxious agents
- A61P39/02—Antidotes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Definitions
- the invention relates to neurotrophic factor polypeptides, nucleic acids encoding neurotrophic factor polypeptides, and antibodies that bind specifically to neurotrophic factors.
- Neurotrophic factors are naturally-occurring proteins which promote survival, maintain phenotypic differentiation, prevent degeneration, and enhance the activity of neuronal cells and tissues.
- Neurotrophic factors are isolated from neural tissue and from non-neural tissue that is innervated by the nervous system, and have been classified into functionally and structurally related groups, also referred to as families, superfamiiies, or subfamilies.
- the neurotrophic factor superfamilies are the fibroblast growth factor, neurotrophin, and transforming growth factor- ⁇ (TGF- ⁇ ) superfamilies.
- TGF- ⁇ transforming growth factor- ⁇
- Individual species of neurotrophic factors are distinguished by their physical structure, their interaction with their composite receptors, and their affects on various types of nerve cells.
- GDNF glial cell line-derived neurotrophic factor ligands
- PSP persephin
- NPN neurturin
- GDNF subfamily differ in their relative affinities for a family of neurotrophic receptors, the GFR® receptors. Due to the affects of neurotrophic factors on neuronal tissue, there remains a need to identify and characterise additional neurotrophic factors for diagnosing and treating disorders of the nervous system.
- neurotrophic factor herein called "neublastin,” or
- NNN Neublastin is classified within the GDNF subfamily because it shares regions of homology with other GDNF ligands (see Tables 3 and 4, infra) and because of its ability to interact with RET (see, e.g., Airaksinen et al., Mol. Cell. Neuroscience. 1999 13 313- 325), neublastin is a novel and unique neurotrophic factor. Unlike other GDNF ligands, neublastin exhibits high affinity for the GFR ⁇ 3-RET receptor complex and unique subregions in its amino acid sequence.
- a “neublastin polypeptide,” as used herein, is a polypeptide which possesses neurotrophic activity (e.g., as described in Examples 6, 7, 8, and 9) and includes those polypeptides which have an amino acid sequence that has at least 70% homology to the human "neublastin" polypeptides set forth in AA -95 -AA 10 5 of SEQ ID NO: 2, AA AA105 of SEQ ID NO: 2, AA -97 -AA 1 0 of SEQ ID NO: 4, AA ⁇ -AA ⁇ o of SEQ ID NO: 4 (“pro"), AA ⁇ -AA 140 of SEQ ID NO: 4, AA ⁇ o-AAwo of SEQ ID NO: 9 ("wild type” prepro), AA- 4 1-AA o of SEQ ID NO: 9 (pro), AA AA 14 o of SEQ ID NO: 5 (mature 140AA), AA AAn ⁇ of SEQ ID NO: 6 (mature 116AA), AA AA 113 of SEQ ID NO: 7 (mature 113
- the C-terminal sequence of the above identified neublastin polypeptides has an amino acid sequence as set forth in AA 2 -AA ⁇ 05 of SEQ ID NO: 2 (i.e., AA ⁇ o7-AA 14 o of SEQ ID NO: 9), more preferably AA 4 AA 10 5 of SEQ ID NO: 2 (i.e., AA 76 -AA-i4o of SEQ ID NO: 9), or the amino acid sequence set forth in AAi9i-AA 224 of SEQ ID NO: 16.
- the neublastin polypeptide retain the 7 conserved Cys residues that are characteristic of the GDNF family and of the TGF-beta super family.
- the neublastin polypeptide has an amino acid sequence greater than 85% homology, most preferably greater than 95% homology, to the foregoing sequences (i.e., AA. 95 -AA ⁇ o5 of SEQ ID NO: 2, AA AA 10 5 of SEQ ID NO: 2, AA -97 - AA 140 of SEQ ID NO: 4, AA AA o of SEQ ID NO: 4, AA ⁇ -AA o of SEQ ID NO: 4, AA- ⁇ o-AA o of SEQ ID NO: 9 ("wild type" prepro), AA -4 ⁇ -AA ⁇ 4 o of SEQ ID NO: 9 (pro), AA AA 140 of SEQ ID NO: 5 (mature 140AA), AA AA 116 of SEQ ID NO: 6 (mature 116AA), AA ⁇ -AA 113 of SEQ ID NO: 7 (mature 113AA), AA AA 140 of SEQ ID NO: 10 (mature 140AA), AA ⁇ AAne of SEQ ID NO: 11
- a “neublastin nucleic acid,” as used herein, is a polynucleotide which codes for a neublastin polypeptide. Accordingly, an isolated neublastin nucleic acid is a polynucleotide molecuie having an open reading frame of nucleotide codons that, were it to be exposed to the appropriate components required for translation, would encode, or code for, a neublastin polypeptide.
- Neublastin nucleic acids of the invention may be RNA or DNA, e.g., genomic DNA, or DNA which is complementary to and/or transcribed from, a neublastin mRNA ("cDNA").
- a neublastin nucleic acid of the invention further includes polynucleotide molecules which hybridize with specificity, under high stringency hybridization conditions, to a polynucleotide that codes for a neublastin polypeptide.
- This invention also relates to nucleic acid primers that are useful in identifying, isolating and amplifying polynucleotides that encode neublastin polypeptides, or fragments thereof.
- certain of these primers are neublastin-specific probes useful for hybridization to a neublastin nucleic acid, but not to nucleic acids coding for the other members of the GDNF family.
- GDNF GDNF, persephin, and neurturin
- a neublastin nucleic acid of the invention is one that is identified as being complementary to a polynucleotide that codes for a neublastin polypeptide, either by having a complementary nucleic acid sequence or demonstrating that it hybridizes with specificity at high stringency hybridization conditions to a polynucleotide that codes for neublastin.
- Particular neublastin nucleic acids include, without limitation, the nucleic acid sequences shown herein and designated SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 29 and SEQ ID NO: 30 as well as primers SEQ ID NOS: 17-28, 31 and 32.
- a neublastin nucleic acid of the invention further includes a unique subregion, or fragment, of a neublastin nucleic acid, including without limitation the nucleic acid fragments shown in FIG. 8.
- the neublastin nucleic acids of the invention may be used to express a neublastin polypeptide, e.g., by expressing a neublastin polypeptide in vitro, or by administering a neublastin nucleic acid to an animal for in vivo expression.
- Neublastin nucleic acids may be included within a nucleic acid vector, e.g., an expression vector or a cloning vector.
- a neublastin nucleic acid may, but need not of necessity, be maintained, reproduced, transferred, or expressed as part of a nucleic acid vector.
- a recombinant expression vector containing a neublastin polynucleotide sequence can be introduced into and/or maintained within a cell.
- Cells hosting a neublastin vector may be prokaryotic.
- a neublastin nucleic acid can be introduced into a eukaryotic cell, e.g., a eukaryotic cell that contains the appropriate apparati for post- translational processing of a polypeptide into a mature protein, and/or the appropriate apparati for secreting a polypeptide into the extracellular environment of the cell.
- the invention further features a neublastin neurotrophic factor, "neublastin.”
- Neublastin may be in the form of a polypeptide, or may be a multimer of two or more neublastin polypeptides, e.g., a neublastin dimer.
- Neublastin polypeptides are associated as multimers by intermolecular structural associations known to those skilled in the art, including without limitation cysteine-cysteine interaction, sulfhydryl bonds, and noncovalent interactions.
- neublastin polypeptides include, without limitation, an amino acid sequence disclosed herein and designated SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 11 , SEQ ID NO: 12 and SEQ ID NO: 16.
- a neublastin polypeptide of the invention is useful for treating a defect in a neuron, including without limitation lesioned neurons and traumatized neurons.
- Peripheral nerves that experience trauma include, but are not limited to, nerves of the medulla or of the spinal cord.
- Neublastin polypeptides are useful in the treatment of neurodegenerative disease, e.g., cerebral ischaemic neuronal damage; neuropathy, e.g., peripheral neuropathy, Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS).
- neuropathy e.g., peripheral neuropathy, Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS).
- Neublastin polypeptides are further contemplated for use in the treatment of impaired memory, e.g., memory impairment associated with dementia.
- FIG. 1 is a photographic image of two northern blots probed with P-labelled neublastin cDNA, comparing relative levels of expression of the neublastin gene in various human adult tissue types (panel A) and in various regions of the adult human brain (panel B).
- FIG. 2 is a photographic image of a northern blot probed with P-labelled neublastin cDNA, comparing the amount of neublastin cDNA expressed in a nontransfected cell-line, HiB5, with the amount of neublastin cDNA expressed in a cell-line transfected with neublastin cDNA, and with a cell-line transfected with GDNF- cDNA.
- FIG. 1 is a photographic image of a northern blot probed with P-labelled neublastin cDNA, comparing the amount of neublastin cDNA expressed in a nontransfected cell-line, HiB5, with the amount of neublastin cDNA expressed in a cell-line transfected with neublastin cDNA, and with a cell-line transfected with GDNF- cDNA.
- FIG. 3 is a photographic image of two western blots which compare the degrees to which neublastin protein is expressed in non-transfected HiB5 cells (lane 1) relative to an HiB5 cell-line stably-transfected with neublastin cDNA (lane 2) was probed with either the neublastin-specific antibody Ab-2 (left blot; Panel A) or the neublastin- specific antibody Ab-1 (right blot; Panel B).
- FIG. 4 is a graphical illustration of the effect of neublastin on the survival of cultured rat embryonic, dopaminergic, ventral mesencephalic neurons and ChAT activity in cholinergic cranial nerve motor neurons in serum-free medium. In particular, FIG.
- FIG. 4A is an illustration of the dose-response curve for recombinant GDNF on ChAT activity (dpm/hour).
- FIG. 4B is an illustration of ChAT activity (dpm/hour) using diluted conditioned medium from either neublastin producing or GDNF-producing cells.
- FIG. 4C is an illustration of the number of tyrosine hydroxylase immunoreactive cells per well.
- FIG. 5 is an illustration of the effect of neublastin secreted from HiB5pUbi1zNBN22 cells on the function and survival of slice cultures of pig embryonic dopaminergic ventral mesencephalic neurons co-cultured with either HiB5pUbi1zNBN22 cells (neublastin) or HiB5 cells (control).
- FIG. 5 illustrate dopamine released to the medium at DIV12 [Dopamine (pmol/ml) - day 12] and DIV21 [Dopamine (pmol/ml) - day 21], respectively.
- FIG. 5C is an illustration of the number of tyrosine hydroxylase immunoreactive cells per culture [TH-ir cells per culture] at DIV21.
- FIG. 6 is an illustration of the in vivo effect of lentiviral-produced neublastin on
- FIG. 7 is a schematic diagram of the genomic structure of the neublastin gene, including the nucleic acid primers which can be used to identify the full length neublastin gene, and their spatial orientation in relation to the genomic Neublastin- encoding sequence ⁇ i.e., gene).
- FIG. 8 is an illustration of neublastin specific primers used to identify the cDNA clone encoding the human neublastin polypeptide that hybridize to nucleic acids that encode neublastin polypeptides, but do not hybridize to nucleic acids encoding the other known GDNF family members (i.e., GDNF, Persephin and neurturin).
- GDNF GDNF, Persephin and neurturin
- FIG. 9 illustrates the neurotrophic activity on cultures of dissociated rat dorsal
- FIG. 10 illustrates neublastin production from CHO cell lines.
- FIG. 11 illustrates a comparison of neublastin and GDNF binding to GFR ⁇ -1 and GFR ⁇ -3 receptors.
- FIG. 12 is a photographic image of a western blot which illustrates R30 anti- 30 peptide antibody and R31 anti-peptide antibody binding to neublastin.
- FIG. 13 is a picture of a gel showing extraction of neublastin by affinity binding on RETL3-lg.
- FIG. 14 is a plasmid map of pET19b-Neublastin, along with the sequence of the synthetic gene for Neublastin.
- FIG. 15 is a plasmid map of pMJB164-HisNeublastin, along with the sequence of the synthetic gene for HisNeublastin. DETAILED DISCLOSURE OF THE INVENTION
- Neublastin is a member of the glial cell line-derived neurotrophic factor (GDNF) sub-class of the transforming growth factor- ⁇ (TGF- ⁇ ) super-family of neurotrophic factors.
- GDNF glial cell line-derived neurotrophic factor
- TGF- ⁇ transforming growth factor- ⁇
- the cDNA encoding neublastin was originally identified as follows. Using the TBLASTN 1.4.11 algorithm ⁇ Atschul et al., Nucl. Acids Res. 1997 25 3389-3402) and human persephin as query (GenBank Ace. No. AF040962), a 290 bp fragment was initially identified in High-Throughput Genomic Sequence (HGTS) of two human bacterial artificial chromosomes (BAC) with GenBank entries AC005038 and AC005051.
- HGTS High-Throughput Genomic Sequence
- AC005038 consists of approximately 190,000 bp of 5 contigs of unordered sequences
- AC005051 consists of approximately 132,000 bp of 12 contigs of unordered sequences.
- the 290 bp fragment identified in the two BAC clones proved to have regions that were homologous, but not identical, to a coding region of the cDNA of the neurotrophic factor, human persephin.
- a 102 bp fragment [SEQ ID NO: 13] was identified in the PCR-based screenings of both the Master Plate and Sub Plate.
- a positive cDNA clone (possessing the 102 bp fragment) was selected, plated on two LB/antibiotic-containing plates, and grown overnight. From these plates, a total of 96 bacterial colonies were selected and individually placed in the wells of a new, 96-well PCR plate containing both PCR primers [SEQ ID NOS: 17 and 18] and the requisite PCR amplification reagents. PCR amplification was then performed and the 96 individual PCR reactions were analysed by 2% agarose gel electrophoresis.
- the positive colony with the clone containing the 102 bp fragment was then identified. Plasmid DNA was obtained from the positive colony containing the 102 bp fragment and sequenced. Subsequent sequencing analysis revealed the presence of a full-length cDNA of 861 bp [SEQ ID NO: 8].
- NBN116 the 116 AA polypeptide designated herein as NBN116, which possesses the amino acid sequence designated as SEQ ID NO: 11 ; and
- NBN113 the 113 AA polypeptide designated herein as NBN113, which possesses the amino acid sequence designated as SEQ ID NO: 12.
- Primer Pair No. 2 Using Primer Pair No. 2, a 887 bp DNA fragment was amplified by PCR from a preparation of human genomic DNA, and cloned into the pCRII vector (Invitrogen) and transformed into E. coli.
- the resulting plasmid was sequenced and a 861 bp putative cDNA sequence (encoding a protein named neublastin herein) was predicted (as set forth in SEQ ID NO: 3).
- an 870 bp DNA fragment was obtained by PCR of human genomic DNA.
- An additional 42 bp region at the 3'- terminus of the Open Reading Frame (ORF) was found in this fragment, in comparison to the 887 bp sequence.
- the genomic structure of the neublastin gene was predicted by comparing it to the sequences of nucleic acids of other neurotrophic factors, by mapping exon-intron boundaries. This analysis demonstrated that the neublastin gene has at least two exons separated by a 70 bp intron.
- the neublastin gene consists of at least five exons (including three coding) separated by four introns (see, e.g., Fig. 8). Together, the exons have a predicted amino acid sequence of a full-length Neublastin polypeptide. It should also be noted that the 887 bp fragment was found to contain the complete coding region of pro- neublastin.
- the predicted cDNA [SEQ ID NO: 3] contains an Open Reading Frame (ORF) encoding pro-neublastin (181 amino acid residues) which showed homology to the three known human proteins - Persephin, Neurturin, and GDNF.
- ORF Open Reading Frame
- the invention provides polynucleotides capable of expressing the polypeptides of the invention.
- the polynucleotides of the invention include DNA, cDNA and RNA sequences, as well as anti-sense sequences, and include naturally occurring, synthetic, and intentionally manipulated polynucleotides.
- the polynucleotides of the invention also include sequences that are degenerate as a result of the genetic code, but which code on expression for a neublastin polypeptide.
- polynucleotide refers to a polymeric form of nucleotides of at least 10 bases in length, preferably at least 15 bases in length.
- isolated polynucleotide is meant a polynucleotide that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived.
- the term therefore includes recombinant DNA which is incorporated into an expression vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule, e.g. a cDNA, independent from other sequences.
- the polynucleotides of the invention also include allelic variants and "mutated polynucleotides" having a nucleotide sequence that differs from the nucleotide sequences presented herein at one or more nucleotide positions.
- the polynucleotide of the invention has a nucleic acid (DNA) sequence capable of hybridizing with the polynucleotide sequence presented as SEQ ID NO: 1 , the polynucleotide sequence presented as SEQ ID NO: 3, the polynucleotide sequence presented as SEQ ID NO: 8, or the polynucleotide sequence presented as SEQ ID NO: 15, its complementary strand, or a sub-sequence hereof under at least medium, medium/high, or high stringency conditions, as described in more detail below.
- DNA nucleic acid
- the isolated polynucleotide of the invention has a nucleic acid (DNA) sequence that is at least 70%, preferably at least 80%, more preferred at least 90%, most preferred at least 95% homologous to the polynucleotide sequence presented as SEQ ID NO: 1 , the polynucleotide sequence presented as SEQ ID NO: 3, the polynucleotide sequence presented as SEQ ID NO: 8, or the polynucleotide sequence presented as SEQ ID NO: 15.
- DNA nucleic acid
- the polynucleotide has the DNA sequence presented as SEQ ID NO: 1 , the DNA sequence presented as SEQ ID NO: 3, the DNA sequence presented as SEQ ID NO: 8, or the polynucleotide sequence presented as SEQ ID NO: 15.
- This invention also provides novel p ⁇ mers and DNA sequences for identifying, isolating and amplifying neublastin polynucleotides which code on expression for neublastin polypeptides or fragments thereof.
- Such primers include the polynucleotides set forth in SEQ ID NOS: 17-28, and 31-32.
- this invention provides neublastin DNA sequences generated from those primers, including those set forth in SEQ ID NOS: 13 and 14.
- this invention provides DNA sequences from 3' or 5' untranslated regions ("UTR") in genomic DNA that flank neublastin exons; such sequences are useful in identifying, isolating and amplifying neublastin polynucleotides which code on expression for neublastin polypeptides or fragments thereof.
