US20090285805A1 - Binding molecules - Google Patents

Binding molecules Download PDF

Info

Publication number
US20090285805A1
US20090285805A1 US11/658,361 US65836105A US2009285805A1 US 20090285805 A1 US20090285805 A1 US 20090285805A1 US 65836105 A US65836105 A US 65836105A US 2009285805 A1 US2009285805 A1 US 2009285805A1
Authority
US
United States
Prior art keywords
heavy chain
domain
binding
antibody
effector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/658,361
Other languages
English (en)
Inventor
Franklin Gerardus Grosveld
Richard Wilhelm Janssens
Dubravka Drabek
Roger Kingdon Craig
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Erasmus University Medical Center
Original Assignee
Erasmus University Medical Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=35431831&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20090285805(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from GB0416392A external-priority patent/GB2416768A/en
Priority claimed from GB0511881A external-priority patent/GB0511881D0/en
Application filed by Erasmus University Medical Center filed Critical Erasmus University Medical Center
Assigned to ERASMUS UNIVERSITY MEDICAL CENTRE ROTTERDAM reassignment ERASMUS UNIVERSITY MEDICAL CENTRE ROTTERDAM ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: GROSVELD, FRANKLIN GERARDUS, DRABEK, DUBRAVKA, JANSSENS, RICHARD WILHELM
Publication of US20090285805A1 publication Critical patent/US20090285805A1/en
Priority to US12/645,684 priority Critical patent/US8921524B2/en
Priority to US12/645,653 priority patent/US8921522B2/en
Priority to US13/013,156 priority patent/US20110118444A1/en
Priority to US13/837,520 priority patent/US9346877B2/en
Priority to US13/837,402 priority patent/US9353179B2/en
Priority to US15/953,622 priority patent/US10906970B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/241—Tumor Necrosis Factors
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/12—Antihypertensives
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1036—Retroviridae, e.g. leukemia viruses
    • C07K16/1045—Lentiviridae, e.g. HIV, FIV, SIV
    • C07K16/1054—Lentiviridae, e.g. HIV, FIV, SIV gag-pol, e.g. p17, p24
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1036—Retroviridae, e.g. leukemia viruses
    • C07K16/1045—Lentiviridae, e.g. HIV, FIV, SIV
    • C07K16/1063—Lentiviridae, e.g. HIV, FIV, SIV env, e.g. gp41, gp110/120, gp160, V3, PND, CD4 binding site
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
    • C07K16/1228—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K16/1232—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia from Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/46—Hybrid immunoglobulins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52—Constant or Fc region; Isotype
    • C07K2317/53—Hinge
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/64—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising a combination of variable region and constant region components
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/73—Fusion polypeptide containing domain for protein-protein interaction containing coiled-coiled motif (leucine zippers)

