WO1995018858A1 - Thrombopoietine - Google Patents

Thrombopoietine Download PDF

Info

Publication number
WO1995018858A1
WO1995018858A1 PCT/US1994/014553 US9414553W WO9518858A1 WO 1995018858 A1 WO1995018858 A1 WO 1995018858A1 US 9414553 W US9414553 W US 9414553W WO 9518858 A1 WO9518858 A1 WO 9518858A1
Authority
WO
WIPO (PCT)
Prior art keywords
mpl ligand
polypeptide
seq
mpl
dna
Prior art date
Application number
PCT/US1994/014553
Other languages
English (en)
Inventor
Dan L. Eaton
Frederic J. De Sauvage
Original Assignee
Genentech, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/196,689 external-priority patent/US8357513B1/en
Priority claimed from US08/249,376 external-priority patent/US8192955B1/en
Priority claimed from US08/348,657 external-priority patent/US6660256B1/en
Priority to EP95906653A priority Critical patent/EP0738323A1/fr
Priority to CA2178482A priority patent/CA2178482C/fr
Priority to KR10-2004-7009015A priority patent/KR20040065249A/ko
Priority to SK875-96A priority patent/SK282265B6/sk
Priority to NZ278726A priority patent/NZ278726A/en
Priority to AU15146/95A priority patent/AU704266B2/en
Priority to UA96072627A priority patent/UA72869C2/xx
Application filed by Genentech, Inc. filed Critical Genentech, Inc.
Priority to PL94315289A priority patent/PL180765B1/pl
Priority to RO96-01347A priority patent/RO117110B1/ro
Priority to US08/374,540 priority patent/US8147844B1/en
Priority to JP7518499A priority patent/JPH09508262A/ja
Priority to BR9408487A priority patent/BR9408487A/pt
Publication of WO1995018858A1 publication Critical patent/WO1995018858A1/fr
Priority to NO19962783A priority patent/NO326903B1/no
Priority to BG100693A priority patent/BG63639B1/bg
Priority to FI962723A priority patent/FI121573B/fi
Priority to LVP-96-315A priority patent/LV11632B/xx