- UTR untranslated regions
- 3' UTR sequences of this invention include the sequences set forth in: nucleotides 721 - 865 of SEQ ID NO: 1 , nucleotides 718 - 861 of SEQ ID NO: 3, nucleotides 718 - 861 of SEQ ID NO: 8, nucleotides 1647 - 2136 of SEQ ID NO: 15, and contiguous sequences of between 10 - 25 nucleotides derived from (i.e., falling within) the foregoing sequences (which are useful, e.g., as primers).
- 5' UTR sequences of this invention include the sequences set forth in: nucleotides 1-10 of SEQ ID NO: 1 , nucleotides 1 - 57 of SEQ ID NO: 8, nucleotides 1 -974 of SEQ ID NO: 15, and contiguous sequences of between 10 - 25 nucleotides derived from (i.e., falling within) the foregoing sequences (which are useful, e.g., as primers).
- the polynucleotides of the invention may preferably be obtained by cloning procedures, e.g. as described in "Current Protocols in Molecular Biology” [John Wiley & Sons, Inc.].
- the polynucleotide is cloned from, or produced on the basis of human genomic DNA or a cDNA library of the human brain. Homology of DNA sequences
- the DNA sequence homology referred to above may be determined as the degree of identity between two sequences indicating a derivation of the first sequence from the second.
- the homology may suitably be determined by means of computer
- GAP provided in the GCG program package [Needleman, S.B. and Wunsch CD., Journal of Molecular Biology 1970 48 443-453].
- GAP creation penalty of 5.0 and GAP extension penalty of 0.3 the coding region of the analogous DNA sequences referred to above exhibits a degree of identity preferably of at least
- sequence identity refers to the degree to which two polynucleotide sequences are identical on a nucleotide-by-nucleotide basis over a particular region of comparison.
- percentage of sequence identity is calculated by comparing two optimally aligned sequences over that region of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I)
- substantially identical denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide
- 25 comprises a sequence that has at least 80 percent sequence identity, preferably at least 85 percent identity and often 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison region.
- the polynucleotides of the invention are such which have a nucleic acid sequence capable of hybridizing with the polynucleotide sequence presented as SEQ ID NO: 1 , the polynucleotide sequence presented as SEQ ID NO: 3, or the polynucleotide sequence presented as SEQ ID NO: 8, or the polynucleotide sequence 35 presented as SEQ ID NO: 15, or their complementary strand, or a sub-sequence hereof under at least medium, medium/high, or high stringency conditions, as described in more detail below.
- Suitable experimental conditions for determining hybridization between a nucleotide probe and a homologous DNA or RNA sequence involves pre-soaking of the filter containing the DNA fragments or RNA to hybridize in 5 x SSC [Sodium chloride/Sodium citrate; cf. Sambrook et al.; Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Lab., Cold Spring Harbor, NY 1989] for 10 minutes, and pre- hybridization of the filter in a solution of 5 x SSC, 5 x Denhardt's solution [cf. Sambrook et al.; Op cit], 0.5 % SDS and 100 ⁇ g/ml of denatured sonicated salmon sperm DNA [cf.
- the isolated polynucleotide of the invention may in particular be a cloned polynucleotide.
- cloned polynucleotide refers to a polynucleotide or DNA sequence cloned in accordance with standard cloning procedures currently used in genetic engineering to relocate a segment of DNA, which may in particular be cDNA, i.e. enzymatically derived from RNA, from its natural location to a different site where it will be reproduced.
- Cloning may be accomplished by any suitable route and may involve techniques such as reverse transcriptase technology, PCR technology, and the like, as well as excision and isolation of the desired DNA segment.
- the cloned polynucleotide of the invention may alternatively be termed "DNA construct” or "isolated DNA sequence", and may in particular be a complementary DNA (cDNA).
- DNA construct or isolated DNA sequence
- cDNA complementary DNA
- the isolated polynucleotide of the invention may be obtained from any suitable source.
- the polynucleotide of the invention is cloned from, or produced on the basis of a cDNA library, e.g. of a cDNA library of the foetal or adult brain, in particular of the forebrain, the hindbrain, the cortex, the striatum, the amygdala, the cerebellum, the caudate nucleus, the corpus callosum, the hippocampus, the thalamic nucleus, the subthalamic nucleus, the olfactory nucleus, the putamen, the substantia nigra, the dorsal root ganglia, the trigeminal ganglion, the superior mesenteric artery, or the thalamus; of the spinal cord; of the heart; the placenta; of the lung; of the liver; of the skeletal muscle; of the kidney; of the liver; of the pancreas; of the intestines; of the eye; of the retina
- the isolated polynucleotide of the invention may be obtained by standard methods, e.g. those described in the working examples.
- a "neublastin polypeptide,” as used herein, is a polypeptide which possesses neurotrophic activity (e.g., as described in Examples 6, 7, 8, and 9) and includes those polypeptides which have an amino acid sequence that has at least 70% homology to the "neublastin" polypeptides set forth in AA -95 -AA ⁇ 0 5 of SEQ ID NO: 2, AA ⁇ -AA 105 of SEQ ID NO: 2, AA -97 -AA 14 o of SEQ ID NO: 4, AA ⁇ -AAMO of SEQ ID NO: 4, AA ⁇ -AA 140 of SEQ ID NO: 4, AA -8 o-AA ⁇ 40 of SEQ ID NO: 9 ("wild type" prepro), AA ⁇ -AAuo of SEQ ID NO: 9 (pro), AA AA 14 o of SEQ ID NO: 5 (mature 140AA), AA AAne of SEQ ID NO: 6 (mature 116AA), AA AAns of SEQ ID NO: 7 (mat
- the C-terminal sequence of the above identified neublastin polypeptides has an amino acid sequence as set forth in AA 72 -AA ⁇ 05 of SEQ ID NO: 2 (i.e., AA 10 7-AAi 40 of SEQ ID NO: 9), more preferably AA 41 -AA 105 of SEQ ID NO: 2 (i.e., AA 7 6-AA 140 of SEQ ID NO: 9).
- the neublastin polypeptide retain the 7 conserved Cys residues that are characteristic of the GDNF family and of the TGF-beta super family.
- the neublastin polypeptide has an amino acid sequence greater than 85% homology, most preferably greater than 95% homology, to the foregoing sequences (i.e., AA -95 -AA 10 5 of SEQ ID NO: 2, AA AA ⁇ s of SEQ ID NO: 2, AA. 97 -
- AAuo of SEQ ID NO: 4, AA ⁇ -AA o of SEQ ID NO: 4, AA ⁇ AA ⁇ o of SEQ ID NO: 4, AA -80 -AA 140 of SEQ ID NO: 9 ("wild type" prepro), AA ⁇ -AAuo of SEQ ID NO: 9 (pro), AA ⁇ -AA 140 of SEQ ID NO: 5 (mature 140AA), AA AA ⁇ 16 of SEQ ID NO: 6 (mature 116AA), AArAA 113 of SEQ ID NO: 7 (mature 113AA), AA AA 140 of SEQ ID NO: 10 (mature 140AA), AA AA 116 of SEQ ID NO: 11 (mature 116AA), AArAAn 3 of SEQ ID NO: 12 (mature 113AA), AA AA 224 of SEQ ID NO: 16 (murine prepro), and preferably any of the foregoing polypeptides with a C-terminal sequence of the above identified neublastin polypeptides has an amino acid sequence as set forth
- this invention contemplates those polypeptides which have an amino acid sequence that has at least 70% homology to the murine "neublastin" polypeptides set forth in AA AA 224 of SEQ ID NO: 16.
- polypeptides of the invention in one embodiment represent the preprosequence (as set forth in SEQ ID NOS: 2, 4, 9, and 16, respectively), the pro sequence (as set forth in AA. 75 - AA 105 of SEQ ID NO: 2, or AA- ⁇ -AAuo of SEQ ID NOS: 4 and 9, respectively) and the mature sequence of neublastin (as set forth in SEQ ID NOS: 5, 6, 7, 10, 11 , or 12, preferably SEQ ID NOS: 10, 11 , 12).
- variant polypeptides include variant polypeptides.
- variant polypeptide means a polypeptide (or protein) having an amino acid sequence that differs from the sequence presented as SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 16, at one or more amino acid positions.
- variant polypeptides include the modified polypeptides described above, as well as conservative substitutions, splice variants, isoforms, homologues from other species, and polymorphisms.
- conservative amino acids substitutions denotes the replacement of an amino acid residue by another, biologically similar residue. For example, one would expect conservative amino acid substitutions to have little or no effect on the biological activity, particularly if they represent less than 10% of the total number of residues in the polypeptide or protein.
- conservative amino acids substitutions represent changes in less than 5% of the polypeptide or protein, most preferably less than 2% of the polypeptide or protein (e.g., when calculated in accordance with NBN113, most preferred conservative substitutions would represent fewer than 3 amino acid substitutions in the wild type mature amino acid sequence).
- there is a single amino acid substitution in the mature sequence wherein the both the substituted and replacement amino acid are non-cyclic.
- particularly conservative substitutions include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine, and the like.
- conservative substitution also include the use of a substituted amino acid residue in place of an un-substituted parent amino acid residue provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide. Modifications of this primary amino acid sequence may result in proteins which have substantially equivalent activity as compared to the unmodified counterpart polypeptide, and thus may be considered functional analogous of the parent proteins.
- modifications may be deliberate, e.g. as by site-directed mutagenesis, or they may occur spontaneous, and include splice variants, isoforms, homologues from other species, and polymorphisms. Such functional analogous are also contemplated according to the invention.
- modifications of the primary amino acid sequence may result in proteins which do not retain the biological activity of the parent protein, including dominant negative forms, etc.
- a dominant negative protein may interfere with the wild- type protein by binding to, or otherwise sequestering regulating agents, such as upstream or downstream components, that normally interact functionally with the polypeptide. Such dominant negative forms are also contemplated according to the invention.
- a “signal peptide” is a peptide sequence that directs a newly synthesised polypeptide to which the signal peptide is attached to the endoplasmic reticulum (ER) for further post-translational processing and distribution.
- heterologous signal peptide means a signal peptide that is not the human neublastin signal peptide, typically the signal peptide of some mammalian protein other than neublastin.
- Skilled artisans will recognise that the human neublastin DNA sequence (either cDNA or genomic DNA), or sequences that differ from human neublastin DNA due to either silent codon changes or to codon changes that produce conservative amino acid substitutions, can be used to genetically modify cultured human cells so that they will overexpress and secrete the enzyme.
- Polypeptides of the present invention also include chimeric polypeptides or cleavable fusion polypeptides in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide or fragment thereof.
- a chimeric polypeptide may be produced by fusing a nucleic acid sequence (or a portion thereof) encoding another polypeptide to a nucleic acid sequence (or a portion thereof) of the present invention.
- Techniques for producing chimeric polypeptides are standard techniques. Such techniques usually requires joining the sequences in a way so that they are in both in the same reading frame, and expression of the fused polypeptide under the control of the same promoter(s) and terminator.
- Polypeptides of the present invention also include truncated forms of the full length neublastin molecule.
- truncated molecules one or more amino acids have been deleted from the N-terminus or the C-terminus, preferably the N-terminus.
- the degree to which a candidate polypeptide shares homology with a neublastin polypeptide of the invention is determined as the degree of identity between two amino acid sequences.
- a high level of sequence identity indicates a likelihood that the first sequence is derived from the second Homology is determined by computer analysis, such as, without limitations, the
- the mature part of a polypeptide encoded by an analogous DNA sequence of the invention exhibits a degree of identity of at least 90%, more preferred of at least 95%, most preferred of at least 98% with the amino acid sequence presented herein as SEQ ID NO: 2, SEQ ID NO: 4; SEQ ID NO.: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 11 ; SEQ ID NO: 12, or SEQ ID NO: 16.
- SEQ ID NO: 2 amino acid sequence presented herein as SEQ ID NO: 2, SEQ ID NO: 4; SEQ ID NO.: 5; SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 11 ; SEQ ID NO: 12, or SEQ ID NO: 16.
- Bioactive Polypeptides The polypeptide of the invention may be provided on any bioactive form, including the form of pre-pro-proteins, pro-proteins, mature proteins, glycosylated proteins, phosphorylated proteins, or any other posttranslational modified protein.
- polypeptide of the invention may in particular be a N-glycosylated polypeptide, which polypeptide preferably is glycosylated at the N-residues indicated in the sequence listings.
- the polypeptide of the invention has the amino acid sequence presented as SEQ ID NO: 9, holding a glycosylated asparagine residue at position 122; the amino acid sequence presented as SEQ ID NO: 10, holding a glycosylated asparagine residue at position 122; the amino acid sequence presented as SEQ ID NO: 11 , holding a glycosylated asparagine residue at position 98; or the amino acid sequence presented as SEQ ID NO: 12, holding a glycosylated asparagine residue at position 95.
- This invention also contemplates neublastin fusion proteins, such as Ig-fusions, as described, e.g., in United States patent 5,434,131 , herein incorporated by reference.
- the invention provides a polypeptide having the amino acid sequence shown as SEQ ID NO: 2, or an amino acid sequence which is at least about
- the invention provides a polypeptide having the amino acid sequence of SEQ ID NO: 4, or an amino acid sequence which is at least 90%, more preferred at least 95%, yet more preferred at least 98%, most preferred at least 99% homologous to the sequence presented as SEQ ID NO: 4.
- the invention provides a polypeptide having the amino acid sequence of SEQ ID NO: 5, or an amino acid sequence which is at least 90%, more preferred at least 95%, most preferred at least 98% homologous to the sequence presented as SEQ ID NO: 5.
- the invention provides a polypeptides having the amino acid sequence of SEQ ID NO: 6, or an amino acid sequence which is at least 90%, more preferred at least 95%, most preferred at least 98% homologous to the sequence presented as SEQ ID NO: 6.
- the invention provides a polypeptides having the amino acid sequence of SEQ ID NO: 7, or an amino acid sequence which is at least 90%, more preferred at least 95%, most preferred at least 98% homologous to the sequence presented as SEQ ID NO: 7.
- the neublastin polypeptide of the invention includes allelic variants, e.g., the polypeptide amino acid sequences of SEQ ID NOS: 5-7, in which Xaa designates Asn or Thr, and Yaa designates Ala or Pro.
- the invention provides a polypeptides having the amino acid sequence of SEQ ID NO: 9, or an amino acid sequence which is at least 90%, more preferred at least 95%, most preferred at least 98% homologous to the sequence presented as SEQ ID NO: 9.
- the invention provides a polypeptide having the amino acid sequence of SEQ ID NO: 10, or an amino acid sequence at least 90%, more preferred at least 95%, most preferred at least 98%, homologous to the sequence presented as SEQ ID NO: 10.
- the invention provides a polypeptide having the amino acid sequence of SEQ ID NO: 11 , or an amino acid sequence at least 90%, more preferred at least 95%, most preferred at least 98% homologous to the sequence presented as SEQ ID NO: 11.
- the invention provides a polypeptide having the amino acid sequence of SEQ ID NO: 12, or an amino acid sequence at least 90%, more preferred at least 95%, most preferred at least 98% homologous to the sequence presented as SEQ ID NO: 12.
- the invention provides a polypeptide having the amino acid sequence of SEQ ID NO: 16, or an amino acid sequence at least 90%, more preferred at least 95%, most preferred at least 98% homologous to the sequence presented as SEQ ID NO: 16, which is a pre-pro-neublastin of murine origin.
- polypeptide of the invention holds the GDNF subfamily fingerprint, i.e. the amino acid residues underlined in Table 3.
- the invention provides a polypeptide encoded by a polynucleotide sequence capable of hybridizing under high stringency conditions with the polynucleotide sequence presented as SEQ ID NO: 1 , its complementary strand, or a sub-sequence thereof.
- the polypeptide of the invention is encoded by a polynucleotide sequence being at least 70% homologous to the polynucleotide sequence presented as SEQ ID NO: 1.
- the polypeptide of the invention is encoded by the polynucleotide sequence presented as SEQ ID NO: 1.
- the invention provides novel polypeptides encoded by a polynucleotide sequence capable of hybridizing under high stringency conditions with the polynucleotide sequence presented as SEQ ID NO: 3, its complementary strand, or a sub-sequence thereof.
- the polypeptide of the invention is encoded by a polynucleotide sequence being at least 70% homologous to the polynucleotide sequence presented as SEQ ID NO: 3.
- the polypeptide of the invention is encoded by the polynucleotide sequence presented as SEQ ID NO: 3.
- the invention provides novel polypeptides encoded by a polynucleotide sequence capable of hybridizing under high stringency conditions with the polynucleotide sequence presented as SEQ ID NO: 8, its complementary strand, or a sub-sequence thereof.
- the polypeptide of the invention is encoded by a polynucleotide sequence being at least 70% homologous to the polynucleotide sequence presented as SEQ ID NO: 8.
- the polypeptide of the invention is encoded by the polynucleotide sequence presented as SEQ ID NO: 8.
- the invention provides novel polypeptides encoded by a polynucleotide sequence capable of hybridizing under high stringency conditions with the polynucleotide sequence presented as SEQ ID NO: 15, its complementary strand, or a sub-sequence thereof.
- the polypeptide of the invention is encoded by a polynucleotide sequence being at least 70% homologous to the polynucleotide sequence presented as SEQ ID NO: 15.
- the polypeptide of the invention is encoded by the polynucleotide sequence presented as SEQ ID NO: 15.
- the polypeptide of the invention may be isolated from mammalian cells, preferably from a human cell or from a cell of murine origin.
- the polypeptide of the invention may be isolated from human heart tissue, from human skeletal muscle, from human pancreas, or from human brain tissue, in particular from caudate nucleus or from thalamus, or it may be obtained from DNA of mammalian origin, as discussed in more detail below.
- Neublastin polypeptides of the invention are useful for moderating metabolism, growth, differentiation, or survival of a nerve or neuronal cell.
- neublastin polypeptides are used to treating or to alleviate a disorder or disease of a living animal, e.g., a human, which disorder or disease is responsive to the activity of a neurotrophic agents. Such treatments and methods are described in more details below.
- Neublastin polypeptides or polypeptide fragments of the invention are used to produce neublastin-specific antibodies.