Definitions

  • the present invention relates to the manufacture of a diverse repertoire of functional heavy chain-only antibodies that undergo affinity maturation, and uses thereof.
  • the invention also relates to the manufacture and use of a diverse repertoire of class-specific heavy chain-only antibodies and to the manufacture and use of multivalent polypeptide complexes with antibody heavy chain functionality, preferably antibody heavy chain binding functionality, constant region effector activity and, optionally, additional effector functions.
  • the present invention also relates to a method of generation of fully functional heavy chain-only antibodies in transgenic mice in response to antigen challenge.
  • the present invention relates to a method for the generation of human antigen-specific, high affinity, heavy chain-only antibodies of any class, or mixture of classes and the isolation and expression of fully functional VH antigen-binding domains.
  • the present invention also relates to the generation of multivalent polypeptide complexes comprising heavy chain functionality, preferably heavy chain effector activity and other binding and effector functions.
  • Monoclonal antibodies or variants thereof will represent a high proportion of new medicines launched in the 21 st century.
  • Monoclonal antibody therapy is already accepted as a preferred route for the treatment for rheumatoid arthritis and Crohn's disease and there is impressive progress in the treatment of cancer.
  • Antibody-based products are also in development for the treatment of cardiovascular and infectious diseases.
  • Most marketed monoclonal antibody products recognise and bind a single, well-defined epitope on the target ligand (eg TNF ⁇ ).
  • TNF ⁇ target ligand
  • the assembly of a complex consisting of two heavy chains and two light chains (the H 2 L 2 complex) and subsequent post-translational glycosylation processes preclude the use of bacterial systems.
  • Production costs and capital costs for antibody manufacture by mammalian cell culture are high and threaten to limit the potential of antibody based therapies in the absence of acceptable alternatives.
  • a variety of transgenic organisms are capable of expressing fully functional antibodies. These include plants, insects, chickens, goats and cattle but none as yet has been used to manufacture marketed therapeutic products.
  • Functional antibody fragments can be manufactured in E. coli but the product generally has low serum stability unless pegylated during the manufacturing process.
  • Bispecific antibody complexes are engineered Ig-based molecules capable of binding two different epitopes on the either the same or different antigens.
  • Bispecific binding proteins incorporating antibodies alone or in combination with other binding agents show promise for treatment modalities where captured human immune functions elicit a therapeutic effect, for example the elimination of pathogens (Van Spriel et al., (1999) J. Infect. Diseases, 179, 661-669; Tacken et al., (2004) J. Immunol., 172, 4934-4940; U.S. Pat. No. 5,487,890), the treatment of cancer (Glennie and van der Winkel, (2003) Drug Discovery Today, 8, 503-5100); and immunotherapy (Van Spriel et al., (2000) Immunol. Today, 21, 391-397; Segal et al., (2001) J. Immunol. Methods, 248, 1-6; Lyden et al., (2001) Nat. Med., 7, 1194-1201).
  • a bi-specific antibody product is based on two or more H 2 L 2 complexes.
  • co-expression of two or more sets of heavy and light chain genes can result in the formation of up to 10 different combinations, only one of which is the desired heterodimer (Suresh et al., (1986) Methods Enzymol., 121, 210-228).
  • BsIgG bispecific IgG formats
  • BsIgGs require engineered “knob and hole” heavy chains to prevent heterodimer formation and utilise identical L-chains to avoid L-chain mispairing (Carter, (2001) J. Immunol. Methods, 248, 7-15).
  • BsAb diabodies or mini antibodies
  • These comprise minimal single chain antibodies incorporating VH and VL binding sites (scFv) which subsequently fold and dimerise to form a divalent bispecific antibody monovalent to each of their target antigens (Holliger et al., (1993) PNAS, 90, 6444-6448; Muller et al., (1998) FEBS Lett., 422, 259-264).
  • scFv VH and VL binding sites
  • CH1 and L-constant domains have been used as heterodimerisation domains for bi-specific mini-antibody formation (Muller et al., (1998) FEBS Lett., 259-264).
  • the BsAb concept has been extended to encompass Di-diabodies, tetravalent bispecific antibodies where the V H and V L domains on each H and L chain have been replaced by engineered pairs of scFv binding domains.
  • Such constructs whilst complex to engineer, can be assembled in mammalian cells in culture in the absence of hetero-dimer redundancy (Lu et al., (2003) J. Immunol. Methods, 279, 219-232).
  • immunoglobulins The structure of immunoglobulins is well known in the art. Most natural immunoglobulins comprise two heavy chains and two light chains. The heavy chains are joined to each other via disulphide bonds between hinge domains located approximately half way along each heavy chain. A light chain is associated with each heavy chain on the N-terminal side of the hinge domain. Each light chain is normally bound to its respective heavy chain by a disulphide bond close to the hinge domain.
  • each chain fold When an Ig molecule is correctly folded, each chain folds into a number of distinct globular domains joined by a more linear polypeptide sequence.
  • the light chain fold For example, the light chain folds into a variable (V L ) and a constant (C L ) domain.
  • Heavy chains have a single variable domain V H , adjacent the variable domain of the light chain, a first constant domain, a hinge domain and two or three further constant domains. Interaction of the heavy (V H ) and light (V L ) chain variable domains results in the formation of an antigen binding region (Fv).
  • V H and V L are required for antigen binding, although heavy chain dimers and amino-terminal fragments have been shown to retain activity in the absence of light chain (Jaton et al., (1968) Biochemistry, 7, 4185-4195).
  • heavy chain-only antibody devoid of light chain
  • man Heavy Chain Disease
  • murine model systems Analysis of heavy chain disease at the molecular level showed that mutations and deletions at the level of the genome could result in inappropriate expression of the heavy chain C H 1 domain, giving rise to the expression of heavy chain-only antibody lacking the ability to bind light chain (see Hendershot et al., (1987) J. Cell Biol., 104, 761-767; Brandt et al., (1984) Mol. Cell. Biol., 4, 1270-1277).
  • camelid V H domain A characterising feature of the camelid heavy chain-only antibody is the camelid V H domain, which provides improved solubility relative to the human V H domain.
  • Human V H may be engineered for improved solubility characteristics (see Davies and Riechmann, (1996) Protein Eng., 9 (6), 531-537; Lutz and Muyldermans, (1999) J. Immuno. Methods, 231, 25-38) or solubility maybe be acquired by natural selection in vivo (see Tanha et al., (2001) J. Biol. Chem., 276, 24774-24780).
  • V H binding domains have been derived from phage libraries, intrinsic affinities for antigen remain in the low micromolar to high nanomolar range, in spite of the application of affinity improvement strategies involving, for example, affinity hot spot randomisation (Yau et al., (2005) J. Immunol. Methods, 297, 213-224).
  • Camelid V H antibodies are also characterised by a modified CDR3 loop.
  • This CDR3 loop is, on average, longer than those found in non-camelid antibodies and is a feature considered to be a major influence on overall antigen affinity and specificity, which compensates for the absence of a V L domain in the camelid heavy chain-only antibody species (Desmyter et al., (1996) Nat. Struct. Biol., 3, 803-811, Riechmann and Muyldermans, (1999) J. Immunol. Methods, 23, 25-28).
  • the normal immunoglobulin heavy chain locus comprises a plurality of V gene segments, a number of D gene segments and a number of J gene segments.
  • Each V gene segment encodes from the N terminal almost to the C terminal of a V domain.
  • the C terminal end of each V domain is encoded by a D gene segment and a J gene segment.
  • VDJ rearrangement in B-cells followed by affinity maturation provides V H binding domains which then, with V L binding domains, form an antigen recognition or binding site. Interaction of the heavy and light chains is facilitated by the C H 1 region of the heavy chain and the ⁇ or ⁇ region of the light chain.
  • the heavy chain locus in the germline comprises gene segments encoding some or all of the possible constant regions.
  • a re-arranged V H binding domain is spliced onto the C H 2 constant region-encoding segment, to provide a re-arranged gene encoding a heavy chain which lacks a C H 1 domain and is therefore unable to associate with an immunoglobulin light chain.
  • Heavy chain-only monoclonal antibodies can be recovered from B-cells of the spleen by standard cloning technology or recovered from B-cell mRNA by phage display technology (Ward et al., (1989) Nature, 341, 544-546). Heavy chain-only antibodies derived from camelids or transgenic animals are of high affinity. Sequence analysis of normal H 2 L 2 tetramers demonstrates that diversity results primarily from a combination of VDJ rearrangement and somatic hypermutation (Xu and Davies, (2000) Immunity, 13, 37-45). Sequence analysis of expressed heavy chain-only mRNA, whether produced in camelids or transgenic animals, supports this observation (De Genst et al., (2005) J. Biol. Chem., 280, 14114-14121).
  • V H regions An important and common feature of natural camelid and human V H regions is that each region binds as a monomer with no dependency on dimerisation with a V L region for optimal solubility and binding affinity. These features have previously been recognised as particularly suited to the production of blocking agents and tissue penetration agents.
  • Homo- or hetero-dimers can also be generated by enzymatic cleavage of heavy chain-only antibodies or by synthetic routes (Jaton et al., (1968) Biochemistry, 7, 41854195 and US2003/0058074 A1).
  • the benefits of a monomeric antibody binding domain have yet to be used to advantage in design of multimeric proteins as reagents, therapeutics and diagnostics.
  • Human V H or camelid V HH produced by phage display technology lacks the advantage of improved characteristics as a result of somatic mutations and the additional diversity provided by D and J region recombination in the CDR3 region of the normal antibody binding site (Xu and Davies, (2000) Immunity, 13, 37-45).
  • Camelid V HH whilst showing benefits in solubility relative to human V H , is antigenic in man and must be generated by immunisation of camelids or by phage display technology.
  • V H binding domains which must be engineered from V H and V L domains with the associated potential of loss of specificity and avidity.
  • V H binding domains derived from related gene families such as T-cell receptors or the shark immunogloblin family also provide alternatives to scFv for the generation of bi- or multi-specific binding molecules.
  • Other naturally occurring binding proteins and domains thereof including, for example, soluble receptor fragments may also be used.
  • Antibody classes differ in their physiological function. For example, IgG plays a dominant role in a mature immune response. IgM is involved in complement fixing and agglutination. IgA is the major class of Ig in secretions—tears, saliva, colostrum, mucus—and thus plays a role in local immunity.
  • IgG plays a dominant role in a mature immune response.
  • IgM is involved in complement fixing and agglutination.
  • IgA is the major class of Ig in secretions—tears, saliva, colostrum, mucus—and thus plays a role in local immunity.
  • the inclusion of class-specific heavy chain constant regions when engineering multivalent binding complexes provides the therapeutic benefits of effector function in vivo dependent on the functionality required. Engineering of individual effector regions can also result in the addition or deletion of functionality (Van Dijk and van der Winkel, Curr. Opin. Chem. Biol ., (2001) August 5 (4), 368-374).
  • IgA constant region functionality would provide improved mucosal function against pathogens (Leher et al., (1999) Exp. Eye. Res., 69, 75-84), whilst the presence of IgG1 constant region functionality provides enhanced serum stability in vivo.
  • the presence of heavy chain C H 2 and C H 3 constant domains provides the basis for stable dimerisation as seen in natural antibodies, and provides recognition sites for post-translational glycosylation.
  • the presence of C H 2 and C H 3 also allows for secondary antibody recognition when bispecific and multivalent complexes are used as reagents and diagnostics.
  • Isolated, pre-rearranged camelid heavy chain-only variable region sequences have previously been cloned in front of a hinge region and human IgG1 effector domain, inserted into vectors and expressed in COS cells to generate antibody.
  • the antibodies expressed in this in vitro environment have already undergone the processes of class (isotype) switching and affinity maturation (hypermutation) in vivo in the camel and can bind to antigen (Riechmann and Muyldermans, (1999) J. Immunol. Methods, 231, 25-38).
  • the present invention provides a method for the production of a VH heavy chain-only or a camelid V H (V HH ) heavy chain-only antibody in a transgenic mammal comprising the step of expressing a heterologous V H or camelid V H (V HH ) heavy chain locus in that mammal, wherein the V H or camelid V H (V HH ) heavy chain locus comprises a heavy chain constant region which does not encode a C H 1 domain and which locus, when expressed, is capable of forming heavy chain-only antibodies of defined class or classes.
  • the V H or camelid V H (V HH ) heavy chain locus may comprise one or more camelid or non-camelid V gene segments.
  • the V gene segment has been selected or engineered to show improved solubility characteristics.
  • the V gene segment is derived from a human.
  • the heavy chain constant region of the heavy chain locus may comprise a C ⁇ 1 and/or a C ⁇ 2 , a C ⁇ , a C ⁇ , a C ⁇ and/or a C ⁇ heavy chain constant region gene. Furthermore, the heavy chain constant region of the heavy chain locus may comprise more than one of the following heavy chain constant regions: C ⁇ 1 , C ⁇ 2 , C ⁇ , C ⁇ , C ⁇ C ⁇ .
  • the V H heavy chain locus comprises a variable region comprising at least one human or camelid V gene segment, at least one D segment and at least one J segment wherein a human or camelid V gene segment, a D gene segment and a J gene segment are capable of recombining to form a VDJ coding sequence.
  • the heavy chain locus preferably comprises twenty or more D gene segments and/or five or more J gene segments.
  • D and J segments are of vertebrate origin, preferably human.
  • the CDR3 loop may be derived using D and J gene segments derived from any vertebrate and are preferably human D and J gene segments.
  • the V H heavy chain locus may also comprise a recombination sequence (rss) capable of recombining a J gene segment directly with a heavy chain constant region gene.
  • rss recombination sequence
  • the heavy chain constant region of the heterologous heavy chain locus is of human origin or vertebrate origin e.g. of camelid origin. Alternatively the constant region may not be of immunoglobulin heavy chain origin.
  • the methods of the invention result in essentially normal B-cell maturation.
  • the present invention also provides a heavy chain-only antibody, or a fragment thereof, or a mixture of classes of heavy chain-only antibodies obtained or obtainable according to a method of the invention.
  • This heavy chain-only antibody may be a monoclonal antibody, or fragment thereof, such as a human or camelid V H binding domain.
  • the V H binding domain of the invention may lack an extended camelid-like CDR3 loop or, alternatively, may comprise an extended camelid-like CDR3 loop.
  • the present invention also provides a vector comprising a heterologous heavy chain locus of the invention and a host cell transformed with such a vector.
  • the invention also provides a transgenic mammal expressing a heterologous heavy chain locus described herein.
  • the transgenic mammal of the invention has a reduced capacity to produce antibodies that include light chains.
  • heavy chain-only antibody or fragment thereof, according to the invention, in the preparation of a medicament for immunotherapy.
  • the heavy chain-only antibodies of the invention may also be used as diagnostics, reagents, abzymes or inhibitory agents.
  • a pharmaceutical composition comprising the heavy chain-only antibody or fragment thereof according to the invention, and a pharmacologically appropriate carrier.
  • the invention also provides a method of production and selection of heavy chain-only antibodies comprising the steps of:
  • V H binding domains may then be produced by identifying and isolating an antigen-specific V H domain from the cloned mRNA of step c).
  • V H binding domains of the invention may also be produced by:
  • transgenic animals in particular mice, can be generated using “micro loci” to produce class-specific, heavy chain-only antibodies, or a mixture of different classes of heavy chain-only antibodies which are secreted by plasma or B cells. These can then be used either to generate a reliable supply of class-specific, heavy chain-only antibody using established hybridoma technology or as a source of functional camelid V H (V HH ) binding domains or V H heavy chain-only binding domains, preferably a soluble V H heavy chain-only binding domains of human origin, which are free of effector functions but which retain binding function.
  • V HH camelid V H
  • V H heavy chain-only binding domains preferably a soluble V H heavy chain-only binding domains of human origin, which are free of effector functions but which retain binding function.
  • Heavy chain-only antibodies (including camelid antibodies) that can be generated by the methods of the invention show high binding affinity, resulting from V, D and J gene segment rearrangements and somatic mutations, generally in the absence of an enlarged CDR3 loop.
  • B-cell maturation is observed with high levels of heavy chain-only antibody present in isolated plasma (provided that the C H 1 domain has been eliminated from all antibody classes present in the recombinant locus).
  • B-cell maturation and the secretion of assembled dimers (eg IgG) or multimers (eg IgM) has no dependency on the presence or expression of light chain genes.
  • nucleotide sequence analysis of antigen-specific mRNA encoding an antigen-specific heavy chain isolated from hybridomas derived from transgenic mice has demonstrated that heavy chain antibody diversity is primarily a function of VDJ recombination. Furthermore, the present inventors have shown that antibody diversity is generated in the CDR3 region of the functional antigen-binding domain of the heavy chain-only antibody with a more limited contribution from somatic mutations in the V H domains.
  • functional V H domains can be cloned and expressed in bacterial systems to generate V H binding domains with full retention of antigen binding, specificity and affinity.
  • class-specific heavy chain dimers and multimers can be secreted by hybridoma cell lines in culture.
  • transgenic mice can be programmed to produce preferred classes of heavy chain-only antibody in response to antigen challenge, eg only IgG as opposed to only IgM or, for example, mixtures of IgA, IgG and IgM.
  • the inventors have previously described (see WO02/085945 and WO02/085944) the generation of transgenic mice expressing a minimal human IgG heavy chain constant region locus devoid of the C H 1 exon and linked by human D and J segments with two llama VHH genes. These produce functional, high affinity, antigen-specific IgG heavy chain-only antibody when challenged with antigen.
  • Mixtures of heavy chain-only antibody classes (IgM and IgG) can be obtained by class switching in vivo through utilisation of gene constructs incorporating heavy chain constant regions in tandem (provided that all constant region genes lack a C H 1 domain and, when present, a C H 4 domain).
  • the improvements described herein show that a mouse constructed with the same IgG constant region locus linked by human D and J segments with two llama V HH genes and a human IgM constant region locus devoid of a C H 1 exon linked by the same human D and J gene segments with two llama V HH genes, also produces high molecular weight (multimeric) IgM heavy chain-only antibody and IgG (dimer) heavy chain-only antibody.
  • essentially normal B-cell maturation and antibody production is dependent on the complete absence of C H 1 sequences from each heavy chain constant region present in the transgenic locus.
  • a transgenic animal carrying a human IgM heavy chain locus with a functional C H 1 exon linked by the same human D and J gene segments to two llama V gene segments, and IgG constant heavy chain region locus devoid of the C H 1 exon linked by the same human D and J gene segments to two llama V gene segments produces very low levels of heavy chain-only antibody and shows no evidence for B-cell maturation.
  • effector domains including the C H 4 domain, may be incorporated or not, as desired, to introduce to, or eliminate from, the resultant heavy chain-only antibody, effector features.
  • the inventors have found that productive expression of antibody (ie B-cell maturation) can result from the use of any V gene segment present in the construct.
  • Isolation and sequencing of antibody mRNA derived from B-cells shows that D and J gene segment recombination occurs to generate CDR3 diversity.
  • Sequence comparison of resultant V H domains reveals somatic mutations, indicating that affinity maturation events have occurred in the recombined D and J gene segments and also in the V H domain of the resultant expressed antibody mRNA.
  • V gene segments selected or engineered for improved solubility and linked to a D and J chain cluster for recombination and CDR3 generation.
  • VDJ sequences are linked to constant effector domain(s) of choice in tandem, each devoid of a C H 1 exon.
  • the invention is not limited to the derivation and production of human or camelid class-specific, heavy chain-only antibody or human V H binding domains (preferably soluble V H binding domains) (alone or linked to the effector domain of choice), but encompasses the production of chaemeric combinations of any V gene segment of vertebrate origin (optionally engineered to improve solubility characteristics) linked to D and J gene segments.
  • the V gene segments are of human origin and are not V gene segments derived from a camelid.
  • the resultant V H domains may not comprise an enlarged camelid-like CDR3 loop unless the D and J segments have been derived from a camelid. This results in a V H domain exhibiting CDR3 diversity and affinity maturation operationally linked to an effector constant region. The latter ensures functional secretion and optionally assembly in the parent transgenic vertebrate of choice and also provides subsequent selectable effector function should this be required.
  • V H domains can be expressed alone in bacterial or other micro-organism systems or as functional heavy chain-only antibody incorporating effector domains secreted by hybridomas or transfected cells in culture.
  • Antibodies and V H binding domains of human origin have wide ranging applications in the field of healthcare as medicines, diagnostics and reagents, with parallel agricultural, environmental and industrial applications.
  • the present invention provides a method for the production of a V H heavy chain-only antibody in a transgenic mammal comprising the step of expressing a heterologous V H heavy chain locus in that mammal.
  • the V H heavy chain locus comprises a heavy chain constant region which does not encode a CH1 domain and which locus is capable of forming a diverse repertoire of complete heavy chain-only antibodies when expressed.
  • the first aspect of the present invention also provides a method for the production of a camelid V H heavy chain-only antibody in a transgenic mammal comprising the step of expressing a camelid V H heavy chain locus in that mammal, wherein the V H heavy chain locus comprises a heavy chain constant region which does not encode a C H 1 domain and which locus, when expressed, is capable of forming a diverse repertoire of complete heavy chain-only antibodies incorporating VDJ rearrangement and affinity maturation in response to antigen challenge.
  • Heavy chain effector molecules may be engineered to be free of functional domains, for example the carboxy-terminal C H 4 domains, provided that engineering does not affect secretory mechanisms preventing cell surface assembly and consequently B-cell maturation.
  • the C H 1 exons alone are deleted from the heterologous locus or are absent from the locus. Additional features maybe engineered into the locus, for example to improve glycosylation, or add function.
  • the heterologous locus when expressed, is capable of forming functional IgA, IgE, IgG, IgD or IgM molecules or isotypes thereof. Individual antibody classes or mixtures of antibody classes or isotypes thereof may also be produced.
  • the heterologous heavy chain locus is designed to produce preferred classes or mixtures of heavy chain-only antibody depending on the antibody class(es) required, with essentially normal B-cell maturation.
  • camelid V, D and J gene segments and camelid effector regions will produce camelid antibodies with features peculiar to camelids, such as enlarged CDR3 loops.
  • human V, D and J gene segments comprising V gene segments randomly selected, or selected or engineered for enhanced solubility, will produce functional human heavy chain-only antibodies.
  • Antibodies obtained according to the invention have the advantage over those of the prior art in that they are of substantially any single or known class and preferably of human origin. Antibodies are of high affinity resulting from a combination of VDJ recombination and affinity maturation in vivo. Antibodies and fragments thereof may be may be isolated, characterised and manufactured using well-established methods known to those skilled in the art.
  • heterologous means a nucleotide sequence or a locus as herein described which is not endogenous to the mammal in which it is located.
  • V H heavy chain locus in the context of the present invention relates to a minimal micro-locus encoding a V H domain comprising one or more V gene segments, one or more D gene segments and one or more J gene segments, operationally linked to one or more heavy chain effector regions (each devoid of a C H 1 domain).
  • the primary source of antibody repertoire variability is the CDR3 region formed by the selection of D and J gene segments by the V-D and D-J junctions.
  • the advantage of the present invention is that antibody repertoire and diversity obtained in the rearranged V H gene sequences can be maximised through the use of multiple D and J gene segments. Subsequent somatic mutation is achieved whilst using a minimal locus (micro-locus) without the need for a large number of V gene segments or the V L and L C (light chain) immunoglobulin loci.
  • the V H heavy chain locus comprises from two to five V (2, 3, 4 or 5) gene segments derived from any vertebrate species.
  • the V gene segments are of human origin, optionally selected or engineered for improved solubility.
  • the V H heavy chain locus comprises from two to forty (2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30 or 40) or more D gene segments.