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/524—Thrombopoietin, i.e. C-MPL ligand
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to the isolation, purification and recombinant or chemical synthesis of proteins that influence survival, proliferation, differentiation or maturation of hematopoietic cells, especially platelet progenitor cells.
  • This invention specifically relates to the cloning and expression of nucleic acids encoding a protein iigand capable of binding to and activating mpl, a member of the cytokine receptor superfamily.
  • This invention further relates to the use of these proteins alone or in combination with other cytokines to treat immune or hematopoietic disorders including thrombocytopenia.
  • the Hematopoietic system produces the mature highly specialized blood cells known to be necessary for survival of all mammals. These mature cells include; erythrocytes, specialized to transport oxygen and carbon dioxide, T- and B- lymphocytes, responsible for cell- and antibody-mediated immune responses, platelets or thrombocytes, specialized to form blood clots, and granulocytes and macrophages, specialized as scavengers and as accessory cells to combat infection.
  • Granulocytes are further subdivided into; neutrophils, eosinophils, basophils and mast cells, specialized cell types having discrete functions.
  • neutrophils eosinophils
  • basophils eosinophils
  • mast cells specialized cell types having discrete functions.
  • all of these specialized mature blood cells are derived from a single common primitive cell type, referred to as the pluripotent (or totipotent) stem cell, found primarily in bone marrow (Dexter et al., Ann. Rev. Cell Biol., 3:423-441 [1987]).
  • the mature highly specialized blood cells must be produced in large numbers continuously throughout the life of a mammal.
  • the vast majority of these specialized blood cells are destined to remain functionally active for only a few hours to weeks (Cronkite et al., Blood Cells, 2:263-284 [1976]).
  • continuous renewal of the mature blood cells, the primitive stem cells themselves, as well as any intermediate or lineage-committed progenitor cell lines lying between the primitive and mature cells is necessary in order to maintain the normal steady state blood cell needs of the mammal.
  • pluripotent stem cell(s) At the heart of the hematopoietic system lies the pluripotent stem cell(s). These cells are relatively few in number and undergo self-renewal by proliferation to produce daughter stem cells or are transformed, in a series of differentiation steps, into increasingly mature lineage-restricted progenitor cells, ultimately forming the highly specialized mature blood cell(s).
  • CFC-Mix certain multipotent progenitor cells, referred to as CFC-Mix, derived from stem cells undergo proliferation (self-renewal) and development to produce colonies containing all the different myeloid cells; erythrocytes, neutrophils, megakaryocytes (predecessors of platelets), macrophages, basophils, eosinophils, and mast cells.
  • Other progenitor cells of the lymphoid lineage undergo proliferation and development into T-cells and B-cells.
  • CFU-E erythroid colony-forming units
  • GM-CFC granulocyte/macrophage colony- forming cells
  • Meg-CFC megakaryocyte colony- forming cells
  • Eos-E eosinophil colony-forming cells
  • CFC basophil colony-forming cells
  • Bas-CFC basophil colony-forming cells
  • Other intermediate predecessor cells between the pluripotent stem cells and mature blood cells are known (see below) or will likely be discovered having varying degrees of lineage-restriction and self-renewal capacity.
  • the underlying principal of the normal hematopoietic cell system appears to be decreased capacity for self-renewal as multipotency is lost and lineage-restriction and maturity is acquired.
  • the pluripotent stem cell possessing the capacity for self-renewal and differentiation into all the various lineage-specific committed progenitor cells.
  • This capacity is the basis of bone marrow transplant therapy where primitive stem cells repopulate the entire hematopoietic cell system.
  • primitive stem cells repopulate the entire hematopoietic cell system.
  • progenitors At the other end of the spectrum lie the highly lineage- restricted progenitors and their progeny which have lost the ability of self-renewal but have acquired mature functional activity.
  • IL-3 interleukin-3
  • GM-CSF granulocyte/macrophage colony-stimulating factor
  • hematopoietic growth factors can exhibit their effect at different stages of cell development from the totipotent stem cell through various committed lineage-restricted progenitors to the mature blood cell.
  • erythropoietin epo
  • IL-3 appears to exert its effect earlier influencing primitive stem cells and intermediate lineage-restricted progenitor cells.
  • Other growth factors such as stem cell factor (SCF) may influence even more primitive cell development.
  • novel hematopoietic growth factors that affect survival, proliferation, differentiation or maturation of any of the blood cells or predecessors thereof would be useful, especially to assist in the re- establishment of a diminished hematopoietic system caused by disease or after radiation- or chemo-therapy.
  • megakaryocytic progenitor cells At least three classes of megakaryocytic progenitor cells have been identified, namely; burst forming unit megakaryocytes (BFU-MK), colony-forming unit megakaryocytes (CFU-MK), and light density megakaryocyte progenitor cells (LD-CFU-MK). Megakaryocytic maturation itself is a continuum of development that has been separated into stages based on standard morphologic criteria. The earliest recognizable member of the megakaryocyte (MK or meg) family are the megakaryoblasts. These cells are initially 20 to 30 ⁇ m in diameter having basophilic cytoplasm and a slightly irregular nucleus with loose, somewhat reticular chromatin and several nucleoli.
  • megakaryoblasts may contain up to 32 nuclei (ployploid), but the cytoplasm remains sparse and immature. As maturation proceeds, the nucleus becomes more lobulate and pyknotic, the cytoplasm increases in quantity and becomes more acidophilic and granular. The most mature cells of this family may give the appearance of releasing platelets at their periphery. Normally, less than 10% of megakaryocytes are in the blast stage and more than 50% are mature.
  • megakaryoblast for the earliest form
  • promegakaryocyte or basophilic megakaryocyte for the intermediate form
  • mature (acidophilic, granular, or platelet-producing) megakaryocyte for the late forms.
  • the mature megakaryocyte extends filaments of cytoplasm into sinusoidal spaces where they detach and fragment into individual platelets (Williams et al., Hematology, 1972).
  • Megakaryocytopoiesis is believed to involve several regulatory factors (Williams et al., Br. J. Haematol., 52 :173 [1982] and Williams et al., J. Cell Physiol., 110:101 [1982]).
  • the early level of megakaryocytopoiesis is postulated as being mitotic, concerned with cell proliferation and colony initiation from CFU-MK but is not affected by platelet count (Burstein et al., J. Cell Physiol., 109:333 [1981 ] and Kimura et al., Exp. Hematol., 13:1048 [1985]).
  • MK-CSF megakaryocyte colony-stimulating factor
  • MK-CSF's have been partly purified from experimentally produced thrombocytopenia (Hill et al., Exp. Hematol., 14:752 [1986]) and human embryonic kidney conditioned medium [CM] (McDonald et al., J. Lab. Clin. Med., 85:59 [1975]) and in man from a plastic anemia and idiopathic thrombocytopenic purpura urinary extracts (Kawakita et al., Blood, 6:556 [1983]) and plasma (Hoffman et al., J. Clin. Invest, 75:1174 [1985]), their physiological function is as yet unknown in most cases.
  • interleukin-3 IL-3
  • multilineage colony stimulating factor multi-CSF [Burstein, Blood Cells, 11 :469 [1986]
  • WEHI-3 is a murine myelomonocytic cell line secreting relatively large amounts of IL-3 and smaller amounts of GM-CSF.
  • IL-3 has been found to potentiate the growth of a wide range of hematopoietic cells (Ihle et al., J. Immunol., 13:282 [1983]).
  • IL-3 has also been found to synergize with many of the known hematopoietic hormones or growth factors (Bartelmez et al., J. Cell Physiol., 122:362-369 [1985] and Warren et al., Cell, 46:667-674 [1988]), including both erythropoietin (EPO) and interleukin-1 (IL-1 ), in the induction of very early multipotential precursors and the formation of very large mixed hematopoietic colonies.
  • EPO erythropoietin
  • IL-1 interleukin-1
  • megakaryocyte potentiators have been found in the conditioned media of murine lung, bone, macrophage cell lines, peritoneal exudate cells and human embryonic kidney cells. Despite certain conflicting data (Mazur, Exp. Hematol.,
  • EPO was postulated to be involved more in the single and two-cell stage aspects of megakaryocytopoiesis as opposed to the effect of PWM- SpCM which was involved in the four-cell stage of megakaryocyte development. The interaction of all these factors on both early and late phases of megakaryocyte development remains to be elucidated.
  • Platelets are critical elements of the blood clotting mechanism. Depletion of the circulating level of platelets, called thrombocytopenia, occurs in various clinical conditions and disorders. Thrombocytopenia is commonly defined as a platelet count below 150 X 10 9 per liter. The major causes of thrombocytopenia can be broadly divided into three categories on the basis of platelet life span, namely; (1) impaired production of platelets by the bone marrow, (2) platelet sequestration in the spleen (splenomegaly), or (3) increased destruction of platelets in the peripheral circulation (e.g., autoimmune thrombocytopenia or chemo- and radiation-therapy). Additionally, in patients receiving large volumes of rapidly administered platelet-poor blood products, thrombocytopenia may develop due to dilution.
  • causes of congenital thrombocytopenia include constitutional aplastic anemia (Fanconi syndrome) and congenital amegakaryocytic thrombocytopenia, which may be associated with skeletal malformations.
  • Acquired disorders of platelet production are caused by either hypoplasia of megakaryocytes or ineffective thrombopoiesis.
  • Megakaryocytic hypoplasia can result from a variety of conditions, including marrow aplasia (including idiopathic forms or myelosuppression by chemotherapeutic agents or radiation therapy), myelfibrosis, leukemia, and invasion of the bone marrow by metastatic tumor or granulomas.
  • toxins, infectious agents, or drugs may interfere with thrombopoiesis relatively selectively; examples include transient thrombocytopenias caused by alcohol and certain viral infections and mild thrombocytopenia associated with the administration of thiazide diuretics.
  • ineffective thrombopoiesis secondary to megaloblastic processes can also cause thrombocytopenia, usually with coexisting anemia and leukopenia.
  • thrombocytopenias due to decreased platelet production depends on identification and reversal of the underlying cause of the bone marrow failure. Platelet transfusions are usually reserved for patients with serious bleeding complications, or for coverage during surgical procedures, since isoimmunization may lead to refractoriness to further platelet transfusions. Mucosal bleeding resulting from severe thrombocytopenia may be ameliorated by the oral or intravenous administration of the antifibrinoiytic agents. Thrombotic complications may develop, however, if antifibrinoiytic agents are used in patients with disseminated intravascular coagulation (DIC).
  • DIC disseminated intravascular coagulation
  • Splenomegaly due to any cause may be associated with mild to moderate thrombocytopenia. This is a largely passive process (hypersplenism) of splenic platelet sequestration, in contrast to the active destruction of platelets by the spleen in cases of immunomediated thrombocytopenia discussed below.
  • hypersplenism the most common cause of hypersplenism is congestive splenomegaly from portal hypertension due to alcoholic cirrhosis, other forms of congestive, infiltrative, or lymphoproliferative splenomegaly are also associated with thrombocytopenia. Platelet counts generally do not fall below 50 X 10 9 per liter as a result of hypersplenism alone.
  • Thrombocytopenia due to nonimmune-mediated platelet destruction Thrombocytopenia can result from the accelerated destruction of platelets by various nonimmunologic processes.
  • Disorders of this type include disseminated intravascular coagulation, prosthetic intravascular devices, extra corporeal circulation of the blood, and thrombotic microangiopathies such as thrombotic thrombocytic purpura.
  • thrombotic thrombocytic purpura In all of these situations, circulating platelets that are exposed to either artificial surfaces or abnormal vascular intima either are consumed at these sites or are damaged and then prematurely cleared by the reticuloendothelial system.
  • Disease states or disorders in which disseminated intravascular coagulation (DIC) may arise are set forth in greater detail in Braunwald et al.
  • Intravascular prosthetic devices including cardiac valves and intra-aortic balloons can cause a mild to moderate destructive thrombocytopenia and transient thrombocytopenia in patients undergoing cardiopulmonary bypass or hemodialysis may result from consumption or damage of platelets in the extra corporeal circuit.
  • ITP in adults is a chronic disease characterized by autoimmune platelet destruction.
  • the autoantibody is usually IgG although other immunoglobulins have also been reported.
  • the autoantibody of ITP has been found to be associated with platelet membrane GPIIblMa- the platelet antigen specificity has not been identified in most cases.
  • Extravascular destruction of sensitized platelets occurs in the reticuloendothelial system of the spleen and liver.
  • rheumatic or autoimmune diseases e.g., systemic lupus erythematosus
  • lymphoproliferative disorders e.g., chronic lymphocytic leukemia.
  • CD4 helper/inducer T cell function probably underlies the profound defects in cellular and humoral immunity leading to the opportunistic infections and malignancies characteristic of AIDS (H. Lane supra).
  • the therapeutic approach to the treatment of patients with thrombocytopenia is dictated by the severity and urgency of the clinical situation.
  • the treatment is similar for HIV-associated and non-HIV-related thrombocytopenia, and although a number of different therapeutic approaches have been used, the therapy remains controversial.
  • glucocorticoid e.g., prednisolone
  • the response is incomplete, or relapse occurs when the glucocorticoid dose is reduced or its administration is discontinued.
  • glucocorticoids are usually administered if platelet count falls below 20 X 10 /liter or when spontaneous bleeding occurs.
  • the compound For patients refractory to glucocorticoids, the compound:
  • Splenectomy removes the major site of platelet destruction and a major source of autoantibody production in many patients. This procedure results in prolonged treatment-free remissions in a large number of patients.
  • surgical procedures are generally to be avoided in immune compromised patients, splenectomy is recommended only in severe cases of thrombocytopenia (e.g. severe HIV-associated ITP), in patients who fail to respond to 2 to 3 weeks of glucocorticoid treatment, or do not achieve sustained response after discontinuation of glucocorticoid administration. Based upon current scientific knowledge, it is unclear whether splenectomy predisposes patients to AIDS.
  • cytotoxic agents e.g., vincristine, and azidothimidine (AZT, zidovudine) also show promise in treating HIV-induced ITP; however, the results are preliminary.
  • AZT azidothimidine
  • TPO thrombopoietin
  • TPO- active polypeptides While reports of partial purification of TPO- active polypeptides exist (see, for example, Tayrien et al., J. Biol. Chem., 262:3262 [1987] and Hoffman et al., J. Clin. Invest. 75:1174 [1985]), others have postulated that TPO is not a discrete entity in its own right but rather is simply the polyfunctional manifestation of a known hormone (IL- 3, Sparrow et al., Prog. Clin. Biol. Res., 215:123 [1986]). Regardless of its form or origin, a molecule possessing thrombopoietic activity would be of significant therapeutic value. Although no protein has been unambiguously identified as TPO, considerable interest surrounds the recent discovery that mpl, a putative cytokine receptor, may transduce a thrombopoietic signal.
  • V. Mpl is a Megakaryocytopoietic Cytokine Receptor
  • GM- CSF granulocyte-macrophage colony-stimulating factor
  • G-CSF granulocyte colony-stimulating factor
  • prolactin Boutin et al., Proc. Natl. Acad. Sci. USA, 88:7744-7748 [1988]; Edery et al., Proc. Natl. Acad. Sci. USA, 86:2112-2116 [1989]
  • GH growth hormone
  • CNTF ciliary neurotrophic factor
  • mpl is a member of the cytokine receptor superfamily comes from sequence homology (Gearing, EMBO J., 8:3667-3676 [1988]; Bazan, Proc. Natl. Acad. Sci. USA, 87:6834-6938 [1990]; Davis et al., Science, 253:59-63 [1991] and Vigon et al., Proc. Natl. Acad. Sci. USA, 89:5640-5644 [1992]) and its ability to transduce proliferative signals.
  • the extracellular domain contains 465 amino acid residues and is composed of two subdomains each with four highly conserved cysteines and a particular motif in the N-terminal subdomain and in the C- terminal subdomain.
  • the ligand-binding extracellular domains are predicted to have similar double ⁇ -barrel fold structural geometries.
  • mpl may belong to the low affinity ligand binding class of cytokine receptors.
  • mpl is reported to be one of the most conserved members of the cytokine receptor superfamily (Vigon supra).
  • mpl is a single chain (class one) receptor like EPO-R or G-CSFR or it is a signal transducing ⁇ -subunit (class three) requiring an ⁇ -subunit like IL-3 (Skoda et al. supra).
  • TPO thrombopoietin
  • Suitable mpl agonist include hMLi 53, hML(R153A, R154A), hML2, hML3, hML4, mML, mML2, mML3, pML, and pML2 or fragments thereof.
  • Fig. 9 shows both strands of a 390 bp fragment of human genomic DNA encoding the mpl ligand.
  • the deduced amino acid sequence of "exon 3" (SEQ ID NO: 3), the coding sequence (SEQ ID NO: 4), and its compliment (SEQ ID NO: 5) are shown.
  • Fig. 10 shows deduced amino acid sequence of mature human mpl ligand (hML) (SEQ ID NO: 6) and mature human erythropoietin (hEPO) (SEQ ID NO: 7).
  • the predicted amino acid sequence for the human mpl ligand is aligned with the human erythropoietin sequence. Identical amino acids are boxed and gaps introduced for optimal alignment are indicated by dashes.
  • Potential N-glycosyiation sites are underlined with a plain line for the hML and with a broken line for hEPO.
  • the two cysteines important for erythropoietin activity are
  • Fig. 11 shows deduced amino acid sequence of mature human mpl ligand isoforms hML (SEQ ID NO: 6), hML2 (SEQ ID NO: 8), hML3 (SEQ ID NO: 9), and hML4 (SEQ ID NO:
  • Figs. 12A, 12B and 12C show the effect of human mpl ligand on Ba/F3-mp/ cell proliferation (A), in vitro human megakaryocytopoiesis quantitated using a radiolabeled murine IgG monoclonal antibody specific to the megakaryocyte glycoprotein GPIIbMla (B), and murine thrombopoiesis measured in a platelet rebound assay (C).
  • Fig. 13 compares the effect of human mpl ligand isoforms and variants in the Ba/F3- mpl cell proliferation assay.
  • hML, mock, hML2, hML3, hML(R153A, R154A), and hML-) 53 were assayed at various dilutions as described in Example 1.
  • Figs. 14A, 14B and 14C show the deduced amino acid sequence (SEQ ID NO: 1) of human mpl ligand (hML) or human TPO (hTPO) and the human genomic DNA coding sequence (SEQ ID NO: 11). Nucleotides and amino acid residues are numbered at the beginning of each line.
  • Fig. 15 shows a SDS-PAGE of purified 293-rhML332 and purified 293-rhML-
  • Fig. 17 shows the cDNA sequence (SEQ ID NO: 14) and predicted protein sequence (SEQ ID NO: 15) of this murine ML isoform (mML). Nucleotides are numbered at the beginning of each line. Amino acid residues are numbered above the sequence starting with Ser 1.
  • This mature murine mpl ligand isoform contains 335 amino acid residues and is believed to be the full length mpl ligand, designated mML.
  • the signal sequence is indicated with a dashed underline and the likely cleavage point is denoted with an arrow.
  • the 5' and 3' untranslated regions are indicated with lower case letters.
  • the two deleations found as a result of alternative splicing (mML2 and mML3) are underlined.
  • the four cysteine residues are indicated by a dot. The seven potential N- glycosylation sites are boxed.
  • Amino acid sequences are aligned with gaps, indicated by dashes, introduced for optimal alingment. Amino acids are numbered at the beginning of each line with Identical residues boxed. Potential N-glycosylation sites are indicated by a shaded box and cysteine residues are designated with a dot. The conserved di-basic amino acid motif that presents a potential protease cleavage site is underlined. The four amino acid deletion found to occur in all three species (ML2) is outlined with a bold box.
  • Fig. 20 shows the cDNA sequence (SEQ ID NO: 19) and predicted mature protein sequence (SEQ ID NO: 18) of a porcine ML isoform (pML).
  • This porcine mpl ligand isoform contains 332 amino acid residues and is believed to be the full length porcine mpl ligand, designated pML. Nucleotides are numbered at the beginning of each line. Amino acid residues are numbered above the sequence starting with Ser 1.
  • Fig. 24 shows the pertinent features of plasmid pSVI5.ID.LL.MLEPO-D ("truncated" or TPO153) used to transfect host CHO-DP12 cells for production of CHO-rhTPOi53.
  • Figs. 25A, 25B, and 25C show the effect of E. co//-rhTPO(Met " 1 , 153) on platelets (A), red blood cells (B) and (C) white blood cells in normal mice.
  • Two groups of 6 female C57 B6 mice were injected daily with either PBS buffer or 0.3 ⁇ g E. co/ -rhTPO(Met "1 , 153) (100 ⁇ l sc).
  • Figs. 26A, 26B and 26C show the effect of E. co//-rhTPO( et " 1 , 153) on platelets (A), red blood cells (B) and (C) white blood cells in sublethally irradiated mice.
  • Two groups of 10 female C57 B6 mice were sublethally irradiated with 750 cGy of gamma radiation from a 1 37 Cs source and injected daily with either PBS buffer or 3.0 ⁇ g E. co/// ' -rhTPO(Met "1 , 153) (100 ⁇ l sc).
  • PBS buffer 3.0 ⁇ g E. co/// ' -rhTPO(Met "1 , 153) (100 ⁇ l sc).
  • 40 ⁇ l of blood was taken from the orbital sinus. This biood was immediately diluted in 10 ml of commercial diluant and complete blood counts were obtained on a Serrono Baker Hematology Analyzer 9018. The data are
  • Figs. 27A, 27B and 27C show the effect of CHO-rhTP ⁇ 332 on (A) platelets (thrombocytes), (B ) red blood cells (erythrocytes) and (C ) white blood cells (leukocytes) in normal mice.
  • Two groups of 6 female C57 B6 mice were injected daily with either PBS buffer or 0.3 ⁇ g CHO-rhTP ⁇ 332 (100 ⁇ l sc). On day 0 and on days 3-7 40 ⁇ l of blood was taken from the orbital sinus. This blood was immediately diluted in 10 ml of commercial diluant and complete blood counts were obtained on a Serrono Baker Hematology Analyzer 9018. The data are presented as means + Standard error of the mean.
  • TPO-j 53 the truncated form of TPO from E. coli
  • TPO332 (Mix fraction) Full length TPO containing approximately 80-90% full length and 10-20% clipped forms
  • TPO332(30K fraction) purified clipped fraction from the original "mix” preparation
  • TPO332(70K fraction) purified full length TPO fraction from the original "mix” preparation.
  • the data are presented as means ⁇ Standard error of the mean.
  • Fig. 30 is a cartoon showing the KIRA ELISA assay for measuring TPO.
  • the figure shows the MPURse.gD chimera and relavant parts of the parent receptors as well as the final construct (right portion of the figure) and a flow diagram (left portion of the figure) showing relavant steps of the assay.
  • Fig. 31 is a flow chart for the KIRA ELISA assay showing each step in the procedure.
  • Figs. 32A-32L provide the nucleotide sequence (SEQ ID NO: 22) of the pSVI17.ID.LL expression vector used for expression of Rse.gD in Example 17.
  • Fig. 33 is a schematic representation of the preperation of plasmid pMP1.
  • Fig. 34 is a schematic representation of the preperation of plasmid pMP21.
  • Fig. 35 is a schematic representation of the preperation of plasmid pMP151.
  • Fig. 36 is a schematic representation of the preperation of plasmid pMP202.
  • Fig. 37 is a schematic representation of the preperation of plasmid pMP172.
  • Fig. 42 is a schematic representation of the preperation of plasmid pMP251.
  • Cytokine is a generic term for proteins released by one cell population which act on another cell as intercellular mediators.
  • cytokines are lymphokines, monokines, and traditional polypeptide hormones. Included among the cytokines are growth hormone, insulin-like growth factors, human growth hormone, N-methionyl human growth hormone, bovine growth hormone, parathyroid hormone, thyroxine, insulin, proinsulin, relaxin, prorelaxin, glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and leutinizing hormone (LH), hematopoietic growth factor, hepatic growth factor, fibrobiast growth factor, prolactin, placental lactogen, tumor necrosis factor- ⁇ (TNF- ⁇ and TNF- ⁇ ) mullerian-inhibiting substance, mouse gonadotropin-associated peptide, inhibin, activin, vascular endothelial growth factor, integrin, nerve growth factors such as N
  • mpl ligand As used herein the foregoing terms are meant to include proteins from natural sources or from recombinant cell culture. Similarly, the terms are intended to include biologically active equivalents; e.g., differing in amino acid sequence by one or more amino acids or in type or extent of glycosylation.
  • mpl ligand “mpl ligand polypeptide”, “ML”, “thrombopoietin” or “TPO” are used interchangeably herein and comprise any polypeptide that possesses the property of binding to mpl, a member of the cytokine receptor superfamily, and having a biological property of the ML as defined below.
  • N-terminal fragments are hML-
  • Mpl ligand variants or "mpl ligand sequence variants” as defined herein means a biologically active mpl ligand as defined below having less than 100% sequence identity with the mpl ligand isolated from recombinant cell culture or aplastic porcine plasma or the human ligand having the deduced sequence described in Fig. 1 (SEQ ID NO: 1).
  • a biologically active mpl ligand variant will have an amino acid sequence having at least about 70% amino acid sequence identity with the mpl ligand isolated from aplastic porcine plasma or the mature murine or human ligand or fragments thereof (see Fig. 1 [SEQ ID NO: 1]), preferably at least about
  • a "chimeric mpl ligand” is a polypeptide comprising full length mpl ligand or one or more fragments thereof fused or bonded to a second heterologous polypeptide or one or more fragments thereof.
  • the chimera will share at least one biological property in common with mpl ligand.
  • the second polypeptide will typically be a cytokine, immunoglobin or fragment thereof.
  • Isolated mpl ligand "highly purified mpl ligand” and “substantially homogeneous mpl ligand” are used interchangeably and mean a mpl ligand that has been purified from a mpl ligand source or has been prepared by recombinant or synthetic methods and is sufficiently free of other peptides or proteins (1 ) to obtain at least 15 and preferably 20 amino acid residues of the N-terminal or of an internal amino acid sequence by using a spinning cup sequenator or the best commercially available amino acid sequenator marketed or as modified by published methods as of the filing date of this application, or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain. Homogeneity here means less than about 5% contamination with other source proteins.
  • Biological property when used in conjunction with either the "mpl ligand” or “Isolated mpl ligand” means having thrombopoietic activity or having an in vivo effector or antigenic function or activity that is directly or indirectly caused or performed by a mpl ligand (whether in its native or denatured conformation) or a fragment thereof.
  • Effector functions includemp/ binding and any carrier binding activity, agonism or antagonism of mpl, especially transduction of a proliferative signal including replication, DNA regulatory function, modulation of the biological activity of other cytokines, receptor (especially cytokine) activation, deactivation, up- or down regulation, cell growth or differentiation and the like.
  • the antibodies used to define "biologically activity" are rabbit polyclonal antibodies raised by formulating the mpl ligand isolated from recombinant cell culture or aplastic porcine plasma in Freund's complete adjuvant, subcutaneously injecting the formulation, and boosting the immune response by intraperitoneal injection of the formulation until the titer of mpl ligand antibody plateaus.
  • Another known effector function of the mpl ligand or polypeptide herein is the ability to stimulate the incorporation of 35 S into circulating platelets in a mouse platelet rebound assay.
  • Yet another known effector function of mpl ligand is the ability to stimulate in vitro human megakaryocytopoiesis that may be quantitated by using a radio labeled monoclonal antibody specific to the megakaryocyte glycoprotein GPIIbllla-
  • Percent amino acid sequence identity with respect to the mpl ligand sequence is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the mpl ligand sequence isolated from aplastic porcine plasma or the murine or human ligand having the deduced amino acid sequence described in Fig. 1 (SEQ ID NO: 1), after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. None of N-terminal, C-terminal, or internal extensions, deletions, or insertions into the mpl ligand sequence shall be construed as affecting sequence identity or homology.
  • exemplary biologically active mpl ligand polypeptides considered to have identical sequences include; prepro-mp/ ligand, pro- p/ ligand, and mature mpl ligand.
  • Mpl ligand microsequencing may be accomplished by any appropriate standard procedure provided the procedure is sensitive enough.
  • highly purified polypeptide obtained from SDS gels or from a final HPLC step are sequenced directly by automated Edman (phenyl isothiocyanate) degradation using a model 470A Applied Biosystems gas phase sequencer equipped with a 120A phenylthiohydantion (PTH) amino acid analyzer.
  • PTH phenylthiohydantion
  • mpl ligand fragments prepared by chemical (e.g., CNBr, hydroxylamine, 2-nitro-5-thiocyanobenzoate) or enzymatic (e.g., trypsin, clostripain, staphylococcal protease) digestion followed by fragment purification (e.g., HPLC) may be similarly sequenced.
  • PTH amino acids are analyzed using the ChromPerfect data system (Justice Innovations, Palo Alto, CA). Sequence interpretation is performed on a VAX 11/785 Digital Equipment Co. computer as described by Henzel et al., J. Chromatography, 404:41 -52 [1987].
  • aliquots of HPLC fractions may be electrophoresed on 5-20% SDS-PAGE, electrotransferred to a PVDF membrane (ProBlott, AIB, Foster City, CA) and stained with Coomassie Brilliant Blue (Matsurdiara, J. Biol. Chem., 262: 10035-10038 [1987].
  • a specific protein identified by the stain is excised from the blot and N- terminal sequencing is carried out with the gas phase sequenator described above.
  • HPLC fractions are dried under vacuum (SpeedVac), resuspended in appropriate buffers, and digested with cyanogen bromide, the Lys- specific enzyme Lys-C (Wako Chemicals, Richmond, VA), or Asp-N (Boehringer Mannheim, Indianapolis, IN). After digestion, the resultant peptides are sequenced as a mixture or after HPLC resolution on a C4 column developed with a propanol gradient in 0.1% TFA prior to gas phase sequencing.
  • Lys-C Lys-specific enzyme
  • Asp-N Boehringer Mannheim, Indianapolis, IN
  • Thrombocytopenia is defined as a platelet count below 150 X 10 9 per liter of blood.
  • Thrombopoietic activity is defined as biological activity that consists of accelerating the proliferation, differentiation and/or maturation of megakaryocytes or megakaryocyte precursors into the platelet producing form of these cells. This activity may be measured in various assays including an in vivo mouse platelet rebound synthesis assay, induction of platelet cell surface antigen assay as measured by an anti-platelet immunoassay (anti-GPII Ml a ) for a human leukemia megakaryoblastic cell line (CMK), and induction of polyploidization in a megakaryoblastic cell line (DAMI).
  • TPO Thrombopoietin
  • TPO is defined as a compound having thrombopoietic activity or being capable of increasing serum platelet counts in a mammal. TPO is preferably capable of increasing endogenous platelet counts by at least 10%, more preferably by 50%, and most preferably capable of elevating platelet counts in a human to greater that 150X10 9 per liter of blood.
  • isolated mpl ligand nucleic acid is RNA or DNA containing greater than 16 and preferably 20 or more sequential nucleotide bases that encode biologically active mpl ligand or a fragment thereof, is complementary to the RNA or DNA, or hybridizes to the
  • RNA or DNA and remains stably bound under moderate to stringent conditions.
  • This RNA or DNA is free from at least one contaminating source nucleic acid with which it is normally associated in the natural source and preferably substantially free of any other mammalian RNA or DNA.
  • the phrase "free from at least one contaminating source nucleic acid with which it is normally associated" includes the case where the nucleic acid is present in the source or natural cell but is in a different chromosomal location or is otherwise flanked by nucleic acid sequences not normally found in the source cell.
  • isolated mpl ligand nucleic acid is RNA or DNA that encodes a biologically active tTp/ ligand sharing at least 75% sequence identity, more preferably at least 80%, still more preferably at least 85%, even more preferably 90%, and most preferably 95% sequence identity with the human, murine or porcine mpl ligand.
  • Control sequences when referring to expression means DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism.
  • Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
  • "Operably linked” when referring to nucleic acids means that the nucleic acids are placed in a functional relationship with another nucleic acid sequence.
  • DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • "operably linked" means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accord with conventional practice.
  • Exogenous when referring to an element means a nucleic acid sequence that is foreign to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is ordinarily not found.
  • Cell Cell
  • cell line cell line
  • cell culture are used interchangeably herein and such designations include all progeny of a cell or cell line.
  • terms like “transformants” and “transformed cells” include the primary subject cell and cultures derived therefrom without regard for the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same function or biological activity as screened for in the originally transformed cell are included. Where distinct designations are intended, it will be clear from the context.