- a "neublastin-specific antibody is an antibody, e.g., a polyclonal antibody or a monoclonal antibody, that is immunoreactive to a neublastin polypeptide or polypeptide fragment, or that binds with specificity to an epitopes of a neublastin polypeptides.
- Polyclonal antibodies may in particular be obtained as described by, e.g., Green et al.,: “Production of Polyclonal Antisera” in Immunochemical Protocols ⁇ Manson, Ed.); Humana Press, 1992, pages 1-5; by Coligan et al.,: “Production of Polyclonal Antisera in Rabbits, Rats, Mice and Hamsters” in Current Protocols in Immunology, 1992, Section 2.4.1 , and by Ed Harlow and David Lane (Eds.) in "Antibodies; A laboratory manual” Cold Spring Harbor Lab. Press 1988. These protocols are hereby incorporated by reference.
- Monoclonal antibodies may in particular be obtained as described by, e.g., Kohler & Milstein, Nature, 1975, 256:495; Coligan et al., in Current Protocols in Immunology, 1992, Sections 2.5.1 - 2.6.7; and Harlow et al., in Antibodies: A Laboratory Manual: Cold Spring Harbor, Pub., 1988, page 726; which protocols are hereby incorporated by reference.
- monoclonal antibodies may be obtained by injecting, e.g., mice with a composition comprising an antigen, verifying the presence of antibody production by removing a serum sample, removing the spleen to obtain B lymphocytes, fusing the B lymphocytes with myeloma cells to produce hybridomas, cloning the hybridomas, selecting positive clones that produce the antibodies to the antigen, and isolating the antibodies from the hybridoma cultures.
- Monoclonal antibodies can be isolated and purified from hybridoma cultures by a variety of well-established techniques, including affinity chromatography with protein A Sepharose, size-exclusion chromatography, and ion-exchange chromatography, see. e.g. Coligan et al. in Current Protocols in Immunology, 1992, Sections 2.7.1 - 2.7.12, and Sections 2.9.1 - 2.9.3; and Barnes et al.: "Purification of Immunoglobulin G (IgG)" in Methods in Molecular Biology; Humana Press, 1992, Vol. 10, Pages 79-104.
- Polyclonal or monoclonal antibodies may optionally be further purified, e.g. by binding to and elution from a matrix to which the polypeptide, to which the antibodies were raised, is bound.
- Antibodies which bind to the neublastin polypeptide of the invention can be prepared using an intact polypeptide or fragments containing small peptides of interest as the immunising antigen.
- the polypeptide used to immunise an animal may be obtained by recombinant DNA techniques or by chemical synthesis, and may optionally be conjugated to a carrier protein.
- Commonly used carrier proteins which are chemically coupled to the peptide include keyhole limpet hemocyanin (KLH), thyroglobulin, bovine serum albumin (BSA), and tetanus toxoid.
- KLH keyhole limpet hemocyanin
- BSA bovine serum albumin
- the coupled peptide may then be used to immunise the animal, which may in particular be a mouse, a rat, a hamster or a rabbit.
- antibodies are produced using the following peptides: Peptide 1 : CRPTRYEAVSFMDVNST (amino acids 108-124 of SEQ ID NO: 9); or Peptide 2: ALRPPPGSRPVSQPC (amino acids 93-107 of SEQ ID NO: 9).
- Peptide 1 CRPTRYEAVSFMDVNST
- Peptide 2 ALRPPPGSRPVSQPC
- Methods for producing antibodies using these polypeptides are described in Example 10.
- Peptide R27 GPGSRARAAGARGC (amino acids 30-43 of SEQ ID NO: 9);
- Peptide R28 LGHRSDELVRFRFC (amino acids 57-70 of SEQ ID NO: 9);
- Peptide R29 CRRARSPHDLSL (amino acids 74-85 of SEQ ID NO: 9); Peptide R30: LRPPPGSRPVSQPC (amino acids 94-107 of SEQ ID NO: 9); and
- Peptide R31 STWRT ⁇ /DRLSATAC (amino acids 123-136 of SEQ ID NO:
- neublastin-derived peptides derived from the mature protein are predicted surface exposed loops based on the known GDNF structure (Eigenbrot and Gerber, Nat. Struct. Biol.. 1997 4 435- 438), and are thus useful for antibody generation:
- Region 1 CRLRSQLVPVRALGLGHRSDELVRFRFC (AA43-70 of SEQ ID NO:
- Region 2 CRRARSPHDLSLASLLGAGALRPPPGSRPVSQPC (AA74-107 of
- Region 3 CRPTRYEAVSFMDVNSTWRTVDRLSATAC (AA108-136 of SEQ ID NO:
- antibodies which specifically bind neublastin or neublastin-derived peptides may be used for detecting the presence of such neublastin neurotrophic factors in various media, and in particular for the diagnosis of conditions or diseases associated with the neublastin molecules of the invention.
- a variety of protocols for such detection including ELISA, RIA and FACS, are known in the art.
- the antibodies of this invention may also be used for blocking the effect of the neurotrophic factor, and may in particular be neutralising antibodies.
- a cell comprising a DNA sequence encoding a neublastin polypeptide of the invention is cultured under conditions permitting the production of the polypeptide, followed by recovery of the polypeptide from the culture medium, as detailed below.
- the cells When cells are to be genetically modified for the purposes of producing a neublastin polypeptide, the cells may be modified by conventional methods or by gene activation.
- a DNA molecule that contains a neublastin cDNA or genomic DNA sequence may be contained within an expression construct and transfected into cells by standard methods including, but not limited to, liposome-, polybrene-, or DEAE dextran-mediated transfection, electroporation, calcium phosphate precipitation, microinjection, or velocity driven microprojectiles ("biolistics").
- Viruses known to be useful for gene transfer include adenoviruses, adeno-associated virus, lentivirus, herpes virus, mumps virus, poliovirus, retroviruses, Sindbis virus, and vaccinia virus such as canary pox virus, as well as Baculovirus infection of insect cells, in particular
- SfP9 insect cells may be modified using a gene activation ("GA") approach, such as described in United States patents 5,733,761 and 5,750,376, each incorporated herein by reference.
- GA gene activation
- the term "genetically modified,” as used herein in reference to cells, is meant to encompass cells that express a particular gene product following introduction of a DNA molecule encoding the gene product and/or regulatory elements that control expression of a coding sequence for the gene product.
- the DNA molecule may be introduced by gene targeting, allowing incorporation of the DNA molecule at a particular genomic site.
- the invention provides a recombinant expression vector comprising the polynucleotide of the invention.
- the recombinant expression vector of the invention may be any suitable eukaryotic expression vector.
- Preferred recombinant expression vectors are the ubiquitin promoter containing vector pTEJ-8 ⁇ Johansen TE, Schoeller MS, Tolstoy S, Schwartz T; FEBS Lett. 1990 267 289-294), and derivatives hereof, e.g. pUbMZ.
- a preferred commercially available eukaryotic expression vectors is e.g. the virus promoter containing vector pcDNA-3 (available from Invitrogen).
- Another preferred expression vector uses SV40 early and adenovirus major late promoters (derived from plasmid pAD2beta; Norton and Coffin, Mol. Cell. Biol. 1985 5 281).
- This invention aiso provides prokaryotic expression vectors and synthetic genes (syngenes) with codon optimisation for prokaryotic expression. Syngenes were constructed with lower GC content and preferred bacterial (e.g., E. coli) codons. The syngene is being cloned into two vectors, pET19b and pMJB164, a derivative of pET19b. The construction with pET19b is shown in Fig. 14. In this construct, the sequence encoding the mature domain of neublastin is directly fused to an initiating methionine. The construction with pMJB164 is shown in Fig. 15.
- the invention provides a production cell genetically manipulated to comprise the isolated polynucleotide sequence of the invention, and/or or a recombinant expression vector of the invention.
- the cell of the invention may in particular be genetically manipulated to transiently or stably express, over-express or co-express polypeptide of the invention. Methods for generating transient and stable expression are known in the art.
- the polynucleotide of the invention may be inserted into an expression vector, e.g. a plasmid, virus or other expression vehicle, and operatively linked to expression control sequences by ligation in a way that expression of the coding sequence is achieved under conditions compatible with the expression control sequences.
- Suitable expression control sequences include promoters, enhancers, transcription terminators, start codons, splicing signals for introns, and stop codons, all maintained in the correct reading frame of the polynucleotide of the invention so as to permit proper translation of mRNA.
- Expression control sequences may also include additional components such as leader sequences and fusion partner sequences.
- the promoter may in particular be a constitutive or an inducible promoter.
- inducible promoters such as pL of bacteriophage ⁇ , plac, pt ⁇ , ptac (pt ⁇ -lac hybrid promoter)
- promoters derived from the genome of mammalian cells e.g. the ubiquitin promoter, the TK promoter, or the metallothionein promoter, or from mammalian viruses, e.g. the retrovirus long terminal repeat, the adenovirus late promoter or the vaccinia virus 7.5K promoter, may be used. Promoters obtained by recombinant DNA or synthetic techniques may also be used to provide for transcription of the polynucleotide of the invention.
- Suitable expression vectors typically comprise an origin of expression, a promoter as well as specific genes which allow for phenotypic selection of the transformed cells, and include vectors like the T7-based expression vector for expression in bacteria [Rosenberg et al; Gene 1987 56 125], the pTEJ-8, pUbilZ, pcDNA-3 and pMSXND expression vectors for expression in mammalian cells [Lee and Nathans, J. Biol. Chem. 1988 263 3521], baculovirus derived vectors for expression in insect cells, and the oocyte expression vector PTLN [Lorenz C, Pusch M & Jentsch T J: Heteromultimeric CLC chloride channels with novel properties; Proc. Natl. Acad. Sci. USA 1996 93 13362-13366].
- the ceil of the invention is an eukaryotic cell, e.g., a mammalian cell, e.g., a human cell, an oocyte, or a yeast cell.
- the cell of the invention may be without limitation a human embryonic kidney (HEK) cell, e.g., a HEK 293 cell, a BHK21 cell, a Chinese hamster ovary (CHO) cell, a Xenopus laevis oocyte (XLO) cell.
- HEK human embryonic kidney
- CHO Chinese hamster ovary
- XLO Xenopus laevis oocyte
- the cell of the invention is a fungal cell, e.g., a filamentous fungal cell
- the cell is an insect cell, most preferably the Sf9 cell.
- Additional preferred mammalian cells of the invention are PC12, HiB5, RN33b cell lines and human neural progenitor cells. Most preferred are human cells.
- primary or secondary cells include fibroblasts, epithelial cells including mammary and intestinal epithelial cells, endotheiial cells, formed elements of the blood including lymphocytes and bone marrow cells, glial ceils, hepatocytes, keratinocytes, muscle cells, neural cells, or the precursors of these cell types.
- immortalised human cell lines useful in the present methods include, but are not limited to, Bowes Melanoma cells (ATCC Accession No. CRL 9607), Daudi cells (ATCC Accession No.
- CCL 213 HeLa cells and derivatives of HeLa cells (ATCC Accession Nos. CCL 2, CCL 2.1 , and CCL 2.2), HL-60 cells (ATCC Accession No. CCL 240), HT-1080 cells (ATCC Accession No. CCL 121), Jurkat cells (ATCC Accession No. TIB 152), KB carcinoma cells (ATCC Accession No. CCL 17), K-562 leukaemia cells (ATCC Accession No. CCL 243), MCF-7 breast cancer cells (ATCC Accession No. BTH 22), MOLT-4 cells (ATCC Accession No. 1582), Namalwa cells (ATCC Accession No. CRL 1432), Raji cells (ATCC Accession No.
- CCL 86 RPMI 8226 cells (ATCC Accession No. CCL 155), U-937 cells (ATCC Accession No. CRL 1593), WI-38VA13 sub line 2R4 cells (ATCC Accession No. CLL 75.1), and 2780AD ovarian carcinoma cells ⁇ Van der Magnolia et al. Cancer Res. 1988 48 5927-5932), as well as heterohybridoma cells produced by fusion of human cells and cells of another species.
- Secondary human fibroblast strains such as WI-38 (ATCC Accession No. CCL 75) and MRC-5 (ATCC Accession No. CCL 171), may also be used.
- incorporation of the heterologous polynucleotide of the invention may be in particular be carried out by infection (employing a virus vector), by transfection (employing a plasmid vector), using calcium phosphate precipitation, microinjection, electroporation, lipofection, or other physical-chemical methods known in the art.
- the isolated polynucleotide sequence of the invention, and/or or a recombinant expression vector of the invention are transfected in a mammalian host cell, a neural progenitor cell, an astrocyte cell, a T-cell, a hematopoitic stem cell, a non-dividing cell, or a cerebral endothelial cell, comprising at least one DNA molecule capable of mediating cellular immortalization and/or transformation.
- Activation of an endogenous gene in a host cell may be accomplished by the introducing regulatory elements, in particular by the introducing a promoter capable of effecting transcription of an endogenous gene encoding the neublastin polypeptide of the invention.
- the invention provides novel pharmaceutical compositions comprising a therapeutically effective amount of the polypeptide of the invention.
- polypeptide of the invention may be administered in any convenient form.
- the polypeptide of the invention is incorporated into a pharmaceutical composition together with one or more adjuvants, excipients, carriers and/or diluents, and the pharmaceutical composition prepared by the skilled person using conventional methods known in the art.
- compositions may comprise the polypeptide of the invention, or antibodies hereof.
- the composition may be administered alone or in combination with at one or more other agents, drugs or hormones.
- the pharmaceutical composition of this invention may be administered by any suitable route, including, but not limited to oral, intravenous, intramuscular, inter- arterial, intramedullary, intrathecal, intraventricular, transdermal, subcultaneous, intraperitoneal, intranasal, anteral, topical, subiingual or rectal application, buccal, vaginal, intraorbital, intracerebral, intracranial, intraspinal, intraventricular, intracisternal, intracapsular, intrapulmonary, transmucosal, or via inhalation.
- oral intravenous, intramuscular, inter- arterial, intramedullary, intrathecal, intraventricular, transdermal, subcultaneous, intraperitoneal, intranasal, anteral, topical, subiingual or rectal application, buccal, vaginal, intraorbital, intracerebral, intracranial, intraspinal, intraventricular, intracisternal, intracapsular, intrapulmonary, transmuco
- Intrapulmonary delivery methods, apparatus and drug preparation are described, for example, in U.S. Patents 5, 785, 049, 5,780,019, and 5,775,320, each incorporated herein by reference.
- Administration may be by periodic injections of a bolus of the preparation, or may be made more continuous by intravenous or intraperitoneal administration from a reservoir which is external (e.g., an IV bag) or internal (e.g., a bioerodable implant, a bioartificial organ, or a colony of implanted neublastin production cells).
- a reservoir which is external (e.g., an IV bag) or internal (e.g., a bioerodable implant, a bioartificial organ, or a colony of implanted neublastin production cells).
- a reservoir which is external (e.g., an IV bag) or internal (e.g., a bioerodable implant, a bioartificial organ, or a colony of implanted neublastin production
- a neublastin according to this invention may be achieved using any suitable delivery means, including:
- a neublastin is delivered directly into the CNS, preferably to the brain ventricles, brain parenchyma, the intrathecal space or other suitable CNS location, most preferably intrathecally.
- parenteral delivery systems include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, pump delivery, encapsulated cell delivery, liposomal delivery, needle-delivered injection, needle-less injection, nebulizer, aeorosolizer, electroporation, and transdermal patch.
- the active ingredient may be administered in one or several doses per day.
- Currently contemplated appropriate dosages are between 0.5 ng neublastin/kg body weight to about 50 ⁇ g/kg per administration, and from about 1.0 ng/kg to about 100 ⁇ g/kg daily.
- the neublastin pharmaceutical composition should provide a local concentration of neurotrophic factor of from about 5 ng/ml cerebrospinal fluid ("CSF") to 25 ng/ml CSF.
- CSF cerebrospinal fluid
- the Neublastin polypeptide of the invention may be administered by genetic delivery, using cell lines and vectors as described below under methods of treatment.
- the polynucleotide of the invention may be inserted into an expression vector, e.g. a plasmid, virus or other expression vehicle, and operatively linked to expression control sequences by ligation in a way that expression of the coding sequence is achieved under conditions compatible with the expression control sequences.
- Suitable expression control sequences include promoters, enhancers, transcription terminators, start codons, splicing signals for introns, and stop codons, all maintained in the correct reading frame of the polynucleotide of the invention so as to permit proper translation of mRNA.
- Expression control sequences may also include additional components such as leader sequences and fusion partner sequences.
- the promoter may in particular be a constitutive or an inducible promoter.
- Constitutive promoters could be synthetic, viral or derived from the genome of mammalian cells, e.g. the human ubiquitin promoter.
- the therapeutic cell line will be a human immortalised neural cell line expressing the polypeptide of the invention. For implantation, we contemplate implanting between about 10 5 to 10 10 cells, more preferably 10 6 to about 10 8 cells.
- the present invention which relates to polynucleotides and proteins, polypeptides, peptide fragments or derivatives produced therefrom, as well as to antibodies directed against such proteins, peptides or derivatives, may be used for treating or alleviating a disorder or disease of a living animal body, including a human, which disorder or disease is responsive to the activity of neurotrophic agents.
- the polypeptides of the present invention may be used directly via, e.g., injected, implanted or ingested pharmaceutical compositions to treat a pathological process responsive to the neublastin polypeptides.
- the polynucleotide of the invention including the complementary sequences thereof, may be used for the expression of the neurotrophic factor of the invention. This may be achieved by cell lines expressing such proteins, peptides or derivatives of the invention, or by virus vectors encoding such proteins, peptides or derivatives of the invention, or by host cells expressing such proteins, peptides or derivatives. These cells, vectors and compositions may be administered to treatment target areas to affect a disease process responsive to the neublastin polypeptides.
- Suitable expression vectors may be derived from lentiviruses, retroviruses, adenoviruses, herpes or vaccinia viruses, or from various bacterially produced plasmids may be used for in vivo delivery of nucleotide sequences to a whole organism or a target organ, tissue or cell population.
- Other methods include, but are not limited to, liposome transfection, electroporation, transfection with carrier peptides containing nuclear or other localising signals, and gene delivery via slow-release systems.