  • the D gene segments may be derived from any vertebrate species but, most preferably, the D gene segments are human D gene segments (normally 25 functional D gene segments).
  • the V H heavy chain locus comprises from two to twenty (2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18 or 20) or more J gene segments.
  • the J gene segments may be derived from any vertebrate species but, most preferably, the J gene segments are human J gene segments (normally 6 J gene segments).
  • the V H heavy chain locus comprises two or more V gene segments, twenty-five functional human D gene segments and 6 human J gene segments.
  • V gene segment encompasses a naturally occurring V gene segment derived from a vertebrate, including camelids and human, which have optionally been selected, mutated, or engineered for improved characteristics, such as solubility. V gene segments are also found in other species such as shark (see Kokubu et al., (1988) EMBO. J, 7, 3413-3422) or have evolved to provide diverse V H -like families of binding proteins exemplified, for example, in the evolution of the immunoglobulin light chain V L repertoire or the T-cell receptor V H repertoire.
  • the V gene segment must be capable of recombining with a D gene segment, a J gene segment and a heavy chain constant (effector) region (which may comprise several exons but excludes a C H 1 exon) according to the present invention to generate a V H heavy chain-only antibody when the nucleic acid is expressed.
  • a V gene segment according to the present invention also includes within its scope any gene sequence encoding a homologue, derivative or protein fragment, which is capable of recombining with a D gene segment, a J gene segment and a heavy chain constant region (comprising one or more exons but not a C H 1 exon) according to the present invention to generate a heavy chain-only antibody as defined herein.
  • V H coding sequences may be derived from a naturally occurring source or they may be synthesised using methods familiar to those skilled in the art.
  • V H domain in the context of the present invention refers to an expression product of a V gene segment when recombined with a D gene segment and a J gene segment as defined above.
  • the V H domain as used herein remains in solution and is active in a physiological medium without the need for any other factor to maintain solubility.
  • the ability of the soluble V H domain to bind antigen has been improved by VDJ recombination and somatic mutation. There is no dependency on the presence or absence of the enlarged CDR3 loop peculiar to the camelid species.
  • the V H domain is able to bind antigen as a monomer and, when combined with effector constant regions, may be produced in mono-specific, bi-specific, multi-specific, bi-valent or multivalent forms, dependent on the choice and engineering of the effector molecules used (eg IgG, IgA IgM etc.) or alternative mechanisms of dimerisation and multimerisation. Any likelihood of binding with a V L domain when expressed as part of a soluble heavy chain-only antibody complex has been eliminated by removal of the C H 1 exon (see Sitia et al., (1990) Cell, 60, 781-790).
  • the V H domain alone can also be engineered with diverse protein domains to produce fusion proteins for targeted therapeutic and diagnostic purpose, for example with toxins, enzymes and imaging agents.
  • a D gene segment’ and ‘a J gene segment’ includes naturally occurring sequences of D and J gene segments.
  • the D and J gene segments are derived from the same vertebrate from which the V gene segment is derived.
  • the D and J gene segments are preferably also derived from a human.
  • the V gene segments maybe derived, for example, from camel and the D and J gene segments from human or vice versa.
  • D gene segment and J gene segment also include within their scope derivatives, homologues and fragments thereof as long as the resultant segment can recombine with the remaining components of a heavy chain antibody locus as herein described to generate a heavy chain-only antibody as herein described.
  • D and J gene segments may be derived from naturally occurring sources or they may be synthesised using methods familiar to those skilled in the art and described herein.
  • the V, D and J gene segments are capable of recombination and preferably undergo somatic mutation.
  • V, D and J gene segments are preferably derived from a single vertebrate species. This may be any vertebrate species but is preferably a human.
  • a heterologous heavy chain locus comprises a region of DNA encoding a heavy chain constant region providing effector functions in vivo (eg IgG, IgM, IgA, IgE, IgD or isotypes thereof).
  • the invention also provides an antigen-specific, heavy chain-only antibody obtained or obtainable by the methods of the present invention.
  • a heavy chain constant region is encoded by a naturally occurring or engineered gene segment that is capable of recombining with a V gene segment, a D gene segment and a J gene segment in a B cell.
  • the heavy chain constant region is derived from an immunoglobulin locus.
  • each heavy chain constant region essentially comprises at least one heavy chain constant region gene, which is expressed without a functional C H 1 domain so that generation of heavy chain-only antibody can occur.
  • Each heavy chain constant region may also comprise one or more additional heavy chain constant region exons, which are selected from the group consisting of C ⁇ , C ⁇ 1-4 , C ⁇ , C ⁇ and C ⁇ 1-2 with the proviso that the additional heavy chain constant region genes also do not express a functional C H 1 domain.
  • the heavy chain constant region gene segments are selected depending on the preferred class or mixture of antibody classes required.
  • the heterologous heavy chain locus is C ⁇ - and C ⁇ -deficient.
  • Ig molecules of class M are known to play an important role in the activation of macrophages and the complement pathway. Due to the close proximity of its binding sites, IgM has a high avidity for pathogens, including viruses. However, IgM is also known to be difficult for use in rapid immunoassay techniques whereas Ig of class G can be readily used in these techniques. For such uses, it would be useful to select for the preferred antibody class, ie IgG or IgM.
  • heterologous heavy chain C ⁇ locus devoid of C H 1 will produce optionally some or all IgG isotypes, dependent on the IgG1, IgG2, IgG3 and IgG4 isotypes present in the heterologous IgG locus.
  • the heavy chains may comprise C ⁇ genes.
  • the resulting IgE molecule might also be used in therapy.
  • IgA and IgM may be obtained when the heavy chain constant region comprises a C ⁇ and a C ⁇ gene.
  • the heavy chain constant region according to the present invention is of human origin, in particular when the heavy chain antibody is to be used for therapeutic applications in humans.
  • the heavy chain constant region is preferably derived from the target organism, vertebrate or mammal in or on which diagnosis or veterinary therapy is to be performed.
  • the heavy chain constant region When expressed, the heavy chain constant region lacks a functional C H 1 domain.
  • the C H 1 exon and, optionally, C ⁇ and C ⁇ constant regions, may be mutated, deleted or substituted.
  • the C H 1 exon is deleted.
  • the presence, for example, of IgM with a functional C H 1 domain inhibits B-cell maturation and consequently limits the productive expression of heavy chain only IgG (devoid of C H 1) within the same locus, as B-cell maturation is inhibited.
  • C H exon a ‘heavy chain constant region exon’ as herein defined includes the sequences of naturally occurring vertebrate, but especially mammalian, C H exons. This varies in a class specific manner. For example, IgG and IgA are naturally devoid of a C H 4 domain.
  • C H exon also includes within its scope derivatives, homologues and fragments thereof in so far as the C H exon is able to form a functional heavy chain-only antibody as herein defined when it is a component of a heavy chain constant region.
  • the C H 4 or other functional domains maybe engineered or deleted within the transgene provided such a process does not inhibit the intracellular secretory process, B-cell maturation or the binding activity of the resultant antibody polypeptide.
  • the transgenic mammal used in the methods of the invention is not a human.
  • the transgenic mammal is preferably a rodent such as a rabbit, guinea pig, rat or mouse. Mice are especially preferred. Alternative mammals such as goats, sheep, cats, dogs or other animals may also be employed.
  • transgenic animals are generated using established oocyte injection technology and, where established, ES cell technology or cloning.
  • immunoglobulin heavy and optionally light chain loci endogenous to the mammal are deleted or silenced when a heavy chain-only antibody is expressed according to the methods of the invention.
  • This approach of generating heavy chain-only antibodies as described above maybe of particular use in the generation of antibodies for human therapeutic use as often the administration of antibodies to a species of vertebrate which is of different origin from the source of the antibodies results in the onset of an immune response against those administered antibodies.
  • the present invention provides a transgenic mammal expressing a heterologous heavy chain locus according to the present invention.
  • the transgenic mammal may be engineered to have a reduced capacity to produce antibodies that include light chains.
  • Antibody-producing cells may be derived from transgenic animals according to the present invention and used, for example, in the preparation of hybridomas for the production of heavy chain-only antibodies as herein defined.
  • nucleic acid sequences may be isolated from transgenic mammals according to the present invention and used to produce V H domain heavy chain-only chain antibodies or bi-specific/bi-functional complexes thereof, using recombinant DNA techniques which are familiar to those skilled in the art.
  • antigen-specific heavy chain-only antibodies may be generated by immunisation of a transgenic animal according to the present invention.
  • the present invention provides a method for the production of heavy chain-only antibodies by immunising a transgenic mammal according to the present invention with an antigen.
  • the mammal is a mouse.
  • the present invention provides a heavy chain-only antibody obtainable according to a method of the present invention and functional fragments and derivatives thereof. Fragments encompassing the VH binding domain can be derived by enzymic cleavage or cyanogen bromide cleavage of a heavy chain-only antibody of the invention ie devoid of light chains (Jaton et al., (1968) Biochemistry, 7, 41854195).
  • a preferred functional fragment is an antigen-specific, heavy chain-only binding domain, ie a V H binding domain, as expressed by the V H locus as a result of recombination between single V, D and J gene segments followed subsequently by somatic mutation.
  • V H loci can be cloned from, eg, mRNA isolated from an antibody-producing cell of an immunised transgenic animal as described above. Cloned sequences can then be displayed using a phage (Ward et al., (1989) Nature, 341, 544-546) or similar display libraries, for example using yeast-based systems (Boder and Wittrup, (1997) Nat. Biotechnol., 15, 553-7) and antigen-specific V H binding domains identified.
  • Antigen-specific heavy chain binding domains can then be manufactured either alone or as fusion proteins in scalable bacterial, yeast or alternative expression systems. Sequences encoding V H binding domains can also be cloned from characterised hybridomas derived by classical procedures from immunised transgenic mice. These can then be used for the production of V H binding domains and derivatives thereof including the engineering of defined antibody classes (eg IgE or IgA) and variants thereof with differing effector functions.
  • defined antibody classes eg IgE or IgA
  • the invention also provides a method of producing a V H binding domain comprising the steps of:
  • V H domain-containing fragments can be generated from heavy chain-only antibodies of the invention using enzymic or chemical cleavage technology and subsequent separation of the V H domain-containing fragment from the other cleavage products.
  • V H binding domain is isolated from a characterised hybridoma
  • the cloned V H binding domain sequence derived from mRNA can be directly cloned into an expression vector without recourse to additional selection steps using phage and other display systems.
  • Production systems for heavy chain only-antibody incorporating effector regions include mammalian cells in culture (eg CHO cells), plants (eg maize), transgenic goats, rabbits, cattle, sheep, chickens and insect larvae suited to mass rearing technology.
  • Other production systems including virus infection (eg baculovirus in insect larvae and cell-lines) are alternatives to cell culture and germline approaches.
  • Other production methods will also be familiar to those skilled in the art. Where there is a requirement for heavy chain-only IgA or IgM assembly, the co-expression of a “J chain” is beneficial. Suitable methods for the production of camelid heavy chain-only antibody or V H binding domains alone are known in the art.
  • camelid V H binding domains have been produced in bacterial systems and camelid heavy chain-only homodimers have been produced in hybridomas and transfected mammalian cells (see Reichmann and Muyldermans, (1999) J. Immunol. Methods, 231, 25-38).
  • the present invention also provides an antigen-specific monomeric or dimeric V H binding domain obtainable according to the method of this aspect of present invention.
  • the present invention also provides a polynucleotide sequence consisting of the heterologous heavy chain locus, an isolated polynucleotide encoding a heavy chain-only antibody of the invention and a vector comprising a heterologous heavy chain locus, or fragment thereof, or isolated polynucleotide encoding a heavy chain-only antibody according to the present invention.
  • the present invention also provides a host cell transformed with a heterologous heavy chain locus, or fragment thereof, or isolated polynucleotide encoding the heavy chain-only antibody or antibody fragment, according to the present invention.
  • the present invention provides a polypeptide complex comprising an antigen-specific V H binding domain according to the present invention having attached to it an effector moiety which provides effector activity.
  • This effector activity may be in addition to that provided by the heavy chain constant region and may be situated at the amino or carboxy terminus of the molecule.
  • Such polypeptide complexes may be in the form of functional monomers or, dependent on the design and interaction of the effector moieties, dimers, tetramers, pentamers, multimers or other complexes incorporating different V H binding domains, so imparting multi-valency and multi-specificity.
  • V H binding domains may be present at the amino or carboxy terminus of the binding molecule (see FIG. 1 for dimeric example).
  • the effector moiety comprises a binding domain, it may have a different specificity from the antigen-specific V H binding domain.
  • the advantage of this arrangement is that the polypeptide complex can facilitate cross-linking of different targets.
  • a bispecific polypeptide complex may be utilised to enhance cell-cell interactions and cell/pathogen interactions.
  • the polypeptide complexes of the invention can be utilised, for example, to bridge between two cell types such as a pathogen and a macrophage (see Biburger et al., (2005) J. Mol. Biol., 346, 1299-1311).
  • the use of V H binding domains is preferable to the use of scFV binding domains in such bi-specific designs.
  • V H binding domains have high binding affinity and can be incorporated into such polypeptide complexes with minimal vector construction and in the absence of design considerations necessary to maintain the specificity and affinity of scFVs relative to their tetrameric parental molecule.
  • dimers or multimeric polypeptide complexes are envisaged dimerisation domains are incorporated, for example the inclusion of C H 2 and C H 3 domains derived from immunoglobulin heavy chain constant regions (see FIG. 2 ).
  • effector moiety includes any moiety that mediates a desired biological effect on a cell.
  • the effector moiety is preferably soluble and may be a peptide, polypeptide or protein or may be a non-peptidic structure.
  • the effector moiety may be an enzyme, hormone, cytokine, drug, pro-drug, toxin, in particular a protein toxin, a radionuclide in a chelating structure, a binding domain, a dimerising or interaction domain, an imaging agent, albumin or an inhibitory agent.
  • Albumin may be utilised as an effector moiety to increase the stability or pharmacokinetic and/or pharmacodynamic properties of the antigen-specific V H binding domain (Sung et al., (2003) J Interferon Cytokine Res., 23 (1): 25-36).
  • the effector moiety may be a PEGylated structure or a naturally glycosylated structure so as to improve pharmacodynamic properties.
  • the effector moiety may be peptide bonded to the antigen-specific V H binding domain or it may be chemically bonded to the antigen-specific heavy V H domain, for example by using a chemical linking structure such as a maleimide linker.
  • the polypeptide complexes of the invention may be expressed as fusion proteins.
  • the present invention also encompasses a polynucleotide sequence consisting of the heterologous heavy chain locus, or an isolated polynucleotide encoding the heavy chain-only antibody, of the present invention wherein the polynucleotide further comprises, in reading frame, one or more exon(s) encoding an effector moiety.
  • This exon may be at the 5′ or 3′ end of the polynucleotide.
  • the polynucleotide may comprise, in the following order and in reading frame, a V H and a binding domain ⁇ effector moiety gene segment.
  • the attachment of the various domains may be achieved using a recombinant DNA construct that encodes the amino acid sequence of the fusion protein, with the DNA encoding the various domains placed in the same reading frame.
  • Such constructs are of value as diagnostics and therapeutics.
  • the effector domain can be a fluorescent protein (eg GFP) or enzyme (eg ⁇ -gal).
  • the effector domain can be a tag for enhanced binding to a substrate (eg polyhistidine or a biotin), an antigen to provide a site of attachment for secondary antibodies or a leucine zipper or similar binding motif which may serve as a site for the attachment of fluorescent markers.
  • a substrate eg polyhistidine or a biotin
  • the present inventors have also realised that it is possible to produce a bi-valent or multi-valent polypeptide complex comprising at least part of an antibody heavy chain, alone or in combination with a separate effector (light) chain comprising a complementary assembly domain and having additional effector activity.
  • Polypeptide complexes according to the present invention retain the physiological function conferred by the heavy chain constant region in combination with additional effector moiety functions associated with the effector chain ( FIG. 3 ).
  • the polypeptide complex comprises heavy chains in combination with one or more effector chains (light chains).
  • the second aspect of the present invention provides a polypeptide complex comprising a pair of heavy chains and a pair of effector chains, wherein:
  • the effector moiety in the heavy chain is different to the effector moiety in the effector chain.
  • the polypeptide complex includes a flexible hinge-like domain at the carboxyl terminus of the C H 3 domain (or C H 4 domain, if present) linking it to the assembly domain.
  • the polypeptide complex includes a natural hinge domain or a flexible engineered hinge-like domain between the binding domain and the C H 2 domain. The presence of hinge regions facilitates the independent function of binding domains and effector moieties in the resultant polypeptide complexes.
  • the effector moiety in the first polypeptide heavy chain optionally has a specificity different from the specificity of the effector moiety in the second polypeptide heavy chain.
  • the effector moiety of the polypeptide complex may be replaced by a binding domain.
  • the binding domain comprises a V H domain (as defined in the first aspect of the invention) or a cell receptor binding domain.
  • the resulting tetravalent dimeric binding protein (polypeptide complex) can comprise up to four different effector moieties.
  • effector moieties at the amino terminal end of the heavy chain are identical, and those at the carboxyl terminal end are identical (but recognise a different antigen or epitope to that at the amino terminal end), facilitating the assembly of a single homodimer.
  • Such a molecule may prove advantageous for the capture of pathogens, effector functionality being provided by the inclusion of appropriate heavy chain functional domains (eg IgA or IgM).
  • an exemplary polypeptide complex according to the third aspect of the invention is useful for cytochemical labelling, targeting methods or therapy.
  • the effector molecule comprises an antigen-specific V H binding domain which targets a cancer cell surface marker and the effector moiety comprises a binding domain specific for a pro-drug converting enzyme (the effector chain).
  • the antigen-specific V H binding domain binds to the target and brings the effector moiety into close proximity with the target such that on binding the effector chain it can exert a biological effect on the target in the presence of the pro-drug (eg nitroreductase with CB1954).
  • the inclusion of immunoglobulin heavy chain effector function as the dimerisation domain may also be beneficial in elimination of the target cell.
  • the effector chain comprises a complementary binding domain and an effector moiety, which associates with a heavy chain through the heavy chain effector moiety to form the assembled polypeptide binding complex.
  • the effector chain complementary assembly domain may be an integral component of the effector moiety or a protein or alternative ligand fused or chemically linked to the effector moiety.
  • the heavy chains of the assembled polypeptide binding complex bind to the target and bring the effector (light) chain moiety into close proximity with the target such that it can exert a biological effect of the target.
  • effector moiety includes any moiety that mediates a desired biological effect on a cell.
  • the effector domain may be a cell, for example a T-cell, a peptide, polypeptide or protein or may be a non-peptidic structure.
  • the effector domain may be an enzyme, drug, pro-drug, toxin, in particular a protein toxin, a radionuclide in a chelating structure or binding domain.
  • the effector moiety associated with the complementary assembly domain maybe cellular, proteinaceous, organic or inorganic in nature, dependent on the desired effect.
  • binding domain as used herein in respect of all the above aspects of the present invention includes any polypeptide domain that is active in a physiological medium. Such a binding domain must also have the ability to bind to a target under physiological conditions.
  • binding domains include domains that can mediate binding or adhesion to a cell surface.
  • Suitable domains which may be used in the polypeptide complexes of the invention are mammalian, prokaryotic and viral cell adhesion molecules, cytokines, growth factors, receptor antagonists or agonists, ligands, cell surface receptors, regulatory factors, structural proteins and peptides, serum proteins, secreted proteins, plasma lemma-associated proteins, viral antigens, bacterial antigens, protozoal antigens, parasitic antigens, lipoproteins, glycoproteins, hormones, neurotransmitters, clotting factors, engineered single chain Fvs and the like.
  • the binding domain is a vertebrate V H domain, more preferably a mammalian V H domain such as a human V H domain.
  • a binding domain may comprise a camelid V H (V HH ) domain or may comprise a V H domain obtained from a non-camelid.
  • the binding domain is a human V H domain.
  • V H binding domains are preferably of B-cell origin derived from transgenic animals or camelids (as described above) as opposed to V H domains derived from synthetic phage libraries, since the former will be of higher affinity due to their generation in response to antigen challenge in vivo via VDJ rearrangement and somatic mutation.
  • the effector moiety comprises a binding domain, it preferably has different specificity from the binding domain in the heavy chain.
  • polypeptide complex can facilitate cross-linking of different targets or bind different antigens on a target cell (eg pathogen).
  • the binding domain in the first heavy chain may have a specificity different from that of the binding domain in the second heavy chain.
  • the polypeptide complex will be at least bivalent and will be able to crosslink different targets and the effector domain will be able to exert its effect on both targets.
  • a multivalent polypeptide complex can be created through the association of these tetravalent heavy chains with effector chains comprising effector domains with yet different specificity(ies) and functionality.
  • the effector moiety in the first heavy chain may have a different specificity from the effector moiety in the second heavy chain, permitting the capture of more than one effector chain, each carrying a different functionality.
  • effector moiety and ‘complementary assembly domain’ as used herein include any moieties that can form at least a non-covalent attachment to each other.
  • the effector moiety and the complementary assembly domain may be a protein, peptide fragment or consensus sequence capable of forming a protein-protein interaction, such as that seen between: the C H 1 domain of an immunoglobulin heavy chain and the constant region of an immunoglobulin light chain; leucine zippers; VCAM and VLA-4; integrins and extracellular matrix proteins; integrins and cell surface molecules such as CD54 or CD102; ALCAMs and SRCR domains; an scFv and antigen or V H binding domain and antigen.
  • the dimerization domains of the heavy chains comprise immunoglobulin heavy chain constant regions
  • the constant regions may give further physiological functionality to the polypeptide binding complex.
  • the immunoglobulin heavy chain constant domains may provide for, inter alia, complement fixation, macrophage activation and binding to Fc receptors, depending on the class or subclass of the antibody constant domains.
  • the class of heavy chain expressed has a major role in effector function in vivo.
  • An established cell line may produce a polypeptide complex having a useful targeting and biological effect but the heavy chain constant region may be of a class which is diagnostically or therapeutically undesirable, or it may not be secreted in useful quantities.
  • the heavy chain constant domains of the polypeptide complexes of the invention may be specifically altered or partially or completely omitted to introduce or remove components of immunoglobulin heavy chains.
  • Ig molecules of class M are known to play an important role in the activation of macrophages and the complement pathway. Due to the close proximity of its binding sites, IgM has a high avidity for pathogens, including viruses. However, IgM is also known to be difficult for use in rapid immunoassay techniques whereas Ig of class G can be readily used in these techniques. For such uses, it would be useful to switch the class of the heavy chain from ⁇ to ⁇ domains.
  • IgG immunoglobulin G
  • IgG antibodies bind and activate macrophages and granulocytes, and can cross the placenta.