  • Plasmids are autonomously replicating circular DNA molecules possessing independent origins of replication and are designated herein by a lower case “p” preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from such available plasmids in accordance with published procedures.
  • other equivalent plasmids are known in the art and will be apparent to the ordinary artisan.
  • Restriction enzyme digestion when referring to DNA means catalytic cleavage of internal phosphodiester bonds of DNA with an enzyme that acts only at certain locations or sites in the DNA sequence. Such enzymes are called “restriction endonucleases”. Each restriction endonuclease recognizes a specific DNA sequence called a “restriction site” that exhibits two-fold symmetry.
  • restriction enzymes commonly are designated by abbreviations composed of a capital letter followed by other letters representing the microorganism from which each restriction enzyme originally was obtained and then a number designating the particular enzyme.
  • plasmid or DNA fragment is used with about 1-2 units of enzyme in about 20 ⁇ l of buffer solution.
  • buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer.
  • Incubation of about 1 hour at 37 C C is ordinarily used, but may vary in accordance with the supplier's instructions. After incubation, protein or polypeptide is removed by extraction with phenol and chloroform, and the digested nucleic acid is recovered from the aqueous fraction by precipitation with ethanol.
  • Digestion with a restriction enzyme may be followed with bacterial alkaline phosphatase hydrolysis of the terminal 5' phosphates to prevent the two restriction-cleaved ends of a DNA fragment from "circularizing" or forming a closed loop that would impede insertion of another DNA fragment at the restriction site.
  • digestion of plasmids is not followed by 5' terminal dephosphorylation.
  • Procedures and reagents for dephosphorylation are conventional as described in sections 1.56-1.61 of Sambrook et al., Molecular Cloning: A Laboratory Manual [New York: Cold Spring Harbor Laboratory Press, 1989].
  • Recovery or “isolation” of a given fragment of DNA from a restriction digest means separation of the digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA.
  • This procedure is known generally. For example, see Lawn et al., Nucleic Acids Res., 9:6103-61 14 [1981], and Goeddel et al., Nucleic Acids Res., 8:4057 [1980].
  • RNA sequences that hybridize to a known probe such as an oligonucleotide, DNA fragment, cDNA or fragment thereof, or RNA fragment.
  • the probe is labeled with a radioisotope such as 32 P, or by biotinylation, or with an enzyme.
  • the RNA to be analyzed is usually electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon, or other suitable membrane, and hybridized with the probe, using standard techniques well known in the art such as those described in sections 7.39-7.52 of Sambrook et al., supra.
  • the DNA is then purified by phenol-chloroform extraction and ethanol precipitation.
  • the DNA fragments that are to be ligated together are put in solution in about equimolar amounts.
  • the solution will also contain ATP, ligase buffer, and a ligase such as T4 DNA ligase at about 10 units per 0.5 ⁇ g of DNA.
  • the vector is first linearized by digestion with the appropriate restriction endonuclease(s).
  • the linearized fragment is then treated with bacterial alkaline phosphatase or calf intestinal phosphatase to prevent self-ligation during the ligation step.
  • Preparation of DNA from cells means isolating the plasmid DNA from a culture of the host cells. Commonly used methods for DNA preparation are the large- and small-scale plasmid preparations described in sections 1.25-1.33 of Sambrook et al., supra. After preparation of the DNA, it can be purified by methods well known in the art such as that described in section 1.40 of Sambrook et al., supra.
  • Oligonucleotides are short-length, single- or double-stranded polydeoxynucleotides that are chemically synthesized by known methods (such as phosphotriester, phosphite, or phosphoramidite chemistry, using solid-phase techniques such as described in EP 266,032 published 4 May 1988, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., Nucl. Acids Res., 14:5399-5407 [1986]). Further methods include the polymerase chain reaction defined below and other autoprimer methods and oligonucleotide syntheses on solid supports. All of these methods are described in Engels et al., Agnew. Chem.
  • oligonucleotide primers can be designed; these primers will be identical or similar in sequence to opposite strands of the template to be amplified.
  • the 5' terminal nucleotides of the two primers may coincide with the ends of the amplified material.
  • PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA, bacteriophage or plasmid sequences, etc. See generally Mullis et al., Cold Spring Harbor Symp. Quant.
  • PCR is considered to be one, but not the only, example of a nucleic acid polymerase reaction method for amplifying a nucleic acid test sample comprising the use of a known nucleic acid as a primer and a nucleic acid polymerase to amplify or generate a specific piece of nucleic acid.
  • “Stringent conditions” are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCI/0.0015 M sodium citrate/0.1% NaDodS ⁇ 4 (SDS) at 50°C, or (2) employ during hybridization a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C.
  • a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C.
  • Another example is use of 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC and 0.1 % SDS.
  • Antibodies are glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules which lack antigen specificity. Polypeptides of the latter kind are, for example, produced at low levels by the lymph system and at increased levels by myelomas.
  • “Native antibodies and immunoglobulins” are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies between the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (V
  • Each light chain has a variable domain at one and (V and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain.
  • Particular amino acid residues are believed to form an interface between the light and heavy chain variable domains (Clothia et al., J. Mol. Biol., 186:651 -663 [1985]; Novotny and Haber, Proc. Natl. Acad. Sci. USA, 82:4592-4596 [1985]).
  • variable refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed through the variable domains of antibodies. It is concentrated in three segments called complementarity determining regions (CDRs) or hypervariable regions both in the light chain and the heavy chain variable domains. The more highly conserved portions of variable domains are called the framework (FR).
  • CDRs complementarity determining regions
  • FR framework
  • the variable domains of native heavy and light chains each comprise four FR regions, largely adopting a ⁇ -sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the ⁇ -sheet structure.
  • the CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen binding site of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, National Institute of Health, Bethesda, MD [1987]).
  • the constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity.
  • Papain digestion of antibodies produces two identical antigen binding fragments, called "Fab” fragments, each with a single antigen binding site, and a residual "Fc” fragment, whose name reflects its ability to crystallize readily.
  • Pepsin treatment yields an F(ab'.2 fragment that has two antigen combining sites and is still capable of cross-linking antigen.
  • Fv is the minimum antibody fragment which contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy and one light chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen binding site on the surface of the V
  • the six CDRs confer antigen binding specificity to the antibody.
  • a single variable domain or half of an Fv comprising only three CDRs specific for an antigen has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
  • the Fab fragment also contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain.
  • Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region.
  • Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
  • F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other, chemical couplings of antibody fragments are also known.
  • immunoglobulins The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa and lambda ( ⁇ ), based on the amino acid sequences of their constant domains. Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of these may be further divided into subclasses (isotypes), e.g., lgG-1 , lgG-2, lgG-3, and lgG-4; IgA- 1 and lgA-2.
  • immunoglobulins There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of these may be further divided into subclasses (isotypes), e.g., l
  • the heavy chain constant domains that correspond to the different classes of immunoglobulins are called ⁇ , delta, epsilon, ⁇ , and ⁇ , respectively.
  • the subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.
  • antibody is used in the broadest sense and specifically covers single monoclonal antibodies (including agonist and antagonist antibodies), antibody compositions with polyepitopic specificity, as well as antibody fragments (e.g., Fab,
  • the term "monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they are synthesized by the hybridoma culture, uncontaminated by other immunoglobulins.
  • the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
  • the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler & Milstein, Nature, 256:495 (1975), or may be made by recombinant DNA methods (see, e.g., U.S. Patent No. 4,816,567 [Cabilly et al.]).
  • the monoclonal antibodies herein specifically include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Patent No. 4,816,567 (Cabilly et al.); and Morrison et al., Proc. Natl. Acad. Sci. USA 81 :6851 -6855 [1984]).
  • chimeric antibodies immunoglobulins in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is
  • Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
  • humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • CDR complementary determining region
  • donor antibody such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • humanized antibody may comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially ail of the FR regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • Fc immunoglobulin constant region
  • Preferred polypeptides of this invention are substantially homogeneous polypeptide(s), referred to as mpl ligand(s) or thrombopoietin (TPO), that possesse the property of binding to mpl, a member of the receptor cytokine superfamily, and having the biological property of stimulating the incorporation of labeled nucleotides ( 3 H-thymidine) into the DNA of IL-3 dependent Ba/F3 cells transfected with human mpl P.
  • mpl ligand(s) or thrombopoietin (TPO) that possesse the property of binding to mpl, a member of the receptor cytokine superfamily, and having the biological property of stimulating the incorporation of labeled nucleotides ( 3 H-thymidine) into the DNA of IL-3 dependent Ba/F3 cells transfected with human mpl P.
  • a synthetic oligonucleotide based on the sequence of the PCR fragment was used to screen a human genomic DNA library.
  • a 45-mer oligonucleotide, designated pR45, was designed and synthesized based on the sequence of the PCR fragment. This oligonucleotide had the following sequence:
  • oligonucleotides corresponding to the 3' and 5' ends of the exon sequence were synthesized. These 2 primers were used in PCR reactions employing as a template cDNA prepared from various human tissues. The expected size of the correct PCR product was 140 bp.
  • 332 amino acid residue ligand is about 38 kDa. There are 6 potential N-glycosylation sites and 4 cysteine residues.
  • the hML mRNA does not contain the consensus polyadenylation sequence AAUAAA, nor the regulatory element AUUUA that is present in 3' untranslated regions of many cytokines and is thought to influence mRNA stability (Shawet al., Cell, 46:659-667 [1986]).
  • Northern blot analysis reveals low levels of a single 1.8 kb hML RNA transcript in both fetal and adult Iiver. After longer exposure, a weaker band of the same size could be detected in adult kidney.
  • human erythropoietin is expressed in fetal Iiver and, in response to hypoxia, the adult kidney and iiver (Jacobs et al., Nature, 313:804-809 [1985] and Bondurant et al., Molec. Cell. Biol., 6:2731 -2733 [1986]).
  • the C-terminal domain of hML contains two di-basic amino acid sequences [Arg-Arg motifs at positions 153-154 and 245-246] that could serve as potential processing sites. Cleavage at these sites may be responsible for generating the 30, 28 and 18-22 kDa forms of the ML isolated from APP.
  • Argi 53-Argi 54 sequence occurs immediately following the erythropoietin-like domain of the ML.
  • the ligand was expressed in mammalian 293 cells under the control of the cytomegalovirus immediate early promoter using the expression vectors pRK5-hML or pRK5-hMLi 53.
  • Supematants from transiently transfected human embryonic kidney 293 cells were found to stimulate 3 H-thymidine incorporation in Ba/F3-mpl cells, but not in parental Ba/F3 cells (Fig. 12A).
  • Media from the 293 cells transfected with the pRK vector alone did not contain this activity. Addition of mp/-lgG to the media abolished the stimulation (data not shown).
  • mice Thrombopoietic activities present in plasma of thrombocytopenic animals have been shown to stimulate platelet production in a mouse rebound thrombocytosis assay (McDonald, Proc. Soc. Exp. Biol. Med., 14:1006-1001 [1973] and McDonald et al., Scand. J. Haematol., 16:326-334 [1976]).
  • mice are made acutely thrombocytopenic using specific antiplatelet serum, resulting in a predictable rebound thrombocytosis.
  • Such immuno-thrombocythemic mice are more responsive to exogenous thrombopoietin-like activities than are normal mice (McDonald, Proc. Soc. Exp. Biol.
  • mice just as exhypoxic mice are more sensitive to erythropoietin than normal are mice (McDonald, et al., J. Lab. Clin. Med., 77:134-
  • hML2 and hML3 showed no detectable activity in this assay, however the activity of hML(R153A, R154A) was similar to hML and hML-1 53 indicating that processing at the Argi53-Arg-
  • megakaryocytopoiesis is regulated at multiple cellular levels (Williams et al., J.Cell Physiol., 110:101 -104 [1982] and Williams et al., Blood Cells, 15:123-133 [1989]). This is based largely on the observation that certain hematopoietic growth factors stimulate proliferation of megakaryocyte progenitors while others appear to primarily affect maturation. The results presented here suggest that the ML acts both as a proliferative and maturation factor. That ML stimulates proliferation of megakaryocyte progenitors is supported by several lines of evidence.
  • APP stimulates both proliferation and maturation of human megakaryocytes in vitro, and this stimulation is completely inhibited by mpl- IgG (Figs. 7 and 8). Furthermore, the inhibition of megakaryocyte colony formation by c-mpl antisense oligonucleotides (Methia et al., Blood, 82:1395-1401 [1993]) and the finding that c-mpl can transduce a proliferative signal in cells into which it is transfected (Skoda et al., EMBO, 12:2645-2653 [1993] and Vigon et al., Oncogene,
  • TPO Human mpl Ligand
  • the structure of the human gene is composed of 6 exons within 7 kb of genomic DNA. The boundaries of all exon/intron junctions are consistent with the consensus motif established for mammalian genes (Shapiro, M. B., et al., Nucl. Acids Res. 15:7155 [1987]).
  • Exon 1 and exon 2 contain 5' untranslated sequence and the initial four amino acids of the signal peptide. The remainder of the secretory signal and the first 26 amino acids of the mature protein are encoded within exon 3. The entire carboxyl domain and 3' untranslated as well as -50 amino acids of the erythropoietin- like domain are encoded within exon 6.
  • the four amino acids involved in the deletion observed within hML-2 (hTPO-2) are encoded at the 5' end of exon 6.
  • FISH fluorescent in situ hybridization
  • rhML332 Purification of rhML332 was conducted as described in Example 19. Briefly, 293-rhML332 conditioned media was applied to a Blue-Sepharose (Pharmacia) column that was subsequently washed with a buffer containing 2M urea. The column was eluted with a buffer containing 2M urea and 1 M NaCl. The Blue-Sepharose (Pharmacia) column that was subsequently washed with a buffer containing 2M urea. The column was eluted with a buffer containing 2M urea and 1 M NaCl. The Blue-
  • a DNA fragment corresponding to the coding region of the human mpl ligand was obtained by PCR, gel purified and labeled in the presence of 32 P-dATP and 2p-dCTP. This probe was used to screen 10 ⁇ clones of a mouse Iiver cDNA library in ⁇ GT10.
  • a murine clone (Fig. 16 [SEQ ID NOS: 12 & 13]) containing a 1443 base pair insert was isolated and sequenced.
  • the presumed initiation codon at nucleotide position 138- 141 was within a consensus sequence favorable for eukaryotic translation initiation (Kozak, M. J.Cell Biol., 108:229-241 [1989]). This sequence defines an open reading frame of 1056 nucleotides, which predicts a primary translation product of
  • This form is believed to be the full length murine ML and is refered to as mML or mML335.
  • the nucleotide and deduced amino acid sequence for mML are provided in Fig. 17 (SEQ ID NOS: 14 & 15).
  • This cDNA clone consists of 1443 base pairs followed by a poly(A) tail. It possesses an open reading frame of 1068 bp flanked by 134 bases of 5' and 241 bases of 3' untranslated sequence. The presumed initiation codon lies at nucleotide position 138-140.
  • the open reading frame encodes a predicted protein of 356 amino acids, the first 21 of which are highly hydrophobic and likely function as a secretion signal.
  • a third murine clone was isolated, sequenced and was found to contained the 116 nucleotide deletion corresponding to hML3.
  • This murine isoform is therefore denominated mML3.
  • Comparison of the deduced amino acid sequences of these two isoforms is shown in Fig. 18 (SEQ ID NOS: 9 & 16).
  • the overall amino acid sequence identity between human and mouse ML is shown in Fig. 18 (SEQ ID NOS: 9 & 16).
  • An expression vector containing the entire coding sequence of mML was transiently transfected into 293 cells as described in Example 1. Conditioned media from these cells stimulated H-thymidine incorporation into Ba/F3 cells expressing either murine or human mpl but had no effect on the parental (mp/-less) cell line.
  • pML pig mpl ligand of 332 amino acid resudues
  • Fig. 20 SEQ ID NOS: 18 & 19
  • pML2 a second form, designated pML2, encoding a protein with a 4 amino acid residue deletion (228 amino acid residues) was identified (see Fig. 21 [SEQ ID NO: 21]).
  • a second di-basic site present at position 245 and 246 in the human sequence is not present in the mouse or pig sequences.
  • the murine and the pig ML sequence contain 4 cysteines, all conserved in the human sequence.
  • Ovary (CHO) Cells The expression vectors used to transfect CHO cells are designated: pSVI5.ID.LL.MLORF (full length or TPO332). and pSVI5.ID.LL.MLEPO-D (truncated or TPO153). The pertinent features of these plasmids are presented in Fig. 23 and 24.
  • Example 20 The transfection procedures are described in Example 20. Briefly, cDNA corresponding to the entire open reading frame of TPO was obtained by PCR. The PCR product was purified and cloned between two restriction sites (Clal and Sail) of the plasmid pSVI5.ID.LL to obtain the vector pSVI5.ID.LL.MLORF. A second construct corresponding to the EPO homologous domain was generated the same way but using a different reverse primer(EPOD.Sal). The final construct for the vector coding for the EPO homologous domain of TPO is called pSVI5.ID.LL.MLEPO-D.
  • Example 20 The process for purifying and isolating TPO from harvested CHO cell culture fluid is described in Example 20. Briefly, harvested cell culture fluid (HCCF) is applied to a Blue Sepharose column (Phamacia) at a ratio of approximately 100L of HCCF per liter of resin. The column is then washed with 3 to 5 column volumes of buffer followed by 3 to 5 column volumes of a buffer containing 2.0M urea. TPO is then eluted with 3 to 5 column volumes of buffer containing both 2.0M urea and 1.0M NaCl.
  • HCCF harvested cell culture fluid
  • Phamacia Blue Sepharose column
  • TPO is then eluted with 3 to 5 column volumes of buffer containing both 2.0M urea and 1.0M NaCl.
  • the Blue Sepharose eluate pool containing TPO is then applied to a Wheat Germ Lectin Sepharose column (Pharmacia) equilibrated in the Blue Sepharose eluting buffer at a ratio of from 8 to 16 ml of Blue Sepharose eluate per ml of resin.
  • the column is then washed with 2 to 3 column volumes of equilibration buffer.
  • TPO is then eluted with 2 to 5 column volumes of a buffer containing 2.0M urea and 0.5M N- acetyl-D-glucosamine.
  • the Wheat Germ Lectin eluate containing TPO is then acidified and Ci 2 E 8 - s added to a final concentration of 0.04%.
  • the resulting pool is applied to a C4 reversed phase column equilibrated in 0.1% TFA, 0.04% C12E8 at a load of approximately 0.2 to 0.5 mg protein per ml of resin.
  • the protein is eluted in a two phase linear gradient of acetonitrile containing 0.1% TFA and 0.04% C12E8 and a pool is made on the basis of SDS-PAGE.
  • the C4 Pool is then diluted and diafilitered versus approximately 6 volumes of buffer on an Amicon YM or like ultrafiltration membrane having a 10,000 to 30,000 Dalton molecular weight cut-off.
  • the resulting diafiltrate may be then directly processed or further concentrated by ultrafiltration.
  • the diafiltrate/concentrate is usually adjusted to a final concentration of 0.01% Tween-80.
  • plasmids pMP21 , pMP151 , pMP41 , pMP57 and pMP202 were all designed to express the first 155 amino acids of TPO downstream of a small leader which varies among the different constructs.
  • the leaders provide primarily for high level translation initiation and rapid purification.
  • the plasmids pMP210-1 , -T8, -21 , -22, -24, -25 are designed to express the first 153 amino acids of TPO downstream of an initiation methionine and differ only in the codon usage for the first 6 amino acids of TPO, while the plasmid pMP251 is a derivative of pMP210-1 in which the carboxy-terminal end of TPO is extended by two amino acids.
  • All of the above plasmids will produce high levels of intraceliular expression of TPO in E. coli upon induction of the tryptophan promoter (Yansura, D. G. et. al. Methods in Enzymology ( Goeddel, D. V., Ed.) 185:54-60, Academic Press, San Diego [1990]).
  • the plasmids pMP1 and pMP172 are intermediates in the construction of the above TPO intraceliular expression plasmids.
  • TPO expression plasmids were used to transform the E. coli using the CaCl2 heat shock method (Mandel, M. et al. J. Mol. Biol., 53:159-162, [1970]) and other procedures described in Example 21. Briefly, the transformed cells were grown first at 37°C until the optical density (600nm) of the culture reached approximately 2-3. The culture was then diluted and, after growth with aeration, acid was added. The culture was then allowed to continue growing with aeration for another 15 hours after which time the cells were harvested by centrifugation.
  • CaCl2 heat shock method Mondel, M. et al. J. Mol. Biol., 53:159-162, [1970]
  • a microorganism such as E. coli expressing TPO encoded by any suitable plasmid is fermented under conditions in which TPO is deposited in insoluble "retractile bodies".
  • cells are first washed in a cell disruption buffer.
  • a preferred reducing agent is dithiothreitol (DTT).
  • the solubilizing buffer may contain a mild oxidizing agent (e.g. molecular oxygen) and a sulfite salt to form monomeric TPO via sulfitolysis.
  • a mild oxidizing agent e.g. molecular oxygen
  • a sulfite salt to form monomeric TPO via sulfitolysis.
  • the resulting TPO-S-sulfonate is later refolded in the presence of the redox buffer (e.g. GSH/GSSG) to form the properly folded TPO.
  • Refolding yields of 40-60% are typical for preparations of TPO that have been purified through the first C4 step.
  • Active material can be obtained when less pure preparations (e.g. directly after the Superdex 200 column or after the initial retractile body extraction) although the yields are less due to extensive precipitation and interference of non-TPO proteins during the TPO refolding process.
  • the disulfide pattern for the biologically active TPO has been determined to be 1-4 and 2-3 by mass spectrometry and protein sequencing, where the cysteines are numbered sequentially from the amino-terminus. This cysteine cross-linking pattern is consistent with the known disulfide bonding pattern of the related molecule erythropoietin.
  • Refolded and purified TPO has activity in both in vitro and in vivo assays.
  • the Ba/F3 assay half-maximal stimulation of thymidine incorporation into the Ba/F3 cells for TPO (Met" 1 1-153) was achieved at 3.3 pg /ml (0.3 pM).
  • the mpl receptor-based ELISA half-maximal activity occurred at 1.9 ng/ml (120 pM).
  • refolded TPO (Met" 1 1-153) was highly potent (activity was seen at doses as low as 30 ng/mouse) to stimulate the production of new platelets. Similar biological activity was observed for other forms of TPO refolded in accordance with the above described procedures (see Figs. 25, 26 and 28).
  • Thrombopoietic activity may be measured in various assays including the Ba/F3 mpl iigand assay described in Example 1 , an in vivo mouse platelet rebound synthesis assay, induction of platelet cell surface antigen assay as measured by an anti-platelet immunoassay (anti-GPIIbllla) or a human leukemia megakaryoblastic cell line (CMK) (see Sato et al., Brit. J.
  • Maturation of megakaryocytes from immature, largely non-DNA synthesizing cells, to morphologically identifiable megakaryocytes involves a process that includes appearance of cytoplasmic organelles, acquisition of membrane antigens (GPIIbllla)- endoreplication and release of platelets as described in the background.
  • a lineage specific promoter (i.e., the mpl ligand) of megakaryocyte maturation would be expected to induce at least some of these changes in immature megakaryocytes leading to platelet release and alleviation of thrombocytopenia.
  • assays were designed to measure the emergence of these parameters in immature megakaryocyte cell lines, i.e., CMK and DAMI cells.
  • the CMK assay (Example 4) measures the appearance of a specific platelet marker, GPIIbllla. and platelet shedding.
  • the DAMI assay (Example 15) measures endoreplication since increases in ploidy are hallmarks of mature megakaryocytes.
  • Recognizable megakaryocytes have ploidy values of 2N, 4N, 8N, 16N, 32N, etc.
  • the in vivo mouse platelet rebound assay (Example 16) is useful in demonstrating that administration of the test compound (here the mpl ligand) results in elevation of platelet numbers.
  • kinase receptor activation (KIRA) ELISA in which CHO cells are transfected with a mpl-Rse chimera and tyrosine phosphorylation of Rse is measured by ELISA after exposure of the mpl portion of the chimera to mpl ligand (see Example
  • the second is a receptor based ELISA in which ELISA plate coated rabbit anti- human IgG captures human chimeric receptor mpMgG which binds the mpl ligand being assayed.
  • a biotinylated rabbit polyclonal antibody to mpl iigand (TPO155) is used to detect bound mpl ligand which is measured using streptavidin-peroxidase as described in Example 18.
  • mice Both normal and sublethally irradiated mice were treated with truncated and full length TPO isolated from Chinese hamster ovary (CHO) cells, E. coli, and human embryonic kidney (293) cells. Both forms of TPO produced in these three hosts stimulated platelet production in mice, however, full length TPO isolated from CHO apeared to produce the greatest in vivo response. These results indicate that proper glycosylation of the carboxy-terminal domain may be necessary for optimal in vivo activity.
  • CHO Chinese hamster ovary
  • E. coli E. coli
  • the "Met” form of the EPO domain (Met in the -1 position plus the first 153 residues of human TPO) produced in E. coli (see Example 23) was injected daily into normal female C57 B6 mice as described in the legends to Figs. 25A, 25B and 25C.
  • These figures show that the non-glycosylated truncated form of TPO produced in E. coli and refolded as described above is capable of stimulating about a two-fold increase in platelet production in normal mice with out effecting the red or white blood cell population.
  • 70 Kda form has the greatest in vivo activity.
  • the DNA encoding mpl ligand polypeptide may be obtained from any cDNA library prepared from tissue believed to possess the mpl ligand mRNA and to express it at a detectable level.
  • the mpl ligand gene may also be obtained from a genomic DNA library or by in vitro oligonucleotide synthesis from the complete nucleotide or amino acid sequence. Libraries are screened with probes designed to identify the gene of interest or the protein encoded by it. For cDNA expression libraries, suitable probes include monoclonal or polyclonal antibodies that recognize and specifically bind to the mpl ligand.
  • a preferred method of practicing this invention is to use carefully selected oligonucleotide sequences to screen cDNA libraries from various tissues, preferably human or porcine kidney (adult or fetal) or Iiver cell lines.
  • tissues preferably human or porcine kidney (adult or fetal) or Iiver cell lines.
  • human fetal liver cell line cDNA libraries are screened with the oligonucleotide probes.
  • human genomic libraries may be screened with the oligonucleotide probes.
  • the oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized.
  • the actual nucleotide sequence(s) is usually designed based on regions of the mpl ligand which have the least codon redundancy.
  • the oligonucleotides may be degenerate at one or more positions. The use of degenerate oligonucleotides is of particular importance where a library is screened from a species in which preferential codon usage is not known. The oligonucleotide must be labeled such that it can be detected upon hybridization to DNA in the library being screened.
  • the preferred method of labeling is to use ATP (e.g., 32 ?) and polynucleotide kinase to radiolabel the 5' end of the oligonucleotide.
  • ATP e.g., 32
  • polynucleotide kinase to radiolabel the 5' end of the oligonucleotide.
  • other methods may be used to label the oligonucleotide, including, but not limited to, biotinylation or enzyme labeling.
  • the mpl ligand nucleic acid that encodes a full-length mpl ligand polypeptide.
  • the nucleic acid sequence includes the native mpl ligand signal sequence. Nucleic acid having all the protein coding sequence is obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence.
  • Amino acid sequence variants of mpl ligand are prepared by introducing appropriate nucleotide changes into the mpl ligand DNA, or by in vitro synthesis of the desired mpl ligand polypeptide.
  • Such variants include, for example, deletions from, or insertions or substitutions of, residues within the amino acid sequence for the porcine mpl ligand.
  • carboxy terminus portions of the mature full length mpl ligand may be removed by proteolytic cleavage, either in vivo or in vitro, or by cloning and expressing a fragment or the DNA encoding full length mpl ligand to produce a biologically active variant.
  • any combination of deletion, insertion, and substitution is made to arrive at the final construct, provided that the final construct possesses the desired biological activity.
  • the amino acid changes also may alter post- translational processes of the mpl ligand, such as changing the number or position of glycosylation sites.
  • the location of the mutation site and the nature of the mutation will depend on the mpl ligand characteristic(s) to be modified.
  • the sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting residues of the same or a different class adjacent to the located site, or combinations of options 1-3.
  • a useful method for identification of certain residues or regions of the mpl ligand polypeptide that are preferred locations for mutagenesis is called “alanine scanning mutagenesis," as described by Cunningham and Wells, Science, 244:1081 - 1085 [1989].
  • a residue or group of target residues are identified (e.g., charged residues such as arg, asp, his, lys, and glu) and replaced by any, but preferably a neutral or negatively charged, amino acid (most preferably alanine or polyalanine) to affect the interaction of the amino acids with the surrounding aqueous environment in or outside the cell.
  • Those domains demonstrating functional sensitivity to the substitutions then are refined by introducing further or other variants at or for the sites of substitution.
  • site for introducing an amino acid sequence variation is predetermined, the nature of the mutation per se need not be predetermined. For example, to optimize the performance of a mutation at a given site, ala scanning or random mutagenesis is conducted at the target codon or region and the expressed mpl ligand variants are screened for the optimal combination of desired activity.
  • variants of the mpl ligand polypeptide include variants from the mpl ligand sequence, and may represent naturally occurring alleles (which will not require manipulation of the mpl ligand DNA) or predetermined mutant forms made by mutating the DNA, either to arrive at an allele or a variant not found in nature.
  • location and nature of the mutation chosen will depend upon the mpl ligand characteristic to be modified.
  • Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues, and typically are contiguous.
  • amino acid sequence deletions for the mpl ligand may include a portion of or the entire carboxy-terminus glycoprotein domain.
  • Amino acid sequence deletions may also include one or more of the first 6 amino-terminus residues of the mature protein.
  • Optional amino acid sequence deletions comprise one or more residues in one or more of the loop regions that exist between the 'helical bundels". Contiguous deletions ordinarily are made in even numbers of residues, but single or odd numbers of deletions are within the scope hereof.
  • Deletions may be introduced into regions of low homology among the mpl ligands that share the most sequence identity to modify the activity of the mpl ligand.
  • deletions may be introduced into regions of low homology among human mpl ligand and other mammalian mpl ligand polypeptides that share the most sequence identity to the human mpl ligand.
  • Deletions from a mammalian mpl ligand polypeptide in areas of substantial homology with other mammalian mpl ligands will be more likely to modify the biological activity of the mpl iigand more significantly.
  • the number of consecutive deletions will be selected so as to preserve the tertiary structure of mpl ligands in the affected domain, e.g., beta-pleated sheet or alpha helix.
  • Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues.
  • Intrasequence insertions i.e., insertions within the mature mpl ligand sequence