- "antisense" nucleotide sequences complementary to the neublastin gene or portions thereof may be used to inhibit or enhance neublastin expression.
- the invention relates to a method of treating or alleviating a disorder or disease of a living animal body, including a human, which disorder or disease is responsive to the activity of neurotrophic agents.
- the disorder or disease may in particular be damages of the nervous system caused by trauma, surgery, ischaemia, infection, metabolic diseases, nutritional deficiency, malignancy or toxic agents, and genetic or idiopathic processes.
- the damage may in particular have occurred to sensory neurons or retinal ganglion cells, including neurons in the dorsal root ganglion or in any of the following tissues: The geniculate, petrosal and nodose ganglia; the vestibuloacoustic complex of the Vlllth cranial nerve; the ventrolateral pole of the maxillomandribular lobe of the trigeminal ganglion; and the mesencephalic trigeminal nucleus.
- the disease or disorder is a neurodegenerative disease involving lesioned and traumatic neurons, such as traumatic lesions of peripheral nerves, the medulla, and/or the spinal cord, cerebral ischaemic neuronal damage, neuropathy and especially peripheral neuropathy, peripheral nerve trauma or injury, ischaemic stroke, acute brain injury, acute spinal cord injury, nervous system tumours, multiple sclerosis, exposure to neurotoxins, metabolic diseases such as diabetes or renal dysfunctions and damage caused by infectious agents, neurodegenerative disorders including Alzheimer's disease, Huntington's disease, Parkinson's disease, Parkinson-Plus syndromes, progressive Supranuclear Palsy (Steele-Richardson-Olszewski Syndrome), Olivopontocerebellar Atrophy (OPCA), Shy-Drager Syndrome (multiple systems atrophy), Guamanian parkinsonism dementia complex, amyotrophic lateral sclerosis, or any other congenital or neurodegenerative disease, and memory impairment connected to dementia.
- traumatic neurons such as traumatic lesions of peripheral nerves,
- we contemplate treatment of motor neuron diseases such as amyotrophic lateral sclerosis ("ALS") and spinal muscular atrophy.
- ALS amyotrophic lateral sclerosis
- a nerve guidance channel with a matrix containing neublastin polypeptides Such nerve guidance channels are disclosed, e.g., United States patent No. 5,834,029, incorporated herein by reference.
- polypeptides and nucleic acids of this invention are polypeptides and nucleic acids of this invention.
- peripheral neuropathies are used in the treatment of peripheral neuropathies.
- peripheral neuropathies contemplated for treatment with the molecules of this invention are trauma-induced neuropathies, e.g., those caused by physical injury or disease state, physical damage to the brain, physical damage to the spinal cord, stroke associated with brain damage, and neurological disorders related to neurodegeneration.
- chemotherapeutic agents e.g., taxoi or cisplatin
- toxin-induced neuropathies drug-induced neuropathies, vitamin-deficiency-induced neuropathies; idiopathic neuropathies; and diabetic neuropathies.
- chemotherapeutic agents e.g., taxoi or cisplatin
- toxin-induced neuropathies drug-induced neuropathies, vitamin-deficiency-induced neuropathies
- idiopathic neuropathies idiopathic neuropathies
- diabetic neuropathies e.g., United States patents 5,496,804 and 5,916,555, each herein incorporated by reference.
- non-neuropathies, mono-multiplex neuropathies, and poly-neuropathies including axonai and demyelinating neuropathies, using the neublastin nucleotides and polypeptides of this invention.
- polypeptides and nucleic acids of this invention are used in the treatment of various disorders in the eye, including photoreceptor loss in the retina in patients afflicted with macular degeneration, retinitis pigmentosa, glaucoma, and similar diseases.
- Another object of the present invention is to provide a method for the prevention of the degenerative changes connected with the above diseases and disorders, by implanting into mammalian brain including human vectors or cells capable of producing a biologically active form of neublastin or a precursor of neublastin, i.e. a molecule that can readily be converted to a biologically active form of neublastin by the body, or additionally cells that secrete neublastin may be encapsulated, e.g. into semipermeable membranes.
- Cells can be grown in vitro for use in transplantation or engraftment into mammalian brain including human.
- the gene encoding the polypeptide of the invention is transfected into a suitable cell line, e.g. into an immortalised rat neural stem cell line like HiB5 and RN33b, or into a human immortalised neural progenitor cell line, and the resulting cell line is implanted in the brain of a living body, including a human, to secrete the therapeutic polypeptide of the invention in the CNS, e.g. using the expression vectors described in International Patent Application WO 98/32869.
- a neublastin nucleic acid can be used to determine whether an individual is predisposed to developing a neurological disorder resulting from a defect in the neublastin gene, e.g., an defect in a neublastin allele, which has been acquired by, e.g., genetic inheritence, by abnormal embryonic development, or by acquired DNA damage.
- a defect in the neublastin gene e.g., an defect in a neublastin allele, which has been acquired by, e.g., genetic inheritence, by abnormal embryonic development, or by acquired DNA damage.
- the analysis can be by, e.g., detecting a deletion(s) or a point-mutation(s) within the neublastin gene, or by detecting the inheritance of such predisposition of such genetic defects with specific restriction fragment length polymorphisms (RFLPs), by detecting the presence or absence of a normal neublastin gene by hybridizing a nucleic acid sample from the patient with a nucleic acid probe(s) specific for the neublastin gene, and determining the ability of the probe to hybridize to the nucleic acid.
- RFLPs restriction fragment length polymorphisms
- a neublastin nucleic acid can be used as a hybridization probe.
- Such hybridization assays may be used to detect, prognose, diagnose, or monitor the various conditions, disorders, or disease states associated with aberrant levels of the mRNAs encoding the Neublastin protein.
- a neublastin nucleic acid can be construed as a "marker" for neublastin neurotrophic factor-dependant physiological processes. These processes include, but are not limited to, "normal” physiological processes (e.g., neuronal function) and pathological processes (e.g., neurodegenerative disease).
- aberrant levels as defined herein, is meant an increased or decreased level relative to that in a control sample or individual not having the disorder determined by quantitative or qualitative means.
- the neublastin nucleic acids and polypeptides of this invention may also be used to screen for and identify neublastin analogues, including small molecule mimetics of neublastin.
- the invention provides a method for identifying a candidate compound that induces a neuroblastin-mediated biological effect, the method comprising the steps of providing a test cell which when contacted with neublastin is induced to express a detectable product, exposing the cell to the candidate compound, and detecting the detectable product. The expression of the detectable product is indicative of the ability of the candidate compound to induce the neuroblastin-mediated biological effect.
- neublastin nucleic acids and polypeptides of this invention may be used on DNA chip or protein chips, or in computer programs to identify related novel gene sequences and proteins encoded by them, including allelic variants and single nucleotide polymorphisms ("SNPs").
- SNPs single nucleotide polymorphisms
- Example 1 Methods for Isolating Neublastin Nucleic Acids
- a 290 bp fragment was identified in two high throughput genomic sequences (HGTS) submitted to GenBank (Accession No. AC005038 and AC005051) by its homology to human persephin. From the nucleic acid sequence of the 290 bp fragment, two neublastin specific primers were synthesised.
- the neublastin top strand primer (“NBNint.sence”) had the sequence 5'-CCT GGC CAG CCT ACT GGG-3' [SEQ ID NO: 17].
- the neublastin bottom strand primer (“NBNint.antisence”) had the sequence 5'-AAG GAG ACC GCT TCG TAG CG-3' [SEQ ID NO: 18]. With these primers, 96-well PCR reactions were performed.
- a 96-well master plate containing plasmid DNA from 500,000 cDNA clones, was loaded with approximately 5000 clones per well.
- a 96-well sub-plate was utilised with E. coli DH10B glycerol stock containing 50 clones per well.
- a neublastin nucleic acid was identified by three rounds of amplification using polymerase chain reaction ("PCR") techniques; amplification increases the number of copies of the nucleic acid in the sample.
- PCR polymerase chain reaction
- PCR thermocycling reactions were performed using the following procedure and conditions. DNA was initially denatured at 94°C for 3 minutes, and then followed by 35 cycles of denaturation at 94°C for 1 minute each, annealing at 55°C for 1 minute, a first extension at 72°C for 90 seconds; and a final extension at 72°C for 5 minutes. The products of 96 individual PCR reactions were analysed by gel electrophoresis using a 2% agarose gel containing ethidium bromide stain. The 102 bp, positive PCR product seen from a well was found to correspond to a unique 96- well sub-plate.
- the 102 bp nucleic acid fragment had the following sequence [SEQ ID NO. 13]:
- Sub-Plate Screening The 96-well human foetal brain sub-plate was screened by PCR-mediated amplification by placing 1 ⁇ l of the glycerol stock from the corresponding sub-plate well in a total volume of 25 ⁇ l which contained: 0.2 mM of each of the two gene-specific primers; 1x standard PCR buffer (Buffer V; Advanced
- Colony PCR One ml of the glycerol stock from the positive sub-plate well was diluted 1 :100 in Luria broth (LB). One ml and 10 ml of the aforementioned dilution were then plated on two separate agar plates containing Luria broth ("LB"), and 100 ⁇ g/ml carbenicillin. The LB plates were then incubated overnight at 30°C.
- LB Luria broth
- 96 colonies were picked into a new 96-well PCR plate containing: 0.2 mM of each of the two aforementioned gene-specific primers, 1x standard PCR buffer (Buffer V; Advanced Biotechnologies, UK), 0.2 mM dNTPs (Amersham-Pharmacia), 0.1 M GC-Melt (Clontech Laboratories, USA), and 0.5 units of Taq DNA polymerase (5 U/ ⁇ l; Advanced Biotechnologies, UK) in a final volume of 25 ⁇ l.
- Buffer V Standard Biotechnologies, UK
- 0.2 mM dNTPs Amersham-Pharmacia
- 0.1 M GC-Melt 0.1 M GC-Melt
- Taq DNA polymerase 5 U/ ⁇ l; Advanced Biotechnologies, UK
- An additional method of amplifying the full-length neublastin cDNA or cDNA fragment can be performed by RACE (Rapid Amplification of cDNA ends) and the neublastin-specific primers NBNint.sence and NBNint.antisence described above, combined with vector-specific or adapter-specific primers, for example by using the Marathon cDNA amplification kit (Clontech Laboratories, USA, Cat. No. K1802-1).
- Another method of cloning neublastin cDNA is by screening human adult or foetal brain libraries with one or more neublastin probes described herein (and as exemplified in Figure 1). These libraries include: ⁇ gt11 human brain (Clontech
- a rapid screening procedure for the neublastin gene was performed in the following manner.
- a 96-well master plate containing plasmid DNA from 500,000 15 cDNA clones, was loaded with approximately 5000 clones per well.
- a 96-well sub- plate was utilised with E. Coli glycerol stock containing 50 clones per well.
- Three rounds of PCR-mediated amplification was performed in order to identify a gene of interest ⁇ i.e., neublastin).
- a mouse fettle cDNA master plate was screened by 20 96-well PCR using gene-specific primers to isolate the mouse neublastin cDNA. The following two primers were synthesised:
- neublastin C2 primer 5'-GGCCACCGCTCCGACGAG-3'
- the 220 bp nucleic acid possessed the following sequence [SEQ ID NO: 14]: ⁇ '-GGCCACCGCTCCGACGAGCTGATACGTTTCCGCTTCTGCAGCGG CTCGTGCCGCCGAGCACGCTCCCAGCACGATCTCAGTCTGGCCAG CCTACTGGGCGCTGGGGCCCTACGGTCGCCTCCCGGGTCCCGGC 30 CGATCAGCCAGCCCTGCTGCCGGCCCACTCGCTATGAGGCCGTCT
- 96-well PCR reactions were then performed in the following manner. Thirty nanograms of mouse foetal brain cDNA (6 ng/ ⁇ l; Origene Technologies) was obtained from the corresponding well of the master plate and placed in a total volume of 25 ⁇ l
- 35 which also contained: 0.2 mM of each of the two aforementioned gene-specific primers ⁇ i.e., C2 primer (NBNint.sence) and neublastin C2as primer (NBNint.antisence)), 1x standard PCR buffer (Buffer V; Advanced Biotechnologies, UK), 0.2 mM dNTPs (Amersham-Pharmacia), 0.1 M GC-Melt (Clontech Laboratories, USA), and 0.5 units of Taq DNA polymerase (5 U/ ⁇ l; Advanced Biotechnologies, UK).
- the following PCR thermocycling conditions were utilised: an initial denaturation at 94°C for 3 minutes, followed by 35 cycles of denaturation at 94°C for 1 minute each, annealing at 55°C for 1 minute, extension at 72°C for 90 seconds; and a final extension at 72°C for 5 minutes.
- the 96 individual PCR reactions were analysed on a 2% agarose gel containing ethidium bromide stain.
- the 220 bp, positive PCR product seen from a well was found to correspond to a unique 96-well sub-plate.
- the 96 individual PCR reactions were then analysed by gel electrophoresis on a 2% agarose gel containing ethidium bromide stain.
- the 220 bp positive PCR product which had been identified corresponded to a unique well of the 96-well sub-plate.
- Sub-Plate Screening The 96-well mouse foetal sub-plate was screened by PCR-mediated amplification by placing 1 ⁇ l of the glycerol stock from the corresponding sub-plate well into a final, total volume of 25 ⁇ l which contained: 0.2 mM of each of the two aforementioned gene-specific primers; 1x standard PCR buffer
- PCR thermocycling was performed according to the conditions described above for the master plate screening.
- Colony PCR One ml of the glycerol stock from the positive sub-plate well was diluted 1 :100 in Luria broth (LB). One ml and 10 ml of the aforementioned dilution were then plated on two separate LB plates, containing 100 ⁇ g/ml carbenicillin, and incubated at 30°C overnight.
- a total of 96 colonies were isolated and transferred to a 96-well PCR plate containing: 0.2 mM of each of the two aforementioned gene- specific primers, 1x standard PCR buffer (Buffer V; Advanced Biotechnologies, UK), 0.2 mM dNTPs (Amersham-Pharmacia); 0.1 M GC-Melt (Clontech Laboratories, USA), and 0.5 units of Taq DNA polymerase (5 U/ ⁇ l; Advanced Biotechnologies UK) in a final volume of 25 ⁇ l.
- PCR thermocycling was performed according to the conditions described above ⁇ see, "master plate screening", infra).
- the 96 individual PCR reactions were analysed by gel electrophoresis on a 2% agarose gel containing ethidium bromide. A positive colony was identified by the presence of the 220 bp fragment. Plasmid DNA was prepared from this positive colony.
- the clone was sequenced by automated DNA sequencing using the BigDye ® terminator cycle sequencing kit with Ampli Taq DNA polymerase. The sequencing gels were run on the ABI Prism 377 (PE Applied Biosystems). The resulting sequence of this clone revealed a full-length cDNA of 2136 bp [SEQ ID NO: 15].
- the cDNA includes an open reading frame with the predicted amino acid sequence shown in SEQ ID NO: 16, which codes for a mouse pre-pro-neublastin polypeptide.
- primer pair No. 1 Using primer pair No. 1 , a 887 bp DNA fragment was amplified from a preparation of human genomic DNA purchased from Clontech Laboratories, (Cat. No. 6550-1).
- PCR protocol PCR was performed using the ExpandTM High Fidelity PCR system (Boehringer Mannheim) with buffer 1. The PCR reaction mixture was supplemented with 5 % dimethylsulfoxide (DMSO) and 17.5 pmol of each dNTP in a total volume of 50 ⁇ l. Thermocycling was performed with a pre-denaturation step at 94°C for 2 minutes, followed by 35 two-step cycles at 94°C for 10 seconds, and 68°C for 1 minute, respectively. Thermocycling was terminated by incubation at 68°C for 5 minutes. Thermocycling was carried out in a PTC-225 DNA Engine Tetrad thermocycler (MJ Research, MA). The PCR products were analysed by gel electrophoresis on 2% agarose (FMC) and then photographed.
- DMSO dimethylsulfoxide
- FMC 2% agarose
- the 887 bp fragment amplified from human genomic DNA with primer pair No. 1 was cloned into the pCRII vector (Invitrogen), and transformed into XL 1-Blue competent £. coli cells (Stratagene).
- the resulting plasmid, designated neublastin-2 was sequenced using Thermosequenase (Amersham Pharmacia Biotech). Sequencing products were analysed by electrophoreses on an ALFExpress automated sequencer (Amersham Pharmacia Biotech). Fragments obtained by PCR amplification of human genomic DNA with the second pair of primers (Primer Pair No. 1 , above), were sequenced, revealing an additional 42 bp region at the 3' prime end of the open reading frame.
- the full-length sequence was analysed by comparing it to the sequences of nucleic acids of other neurotrophic factors, as well as by mapping exon-intron boundaries using gene-finding software programs which identify probable splice junctions and regions of high coding potential using Netgene and Gene Mark software ⁇ Brunak et al., J. Mol. Biol. 1991 220 49-65); Borodovsky et al., Nucl. Acids Res. 1995 23 3554-62).
- the exon-intron boundaries were confirmed by the cDNA obtained from the Rapid Screen described above. As illustrated in FIG. 7, the resulting neublastin gene has two exons separated by a 70 bp intron.
- the exons have a predicted amino acid sequence of a full-length Neublastin polypeptide.
- the predicted cDNA [SEQ ID NO: 3] contains an open reading frame (ORF) encoding 238 amino acid residues [SEQ ID NO: 4].
- the Neublastin-2 clone contained the complete coding sequence of pro-neublastin.
- the amino acid sequence encoded by the gene showed high homology to three proteins, persephin, neurturin, and GDNF.
- neublastin RNA was detected in both nervous and non-nervous tissue in rodents and in humans, and at various developmental immature and adult stages, using the techniques described below.
- the total amount of denatured DNA was added together with 5 ⁇ l of Redivue [ 32 P] dCTP (Amersham Pharmacia Biotech Ltd.) in the reaction tube containing buffered solution of dATP, dGTP, dTTP, exonuclease free Klenow enzyme and random primer in dried stabilised form.