  • the constant regions of the heavy chains of the polypeptide complexes of the present invention may be of human, rabbit, rat or mouse origin as herein defined. Preferably, they are of human origin.
  • polypeptide complexes of the present invention can also be used solely to block binding of ligands to their receptors by using dimerisation domains which provide no effector functions. Multiple receptors can be blocked by a multi-specific polypeptide complex.
  • the effector molecule may comprise a dimerization domain such that the effector molecule can associate with a separate effector molecule.
  • This dimerization domain may comprise one or more of C H 2, C H 3 or C H 4 antibody constant region domains and/or a J chain.
  • two or more effector molecules may associate to produce an effector molecule dimer or multimer.
  • the effector molecules may be the same (enabling the production of an effector molecule homodimer or homomultimer) or different (enabling the production of an effector molecule heterodimer or heteromultimer).
  • the effector molecule dimer or multimer is bi-valent or multi-valent.
  • the constant regions for the two or more effector molecules ie the dimerization domains
  • the constant regions for the two or more effector molecules are identical, thus reducing the possibility of product heterogeneity.
  • a polypeptide complex comprising a dimer consisting of a first polypeptide heavy chain and a second polypeptide heavy chain wherein:
  • the first and second chains have the same effector moiety.
  • the dimerization domain comprises at least C H 2, C H 3 and, optionally, C H 4 antibody constant region domains
  • the fourth aspect of the present invention also provides a polypeptide complex comprising a plurality of polypeptide heavy chain dimers and a J chain, wherein:
  • each heavy chain constant region preferably comprises at least one heavy chain constant region gene, which is expressed without a functional C H 1 domain so that generation of heavy chain-only antibody can occur.
  • Each heavy chain constant region may also comprise one or more additional heavy chain constant region genes, which are selected from the group consisting of C ⁇ , C ⁇ 1-4 , C ⁇ , C ⁇ and C ⁇ 1-2 with the proviso that the additional heavy chain constant region genes also do not express a functional C H 1 domain.
  • the heavy chain constant region genes are selected depending on the preferred class or mixture of antibody classes required.
  • the heavy chains each include a C H 4 domain
  • the constant domains are ⁇ domains
  • the polypeptide complex includes a J chain.
  • the heavy chains each include a C H 4 domain
  • the constant domains are ⁇ domains
  • the antibody includes a J chain.
  • the modular domain arrangement of the polypeptide complexes of the present invention enables them to be constructed in a large number of possible permutations.
  • Such alterations in the domain architecture and amino acid sequence of the polypeptide complex may be achieved by suitable mutation or partial synthesis and replacement of appropriate regions of the corresponding DNA coding sequences.
  • Substitute or additional domains may be obtained from compatible recombinant DNA sequences.
  • the heavy chains may include a natural hinge or engineered flexible polypeptide domain both between the binding domain and the amino terminus of the C H 2 domain and between the effector domain and the C-terminal end of the heavy chain (C H 3 or C H 4).
  • the heavy chains in the polypeptide complex of the invention are expressed as fusion proteins.
  • the effector chains in the polypeptide complex of this aspect of the invention may be expressed as fusion proteins or may be assembled by chemical means or, if cellular in nature, may be isolated from blood or tissue, or captured in vivo (for example albumin).
  • the attachment of the various domains may be achieved using a recombinant DNA construct that encodes the amino acid sequence of the fusion protein, with the DNA encoding the various domains placed in the same reading frame.
  • the effector moiety if present as part of a fusion protein, may be located at either the amino or carboxy terminus of the complementary assembly domain.
  • the domains in the effector chain may be assembled by normal peptide chemical methods, as already known in the art, rather than by being synthesised as a fusion protein.
  • Linkage may be through a peptide bond or through chemical linkage.
  • the effector moiety may be peptide bonded to the complementary assembly domain or it may be chemically bonded to the complementary assembly domain, for example by using a chemical linking structure such as a maleimide linker.
  • the effector moiety may be positioned at any location in the heavy chain.
  • the effector moiety may be situated at the C terminal end of the heavy chain or between the binding domain and either the C H 2 domain or the hinge domain of the polypeptide complex. It is preferred that the assembly domain is not situated between the C H 2 and C H 3 domains as this might interfere with an effector function and the dimerization domains.
  • the effector moiety is attached to the amino terminal or carboxy end of the heavy chain via a peptidic flexible linker or hinge like region so as to facilitate independent binding/function of effector moieties.
  • the present invention also provides a polynucleotide sequence encoding a heavy chain of any one of the polypeptide complexes of the present invention, a vector comprising one or more of the polynucleotide sequences referred to above and a host cell transformed with a vector encoding the heavy chain of a polypeptide complex of the present invention.
  • the polynucleotides preferably include sequences which allow the expressed heavy chains to be secreted as homodimers into the medium in which the host cell is growing.
  • the host cell may be of any origin, including bacterial and yeast cells, but is preferably a vertebrate host cell, more preferable a mammalian host cell.
  • Transfection of the same host cell with a second vector encoding a heavy chain comprising a binding domain with specificity for a different target results in co-expression of the two constructs and the assembly of a mixture of homodimers and heterodimers.
  • Homodimers will show specificity to the cognate antigen and heterodimers will bind both antigens.
  • the present invention also provides a host cell transformed with a vector encoding at least one effector chain of a polypeptide complex of the present invention.
  • the host cell may be of any origin, including a bacterial or yeast cell, but is preferably a vertebrate host cell, more preferably a mammalian host cell.
  • the effector chain may be synthesised using methods which are known in the art.
  • the present invention also provides a host cell transformed with a vector encoding at least one heavy chain of a polypeptide complex of the present invention.
  • the host cell may be of any origin, including a bacterial or yeast cell, but is preferably a vertebrate host cell, more preferable a mammalian host cell.
  • the heavy chain may be synthesised using methods which are known in the art.
  • the present invention also provides a host cell transformed with a vector encoding at least one heavy chain and at least one effector chain of a polypeptide complex of the present invention.
  • the host cell may be of any origin, including a bacterial or yeast cell, but is preferably a vertebrate host cell, more preferable a mammalian host cell.
  • the chains may be synthesised independently and assembled using methods which are known in the art.
  • the present invention provides a transgenic organism expressing at least one heavy chain homo- or hetero-dimer polypeptide complex of the present invention.
  • the transgenic organism maybe a non-human vertebrate or mammal, a plant or an insect.
  • the present invention also provides a method for the production of class-specific heavy chain-only antibodies and VH domains thereof, according to the first aspect of the invention, by immunising a transgenic organism of the present invention with an antigen.
  • the organism is a mouse.
  • the heavy chain-only antibodies and polypeptide binding complexes of the invention have a great number of applications.
  • the heavy chain-only antibodies and polypeptide complexes of the invention comprise bi- and multi-specific polypeptide complexes. These complexes are particularly advantageous, eg as therapeutics for the treatment and prevention of infectious diseases.
  • the heavy chain-only antibodies and polypeptide binding complexes of the invention are useful for cytochemical labelling, targeting methods, therapy and diagnostics.
  • polypeptide complexes of the invention can be utilised, for example, to bridge polypeptide complexes between two cell types such as a pathogen and a macrophage, or a tumour cell and a T-cell.
  • the polypeptide complex may recognise two or more epitopes on the same pathogen with effector function being provided by the heavy chain constant region alone.
  • bi-specific polypeptide binding complexes may be used to target cells and tissues in vivo, then subsequently to capture circulating effector molecules or imaging agents.
  • bi-specific tumour targeting agents can be used to capture pro-drug converting complexes for the subsequent localised conversion of pro-drug to reactive agent.
  • Bi- and multi-specific binding complexes in combination with effector agents may also be used to bind and destroy one or more pathogens dependent on the selection of binding domains.
  • the presence of two or more binding domains which recognise different antigens on the same pathogen provide clinical advantages and reduce the likelihood of pathogen escape and drug redundancy as a result of mutation within the pathogen.
  • the present invention provides heavy chain-only antibodies or fragments thereof according to the first aspect of the invention, polypeptide chains and complexes according to the second aspect of the invention; and effector chains and polypeptide complexes according to the third aspect of the invention. All are suitable for pharmaceutical use in humans, and so the invention provides a pharmaceutical composition comprising a heavy chain-only antibody, polypeptide chain, effector chain or polypeptide complex of the present invention.
  • the invention also provides the use of a heavy chain-only antibody, a polypeptide chain, an effector chain or a polypeptide complex of the present invention in the preparation of a medicament for the prophylaxis and/or treatment of disease. Heavy and effector chains may be formulated together or separately, dependent on the manner of administration and action of the medicament.
  • compositions and medicaments will typically be formulated before administration to patients.
  • the heavy chain-only antibodies or polypeptide complexes may be mixed with stabilisers, particularly if they are to be lyophilised.
  • Addition of sugars eg mannitol, sucrose, or trehalose
  • a preferred stabiliser is mannitol.
  • Human serum albumin preferably recombinant
  • Mixtures of sugars can also be used, eg sucrose and mannitol, trehalose and mannitol, etc.
  • Buffer may be added to the composition, eg a Tris buffer, a histidine buffer, a glycine buffer or, preferably, a phosphate buffer (eg containing sodium dihydrogen phosphate and disodium hydrogen phosphate). Addition of buffer to give a pH between 7.2 and 7.8 is preferred, and in particular a pH of about 7.5.
  • a Tris buffer eg a Tris buffer, a histidine buffer, a glycine buffer or, preferably, a phosphate buffer (eg containing sodium dihydrogen phosphate and disodium hydrogen phosphate).
  • Addition of buffer to give a pH between 7.2 and 7.8 is preferred, and in particular a pH of about 7.5.
  • sterile water for injection may be used. It is also possible to reconstitute a lyophilised cake with an aqueous composition comprising human serum albumin (preferably recombinant).
  • the heavy chain-only antibodies and polypeptide complexes will be utilised in purified form together with pharmacologically appropriate carriers.
  • the invention thus provides a method for treating a patient, comprising administering a pharmaceutical composition of the invention to the patient.
  • the patient is preferably a human, and may be a child (eg a toddler or infant), a teenager or an adult, but will generally be an adult.
  • the invention also provides heavy chain-only antibodies, polypeptide chains, effector chains or a polypeptide complex of the invention for use as a medicament.
  • the invention also provides the use of the heavy chain-only antibodies, polypeptide chains, effector chains or chain polypeptide complexes of the invention in the manufacture of a medicament for treating a patient.
  • ⁇ ество are preferably for the treatment of one of the following diseases or disorders: wound healing, cell proliferative disorders, including neoplasm, melanoma, lung, colorectal, osteosarcoma, rectal, ovarian, sarcoma, cervical, oesophageal, breast, pancreas, bladder, head and neck and other solid tumours; myeloproliferative disorders, such as leukemia, non-Hodgkin lymphoma, leukopenia, thrombocytopenia, angiogenesis disorder, Kaposis' sarcoma; autoimmune/inflammatory disorders, including allergy, inflammatory bowel disease, arthritis, psoriasis and respiratory tract inflammation, asthma, immunodisorders and organ transplant rejection; cardiovascular and vascular disorders, including hypertension, oedema, angina, atherosclerosis, thrombosis, sepsis, shock, reperfusion injury, and ischemia; neurological disorders including central nervous system disease, Alzheimer's disease, brain
  • the present invention provides the use of a heavy chain-only antibody or polypeptide binding complex of the present invention as a diagnostic, prognostic, or therapeutic imaging agent. Furthermore, the present invention provides the use of a heavy chain homo- or hetero-dimer of the present invention alone or in combination with one or more effector (light) chains of the present invention as a therapeutic imaging agent, a cytochemical reagent or diagnostic agent.
  • the present invention provides the use of a heavy chain-only antibody or a fragment thereof as herein described as an intracellular binding reagent, or an abzyme.
  • Preferred heavy chain-only antibody fragments are soluble antigen-specific VH binding domains.
  • the present invention also provides, the use of an antigen-specific single chain antibody or VH binding domain according to the present invention as an enzyme inhibitor or receptor blocker.
  • Preferred heavy chain-only antibody fragments are soluble antigen-specific VH binding domains.
  • the present invention also provides the use of a V H domain fused to an effector molecule for use as a therapeutic, imaging agent, diagnostic, abzyme or reagent.
  • FIGS. 1A and 1B shows a polypeptide complex comprising a binding domain (V H ) dimerization domain (optionally C H 2, C H 3 and C H 4) and a effector moiety (EM). Binding domains and effector moieties may be positioned at the amino or carboxy terminal ends of the dimerization domains.
  • V H binding domain
  • EM effector moiety
  • FIGS. 2A and 2B shows different configurations of binding domains and the replacement of the effector moiety by further binding domains.
  • FIG. 3 shows a heavy chain polypeptide complex in association with an effector chain.
  • the effector chain comprises a complementary binding domain (CBD) and an effector moiety (EM).
  • CBD is recognised by EM of heavy chain.
  • CBD is fused to or part of effector, e.g. enzyme, toxin, chelator, imaging agent. Effector chain can be synthesized separately from heavy chain.
  • FIG. 4 shows a bivalent secretory IgA in association with a J chain.
  • FIG. 5 shows a multivalent heavy chain-only IgM-like polypeptide complex assembled via a J chain.
  • FIG. 6 shows the strategy for the generation of transgenic mice expressing an IgG locus and the functional generation of heavy chain-only antibodies and V H domains as a result of antigen challenge.
  • FIG. 7 shows the strategy for the generation of transgenic mice expressing an IgM locus and the functional generation of heavy chain-only antibodies and VH domains as a result of antigen challenge.
  • FIG. 8 shows the strategy for the generation of transgenic mice expressing an IgA locus and the functional generation of heavy chain-only antibodies and VH domains as a result of antigen challenge.
  • FIG. 9 Sequence alignment of the PCR products obtained from bone marrow cDNA using V HH 1 and V HH 2 primers in combination with human C ⁇ 2 primer from mice containing a locus with constant regions that have a camelid splice mutation to remove CH1. The results show that CH1 is not removed.
  • FIGS. 10-13 Structure of VH/camelid VH (VHH) constructs.
  • 1-n stands for any number of VH genes, or D or J segments.
  • the normal complement of the human locus is 51 V genes, 25 functional D segments (plus 2 non functional ones) and 6 J segments.
  • C ⁇ for IgM
  • C ⁇ for IgE
  • the VH genes(s) have been mutated to provide solubility as described in the public domain
  • VH genes, D and J segments and C exons are preferably human, but could be from any other species including camelids. In the latter case the camelid VH (VHH) genes would not be mutated as they are naturally soluble.
  • FIG. 14 Mouse immunization schedule and antibody assay for the generation of heavy chain-only IgG against E. Coli HSP70.
  • FIG. 15 Flow cytometric analysis and immunohistochemistry results for spleen cells derived from transgenic mice.
  • FIG. 16 Results of ELISA analysis of DKTP immunized transgenic mice and sequence analysis of resulting antibody library.
  • FIG. 17 Examples of somatic mutations and VDJ rearrangement seen in immunized transgenic mice.
  • FIG. 18 Results of immunostaining assay on Tet-on cell line transfected with response plasmid containing A5 antibody.
  • FIG. 19 Results of Western bolt analysis of sera of transgenic mouse lines.
  • FIG. 20 Size fractionation of human IgM mixed with human single chain IgM produced by the IgM plus IgG locus mice.
  • FIG. 21 Results of ELISA analysis of single chain IgM and IgG antibodies raised against human TNF ⁇ .
  • FIG. 22 shows a strategy for the generation of a homodimer plasmid with binding affinity for HSP70 and ⁇ GAG.
  • FIG. 23 Functional expression of homodimer polypeptide complex in CHO cells.
  • FIG. 24 demonstrates functional binding and simultaneous of homodimer polypeptide complex to alpha ⁇ GAG and HSP70.
  • a second variable region (VHH2 directed against gag) is cloned onto the carboxyterminal end of a heavy chain only antibody containing the other specificity (VHH1 directed against HSP70).
  • the hinge region between CH3 and VHH2 has been replaced by a linker region where all cysteines have been replaced by prolines (arrows).
  • Gag Rabbit polyclonal/Swine ⁇ rabbit-AP (blue).
  • HSP70 monoclonal/Goat ⁇ Human IgG-HRP (brown).
  • Diabody Goat ⁇ Human IgG-HRP (brown).
  • Lane 1 Gag/Diabody/BI21 cell lysate.
  • Lane 2 Gag/culture medium (is Diabody negative control)/BI21.
  • Lane 3 -milk-BSA/Diabody/BI21.
  • Lane 4 -milk-BSA/culture medium/BI21.
  • Lane 5 Gag/Diabody/-milk-BSA.
  • Lane 6 Gag/culture medium/-milk-BSA
  • FIG. 25 shows the strategy for the generation of homodimer polypeptide complexes, optionally in association with effector chains carrying IgA effector function
  • FIG. 26 shows the strategy for the generation of homodimer polypeptide complexes, optionally in association with effector chains carrying IgA effector function.
  • Any suitable recombinant DNA technique may be used in the production of the bi- and multi-valent polypeptide complexes, single heavy chain antibodies, and fragments thereof, of the present invention.
  • Typical expression vectors such as plasmids, are constructed comprising DNA sequences coding for each of the chains of the polypeptide complex or antibody. Any suitable established techniques for enzymic and chemical fragmentation of immunoglobulins and separation of resultant fragments may be used.
  • the present invention also provides vectors including constructs for the expression of heavy chain-only antibodies in transgenic mice and the construction and expression of polypeptide complaxes of the present invention.
  • a single vector may be constructed which contains the DNA sequences coding for more than polypeptide chain.
  • the DNA sequences encoding two different heavy chains may be inserted at different positions on the same plasmid.
  • the DNA sequence coding for each polypeptide chain may be inserted individually into a plasmid, thus producing a number of constructed plasmids, each coding for a particular polypeptide chain.
  • the plasmids into which the sequences are inserted are compatible.
  • Each plasmid is then used to transform a host cell so that each host cell contains DNA sequences coding for each of the polypeptide chains in the polypeptide complex.
  • Suitable expression vectors which may be used for cloning in bacterial systems include plasmids, such as Co1 E1, pcR1, pBR322, pACYC 184 and RP4, phage DNA or derivatives of any of these.
  • suitable expression vectors include plasmids based on a 2 micron origin.
  • Any plasmid containing an appropriate mammalian gene promoter sequence may be used in cloning in mammalian systems. Insect or bacculoviral promoter sequences may be used fir insect cell gene expression.
  • Such vectors include plasmids derived from, for instance, pBR322, bovine papilloma virus, retroviruses, DNA viruses and vaccinia viruses.
  • Suitable host cells which may be used for expression of the polypeptide complex or antibody include bacteria, yeasts and eukaryotic cells, such as insect or mammalian cell lines, transgenic plants, insects, mammalian and other invertebrate or vertebrate expression systems.
  • polypeptide complex also include homologous polypeptide and nucleic acid sequences obtained from any source, for example related cellular homologues, homologues from other species and variants or derivatives thereof.
  • the present invention encompasses variants, homologues or derivatives of the polypeptide complexes and antibodies as herein described.
  • a homologous sequence is taken to include an amino acid sequence which is at least 80, 85, 90, 95, 96, 97, 98, 99, 99.5, 99.6, 99.7, 99.8, 99.9% identical, preferably at least 98 or 99%, identical, at the amino acid level over at least 30, preferably 50, 70, 90 or 100 amino acids.
  • homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.
  • the present invention also includes constructed expression vectors and transformed host cells for use in producing the polypeptide complexes and antibodies of the present invention.
  • the individual heavy chains will be processed by the host cell to form the complete polypeptide complex or antibody which advantageously is secreted therefrom.
  • the effector chain is produced separately either by a host cell or by synthetic means.
  • the present invention provides a method for the production of the antibodies of the present invention comprising administering an antigen to a transgenic organism of the present invention.
  • the antibodies and polypeptide complexes produced from transgenic animals of the present invention include polyclonal and monoclonal antibodies and fragments thereof. If polyclonal antibodies are desired, the transgenic animal (e.g. mouse, rabbit, goat, horse, etc.) may be immunised with an antigen and serum from the immunised animal, collected and treated by known procedures. If serum containing polyclonal antibodies contains antibodies to other antigens, the polyclonal antibodies of interest can be purified by immunoaffinity chromatography and such like techniques which will be familiar to those skilled in the art. Techniques for producing and processing polyclonal antisera are also known in the art.
  • polypeptide complexes and antibodies including fragments thereof of the present invention may be employed in: in vivo therapeutic and prophylactic applications, in vitro and in vivo diagnostic applications, in vitro assay and reagent applications, and the like.
  • Therapeutic and prophylactic uses of the polypeptide complexes and antibodies of the invention involve the administration of the above to a recipient mammal, such as a human.
  • polypeptide complexes and antibodies including fragments thereof of at least 90 to 95% homogeneity are preferred for administration to a mammal, and 98 to 99% or more homogeneity is most preferred for pharmaceutical uses, especially when the mammal is a human.
  • the polypeptide complexes and heavy-chain-only antibodies as herein described may be used diagnostically or therapeutically (including extracorporeally) or in developing and performing assay procedures using methods known to those skilled in the art.
  • polypeptide complexes and antibodies of the present invention will be utilised in purified form together with pharmacologically appropriate carriers.
  • these carriers include aqueous or alcoholic/aqueous solutions, emulsions or suspensions, which may include saline and/or buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride and lactated Ringer's.
  • Suitable physiologically-acceptable adjuvants may be chosen from thickeners such as carboxymethylcellulose, polyvinylpyrrolidone, gelatin and alginates.
  • Intravenous vehicles include fluid and nutrient replenishers and electrolyte replenishers, such as those based on Ringer's dextrose. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents and inert gases, may also be present (Mack (1982) Remington's Pharmaceutical Sciences, 16th Edition).
  • polypeptide complexes and antibodies, including fragments thereof, of the present invention may be used as separately administered compositions or in conjunction with other agents. These can include various immunotherapeutic drugs, such as cyclosporine, methotrexate, adriamycin, cisplatinum or an immunotoxin. Alternatively, the polypeptide complexes can be used in conjunction with enzymes for the conversion of pro-drugs at their site of action.
  • compositions can include “cocktails” of various cytotoxic or other agents in conjunction with the selected antibodies of the present invention or even combinations of the selected antibodies of the present invention.
  • the route of administration of pharmaceutical compositions of the invention may be any of those commonly known to those of ordinary skill in the art.
  • the polypeptide complexes or antibodies of the invention can be administered to any patient in accordance with standard techniques.
  • the administration can be by any appropriate mode, including parenterally, intravenously, intramuscularly, intraperitoneally, transdermally, via the pulmonary route, or also, appropriately, by direct infusion with a catheter.
  • the dosage and frequency of administration will depend on the age, sex and condition of the patient, concurrent administration of other drugs, counter-indications and other parameters to be taken into account by the clinician.
  • polypeptide complexes and antibodies of this invention can be lyophilised for storage and reconstituted in a suitable carrier prior to use.
  • Known lyophilisation and reconstitution techniques can be employed. It will be appreciated by those skilled in the art that lyophilisation and reconstitution can lead to varying degrees of functional activity loss and that use levels may have to be adjusted upward to compensate.
  • polypeptide complexes and antibodies of the present invention may be used for diagnostic purposes.
  • antibodies as herein described may be generated or raised against antigens which are specifically expressed during disease states or whose levels change during a given disease states.
  • labels may be added. Suitable labels include, but are not limited to, any of the following: radioactive labels, NMR spin labels and fluorescent labels. Means for the detection of the labels will be familiar to those skilled in the art.