  • An exemplary preferred fusion is that of mpl ligand or fragment thereof and another cytokine or fragment thereof.
  • terminal insertions include mature mpl ligand with an N-terminal methionyl residue, an artifact of the direct expression of mature mpl ligand in recombinant cell culture, and fusion of a heterologous N-terminal signal sequence to the N-terminus of the mature mpl ligand molecule to facilitate the secretion of mature mpl ligand from recombinant hosts.
  • signal sequences generally will be obtained from, and thus homologous to, the intended host cell species. Suitable sequences include STII or Ipp for E. coli, alpha factor for yeast, and viral signals such as herpes gD for mammalian cells.
  • insertional variants of the mpl ligand molecule include the fusion to the N- or C-terminus of mpl ligand of immunogenic polypeptides (i.e., not endogenous to the host to which the fusion is administered), e.g., bacterial polypeptides such as beta- lactamase or an enzyme encoded by the E. coli trp locus, or yeast protein, and C- terminal fusions with proteins having a long half-life such as immunoglobulin constant regions (or other immunoglobulin regions), albumin, or ferritin, as described in WO 89/02922 published 6 April 1989.
  • a third group of variants are amino acid substitution variants.
  • These variants have at least one amino acid residue in the mpl ligand molecule removed and a different residue inserted in its place.
  • the sites of greatest interest for substitutional mutagenesis include sites identified as the active site(s) of mpl ligand and sites where the amino acids found in other analogues are substantially different in terms of side- chain bulk, charge, or hydrophobicity, but where there is also a high degree of sequence identity at the selected site among various mpl ligand species and/or within the various animal analogues of one mpl ligand member.
  • sites of interest are those in which particular residues of the mpl ligand obtained from various family members and/or animal species within one member are identical. These sites, especially those falling within a sequence of at least three other identically conserved sites, are substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 3 under the heading of preferred substitutions. If such substitutions result in a change in biological activity, then more substantial changes, denominated exemplary substitutions in Table 3, or as further described below in reference to amino acid classes, are introduced and the products screened.
  • the alternative method involves two or more rounds of mutagenesis to produce the desired mutant.
  • the first round is as described for the single mutants: wild-type DNA is used for the template, an oligonucleotide encoding the first desired amino acid substitution (s) is annealed to this template, and the heteroduplex DNA molecule is then generated.
  • the second round of mutagenesis utilizes the mutated DNA produced in the first round of mutagenesis as the template.
  • this template already contains one or more mutations.
  • the oligonucleotide encoding the additional desired amino acid substitution(s) is then annealed to this template, and the resulting strand of DNA now encodes mutations from both the first and second rounds of mutagenesis.
  • This resultant DNA can be used as a template in a third round of mutagenesis, and so on.
  • PCR mutagenesis is also suitable for making amino acid variants of mpl ligand polypeptide. While the following discussion refers to DNA, it is understood that the technique also finds application with RNA.
  • the PCR technique generally refers to the following procedure (see Erlich, supra, the chapter by R. Higuchi, p. 61-70): When small amounts of template DNA are used as starting material in a PCR, primers that differ slightly in sequence from the corresponding region in a template DNA can be used to generate relatively large quantities of a specific DNA fragment that differs from the template sequence only at the positions where the primers differ from the template.
  • sequence of the second primer is located within 200 nucleotides from that of the first, such that in the end the entire amplified region of DNA bounded by the primers can be easily sequenced.
  • PCR amplification using a primer pair like the one just described results in a population of DNA fragments that differ at the position of the mutation specified by the primer, and possibly at other positions, as template copying is somewhat error-prone.
  • Thermus aquaticus (Taq) DNA polymerase (5 units/ ⁇ l, purchased from Perkin-Elmer Cetus) is added below the mineral oil layer.
  • the reaction mixture is then inserted into a DNA Thermal Cycler (purchased from Perkin-Elmer Cetus) programmed as follows:
  • the starting material is the plasmid (or other vector) comprising the mpl ligand DNA to be mutated.
  • the codon(s) in the mpl ligand DNA to be mutated are identified.
  • the plasmid is cut at these sites to linearize it.
  • a double-stranded oligonucleotide encoding the sequence of the DNA between the restriction sites but containing the desired mutation(s) is synthesized using standard procedures. The two strands are synthesized separately and then hybridized together using standard techniques.
  • This double-stranded oligonucleotide is referred to as the cassette.
  • This cassette is designed to have 3' and 5' ends that are compatible with the ends of the linearized plasmid, such that it can be directly ligated to the plasmid.
  • This plasmid now contains the mutated mpl ligand DNA sequence.
  • nucleic Acid e.g., cDNA or genomic DNA
  • a replicable vector for further cloning (amplification of the DNA) or for expression.
  • Many vectors are available, and selection of the appropriate vector will depend on (1) whether it is to be used for DNA amplification or for DNA expression, (2) the size of the nucleic acid to be inserted into the vector, and (3) the host cell to be transformed with the vector.
  • Each vector contains various components depending on its function (amplification of DNA or expression of DNA) and the host cell with which it is compatible.
  • the vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence.
  • the mpl ligand of this invention may be expressed not only directly, but also as a fusion with a heterologous polypeptide, preferably a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide.
  • the signal sequence may be a component of the vector, or it may be a part of the mpl ligand DNA that is inserted into the vector.
  • the heterologous signal sequence selected should be one that is recognized and processed (i.e., cleaved by a signal peptidase) by the host cell.
  • the signal sequence is substituted by a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, Ipp, or heat-stable enterotoxin II leaders.
  • a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, Ipp, or heat-stable enterotoxin II leaders.
  • yeast secretion the native signal sequence may be substituted by, e.g., the yeast invertase, alpha factor, or acid phosphatase leaders, the C. albicans glucoamylase leader (EP
  • the native signal sequence i.e., the mpl ligand presequence that normally directs secretion of mpl ligand from its native mammalian cells in vivo
  • the native signal sequence i.e., the mpl ligand presequence that normally directs secretion of mpl ligand from its native mammalian cells in vivo
  • signal sequences from other mpl ligand polypeptides or from the same mpl ligand from a different animal species signal sequences from a mpl ligand, and signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders, for example, the herpes simplex gD signal.
  • Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells.
  • this sequence is one that enables the vector to replicate independently of the host chromosomal DNA, and includes origins of replication or autonomously replicating sequences.
  • origins of replication or autonomously replicating sequences are well known for a variety of bacteria, yeast, and viruses.
  • the origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2 ⁇ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells.
  • the origin of replication component is not needed for mammalian expression vectors (the SV40 origin may typically be used only because it contains the early promoter).
  • Most expression vectors are "shuttle" vectors, i.e., they are capable of replication in at least one class of organisms but can be transfected into another organism for expression.
  • a vector is cloned in E. coli and then the same vector is transfected into yeast or mammalian cells for expression even though it is not capable of replicating independently of the host cell chromosome.
  • DNA may also be amplified by insertion into the host genome. This is readily accomplished using Bacillus species as hosts, for example, by including in the vector a
  • Selection genes should contain a selection gene, also termed a selectable marker. This gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with the vector containing the selection gene will not survive in the culture medium.
  • Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
  • One example of a selection scheme utilizes a drug to arrest growth of a host cell.
  • Those cells that are successfully transformed with a heterologous gene express a protein conferring drug resistance and thus survive the selection regimen.
  • Examples of such dominant selection use the drugs neomycin (Southern et al., J. Molec. Appl. Genet., 1 :327 [1982]) mycophenolic acid (Mulligan et al., Science, 209: 1 422 [1980]) or hygromycin Sugden et al., Mol. Cell. Biol., 5:410-413 [1985]).
  • the three examples given above employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid), or hygromycin, respectively.
  • Suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the mpl ligand nucleic acid, such as dihydrofolate reductase (DHFR) or thymidine kinase.
  • DHFR dihydrofolate reductase
  • the mammalian cell transformants are placed under selection pressure that only the transformants are uniquely adapted to survive by virtue of having taken up the marker. Selection pressure is imposed by culturing the transformants under conditions in which the concentration of selection agent in the medium is successively changed, thereby leading to amplification of both the selection gene and the DNA that encodes mpl ligand polypeptide.
  • Amplification is the process by which genes in greater demand for the production of a protein critical for growth are reiterated in tandem within the chromosomes of successive generations of recombinant cells. Increased quantities of mpl ligand are synthesized from the amplified DNA.
  • cells transformed with the DHFR selection gene are first identified by culturing all of the transformants in a culture medium that contains methotrexate (Mtx), a competitive antagonist of DHFR.
  • Mtx methotrexate
  • An appropriate host cell when wild-type DHFR is employed is the Chinese hamster ovary (CHO) cell line deficient in DHFR activity, prepared and propagated as described by Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216 [1980].
  • the transformed cells are then exposed to increased levels of Mtx. This leads to the synthesis of multiple copies of the DHFR gene, and, concomitantly, multiple copies of other DNA comprising the expression vectors, such as the DNA encoding mpl ligand.
  • This amplification technique can be used with any otherwise suitable host, e.g., ATCC No. CCL61 CHO-K1 , notwithstanding the presence of endogenous DHFR if, for example, a mutant DHFR gene that is highly resistant to Mtx is employed (EP 117,060).
  • Promoter Component Expression and cloning vectors usually contain a promoter that is recognized by the host organism and is operably linked to the mpl ligand nucleic acid. Promoters are untranslated sequences located upstream (5') to the start codon of a structural gene (generally within about 100 to 1000 bp) that control the transcription and translation of particular nucleic acid sequence, such as the mpl ligand nucleic acid sequence, to which they are operably linked. Such promoters typically fall into two classes, inducible and constitutive.
  • Inducible promoters are promoters that initiate increased levels of transcription from DNA under their control in response to some change in culture conditions, e.g., the presence or absence of a nutrient or a change in temperature. At this time a large number of promoters recognized by a variety of potential host cells are well known. These promoters are operably linked to mpl ligand encoding DNA by removing the promoter from the source DNA by restriction enzyme digestion and inserting the isolated promoter sequence into the vector. Both the native mpl ligand promoter sequence and many heterologous promoters may be used to direct amplification and/or expression of the mpl ligand DNA. However, heterologous promoters are preferred, as they generally permit greater transcription and higher yields of expressed mpl iigand as compared to the native mpl ligand promoter.
  • Another sequence found 70 to 80 bases upstream from the start of transcription of many genes is a CXCAAT region where X may be any nucleotide.
  • X may be any nucleotide.
  • At the 3' end of most eukaryotic genes is an AATAAA sequence that may be the signal for addition of the poly A tail to the 3' end of the coding sequence. All of these sequences are suitably inserted into eukaryotic expression vectors.
  • Suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem., 255:2073 [1980]) or other glycolytic enzymes (Hess et al., J. Adv.
  • enolase such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phospho
  • Mpl ligand transcription from vectors in mammalian host ceils is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,211 ,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and most preferably Simian Virus 40 (SV40), from heterologous mammalian promoters, e.g., the actin promoter or an immunoglobulin promoter, from heat-shock promoters, and from the promoter normally associated with the mpl ligand sequence, provided such promoters are compatible with the host cell systems.
  • viruses such as polyoma virus, fowlpox virus (UK 2,211 ,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papillom
  • Transient Expression Vectors Particularly useful in the practice of this invention are expression vectors that provide for the transient expression in mammalian cells of DNA encoding the mpl iigand polypeptide.
  • transient expression involves the use of an expression vector that is able to replicate efficiently in a host cell, such that the host cell accumulates many copies of the expression vector and, in turn, synthesizes high levels of a desired polypeptide encoded by the expression vector.
  • Transient expression systems comprising a suitable expression vector and a host cell, allow for the convenient positive identification of polypeptides encoded by cloned DNAs, as well as for the rapid screening of such polypeptides for desired biological or physiological properties.
  • transient expression systems are particularly useful in the invention for purposes of identifying analogues and variants of mpl ligand polypeptide that have mpl ligand polypeptide biological activity.
  • filamentous fungi such as, e.g, Neurospora, Penicillium, Tolypocladium (WO 91/00357 published 10 January 1991), and Aspergillus hosts such as A. nidulans (Ballance et al., Biochem. Biophys. Res. Commun., 112:284-289 [1983]; Tilburn et al., Gene, 26:205-221 [1983]; Yelton et al., Proc. Natl. Acad. Sci. USA, 81 :1470-1474 [1984]) and A. niger (Kelly and Hynes, EMBO J., 4:475-479 [1985]).
  • Suitable host cells for the expression of glycosylated mpl ligand are derived from multicellular organisms. Such host cells are capable of complex processing and glycosylation activities. In principle, any higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture. Examples of invertebrate cells include plant and insect cells. Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruitfly), and Bombyx mori have been identified.
  • DNA segments isolated from the upstream region of the T-DNA 780 gene are capable of activating or increasing transcription levels of plant-expressible genes in recombinant DNA-containing plant tissue.
  • EP 321 ,196 published 21 June 1989.
  • interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years (Tissue Culture, Academic Press, Kruse and Patterson, editors [1973]).
  • Examples of useful mammalian host cell lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 [1977]); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cellsADHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216 [1980]); mouse sertoli cells (TM4, Mather, Biol.
  • monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat Iiver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human Iiver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N.Y. Acad. Sci., 383:44-68 [1982]); MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2).
  • Host cells are transfected and preferably transformed with the above-described expression or cloning vectors of this invention and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
  • Transfection refers to the taking up of an expression vector by a host cell whether or not any coding sequences are in fact expressed. Numerous methods of transfection are known to the ordinarily skilled artisan, for example, CaP ⁇ 4 and electroporation. Successful transfection is generally recognized when any indication of the operation of this vector occurs within the host cell.
  • Prokaryotic cells used to produce the mpl ligand polypeptide of this invention are cultured in suitable media as described generally in Sambrook et al., supra.
  • the mammalian host cells used to produce the mpl ligand of this invention may be cultured in a variety of media.
  • Commercially available media such as Ham's F10 (Sigma), Minimal Essential Medium ([MEM], Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium ([DMEM], Sigma) are suitable for culturing the host cells.
  • any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleosides (such as adenosine and thymidine), antibiotics (such as GentamycinTM drug), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art.
  • the culture conditions such as temperature, pH, and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the host cells referred to in this disclosure encompass cells in in vitro culture as well as cells that are within a host animal.
  • the biotin then serves as the site for binding to avidin or antibodies, which may be labeled with a wide variety of labels, such as radionuclides, fluorescers, enzymes, or the like.
  • antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.
  • the antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
  • Gene expression may be measured by immunological methods, such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
  • immunohistochemical staining techniques a cell sample is prepared, typically by dehydration and fixation, followed by reaction with labeled antibodies specific for the gene product coupled, where the labels are usually visually detectable, such as enzymatic labels, fluorescent labels, luminescent labels, and the like.
  • a particularly sensitive staining technique suitable for use in the present invention is described by Hsu et al., Am. J. Clin. Path., 75:734-738 [1980].
  • Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native mpl ligand polypeptide or against a synthetic peptide based on the DNA sequences provided herein as described further below.
  • Mpl ligand preferably is recovered from the culture medium as a secreted polypeptide, although it also may be recovered from host cell lysates when directly expressed without a secretory signal.
  • the mpl ligand When mpl ligand is expressed in a recombinant cell other than one of human origin, the mpl ligand is completely free of proteins or polypeptides of human origin. However, it is still usually necessary to purify mpl iigand from other recombinant cell proteins or polypeptides to obtain preparations that are substantially homogeneous as to the mpl ligand per se.
  • the culture medium or lysate is centrifuged to remove particulate cell debris. The membrane and soluble protein fractions are then separated.
  • a commercially available protein concentration filter e.g., Amicon or Millipore Pellicon ultrafiltration units
  • the mpl ligand may then be purified from the soluble protein fraction and from the membrane fraction of the culture lysate, depending on whether the mpl ligand is membrane bound. Mpl ligand thereafter is purified from contaminant soluble proteins and polypeptides by salting out and exchange or chromatographic procedures employing various gel matrices. These matrices include; acrylamide, agarose, dextran, cellulose and others common to protein purification.
  • Exemplary chromatography procedures suitable for protein purification include; immunoaffinity (e.g., anti-hmp/ ligand Mab), receptoraffinity (e.g., mpMgG or protein A Sepharose), hydrophobic interaction chromatography (HIC) (e.g., ether, butyl, or phenyl Toyopearl), lectin chromatography (e.g., Con A-Sepharose, lentil-lectin-Sepharose), size exclusion (e.g., Sephadex G-75), cation- and anion-exchange columns (e.g., DEAE or carboxymethyl- and sulfopropyl-cellulose), and reverse-phase high performance liquid chromatography (RP-HPLC) (see e.g., Urdal et al., J.
  • immunoaffinity e.g., anti-hmp/ ligand Mab
  • receptoraffinity e.g., mpMgG or protein A Sepharose
  • HIC
  • Mpl ligand variants in which residues have been deleted, inserted, or substituted are recovered in the same fashion as native mpl iigand, taking account of any substantial changes in properties occasioned by the variation.
  • preparation of a mpl ligand fusion with another protein or polypeptide e.g., a bacterial or viral antigen, facilitates purification; an immunoaffinity column containing antibody to the antigen can be used to adsorb the fusion polypeptide.
  • Immunoaffinity columns such as a rabbit polyclonal anti-mp/ ligand column can be employed to absorb the mpl ligand variant by binding it to at least one remaining immune epitope.
  • the mpl ligand may be purified by affinity chromatography using a purified mp/-lgG coupled to a (preferably) immobilized resin such as Affi-Gel 10 (Bio-Rad, Richmond, CA) or the like, by means well known in the art.
  • a protease inhibitor such as phenyl methyl sulfonyl fluoride (PMSF) also may be useful to inhibit proteolytic degradation during purification, and antibiotics may be included to prevent the growth of adventitious contaminants.
  • purification methods suitable for native mpl ligand may require modification to account for changes in the character of mpl ligand or its variants upon expression in recombinant cell culture.
  • mpl ligand polypeptides Covalent modifications of mpl ligand polypeptides are included within the scope of this invention. Both native mpl ligand and amino acid sequence variants of the mpl ligand may be covalently modified.
  • One type of covalent modification included within the scope of this invention is a mpl ligand fragment.
  • Variant mpl ligand fragments having up to about 40 amino acid residues may be conveniently prepared by chemical synthesis or by enzymatic or chemical cleavage of the full-length or variant mpl ligand polypeptide.
  • Cysteinyl residues most commonly are reacted with ⁇ -haloacetates (and corresponding amines), such as chloroacetic acid or chloroacetamide, to give carboxymethyl or carboxyamidomethyl derivatives.
  • Oysteinyl residues also are derivatized by reaction with bromotrifluoroacetone, ⁇ x - b ro m o - ⁇ - ( 5 - imidozoyl)propionic acid, chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2- pyridyl disulfide, methyl 2-pyridyl disulfide, p-chloromercuribenzoate, 2- chloromercuri-4-nitrophenol, or chloro-7-nitrobenzo-2-oxa-1 ,3-diazole.
  • Histidyl residues are derivatized by reaction with diethylpyrocarbonate at pH 5.5-7.0 because this agent is relatively specific for the histidyl side chain.
  • Para- bromophenacyl bromide also is useful; the reaction is preferably performed in 0.1 M sodium cacodylate at pH 6.0.
  • Lysinyl and amino terminal residues are reacted with succinic or other carboxylic acid anhydrides. Derivatization with these agents has the effect of reversing the charge of the lysinyl residues.
  • Arginyl residues are modified by reaction with one or several conventional reagents, among them phenylglyoxal, 2,3-butanedione, 1 ,2-cyclohexanedione, and ninhydrin. Derivatization of arginine residues requires that the reaction be performed in alkaline conditions because of the high pK a of the guanidine functional group. Furthermore, these reagents may react with the groups of lysine as well as the arginine epsilon-amino group.
  • tyrosyl residues may be made, with particular interest in introducing spectral labels into tyrosyl residues by reaction with aromatic diazonium compounds or tetranitromethane.
  • aromatic diazonium compounds or tetranitromethane Most commonly, N-acetylimidizole and tetranitromethane are used to form O-acetyl tyrosyl species and 3-nitro derivatives, respectively.
  • Tyrosyl residues are iodinated using 1 25
  • R and R' are different alkyl groups, such as 1 -cyclohexyl-3-(2-morpholinyl-4-ethyl)carbodiimide or 1 - ethyl-3-(4-azonia-4,4-dimethylpentyl)carbodiimide.
  • aspartyl and glutamyl residues are converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.
  • Derivatization with bifunctional agents is useful for crosslinking mpl ligand to a water-insoluble support matrix or surface for use in the method for purifying anti- mpl ligand antibodies, and vice versa.
  • Commonly used crosslinking agents include, e.g., 1 ,1 -bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifunctional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis(succinimidylpropionate), and bifunctional maleimides such as bis-N-maleimido-1 ,8-octane.
  • Derivatizing agents such as methyl-3-[(p-azidophenyl)dithio]propioimidate yield photoactivatable intermediates that are capable of forming crosslinks in the presence of light.
  • reactive water-insoluble matrices such as cyanogen bromide-activated carbohydrates and the reactive substrates described in U.S. Patent Nos. 3,969,287; 3,691 ,016; 4,195,128; 4,247,642; 4,229,537; and 4,330,440 are employed for protein immobilization.
  • Glutaminyl and asparaginyl residues are frequently deamidated to the corresponding glutamyl and aspartyl residues, respectively. These residues are deamidated under neutral or basic conditions. The deamidated form of these residues falls within the scope of this invention.
  • Other modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the ⁇ -amino groups of lysine, arginine, and histidine side chains (T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, pp. 79-86 [1983]), acetylation of the N-terminal amine, and amidation of any C- terminal carboxyl group.
  • the mpl ligand amino acid sequence is preferably altered through changes at the DNA level, particularly by mutating the DNA encoding the mpl ligand polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids.
  • the DNA mutation(s) may be made using methods described above under the heading of "Amino Acid Sequence Variants of mpl Ligand.”
  • Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo-glycosidases as described by Thotakura et al., Meth. Enzymol., 138:350 [1987].
  • Another type of covalent modification of mpl ligand comprises linking the mpl ligand polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301 ,144; 4,670,417; 4,791 ,192 or 4,179,337.
  • Mpl ligand polypeptides covalently linked to the forgoing polymers are refered to herein as pegylated mpl ligand polypeptides
  • Animals are immunized against the mpl ligand polypeptide or fragment, immunogenic conjugates or derivatives by combining 1 mg of 1 ⁇ g of the peptide or conjugate (for rabbits or mice, respectively) with 3 volumes of Freund's complete adjuvant and injecting the solution intradermally at multiple sites.
  • 1 mg of 1 ⁇ g of the peptide or conjugate for rabbits or mice, respectively
  • 3 volumes of Freund's complete adjuvant injecting the solution intradermally at multiple sites.
  • the animals are boosted with 1/5 to 1/10 the original amount of peptide or conjugate in Freund's complete adjuvant by subcutaneous injection at multiple sites.
  • Seven to 14 days later the animals are bled and the serum is assayed for mpl ligand antibody titer. Animals are boosted until the titer plateaus.
  • the animal boosted with the conjugate of the same mpl ligand, but conjugated to a different protein and/or through a different cross-linking reagent.
  • Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are used to enhance the immune response.
  • Monoclonal antibodies are obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts.
  • the modifier "monoclonal" indicates the character of the antibody as not being a mixture of discrete antibodies.
  • the mpl ligand monoclonal antibodies of the invention may be made using the hybridoma method first described by Kohler & Milstein, Nature, 256:495 [1975], or may be made by recombinant DNA methods (U.S. Patent No. 4,816,567 [Cabilly et al.]).
  • the hybridoma cells thus prepared are seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells.
  • a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells.
  • the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the growth of HGPRT-deficient cells.
  • Preferred myeloma cells are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium.
  • preferred myeloma cell lines are murine myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse tumors available from the Salk Institute Cell Distribution Center, San Diego, California USA, and SP-2 cells available from the American Type Culture Collection, Rockville, Maryland USA.
  • Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133:3001 [1984]; Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp.51-63, Marcel Dekker, Inc., New York, 1 987) .
  • Culture medium in which hybridoma cells are growing is assayed for production of monoclonal antibodies directed against mpl ligand.
  • the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA).
  • RIA radioimmunoassay
  • ELISA enzyme-linked immunoabsorbent assay
  • the binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson & Pollard, Anal. Biochem., 107:220 [1980].
  • the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, supra). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium or RPMI- 1640 medium.
  • the hybridoma cells may be grown in vivo as ascites tumors in an animal.
  • the monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
  • DNA encoding the monoclonal antibodies of the invention is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
  • the hybridoma cells of the invention serve as a preferred source of such DNA.
  • the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.
  • Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein (mpl ligand) to be detected.
  • the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three part complex.
  • the second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti-immunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay).
  • sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme (e.g., horseradish peroxidase).
  • transgenic animals e.g., mice
  • transgenic animals e.g., mice
  • antibody heavy chain joining region
  • Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. Methods for making bispecific antibodies are known in the art.
  • antibody variable domains with the desired binding specificities are fused to immunoglobulin constant domain sequences.
  • the fusion preferably is with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, CH2 and CH3 regions. It is preferred to have the first heavy chain constant region
  • DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain are inserted into separate expression vectors, and are cotransfected into a suitable host organism. This provides for great flexibility in adjusting the mutual proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yields. It is, however, possible to insert the coding sequences for two or all three polypeptide chains in one expression vector when the expression of at least two polypeptide chains in equal ratios results in high yields or when the ratios are of no particular significance.
  • the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. This approach is disclosed in copending application Serial No. 07/931 ,811 filed 17 August 1992.
  • Heteroconjugate antibodies are also within the scope of the present invention.
  • Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Patent No. 4,676,980), and for treatment of HIV infection (PCT publication Nos. WO 91/00360 and WO 92/00373; EP 03089).
  • Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross- linking agents are well known in the art, and are disclosed in U.S. Patent No.
  • the megakaryocytopoietic proteins of the instant invention may be employed alone or in combination with other cytokines, hematopoietins, interleukins, growth factors, or antibodies in the treatment of the above-identified disorders and conditions.
  • the instant compounds may be employed in combination with other protein or peptide having thrombopoietic activity including; G-CSF, GM-CSF, LIF, M-CSF, IL-1 , IL-3, erythropoietin (EPO), kit ligand, IL-6, and IL-11.
  • the megakaryocytopoietic proteins of the instant invention are prepared in a mixture with a pharmaceutically acceptable carrier.
  • This therapeutic composition can be administered intravenously or through the nose or lung.
  • the composition may also be administered parenterally or subcutaneously as desired.
  • the therapeutic composition should be pyrogen-free and in a parenterally acceptable solution having due regard for pH, isotonicity, and stability. These conditions are known to those skilled in the art.
  • dosage formulations of the compounds of the present invention are prepared for storage or administration by mixing the compound having the desired degree of purity with physiologically acceptable carriers, excipients, or stabilizers.
  • sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the polypeptide, which matrices are in the form of shaped articles, e.g., films, or microcapsules.
  • sustained-release matrices include polyesters, hydrogels [e.g., poly(2-hydroxyethyl- methacrylate) as described by Langer et al., J. Biomed. Mater. Res., 15:167-277 [1981] and Langer, Chem. Tech., 1 2 :98-105 [1982] or poly(vinylalcohol)], polylactides (U.S. Patent No.
  • Sustained-release megakaryocytopoietic protein compositions also include liposomally entrapped megakaryocytopoietic protein.
  • Liposomes containing megakaryocytopoietic protein are prepared by methods known per se: DE 3,218,121 ; Epstein et al., Proc. Natl. Acad. Sci. USA, 82:3688-3692 [1985]; Hwang et al., Proc. Natl. Acad. Sci. USA, 77:4030-4034 [1980]; EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641 ; Japanese patent application 83-118008; U.S. Patent Nos.
  • the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. % cholesterol, the selected proportion being adjusted for the optimal megakaryocytopoietic protein therapy.