- the solution was mixed by pipetting up and down 2 times, moving the pipette tip around in the solution, and the reaction mixture was incubated at 37°C for 10 minutes.
- the labelling reaction was stopped by adding 5 ⁇ l of 0.2 M EDTA.
- the labelled DNA was denatured to single strands by heating the DNA sample to 95-100°C for 5 minutes, then snap cooling the DNA sample on ice for 5 minutes. The tube was centrifuged and its contents mixed well. Finally the single-stranded DNA probe was purified using the Nucleotide Removal Kit (Qiagen).
- Hybridization Techniques Prepared northern blots were purchased from a commercial supplier ("Multiple Tissue Northern Blots, Clontech Laboratories, USA, Catalogue Nos. 7760-1 and 7769-1) and were hybridized according to the manufacturer's instructions using the neublastin 32 P-labeled probe prepared above.
- ExpressHyb Solution (Clontech Laboratories, USA) was used, and a concentration of approximately 3 ng/ml of the labelled probe was employed. The ExpressHyb solution was heated to 68°C and then stirred to dissolve any precipitate.
- Each northern blot membrane (10x10 cm) was pre-hybridized in at least 5 ml of ExpressHyb Solution at 68°C for 30 minutes in a Hybaid Hybridization Oven according to the manufacturer's instructions.
- the neublastin 32 P-labeled probe was denatured at 95-100°C for 2 minutes and then chilled quickly on ice.
- Fourteen microliters (14 ⁇ l) of the labelled probe was added to 5 ml of fresh ExpressHyb, and thoroughly mixed.
- the ExpressHyb Solution used in the p re-hybridization was replaced by evenly distributing over the blots the 5 ml of fresh ExpressHyb Solution containing labelled DNA probe.
- Blots were incubated at 68°C for 1 hour in a Hybaid hybridization Oven. After incubation, the blots were rinsed and washed several times at low stringency (2x SSC buffer containing 0.05 % SDS at room temperature) followed by a high stringency wash (0.1x SSC containing 0.1 % SDS at 50°C) [20X SSC is 0.3 M NaCI/0.3 M Na citrate, pH 7.0]. The blots were exposed to a Hyperfilm MP (Amersham Pharmacia Biotech Ltd.) at -80°C using intensifying screens.
- a Hyperfilm MP Amersham Pharmacia Biotech Ltd.
- the markers represent polynucleotides of 1.35 kilobase pairs ("kb"), 2.4 kb, 4.4 kb, 7.5 kb, and 9.5 kb in size.
- the membrane of Fig. 1A was prepared with mRNA extracted from various adult human tissues: From the results of the northern blot hybridization analysis, applicants conclude that neublastin mRNA is expressed in many adult human tissues. The highest level of neublastin expression is detected in the heart, in skeletal muscle and in the pancreas.
- the membrane of FIG. 1B was prepared with RNA extracted from various regions of the adult human brain. Within the adult brain, the highest level of expression is seen in the caudate nucleus and in the thalamus. An mRNA transcript of approximately 5 kb was the predominant form of neublastin mRNA expressed in the brain.
- neublastin RNA in animal tissues, e.g., rodent tissues, with a neublastin anti-sense probe.
- Tissue Samples Time pregnant mice (B&K Universal, Sweden) were killed by cervical dislocation on gestational day 13.5 or 18.5. Embryos were removed by dissection under sterile conditions, and immediately immersed in a solution of 0.1 M phosphate buffer (PB) containing 4% paraformaldehyde (“PFA") for 24-30 hours, and then removed from the PFA and stored in PBS. The tissue was prepared for sectioning by immersing the tissue in a solution of 30% sucrose, and then embedding it in TissueTech (O.C.T. Compound, Sakura Finetek USA, Torrance ,CA).
- PB phosphate buffer
- PFA paraformaldehyde
- Neonatal heads/brains (P1 , P7) were fixed following the same protocol as for the embryonic stages, and adult brain tissue was dissected, immediately frozen on dry ice, and cut on a cryostat without any prior embedding.
- Preparation of Neublastin Riboprobes An antisense neublastin RNA probe
- a "neublastin riboprobe” was made as follows. Nucleotides 1109-1863 of the mouse neublastin cDNA sequence [SEQ ID NO: 15] were sub-cloned into the BlueScript vector (Stratagene). The resulting plasmid was cut into a linear DNA using EcoRI restriction endonuclease. The EcoRI DNA fragment was in vitro transcribed with T3 RNA polymerase and the digoxigenin ("DIG”) RNA Labelling Kit according to the manufacturer's instructions (Boehringer Mannheim).
- DIG digoxigenin
- Hybridization Cryostat sections were fixed for 10 minutes in 4% PFA, treated for 5 minutes with 10 mg/ml of proteinase K, dehydrated sequentially in 70% and 95% ethanol for 5 and 2 min, respectively, and then allowed to air dry.
- Hybridization buffer (50% deionized formamide, 10% of a 50% dextran sulphate solution, 1% Denhardt's solution, 250 ⁇ g/ml yeast tRNA, 0.3M NaCl, 20mM Tris-HCI (pH8), 5mM EDTA, 10mM NaPO , 1% sarcosyl) containing 1 ⁇ g/ml of the DIG-labelled probe was heated to 80°C for 2 minutes and applied onto the sections.
- sections was then covered with parafilm and incubated at 55°C for 16-18 hours. The next day the sections were washed at high stringency (2x SSC containing 50% formamide) at 55°C for 30 minutes, and then washed in RNase buffer and incubated with 20 ⁇ g/ml of RNaseA for 30 minutes at 37°C.
- sections were pre-incubated in blocking solution (PBS containing 0.1% Tween-20 and 10% heat-inactivated goat serum) for 1 hour and then incubated over night at 4°C with a 1 :5000 dilution of alkaline-phosphatase-coupled anti-DIG antibody (Boehringer Mannheim).
- each section was given four, two- hour washes in PBS containing 0.1 % Tween-20, and then given two ten-minute washes in NTMT buffer (100 mM NaCl, 100 mM Tris-HCI (pH9.5), 50 mM MgCI 2 , 0.1% Tween-20).
- NTMT buffer 100 mM NaCl, 100 mM Tris-HCI (pH9.5), 50 mM MgCI 2 , 0.1% Tween-20.
- the sections were then incubated in BM-purple substrate containing 0.5mg/ml of levamisole for 48 hours. The colour reaction was stopped by washing in PBS.
- the sections were air dried and covered with cover-slip with DPX (KEBO-lab, Sweden).
- In situ hybridization Two series of sections were hybridized using an anti- sense alkaline-phosphatase (AP) conjugated oligodeoxynucleotide probe (5'-NCA GGT GGT CCG TGG GGG GCG CCA AGA CCG G-3' [SEQ ID NO: 27], Oligo. No. 164675, DNA Technology, Denmark,). This probe is complementary to bases 1140 to 1169 of the mouse neublastin cDNA of SEQ ID NO: 15).
- AP anti- sense alkaline-phosphatase conjugated oligodeoxynucleotide probe
- the sections Prior to hybridization, the sections were air dried at room temperature, heated at 55°C for 10 min., and then treated with 96% ethanol at 4°C overnight. The sections were then air dried and incubated in hybridization medium (5.0 pmol probe/ml) overnight at 39 °C ⁇ Finsen et al., Neurosci. 1992 47 105-113; West et al., J. Comp. Neurol. 1996 370 11-22).
- Post-hybridization treatment consisted of four, thirty-minute rinses in 1x SSC (0.15M NaCl, 0.015 M Na-citrate) at 55 °C, followed by three ten-minute rinses in Tris- HCI, pH 9.5 at room temperature prior to applying AP developer.
- AP developer was prepared immediately before use and contained nitroblue tetrazoleum (NBT, Sigma), 5-bromo, 4-chloro, 3-indolylphosphate (BCIP, Sigma), and Tris-HCI-MgCI 2 buffer, pH 9.5 ⁇ Finsen et al., Neurosci. 1992 47 105-113). AP development took place in the dark at room temperature for 48 hours.
- the colour reaction was stopped by rinsing the sections in destilled water.
- the sections were dehydrated in graded acetone, softened in xylene-phenol creosote (Allchem, UK), cleared in xylene, and coverslipped using Eukitt (Bie & Berntsen, Denmark).
- Control reactions consisted of (1) pre-treating the sections with RNase A (50 ⁇ g/ml, Pharmacia, Sweden) prior to hybridization; (2) hybridizing the sections with a hundred-fold excess of unlabelled probe; and (3) hybridizing the sections with hybridization buffer alone.
- the results of the hybridization reactions are presented in Table 2.
- neublastin was weakly expressed in rat embryos in the forebrain, in the hindbrain, and in the spinal cord. Neublastin mRNA was also detected in the eye (retina), dorsal root ganglia, the trigeminal ganglia (V), and in the kidneys, lungs, heart, liver, and intestines. In newborn (PO) rats there was marked neublastin expression in the cortex and in the striatum. Neublastin expression was also detected in the olfactory bulb and in the hippocampus. In 7-day-old (P7) rats, neublastin was expressed in the cortex, the striatum, the olfactory bulb, and in the cerebellum.
- a marked signal was seen in the hippocampus. In adult rats, very low or undetectable levels of neublastin expression were detected in most areas of the brain. Weak signals were detected in the thalamic nucleus, and marked neublastin expression was detected in the hippocampus.
- Example 4 Neublastin Polypeptides
- the open reading frame, or coding region (CDS), identified in SEQ ID NO: 8 encodes the pre-pro-polypeptide (designated "pre-pro-neublastin”).
- the amino acid sequence predicted from this open reading frame is shown in SEQ ID NO: 9.
- SEQ ID NO: 9 Based on SEQ ID NO: 9, three variants of neublastin polypeptides were identified. These variants include: (7) the polypeptide designated herein as NBN140, which possesses the amino acid sequence designated as SEQ ID NO: 10;
- CDS coding region
- SEQ ID NO: 3 which encodes the pre-pro-polypeptide possessing the amino acid sequence (designated as SEQ ID NO: 4)
- SEQ ID NO: 4 three variants of neublastin were identified. These variants include: (i) the polypeptide which possesses the amino acid sequence designated as SEQ ID NO: 5;
- SEQ ID NO: 9 was aligned with the amino acid sequences of GDNF, persephin and neurturin. This alignment is illustrated in Table 3.
- Persephin-full LQGQGRAHGG PCCRPTRYT-DVAFLDDRHR QRLPQLSAAACGCGG GDNF_HUMAN-ful1 LSRNRR VSD IVGQACCRPIAFDDDLSFLDDN VYHILRKHSAKRCGCI- * indicates positions which have a single, fully conserved residue, indicates that one of the following 'strong' groups is fully conserved: -STA, NEQK, NHQK, NDEQ, QHRK, MILV, MILF, HY, FYW. 5 . indicates that one of the following 'weaker' groups is fully conserved:
- 10 neublastin has seven conserved cysteine residues at locations that are conserved within the TGF- ⁇ superfamily.
- the preferred neuroblastin polypeptide contains (seven) cysteines conserved as in SEQ ID NO: 2 at positions 8, 35, 39, 72, 73, 101 and 103, or as in SEQ ID NOS: 4 and 9 at positions 43, 70, 74, 107, 108, 136 and 138. These seven conserved cysteine residues are known within the TGF-b
- neublastin was shown to be a member of the GDNF subfamily of neurotrophic factors (LGLG - FR(Y/F)CSGSC - QxCCRP -
- IHA Inhibin- ⁇
- the full length cDNA encoding neublastin was inserted into the eukaryotic expression vector pUbilZ.
- This vector was generated by cloning the human UbC promoter into a modified version of pcDNA3.1/Zeo.
- the unmodified pcDNA3.1/Zeo is commercially available (Invitrogen).
- the modified pcDNA3.1/Zeo is smaller than the parent vector, because the ampicillin gene (from position 3933 to 5015) and a sequence from position 2838 to 3134 were removed.
- the CMV promoter was replaced with the UbC promoter from pTEJ-8 ⁇ Johansen et ai, FEBS Lett. 1990 267 289-294), resulting in pUbilZ.
- HiB5 is an immortalised rat neural cell line ⁇ Renfranz er a/., Cell. 1991 66 713-729.
- HiB5 cell lines stably expressing neublastin (as determined by RT-PCR) have been established.
- HiB5pUbi1zNBN22 expression was confirmed by hybridizing total RNA on a Northern blot with a 32 P-labelled neublastin probe. The results of these studies are shown in Fig. 2.
- HiB5pUbi1zNBN22 was then used as a source of neublastin for studies of neublastin neurotrophic activity.
- FIG. 2 shows the expression of neublastin cDNA in the HiB5pUbi1zNBN22
- antibodies raised against neublastin-derived polypeptides also recognised a protein of approximately 13 kilodaltons ("kD") in conditioned medium from the HiB5pUbi1zNBN22 clone but not from non-transfected HiB5 cells (cf. Example 6).
- the predicted molecular weights of the non-modified (i.e. lacking post- translational modifications) neublastin polypeptides NBN140 [SEQ ID NO: 10], NBN116 [SEQ ID NO: 11] and NBN113 [SEQ ID NO: 12] were determined to be 14.7 kilodaltons ("kD"), 12.4 kD, and 12.1 kD, respectively.
- a Northern blot with total RNA (10 ⁇ g) from untransfected HiB5 cells and the HiB5pUbi1zNBN22 clone was prepared by electrophoresis on a 0.8 % formaldehyde agarose gel and blotted onto a nylon membrane (Duralone, Stratagene). The blot was hybridized and washed as described in Example 3 with a 1.3 kb 32 P- labelled probe prepared by random labelling covering SEQ ID NO: 8 and additional nucleotides from the 5'UTR and 3'UTR of the neublastin cDNA. The blot was exposed to a Hyperfilm MP (Amersham) at -80°C using intensifying screens.
- Conditioned medium from Hib5pUbi1zNBN22, or untransfected Hib5 cells incubated overnight in serum-free medium supplemented with N2 supplement (Life Technologies; Cat. No. 17502-048) was concentrated and separated on 15% polyacrylamide gels (Amersham Pharmacia Biotech; Cat. No. 80-1262-01). Proteins were transferred to PVDF-membranes (Amersham Pharmacia Biotech; Cat. No. RPN- 303F) and non-specific protein-binding sites were blocked with 5% non-fat dry milk in PBS with 0.1% Tween-20.
- Membranes were incubated overnight with a polyclonal neublastin antibody (1 :1000), followed by incubation with a secondary anti-rabbit IgG antibody (Amersham Pharmacia Biotech; Cat. No. NA 934) conjugated to horseradish peroxidase (1 :2000). Immunostaining was visualised using enhanced chemoluminiscence (ECL) (Amersham Pharmacia Biotech; Cat. No. RPN2109) or ECL+ (Amersham Pharmacia Biotech; Cat. No. RPN2132) according to the manufacturer ' s instructions (Amersham).
- ECL enhanced chemoluminiscence
- Figure 3A and 3B are illustrations of the expression of neublastin protein in transfected HiB5 cells.
- the medium was then analysed by Western blotting using two different polyclonal antibodies, Ab-1 and Ab-2 described in Example 10, specific for neublastin.
- both of the antibodies were found to recognise a protein with a molecular weight of approximately 15 kDa. This protein was not seen in non-transfected HiB5 cells.
- the cloned cDNA encoding neublastin can also be inserted into other eukaryotic expression vector, e.g., the eukaryotic expression vector TEJ-8 ⁇ Johansen et al., FEBS Lett. 1990 267 289-294) or pcDNA-3 (Invitrogen), and the resulting expression plasmid transfected into an alternative mammalian cell line, e.g., Chinese Hamster Ovary ("CHO") cells, the HEK293, the COS, the PC 12, or the RN33b cell lines, or a human neural stem cell.
- Stable cell lines expressing neublastin are used, e.g., to produce the neublastin protein.
- pEAG347 contains tandem SV40 early and adenovirus major late promoters (derived from plasmid pAD2beta; Norton and Coffin, Mol. Cell. Biol. 1985 5 281), a unique Notl cloning site, followed by SV40 late transcription termination and polyA signals (derived from plasmid pCMVbeta; MacGregor and Caskey, Nucl. Acids. Res. 1989 17 2365).
- pEAG347 contains a pUC19- derived plasmid backbone and a pSV2dhfr-derived dhfr for MTX selection and amplification in transfected CHO cells.
- Plasmid pJC070.14 was generated in two steps. First, a fragment encoding the prepro form of human Neublastin was isolated from plasmid pUbi1Z-NBN using the polymerase chain reaction with oligonucleotides KD2-824 5'AAGGAAAAAA GCGGCCGCCA TGGAACTTGG ACTTGGAGG3' [SEQ ID NO: 31], KD2-825 5' I I I I I I CCTT GGCGGCCGCT CAGCCCAGGC AGCCGCAGG3' [SEQ ID NO: 32] and PFU polymerase.
- the fragment was cloned into the Srf-1 site of pPCR-Script Amp SK(+) to generate the plasmid pJC069.
- a partial Not-1 digest was performed on plasmid pJC069 to generate a 685bp fragment (containing the neublastin gene) which was cloned into the Not-1 site of plasmid pEAG347 to generate plasmid pJC070.14. Transcription of the neublastin gene in plasmid pJC070.14 is controlled by the adenovirus major late promoter.
- CHO cell lines expressing Neublastin 200 ⁇ g of pJC070.14 was linearized by digestion with the restriction endonuclease Mlu-1. The DNA was extracted with phenol: chloroforrr soamyl alcohol (25:24:1) and ethanol precipitated. The linearized DNA was resuspended in 20mM Hepes pH7.05, 137mM NaCl, 5mM KCI, 0.7mM Na 2 HPO 4 , 6mM dextrose (HEBS) and introduced into ⁇ 4E7 CHO dukx R" ⁇ dhfr-) cells (p23) by electroporation (280V and 960 ⁇ F).
- HEBS 6mM dextrose
- the cells were returned to culture in ⁇ + Modified Eagle's Medium (MEM) supplemented with 10% foetal bovine serum (FBS) for two days.
- MEM Modified Eagle's Medium
- FBS foetal bovine serum
- the cells were then trypsinized and replated in 100mm dishes (100,000 cells/plate) in ⁇ -MEM (lacking ribo- and deoxyribonucleosides), supplemented with 10% dialysed FBS, for five days.