  • compositions containing the polypeptide complexes and antibodies of the present invention or a cocktail thereof can be administered for prophylactic and/or therapeutic treatments.
  • a composition containing one or more polypeptide complexes or antibodies of the present invention may be utilised in prophylactic and therapeutic settings to aid in the alteration, inactivation, killing or removal of a select target cell population in a mammal.
  • the selected repertoires of polypeptide complexes and antibodies described herein may be used extracorporeally or in vitro selectively to kill, deplete or otherwise effectively remove a target cell population from a heterogeneous collection of cells.
  • transgenic mice were prepared to express a heavy chain locus wherein two llama VHH exons were linked to the human heavy chain diversity (D) and joining (J) segments, followed by the C ⁇ , C ⁇ , C ⁇ 2, C ⁇ 3 human constant region genes and human heavy chain immunoglobulin 3′ LCR.
  • the human C ⁇ 2 and C ⁇ 3 genes contained a G to A splice mutation.
  • the presence of the Frt site enabled the generation of a single copy transgenic mouse from a multi-copy transgene array by Flp mediated recombination.
  • sequences from the transgenic locus with a G to A splice mutation showed aberrant splicing but incomplete CH1 removal ( FIG. 9 ).
  • VH genes were combined into a BAC vector by standard procedures such as direct cloning using custom made linkers or homologous recombination.
  • clones Two clones were selected from the human genomic Pac library RPCI-11 (BACPAC Recource Center, USA): clone 1065 N8 containing human heavy chain D and J segments, C ⁇ (IgM) and C ⁇ (IgD) and clone 1115 N15 containing the C ⁇ 3 (IgG3) genes.
  • Bac clone 11771 from a different human genomic library (Incyte Genomics, Calif., USA) was used as a source of C ⁇ 2 (IgG2) gene and the immunoglobulin heavy chain LCR (Mills et al. (1997) J. Exp Med., 15; 186(6):845-58).
  • any of the other Ig constant regions can be cloned from these BACs (IgA, IgE).
  • a complete deletion of CH1 exon was achieved by homologous recombination (Imam et al. (2001)) using sequences that flank the CH1 exon of each constant region.
  • An frt site could optionally be introduced in front of the C ⁇ switch region to allow the generation of single copy loci from multicopy loci by treatment with flp recombinase in vivo by standard means e.g. by breeding to rosa-flp mice ( FIG. 10 ).
  • VH genes, D and J segments and C and LCR exons were cloned into one BAC either by conventional restriction digestion and ligations or by homologous recombination (or a mixture of both) or any other cloning technique.
  • VHs genes preferably engineered human V H genes to provide solubility or camelid VHH genes
  • human D and J heavy chain segments and C ⁇ were cloned into a BAC.
  • C ⁇ region was cloned into the final BAC.
  • VHs genes preferably engineered human VH segments to provide solubility or camelid VHH genes
  • human D and J heavy chain segments C ⁇ (without CH1 but with CH4 exon), (optional C ⁇ ) and the modified human C ⁇ 2 and C ⁇ 3 genes and 3′ LCR were cloned into a BAC.
  • C ⁇ without CH1 but with CH4 exon
  • C ⁇ modified human C ⁇ 2 and C ⁇ 3 genes and 3′ LCR
  • VHs genes preferably engineered human VH genes to provide solubility or camelid VHH genes
  • C ⁇ with CH1 and CH4
  • C ⁇ with CH1 and CH4
  • C ⁇ modified human C ⁇ 2 and C ⁇ 3 genes and 3′ LCR
  • BAC was grown in 294 Cre E. coli strain (Buscholz et al.) and cre mediated recombination yielded bacteria producing an IgG only locus.
  • the final BAC was introduced into transgenic mice by standard microinjection of fertilized eggs or via embryonic stem cell transfection technology.
  • Transgenic loci were checked for integrity and number of copies by Southern blot analysis of tail DNA (Southern 1975) using 5′ and 3′ end locus probes. Founders were bred as lines in the ⁇ MT ⁇ / ⁇ background. Genotyping was done by standard PCR analysis using primers for each of the different regions of the locus. Sequence analysis of the RT-PCR products derived from BM cDNA of transgenic mice where the entire CH 1 exon from both the C ⁇ 2 and the C ⁇ 3 was been deleted (one with (HLL lines) and one without the C ⁇ and C ⁇ genes, showed that the transgenic loci are not only capable of VDJ recombination, but that the IgG transcripts resemble those found in llama and camel HCAbs.
  • Spleens were embedded in OCT compound. Frozen 5 ⁇ m cryostat sections were fixed in acetone and single or double labeled as previously described (Leenen et al. 1998). Monoclonal antibodies anti B220/RA3-6B2, anti-CD11c/N418 (Steinman et al., 1997), were applied as hybridoma culture supernatants. Peroxidase coupled goat anti-human IgG and anti-human IgM were from Sigma.
  • Second-step reagents were peroxidase labeled goat anti-rat Ig (DAKO, Glostrup, Denmark) or anti-hamster Ig (Jackson ImmunoResearch Laboratories, West Grove, Pa.) and goat anti-rat Ig alkaline phosphatase (Southern Biotechnology, Birmingham, Ala., USA).
  • FIG. 15 shows the immunohistochemical analysis of 5 ⁇ m frozen sections of spleens from ⁇ MT ⁇ / ⁇ , WT and HLL and HLL-MD transgenic mice in the ⁇ MT ⁇ / ⁇ background. Sections were stained with anti B220 (blue) for B cells and anti-CD 11c/N418 (brown) for dendritic cells. Arrows indicate the location of small clusters of B cells.
  • Single cell suspensions were prepared from lymphoid organs in PBS, as described previously (Slieker et al. 1993). Approximately 1 ⁇ 10 6 cells were incubated with antibodies in PBS/0.5% bovine serum albumin (BSA) in 96 well plates for 30 min at 4° C. Cells were washed twice in PBS/0.5% BSA. For each sample, 3 ⁇ 10 4 events were scored using a FACScan analyzer (Becton Dickinson, Sunnyvale, Calif.). FACS data were analyzed using CellQuest version 1.0 computer software. Four-color analysis was performed on a Becton Dickinson FACS Calibur.
  • BSA bovine serum albumin
  • mAbs were obtained from BD Pharmingen (San Diego, Calif.): FITC conjugated anti B220-RA3-6B2, PE conjugated anti CD19. FACS scan data of spleen cells, stained with anti-CD19 and anti-B220 are displayed in the bottom panel of FIG. 15 .
  • FIG. 1 On the left of the figure is a representation of Flp recombination in vivo by breeding HLL lines to a FlpeR transgenic line and supporting FACS scan data on spleen cells of the recombinant, showing B cell rescue as seen in the directly generated original HLL-MD lines.
  • FIG. 1 On the right is a representation of Cre recombination in vivo by breeding to Cag Cre transgenic line and FACS data on spleen cells of the single copy recombinant.
  • mice containing a heavy chain only antibody locus consisting of two llama VHH domains, human D and J regions and IgG2 and 3 constant regions (without a CH1 domain) were created.
  • mice 8 week old mice were immunized with either E. Coli heat shock protein 70 (hsp70). 20 ⁇ g or 5 ⁇ g of antigen with Specol adjuvant (IDDLO, Lelystadt, NL) was injected respectively s.c. on days 0, 14, 28, 42 and i.p. on day 50. Blood was taken on day 0, 14 and 45. After three boosts a low titer of antigen specific antibodies was detected in 1 out of 3 Hsp70 immunized HLL-MD1 mice ( FIG. 14 ).
  • IDDLO E. Coli heat shock protein 70
  • the anti-HSP 70 HCAb consists of the llama VHH segment closest to the D region (VHH 2) recombined to the human IgHD3-10 segment (acc.num.X13972) and the human IgHJ4-02 segment (acc.num.X86355). Although not at high frequency, the VHHs has a few mutations that give rise to the amino acid alterations seen in FIG. 9A when compared to the germ line configuration.
  • the RT-PCR analysis also showed only one productive IgH transcript in the hybridoma, suggesting that there are no other transcripts made.
  • the ⁇ HSP70 IgG2 antibody is secreted as heavy chain only dimer (Western blots under denaturing gel (dimer) and non denaturing gel (monomer) conditions FIG. 14 ).
  • Spleen cells were fused with Sp2-O-Ag14 myeloma cells (gift from R. Haperen) on day 56 using a ClonalCellTM-HY kit (StemCell Technologies, UK) according to the manufacturer's instructions.
  • mice containing a heavy chain only antibody locus consisting of two llama VHH domains, human D and J regions, a human IgM and IgG2 and 3 constant regions (all without a CH1 domain, FIG. 12 ) were immunized with TNF ⁇ to obtain HC-IgM antibodies.
  • One out of three mice showed positive sera in standard ELISA assays.
  • a standard myeloma fusion yielded a positive IgM hybridoma ( FIG. 16 ).
  • mice Blood from 15-25 weeks old mice was collected in EDTA coated tubes, spun for 15′ at room temperature (RT) and the supernatant diluted 1:5 in PBS.
  • a 96 well plate was coated for 2 h with 5 mg/ml of a goat anti human IgG (YES Biotechnology) or a goat anti human IgM (Sigma), washed with PBS, blocked for 1 h at RT with blocking solution (1.5% BSA/1.5% powder milk/0.1% tween 20/PBS) and washed three times with PBS.
  • Dilution series of serum samples and standards (human IgG2 or human IgM (Sigma, Zwijndrecht, NL)) were loaded and incubated for 2-4-h and the plates washed 6 times with PBS before addition of a secondary antibody (1:2000 diluted goat anti human IgG or goat anti human IgM coupled to HRP (Sigma, Zwijndrecht, NL)). All dilutions were done in a blocking solution. After 1-2 h incubation at RT and washing in PBS, POD substrate (Roche) was added.
  • the ELISA for the detection of antigen specific soluble sdAbs from the IgG2 phage library is shown in FIG. 16 .
  • Soluble sdAbs were used as primary antibodies on antigen-coated plates, followed by mouse ⁇ -myc antibody and HRP conjugated goat ⁇ -mouse antibody. POD was used as a substrate.
  • the bottom panel shows fingerprinting of clones with restriction enzyme Hinf I, showing 5 different inserts coding for sdAb against B. Pertusis.
  • Transformation into TG1 electro-competent cells yielded in a human single domain antibody library. Two rounds of selection were performed using panning on vaccine antigens adsorbed onto plastic (immunotubes coated with undiluted vaccine). Restriction analysis and sequencing were standard.
  • FIG. 17 shows some examples of somatic mutations of clones from non immunized mice (left panel) and immunized mice (right panel).
  • the mice were IgG only loci, immunized E. Coli hsp70, Pertussis lysate, tetanus toxoid.
  • grey shade is the IgG2 hinge region starting with ERKCCV
  • FIG. 18 shows immunostaining results of one of Tet-on cell line additionally transfected with the response plasmid containing A5 antibody (Dekker et al. 2003).
  • the upper panel shows doxycicline induced production of A5 antibody (red) in cytoplasm and nuclear staining of the cells with DAPI (blue).
  • Lower panel shows that cells expressing rtTA in nucleus are the ones producing the A5 upon induction (upper panel).
  • Staining was done with one of the human HCAb against rtTA (green) with the sequence shown below.
  • the FITC conjugated goat anti human IgG was used as a secondary step.
  • A5 was detected as previously described by Dekker et al 2003.
  • the rTTA antibody was an IgG3 with the following sequence:
  • the IgG3 hinge starts at amino acid 198 ELKTPL. For comparison see the IgG2 hinge region in FIG. 17 .
  • FIG. 19 shows Western blots of sera of different transgenic mouse lines containing the IgM plus IgG locus ( FIG. 10 ) after cre treatment (ie IgM deleted, only IgG left). Sera were purified by prot G and gel fractionated under reducing ( FIG. 19 right panel) and non reducing ( FIG. 19 , left panel) conditions. The controls were the background KO mice and a normal human serum sample. Note the size difference between the two gels showing that the human heavy chain only IgG is a dimer.
  • the signal shown in FIG. 19 was detected with an anti-human IgG antibody by standard procedures.
  • the serum from the IgM plus IgG mice ( FIG. 13 ) was fractionated by gel filtration under non reducing conditions after mixing with a human serum sample as a control. Results are shown in FIG. 20 .
  • Molecular weights of the complexes on the column decrease with each lane (representing each fraction) from left to right.
  • the fractions (each lane) were analysed by gel electrophoresis under reducing conditions.
  • FIG. 21 The top two rows in FIG. 21 were analysed with an anti-human IgG, the next two rows with an anti human IgM.
  • the serum samples show that the mouse has generated both IgG and IgM anti-TNF ⁇ antibodies.
  • the single arrow shows a positive IgM hybridoma.
  • the wells were coated with commercially available human TNF ⁇ . All procedures were standard.
  • the bi-specific bi-valent antibody was generated by combining two heavy chain only mono-specific antibodies.
  • the first antibody forms the backbone bringing in the first specificity and the effector functions (variable region and constant region respectively).
  • This hinge was similar to the existing IgG2 hinge sequence but was altered by replacing the cysteins with prolines to prevent crosslinking of the cysteins in the antibody dimer and providing extra flexibility via the prolines to prevent the second antibody being spatially constrained, which otherwise may have inhibited its function.
  • the starting backbone antibody was an antibody raised against the E. coli HSP70 protein.
  • the HSP70 antigen was injected into transgenic mice that contained a heavy chain only antibody locus as described in (see above FIG. 14 ).
  • a monoclonal antibody was raised from these animals by standard hybridoma fusion technology (see above).
  • the cDNA coding for the ⁇ LHSP-antibody was subsequently cloned by standard RT-PCR recombinant DNA methods resulting in a plasmid containing a full length cDNA that included from the 5′ end to the 3′ end (in the protein from the N terminus to COOH terminus) the start codon ATG, the signal peptide sequence, the variable domain VHH1 (see Janssens et al.), the recombined D and J region and the constant region of C ⁇ 2 (lacking a CH1 region), but including the stop codon and the polyA site ( FIG. 22 upper left).
  • the cDNA coding for the ⁇ HSP70 antibody was amplified by PCR for cloning using a forward primer and a reverse primer.
  • the forward primer was:
  • the reverse primer was: GAC AAGCTT TACCCGGAGACAGGGAGAGGC providing a HindIII cloning site (underlined) and remaining the normal stop codon.
  • the amplification therefore leads to a EcoRI/HindIII fragment containing an EcoRI site (underlined), an efficient translation start sequence (bold) and the normal start codon of the ⁇ HSP antibody gene (greyshade, see also FIG. 22 ).
  • the reverse 3′ end primer was: GAC AAGCTT TACCCGGAGACAGGGAGAGGC providing a HindIII cloning site (underlined) and removing the normal stop codon. This resulted in a fragment ( FIG. 22 left second from top) with an EcoRI site to clone onto a promoter sequence and a HindIII site for cloning the 5′ end onto the expression plasmid and the 3′ end onto a novel hinge sequence (see below). Lastly the fragment was cut with EcoRI and HindIII to provide the appropriate single stranded ends for cloning.
  • the second cloned antibody bringing in the second specificity comprised the VHH domain of a llama antibody against the pig retrovirus (PERV) gag antigen (Dekker et al., (2003) J. Virol., 77 (22): 12132-9, FIG. 22 top right).
  • the ⁇ gag was amplified via standard PCR amplification using the following primers:
  • the two antibody sequences were combined into one diabody sequence via the novel hinge.
  • the novel hinge was generated from two oligonucleotides that together form a double strand oligonucleotide with 5′ and 3′ overhangs (respectively HindIII and XhoI compatible) for cloning purposes. It was designed to be in frame with the end of the ⁇ HSP70 sequence and the start of the ⁇ gag sequence. Formation of the sulphide bridges normally present in the human IgG2 hinge, was prevented by replacing the cysteins (greyshade) with prolines (underlined). The prolines add extra flexibility to the hinge to allow the proper functioning of the second antibody domain that becomes connected to COOH terminus of the first antibody via the hinge.
  • the three fragments ( ⁇ HSP70 IgG2, hinge and ⁇ gag) were subsequently ligated into a bluescript (Pbluescript11 sk+) expression plasmid that contains a chicken actin promoter and a CMV enhancer sequence ( FIG. 22 , expression plasmid) by standard recombinant DNA technology.
  • a bluescript Pbluescript11 sk+ expression plasmid that contains a chicken actin promoter and a CMV enhancer sequence
  • the diabody expression plasmid was grown and cotransfected with the plasmid pGK-hygro (to allow the selection of transfected cells) by standard methods (Superfect) into CHO cells ( FIG. 23 ). Positive clones were selected in hygromycin containing medium and positively identified as expressing the diabody by performing a standard a gag ELISA (Dekker et al., J. Virol. 2003) of the growth medium containing secreted diabody by the CHO cells using an ⁇ human IgG-HRP detection.
  • the ELISA and the Western blot together show that the diabody is expressed and secreted into the medium as a dimer by the transfected CHO cells (at >70 ng/ml) and that the antibody can bind the HSP70 and gag antigens. However it does not show that the same dimer diabody molecule can bind both antigens at the same time.
  • the CHO clones were grown under the same standard conditions and in media (SIGMA hybridoma medium, serum-free) used for the collection of antibodies from hybridomas.
  • the samples were analysed by Western blot and therefore run on a 10% SDS-PAGE and blotted on nitrocellulose membrane.
  • the blot was blocked for two hrs with PBS-Milk-BSA and incubated with primary antibodies.
  • the products were visualized by standard methods using secondary antibodies coupled to enzymes that allow visual staining.
  • the reagent used were:
  • Gag Rabbit polyclonal (1:2000) 2 hrs RT ⁇ Diabody: Goat a human IgG-HRP (1:2500) 2 hrs RT ⁇ HSP70: Monoclonal G20-380 medium (1:2) 2 hrs RT.
  • Controls were carried out by leaving out one of the components or adding medium from CHO cells not producing diabodies ( FIG. 24 ), i.e; lacking no diabody application (medium from non transfected CO cells) and has therefore only gag (lane 2); lacking gag at the bottom of the well (replaced by milk protein) and should therefore have none of the products (lane 3); lacking gag and diabody and should have none of the products (lane 4); lacking HSP70 antigen (replaced by milk antigen) and should therefore have only the diabody and gag (lane 5); lacking HSP70 and diabody and should have only gag (lane 6).
  • bispecific IgA is essentially as described for IgG (above), but using in addition to the Vhsol, D and J, the constant region C ⁇ leading to the generation of IgA ( FIG. 25 ).
  • IgM insulin receptor
  • FIG. 26 right bottom after elimination of the multimerisation sequences, one can also generate multimers simply by co-expressing IgM's with different specificities ( FIG. 26 left bottom).
  • An expression vector encoding a polypeptide complex comprising: a heavy chain including a binding domain which binds to PSCA (prostate stem cell antigen), an assembly domain consisting the leucine zipper motif of Jun and antibody hinge, CH2 and CH3 domains; and a light chain including a complementary assembly domain consisting of the leucine zipper motif of Fos is constructed using molecular biology techniques as described in Sambrook et al ((1989) Molecular Cloning—A Laboratory Manual, Cold Spring Harbor Laboratory Press).
  • the expression vector is then transferred to a suitable host cell by conventional techniques to produce a transfected host cell for optimized expression of the vector.
  • the transfected or transformed host cell is then cultured using any suitable technique known to these skilled in the art to produce the polypeptide complex of the invention.
  • polypeptide complexes are purified by standard procedures of the art, including cross-flow filtration, ammonium sulphate precipitation and affinity column chromatography (e.g., protein A).
  • the soluble effector domain consisting of 3,3′-diindolylmethane (DIM) is then fused to the complementary assembly domain using techniques known to those skilled in the art.
  • An expression vector encoding the heavy chain of the polypeptide complex of the present invention comprising; a soluble VHH binding domain which binds to AFP (Alpha-Fetoprotein) and an assembly domain consisting the leucine zipper motif of Jun, and antibody hinge, CH2 and CH3 domains is constructed using molecular biology techniques as described in Sambrook et al.
  • a second expression vector encoding the light chain of the polypeptide complex of the present invention is also constructed. This comprises a complementary assembly domain consisting of the leucine zipper motif of Fos.
  • the expression vectors are then transferred to a suitable host cell by conventional techniques to produce a co-transfected host cell for optimized expression of the vector.
  • the transfected or transformed host cell is then cultured using any suitable technique known to these skilled in the art to produce the polypeptide complex of the invention.
  • polypeptide complexes are purified by standard procedures of the art, including cross-flow filtration, ammonium sulphate precipitation and affinity column chromatography (e.g., protein A).
  • the soluble effector domain consisting of 3,3′-diindolylmethane (DIM) is then fused to the complementary assembly domain using techniques known to those skilled in the art.
  • An expression vector encoding a polypeptide complex comprising: a heavy chain including a binding domain which binds to PSCA (prostate stem cell antigen), an assembly domain consisting VCAM and antibody hinge, CH2 and CH3 domains; and a light chain including a complementary assembly domain consisting of VLA-4 fused to ricin A toxin is constructed using molecular biology techniques as described in Sambrook et al.
  • the expression vector is then transferred to a suitable host cell by conventional techniques to produce a transfected host cell for optimized expression of the vector.
  • the transfected or transformed host cell is then cultured using any suitable technique known to these skilled in the art to produce the polypeptide complex of the invention.
  • polypeptide complexes are purified by standard procedures of the art, including cross-flow filtration, ammonium sulphate precipitation and affinity column chromatography (e.g., protein A).
  • An expression vector encoding a polypeptide complex comprising: a heavy chain including a binding domain which binds to PSCA (prostate stem cell antigen), an assembly domain consisting the leucine zipper motif of Jun and antibody hinge, CH2 and CH3 domains; and a light chain including a complementary assembly domain consisting of the leucine zipper motif of Fos and a soluble effector domain encoding purine nucleoside phosphorylase (PNP) is constructed using molecular biology techniques as described in Sambrook et al.
  • the expression vector is then transferred to a suitable host cell by conventional techniques to produce a transfected host cell for optimized expression of the vector.
  • the transfected or transformed host cell is then cultured using any suitable technique known to these skilled in the art to produce the polypeptide complex of the invention.
  • polypeptide complexes are purified by standard procedures of the art, including cross-flow filtration, ammonium sulphate precipitation and affinity column chromatography (e.g., protein A).
  • PNP converts fludarabine to the toxic metabolite 2-fluoroadenine which kills the cells that comprise the PNP enzyme and in addition diffuses to kill surrounding uninfected cells, a local bystander effect.
  • An expression vector encoding a first heavy chain of the polypeptide complex of the present invention comprising; a soluble VHH binding domain which binds to V3-PND region of glycoprotein antigen gp120 and an assembly domain consisting the leucine zipper motif of Jun and antibody hinge, CH2 and CH3 domains is constructed using molecular biology techniques as described in Sambrook et al.
  • a second expression vector encoding a second heavy chain of the polypeptide complex of the present invention is also constructed comprising: a soluble VHH binding domain which binds to GP-41, an assembly domain consisting of the leucine zipper motif of Jun and antibody hinge, CH2 and CH3 domains.
  • a third expression vector encoding the light chain of the polypeptide complex of the present invention is also constructed. This comprises a complementary assembly domain consisting of the leucine zipper motif of Fos.
  • the expression vectors are then transferred to a suitable host cell by conventional techniques to produce a co-transfected host cell for optimized expression of the vector.
  • the transfected or transformed host cell is then cultured using any suitable technique known to these skilled in the art to produce the polypeptide complex of the invention.
  • polypeptide complexes are purified by standard procedures of the art, including cross-flow filtration, ammonium sulphate precipitation and affinity column chromatography (e.g., protein A).
  • the soluble effector domain consisting of HIV-1 MN V3 (PND) peptide immunogen is then fused to the complementary assembly domain using techniques known to those skilled in the art.
  • An expression vector encoding a first heavy chain of the polypeptide complex of the present invention comprising: a soluble VHH binding domain which binds to V3-PND region of glycoprotein antigen constructed using molecular biology techniques as described in Sambrook et al ((1989) Molecular Cloning—A Laboratory Manual, Cold Spring Harbor Laboratory Press).
  • a second expression vector encoding a second heavy chain of the polypeptide complex of the present invention is also constructed comprising: a soluble VHH binding domain which binds to GP-41.
  • the two heavy chains are characterised in that the constant regions for the two heavy chains comprise identical ⁇ , CH2, CH3 and CH4 domains.
  • the expression vectors are then transferred a host cell which constitutively expresses a J chain by conventional techniques to produce a co-transfected host cell for optimized expression of the vector.
  • the transfected or transformed host cell is then cultured using any suitable technique known to these skilled in the art to produce the polypeptide complex of the invention.
  • polypeptide complexes are purified by standard procedures of the art, including cross-flow filtration, ammonium sulphate precipitation and affinity column chromatography (e.g., protein A).
  • the soluble effector domain consisting of HIV-1 MN V3 (PND) peptide immunogen is then fused to the complementary assembly domain using techniques known to those skilled in the art.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Biomedical Technology (AREA)
  • AIDS & HIV (AREA)
  • Zoology (AREA)
  • Diabetes (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Neurosurgery (AREA)
  • Rheumatology (AREA)
  • Cardiology (AREA)
  • Neurology (AREA)
  • General Engineering & Computer Science (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Communicable Diseases (AREA)
  • Orthopedic Medicine & Surgery (AREA)
US11/658,361 2004-07-22 2005-07-22 Binding molecules Abandoned US20090285805A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US12/645,684 US8921524B2 (en) 2004-07-22 2009-12-23 Binding molecules
US12/645,653 US8921522B2 (en) 2004-07-22 2009-12-23 Binding molecules
US13/013,156 US20110118444A1 (en) 2004-07-22 2011-01-25 Binding molecules
US13/837,402 US9353179B2 (en) 2004-07-22 2013-03-15 Binding molecules
US13/837,520 US9346877B2 (en) 2004-07-22 2013-03-15 Binding molecules
US15/953,622 US10906970B2 (en) 2004-07-22 2018-04-16 Methods of making heavy chain only antibodies using transgenic animals