  • the dosage will be determined by the attending physician taking into consideration various factors known to modify the action of drugs including severity and type of disease, body weight, sex, diet, time and route of administration, other medications and other relevant clinical factors.
  • the daily regimen will range from 0.1-100 ⁇ g/kg body weight.
  • the dosage will range from 0.1- 50 ⁇ g/kg body weight.
  • the initial dosage will range from 1 to 5 ⁇ g/kg/day.
  • the dosage range will be the same as that of other cytokines, especially G-CSF, GM-CSF, and EPO.
  • Therapeutically effective dosages may be determined by either in vitro or in vivo methods.
  • Platelet-poor plasma was collected from normal or aplastic anemic pigs. Pigs were rendered aplastic by irradiation with 900 cGy of total body irradiation using a 4mEV linear accelerator. The irradiated pigs were supported for 6-8 days with intramuscular injections of cefazolin. Subsequently, their total blood volume was removed under general anesthesia, heparinized, and centrifuged at 1800 x g for 30min. to make platelet-poor plasma. The megakaryocyte stimulating activity was found to peak 6 days after irradiation.
  • the eluted protein peak is diluted with dH2 ⁇ to a conductivity of 15mS and loaded onto a Blue-Sepharose column equilibrated (240 ml) in PBS. Subsequently, the column is washed with 5 column volumes each of PBS and 10mM NaP04 (pH 7.4) containing 2M urea. Proteins are eluted from the column with 10mM NaP ⁇ 4 (pH 7.4) containing 2M urea and 1 M NaCl.
  • the eluted protein peak is made 0.01% octyl glucoside(n-octyl ⁇ -D-glucopyranoside) and 1 mM each with EDTA and Pefabloc (Boehinger Mannheim) and loaded directly onto tandemly linked CD4-lgG (Capon, D.J. et al. Nature 337:525-531 [1989]) and mpl-lgG Ultralink (Pierce) columns (see below).
  • the CD4-lgG (2 ml) column is removed after the sample is loaded and the mp/-lgG (4 ml) column is washed with 10 column volumes each of PBS and PBS containing 2 M NaCl and eluted with 0.1 M glycine-HCI pH 2.25. Fractions are collected into 1/10th volume 1 M Tris-HCl (pH 8.0).
  • the cells were selected in 0.4 mg/ml G418 and individual clones were isolated. Mpl- ⁇ gG expression from isolated clones was determined using a human Fc specific ELISA. The best expression clone had an expression level of 1-2 mg/ml of mp/-lgG.
  • IL-3 dependent cell line Ba/F3 by electroporation (1 x 10 7 cells, 9605F, 250Volts).
  • a replica of the gel was made on nitrocellulose as follows: A piece of nitrocellulose was wet with distilled water and carefully laid on top of the exposed gel face so air bubbles were excluded. Fiducial marks were placed on the nitrocellulose and the gel plate so the replica could be accurately repositioned after staining. After approximately 2 minutes, the nitrocellulose was carefully removed, and the gel was wrapped in plastic wrap and placed in the refrigerator. The nitrocellulose was stained with Biorad's gold total protein stain by first agitating it in 3 x 10 ml 0.1% Tween 20 + 0.5 M NaCl + 0.1 M Tris-HCl pH 7.5 over approximately 45 minutes followed by 3 x 10 ml purified water over 5 minutes.
  • the tubes were placed on ice for 1 hour, microfuged at 14K rpm for 3 min. and the supematants carefully removed from the precipitated SDS. The supematants were then placed on ice for approximately 1 hour more and microfuged again for 4 min. The supematants were diluted in phosphate buffered saline and submitted for the activity assay. Remaining samples were frozen at -70°C.
  • EXAMPLE 4 Liquid Suspension Megakaryocytopoiesis Assay Human peripheral stem cells (PSC) (obtained from consenting patients) were diluted 5 fold with IMDM media (Gibco) and centrifuged for 15 min. at room temp, at 800 x g. The cell pellets were resuspended in IMDM and layered onto 60% Percoll (density 1.077 gm/ml ) (Pharmacia) and centrifuged at 800 x g for 30 min.
  • PSC peripheral stem cells
  • oligonucleotides were designed for use as polymerase chain reaction (PCR) primers (see Table 4). Two primer pools were synthesized, a positive sense 20 mer pool encoding amino acid residues 2-8 (mpl 1) and an anti-sense 21-mer pool complimentary to sequences encoding amino acids 18- 24 (mpl 2).
  • PCR polymerase chain reaction
  • Porcine genomic DNA isolated from porcine peripheral blood lymphocytes, was used as a template for PCR.
  • the 50 ⁇ l reaction contained: 0.8 ⁇ g of porcine genomic DNA in 10mM Tris-HCl (pH 8.3), 50mM KCl, 3mM MgCl2, 100 ⁇ g/ml BSA, 400 ⁇ M dNTPs, 1 ⁇ M of each primer pool and 2.5 units of Taq polymerase.
  • Initial template denaturation was at 94°C for 8 min. followed by 35 cycles of 45 seconds at 94°C, 1 min. at 55°C and 1 min. at 72°C. The final cycle was allowed to extend for 10 min. at 72°C.
  • PCR products were separated by electrophoresis on a 12% polyacrylamide gel and visualized by staining with ethidium bromide. It was reasoned that If the amino- terminal amino acid sequence was encoded by a single exon then the correct PCR product was expected to be 69 bp. A DNA fragment of this size was eluted from the gel and subcloned into pGEMT (Promega). Sequences of three clones are shown below in Table 5.
  • pR45 45-mer deoxyoligonucleotide
  • a 2.8 kb BamHI-Xbal fragment that hybridized to the 45-mer was subcloned into pBluescript SK-. Partial DNA sequencing of this clone was preformed using as primers oligonucleotides specific to the porcine mpl ligand DNA sequence. The sequence obtained confirmed that DNA encoding the human homolog of the porcine mpl ligand had been isolated. An EcoRI restriction site was detected in the sequence allowing us to isolate a 390 bp EcoRI-Xbal fragment from the 2.8 kb BamHI-Xbal and to subclone it in pBluescript SK-.
  • EXAMPLE 7 Full Length Human mpl Ligand cDNA Based on the human "exon 3" sequence (Example 6) two non-degenerate oligonucleotides corresponding to the 3' and 5' ends of the "exon 3" sequence were synthesized (Table 6).
  • HL1151x was screened with the same 45 mer oligonucleotide used to screen the human genomic library.
  • the oligonucleotide was labelled with ( ⁇ PJ-ATP using T4 polynucleotide kinase.
  • the library was screened under low stringency hybridization conditions. The filters were prehybridized for 2hr then hybridized with the probe overnight at 42°C in 20% formamide, 5xSSC, lOxDenhardt's, 0.05M sodium phosphate (pH 6.5), 0.1% sodium pyrophosphate, 50 ⁇ g/ml of sonicated salmon sperm DNA for 16hr.
  • DNA sequence was determined with three different classes of template derived from the plasmid pDR2-FL2b. DNA sequencing of double-stranded plasmid DNA was carried out with the ABI373 (Applied Biosystems, Foster City, California) automated fluorescent DNA sequencer using standard protocols for dye-labeled dideoxy nucleoside triphosphate terminators (dye-terminators) and custom synthesized walking primers (Sanger et al., Proc. Natl. Acad. Sci. USA, 74:5463-5467 [1977]; Smith et al., Nature, 321 :674-679 [1986]).
  • ABI373 Applied Biosystems, Foster City, California
  • hML-2 and hML-3 showed no detectable activity in this assay, however the activity of hML(R153A, R154A) was similar to hML indicating that processing at this di-basic site is not required for activity (see Fig. 13) .
  • EXAMPLE 12 Murine mpl Ligand cDNA mML, mML-2 and mML-3
  • DP12.CHO cells (EP 307,247 published 1 ⁇ March 1989) were electroporated with pSV.ID.M.tmRd ⁇ which had been linearized at a unique Notl site in the plasmid backbone.
  • the DNA was ethanol precipitated after phenol/chloroform extraction and ⁇ was resuspended in 20 ⁇ l 1/10 Tris EDTA. Then, 10 ⁇ g of DNA was incubated with 10 7
  • the anti-gD 5B6 coated plate was washed 6 times with wash buffer (PBS containing 0.05 % Tween-20 and 0.01 % thimerosal) using an automated plate washer (ScanWasher 300, Skatron Instruments, Inc, Sterling, VA). 5 The lysate containing solubilized MPURse.gD from the cell-culture microtiter well was transferred (8 ⁇ ⁇ l/well) to anti-gD 6B6 coated and blocked ELISA well and was incubated for 2 h at room temperature with gentle agitation.
  • wash buffer PBS containing 0.05 % Tween-20 and 0.01 % thimerosal
  • ScanWasher 300 Skatron Instruments, Inc, Sterling, VA
  • ELISA plates were coated with rabbit F(ab')2 anti-human IgG (Fc) in pH 9.6 carbonate buffer at 4°C overnight. Plates were blocked with O. ⁇ % bovine serum albumin in PBS at room temperature for one hour. Fermenter harvest containing the chimeric receptor, mpl- ⁇ gG, was added to the plates and incubated for 2 hours. Twofold serial dilutions (0.39-26 ng/ml) of the standard (TPO332 produced in 293 cells with the concentration determined by quantitative amino acid analysis) and serially diluted samples in 0.6% bovine serum albumin, 0.06% tween 20 were added to the plates and incubated for 2 hours.
  • a cDNA corresponding to the TPO entire open reading frame was obtained by PCR using the following oligonucleotides as primers:
  • PRK ⁇ -hmp/ 1 (described in Example 9) was used as template for the reaction in the presence of pfu DNA polymerase (Stratagene). Initial denaturation was for 7 min. at 94°C followed by 2 ⁇ cycles of amplification (1 min. at 94°C, 1 min. at 55°C and 1 min. at 72°C). Final extension was for 16 min. at 72°C).
  • the PCR product was purified and cloned between the restriction sites Clal and Xbal of the plasmid pRK ⁇ tkneo, a pRK ⁇ derived vector modified to express a neomycin resistance gene under the control of the thymidine kinase promote, to obtain the vector pRK ⁇ tkneo.ORF.
  • a second construct corresponding to the epo homologous domain was generated the same way but using Cla.FL.F as forward primer and the following reverse primer:
  • Arg.STOP.Xba 5'TCTAGATCTAGATCACCTGACGCAGAGGGTGGACC3'
  • rhML332 was found to elute in the 28-30% propanol region of the gradient. By SDS-PAGE the purified rhML332 migrates as a broad band in the 68-80 kDa region of the gel(see Figure 15). 4. Purification of rhMLts3 293-rhML-
  • 53 eluted from the mp/-affinity column was purified to homogeneity using a C4-HPLC column run under the same conditions as described for rhML332.
  • SDS-PAGE the purified rhML-j 53 resolves into 2 major and 2 minor bands with Mr of _18,000-21 ,000(see Figure 15) .
  • EXAMPLE 20 Expression and Purification of TPO from CHO
  • pSVI ⁇ .lD.LL.MLORF full length or hTP0332
  • pSVI ⁇ .lD.LLMLEPO-D truncated or hTPO-153.
  • Fig. 23 and 24 The pertinent features of these plasmids are presented in Fig. 23 and 24.
  • ⁇ PRK ⁇ -h/np/ I (described in Example 7 and 9) was used as template for the reaction in the presence of pfu DNA polymerase (Stratagene). Initial denaturation was for 7 min. at 94°C followed by 26 cycles of amplification (1 min. at 94°C, 1 min. at ⁇ °C and 1 min. at 72°C). Final extension was for 15 min. at 72°C).
  • the PCR product was purified and cloned between the restriction sites Clal and Sail of the 0 plasmid pSVI5.ID.LL to obtain the vector pSVI ⁇ .lD.LL.MLORF.
  • a second construct corresponding to the EPO homologous domain was generated the same way but using Cla.FL.F2 as forward primer and the following reverse primer:
  • the coding sequences for the full length and truncated ligand were introduced into the multiple cloning site of the CHO expression vector pSVI5.ID.LL.
  • This vector contains the SV40 early promoter/enhancer region, a modified splice unit 0 containing the mouse DHFR cDNA, a multiple cloning site for the introduction of the gene of interest (in this case the TPO sequences described) an SV40 polyadenylation signal and origin of replication and the beta-lactamase gene for plasmid selection and amplification in bacteria. 3.
  • the host CHO (Chinese Hamster Ovary) cell line used for the expression of the ⁇ TPO molecules described herein is known as CHO-DP12 (see EP 307,247 published 16 March 1989).
  • This mammalian cell line was clonally selected from a transfection of the parent line (CHO-K1 DUX-B1 1 (DHFR-)- obtained from Dr. Frank Lee of Stanford University with the permission of Dr.L. Chasin) with a vector expressing preproinsulin to obtain clones with reduced insulin requirements.
  • DHFR minus and clones can be selected for the presence of DHFR cDNA vector sequences by growth on medium devoid of nucleoside supplements (glycine, hypoxanthine, and thymidine). This selection system for stably expressing CHO cell lines is commonly used.
  • nucleoside supplements glycine, hypoxanthine, and thymidine.
  • DP12 cells via electroporation (see e.g. Andreason, G.L. J. Tiss. Cult. Meth., 16,66 [1993]) with linearized pSVI ⁇ .lD.LL.MLORF or pSVI ⁇ .lD.LL.MLEPO-D plasmids respectively.
  • Three (3) restriction enzyme reaction mixtures were set up for each plasmid cutting; 10 ⁇ g, 2 ⁇ g and ⁇ O ⁇ g of the vector with the enzyme NOTI by standard 0 molecular biology methods. This restriction site is found only once in the vector in the linearization region 3' and outside the TPO ligand transcription units (see Fig. 23). The 100 ⁇ l reactions were set up for overnight incubation at 37 degrees.
  • DNA mix were incubated together at room temperature for one hour and then transferred to a BRL electroporation chamber. Each reaction mix was then electroporated in a standard BRL electroporation apparatus at 360 volts set at 330 ⁇ F and low capacitance. After electroporation, the cells were allowed to sit in the 5 apparatus for 5 minutes and then on ice for an additional 10 minute incubation period. The electroporated cells were transferred to 60mm cell culture dishes containing 5 ml of standard, complete growth medium for CHO cells (High glucose DMEM-F12 50:50 without glycine supplemented with 1X GHT, 2mM glutamine, and ⁇ % fetal calf serum) and grown overnight in a ⁇ % CO2 cell culture incubator. c. Selection and screening method
  • DHFR selective medium Ham's DMEM-F12, 1 :1 medium described above supplemented with either 2% or 6% dialyzed fetal calf serum but devoid of glycine, hypoxanthine and thymidine this is the standard DHFR selection medium we use.
  • Cells from each 60mm dish were subsequently replated into ⁇ /1 ⁇ 0 mm dishes. Cells were then incubated for 10 to 16 days( with 0 one medium change) at 37 degrees/6% CO2 until clones began to appear and reached sizes amenable to transfer to 96 well dishes.
  • CHO cell clones are expanded and plated in 10cm dishes at 4 6 concentrations of methotrexate (i.e.. ⁇ OnM, 100nM, 200nM and 400nM) at two or three cell numbers (10 ⁇ , 6x106, and 106 cells per dish). These cultures are then incubated at 37 degree/ ⁇ % CO2 until clones are established and amenable to transfer to 96 well dishes for further assay.
  • methotrexate i.e. 600nM, 800 nM, 0 1000nM and 1200nM
  • Banked cells are thawed and the cell population is expanded by standard cell 5 growth methods in either serum free or serum containing medium. After expansion to sufficient cell density, cells are washed to remove spent cell culture media. Cells are then cultured by any standard method including; batch, fed-batch or continuous culture at 26-40 °C, neutral pH, with a dissolved O2 content of at least 6% until the constitutively secreted TPO is accumulated. Cell culture fluid is then separated from the cells by mechanical means such as centrifugation.
  • the Blue Sepharose Pool containing TPO is then applied to a Wheat Germ Lectin Sepharose 6MB column (Pharmacia) equilibrated in 0.01 M Na Phosphate pH7.4, 2.0M urea, and 1.0M NaCl at a ratio of from 8 to 16 ml of Blue Sepharose Pool per ml of resin at flow rate of approximately 60 ml/hr/cm 2 .
  • the column is then washed with 2 to 3 column volumes of equilibration buffer.
  • the TPO is then eluted with 2 to 5 column volumes of 0.01 M Na Phosphate pH7.4, 2.0M urea, 0.6M N-acetyl-D- glucosamine.
  • the C4 Pool is then diluted with 2 volumes of 0.01 M Na Phosphate pH7.4, 0.16M NaCl and diafilitered versus approximately 6 volumes of 0.01 M Na Phosphate pH7.4, 0.16M NaCl on an Amicon YM or like ultrafiltration membrane having a 10,000 to 30,000 Dalton molecular weight cut-off.
  • the resulting diafiltrate may be then directly processed or further concentrated by ultrafiltration.
  • the diafiltrate/concentrate is adjusted to a final concentration of 0.01% Tween-80.
  • the plasmids pMP21 , pMP161 , pMP41 , pMP67 and pMP202 are all designed to express the first 155 amino acids of TPO downstream of a small leader which varies among the different constructs.
  • the leaders provide primarily for high level translation initiation and rapid purification.
  • the plasmids pMP210-1 , -T8, -21 , -22, -24, -2 ⁇ are designed to express the first 163 amino acids of TPO downstream of an initiation methionine and differ only in the codon usage for the first 6 amino acids of TPO, while the plasmid pMP261 is a derivative of pMP210-1 in which the carboxy terminal end of TPO is extended by two amino acids.
  • Plasmid pMP1 Plasmid pMP1
  • the plasmid pMP1 is a secretion vector for the first 155 amino acids of TPO, and was constructed by ligating together 5 fragments of DNA as shown in Fig. 33. The first of these was the vector pPho21 in which the small Mlul-BamHI fragment had been removed.
  • pPho21 is a derivative of phGH1 (Chang, C. N. et. al., Gene 55:189- 196 [1987]) in which the human growth hormone gene has been replaced with the E. coli phoA gene, and a Mlul restriction site has been engineered into the coding sequence for the STII signal sequence at amino acids 20-21.
  • SEQ ID NO: 69 (SEQ ID NO: 70) were preligated with T4-DNA ligase, and second cut with Pstl.
  • the fourth was a 152 base pair Pstl-Haelll fragment from pRK ⁇ hmpll encoding amino acids 104-155 of TPO.
  • the last was a 412 base pair Stul-BamHI fragment from pdh108 containing the lambda to transcriptional terminator as previously described (Scholtissek, S. et. al., NAR 15:3185 [1987]).
  • the plasmid pMP21 is designed to express the first 156 amino acids of TPO with the aid of a 13 amino acid leader comprising part of the STII signal sequence. It was constructed by ligating together three (3) DNA fragments as shown in Fig. 34, the first of these being the vector pV ⁇ G31 in which the small Xbal-SphI fragment had been removed.
  • the vector pVEG31 is a derivative of pHGH207-1 (de Boer, H. A. et. al. , in Promoter Structure and Function (Rodriguez, R. L. and Chamberlain, M. J. , Ed), 462, Praeger, New York [1982]) in which the human growth hormone gene has been replaced by the gene for vascular endothelial growth factor (this identical vector fragment can be obtained from this latter plasmid).
  • the second part in the ligation was a synthetic DNA duplex with the following sequence:
  • the plasmid pMP151 is designed to express the first 165 amino acids of TPO downstream of a leader comprising 7 amino acids of the STII signal sequence, 8 histidines, and a factor Xa cleavage site. As shown in Fig. 35, pMP151 was constructed by ligating together three DNA fragments, the first of these being the previously described vector pVEG31 from which the small Xbal-SphI fragment had been removed. The second was a synthetic DNA duplex with the following sequence:
  • Plasmid pMP202 The plasmid pMP202 is very similar to the expression vector pMP161 with the exception that the factor Xa cleavage site in the leader has been replaced with a thrombin cleavage site. As shown in Fig. 36, pMP202 was constructed by ligating together three DNA fragments. The first of these was the previously described pVEG31 in which the small Xbal-SphI fragment had been removed. The second was a synthetic DNA duplex with the following sequence:
  • the plasmid pMP172 is a secretion vector for the first 153 amino acids of TPO, and is an intermediate for the construction of pMP210. As shown in Fig. 37, pMP172 was prepared by ligating together three DNA fragments, the first of which was the vector pLS32lamB in which the small EcoRI-Hindlll section had been removed. The second was a 946 base pair EcoRI-Hgal fragment from the previously described plasmid pMP1 1 . The last piece was a synthetic DNA duplex with the following sequence:
  • the plasmid pMP210 is designed to express the first 163 amino acids of TPO after a translational initiation methionine.
  • This plasmid was actually made as a bank of plasmids in which the first 6 codons of TPO were randomized in the third position of each codon, and was constructed as shown in Fig. 38 by the ligation of three DNA fragments.
  • the first of these was the previously described vector pVEG31 in which the small Xbal-SphI fragment had been removed.
  • the second was a synthetic DNA dupex shown below treated first with DNA polymerasel (Klenow) followed by digestion with Xbal and Hinfl, and encoding the initation methionine and the randomized first 6 codons of TPO.
  • the third was a 890 base pair Hinfl-Sphl fragment from pMP172 encoding amino acids 19-163 of TPO.
  • the plasmid pMP210 bank of approximately 3700 clones was retransformed onto high tetracycline (50 ⁇ g/ml) LB plates to select out high translational initiation clones (Yansura, D. G. et. al., Methods: A Companion to Methods in Enzymology 4:151- 158 [1992]).
  • Yansura, D. G. et. al. Methods: A Companion to Methods in Enzymology 4:151- 158 [1992]
  • Fig. 39 SEQ ID NOS: 23, 24, 2 ⁇ , 26, 27 and 28.
  • the plasmid pMP41 is designed to express the first 156 amino acids of TPO fused to a leader consisting of 7 amino acids of the STII signal sequence followed by a factor Xa cleavage site.
  • the plasmid was constructed as shown in Fig. 40 by ligating together three pieces of DNA, the first of which was the previously described vector pVEG31 in which the small Xbal-SphI fragment had been removed.
  • the second was the following synthetic DNA duplex: ⁇ '-CTAGAATTATGAAAAAGAATATCGCATTTATCGAAGGTCGTAGCC (SEQ ID NO: 81) TTAATACTTTTTCTTATAGCGTAAATAGCTTCCAGCAT- ⁇ ' (SEQ ID NO: 82)
  • the last piece of the ligation was the 1064 base pair Bgll-Sphl fragment from the previously described plasmid pMP11.
  • the plasmid pMP67 expresses the first 166 amino acids of TPO downstream of a leader consisting of 9 amino acids of the STII signal sequence and the dibasic site Lys-
  • This dibasic site provides for a means of removing the leader with the protease ArgC.
  • This plasmid was constructed as shown in Fig. 41 by ligating together three DNA pieces. The first of these was the previously described vector pVEG31 in which the small Xbal-SphI fragment had been removed. The second was the following synthetic DNA duplex: ⁇ '-CTAGAATTATGAAAAAGAATATCGCATTTCTTCTTAAACGTAGCC (SEQ ID NO: 83)
  • the plasmid pMP261 is a derivative of pMP210-1 in which two additional amino acids of TPO are included on the carboxy terminal end. As shown in Fig.42, this plasmid was constructed by ligating together two pieces of DNA, the first of these being the previously described pMP21 in which the small Xbal-Apal fragment had been removed. The second part of the ligation was a 316 base pair Xbal-Apal fragment from pMP210-1 . 2. Transformation and Induction of E. coli with TPO expression vectors
  • TPO expression plasmids were used to transform the E. coli strain 44C6 (w31 10 tonA ⁇ rpoHts IO ⁇ clpP ⁇ galE) using the CaCl2 heat shock method
  • the transformed cells were grown first at 37°C in LB media containing 50 ⁇ g/ml carbenicillin until the optical density (600nm) of the culture reached approximately 2-3.
  • the LB culture was then diluted 20x into M9 media containing 0.49% casamino acids (w/v) and 50 ⁇ g/ml carbenicillin.
  • indole-3-acrylic acid was added to a final concentration of 50 ⁇ g/ml.
  • the culture was then allowed to continue growing at 30°C with aeration for another 15 hours at which time the cells were harvested by centrifugation.
  • E. coli cells expressing TPO (Met" 1 1-153) encoded by the plasmid pMP210- 1 are fermented as described above. Typically, about 100g of cells are resuspended in 1 L (10 volumes) of cell disruption buffer (10 mM Tris, 5 mM EDTA, pH 8) with a
  • the pellet from above is resuspended in 5 volumes by weight of 20 mM Tris, pH 8, with 6-8 M guanidine and 25 mM DTT (dithiothreitol) and stirred for 1-3 hr., or overnight, at 4°C to effect solubilization of the TPO protein.
  • High concentrations of urea (6-8M) are also useful but generally result in lower yields compared to guanidine.
  • the solution is centrifuged at 30,000 x g for 30 min. to produce a clear supernatant containing denatured, monomeric TPO protein.
  • the supernatant is then chromatographed on a Superdex 200 gel filtration column (Pharmacia, 2.6 x 60 cm) at a flow rate of 2 ml/min. and the protein eluted with 20 0 mM Na phosphate, pH 6.0, with 10 mM DTT Fractions containing monomeric, denatured TPO protein eluting between 160 and 200 ml are pooled.
  • the TPO protein is further purified on a semi-preparative C4 reversed phase column (2 x 20 cm VYDAC). The sample is applied at 6 ml/min. to a column equilibrated in 0.1% TFA(trifluoroacetic acid) with 30% acetonitrile.
  • the protein is eluted with a linear ⁇ gradient of acetonitrile (30-60% in 60 min.).
  • the purified reduced protein elutes at approximately 50% acetonitrile. This material is used for refolding to obtain biologically active TPO variant.
  • the refolding buffer is gently stirred at 4°C for 12-48 hr to effect maximal refolding yields of the correct disulfide-bonded form of TPO (see below).
  • the solution is then acidified with TFA to a final concentration of 0.2%, filtered through a 0.46 or 0.22 micron filter, and 1/10 volume of acetonitrile added. This solution is then pumped directly onto a C4 reversed phase column and the 5 purified, refolded TPO (Met" 1 1-153) eluted with the same gradient program as above.
  • TPO Refolded, biologically active TPO is eluted at approximately 45% acetonitrile under these conditions. Improper disulfide-bonded versions of TPO are eluted earlier.
  • the final purified TPO (Met "1 1-153) is greater than 95% pure as assessed by SDS gels and analytical C4 reversed phase chromatography. For animal studies, the C4 purified material was dialyzed into physiologically compatible buffers. Isotonic buffers (10 mM Na acetate, pH 5.6, 10 mM Na succinate, pH ⁇ . ⁇ or 10 mM Na ⁇ phosphate, pH 7.4) containing 160 mM NaCl and 0.01% Tween 80 were utilized.
  • CHAPS 5 CHAPS 5 family
  • CHAPS 5 CHAPS 5 family
  • EDTA metal-catalyzed oxidation (and aggregation)
  • Glycerol concentrations produced the optimal refolding conditions.
  • Organic solvents e.g. ethanol, acetonitrile, methanol
  • Tris and phosphate buffers were generally useful.
  • Incubation at 4°C also produced higher levels of properly folded TPO.
  • 0 Refolding yields of 40-60% are typical for preparations of TPO that have been purified through the first C4 step.
  • Active material can be obtained when less pure preparations (e.g. directly after the Superdex 200 column or after the initial retractile body extraction) although the yields are less due to extensive precipitation ⁇ and interference of non-TPO proteins during the TPO refolding process.
  • TPO (Met" 1 1-163) contains 4 cysteine residues
  • version 1 disulfides between cysteine residues 1-4 and 2-3
  • version 2 disulfides between cysteine residues 1-2
  • 3-4 version 3 disulfides between cysteine residues 1-3 and 2-4.
  • peaks containing the TPO protein were separated by C4 reversed phase chromatography. Only one of these peaks had significant biological activity as determined using the Ba/F3 assay. Subsequently, the refolding conditions were optimized to yield preferentially that version. Under these conditions, the misfolded versions are less than 10-20% of the total monomer TPO obtained.
  • the disulfide pattern for the biologically active TPO has been determined to be 1-4 and 2-3 by mass spectrometry and protein sequencing(/.e. version 1). Aliquots of the various C4-resolved peaks ( ⁇ -10 nmoles) were digested with trypsin (1 :26 mole ratio of trypsin to protein). The digestion mixture was analyzed by matrix- assisted laser desorption mass spectrometry before and after reduction with DTT. After reduction, masses corresponding to most of the larger tryptic peptides of TPO were detected. In the un-reduced samples, some of these masses were missing and new masses were observed. The mass of the new peaks corresponded basically to the sum of the individual tryptic peptides involved in the disulfide pair.
  • TPO Refolded and purified TPO (Met" 1 1-163) has activity in both in vitro and in vivo assays.
  • the Ba/F3 assay half-maximal stimulation of thymidine incorporation into the Ba/F3 cells was achieved at 3.3 pg /ml (0.3 pM).
  • the mpl receptor-based ELISA half-maximal activity occurred at 1.9 ng/ml (120 pM).
  • TPO (Met" 1 1-153) was highly potent (activity was seen at doses as low as 30 ng/mouse) to stimulate the production of new platelets.
  • TPO variants produced in E. coli, purified and refolded into biological active forms are provided below.
  • MKKNIAFLLNAYASPAPPAC CVRRA (SEQ ID NO: 85) where the leader sequence is underlined and C C represents Cys 7 through Cys 151 .
  • This variant was constructed to provide a tyrosine for radio-iodination of TPO for receptor and biological studies.
  • MKKNIAFHHHHHHHHIEGRSPAPPAC CVRRA (SEQ ID NO: 86) where the leader sequence is underlined and C C represents Cys 7 through Cys 151 .
  • This variant when purified and refolded, can be treated with the enzyme Factor Xa 0 which will cleave after the arginine residue of the sequence IEGR yielding a TPO variant of 1 ⁇ residues in length with a natural serine N-terminal amino acid.
  • T-H8MLF - is prepared as described above for variant (2), except a thrombin sensitive sequence IEPR is fused to the N-terminal domain of TPO.
  • the resulting sequence is ⁇ MKKNIAFHHHHHHHHIEPRSPAPPAC CVRRA (SEQ ID NO: 87) where the leader sequence is underlined and and C C represents Cys 7 through
  • TPO variants were purified by C4 reversed phase chromatography in 0.1 % TFA utilizing an acetonitrile gradient as described previously. All of the TPO variants (in their unproteolyzed forms) had biological activity as assessed by the Ba/F3 assay, with half-maximal activities of 2-5 pM. 0 B. Proteolytic processing of Variants (2) and (3) to generate authentic N- terminal TPO (1-155).
  • TPO variants (2) and (3) above were designed with an enzymatically- cleavable leader peptide before the normal N-terminal amino acid residue of TPO.
  • variants (2) and (3) were ⁇ subjected to digestion with the appropriate enzyme.
  • the acetonitrile from the C4 reversed phase step was removed by blowing a gentle stream of nitrogen on the solution. Thereafter the two variants were treated with either Factor Xa or thrombin as described below.
  • TPO variant (2) 1 M Tris buffer, pH 8, was added to the acetonitrile-free solution to a final concentration of 60 mM and the pH was adjusted to 8 if necessary. NaCl and CaCl2 were added to 0.1 M and 2 mM, respectively.
  • Factor Xa New England Biolabs was added to achieve about a 1 :26 to 1 :100 mole ratio of enzyme to variant. The sample was incubated at room temperature for 1-2 hr. to achieve maximal cleavage as assessed by a change in migration on SDS gels representing the loss of the leader sequence. Thereafter, the reaction mixture was purified by C4 reversed phase chromatography using the same gradient and conditions as described above for the purification of properly folded variants.
  • the purified TPO (1-156) variant after removal of the N-terminal leader sequence and with the internal cleavage, had a half-maximal activity of 0.2 to 0.3 picomolar.
  • the intact variant with the leader sequence had a half-maximal activity of 2-4 picomolar.
  • the digestion buffer consisted of 50 mM Tris, pH 8, 2% CHAPS, 0.3 M NaCl, 5 mM EDTA and human or bovine thrombin (Calbiochem) at a 1 :25 to 1 :50 by weight of enzyme to TPO variant protein.
  • Digestion was conducted at room temperature for 2-6 hours. The progress of the digestion was assessed by SDS gels as described above for the Factor Xa cleavage reaction. Generally, more than 90% cleavage of the leader sequence was achieved in this time.
  • the resultant TPO was purified on C4 reversed phase columns as described above and was shown to have the desired N-terminal by amino acid sequencing.
  • TPO protein had high biological activity with half- maximal responses in the Ba/F3 assay at 0.2-0.4 picomolar protein.
  • this protein had a half-maximal response at 2-4 ng/ml purified protein (120-240 picomolar) while the intact variant containing the leader sequence was less potent in both assays by 5-10 fold.
  • the HPLC-purified cleaved protein was dialyzed into physiological acceptable buffers, with 160 mM NaCl, 0.01% Tween 80 and 10 mM sodium succinate, pH ⁇ . ⁇ , or 10 mM sodium acetate, pH 6.5, or 10 mM sodium phosphate, pH 7.4.
  • the purified protein was stable for several weeks when stored at 4°C.
  • this purified TPO with the authentic N-terminal sequence was highly active, stimulating the production of platelets at doses as low as 30 ng/mouse.
  • hML Human mpl ligand
  • a general strategy for hML-153 synthesis using subtiligase is shown (Scheme 1 ). Beginning with a fully deprotected peptide corresponding to the C-terminal fragment of the protein, an N-terminal protected, C-terminal activated ester peptide is added along with subtiligase. When the reaction is complete, the product is isolated by reverse phase HPLC and the protecting group is removed from the N-terminus. The next peptide fragment is ligated, deprotected and the process is repeated using successive peptides until full length protein is obtained.
  • hMLi53 Based on our knowledge of the sequence specificity of the subtiligase as well as the amino acid sequence of the biologically active "epo-domain" of hML, we divided hMLi53 into seven fragments 18-25 residues in length. Test ligation tetrapeptides were synthesized to determine suitable ligation junctions for the 18-25mer's. Table 13 shows the results of these test ligations.
  • the ligation peptides indicated in Table 14 should be efficiently ligated by the subtiligase.
  • a suitable protecting group for the N- terminus of each donor ester peptide was needed to prevent self-ligation.
  • iNOC isonicotinyl
  • the peptides are then seqentially ligated until the full protein is produced and the final product refolded in vitro.
  • disulfide pairs are believed to be formed between cysteine residues 7 and 161 and between 28 and 86. Oxidation of the disulfides may be accomplished by simply stirring the reduced material under an oxygen atmosphere for several hours. The refolded material can then be purified by HPLC and fractions containing active protein pooled and iyophilized.
  • disulfides can be differentially protected to control sequential oxidation between specific disulfide pairs. Protection of cysteines 7 and 151 with acetamidomethyl (acm) groups would ensure oxidation of 28 and 85.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Saccharide Compounds (AREA)
  • Vehicle Body Suspensions (AREA)
  • Information Transfer Systems (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention a pour objet la thrombopoïétine isolée (TPO), l'ADN isolé codant la TPO et des procédés de recombinaison ou de synthèse pour préparer et purifier la TPO. Diverses formes de TPO ont une influence sur la réplication, la différenciation ou la maturation des cellules sanguines, particulièrment des mégakaryocytes et des cellules parentes de mégakaryocytes. Par conséquent, ces composés peuvent être utilisés pour le traitement de la thrombocytopénie.
PCT/US1994/014553 1994-01-03 1994-12-28 Thrombopoietine WO1995018858A1 (fr)