- the cells were subsequently split at a density of 100,000 cells/100mm plate, and selected in 200nM methotrexate. Resistant colonies were picked and scaled up to 6 well plates; conditioned media from each clone was screened using a specific assay for neublastin described below.
- the twelve clones expressing the highest level of neublastin were scaled up to T162 flasks and subsequently reassayed.
- the CHO cell lines produced neublastin in the range of 25 to 50
- GDNF-like molecules can be evaluated for their ability to mediate binding between the extracellular domain of RET and the various co- receptors, GFR ⁇ l , GFRo2, and GFR ⁇ 3.
- Soluble forms of RET and the co-receptors were generated as fusion proteins.
- a fusion protein between the extracellular domain of rat RET and placental alkaline phosphatase (RET-AP) and a fusion protein between the extracellular domain of rat GFR ⁇ l (disclosed in published application WO 9744356; November 27, 1997, herein incorporated by reference) and the Fc domain of human lgG1 (rGFR ⁇ 1-lg) have been described ⁇ Sanicola et al. Proc Natl Acad Sci USA 1997 94 6238).
- a DNA fragment encoding amino acids 1-359 of murine RETL3 was ligated to a fragment containing the Fc domain of human lgG1 and cloned into the expression vector pEAG347 to generate plasmid pGJ144.
- Plasmid pGJ144 was transfected into Chinese hamster ovary cells (CHO) to generate a stable cell line producing the fusion protein, which was purified on a Protein A Sepharose immunoaffinity column using standard methods.
- the GDNF-like molecule can mediate binding of the co-receptor to RET in this assay, then the RET-AP fusion protein will be retained on the plate and the amount that is retained can be measured using a chemiluminescent substrate for alkaline phosphatase.
- Dynex Microlite-1 ELISA plates (Dynex Technologies) were coated with 1 ⁇ g/ml goat antibody specific for human Fc in 50mM bicarbonate/carbonate, pH 9.6 for 16hr. The plates were emptied and filled with 300 ⁇ l of 1 % l-block (Tropix) in TBS/0.5% Tween-20 (TBST), for 1 hr. After washing three times with TBST the wells were filled with 100 ⁇ l of 1 ⁇ g/ml rGFR ⁇ 1-lg or mGFR ⁇ 3-lg diluted in conditioned media from 293 EBNA cells expressing the RET-AP fusion gene.
- the protein was extracted from the medium using the GFR ⁇ 3-lg fusion protein and analysed by western blots with polyclonal antibodies raised against neublastin peptides.
- the neublastin was extracted with mGFR ⁇ 3-lg attached to Sepharose beads.
- mGFR ⁇ 3-lg was attached to Sepharose beads using the conditions suggested by the manufacturer, Pharmacia Inc.
- 100 ⁇ L of mGFR ⁇ 3-lg- Sepharose was added to 1.0 mL samples of conditioned medium from a negative control CHO cell line or from the neublastin producing CHO cell line #16.
- the suspensions were incubated for two hours on a rocking platform. Each suspension was centrifuged and the supernatant removed followed with three 1.0 mL washes with 10 mM HEPES, 100 mM NaCl, pH 7.5.
- Each resin was resuspended in 100 ⁇ L of 2X reducing sample buffer and heated to 100°C for 5 minutes. 20 ⁇ L of the sample buffer supernatant and 10 uL of a molecular weight standard (FMC) were applied to each well of a 10-20% precast SDS-PAGE gel (Owl Scientific). The gel was electrophoresed at 40 mA constant current for 72 minutes.
- FMC molecular weight standard
- the protein was electroblotted to nitrocellulose (Schleicher and Schuell) in a Hofer Scientific apparatus in 10 mM CAPS, 10% methanol, 0.05% SDS, pH 11.2 buffer system (45 minutes at 400 mA constant current).
- nitrocellulose filter was removed from the cassette and the molecular weight markers were visualised by staining with a solution of 0.1% Ponceau S in 1% acetic acid for 60 seconds.
- the membrane was cut into two sections and the excess stain was removed by gentle agitation in distilled water. The membranes were blocked in 2% nonfat dry milk in TBS overnight at 4°C.
- the membranes were incubated individually with two of the affinity-purified anti-neublastin peptide antibodies (R30 and R31) at a concentration of 1.0 ⁇ g/mL in 2% nonfat dry milk in TBS). The membranes were washed with three 10 minute washes in TBS- Tween and incubated in a 1 :5000 dilution of goat anti-rabbit IgG-HRP conjugate (Biorad) for 30 minutes. The membranes were washed with three 10 minute washes of TBS-Tween and developed with ECL substrate (Amersham). As shown in Figure 12, specific bands were detected in the proteins extracted from the neublastin producing CHO cell line with both antibodies (lanes 2 and 4), when compared to the bands observed in the extracted proteins from the negative control cell line (lanes 1 and 3).
- the molecular weight of the lower species is about 13kD and probably represents the mature domain of neublastin, generated after cleavage of the pro- domain. This cleavage could occur after any one of the three Arg- (e.g., -RXXRi-) residues of the prepro neublastin protein to generate either the 140 AA, 116 AA or 113 AA forms, as set forth in SEQ ID NOS: 10, 11 , or 12, respectively.
- the predicted molecular weights of the non-modified (i.e., lacking post-translational modifications) neublastin polypeptides NBN140 [SEQ ID NO: 10], NBN116 [SEQ ID NO: 11], and NBN113 [SEQ ID NO: 12] were determined to be 14.7 kD, 12.4 kD, and 12.1 kD, respectively. Further analysis will be needed to confirm the structure of this species as well as the other neublastin specific bands.
- the neublastin was extracted with hGFR ⁇ 3-lg captured on an ELISA plate.
- a DNA fragment encoding amino acids 1-364 of human GFR ⁇ 3 was ligated to a fragment containing the Fc domain of human lgG1 and cloned into the expression vector CH269 described by Sanicola et al. (Proc Natl Acad Sci USA 1997 94 6238).
- the fusion protein encoded by this plasmid was transiently expressed in 293-Epstein-Barr virus-encoded nuclear antigen (EBNA) cells and purified on a Protein A Sepharose immunoaffinity column using standard methods.
- EBNA Protein A Sepharose immunoaffinity column
- the proteins were transferred to nitrocellulose.
- the membrane was blocked and probed in 5% non fat dry milk, PBST and washed in PBST.
- Neublastin was detected by electrochemoluminescence after reaction with polyclonal antibodies (R30 and R31) raised against two neublastin peptides (at 1 ug/ml) followed by reaction with HRP-conjugated goat anti-rabbit antibodies (BioRad).
- polyclonal antibodies R30 and R31
- HRP-conjugated goat anti-rabbit antibodies BioRad
- five neublastin specific bands were detected in the extracted proteins from the neublastin producing CHO cell line (lane 2).
- the lower two bands are very similar to the bands observed in Figure 12; again, the lower band probably represents the mature domain of neublastin generated after cleavage of the pro- domain.
- syngenes were constructed with lower GC content and preferred E. coli codons.
- the syngene is being cloned into two vectors, pET19b and pMJB164, a derivative of pET19b.
- the construction with pET19b is shown in Figure 14.
- the sequence encoding the mature domain of neublastin (NBN113) is directly fused to an initiating methionine.
- the construction with pMJB164 is shown in Figure 15.
- the mature domain of neublastin is fused to a histidine tag (i.e. 10 histidines) separated by an enterokinase cleavage site.
- the initiating methionine precedes the histidine tag.
- Example 6 Effect of Neublastin on the survival of Rat Embryonic Dopaminergic Neurons and ChAT Activity.
- HBSS cold Hanks Buffered Salt Solution
- Tissue pieces were incubate in sterile filtered 0.1 % trypsin (Worthington) and 0.05% DNase (Sigma) in HBSS at 37°C for 20 min. Tissue pieces was then rinsed four times in HBSS + 0.05% DNase and dissociated using a 1 ml automatic pipette. The suspension was then centrifuged at 600 rpm for 5 min and the pellet was resuspended in serum conditioned medium (SCM; DMEM with 10% foetal calf serum).
- SCM serum conditioned medium
- the total number of cells was assessed by tryphan blue dye exclusion method and plated at a density of 100.000 cells/cm2 in poly-L-lysine coated eight-well chamber slides (Nunc) for assessment of dopaminergic neuron survival or at 200 000 cells/cm 2 in 48 well plates (Nunc) for ChAT activity measurements.
- Cells were incubated in SCM at 5% CO2/95% O2 and 95% humidity in 37°C for 24-48h before changing to serum free medium (SFM) with addition of neurotrophic factors.
- SFM serum free medium
- HiB5pUbi1zNBN22 a cell line for ChAT activity was left for 3 days with SFM and then lysed in HBSS + 0.1% Triton X-100 and immediately frozen down on dry ice until Chat activity measurement.
- Trophic Factor Addition Conditioned medium was collected from nontransfected HiB5 control or HiB5 producing neublastin (HiB5pUbi1zNBN22) or GDNF (HiB5pUbi1zGDNF-L17).
- HiB5pUbi1zNBN22 produces approximately 20 ng
- the respective cell lines were incubated overnight with DMEM + 1 % FCS and the supernatant was taken off and stored at -20°C until use.
- the supernatants were diluted in 1 :50 in SFM when added to the cells. Separate wells were treated with HiB5 control supernatant (1 :50) + purified recombinant rat GDNF (from 0.03 - 10 ng/ml).
- FIGS. 4A-4C are illustrations of the effect of neublastin, secreted from HiB5pUbi1zNBN22 cells, on the survival of cultured rat embryonic, dopaminergic, ventral mesencephalic neurons and ChAT activity in cholinergic cranial nerve motor neurons in serum-free medium as described infra in Example 5.1.
- FIG. 4A is an illustration of the dose-response curve for recombinant GDNF on ChAT activity (dpm/hour) measured at DIV5 in serum-free cultures which were initially established from E14 ventral mesencephali [i.e., HiB5; GDNF 0.03 ng/ml; GDNF 0.1 ng/ml; GDNF 0.3 ng/ml; GDNF 1 ng/ml; GDNF 10 ng/ml; GDNF 100 ng/ml].
- FIG. 4B is an illustration of ChAT activity (dpm/hour) measured at DIV5 in serum-free cultures which were initially established from E14 ventral mesencephali.
- FIG. 4C is an illustration of the number of tyrosine hydroxylase immunoreactive cells per well [No. TH+ cells/well] at DIV7 in serum-free cultures which were initially established from E14 rat ventral mesencephali.
- HiB5 1 :10 non-transfected HiB5 cells
- HiB5 1 :40 GDNF 0.1 ng/ml
- GDNF 10 ng/ml GDNF 100 ng/ml
- neublastin 1 :40 recombinant GDNF
- Example 7 Effect of Neublastin on the survival of slice cultures of pig embryonic dopaminergic ventral mesencephalic neurons
- VM Ventral mesencephali
- E28 porcine embryos
- GIBCO Gey's balanced salt solution
- the tissue slices were cultured by the interface culture method, originally developed by Stoppini er a/. [L. Stoppini, P.A. Buchs, D. Muller, J. Neurosci. Methods 1991 37 173-182].
- the co-cultures were first grown in an incubator at 33°C for 48 hours allowing the HiB5 cells immortalised with a temperature sensitive oncogene to proliferate, and then placed in an incubator at 37°C, where the HiB5 cells differentiate.
- the medium was changed twice a week. Antimitotics and antibiotics were not used at any stage.
- the sections were then washed in TBS with 1% Triton X-100 (3x15 min.) and incubated for 60 min. with streptavidin-peroxidase (Dako) diluted 1:200 in TBS with 10% FBS. After washing in TBS (3x15 min.), bound antibody was visualised by treatment with 0.05% 3,3-diaminobenzidine (Sigma) in TBS containing 0.01% H 2 O 2 . Finally, the sections were dehydrated in alcohol, cleared in xylene, and cover-slipped in Eukitt.
- FIGS. 5A-5C are illustrations of the effect of neublastin secreted from HiB5pUbi1zNBN22 cells on the function and survival of slice cultures of pig embryonic dopaminergic ventral mesencephalic neurons co-cultured with either HiB5pUbi1zNBN22 cells (neublastin) or HiB5 cells (control) as described infra.
- FIG. 5A and Fig. 5B illustrate dopamine released to the medium at DIV12 [Dopamine (pmol/ml) - day 12] and DIV21 [Dopamine (pmol/ml) - day 21], respectively.
- FIG. 5C is an illustration of the number of tyrosine hydroxylase immunoreactive cells per culture [TH-ir cells per culture] at DIV21.
- This example shows the neurotrophic activity of a neublastin polypeptide in comparison with known neurotrophic factors.
- Pregnant female mice were killed by cervical dislocation.
- the embryos were processed for culture as follows. Electrolytically sharpened tungsten needles were used to dissect dorsal root ganglia from indicated stages of C57/BI6 mice (Mollegaard Breeding, Denmark). Embryonic ganglia were incubated for 5 minutes at 37°C with 0.05% trypsin (Gibco/BRL) in calcium and magnesium-free Hanks balanced salt solution. Postnatal ganglia were treated with coliagenase/dispase 1 mg/ml for 30 to 45 minutes and then trypsin/DNAse 0,25% for 15 minutes.
- the ganglia were washed once with 10 ml of DMEM containing 10% heat inactivated horse serum, and were gently triturated with a fire-polished Pasteur pipette to give a single cell suspension.
- the cells were plated on 24 well plates (Nunc), that were precoated with polyornithine (0.5 mg/ml, overnight) and laminin (20 mg/ml for 4 h; Gibco/BRL).
- the neurons were incubated at 37°C in a humidified 5% CO 2 incubator in a defined medium consisting of Hams F14 supplemented with 2 mM glutamine, 0.35% bovine serum albumin, 60 ng/ml progesterone, 16 mg/ml putrescine, 400 ng/ml L-thyroxine, 38 ng/ml sodium selenite, 340 ng/ml triiodo-thyronine, 60 mg/ml penicillin and 100 mg/ml streptomycin.
- E12 represents data from experiments carried out on DRG cells isolated from embryonic day 12;
- E16 represents data from experiments carried out on DRG cells isolated from embryonic day 16;
- P0 represents data from experiments carried out on DRG cells isolated from the day of birth
- P7 represents data from experiments carried out on DRG cells isolated from day 7 after birth
- P15 represents data from experiments carried out on DRG cells isolated from day 15 after birth.
- Example 9 In vivo effects of neublastin on nigral dopamine neurons
- neublastin neuroblastin
- DA nigral dopamine
- Lentivirus production To generate a lentiviral transfer vector encoding neublastin, pHR'-neublastin, a 1331 bp BamHl fragment from neublastin cDNA was subcloned in the BamH1/Bgl II site of pSL301 (Invitrogen). From this construct a 1519 bp BamH1/Xho1 fragment was cut out and ligated in the BamH1/Xho1 site of pHR'
- RNA slot blot technique ⁇ von Schwedler U, Song J, Aiken C, Trono D: "Vif is crucial for human immunodeficiency virus type 1
- Tissue Processing At 21 days after the 6-OHDA injection the animals were deeply anaesthetised with chloral hydrate and transcardially perfused with saiine (pH 7.4; room temperature) for one min followed by 200 ml ice cold formaldehyde solution (4% paraformaldehyde in 0.1M phosphate buffer, pH 7.4). The brains were dissected and postfixed in the same fixative for 3-4 hours and then transferred into 25% sucrose/0.1M phosphate buffer for 48 hours. Five series of 40 ⁇ m sections through the striatum and substantia nigra (SN) were cut on a freezing microtome.
- MTN medial terminal nucleus of the accessory optic tract
- FIG. 6 is an illustration of the in vivo effect of lentiviral-produced neublastin on nigral dopamine neurons.
- 6-OHDA 6-hydroxydopamine
- the animals received injections with lentiviral vectors expressing neublastin [neublastin], GDNF [GDNF] or the Green Fluorescent Protein [GFP] as indicated in the figure.
- the figure shows the percentage [%FG lesion/intact] of FG-labelled neurons in the lesioned (right) side verses the intact (left) side of the striata of the three groups of animals.
- Example 10 Production of Antibodies
- peptide 1 CRPTRYEAVSFMDVNST (amino acids 108-124 of SEQ ID NO: 9); or peptide 2: ALRPPPGSRPVSQPC (amino acids 93-107 of SEQ ID NO: 9) conjugated to carrier protein at 3 week intervals.
- Two rabbits for each peptide were immunised at week 0, 3, 6 and 10, and bleeds were collected at week 7 and 11. The second bleed was affinity purified via a peptide affinity column.
- the antibodies were named Ab-1 and Ab-2, according to the peptide.
- Residual protein-binding sites were blocked with 5% non-fat dry milk in PBS with 0.1 % Tween-20. Membranes were incubated overnight with neublastin antibody (1 :1000), followed by incubation with a secondary anti-rabbit or anti-mouse IgG antibody conjugated to horseradish peroxidase (1 :2000).