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
GB0416392.9 2004-07-22
GB0416392A GB2416768A (en) 2004-07-22 2004-07-22 Heavy chain immunoglobulin complexes
GB0511881.5 2005-06-10
GB0511881A GB0511881D0 (en) 2005-06-10 2005-06-10 Binding molecules
PCT/GB2005/002892 WO2006008548A2 (en) 2004-07-22 2005-07-22 Binding molecules

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2005/002892 A-371-Of-International WO2006008548A2 (en) 2004-07-22 2005-07-22 Binding molecules

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12/645,653 Continuation US8921522B2 (en) 2004-07-22 2009-12-23 Binding molecules
US12/645,684 Continuation US8921524B2 (en) 2004-07-22 2009-12-23 Binding molecules

Publications (1)

Publication Number Publication Date
US20090285805A1 true US20090285805A1 (en) 2009-11-19

Family

ID=35431831

Family Applications (7)

Application Number Title Priority Date Filing Date
US11/658,361 Abandoned US20090285805A1 (en) 2004-07-22 2005-07-22 Binding molecules
US12/645,684 Active 2026-08-26 US8921524B2 (en) 2004-07-22 2009-12-23 Binding molecules
US12/645,653 Active 2026-12-22 US8921522B2 (en) 2004-07-22 2009-12-23 Binding molecules
US13/013,156 Pending US20110118444A1 (en) 2004-07-22 2011-01-25 Binding molecules
US13/837,520 Active 2026-02-14 US9346877B2 (en) 2004-07-22 2013-03-15 Binding molecules
US13/837,402 Active US9353179B2 (en) 2004-07-22 2013-03-15 Binding molecules
US15/953,622 Active US10906970B2 (en) 2004-07-22 2018-04-16 Methods of making heavy chain only antibodies using transgenic animals

Family Applications After (6)