Priority Applications (16)

Application Number Priority Date Filing Date Title
US08/374,540 US8147844B1 (en) 1994-01-03 1994-12-28 Mpl ligand (thrombopoietin), nucleic acids encoding such, and methods of treatment using mpl ligand
JP7518499A JPH09508262A (ja) 1994-01-03 1994-12-28 トロンボポエチン
BR9408487A BR9408487A (pt) 1994-01-03 1994-12-28 Polipeptídeo ligante de mpl agonista de mpl fragmento de polipeptídeo polipeptídeo quimera anticorpo linha de célula de hibridoma molécula de ácido nucleico molécula de DNA vetor de express o célula hospedeira processo de uso de uma molécula de ácido nucleico método de determinaç o da presença de polipeptideo ligante de mpl método de amplificação composição método para tratamento de um mamífero processo para a biossíntese de um polipeptídeo ligante de mpl humano
RO96-01347A RO117110B1 (ro) 1994-01-03 1994-12-28 POLIPEPTIDA LIGAND mpl, ACID NUCLEIC, CARE O CODIFICA, VECTOR DE EXPRESIE, PROCEDEU PENTRU PRODUCEREA POLIPEPTIDEI LIGAND, SI COMPOZITIE FARMACEUTICA CU ACEASTA
KR10-2004-7009015A KR20040065249A (ko) 1994-01-03 1994-12-28 트롬보포이에틴
SK875-96A SK282265B6 (sk) 1994-01-03 1994-12-28 Polypeptid mpl ligandu, jeho zodpovedajúca nukleová kyselina, expresný vektor a hostiteľská bunka, ktorá ho obsahuje, spôsob prípravy polypeptidu a jeho použitie
NZ278726A NZ278726A (en) 1994-01-03 1994-12-28 Ligands for mpl (cytokine) receptors (especially thrombopoietin), recombinant production thereof and use
AU15146/95A AU704266B2 (en) 1994-01-03 1994-12-28 Thrombopoietin
UA96072627A UA72869C2 (en) 1994-12-02 1994-12-28 Polypeptide of mpl ligand (variants), isolated molecul of nucleic acid encoding polypeptide of mpl ligand (variants), expressing vector, host cell, method for manufacturing polypeptide of mpl ligand (variants), composition, method for drug manufacturing, method for detecting polypeptide of mpl ligand, antibody, method for producing antibody, hybridoma cell line
EP95906653A EP0738323A1 (fr) 1994-01-03 1994-12-28 Thrombopoietine
PL94315289A PL180765B1 (pl) 1994-01-03 1994-12-28 Polipeptyd ligandu mpl, cząsteczka kwasu nukleinowego kodująca polipeptyd ligandu mpl, wektor ekspresyjny, transformowana komórka gospodarza, sposób otrzymywania przeciwciał, sposób otrzymywania polipeptydu ligandu mpl, sposób biosyntezy ludzkiego polipeptydu ligandu mpl, sposób określania obecności genu polipeptydu ligandu mpl oraz kompozycja
CA2178482A CA2178482C (fr) 1994-01-03 1994-12-28 Thrombopoietine
FI962723A FI121573B (fi) 1994-01-03 1996-07-02 Menetelmä eristetyn mpl-ligandipolypeptidin valmistamiseksi
BG100693A BG63639B1 (bg) 1994-01-03 1996-07-02 Тромбопоетин-mpi-лигаден полипептид
NO19962783A NO326903B1 (no) 1994-01-03 1996-07-02 Isolert mpl-ligandpolypeptid, isolert nukleinsyremolekyl, ekspresjonsvektor, vertscelle, fremgangsmate for fremstilling av mpl-ligand, antistoff og farmasoytisk preparat for behandling eller forebyggelse av trombocytopeni.
LVP-96-315A LV11632B (en) 1994-01-03 1996-07-24 Thrombopoietin