- Peptide R27 GPGSRARAAGARGC (amino acids 30-43 of SEQ ID NO: 9)
- Peptide R28 LGHRSDELVRFRFC (amino acids 57-70 of SEQ ID NO: 9)
- Peptide R29 CRRARSPHDLSL (amino acids 74-85 of SEQ ID NO: 9)
- Peptide R30 LRPPPGSRPVSQPC (amino acids 94-107 of SEQ ID NO: 9);
- Peptide R31 STWRTVDRLSATAC (amino acids 123-136 of SEQ ID NO: 9).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Genetics & Genomics (AREA)
- Diabetes (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Ophthalmology & Optometry (AREA)
- Toxicology (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Endocrinology (AREA)
- Psychology (AREA)
- Obesity (AREA)
- Biotechnology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- Gastroenterology & Hepatology (AREA)
- Hospice & Palliative Care (AREA)
Priority Applications (17)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EA200100110A EA003734B1 (ru) | 1998-07-06 | 1999-07-05 | Нейротрофические факторы |
| NZ508994A NZ508994A (en) | 1998-07-06 | 1999-07-05 | Neurotrophic factors |
| AT99931023T ATE522609T1 (de) | 1998-07-06 | 1999-07-05 | Neurotrophe faktoren |
| AU47693/99A AU755114B2 (en) | 1998-07-06 | 1999-07-05 | Neurotrophic factors |
| HU0103758A HU227870B1 (en) | 1998-07-06 | 1999-07-05 | Neurotrophic factors |
| EEP200100008A EE05590B1 (et) | 1998-07-06 | 1999-07-05 | Neurotroopsed tegurid |
| IL14025999A IL140259A0 (en) | 1998-07-06 | 1999-07-05 | Neurotrophic factors |
| DK99931023.8T DK1095140T3 (da) | 1998-07-06 | 1999-07-05 | Neurotrofe faktorer |
| BR9911908-0A BR9911908A (pt) | 1998-07-06 | 1999-07-05 | ácido nucléico, sequência de ácido nucléico, processos de usar um ácido nucléico, de usar o vetor, de fabricar o polipeptìdeo, de administrar o polipeptìdeo, de tratar uma doença ou distúrbio neurodegenerativos em um animal, de determinar se uma doença ou distúrbio neurodegenerativos em um animal, de produzir qualquer um polipeptìdeo, processo para identificar, isolar ou amplificar uma sequência de ácido nucléico de neublastina, de diagnosticar ou avaliar quanto a presença de uma doença ou distúrbio ou uma predisposiçãopara desnvolvê-los, para avaliar um polipeptìdeo de neublastina purificado ou um derivado ou fragmento deste ou um modulador da atividade dos precedentes quanto a atividade em tratar ou prevenir uma doença, de tratar um distúbio neurológico, de usar a sequência de um ou mais ácidos nucléicos, e para identificar um composto candidato que induza um efeito biológico mediado pela neuroblastina, vetor, célula transformada com ácido nucléico, polipeptìdeo, cmposição, anticorpo, gene sintético, e, conjunto. |
| JP2000558205A JP2002519061A (ja) | 1998-07-06 | 1999-07-05 | 神経栄養因子 |
| EP99931023A EP1095140B1 (en) | 1998-07-06 | 1999-07-05 | Neurotrophic factors |
| CA2336218A CA2336218C (en) | 1998-07-06 | 1999-07-05 | Neurotrophic factors |
| ES99931023T ES2373173T3 (es) | 1998-07-06 | 1999-07-05 | Factores neurotróficos. |
| SI9931062T SI1095140T1 (sl) | 1998-07-06 | 1999-07-05 | Nevrotrofični dejavniki |
| HK02100492.1A HK1038943A1 (zh) | 1998-07-06 | 1999-07-05 | 神经营养因子 |
| IL140259A IL140259A (en) | 1998-07-06 | 2000-12-12 | Neublastin neurotrophic factors and use thereof for preparation of medicaments |
| NO20010088A NO330689B1 (no) | 1998-07-06 | 2001-01-05 | Isolert neublastin polynukleotid, ekspresjonsvektor, isolert vertscelle, polypeptid, fremgangsmate for fremstilling av et polypeptid, preparat samt polypeptid for anvendelse som et medikament. |
Applications Claiming Priority (14)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DK199800904 | 1998-07-06 | ||
| DKPA199800904 | 1998-07-06 | ||
| US9222998P | 1998-07-09 | 1998-07-09 | |
| US60/092,229 | 1998-07-09 | ||
| DK199801048 | 1998-08-19 | ||
| DKPA199801048 | 1998-08-19 | ||
| US9777498P | 1998-08-25 | 1998-08-25 | |
| US60/097,774 | 1998-08-25 | ||
| DKPA199801265 | 1998-10-06 | ||
| DK199801265 | 1998-10-06 | ||
| US10390898P | 1998-10-13 | 1998-10-13 | |
| US60/103,908 | 1998-10-13 | ||
| US09/347,613 | 1999-07-02 | ||
| US09/347,613 US6593133B1 (en) | 1998-07-06 | 1999-07-02 | Neurotrophic factors |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2000001815A2 true WO2000001815A2 (en) | 2000-01-13 |
| WO2000001815A3 WO2000001815A3 (en) | 2000-02-17 |
Family
ID=27561795
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/DK1999/000384 Ceased WO2000001815A2 (en) | 1998-07-06 | 1999-07-05 | Neurotrophic factors |
Country Status (18)
| Country | Link |
|---|---|
| US (6) | US6593133B1 (enExample) |
| EP (2) | EP1095140B1 (enExample) |
| JP (5) | JP2002519061A (enExample) |
| KR (1) | KR100743376B1 (enExample) |
| AT (1) | ATE522609T1 (enExample) |
| AU (1) | AU755114B2 (enExample) |
| CA (1) | CA2336218C (enExample) |
| CY (1) | CY1112101T1 (enExample) |
| DK (1) | DK1095140T3 (enExample) |
| EE (1) | EE05590B1 (enExample) |
| ES (1) | ES2373173T3 (enExample) |
| HU (1) | HU227870B1 (enExample) |
| IS (1) | IS2835B (enExample) |
| NZ (1) | NZ508994A (enExample) |
| PT (1) | PT1095140E (enExample) |
| SI (1) | SI1095140T1 (enExample) |
| TR (1) | TR200100056T2 (enExample) |
| WO (1) | WO2000001815A2 (enExample) |
Cited By (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000034475A3 (en) * | 1998-12-09 | 2000-11-09 | Amgen Inc | Grnf4, a gdnf-related neurotrophic factor |
| WO2000004050A3 (en) * | 1998-07-14 | 2000-11-09 | Janssen Pharmaceutica Nv | Neurotrophic growth factor |
| EP1028975A4 (en) * | 1998-09-29 | 2001-01-10 | Univ Washington | ARTEMINE, A NEW NEUROTROPHIC FACTOR |
| WO2000054813A3 (en) * | 1999-03-15 | 2001-05-03 | Chiron Corp | Use of recombinant gene delivery vectors for treating or preventing diseases of the eye |
| WO2002078730A2 (en) | 2001-03-28 | 2002-10-10 | Biogen, Inc. | Use of neublastin polypeptides for treating neuropathic pain |
| WO2002060929A3 (en) * | 2001-02-01 | 2003-03-06 | Biogen Inc | Polymer conjugates of neublastin and methods of using same |
| WO2002072826A3 (en) * | 2001-03-12 | 2003-04-10 | Biogen Inc | Neurotrophic factors |
| WO2002051433A3 (en) * | 2000-12-22 | 2004-03-25 | Genentech Inc | Use of artemin, a member of the gdnf ligand family for preparing a neuroprotective medicament |
| WO2004069176A2 (en) | 2001-02-01 | 2004-08-19 | Biogen Idec Ma Inc. | Polymer conjugates of mutated neublastin |
| US6943153B1 (en) | 1999-03-15 | 2005-09-13 | The Regents Of The University Of California | Use of recombinant gene delivery vectors for treating or preventing diseases of the eye |
| EA008743B1 (ru) * | 2003-01-31 | 2007-08-31 | Байоджен Айдек Ма Инк. | Полимерные конъюгаты мутантного неубластина |
| WO2007019860A3 (en) * | 2005-08-16 | 2007-09-20 | Copenhagen University | Gdnf derived peptides |
| US7276580B2 (en) | 2001-03-12 | 2007-10-02 | Biogen Idec Ma Inc. | Neurotrophic factors |
| EP1897552A1 (en) | 2003-04-18 | 2008-03-12 | Biogen Idec MA Inc. | Polymer-conjugated glycosylated neublastin |
| EP1867719A3 (en) * | 1999-06-02 | 2008-03-19 | Genentech, Inc. | Methods and compositions for inhibiting neoplastic cell growth |
| EP1786454A4 (en) * | 2004-08-19 | 2008-06-18 | Biogen Idec Inc | VARIANTS OF NEUBLASTINE |
| WO2009002193A1 (en) * | 2007-06-27 | 2008-12-31 | Auckland Uniservices Limited | Polypeptides and polynucleotides for artemin and related ligands, and methods of use thereof |
| EP2058329A1 (en) | 2003-06-10 | 2009-05-13 | NsGene A/S | Improved secretion of neublastin |
| US7598059B2 (en) | 2003-10-02 | 2009-10-06 | Biogen Idec Ma Inc. | Neublastin expression constructs |
| US8222378B2 (en) | 1998-07-14 | 2012-07-17 | Janssen Pharmaceutica N.V. | Neurotrophic growth factor, enovin |
| EP2609930A2 (en) | 2006-02-27 | 2013-07-03 | Biogen Idec MA Inc. | Treatments for neurological disorders |
| WO2014152511A1 (en) | 2013-03-15 | 2014-09-25 | The Jackson Laboratory | Methods for promoting wound healing and hair growth |
| WO2016115442A3 (en) * | 2015-01-18 | 2016-11-24 | Biogen Ma Inc. | Therapeutic protein formulations |
| US9943573B2 (en) | 2012-05-15 | 2018-04-17 | Avalanche Australia Pty Ltd. | Treatment of ocular neovascularization using anti-VEGF proteins |
| US10000741B2 (en) | 2014-03-17 | 2018-06-19 | Adverum Biotechnologies, Inc. | Compositions and methods for enhanced gene expression in cone cells |
| US10584328B2 (en) | 2015-12-23 | 2020-03-10 | Adverum Biotechnologies, Inc. | Mutant viral capsid libraries and related systems and methods |
| US10634677B2 (en) | 2013-10-14 | 2020-04-28 | Indiana University Research And Technology Corporation | Use of acamprosate to modulate ERK1/2 activation in animal models for FXS and ASD and individuals diagnosed with FXS and ASD |
| US11021519B2 (en) | 2015-03-02 | 2021-06-01 | Adverum Biotechnologies, Inc. | Compositions and methods for intravitreal delivery of polynucleotides to retinal cones |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6593133B1 (en) * | 1998-07-06 | 2003-07-15 | Nsgene A/S | Neurotrophic factors |
| US20040077543A1 (en) * | 2001-03-28 | 2004-04-22 | Sah Dinah W. Y. | Treatment using neublastin polypeptides |
| AU2003249013A1 (en) * | 2002-07-09 | 2004-01-23 | Bristol-Myers Squibb Company | Polynucleotides encoding a novel testis-specific tubulin tyrosine-ligase-like protein, bgs42 |
| JP4571776B2 (ja) * | 2002-11-05 | 2010-10-27 | Jx日鉱日石エネルギー株式会社 | 潤滑油組成物 |
| US20060239966A1 (en) * | 2003-10-20 | 2006-10-26 | Tornoee Jens | In vivo gene therapy of parkinson's disease |
| ATE472333T1 (de) * | 2004-08-19 | 2010-07-15 | Biogen Idec Inc | Rückfaltung von proteinen der transforming-growth-factor-beta-familie |
| WO2007042040A2 (en) * | 2005-10-11 | 2007-04-19 | Ns Gene A/S | TREATMENT OF RETINOPATHIES USING GFRα3 AGONISTS |
| WO2007103182A2 (en) * | 2006-03-01 | 2007-09-13 | Biogen Idec Ma Inc. | Compostions and methods for administering gdnf ligand family proteins |
| AU2008247637B2 (en) | 2007-05-01 | 2013-12-05 | Biogen Ma Inc. | Compositions and methods for increasing vascularization |
| WO2009020964A2 (en) * | 2007-08-08 | 2009-02-12 | Biogen Idec Ma Inc. | Anti-neublastin antibodies and uses thereof |
Family Cites Families (54)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4352883A (en) | 1979-03-28 | 1982-10-05 | Damon Corporation | Encapsulation of biological material |
| US4353888A (en) | 1980-12-23 | 1982-10-12 | Sefton Michael V | Encapsulation of live animal cells |
| US4407957A (en) | 1981-03-13 | 1983-10-04 | Damon Corporation | Reversible microencapsulation of a core material |
| US5525464A (en) | 1987-04-01 | 1996-06-11 | Hyseq, Inc. | Method of sequencing by hybridization of oligonucleotide probes |
| US4883666A (en) | 1987-04-29 | 1989-11-28 | Massachusetts Institute Of Technology | Controlled drug delivery system for treatment of neural disorders |
| US5283187A (en) | 1987-11-17 | 1994-02-01 | Brown University Research Foundation | Cell culture-containing tubular capsule produced by co-extrusion |
| US5158881A (en) | 1987-11-17 | 1992-10-27 | Brown University Research Foundation | Method and system for encapsulating cells in a tubular extrudate in separate cell compartments |
| DE3829766A1 (de) | 1988-09-01 | 1990-03-22 | Akzo Gmbh | Verfahren zur herstellung von membranen |
| DE3829752A1 (de) | 1988-09-01 | 1990-03-22 | Akzo Gmbh | Integrale asymmetrische polyaethersulfonmembran, verfahren zur herstellung und verwendung zur ultrafiltration und mikrofiltration |
| US5082670A (en) | 1988-12-15 | 1992-01-21 | The Regents Of The University Of California | Method of grafting genetically modified cells to treat defects, disease or damage or the central nervous system |
| US5800992A (en) | 1989-06-07 | 1998-09-01 | Fodor; Stephen P.A. | Method of detecting nucleic acids |
| US5143854A (en) | 1989-06-07 | 1992-09-01 | Affymax Technologies N.V. | Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof |
| US5084350A (en) | 1990-02-16 | 1992-01-28 | The Royal Institution For The Advance Of Learning (Mcgill University) | Method for encapsulating biologically active material including cells |
| US5618531A (en) | 1990-10-19 | 1997-04-08 | New York University | Method for increasing the viability of cells which are administered to the brain or spinal cord |
| DK0585368T3 (da) | 1991-04-25 | 1998-03-16 | Univ Brown Res Found | Implanterbart biokompatibelt immunisolatorisk vehikel til afgivelse af udvalgte terapeutiske produkter |
| DK0606217T4 (da) | 1991-06-27 | 2009-03-30 | Bristol Myers Squibb Co | CTL4-receptor, fusionsproteiner indeholdende den samt anvendelse deraf |
| CA2112674C (en) | 1991-07-02 | 2005-10-04 | John S. Patton | Method and device for delivering aerosolized medicaments |
| US5750376A (en) | 1991-07-08 | 1998-05-12 | Neurospheres Holdings Ltd. | In vitro growth and proliferation of genetically modified multipotent neural stem cells and their progeny |
| MX9205293A (es) | 1991-09-20 | 1993-05-01 | Syntex Sinergen Neuroscience J | Factores neurotrofico derivado del glial |
| US5968502A (en) | 1991-11-05 | 1999-10-19 | Transkaryotic Therapies, Inc. | Protein production and protein delivery |
| US5284350A (en) * | 1992-05-22 | 1994-02-08 | Medical Composite Technology | Foldable wheelchair and side frame assembly |
| US5785049A (en) | 1994-09-21 | 1998-07-28 | Inhale Therapeutic Systems | Method and apparatus for dispersion of dry powder medicaments |
| KR100291620B1 (ko) | 1992-09-29 | 2001-10-24 | 추후제출 | 부갑상선호르몬의활성단편의폐를통한전달방법 |
| CA2092271C (en) | 1993-03-09 | 2009-10-13 | Eddie Reed | Use of g-csf for treating taxol side-effects |
| CA2169292C (en) | 1993-08-12 | 2010-11-23 | E. Edward Baetge | Improved compositions and methods for the delivery of biologically active molecules using genetically altered cells contained in biocompatible immunoisolatory capsules |
| DE4339605A1 (de) | 1993-11-20 | 1995-05-24 | Beiersdorf Ag | Desodorierende Wirkstoffkombinationen auf der Basis von alpha, omega-Alkandicarbonsäuren und Fettsäurepartialglyceriden |
| US5834029A (en) | 1994-07-20 | 1998-11-10 | Cytotherapeutics, Inc. | Nerve guidance channel containing bioartificial three-dimensional hydrogel extracellular matrix derivatized with cell adhesive peptide fragment |
| US5795716A (en) | 1994-10-21 | 1998-08-18 | Chee; Mark S. | Computer-aided visualization and analysis system for sequence evaluation |
| US5780014A (en) | 1995-04-14 | 1998-07-14 | Inhale Therapeutic Systems | Method and apparatus for pulmonary administration of dry powder alpha 1-antitrypsin |
| US5654007A (en) | 1995-06-07 | 1997-08-05 | Inhale Therapeutic Systems | Methods and system for processing dispersible fine powders |
| US5739307A (en) | 1995-08-28 | 1998-04-14 | Washington University | Polynucleotide encoding neurturin neurotrophic factor |
| US5733729A (en) | 1995-09-14 | 1998-03-31 | Affymetrix, Inc. | Computer-aided probability base calling for arrays of nucleic acid probes on chips |
| US5641749A (en) * | 1995-11-29 | 1997-06-24 | Amgen Inc. | Method for treating retinal ganglion cell injury using glial cell line-derived neurothrophic factor (GDNF) protein product |
| US6299895B1 (en) * | 1997-03-24 | 2001-10-09 | Neurotech S.A. | Device and method for treating ophthalmic diseases |
| US6878544B2 (en) * | 1996-04-19 | 2005-04-12 | Neurotech Sa | Retinal cell lines with extended life-span and their applications |
| DE69736428T2 (de) | 1996-05-08 | 2007-08-30 | Biogen Idec Ma Inc., Cambridge | RET-LIGAND 3 (RetL3), UM NEURALES UND RENALES WACHSTUM ZU STIMULIEREN |