Application Number Title Priority Date Filing Date
US12/645,684 Active 2026-08-26 US8921524B2 (en) 2004-07-22 2009-12-23 Binding molecules
US12/645,653 Active 2026-12-22 US8921522B2 (en) 2004-07-22 2009-12-23 Binding molecules
US13/013,156 Pending US20110118444A1 (en) 2004-07-22 2011-01-25 Binding molecules
US13/837,520 Active 2026-02-14 US9346877B2 (en) 2004-07-22 2013-03-15 Binding molecules
US13/837,402 Active US9353179B2 (en) 2004-07-22 2013-03-15 Binding molecules
US15/953,622 Active US10906970B2 (en) 2004-07-22 2018-04-16 Methods of making heavy chain only antibodies using transgenic animals

Country Status (21)

Country Link
US (7) US20090285805A1 (ko)
EP (6) EP1978032A3 (ko)
JP (3) JP2008512987A (ko)
KR (4) KR101457753B1 (ko)
CN (2) CN102659940B (ko)
AU (2) AU2005263994B2 (ko)
BR (1) BRPI0513577A (ko)
CA (1) CA2580336C (ko)
CY (2) CY1115762T1 (ko)
DK (3) DK2311874T3 (ko)
ES (3) ES2635497T3 (ko)
HU (1) HUE034335T2 (ko)
LT (1) LT2311874T (ko)
MX (2) MX2007000921A (ko)
PL (2) PL1776383T3 (ko)
PT (2) PT2311874T (ko)
RU (1) RU2398882C2 (ko)
SG (1) SG188080A1 (ko)
SI (2) SI2311874T1 (ko)
WO (1) WO2006008548A2 (ko)
ZA (3) ZA200701186B (ko)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110145937A1 (en) * 2009-12-10 2011-06-16 Regeneron Pharmaceuticals, Inc. Mice That Make Heavy Chain Antibodies
WO2012156981A1 (en) 2011-05-13 2012-11-22 Cadila Healthcare Limited Pharmaceutical compositions of lurasidone
WO2013121440A1 (en) 2012-02-13 2013-08-22 Cadila Healthcare Limited Process for preparing benzisothiazol-3-yl-peperazin-l-yl-methyl-cyclo hexyl-methanisoindol-1,3-dione and its intermediates
US10358497B2 (en) 2015-09-29 2019-07-23 Amgen Inc. Methods of treating cardiovascular disease with an ASGR inhibitor
WO2020247852A1 (en) 2019-06-07 2020-12-10 Amgen Inc. Bispecific binding constructs
US10881085B2 (en) 2014-03-21 2021-01-05 Regeneron Pharmaceuticals, Inc. Non-human animals that make single domain binding proteins
WO2021041920A1 (en) * 2019-08-28 2021-03-04 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
WO2021247812A1 (en) 2020-06-04 2021-12-09 Amgen Inc. Bispecific binding constructs
WO2022120033A1 (en) 2020-12-03 2022-06-09 Amgen Inc. Immunoglobuline constructs with multiple binding domains
US11419898B2 (en) 2018-10-17 2022-08-23 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
US11446332B2 (en) 2017-04-13 2022-09-20 Senti Biosciences, Inc. Combinatorial cancer immunotherapy

Families Citing this family (110)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7754208B2 (en) 2001-01-17 2010-07-13 Trubion Pharmaceuticals, Inc. Binding domain-immunoglobulin fusion proteins
MX2007000921A (es) 2004-07-22 2007-11-09 Univ Erasmus Medical Ct Moleculas de union.
NI200800032A (es) 2005-07-25 2009-03-23 Reducción de célula b utilizando moléculas de unión específicas cd37 y cd20
GB0601513D0 (en) * 2006-01-25 2006-03-08 Univ Erasmus Medical Ct Binding molecules 3
CA2638117A1 (en) * 2006-01-25 2007-08-30 Erasmus University Medical Center Rotterdam Generation of heavy-chain only antibodies in transgenic animals
GB0618345D0 (en) * 2006-09-18 2006-10-25 Univ Erasmus Binding molecules
MX2008015524A (es) * 2006-06-12 2009-01-13 Trubion Pharmaceuticals Inc Proteinas de union multivalentes monocatenarias con funcion efectora.
EP2102244A2 (en) 2006-12-19 2009-09-23 Ablynx N.V. Amino acid sequences directed against a metalloproteinase from the adam family and polypeptides comprising the same for the treatment of adam-related diseases and disorders
US20100062004A1 (en) 2006-12-19 2010-03-11 Ablynx N.V. Amino acid sequences directed against gpcrs and polypeptides comprising the same for the treatment of gpcr-related diseases and disorders
GB0706628D0 (en) * 2007-04-04 2007-05-16 Univ Erasmus Germ-line manipulation 1
AU2008259939B2 (en) 2007-06-01 2014-03-13 Open Monoclonal Technology, Inc. Compositions and methods for inhibiting endogenous immunoglobulin genes and producing transgenic human idiotype antibodies
WO2009013620A2 (en) * 2007-06-11 2009-01-29 Erasmus University Medical Center Rotterdam Homologous recombination
EP2173772A2 (en) * 2007-07-03 2010-04-14 Ablynx N.V. Providing improved immunoglobulin sequences by mutating cdr and/or fr positions
CA2706425A1 (en) 2007-11-27 2009-06-04 Ablynx N.V. Method for obtaining polypeptide constructs comprising two or more single domain antibodies
CA2710471C (en) 2007-12-26 2018-06-05 Biotest Ag Immunoconjugates targeting cd138 and uses thereof
CN101945892B (zh) 2007-12-26 2017-11-24 生物测试股份公司 用于改进对表达cd138的肿瘤细胞的靶向的方法和试剂
KR101626416B1 (ko) 2007-12-26 2016-06-01 바이오테스트 아게 Ｃｄ138 표적 물질 및 이의 용도
CA2720763A1 (en) 2008-04-07 2009-10-15 Ablynx Nv Amino acid sequences directed against the notch pathways and uses thereof
SI2132228T1 (sl) 2008-04-11 2011-10-28 Emergent Product Dev Seatle CD37 imunoterapevtik in kombinacija z njegovim bifunkcionalnim kemoterapevtikom
BRPI0911984A2 (pt) 2008-05-16 2016-09-20 Ablynx Nv sequências de aminoácidos direncionadas contra cxcr4 e outros compostos gpcrs compreendendo os mesmos
EP2669298A3 (en) 2008-05-23 2014-02-26 Ablexis, LLC Single variable immunoglobulin domain comprising VL-DH-JL
SI2285408T1 (sl) 2008-06-05 2019-02-28 Ablynx N.V. Aminokislinska zaporedja usmerjena proti proteinom ovojnicam virusa in polipeptidi, ki zaporedja vsebujejo za zdravljenje virusnih bolezni
US20100136584A1 (en) * 2008-09-22 2010-06-03 Icb International, Inc. Methods for using antibodies and analogs thereof
CN112715482B (zh) 2008-12-18 2022-11-11 伊拉兹马斯大学鹿特丹医学中心 表达人源化抗体的非人转基因动物及其用途
WO2010070145A2 (en) 2008-12-19 2010-06-24 Ablynx N.V. Method for generation of immunoglobulin sequences
WO2010079149A1 (de) 2009-01-09 2010-07-15 Ipk Gatersleben Fusionsantikörper
GB0905023D0 (en) * 2009-03-24 2009-05-06 Univ Erasmus Medical Ct Binding molecules
PL2564695T3 (pl) 2009-07-08 2015-10-30 Kymab Ltd Modele zwierzęce i cząsteczki terapeutyczne
US20120204278A1 (en) 2009-07-08 2012-08-09 Kymab Limited Animal models and therapeutic molecules
US9445581B2 (en) 2012-03-28 2016-09-20 Kymab Limited Animal models and therapeutic molecules
US8962807B2 (en) 2009-12-14 2015-02-24 Ablynx N.V. Single variable domain antibodies against OX40L, constructs and therapeutic use
US9120855B2 (en) 2010-02-10 2015-09-01 Novartis Ag Biologic compounds directed against death receptor 5
TWI586806B (zh) * 2010-04-23 2017-06-11 建南德克公司 異多聚體蛋白質之製造
CN113150121A (zh) 2010-08-02 2021-07-23 瑞泽恩制药公司 制造包含vl结构域的结合蛋白的小鼠
AR083784A1 (es) 2010-11-08 2013-03-20 Novartis Ag Polipeptidos de enlace de los receptores de quimiocina
WO2012122512A1 (en) * 2011-03-10 2012-09-13 Hco Antibody, Inc. Recombinant production of mixtures of single chain antibodies
UA117218C2 (uk) 2011-05-05 2018-07-10 Мерк Патент Гмбх Поліпептид, спрямований проти il-17a, il-17f та/або il17-a/f
CA2846322A1 (en) 2011-09-19 2013-03-28 Kymab Limited Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics
EP2761008A1 (en) 2011-09-26 2014-08-06 Kymab Limited Chimaeric surrogate light chains (slc) comprising human vpreb
US9253965B2 (en) 2012-03-28 2016-02-09 Kymab Limited Animal models and therapeutic molecules
ES2728301T3 (es) * 2012-03-13 2019-10-23 Novimmune Sa Anticuerpos biespecíficos fácilmente aislados con formato de inmunoglobulina nativa
US10251377B2 (en) 2012-03-28 2019-04-09 Kymab Limited Transgenic non-human vertebrate for the expression of class-switched, fully human, antibodies
GB2502127A (en) * 2012-05-17 2013-11-20 Kymab Ltd Multivalent antibodies and in vivo methods for their production
KR102229945B1 (ko) 2012-04-11 2021-03-18 더 유나이티드 스테이츠 오브 어메리카, 애즈 리프리젠티드 바이 더 세크러테리, 디파트먼트 오브 헬쓰 앤드 휴먼 서비씨즈 B-세포 성숙 항원을 표적화하는 키메라 항원 수용체
US9328174B2 (en) 2012-05-09 2016-05-03 Novartis Ag Chemokine receptor binding polypeptides
DK2931030T4 (da) 2012-12-14 2024-04-22 Omniab Inc Polynukleotider, der koder for graver-antistoffer med humane idiotyper, og dyr, der omfatter disse
PL2967012T3 (pl) 2013-03-14 2021-04-19 Erasmus University Medical Center Rotterdam Transgeniczne ssaki inne niż człowiek do wytwarzania przeciwciał
US10993420B2 (en) 2013-03-15 2021-05-04 Erasmus University Medical Center Production of heavy chain only antibodies in transgenic mammals
US9788534B2 (en) 2013-03-18 2017-10-17 Kymab Limited Animal models and therapeutic molecules
US11707056B2 (en) 2013-05-02 2023-07-25 Kymab Limited Animals, repertoires and methods
US9783593B2 (en) 2013-05-02 2017-10-10 Kymab Limited Antibodies, variable domains and chains tailored for human use
WO2015053887A1 (en) * 2013-09-05 2015-04-16 Igm Biosciences, Inc. Constant chain modified bispecific, penta- and hexavalent ig-m antibodies
CA2925723A1 (en) 2013-10-01 2015-04-09 Kymab Limited Animal models and therapeutic molecules
BR112016018313A8 (pt) 2014-02-10 2018-06-12 Igm Biosciences Inc Moléculas de ligação multiespecíficas iga
RU2723940C2 (ru) 2014-03-21 2020-06-18 Экс-Боди, Инк. Биспецифические антигенсвязывающие полипептиды
CA2941514A1 (en) 2014-03-21 2015-09-24 Regeneron Pharmaceuticals, Inc. Vl antigen binding proteins exhibiting distinct binding characteristics
EP3125920B1 (en) 2014-04-04 2020-12-23 Del Mar Pharmaceuticals Dianhydrogalactitol, diacetyldianhydrogalactitol or dibromodulcitol to treat non-small-cell carcinoma of the lung and ovarian cancer
PT3209698T (pt) 2014-10-22 2018-12-14 Crescendo Biologics Ltd Ratinhos transgénicos
EP3271403A1 (en) 2015-03-19 2018-01-24 Regeneron Pharmaceuticals, Inc. Non-human animals that select for light chain variable regions that bind antigen
RU2749674C2 (ru) 2015-07-29 2021-06-16 Аллерган, Инк. Антитела против ang-2, содержащие только тяжелую цепь
CN105384825B (zh) 2015-08-11 2018-06-01 南京传奇生物科技有限公司 一种基于单域抗体的双特异性嵌合抗原受体及其应用
JP2018523673A (ja) 2015-08-14 2018-08-23 アラーガン、インコーポレイテッドＡｌｌｅｒｇａｎ，Ｉｎｃｏｒｐｏｒａｔｅｄ Ｐｄｇｆに対する重鎖のみ抗体
WO2017053469A2 (en) 2015-09-21 2017-03-30 Aptevo Research And Development Llc Cd3 binding polypeptides
WO2018014260A1 (en) 2016-07-20 2018-01-25 Nanjing Legend Biotech Co., Ltd. Multispecific antigen binding proteins and methods of use thereof
RU2021137547A (ru) 2016-08-24 2022-01-11 Тенеобио, Инк. Трансгенные животные, отличные от человека, продуцирующие модифицированные антитела, содержащие только тяжелые цепи
CR20220578A (es) 2016-09-14 2023-01-17 Teneobio Inc Anticuerpos de unión a cd3
WO2018068201A1 (en) 2016-10-11 2018-04-19 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against ctla-4
EP3332637A1 (en) * 2016-12-09 2018-06-13 Universitätsklinikum Hamburg-Eppendorf Vhh-containing heavy chain antibody and production thereof
BR112019012354A2 (pt) 2016-12-21 2019-11-26 Teneobio Inc anticorpos apenas de cadeia pesada anti-bcma
CN110662421B (zh) 2017-01-19 2023-03-24 欧莫诺艾比公司 来自具有多个重链免疫球蛋白基因座的转基因啮齿类动物的人抗体
US11427642B2 (en) 2017-06-20 2022-08-30 Teneoone, Inc. Anti-BCMA heavy chain-only antibodies
JP7303126B2 (ja) 2017-06-20 2023-07-04 テネオバイオ， インコーポレイテッド 抗ｂｃｍａ重鎖のみ抗体
CN111133007A (zh) 2017-09-13 2020-05-08 特尼奥生物股份有限公司 与胞外酶结合的重链抗体
RU2756100C1 (ru) 2017-12-20 2021-09-28 Харбор Байомед (Шанхай) Ко., Лтд Антитела, связывающие ctla-4, и их применение
AU2018392088A1 (en) 2017-12-22 2020-08-13 Teneobio, Inc. Heavy chain antibodies binding to CD22
CN111699198B (zh) 2017-12-28 2023-09-05 南京传奇生物科技有限公司 针对tigit的单域抗体和其变体
US11713353B2 (en) 2018-01-15 2023-08-01 Nanjing Legend Biotech Co., Ltd. Single-domain antibodies and variants thereof against PD-1
KR20200138720A (ko) 2018-03-30 2020-12-10 난징 레전드 바이오테크 씨오., 엘티디. Lag-3에 대한 단일-도메인 항체 및 이의 용도
KR102115300B1 (ko) * 2018-06-01 2020-05-26 재단법인 목암생명과학연구소 항체 라이브러리 및 이를 이용한 항체 스크리닝 방법
EP3806630A4 (en) * 2018-06-13 2022-02-23 Crystal Bioscience Inc. PRODUCTION OF ANTIBODIES BY MODIFICATION OF AUTONOMOUS HEAVY CHAIN VARIABLE DOMAINS THROUGH GENE CONVERSION
WO2020018922A1 (en) 2018-07-20 2020-01-23 Teneobio, Inc. Heavy chain antibodies binding to cd19
GB2576914A (en) 2018-09-06 2020-03-11 Kymab Ltd Antigen-binding molecules comprising unpaired variable domains produced in mammals
WO2020087065A1 (en) 2018-10-26 2020-04-30 Teneobio, Inc. Heavy chain antibodies binding to cd38
WO2020169755A2 (en) 2019-02-20 2020-08-27 Harbour Antibodies Bv Antibodies
BR112021019334A2 (pt) 2019-04-05 2021-12-07 Teneobio Inc Anticorpos de cadeia pesada que se ligam ao psma
AU2020291938A1 (en) 2019-06-14 2022-01-20 Teneobio, Inc. Multispecific heavy chain antibodies binding to CD22 and CD3
JP2023507120A (ja) 2019-12-18 2023-02-21 テネオフォー， インコーポレイテッド Ｃｄ３８に結合する重鎖抗体
GB202003632D0 (en) 2020-03-12 2020-04-29 Harbour Antibodies Bv SARS-Cov-2 (SARS2, COVID-19) antibodies
TW202330622A (zh) 2020-04-29 2023-08-01 美商泰尼歐生物公司 具有經修飾重鏈恆定區之多特異性重鏈抗體
EP4121172A1 (en) 2020-04-29 2023-01-25 Teneobio, Inc. Multispecific heavy chain antibodies with modified heavy chain constant regions
EP4142791A1 (en) 2020-04-29 2023-03-08 TeneoOne, Inc. Methods of treating multiple myeloma
CR20220656A (es) 2020-06-30 2023-03-01 Teneobio Inc Unión de anticuerpos multiespecíficos a bcma
IL301137A (en) 2020-09-11 2023-05-01 Regeneron Pharma Identification and production of antigen-specific antibodies
GB202017555D0 (en) 2020-11-06 2020-12-23 Harbour Antibodies Bv Antibody-conjugated nanoparticles
TW202233684A (zh) 2020-11-18 2022-09-01 美商泰尼歐生物公司 結合於葉酸受體α之重鏈抗體
CN117042601A (zh) 2020-12-09 2023-11-10 特里安尼公司 纯重链抗体
KR20230147048A (ko) 2020-12-16 2023-10-20 리제너론 파마슈티칼스 인코포레이티드 인간화 Fc 알파 수용체를 발현하는 마우스
WO2022178255A2 (en) 2021-02-19 2022-08-25 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Single domain antibodies that neutralize sars-cov-2
CA3211138A1 (en) 2021-02-25 2022-09-01 Teneobio, Inc. Anti-psma antibodies and car-t structures
AU2022226565A1 (en) 2021-02-26 2023-08-31 Teneobio, Inc. Anti-muc1-c antibodies and car-t structures
TW202304994A (zh) 2021-04-02 2023-02-01 美商泰尼歐生物公司 促效性抗ｉｌ－２ｒ抗體及使用方法
WO2022216864A1 (en) 2021-04-06 2022-10-13 Teneobio, Inc. Anti-cd19 antibodies and car-t structures
AU2022259688A1 (en) 2021-04-16 2023-10-05 Teneobio, Inc. Anti-cd20 antibodies and car-t structures
WO2022235988A1 (en) * 2021-05-05 2022-11-10 Leveragen, Inc. Engineered non-human animals for producing antibodies
WO2022271987A1 (en) 2021-06-23 2022-12-29 TeneoFour, Inc. Anti-cd38 antibodies and epitopes of same
WO2023004197A1 (en) 2021-07-23 2023-01-26 Teneoten, Inc. Heavy chain antibodies binding to hepatitis b surface antigen
WO2023036982A1 (en) 2021-09-10 2023-03-16 Harbour Antibodies Bv Anti-sars2-s antibodies
GB202112935D0 (en) 2021-09-10 2021-10-27 Harbour Antibodies Bv Sars-cov-2 (sars2, covid-19) heavy chain only antibodies
WO2024077044A1 (en) 2022-10-05 2024-04-11 Amgen Inc. Combination therapies comprising t-cell redirecting therapies and agonistic anti-il-2r antibodies or fragments thereof
WO2024083843A1 (en) 2022-10-18 2024-04-25 Confo Therapeutics N.V. Amino acid sequences directed against the melanocortin 4 receptor and polypeptides comprising the same for the treatment of mc4r-related diseases and disorders