Applications Claiming Priority (14)

Application Number Priority Date Filing Date Title
US17655394A 1994-01-03 1994-01-03
US08/176,553 1994-01-03
US18560794A 1994-01-21 1994-01-21
US08/185,607 1994-01-21
US08/196,689 1994-02-15
US08/196,689 US8357513B1 (en) 1994-01-03 1994-02-15 Nucleic acids encoding mpl ligand (thrombopoietin) and fragments thereof
US22326394A 1994-04-04 1994-04-04
US08/223,263 1994-04-04
US08/249,376 US8192955B1 (en) 1994-01-03 1994-05-25 Nucleic acids encoding MPL ligand (thrombopoietin), variants, and fragments thereof
US08/249,376 1994-05-25
US34865894A 1994-12-02 1994-12-02
US08/348,657 US6660256B1 (en) 1994-01-03 1994-12-02 Porcine mpl ligand
US08/348,657 1994-12-02
US08/348,658 1994-12-02

Publications (1)

Publication Number Publication Date
WO1995018858A1 true WO1995018858A1 (fr) 1995-07-13

Family

ID=27569151

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1994/014553 WO1995018858A1 (fr) 1994-01-03 1994-12-28 Thrombopoietine

Country Status (28)

Country Link
EP (1) EP0738323A1 (fr)
JP (2) JPH09508262A (fr)
CN (1) CN1134539C (fr)
AU (1) AU704266B2 (fr)
BG (1) BG63639B1 (fr)
CA (1) CA2178482C (fr)
CZ (1) CZ296130B6 (fr)
DK (1) DK149194A (fr)
ES (1) ES2114786B1 (fr)
FI (1) FI121573B (fr)
FR (1) FR2714670B1 (fr)
GB (1) GB2285446B (fr)
HR (1) HRP941020A2 (fr)
HU (1) HUT75657A (fr)
IE (1) IE72517B1 (fr)
IL (1) IL112184A (fr)
IT (1) IT1283770B1 (fr)
LU (1) LU88573A1 (fr)
LV (1) LV11632B (fr)
NL (1) NL9500010A (fr)
NO (1) NO326903B1 (fr)
NZ (1) NZ278726A (fr)
PT (1) PT101627B (fr)
RO (1) RO117110B1 (fr)
SG (1) SG47030A1 (fr)
SI (1) SI9420079A (fr)
SK (1) SK282265B6 (fr)
WO (1) WO1995018858A1 (fr)

Cited By (47)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996022309A1 (fr) * 1995-01-17 1996-07-25 Kirin Brewery Company, Limited Anticorps monoclonal anti-tpo
WO1996028182A1 (fr) * 1995-03-15 1996-09-19 Kirin Brewery Company, Limited Procede pour empecher l'adsorption de tpo et composition stable contenant du tpo
WO1996028181A1 (fr) * 1995-03-15 1996-09-19 Kirin Brewery Company, Limited Procede pour empecher l'adsorption de tpo et composition contenant de la tpo
WO1996029411A1 (fr) * 1995-03-17 1996-09-26 Transkaryotic Therapies, Inc. Production et administration d'une proteine
WO1996041642A1 (fr) * 1995-06-08 1996-12-27 Kirin Brewery Company, Limited Composition lyophilisee stable contenant de la thrombopoietine (tpo)
WO1997026907A1 (fr) * 1996-01-25 1997-07-31 Genentech, Inc. Nouvelle administration de thrombopoietine
US5696250A (en) * 1995-02-15 1997-12-09 Amgen Inc. DNA encoding megakaryocyte growth and development factor analogs
WO1998006849A1 (fr) * 1996-08-13 1998-02-19 Zymogenetics, Inc. Vecteurs d'expression, cellules et procedes servant a la preparation de polypeptides de thrombopoietine
US5766581A (en) * 1994-03-31 1998-06-16 Amgen Inc. Method for treating mammals with monopegylated proteins that stimulates megakaryocyte growth and differentiation
US5795569A (en) * 1994-03-31 1998-08-18 Amgen Inc. Mono-pegylated proteins that stimulate megakaryocyte growth and differentiation
US5869451A (en) * 1995-06-07 1999-02-09 Glaxo Group Limited Peptides and compounds that bind to a receptor
US5980893A (en) * 1997-07-17 1999-11-09 Beth Israel Deaconess Medical Center, Inc. Agonist murine monoclonal antibody as a stimulant for megakaryocytopoiesis
US5989538A (en) * 1995-02-15 1999-11-23 Amgen Inc. Mpl ligand analogs
WO2000000612A1 (fr) * 1998-06-30 2000-01-06 Daewoong Pharmaceutical Co., Ltd. Nouvelle muteine de trhombopoietine humaine
US6066318A (en) * 1995-10-05 2000-05-23 G.D. Searle & Co. Multi-functional hematopoietic fusion proteins between sequence rearranged C-MPL receptor agonists and other hematopoietic factors
US6251864B1 (en) 1995-06-07 2001-06-26 Glaxo Group Limited Peptides and compounds that bind to a receptor
US6254870B1 (en) 1995-02-03 2001-07-03 G. D. Searle & Co. Thrombopoietin: IL-3 fusion protein
JP2001526689A (ja) * 1997-05-21 2001-12-18 ジェネンテク・インコーポレイテッド トロンボポエチンの新規な投与
US6342220B1 (en) 1997-08-25 2002-01-29 Genentech, Inc. Agonist antibodies
WO2002018569A2 (fr) * 2000-08-30 2002-03-07 Batthyany Dighiero, Carlos, Ignacio, Edmundo Methodes de preparation de polypeptides de thrombopoietine humaine a partir de cultures de cellules mammiferes
US6465430B1 (en) 1995-06-07 2002-10-15 Smithkline Beecham Corporation Peptides and compounds that bind to a thrombopoietin receptor
US6565844B1 (en) 1991-11-05 2003-05-20 Transkaryotic Therapies, Inc. Protein production and protein delivery
WO2003086444A1 (fr) 2002-04-04 2003-10-23 Amgen Inc. Utilisation de fusions de transthyretine peptide/proteine destinees a accroitre la demi-vie serique de peptides/proteines actifs au plan pharmacologique
US6673580B2 (en) 2000-10-27 2004-01-06 Genentech, Inc. Identification and modification of immunodominant epitopes in polypeptides
US6835809B1 (en) 1998-10-23 2004-12-28 Amgen Inc. Thrombopoietic compounds
EP0804480B1 (fr) * 1994-12-30 2006-03-08 ZymoGenetics, Inc. Thrombopoietine purifiee et son procede d'obtention
US7037491B2 (en) 1998-06-30 2006-05-02 Daewoong Pharmaceutical Co., Ltd. Human thrombopoietin comprising glycosylation sited at residues 157 and 164
US7091311B2 (en) 1996-06-07 2006-08-15 Smithkline Beecham Corporation Peptides and compounds that bind to a receptor
US7189827B2 (en) 1998-10-23 2007-03-13 Amgen Inc. Modified peptides as therapeutic agents
WO2007098547A1 (fr) * 2006-03-01 2007-09-07 Apollo Life Sciences Limited Molécule et chimères de cette molécule
WO2008011664A1 (fr) 2006-07-24 2008-01-31 The University Of Queensland Procédé de production d'une population de cellules
US7332474B2 (en) 2001-10-11 2008-02-19 Amgen Inc. Peptides and related compounds having thrombopoietic activity
EP1994824A1 (fr) 2001-11-15 2008-11-26 Kirin Pharma Kabushiki Kaisha Animal non humain chimérique
US7576056B2 (en) 2003-08-28 2009-08-18 Ortho-Mcneil Pharmaceutical, Inc. Peptides and compounds that bind to a receptor
US7723295B2 (en) 2003-08-28 2010-05-25 Ortho-Mcneil Pharmaceutical, Inc. Peptides and compounds that bind to a receptor
WO2010085086A2 (fr) 2009-01-20 2010-07-29 한올바이오파마 주식회사 Fragment polypeptidique de thrombopoïétine humaine modifié et son procédé de fabrication
US7981425B2 (en) 2006-06-19 2011-07-19 Amgen Inc. Thrombopoietic compounds
US8067367B2 (en) 2002-09-18 2011-11-29 Janssen Pharmaceutica, N.V. Methods of increasing platelet and hematopoietic stem cell production
EP2425860A1 (fr) 2005-08-12 2012-03-07 Amgen Inc. Molécules Fc modifiées
US8143380B2 (en) 2004-07-08 2012-03-27 Amgen Inc. Therapeutic peptides
US8420779B2 (en) 2007-05-22 2013-04-16 Amgen Inc. Compositions and methods for producing bioactive fusion proteins
CN103555760A (zh) * 2013-10-18 2014-02-05 江苏康禾生物制药有限公司 一种重组人血小板生成素的制备方法及其制剂
WO2014089478A1 (fr) * 2012-12-07 2014-06-12 University Of Tennessee Research Foundation Procédés d'analyse numérique pour troubles plaquettaires et supports lisibles par ordinateur et systèmes pour leur mise en œuvre
US9012605B2 (en) 2006-01-23 2015-04-21 Amgen Inc. Crystalline polypeptides
US9115361B2 (en) 2004-05-18 2015-08-25 Intrexon Corporation Methods for dynamic vector assembly of DNA cloning vector plasmids
US11618877B2 (en) 2017-01-13 2023-04-04 Instil Bio (Uk) Limited Aseptic tissue processing method, kit and device
US11767510B2 (en) 2019-12-20 2023-09-26 Instil Bio (Uk) Limited Devices and methods for isolating tumor infiltrating lymphocytes and uses thereof

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0811064B1 (fr) * 1995-02-15 2006-04-19 Amgen Inc., Analogues de ligand mpl
ZA964382B (en) * 1995-06-06 1997-12-01 Genentech Inc Lymphotoxin and thrombopoietin for use in the treatment of cancer.
US6031071A (en) * 1996-01-24 2000-02-29 Biophage, Inc. Methods of generating novel peptides
CY2010012I2 (el) * 2000-05-25 2020-05-29 Novartis Ag Μιμητικα θρομβοποιητινης
KR100467750B1 (ko) * 2001-11-29 2005-01-24 씨제이 주식회사 생체내 에리스로포이에틴 활성이 증진된 융합단백질
EP2934555B1 (fr) * 2012-12-21 2021-09-22 Astellas Institute for Regenerative Medicine Procédés de production de plaquettes à partir de cellules souches pluripotentes
JP6463499B2 (ja) * 2015-12-21 2019-02-06 ブラインオン， インク 記憶力、学習力、認知力向上用組成物
WO2021052470A1 (fr) * 2019-09-20 2021-03-25 中美瑞康核酸技术(南通)研究院有限公司 Molécule d'acide nucléique pour le traitement de la thrombocytopénie immunitaire et son application

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5260417A (en) 1989-04-03 1993-11-09 Genetics Institute, Inc. Megakaryocyte growth promoting activity protein
WO1990012877A1 (fr) * 1989-04-19 1990-11-01 Cetus Corporation Proteines m-csf multifonctionnelles et codage de genes pour celles-ci
US5223408A (en) * 1991-07-11 1993-06-29 Genentech, Inc. Method for making variant secreted proteins with altered properties
DE69232017T2 (de) * 1991-12-06 2002-03-21 Genentech Inc Prohormon Konvertase transformierte Zellen.
IL139335A (en) 1994-01-03 2005-08-31 Genentech Inc Mpl ligand polypeptides, nucleic acids encoding them, vectors and host cells comprising such nucleic acids, processes for producing such polypeptides pharmaceutical compositions containing them and use thereof in the preparation of medicaments for treating thrombocytopenia

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
BARTLEY ET AL: "IDENTIFICATION AND CLONING OF A MEGAKARYOCYTE GROWTH AND DEVELOPMENT FACTOR THAT IS A LIGAND FOR THE CYTOKINE RECEPTOR MPL", CELL, vol. 77, 1 July 1994 (1994-07-01), pages 1117 - 1124, XP002078337, DOI: doi:10.1016/0092-8674(94)90450-2 *
DE SAUVAGE ET AL: "STIMULATION OF MEGAKARYOCYTOPOIESIS AND THROMBOPOIESIS BY THE C-MPL LIGAND", NATURE, vol. 369, 16 June 1994 (1994-06-16), pages 533 - 538, XP000606274, DOI: doi:10.1038/369533a0 *
FOSTER ET AL: "HUMAN THROMBOPOIETIN:GENE STRUCTURE,CDNA SEQUENCE,EXPRESSION,AND CHROMOSOMAL LOCALIZATION", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES,USA, vol. 91, no. 26, 20 December 1994 (1994-12-20), pages 13023 - 13027, XP002078340, DOI: doi:10.1073/pnas.91.26.13023 *
MCDONALD ET AL: "A FOUR-STEP PROCEDURE FOR THE PURIFICATION OF THROMBOPOIETIN", EXPERIMENTAL HEMATOLOGY, vol. 17, no. 8, pages 865 - 871 *
MCDONALD ET AL: "PURIFICATION AND ASSAY OF THROMBOPOIETIN", EXPERIMENTAL HEMATOLOGY, vol. 2, no. 6, pages 355 - 361 *
MCDONALD ET AL: "STUDIES ON THE PURIFICATION OF THROMBOPOIETIN FROM KIDNEY CELL CULTURE MEDIUM", THE JOURNAL OF LABORATORY AND CLINICAL MEDICINE, vol. 106, no. 2, pages 162 - 174, XP009073277 *
MCDONALD: "THROMBOPOETIN:ITS BIOLOGY,PURIFICATION,AND CHARACTERIZATION", EXPERIMENTAL HEMATOLOGY, vol. 16, no. 3, pages 201 - 205 *
See also references of EP0738323A1 *
SKODA ET AL: "MURINE C-MPL:A MEMBER OF THE HEMATOPOIETIC GROWTH FACTOR RECEPTOR SUPERFAMILY THAT TRANSDUCES A PROLIFERATIVE SIGNAL", THE EMBO JOURNAL, vol. 12, no. 7, pages 2645 - 2653, XP002017389 *
SOHMA ET AL: "MOLECULAR CLONING AND CHROMOSOMAL LOCALIZATION OF THE HUMAN THROMBOPOIETIN GENE", FEBS LETTERS, vol. 353, no. 1, 10 October 1994 (1994-10-10), pages 57 - 61, XP025576916, DOI: doi:10.1016/0014-5793(94)01008-0 *

Cited By (73)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6565844B1 (en) 1991-11-05 2003-05-20 Transkaryotic Therapies, Inc. Protein production and protein delivery
US6270989B1 (en) 1991-11-05 2001-08-07 Transkaryotic Therapies, Inc. Protein production and delivery
US5795569A (en) * 1994-03-31 1998-08-18 Amgen Inc. Mono-pegylated proteins that stimulate megakaryocyte growth and differentiation
EP0690127B1 (fr) * 1994-03-31 1998-08-05 Amgen Inc. Compositions et procédé pour la stimulation de la croissance et la différentiation des mégacaryocytes
US5766581A (en) * 1994-03-31 1998-06-16 Amgen Inc. Method for treating mammals with monopegylated proteins that stimulates megakaryocyte growth and differentiation
EP0804480B1 (fr) * 1994-12-30 2006-03-08 ZymoGenetics, Inc. Thrombopoietine purifiee et son procede d'obtention
WO1996022309A1 (fr) * 1995-01-17 1996-07-25 Kirin Brewery Company, Limited Anticorps monoclonal anti-tpo
US6254870B1 (en) 1995-02-03 2001-07-03 G. D. Searle & Co. Thrombopoietin: IL-3 fusion protein
US5989538A (en) * 1995-02-15 1999-11-23 Amgen Inc. Mpl ligand analogs
US5756083A (en) * 1995-02-15 1998-05-26 Amgen Inc. Mpl ligand analogs
US5696250A (en) * 1995-02-15 1997-12-09 Amgen Inc. DNA encoding megakaryocyte growth and development factor analogs
US7399833B1 (en) 1995-02-15 2008-07-15 Elliott Steven G MGDF analogs
WO1996028181A1 (fr) * 1995-03-15 1996-09-19 Kirin Brewery Company, Limited Procede pour empecher l'adsorption de tpo et composition contenant de la tpo
WO1996028182A1 (fr) * 1995-03-15 1996-09-19 Kirin Brewery Company, Limited Procede pour empecher l'adsorption de tpo et composition stable contenant du tpo
WO1996029411A1 (fr) * 1995-03-17 1996-09-26 Transkaryotic Therapies, Inc. Production et administration d'une proteine
US6506362B1 (en) 1995-06-07 2003-01-14 Glaxo Group Limited Labeled compounds that bind to a thrombopoietin receptor
US5869451A (en) * 1995-06-07 1999-02-09 Glaxo Group Limited Peptides and compounds that bind to a receptor
US6121238A (en) * 1995-06-07 2000-09-19 Glaxo Wellcome Inc. Peptides and compounds that bind to a receptor
US6465430B1 (en) 1995-06-07 2002-10-15 Smithkline Beecham Corporation Peptides and compounds that bind to a thrombopoietin receptor
US6251864B1 (en) 1995-06-07 2001-06-26 Glaxo Group Limited Peptides and compounds that bind to a receptor
WO1996041642A1 (fr) * 1995-06-08 1996-12-27 Kirin Brewery Company, Limited Composition lyophilisee stable contenant de la thrombopoietine (tpo)
US6066318A (en) * 1995-10-05 2000-05-23 G.D. Searle & Co. Multi-functional hematopoietic fusion proteins between sequence rearranged C-MPL receptor agonists and other hematopoietic factors
US6730303B1 (en) 1995-10-05 2004-05-04 Pharmacia Corporation Fused G-CSF and IL-3 proteins and uses thereof
EP1201246A3 (fr) * 1996-01-25 2002-05-08 Genentech, Inc. Utilisation de la thrombopoiétine comme médicament pour la thérapie et la prévention de la thrombocytopenie
WO1997026907A1 (fr) * 1996-01-25 1997-07-31 Genentech, Inc. Nouvelle administration de thrombopoietine
US8227422B2 (en) 1996-06-07 2012-07-24 Glaxosmithkline Llc Peptides and compounds that bind to a receptor
US7091311B2 (en) 1996-06-07 2006-08-15 Smithkline Beecham Corporation Peptides and compounds that bind to a receptor
AU728881B2 (en) * 1996-08-13 2001-01-18 Zymogenetics Inc. Expression vectors, cells, and methods for preparing thrombopoietin polypeptides
WO1998006849A1 (fr) * 1996-08-13 1998-02-19 Zymogenetics, Inc. Vecteurs d'expression, cellules et procedes servant a la preparation de polypeptides de thrombopoietine
JP2001526689A (ja) * 1997-05-21 2001-12-18 ジェネンテク・インコーポレイテッド トロンボポエチンの新規な投与
US5980893A (en) * 1997-07-17 1999-11-09 Beth Israel Deaconess Medical Center, Inc. Agonist murine monoclonal antibody as a stimulant for megakaryocytopoiesis
US6342220B1 (en) 1997-08-25 2002-01-29 Genentech, Inc. Agonist antibodies
EP1958965A2 (fr) 1997-08-25 2008-08-20 Genentech, Inc. Anticorps agonistes pour un récepteur musk, et leurs utilisations thérapeutiques
US7037491B2 (en) 1998-06-30 2006-05-02 Daewoong Pharmaceutical Co., Ltd. Human thrombopoietin comprising glycosylation sited at residues 157 and 164
WO2000000612A1 (fr) * 1998-06-30 2000-01-06 Daewoong Pharmaceutical Co., Ltd. Nouvelle muteine de trhombopoietine humaine
US9534032B2 (en) 1998-10-23 2017-01-03 Amgen Inc. Thrombopoietic compounds
EP2319928A1 (fr) 1998-10-23 2011-05-11 Kirin-Amgen, Inc. Thrombopoietines dimériques et mimétiques se liant au récepteur MP1 et ayant une activité thrombopoietique
US6835809B1 (en) 1998-10-23 2004-12-28 Amgen Inc. Thrombopoietic compounds
US9145450B2 (en) 1998-10-23 2015-09-29 Amgen Inc. Thrombopoietic compounds
US7189827B2 (en) 1998-10-23 2007-03-13 Amgen Inc. Modified peptides as therapeutic agents
AU2001282376B2 (en) * 2000-08-30 2006-11-09 Batthyany Dighiero, Carlos Ignacio Edmundo Methods for preparing human thrombopoietin polypeptides by mammalian cell cultures
AU2001282376B9 (en) * 2000-08-30 2006-12-07 Batthyany Dighiero, Carlos Ignacio Edmundo Methods for preparing human thrombopoietin polypeptides by mammalian cell cultures
WO2002018569A3 (fr) * 2000-08-30 2003-01-09 Guzicovsky Alfonso Cayota Methodes de preparation de polypeptides de thrombopoietine humaine a partir de cultures de cellules mammiferes
WO2002018569A2 (fr) * 2000-08-30 2002-03-07 Batthyany Dighiero, Carlos, Ignacio, Edmundo Methodes de preparation de polypeptides de thrombopoietine humaine a partir de cultures de cellules mammiferes
US6673580B2 (en) 2000-10-27 2004-01-06 Genentech, Inc. Identification and modification of immunodominant epitopes in polypeptides
US7332474B2 (en) 2001-10-11 2008-02-19 Amgen Inc. Peptides and related compounds having thrombopoietic activity
EP1994824A1 (fr) 2001-11-15 2008-11-26 Kirin Pharma Kabushiki Kaisha Animal non humain chimérique
EP2298331A2 (fr) 2002-04-04 2011-03-23 Amgen, Inc Utilisation de fusions de peptides/protéines de transthyrétine pour augmenter la demi-vie sérique de peptides/protéines pharmacologiquement actifs
WO2003086444A1 (fr) 2002-04-04 2003-10-23 Amgen Inc. Utilisation de fusions de transthyretine peptide/proteine destinees a accroitre la demi-vie serique de peptides/proteines actifs au plan pharmacologique
US8067367B2 (en) 2002-09-18 2011-11-29 Janssen Pharmaceutica, N.V. Methods of increasing platelet and hematopoietic stem cell production
US8283313B2 (en) 2002-09-18 2012-10-09 Janssen Pharmaceutica, Nv Methods of increasing platelet and hematopoietic stem cell production
US7723295B2 (en) 2003-08-28 2010-05-25 Ortho-Mcneil Pharmaceutical, Inc. Peptides and compounds that bind to a receptor
US7576056B2 (en) 2003-08-28 2009-08-18 Ortho-Mcneil Pharmaceutical, Inc. Peptides and compounds that bind to a receptor
US10036026B2 (en) 2004-05-18 2018-07-31 Intrexon Corporation Methods for dynamic vector assembly of DNA cloning vector plasmids
US9115361B2 (en) 2004-05-18 2015-08-25 Intrexon Corporation Methods for dynamic vector assembly of DNA cloning vector plasmids
US8143380B2 (en) 2004-07-08 2012-03-27 Amgen Inc. Therapeutic peptides
EP2425860A1 (fr) 2005-08-12 2012-03-07 Amgen Inc. Molécules Fc modifiées
US11266744B2 (en) 2005-08-12 2022-03-08 Amgen Inc. Modified Fc molecules
US10188740B2 (en) 2005-08-12 2019-01-29 Amgen Inc. Modified Fc molecules
US9114175B2 (en) 2005-08-12 2015-08-25 Amgen Inc. Modified Fc molecules
US9012605B2 (en) 2006-01-23 2015-04-21 Amgen Inc. Crystalline polypeptides
WO2007098547A1 (fr) * 2006-03-01 2007-09-07 Apollo Life Sciences Limited Molécule et chimères de cette molécule
US8541201B2 (en) 2006-06-19 2013-09-24 Amgen Inc. Thrombopoietic compounds
US7981425B2 (en) 2006-06-19 2011-07-19 Amgen Inc. Thrombopoietic compounds
WO2008011664A1 (fr) 2006-07-24 2008-01-31 The University Of Queensland Procédé de production d'une population de cellules
EP2738257A1 (fr) 2007-05-22 2014-06-04 Amgen Inc. Compositions et procédés pour produire des protéines de fusion bioactives
US8420779B2 (en) 2007-05-22 2013-04-16 Amgen Inc. Compositions and methods for producing bioactive fusion proteins
WO2010085086A2 (fr) 2009-01-20 2010-07-29 한올바이오파마 주식회사 Fragment polypeptidique de thrombopoïétine humaine modifié et son procédé de fabrication
WO2014089478A1 (fr) * 2012-12-07 2014-06-12 University Of Tennessee Research Foundation Procédés d'analyse numérique pour troubles plaquettaires et supports lisibles par ordinateur et systèmes pour leur mise en œuvre
CN103555760A (zh) * 2013-10-18 2014-02-05 江苏康禾生物制药有限公司 一种重组人血小板生成素的制备方法及其制剂
US11618877B2 (en) 2017-01-13 2023-04-04 Instil Bio (Uk) Limited Aseptic tissue processing method, kit and device
US11618878B2 (en) 2017-01-13 2023-04-04 Instil Bio (Uk) Limited Aseptic tissue processing method, kit and device
US11767510B2 (en) 2019-12-20 2023-09-26 Instil Bio (Uk) Limited Devices and methods for isolating tumor infiltrating lymphocytes and uses thereof

Also Published As

Publication number Publication date
BG100693A (en) 1998-01-30
GB2285446B (en) 1999-07-28
CZ192296A3 (en) 1997-05-14
CN1134539C (zh) 2004-01-14
BG63639B1 (bg) 2002-07-31
CA2178482C (fr) 2012-01-03
FI962723A (fi) 1996-09-03
GB9425831D0 (en) 1995-02-22
FI121573B (fi) 2011-01-14
EP0738323A1 (fr) 1996-10-23
AU1514695A (en) 1995-08-01
NO962783D0 (no) 1996-07-02
SK282265B6 (sk) 2001-12-03
JPH09508262A (ja) 1997-08-26
NZ278726A (en) 1998-06-26
FI962723A0 (fi) 1996-07-02
HUT75657A (en) 1997-05-28
JPH10113186A (ja) 1998-05-06
NO326903B1 (no) 2009-03-16
RO117110B1 (ro) 2001-10-30
IT1283770B1 (it) 1998-04-30
FR2714670B1 (fr) 1997-01-10
PT101627A (pt) 1995-11-30
LU88573A1 (de) 1995-06-01
ITTO950002A1 (it) 1995-07-03
LV11632A (lv) 1996-12-20
FR2714670A1 (fr) 1995-07-07
ES2114786B1 (es) 1999-01-01
ITTO950002A0 (it) 1995-01-02
HU9601805D0 (en) 1996-08-28
DK149194A (da) 1995-07-04
PT101627B (pt) 1996-11-29
CZ296130B6 (cs) 2006-01-11
AU704266B2 (en) 1999-04-15
SI9420079A (en) 1997-02-28
IL112184A (en) 2004-07-25
NL9500010A (nl) 1995-08-01
HRP941020A2 (en) 1997-04-30
CA2178482A1 (fr) 1995-07-13
GB2285446A (en) 1995-07-12
SK87596A3 (en) 1997-11-05
IE950002A1 (en) 1995-07-12
IE72517B1 (en) 1997-04-23
SG47030A1 (en) 1998-03-20
CN1141061A (zh) 1997-01-22
ES2114786A1 (es) 1998-06-01
IL112184A0 (en) 1995-03-15
NO962783L (no) 1996-09-03
LV11632B (en) 1997-04-20

Similar Documents

Publication Publication Date Title
AU704266B2 (en) Thrombopoietin
US5830647A (en) Hybridization and amplification of nucleic acids encoding mpl ligand
AU749175B2 (en) Thrombopoietin
AU782245B2 (en) Thrombopoietin
RU2245365C2 (ru) Тромбопоэтин
LT4120B (en) Thrombopoetin
US8278099B1 (en) Monoclonal antibody to human thrombopoietin
US8147844B1 (en) Mpl ligand (thrombopoietin), nucleic acids encoding such, and methods of treatment using mpl ligand
US8399250B1 (en) Anti-mpl ligand (thromobpoietin) antibodies
US8193323B1 (en) mpl ligand (thrombopoietin), active fragments thereof, and fusion proteins and compositions comprising mpl ligand and other cytokines
US8241900B1 (en) mpl ligand
KR100607613B1 (ko) 트롬보포이에틴
IL161813A (en) CHIMERIC POLYPEPTIDES COMPRISING A HETEROLOGOUS POLYPEPTIDE AND A FRAGMENT OF A mpl LIGAND
KR20040065249A (ko) 트롬보포이에틴
Freeburn A study of the granulocyte-macrophage colony stimulating factor receptor (GM-CSFR) in leukaemia
SA95150635B1 (ar) ثرومبوبواييتين thrombopoietin (عامل مولد للصفائح الدموية )

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 94194751.3

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 08374540

Country of ref document: US

ENP Entry into the national phase

Ref document number: 1995 374540

Country of ref document: US

Date of ref document: 19950119

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 1995 433098

Country of ref document: US

Date of ref document: 19950503

Kind code of ref document: A

Ref document number: 1995 433103

Country of ref document: US

Date of ref document: 19950503

Kind code of ref document: A

Ref document number: 1995 433766

Country of ref document: US

Date of ref document: 19950503

Kind code of ref document: A

AK Designated states

Kind code of ref document: A1

Designated state(s): AM AT AU BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU JP KE KG KP KR KZ LK LR LT LU LV MD MG MN MW NL NO NZ PL PT RO RU SD SE SI SK TJ TT UA US US US US US US US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE MW SD SZ AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2178482

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 278726

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: PV1996-1922

Country of ref document: CZ

WWE Wipo information: entry into national phase

Ref document number: 962723

Country of ref document: FI

Ref document number: 96-01347

Country of ref document: RO

WWE Wipo information: entry into national phase

Ref document number: 87596

Country of ref document: SK

REEP Request for entry into the european phase

Ref document number: 1995906653

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 1995906653

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 96-118

Country of ref document: LT

WWP Wipo information: published in national office

Ref document number: 1995906653

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 96-118

Country of ref document: LT

WWG Wipo information: grant in national office

Ref document number: 96-118

Country of ref document: LT

WWP Wipo information: published in national office

Ref document number: PV1996-1922

Country of ref document: CZ

WWE Wipo information: entry into national phase

Ref document number: 1020047009015

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: PV1996-1922

Country of ref document: CZ