| US5754524A (en) | 1996-08-30 | 1998-05-19 | Wark; Barry J. | Computerized method and system for analysis of an electrophoresis gel test |
| KR100195886B1 (ko) | 1996-11-01 | 1999-06-15 | 김상조 | 당뇨병 치료용 의약조성물 |
| WO1998032869A1 (en) | 1997-01-29 | 1998-07-30 | Neurosearch A/S | Expression vectors and methods for in vivo expression of therapeutic polypeptides |
| US20020192209A1 (en) * | 1997-09-17 | 2002-12-19 | Genentech, Inc. | Methods and compositions for inhibiting neoplastic cell growth |
| US6593133B1 (en) * | 1998-07-06 | 2003-07-15 | Nsgene A/S | Neurotrophic factors |
| US20020055467A1 (en) * | 1998-07-06 | 2002-05-09 | Johansen Teit E. | Novel neurotrophic factors |
| HK1045528B (zh) | 1998-07-14 | 2006-10-27 | 詹森药业有限公司 | 神经营养生长因子 |
| AU778998B2 (en) * | 1998-09-22 | 2004-12-23 | University Of Maryland At Baltimore | Cystine knot growth factor mutants |
| US6284540B1 (en) | 1998-09-29 | 2001-09-04 | Washington University | Artemin, a novel neurotrophic factor |
| EP1137774A2 (en) * | 1998-12-09 | 2001-10-04 | Amgen Inc. | Grnf4, a gdnf-related neurotrophic factor |
| DK1607402T3 (da) * | 1999-03-08 | 2007-04-16 | Genentech Inc | Sammensætninger og fremgangsmåder til tumorbehandling |
| US6361771B1 (en) * | 1999-04-06 | 2002-03-26 | Neurotech S.A. | ARPE-19 as a platform cell line for encapsulated cell-based delivery |
| CA2373915A1 (en) * | 1999-06-02 | 2000-12-07 | Genentech, Inc. | Methods and compositions for inhibiting neoplastic cell growth |
| JP2001329126A (ja) | 2000-05-22 | 2001-11-27 | Bridgestone Corp | 硬化性組成物 |
| EP1325966B1 (en) * | 2000-09-12 | 2009-04-01 | JFE Steel Corporation | Super-high strength cold-rolled steel sheet and method for production thereof |
| US7276580B2 (en) * | 2001-03-12 | 2007-10-02 | Biogen Idec Ma Inc. | Neurotrophic factors |
| US20040077543A1 (en) * | 2001-03-28 | 2004-04-22 | Sah Dinah W. Y. | Treatment using neublastin polypeptides |
| US7598059B2 (en) * | 2003-10-02 | 2009-10-06 | Biogen Idec Ma Inc. | Neublastin expression constructs |
-
1999
- 1999-07-02 US US09/347,613 patent/US6593133B1/en not_active Expired - Lifetime
- 1999-07-05 KR KR1020017000184A patent/KR100743376B1/ko not_active Expired - Fee Related
- 1999-07-05 EP EP99931023A patent/EP1095140B1/en not_active Expired - Lifetime
- 1999-07-05 HU HU0103758A patent/HU227870B1/hu not_active IP Right Cessation
- 1999-07-05 ES ES99931023T patent/ES2373173T3/es not_active Expired - Lifetime
- 1999-07-05 EE EEP200100008A patent/EE05590B1/xx not_active IP Right Cessation
- 1999-07-05 JP JP2000558205A patent/JP2002519061A/ja active Pending
- 1999-07-05 NZ NZ508994A patent/NZ508994A/en not_active IP Right Cessation
- 1999-07-05 TR TR2001/00056T patent/TR200100056T2/xx unknown
- 1999-07-05 PT PT99931023T patent/PT1095140E/pt unknown
- 1999-07-05 DK DK99931023.8T patent/DK1095140T3/da active
- 1999-07-05 CA CA2336218A patent/CA2336218C/en not_active Expired - Fee Related
- 1999-07-05 SI SI9931062T patent/SI1095140T1/sl unknown
- 1999-07-05 EP EP10181304A patent/EP2290079A3/en not_active Withdrawn
- 1999-07-05 AT AT99931023T patent/ATE522609T1/de active
- 1999-07-05 AU AU47693/99A patent/AU755114B2/en not_active Ceased
- 1999-07-05 WO PCT/DK1999/000384 patent/WO2000001815A2/en not_active Ceased
-
2000
- 2000-09-15 US US09/662,183 patent/US6734284B1/en not_active Expired - Lifetime
- 2000-12-14 IS IS5769A patent/IS2835B/is unknown
-
2004
- 2004-03-22 US US10/806,793 patent/US20040230043A1/en not_active Abandoned
-
2005
- 2005-06-01 JP JP2005161155A patent/JP2005341968A/ja not_active Withdrawn
- 2005-11-10 JP JP2005326745A patent/JP2006122053A/ja not_active Withdrawn
-
2007
- 2007-04-27 JP JP2007120282A patent/JP2007252381A/ja not_active Withdrawn
- 2007-10-31 US US11/932,744 patent/US20080227703A1/en not_active Abandoned
- 2007-11-28 JP JP2007307603A patent/JP2008133282A/ja active Pending
-
2009
- 2009-10-27 US US12/606,602 patent/US20100234293A1/en not_active Abandoned
-
2011
- 2011-04-11 US US13/084,267 patent/US20120252726A1/en not_active Abandoned
- 2011-11-29 CY CY20111101173T patent/CY1112101T1/el unknown
Non-Patent Citations (4)
| Title |
|---|
| "GenBank", Database accession no. AC005038 |
| BAMES ET AL.: "Methods in Molecular Bioloay", vol. 10, 1992, HUMANA PRESS, article "Purification of Immunoglobulin G (lgG)", pages: 79 - 104 |
| COLIGAN ET AL., CURRENT PROTOCOLS IN IMMUNOLOAV., 1992 |
| UNSICKER ET AL., CELL & TISSUE RESEARCH, vol. 286, no. 2, 1996, pages 175 - 178 |
Cited By (71)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8492336B2 (en) | 1998-07-14 | 2013-07-23 | Janssen Pharmaceutica N.V. | Methods of treating neuropathic pain with an environ polypeptide |
| WO2000004050A3 (en) * | 1998-07-14 | 2000-11-09 | Janssen Pharmaceutica Nv | Neurotrophic growth factor |
| EP1640381A3 (en) * | 1998-07-14 | 2007-01-31 | Janssen Pharmaceutica N.V. | Neurotrophic growth factor |
| HRP20010036B1 (hr) * | 1998-07-14 | 2010-06-30 | Janssen Pharmaceutica N.V. | Neurotrofni faktor rasta |
| US8222378B2 (en) | 1998-07-14 | 2012-07-17 | Janssen Pharmaceutica N.V. | Neurotrophic growth factor, enovin |
| KR100712223B1 (ko) * | 1998-07-14 | 2007-04-27 | 얀센 파마슈티카 엔.브이. | 신경친화성 성장 인자 |
| CZ303868B6 (cs) * | 1998-07-14 | 2013-06-05 | Janssen Pharmaceutica N. V. | Lidský neurotrofický rustový faktor a jeho aplikace |
| EP1028975A4 (en) * | 1998-09-29 | 2001-01-10 | Univ Washington | ARTEMINE, A NEW NEUROTROPHIC FACTOR |
| US6284540B1 (en) | 1998-09-29 | 2001-09-04 | Washington University | Artemin, a novel neurotrophic factor |
| WO2000034475A3 (en) * | 1998-12-09 | 2000-11-09 | Amgen Inc | Grnf4, a gdnf-related neurotrophic factor |
| WO2000054813A3 (en) * | 1999-03-15 | 2001-05-03 | Chiron Corp | Use of recombinant gene delivery vectors for treating or preventing diseases of the eye |
| US6943153B1 (en) | 1999-03-15 | 2005-09-13 | The Regents Of The University Of California | Use of recombinant gene delivery vectors for treating or preventing diseases of the eye |
| EP1867719A3 (en) * | 1999-06-02 | 2008-03-19 | Genentech, Inc. | Methods and compositions for inhibiting neoplastic cell growth |
| WO2002051433A3 (en) * | 2000-12-22 | 2004-03-25 | Genentech Inc | Use of artemin, a member of the gdnf ligand family for preparing a neuroprotective medicament |
| AU2002232785B2 (en) * | 2000-12-22 | 2006-05-18 | Genentech, Inc. | Use of artemin, a member of the GDNF ligand family for preparing a neuroprotective medicament |
| AU2002247037B2 (en) * | 2001-02-01 | 2007-08-16 | Biogen Ma Inc. | Polymer conjugates of neublastin and methods of using same |
| EA009771B1 (ru) * | 2001-02-01 | 2008-04-28 | Байоджен Айдек Ма, Инк. | Полипептид нейбластина, способы его получения и применения |
| NO332150B1 (no) * | 2001-02-01 | 2012-07-09 | Biogen Idec Inc | Polymerkonjugater av neublastin, samt anvendelse derav |
| CN1500095B (zh) * | 2001-02-01 | 2010-06-16 | 比奥根艾迪克Ma公司 | 神经胚活素的多聚体偶联物及其应用方法 |
| WO2002060929A3 (en) * | 2001-02-01 | 2003-03-06 | Biogen Inc | Polymer conjugates of neublastin and methods of using same |
| WO2004069176A2 (en) | 2001-02-01 | 2004-08-19 | Biogen Idec Ma Inc. | Polymer conjugates of mutated neublastin |
| SG149685A1 (en) * | 2001-02-01 | 2009-02-27 | Biogen Idec Inc | Polymer conjugates of neublastin and methods of using same |
| EP1862475A1 (en) * | 2001-02-01 | 2007-12-05 | Biogen Idec MA Inc. | Polymer conjugates of neublastin and methods of using same |
| KR100872807B1 (ko) * | 2001-02-01 | 2008-12-09 | 바이오겐 아이덱 엠에이 인코포레이티드 | 누블라스틴의 중합체 컨쥬게이트 및 이의 사용 방법 |
| US7442370B2 (en) | 2001-02-01 | 2008-10-28 | Biogen Idec Ma Inc. | Polymer conjugates of mutated neublastin |
| US7276580B2 (en) | 2001-03-12 | 2007-10-02 | Biogen Idec Ma Inc. | Neurotrophic factors |
| US7358228B2 (en) | 2001-03-12 | 2008-04-15 | Biogen Idec Ma Inc. | Methods of treating pain using neurotrophic factors |
| EP1930439A1 (en) * | 2001-03-12 | 2008-06-11 | Biogen Idec MA, Inc. | Neurotrophic factors |
| WO2002072826A3 (en) * | 2001-03-12 | 2003-04-10 | Biogen Inc | Neurotrophic factors |
| AU2002240943B2 (en) * | 2001-03-12 | 2007-05-10 | Biogen Ma Inc. | Neurotrophic factors |
| US7655463B2 (en) | 2001-03-12 | 2010-02-02 | Biogen Idec Ma Inc. | Methods of activating RET receptor tyrosine kinase using neurotrophic factors |
| CN1525866B (zh) * | 2001-03-28 | 2013-05-29 | 比奥根艾迪克Ma公司 | 神经胚活素多肽的治疗作用 |
| WO2002078730A3 (en) * | 2001-03-28 | 2003-11-27 | Biogen Inc | Use of neublastin polypeptides for treating neuropathic pain |
| JP2012167119A (ja) * | 2001-03-28 | 2012-09-06 | Biogen Idec Ma Inc | ニューロパシーの疼痛を処置するためのニューブラスチンポリペプチドの使用 |
| JP2005508842A (ja) * | 2001-03-28 | 2005-04-07 | バイオジェン・アイデック・エムエイ・インコーポレイテッド | ニューロパシーの疼痛を処置するためのニューブラスチンポリペプチドの使用 |
| CN1525866A (zh) * | 2001-03-28 | 2004-09-01 | ¸ | 神经胚活素多肽的治疗作用 |
| WO2002078730A2 (en) | 2001-03-28 | 2002-10-10 | Biogen, Inc. | Use of neublastin polypeptides for treating neuropathic pain |
| KR101293805B1 (ko) * | 2003-01-31 | 2013-08-06 | 바이오겐 아이덱 엠에이 인코포레이티드 | 돌연변이된 뉴블라스틴의 중합체 컨주게이트 |
| EA008743B1 (ru) * | 2003-01-31 | 2007-08-31 | Байоджен Айдек Ма Инк. | Полимерные конъюгаты мутантного неубластина |
| EP2301960A2 (en) | 2003-01-31 | 2011-03-30 | Biogen Idec MA Inc. | Polymer conjugates of mutated neublastin |
| EP1897552A1 (en) | 2003-04-18 | 2008-03-12 | Biogen Idec MA Inc. | Polymer-conjugated glycosylated neublastin |
| EP2322205A1 (en) | 2003-04-18 | 2011-05-18 | Biogen Idec MA Inc. | Polymer-conjugated glycosylated neublastin |
| US7601518B2 (en) | 2003-06-10 | 2009-10-13 | Nsgene A/S | Secretion of neublastin |
| EP2058329A1 (en) | 2003-06-10 | 2009-05-13 | NsGene A/S | Improved secretion of neublastin |
| US7598059B2 (en) | 2003-10-02 | 2009-10-06 | Biogen Idec Ma Inc. | Neublastin expression constructs |
| EP1786454A4 (en) * | 2004-08-19 | 2008-06-18 | Biogen Idec Inc | VARIANTS OF NEUBLASTINE |
| EP2335713A3 (en) * | 2004-08-19 | 2011-11-02 | Biogen Idec MA Inc. | Neublastin variants |
| EP2238983A3 (en) * | 2004-08-19 | 2011-03-09 | Biogen Idec MA Inc. | Neublastin variants |
| US8138148B2 (en) | 2005-08-16 | 2012-03-20 | Copenhagen University | GDNF derived peptides |
| WO2007019860A3 (en) * | 2005-08-16 | 2007-09-20 | Copenhagen University | Gdnf derived peptides |
| US10328125B2 (en) | 2006-02-27 | 2019-06-25 | Gloriana Therapeutics, Inc. | Treatments for neurological disorders |
| EP2609930A2 (en) | 2006-02-27 | 2013-07-03 | Biogen Idec MA Inc. | Treatments for neurological disorders |
| CN101932602A (zh) * | 2007-06-27 | 2010-12-29 | 奥克兰联合服务有限公司 | 用于Artemin及相关配体的多肽和多核苷酸,及其使用方法 |
| CN101932602B (zh) * | 2007-06-27 | 2017-05-24 | 新加坡国立大学 | 用于Artemin及相关配体的多肽和多核苷酸,及其使用方法 |
| WO2009002193A1 (en) * | 2007-06-27 | 2008-12-31 | Auckland Uniservices Limited | Polypeptides and polynucleotides for artemin and related ligands, and methods of use thereof |
| US9943573B2 (en) | 2012-05-15 | 2018-04-17 | Avalanche Australia Pty Ltd. | Treatment of ocular neovascularization using anti-VEGF proteins |
| US10004788B2 (en) | 2012-05-15 | 2018-06-26 | Avalanche Australia Pty Ltd. | Treatment of ocular neovascularization using anti-VEGF proteins |
| WO2014152511A1 (en) | 2013-03-15 | 2014-09-25 | The Jackson Laboratory | Methods for promoting wound healing and hair growth |
| US12357674B2 (en) | 2013-03-15 | 2025-07-15 | The Jackson Laboratory | Methods for promoting wound healing and hair growth comprising GDNF administration |
| US11890322B2 (en) | 2013-03-15 | 2024-02-06 | The Jackson Laboratory | Methods for promoting wound healing and hair growth comprising GDNF administration |
| US10376562B2 (en) | 2013-03-15 | 2019-08-13 | The Jackson Laboratory | Methods for promoting wound healing and hair growth comprising GDNF administration |
| US10634677B2 (en) | 2013-10-14 | 2020-04-28 | Indiana University Research And Technology Corporation | Use of acamprosate to modulate ERK1/2 activation in animal models for FXS and ASD and individuals diagnosed with FXS and ASD |
| US11733243B2 (en) | 2013-10-14 | 2023-08-22 | Indiana University Research And Technology Corporation | Use of acamprosate to modulate ERK1/2 activation in animal models for FXS and ASD and individuals diagnosed with FXS and ASD |
| US11248214B2 (en) | 2014-03-17 | 2022-02-15 | Adverum Biotechnologies, Inc. | Compositions and methods for enhanced gene expression in cone cells |
| US10000741B2 (en) | 2014-03-17 | 2018-06-19 | Adverum Biotechnologies, Inc. | Compositions and methods for enhanced gene expression in cone cells |
| US12275959B2 (en) | 2014-03-17 | 2025-04-15 | Adverum Biotechnologies, Inc. | Compositions and methods for enhanced gene expression in cone cells |
| EP3804747A1 (en) * | 2015-01-18 | 2021-04-14 | Gloriana Therapeutics, Inc. | Therapeutic protein formulations |
| WO2016115442A3 (en) * | 2015-01-18 | 2016-11-24 | Biogen Ma Inc. | Therapeutic protein formulations |
| US11021519B2 (en) | 2015-03-02 | 2021-06-01 | Adverum Biotechnologies, Inc. | Compositions and methods for intravitreal delivery of polynucleotides to retinal cones |
| US10584328B2 (en) | 2015-12-23 | 2020-03-10 | Adverum Biotechnologies, Inc. | Mutant viral capsid libraries and related systems and methods |
| US11427931B2 (en) | 2015-12-23 | 2022-08-30 | Adverum Biotechnologies, Inc. | Mutant viral capsid libraries and related systems and methods |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1095140B1 (en) | Neurotrophic factors | |
| US8217146B2 (en) | Neurotrophic factors and methods of use thereof | |
| EP1930439B1 (en) | Neurotrophic factors | |
| AU2002240943A1 (en) | Neurotrophic factors | |
| IL140259A (en) | Neublastin neurotrophic factors and use thereof for preparation of medicaments | |
| ZA200007404B (en) | Neurotrophic factors. | |
| HK1120556B (en) | Neurotrophic factors | |
| HK1117870A (en) | Neurotrophic factors | |
| MXPA01000104A (en) | Neurotrophic factors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 99808289.9 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2000/07404 Country of ref document: ZA Ref document number: 140259 Country of ref document: IL Ref document number: 200007404 Country of ref document: ZA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 508994 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 47693/99 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2336218 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PV2001-53 Country of ref document: CZ |
|
| ENP | Entry into the national phase |
Ref document number: 2000 558205 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020017000184 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2001/000104 Country of ref document: MX Ref document number: 2001/00056 Country of ref document: TR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1999931023 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200100110 Country of ref document: EA |
|
| WWP | Wipo information: published in national office |
Ref document number: 1999931023 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: PV2001-53 Country of ref document: CZ |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020017000184 Country of ref document: KR |
|
| NENP | Non-entry into the national phase |
Ref country code: CA |
|
| WWG | Wipo information: grant in national office |
Ref document number: 47693/99 Country of ref document: AU |