Family Cites Families (54)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0143151A3 (en) 1980-08-11 1985-07-10 BAUSCH & LOMB INCORPORATED Apparatus for use in an ophthalmic instrument
WO1988009344A1 (en) 1987-05-21 1988-12-01 Creative Biomolecules, Inc. Targeted multifunctional proteins
JP3771253B2 (ja) 1988-09-02 2006-04-26 ダイアックス コープ． 新規な結合タンパク質の生成と選択
JP2919890B2 (ja) 1988-11-11 1999-07-19 メディカル リサーチ カウンスル 単一ドメインリガンド、そのリガンドからなる受容体、その製造方法、ならびにそのリガンドおよび受容体の使用
US5175384A (en) 1988-12-05 1992-12-29 Genpharm International Transgenic mice depleted in mature t-cells and methods for making transgenic mice
US6150584A (en) * 1990-01-12 2000-11-21 Abgenix, Inc. Human antibodies derived from immunized xenomice
DK0710719T3 (da) 1990-01-12 2007-07-09 Amgen Fremont Inc Frembringelse af xenogene antistoffer
US6673986B1 (en) 1990-01-12 2004-01-06 Abgenix, Inc. Generation of xenogeneic antibodies
US5877397A (en) 1990-08-29 1999-03-02 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US7041871B1 (en) 1995-10-10 2006-05-09 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5843440A (en) 1990-10-03 1998-12-01 Redcell Canada, Inc. Cellular and serum protein anchors for modulating pharmacokinetics
AU8869291A (en) 1990-10-04 1992-04-28 University Of Virginia Alumni Patents Foundation, The Primate erythrocyte bound monoclonal antibody heteropolymers
PT1498427E (pt) * 1992-08-21 2010-03-22 Univ Bruxelles Imunoglobulinas desprovidas de cadeias leves
EP0739981A1 (en) 1995-04-25 1996-10-30 Vrije Universiteit Brussel Variable fragments of immunoglobulins - use for therapeutic or veterinary purposes
WO1998021355A1 (en) * 1996-11-15 1998-05-22 Life Technologies, Inc. Mutants of green fluorescent protein
EP0942968B1 (en) 1996-12-03 2008-02-27 Amgen Fremont Inc. Fully human antibodies that bind EGFR
EP0954978B1 (en) * 1998-03-12 2011-11-30 VHsquared Limited New products comprising inactivated yeasts or moulds provided with active antibodies
US7083950B2 (en) † 1998-09-25 2006-08-01 Regeneron Pharmaceuticals, Inc. High affinity fusion proteins and therapeutic and diagnostic methods for use
CA2634294A1 (en) * 2000-08-03 2002-02-14 Therapeutic Human Polyclonals, Inc. Production of humanized antibodies in transgenic animals
WO2002012467A2 (en) 2000-08-04 2002-02-14 Incyte Genomics, Inc. Drug metabolizing enzymes
US6596541B2 (en) 2000-10-31 2003-07-22 Regeneron Pharmaceuticals, Inc. Methods of modifying eukaryotic cells
US6992174B2 (en) * 2001-03-30 2006-01-31 Emd Lexigen Research Center Corp. Reducing the immunogenicity of fusion proteins
US20030022240A1 (en) 2001-04-17 2003-01-30 Peizhi Luo Generation and affinity maturation of antibody library in silico
GB0110029D0 (en) * 2001-04-24 2001-06-13 Grosveld Frank Transgenic animal
MXPA03011365A (es) 2001-06-13 2005-03-07 Genmab As Anticuerpos monoclonales humanos para el receptor de factor de crecimiento epidermico (egfr).
GB0115256D0 (en) 2001-06-21 2001-08-15 Babraham Inst Mouse light chain locus
ATE477280T1 (de) † 2001-06-28 2010-08-15 Domantis Ltd Doppelspezifischer ligand und dessen verwendung
US6880232B2 (en) 2001-09-26 2005-04-19 Intel Corporation Method of making an electrical inductor using a sacrificial electrode
JP2005289809A (ja) * 2001-10-24 2005-10-20 Vlaams Interuniversitair Inst Voor Biotechnologie Vzw (Vib Vzw) 突然変異重鎖抗体
US6755339B2 (en) † 2002-06-21 2004-06-29 Delphi Technologies, Inc. Fluxing apparatus for applying powdered flux
JP2006512895A (ja) * 2002-06-28 2006-04-20 ドマンティス リミテッド リガンド
GB0218030D0 (en) 2002-08-02 2002-09-11 Minos Biosystems Multi-submit protein production system
GB0228210D0 (en) * 2002-12-03 2003-01-08 Babraham Inst Single chain antibodies
GB0230203D0 (en) 2002-12-27 2003-02-05 Domantis Ltd Fc fusion
EP1597280B2 (en) 2003-02-26 2016-08-24 Institute for Research in Biomedicine Monoclonal antibody production by ebv transformation of b cells
WO2005070966A2 (en) † 2004-01-16 2005-08-04 Regeneron Pharmaceuticals, Inc. Fusion polypeptides capable of activating receptors
US7785903B2 (en) 2004-04-09 2010-08-31 Genentech, Inc. Variable domain library and uses
MX2007000921A (es) * 2004-07-22 2007-11-09 Univ Erasmus Medical Ct Moleculas de union.
US20060117398A1 (en) 2004-10-22 2006-06-01 Roland Buelow Suppression of endogenous immunoglobulin expression
EP1844073A1 (en) 2005-01-31 2007-10-17 Ablynx N.V. Method for generating variable domain sequences of heavy chain antibodies
MX2007014564A (es) 2005-05-20 2008-02-07 Ablynx Nv Anticuerpos de vhh de dominio unico contra el factor de von willebrand.
GB0618345D0 (en) 2006-09-18 2006-10-25 Univ Erasmus Binding molecules
CA2638117A1 (en) * 2006-01-25 2007-08-30 Erasmus University Medical Center Rotterdam Generation of heavy-chain only antibodies in transgenic animals
EP2016101A2 (en) 2006-05-09 2009-01-21 Genentech, Inc. Binding polypeptides with optimized scaffolds
US7731969B1 (en) 2006-12-06 2010-06-08 Neoclone Biotechnology International, Llc Methods for developing and producing antigen-specific antibody-producing cells
AU2008259939B2 (en) 2007-06-01 2014-03-13 Open Monoclonal Technology, Inc. Compositions and methods for inhibiting endogenous immunoglobulin genes and producing transgenic human idiotype antibodies
WO2009013620A2 (en) 2007-06-11 2009-01-29 Erasmus University Medical Center Rotterdam Homologous recombination
GB0905023D0 (en) 2009-03-24 2009-05-06 Univ Erasmus Medical Ct Binding molecules
CN110079550A (zh) 2009-12-10 2019-08-02 瑞泽恩制药公司 生产重链抗体的小鼠
RS59413B2 (sr) 2011-02-25 2023-06-30 Regeneron Pharma Adam6 miševi
WO2012122512A1 (en) 2011-03-10 2012-09-13 Hco Antibody, Inc. Recombinant production of mixtures of single chain antibodies
GB2502127A (en) 2012-05-17 2013-11-20 Kymab Ltd Multivalent antibodies and in vivo methods for their production
DK2931030T4 (da) 2012-12-14 2024-04-22 Omniab Inc Polynukleotider, der koder for graver-antistoffer med humane idiotyper, og dyr, der omfatter disse
US10993420B2 (en) 2013-03-15 2021-05-04 Erasmus University Medical Center Production of heavy chain only antibodies in transgenic mammals

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8754287B2 (en) 2009-12-10 2014-06-17 Regeneron Pharmaceuticals, Inc. Mice that make heavy chain antibodies
US9888675B2 (en) 2009-12-10 2018-02-13 Regeneron Pharmaceuticals, Inc. Mice that make heavy chain antibodies
US11234419B2 (en) 2009-12-10 2022-02-01 Regeneran Pharmaceuticals, Inc. Mice that make heavy chain antibodies
US20110145937A1 (en) * 2009-12-10 2011-06-16 Regeneron Pharmaceuticals, Inc. Mice That Make Heavy Chain Antibodies
WO2012156981A1 (en) 2011-05-13 2012-11-22 Cadila Healthcare Limited Pharmaceutical compositions of lurasidone
US9433620B2 (en) 2011-05-13 2016-09-06 Cadila Healthcare Limited Pharmaceutical compositions of lurasidone
WO2013121440A1 (en) 2012-02-13 2013-08-22 Cadila Healthcare Limited Process for preparing benzisothiazol-3-yl-peperazin-l-yl-methyl-cyclo hexyl-methanisoindol-1,3-dione and its intermediates
US9409899B2 (en) 2012-02-13 2016-08-09 Cadila Healthcare Limited Process for preparing benzisothiazol-3-yl-piperazin-1-yl-methyl-cyclo hexylmethanisoindol-1,3-dione and its intermediates
US10881085B2 (en) 2014-03-21 2021-01-05 Regeneron Pharmaceuticals, Inc. Non-human animals that make single domain binding proteins
US11066472B2 (en) 2015-09-29 2021-07-20 Amgen Inc. Methods of treating cardiovascular disease with an anti-ASGR antibody or binding fragments thereof
US10358497B2 (en) 2015-09-29 2019-07-23 Amgen Inc. Methods of treating cardiovascular disease with an ASGR inhibitor
US11446332B2 (en) 2017-04-13 2022-09-20 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
US11419898B2 (en) 2018-10-17 2022-08-23 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
WO2020247854A1 (en) 2019-06-07 2020-12-10 Amgen Inc. Bispecific binding constructs with selectively cleavable linkers
WO2020247852A1 (en) 2019-06-07 2020-12-10 Amgen Inc. Bispecific binding constructs
WO2021041920A1 (en) * 2019-08-28 2021-03-04 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
WO2021247812A1 (en) 2020-06-04 2021-12-09 Amgen Inc. Bispecific binding constructs
WO2022120033A1 (en) 2020-12-03 2022-06-09 Amgen Inc. Immunoglobuline constructs with multiple binding domains

Also Published As

Publication number Publication date
CN102659940B (zh) 2022-07-05
KR101443473B1 (ko) 2014-09-22
ES2440990T5 (es) 2022-10-25
CY1119561T1 (el) 2018-03-07
CN102659941A (zh) 2012-09-12
EP3272770B1 (en) 2023-12-20
EP2311874B1 (en) 2017-05-31
SI1776383T1 (sl) 2014-12-31
PT2311874T (pt) 2017-08-25
CY1115762T1 (el) 2017-01-25
JP5888893B2 (ja) 2016-03-22
AU2005263994B2 (en) 2011-03-24
US20100197897A1 (en) 2010-08-05
EP1864998A2 (en) 2007-12-12
JP2008512987A (ja) 2008-05-01
KR101151957B1 (ko) 2012-06-01
KR101457753B1 (ko) 2014-11-03
US20130345405A1 (en) 2013-12-26
WO2006008548A3 (en) 2006-06-01
EP1776383A2 (en) 2007-04-25
KR101422286B1 (ko) 2014-07-23
PT1776383E (pt) 2014-12-02
JP5855381B2 (ja) 2016-02-09
EP1776383B1 (en) 2014-08-20
KR20100133022A (ko) 2010-12-20
PL2311874T3 (pl) 2017-10-31
US9346877B2 (en) 2016-05-24
SG188080A1 (en) 2013-03-28
AU2005263994A1 (en) 2006-01-26
RU2007106728A (ru) 2008-08-27
AU2010212518A1 (en) 2010-09-16
US20100216974A1 (en) 2010-08-26
EP1864998A3 (en) 2007-12-19
EP4353819A2 (en) 2024-04-17
EP1978032A2 (en) 2008-10-08
DK2311874T3 (en) 2017-08-28
WO2006008548A2 (en) 2006-01-26
KR20120079179A (ko) 2012-07-11
US9353179B2 (en) 2016-05-31
US8921524B2 (en) 2014-12-30
ZA201301416B (en) 2014-12-23
EP3272770A1 (en) 2018-01-24
DK1776383T3 (da) 2014-11-03
ZA200701186B (en) 2009-12-30
LT2311874T (lt) 2017-11-27
CN102659941B (zh) 2016-01-20
EP2311874A2 (en) 2011-04-20
MX338603B (es) 2016-04-22
CA2580336C (en) 2016-07-19
CN102659940A (zh) 2012-09-12
EP2311874A3 (en) 2011-12-07
ES2635497T3 (es) 2017-10-04
US20110118444A1 (en) 2011-05-19
KR20070050927A (ko) 2007-05-16
PL1776383T3 (pl) 2015-02-27
US8921522B2 (en) 2014-12-30
CA2580336A1 (en) 2006-01-26
ES2440990T3 (es) 2014-01-31
US20180244765A1 (en) 2018-08-30
US20130344057A1 (en) 2013-12-26
KR20110102957A (ko) 2011-09-19
ZA200801820B (en) 2013-05-29
SI2311874T1 (sl) 2017-12-29
JP2012024087A (ja) 2012-02-09
BRPI0513577A (pt) 2008-05-06
DK1864998T4 (da) 2022-07-04
DK1864998T3 (da) 2014-01-13
EP1978032A3 (en) 2009-02-18
MX2007000921A (es) 2007-11-09
HUE034335T2 (en) 2018-02-28
EP1864998B1 (en) 2013-09-25
US10906970B2 (en) 2021-02-02
AU2010212518B2 (en) 2013-03-14
EP1864998B2 (en) 2022-06-22
JP2012005491A (ja) 2012-01-12
ES2523661T3 (es) 2014-11-28
RU2398882C2 (ru) 2010-09-10

Similar Documents

Publication Publication Date Title
US10906970B2 (en) Methods of making heavy chain only antibodies using transgenic animals
AU2011203061B2 (en) Binding molecules

Legal Events

Date Code Title Description
AS Assignment

Owner name: ERASMUS UNIVERSITY MEDICAL CENTRE ROTTERDAM, NETHE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:GROSVELD, FRANKLIN GERARDUS;JANSSENS, RICHARD WILHELM;DRABEK, DUBRAVKA;REEL/FRAME:020992/0399;SIGNING DATES FROM 20080408 TO 20080410

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION