EP1893639A2 - Neue cystein-verarmte hydrophobinfusionsproteine, deren herstellung und verwendung - Google Patents

Neue cystein-verarmte hydrophobinfusionsproteine, deren herstellung und verwendung

Info

Publication number
EP1893639A2
EP1893639A2 EP06763632A EP06763632A EP1893639A2 EP 1893639 A2 EP1893639 A2 EP 1893639A2 EP 06763632 A EP06763632 A EP 06763632A EP 06763632 A EP06763632 A EP 06763632A EP 1893639 A2 EP1893639 A2 EP 1893639A2
Authority
EP
European Patent Office
Prior art keywords
hydrophobin
polypeptides
sequence
polypeptides according
structural formula
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06763632A
Other languages
English (en)
French (fr)
Inventor
Thomas Subkowski
Marvin Karos
Hans-Georg Lemaire
Heiko Barg
Claus Bollschweiler
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF SE filed Critical BASF SE
Publication of EP1893639A2 publication Critical patent/EP1893639A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to novel hydrophobin infusion proteins, their preparation and use
  • Hydrophobins are small proteins of about 100 AA, which are characteristic of filamentous fungi and do not occur in other organisms. Recently, hydrophobin-like proteins have been discovered in Streptomyces coelicolor, also known as "chapliners,” which also have high surface-active properties, and at water-air interfaces can chapline into amyloid-like fibrils (Classen et al., 2003) Genes Dev 1714-1726; Elliot et al., 2003, Genes Dev. 17, 1727-1740).
  • Hydrophobins are in a water-insoluble form on the surface of various fungal structures, e.g. Aerial hyphae, spores, fruiting bodies, distributed.
  • the genes for hydrophobins could be isolated from ascomycetes, deuteromycetes and basidiomycetes.
  • Some fungi contain more than one hydrophobing, e.g. Schizophyllum commune, Coprinus cinereus, Aspergillus nidulans.
  • various hydrophobins are involved in different stages of fungal development. The hydrophobins are believed to be responsible for different functions (van Wetter et al., 2000, Mol. Microbiol., 36, 201-210, Kershaw et al., 1998, Fungal Genet., Biol, 1998, 23, 18-33).
  • hydrophobins As a biological function for hydrophobins, in addition to reducing the surface tension of water to generate aerial hyphae, the hydrophobization of spores is also described (Wösten et al., 1999, Curr. Biol., 19, 1985-88, Bell et al., 1992 , Genes Dev., 6, 2382-2394). Hydrophobins also serve to line gas channels in lichen fructoids and as components in the plant surface recognition system by fungal pathogens (Lugones et al., 1999, Mycol Res., 103, 635-640, Hamer & Talbot 1998, Curr. Opinion Microbiol. , Vol. 1, 693-697). Complementation experiments have shown that hydrophobins can functionally replace to some degree within a class.
  • the hitherto known hydrophobins can be prepared by conventional protein-chemical cleaning and isolation methods only in moderate yield and purity. Attempts to provide larger quantities of hydrophobins using genetic engineering have also been unsuccessful.
  • the object was to provide novel hydrophobins and their production process, which allow an economical production of hydrophobins and their use in various technical fields.
  • the invention relates to polypeptides of the general structural formula (I)
  • X is any of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, Gly) and the indices standing at X represent the number of amino acids, the indices n and m being numbers between 0 and 500, preferably between 15 and 300, p being a number between 1 and 250, preferably 1-100 , and C is cysteine, alanine, serine, glycine, methionine or threonine, wherein at least four of the radicals named C are cysteine, with the proviso that at least one of the peptide sequences abbreviated by X n or X n , or X p represents is a peptide sequence which is at least 20 amino acids long and which is not naturally linked to a hydrophobin which, after coating a glass surface, causes a change in the contact angle of at least
  • the amino acids designated C 1 to C 8 are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular should be at least 7 of the positions C 1 to C 8 consist of cysteines. Cysteines can either be reduced in the proteins according to the invention or form disulfide bridges with one another. Particularly preferred is the intramolecular formation of CC bridges, in particular those having at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.
  • cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions indicated by X, the numbering of the individual C-positions in the general formulas may change accordingly.
  • polypeptides are those of the general formula (II)
  • X is any of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, Gly) and the indices standing at X represent the number of amino acids, the indices n and m being numbers between 2 and 300 and C being cysteine, alanine, serine, glycine, methionine or threonine, at least four of the radicals designated C.
  • X n or X m represents a peptide sequence which is at least 35 amino acids in length, which is naturally not linked to a hydrophobin which after coating a glass surface has a contact angle change of at least 20 ° cause.
  • X is any of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, Gly) and the indices standing at X represent the number of amino acids, the indices n and m being numbers between 0 and 200 and C being cysteine, alanine, serine, glycine, methionine or threonine, at least six of which are denoted by C.
  • At least one of the peptide sequences abbreviated by X n or X m is a peptide sequence of at least 40 amino acids, which is not naturally linked to a hydrophobin which, after coating a glass surface, changes the contact angle of cause at least 20 °.
  • the hydrophobins mentioned are structurally characterized in the sequence listing below. It is also possible to link together a plurality of hydrophobins, preferably 2 or 3, of the same or different structure and to link them to a corresponding suitable polypeptide sequence which is not naturally associated with a hydrophobin.
  • Particularly preferred embodiments of the present invention are the novel proteins having the polypeptide sequences shown in SEQ ID NO: 20, 22, 24 and the nucleic acid sequences coding therefor, in particular the sequences according to SEQ ID NO: 19, 21, 23. Also proteins which are starting from those shown in SEQ ID NO. 22, 22 or 24 represented by exchange, insertion or deletion of at least one, up to 10, preferably 5, more preferably 5% of all amino acids, and still have the biological property of the starting proteins to at least 50%, are particularly preferred embodiments.
  • the biological property of the proteins is understood to mean the change in the contact angle as described in Example 10.
  • the proteins according to the invention carry at least one position, which is abbreviated X n or X m or X p , a polypeptide sequence of at least 20, preferably at least 35, more preferably at least 50 and especially at least 100 amino acids (also referred to as fusion partners hereinafter) that are not naturally is linked to a hydrophobin.
  • X n or X m or X p a polypeptide sequence of at least 20, preferably at least 35, more preferably at least 50 and especially at least 100 amino acids (also referred to as fusion partners hereinafter) that are not naturally is linked to a hydrophobin.
  • the fusion partner portion can be selected from a variety of proteins. It is also possible to link several fusion partners with one hydrophobin part, for example at the amino terminus (X n ) and at the carboxy terminus (X m ) or in the middle (Xp) of the hydrophobin part. However, it is also possible, for example, to link two fusion partners with a position (X n or X n ,) of the protein according to the invention.
  • Particularly preferred fusion partners are those polypeptide sequences which result in the protein according to the invention being able to coat glass surfaces and the protein-treated glass surface becoming resistant to a detergent treatment as described in detail in the experimental part (Example 10) (eg 1%). SDS / 80 ° C / 10 min).
  • fusion partners are polypeptides that occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis.
  • fusion partners are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NO: 17 and 18), and thioredoxin.
  • fragments or derivatives of said sequences which comprise only a part, preferably 10-90%, particularly preferably 25-75% of said sequences.
  • a deletion at the C-terminal end is preferred; for example, a yaad fragment which consists only of the first 75 N-terminal amino acids, or in which individual amino acids, or nucleotides are changed from the said sequence.
  • additional amino acids in particular two additional amino acids, preferably the amino acids Arg, Ser, can be added at the C-terminal end of the sequences yaad and yaae.
  • additional amino acids may preferably be inserted in relation to the naturally occurring sequence, for example amino acid No. 2 (Gly) in SEQ ID NO: 17 and 18.
  • fusion partners especially those at the position X p in the general formula (I) are enzymatically active domains, antimicrobial domains, agonistic / antagonistic polypeptide sequences on receptors, colorants, flavors and odors, metal-binding domains .
  • selective coupling sites for the covalent bonding of various active substances and effect substances can be created.
  • additional lysines can be added to this loop in order to specifically couple active substances and effect substances to the hydrophobin molecule backbone via the primary amino group with the aid of the heterobifunctional linkers known to the person skilled in the art.
  • additional amino acids can also be inserted at the junctions of two fusion partners, which result from the fact that recognition sites for restriction endonucleases are either newly created or inactivated at the nucleic acid level.
  • proteins according to the invention may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical crosslinking, for example with glutaraldehyde.
  • a characteristic of the proteins according to the invention is the change of surface properties when the surfaces are coated with the proteins.
  • the change in the surface properties can be determined experimentally by measuring the contact angle of a water drop before and after coating the surface with the protein according to the invention and determining the difference between the two measurements.
  • the proteins according to the invention have the property of increasing the contact angle by at least 20, preferably 25, more preferably 30 degrees.
  • the assembled membranes of class I hydrophobins are highly insoluble (even against 1% SDS at elevated temperature) and can only be dissociated by concentrated trifluoroacetic acid (TFA) or formic acid.
  • the assembled forms of class II hydrophobins are less stable. They can already be redissolved by 60% ethanol or 1% SDS (at room temperature). This high stability towards solvents and detergents is a special property of the hydrophobins and distinguishes coatings with the polypeptides according to the invention from "unspecific" protein coatings, as they form a large number of proteins on surfaces.
  • a comparison of the amino acid sequences shows that the length of the region between cysteine C 3 and C 4 in class II hydrophobins is significantly shorter than in class I hydrophobins.
  • Class II hydrophobins continue to have more charged amino acids than Class I.
  • Another object of the invention are methods for preparing the proteins according to the invention.
  • These polypeptides can be prepared chemically by known methods of peptide synthesis, for example by solid phase synthesis according to Merrifield.
  • nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular a DNA sequence are combined such that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence.
  • Suitable host organisms may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus. megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacilli, Hansenula polymorph, Trichoderma reesei, SF9 (or related cells), and the like.
  • prokaryotes including archaea
  • eukaryotes especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus. megaterium, Aspergillus oryzea,
  • the invention furthermore relates to expression constructs comprising, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide according to the invention, and also vectors comprising at least one of these expression constructs.
  • Such constructs according to the invention preferably comprise a promoter 5 "upstream from the respective coding sequence and a terminator sequence 3" downstream and optionally further conventional regulatory elements, in each case operatively linked to the coding sequence.
  • an 'operative link' is meant the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory Elements such that each of the regulatory elements can fulfill its function in the expression of the coding sequence as intended.
  • operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like.
  • Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. As described in Goeddel, Gene Expression Technolgy: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • a preferred nucleic acid construct advantageously also contains one or more of the already mentioned “enhancer” sequences operably linked to the promoter which allow for increased expression of the nucleic acid sequence. Also at the 3 1 - end of the DNA sequences additional advantageous sequences can be inserted, such as other regulatory elements or terminators.
  • the nucleic acids according to the invention can be contained in one or more copies in the construct.
  • the construct may also contain further markers, such as antibiotic resistance or auxotrophic complementing genes, optionally for selection on the construct.
  • Advantageous regulatory sequences for the process according to the invention are, for example, in promoters such as cos, tac, trp, tet, trp tet, lpp, lac, lpp-lac, laclq-T7, T5, T3 gal, trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which are advantageously used in gram-negative bacteria.
  • Further advantageous regulatory sequences are contained, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.
  • the nucleic acid construct, for expression in a host organism is advantageously inserted into a vector, such as a plasmid or a phage, which allows for optimal expression of the genes in the host.
  • a vector such as a plasmid or a phage
  • all other vectors known to the person skilled in the art ie, z.
  • Viruses such as SV40, CMV, baculovirus and adenovirus, transposon JS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system.
  • vectors can be autonomously replicated in the host organism or replicated chromosomally. These vectors represent a further embodiment of the invention.
  • Suitable plasmids are described, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, PLN-3-lll lI B1, tgt11 oderpBdCI, in StreptomycesplJ101, plJ364, pIJ702 oderplJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacteri- to pSA77 or pAJ667, in fungi pALS1, PLL2 or pBB116, in yeasts 2alpha , pAG-1,
  • plasmids mentioned represent a small selection of the possible plasmids. Further plasmids are well known to the person skilled in the art and can be found, for example, in the book Cloning Vectors (Eds. Pouwels PH et al., Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018).
  • the nucleic acid construct for expression of the other genes contained additionally 3 'and / or ⁇ '-terminal regulatory sequences to increase the expression, which are selected depending on the selected host organism and gene or genes for optimal expression.
  • genes and protein expression are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
  • the regulatory sequences or factors can thereby preferably influence the gene expression of the introduced genes positively and thereby increase.
  • enhancement of the regulatory elements can advantageously be achieved at the transcriptional level by using strong transcription signals such as promoters and / or enhancers.
  • a translation enhancement is also possible, for example by improving the stability of the mRNA.
  • the nucleic acid construct according to the invention or the nucleic acid according to the invention can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination.
  • This linear DNA can consist of a linearized vector such as a plasmid or only of the nucleic acid construct or of the nucleic acid according to the invention.
  • An expression cassette according to the invention is produced by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator or polyadenylation signal.
  • common recombination and cloning techniques are used, as described, for example, in T. Maniatis, EFFritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989) and in TJ Silhavy , ML Berman and LW Enquist, Experiments with Gene Fusions, CoId Spring Harbor Laboratory, ColD Spring Harbor, NY (1984) and in Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
  • the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector for expression in a suitable host organism, which enables optimal expression of the genes in the host.
  • Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors” (Pouweis P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985).
  • recombinant microorganisms can be produced which, for example, are transformed with at least one vector according to the invention and can be used for the production of the polypeptides according to the invention.
  • the above described Recombinant constructs are introduced into a suitable host system and expressed.
  • homologously recombined microorganisms can also be produced.
  • a vector is produced which contains at least a portion of a gene according to the invention or of a coding sequence in which optionally at least one amino acid deletion, addition or substitution has been introduced in order to modify the sequence according to the invention, e.g. B. functionally disrupted ("knockout" - vector).
  • the introduced sequence can, for. B. also be a homologue of a related microorganism or be derived from a mammalian, yeast or insect source.
  • the vector used for homologous recombination may be such that the endogenous gene is mutated or otherwise altered upon homologous recombination, but still encodes the functional protein (eg, the upstream regulatory region may be so altered). that thereby the expression of the endogenous protein is changed).
  • the altered section of the gene according to the invention is in the homologous recombination vector.
  • suitable vectors for homologous recombination is e.g. As described in Thomas, K.R. and Capecchi, M.R. (1987) Cell 51: 503.
  • prokaryotic or eukaryotic organisms are suitable as recombinant host organisms for the nucleic acid according to the invention or the nucleic acid construct.
  • microorganisms such as bacteria, fungi or yeasts are used as host organisms.
  • gram-positive or gram-negative bacteria preferably bacteria of the families Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, more preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus are used ,
  • mini- Croorganisms are usually in a liquid medium containing a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese, magnesium salts and optionally vitamins, at Te Temperatures between O C and 100 C, preferably between 10 C to 60 C attracted under oxygen fumigation.
  • a carbon source usually in the form of sugars
  • a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate
  • trace elements such as iron, manganese, magnesium salts and optionally vitamins
  • Te Temperatures between O C and 100 C, preferably between 10 C to 60 C attracted under oxygen fumigation.
  • the pH of the nutrient fluid can be kept at a fixed value, that is regulated during the cultivation or not.
  • the cultivation can be done batchwise, semi-batchwise or continuously.
  • Nutrients can be presented at the
  • the invention furthermore relates to processes for the recombinant production of polypeptides according to the invention or functional, biologically active fragments thereof, which comprises cultivating a polypeptide-producing microorganism, optionally inducing the expression of the polypeptides and isolating them from the culture.
  • the polypeptides can thus also be produced on a large-scale if desired.
  • the recombinant microorganism can be cultured and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989).
  • the cells are then disrupted if the polypeptides are not secreted into the culture medium and the product recovered from the lysate by known protein isolation techniques.
  • the cells can optionally by high-frequency ultrasound, by high pressure, such. In a French pressure cell, by osmolysis, by the action of detergents, enzymes or organic solvents, by homogenizers or by combining several of the listed methods.
  • Purification of the polypeptides can be achieved by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography. and other conventional methods such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, FG, Biochemische Harvey Methoden, Verlag Water de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
  • vector systems or oligonucleotides for the isolation of the recombinant protein, which extend the cDNA to certain nucleotide sequences and thus encode altered polypeptides or fusion proteins, the z. B. serve a simpler cleaning.
  • suitable modifications are, for example, anchors known as tags, such as the modification known as hexa-histidine anchors, or epitopes that can be recognized as antigens of antibodies (described, for example, in Harlow, E.
  • Suitable tags include HA, calmodulin-BD, GST, MBD, chitin-BD, streptavidin-BD-Avi-Tag, Flag-Tag, T7, etc.
  • anchors may be used to attach the proteins to a solid support, such as a polymer matrix, which may, for example, be filled in a chromatography column or used on a microtiter plate or other support are available from the commercial affinity tag providers.
  • hydrophobins Due to the exceptional properties of hydrophobins for coating surfaces (e.g., resistant to detergents such as 1% SDS solution), these proteins have high potential for numerous industrial applications.
  • these patents cite examples of such applications, which are hereby incorporated by reference for the use of hydrophobins. No. Prio applicant
  • hydrophobins especially those of class I failed so far on an efficient manufacturing and cleaning method.
  • hydrophobin proteins of this invention possess both in their fused form, i. together with the fusion partner portion, as well as in isolated form, the desirable properties of hydrophobins.
  • the proteins according to the invention can be used as "pure" hydrophobins both directly as fusion proteins and after cleavage and separation of the fusion partner.
  • a potential cleavage site (specific recognition site for proteases) in the fusion protein between the hydrophobin part and the fusion partner part.
  • Suitable cleavage sites are, in particular, those peptide sequences which are otherwise found neither in the hydrophobin part nor in the fusion partner part, which can easily be determined with bioinformatic tools.
  • Particularly suitable are, for example, BrCN cleavage on methionine, or protease-mediated cleavage with factor Xa, enterokinase, thrombin, TEV cleavage (Tobacca etch virus protease).
  • oligonucleotides Hal570 and Hal571 (HaI 572 / HaI 573) a polymerase chain reaction was carried out.
  • the PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site.
  • the PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII.
  • This DNA fragment was used as insert, and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BglI.
  • the resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS 6 and YAAE :: HIS 6
  • Hal570 gcgcgcccatggctcaaacaggtactga
  • Hal571 gcagatctccagccgcgttcttgcatac
  • Hal572 ggccatgggattaacaataggtgtactagg
  • Hal573 gcagatcttacaagtgccttttgcttatattcc
  • the oligonucleotides KaM 416 and KaM 417 Using the oligonucleotides KaM 416 and KaM 417, a polymerase chain reaction was carried out.
  • the template DNA used was genomic DNA of the mold Aspergillus nidulans.
  • the resulting PCR fragment contained the coding sequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase cleavage site.
  • the PCR fragment was purified and cut with the restriction endonuclease Barn HI. This DNA fragment was used as insert and cloned into vector pQE60YAAD # 2 previously linearized with restriction endonuclease BglII.
  • the resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS 6 .
  • KaM416 GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
  • the antimicrobial test is carried out in 6-well microtiter plates. These are filled with the agar required for appropriate growth. (LB, YM). The plates are then inoculated with overnight cultures. The following microorganisms are under test.
  • plasmid # 513 The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
  • KaM434 GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
  • plasmid # 507 The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • Plasmid # 506 The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • the template DNA was an artificially synthesized DNA sequence - hydrophobin
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT-
  • GAAGTTCTCCGTCTCCGC KaM418 CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
  • Plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.
  • the template DNA used was Schyzophyllum commune cDNA (see Appendix).
  • KaM464 CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
  • KaM465 GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
  • 100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 mM sodium phosphate buffer, pH 7.5 and resuspended.
  • the suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) to break down the nucleic acids incubated.
  • filter Before cell disruption, filter with a glass cartridge (P1).
  • P1 Two homo- genier runs at 1500 bar (Microfluidizer M-110EH, Microfluidics Corp.).
  • the homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , Centrifugation and resuspension are repeated 3 times with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stir for one hour and perform a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g).
  • the hydrophobin is contained in the supernatant after the final centrifugation ( Figure 1).
  • the experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells.
  • 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) equilibrated with 50 mM Tris-Cl pH 8.0 buffer.
  • the column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole.
  • the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.
  • Lane 1 shows the purification of the hydrophobin according to the invention: Lane 1: application of nickel-Sepharose column (1:10 dilution)
  • Lanes 3 - 5 OD 280 maxima of the elution fractions
  • the inventive hydrophobin of Figure 1 has a molecular weight of about 53 kD.
  • the smaller bands partially represent degradation products of the hydrophobin.
  • hydrophobin or hydrophobin fusion protein is preferably carried out on glass or Teflon as models for a hydrophilic or hydrophobic surfaces. Standard tests for coating
  • the samples are air dried and the contact angle (in degrees) of a drop of 5 ⁇ l of water is determined. There are e.g. the following values:
  • the samples are air dried and the contact angle (in degrees) of a drop of 5 ⁇ l of water is determined.
  • the contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Surface Treatment Of Glass (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Polypeptide der allgemeinen Strukturformel (I) X<SUB>n</SUB>-C<SUP>1</SUP>-X<SUB>1-50</SUB>-C<SUP>2</SUP>-X<SUB>0-5</SUB>-C<SUP>3</SUP>-X<SUB>P</SUB>-C<SUP>4</SUP>-X<SUB>1-100</SUB>-C<SUP>5</SUP>-X<SUB>1-50</SUB>-C<SUP>6</SUP>-X<SUB>0-5</SUB>-C<SUP>7</SUP>-X<SUB>1-50</SUB>-C<SUP>8</SUP>-Xm (I), deren Herstellung und Verwendung.

Description

Neue Cystein-verarmte Hydrophobinfusionsproteine, deren Herstellung und Verwendung
Beschreibung
Die vorliegende Erfindung betrifft neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
Stand der Technik
Hydrophobine sind kleine Proteine von etwa 100 AS, die charakteristisch für filamentö- se Pilze sind und nicht in anderen Organismen vorkommen. Kürzlich wurden Hy- drophobin-ähnliche Proteine in Streptomyces coelicolor entdeckt, die als „Chapline" bezeichnet werden und ebenfalls hoch oberflächenaktive Eigenschaften haben. An Wasser/Luft-Grenzflächen können sich Chapline zu Amyloid-ähnlichen Fibrillen as- semblieren (Classen et al. 2003 Genes Dev 1714-1726 ; Elliot et al. 2003, Genes Dev. 17, 1727-1740).
Hydrophobine sind in einer wasserunlöslichen Form auf der Oberfläche von verschie- denen pilzlichen Strukturen, wie z.B. Lufthyphen, Sporen, Fruchtkörpern, verteilt. Die Gene für Hydrophobine konnten aus Ascomyzeten, Deuteromyzeten und Basidiomyzeten isoliert werden. Einige Pilze enthalten mehr als ein Hydrophobingen, z.B. Schi- zophyllum commune, Coprinus cinereus, Aspergillus nidulans. Offensichtlich sind verschiedene Hydrophobine in unterschiedlichen Stadien der pilzlichen Entwicklung in- volviert. Die Hydrophobine sind dabei vermutlich verantwortlich für unterschiedliche Funktionen (van Wetter et al., 2000, Mol. Microbiol., 36, 201-210; Kershaw et al. 1998, Fungal Genet. Biol, 1998, 23, 18-33).
Als biologische Funktion für Hydrophobine wird neben der Reduzierung der Oberflä- chenspannung von Wasser zur Generierung von Lufthyphen auch die Hydrophobisie- rung von Sporen beschrieben (Wösten et al. 1999, Curr. Biol., 19, 1985-88; Bell et al. 1992, Genes Dev., 6, 2382-2394). Weiterhin dienen Hydrophobine zur Auskleidung von Gaskanälen in Fruchtkörpern von Flechten und als Komponenten im Erkennungssystem von pflanzlichen Oberflächen durch pilzliche Pathogene (Lugones et al. 1999, Mycol. Res., 103, 635-640; Hamer & Talbot 1998, Curr. Opinion Microbiol., Band 1, 693-697). Komplementationsexperimente haben gezeigt, dass Hydrophobine sich innerhalb einer Klasse bis zu einem gewissen Grad funktionell ersetzen können.
Die bisher bekannten Hydrophobine lassen sich mit üblichen proteinchemischen Reini- gungs- und Isolationsverfahren nur in massiger Ausbeute und Reinheit darstellen. Auch Versuche, mit Hilfe von gentechnischen Verfahren, grossere Mengen an Hydrophobinen bereitzustellen, waren bisher nicht erfolgreich.
Aufgabenstellung
Es bestand die Aufgabe, neuartige Hydrophobine und deren Herstellungsverfahren bereitzustellen, die eine wirtschaftliche Produktion der Hydrophobine und deren Einsatz auf verschiedenen technischen Gebieten erlauben.
Beschreibung der Erfindung
Gegenstand der Erfindung sind Polypeptide der allgemeinen Strukturformel (I)
Xn-C -Xi_5o-C -Xo-5-C -Xp-C -Xi-ioo-C -Xi_5o-C -X0-S-C -Xi-S0-C -Xm (I)
wobei X für jede der 20 natürlich vorkommenden Aminosäuren (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, AIa, Asp, GIu, GIy) stehen kann und die bei X stehenden Indizes die Anzahl der Aminosäuren darstellen, wobei die Indizes n und m für Zahlen zwischen 0 und 500 , bevorzugt zwischen 15 und 300, ste- hen, p für eine Zahl zwischen 1 und 250, bevorzugt 1-100 steht, und C für Cystein, Alanin, Serin, Glycin, Methionin oder Threonin steht, wobei mindestens vier der mit C benannten Reste für Cystein stehen, mit der Maßgabe, dass wenigstens eine der mit Xn oder Xn, oder Xp abgekürzten Peptidsequenzen für eine mindestens 20 Aminosäuren lange Peptidsequenz steht , die natürlicherweise nicht mit einem Hydrophobin ver- knüpft ist, die nach Beschichten einer Glasoberfläche eine Kontaktwinkeländerung von mindestens 20° bewirken.
Die mit C1 bis C8 benannten Aminosäuren sind bevorzugt Cysteine; sie können aber auch durch andere Aminosäuren ähnlicher Raumerfüllung, bevorzugt durch Alanin, Serin, Threonin, Methionin oder Glycin ersetzt werden. Allerdings sollen mindestens vier, bevorzugt mindestens 5, besonders bevorzugt mindestens 6 und insbesondere mindestens 7 der Positionen C1 bis C8 aus Cysteinen bestehen. Cysteine können in den erfindungsgemässen Proteinen entweder reduziert vorliegen oder miteinander Disulfidbrücken ausbilden. Besonders bevorzugt ist die intramolekulare Ausbildung von C-C Brücken, insbesondere die mit mindestens einer, bevorzugt 2, besonders bevor- zugt 3 und ganz besonders bevorzugt 4 intramolekularen Disulfidbrücken. Bei dem oben beschriebenen Austausch von Cysteinen durch Aminosäuren ähnlicher Raumerfüllung werden vorteilhaft solche C-Positionen paarweise ausgetauscht, die intramolekulare Disulfidbrücken untereinander ausbilden können.
Falls in den mit X bezeichneten Positionen auch Cysteine, Serine, Alanine, Glycine, Methionine oder Threonine verwendet werden, kann sich die Nummerierung der einzelnen C-positionen in den allgemeinen Formeln entsprechend verändern.
Besonders vorteilhafte Polypeptide sind solche der allgemeinen Formel (II)
Xn-C -X3-25-C -Xθ-2"C -X5-50-C -X2-35"C -X2-15"C -Xθ-2"C -X3-35"C -Xm (H)
wobei X für jede der 20 natürlich vorkommenden Aminosäuren (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, AIa, Asp, GIu, GIy) stehen kann und die bei X stehenden Indizes die Anzahl der Aminosäuren darstellen, wobei die Indizes n und m für Zahlen zwischen 2 und 300 stehen und C für Cystein, Alanin, Serin, Glycin, Methionin oder Threonin steht, wobei mindestens vier der mit C benannten Reste für Cystein stehen, mit der Maßgabe, dass wenigstens eine der mit Xn oder Xm abgekürzten Peptidsequenzen für eine mindestens 35 Aminosäuren lange Peptidse- quenz steht , die natürlicherweise nicht mit einem Hydrophobin verknüpft ist, die nach Beschichten einer Glasoberfläche eine Kontaktwinkeländerung von mindestens 20° bewirken.
Ganz besonders vorteilhaft sind solche Polypeptide der allgemeinen Formel (III)
Xn-C -Xö-g-C -C -Xn-39-C -X2-23"C -Xδ-g-C -C -Xß-Iδ-C -Xm (Hl)
wobei X für jede der 20 natürlich vorkommenden Aminosäuren (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, AIa, Asp, GIu, GIy) stehen kann und die bei X stehenden Indizes die Anzahl der Aminosäuren darstellen, wobei die Indizes n und m für Zahlen zwischen 0 und 200 stehen und C für Cystein, Alanin, Serin, Glycin, Methionin oder Threonin steht, wobei mindestens sechs der mit C benann- ten Reste für Cystein stehen, mit der Maßgabe, dass wenigstens eine der mit Xn oder Xm abgekürzten Peptidsequenzen für eine mindestens 40 Aminosäuren lange Peptid- sequenz steht , die natürlicherweise nicht mit einem Hydrophobin verknüpft ist, die nach Beschichten einer Glasoberfläche eine Kontaktwinkeländerung von minde- stens 20° bewirken.
Bevorzugte Ausführungsformen der beschriebenen Erfindung sind Polypeptide mit der allgemeinen Strukturformel (I) (II) oder (IM), wobei diese Strukturformel mindestens ein Hydrophobin der Klasse I, bevorzugt mindestens ein Hydrophobin dewA, rodA, hypA, hypB, sc3, basfl, basf2, oder Teile oder Derivate davon umfasst. Die genannten Hydrophobine sind im nachfolgenden Sequenzprotokoll strukturell charakterisiert. Es können auch mehrere Hydrophobine, bevorzugt 2 oder 3, gleicher oder unterschiedlicher Struktur miteinander verknüpft und mit einer entsprechenden geeigneten Polypep- tidsequenz, die natürlicherweise nicht mit einem Hydrophobin verbunden ist, verknüpft werden.
Besonders bevorzugte Ausführungsformen der vorliegenden Erfindung sind die neuen Proteine mit der in SEQ ID NO: 20, 22, 24 dargestellen Polypeptidsequenzen sowie den dafür codierenden Nukleinsäuresequenzen, insbesondere den Sequenzen gemäss SEQ ID NO: 19, 21, 23. Auch Proteine, die sich ausgehend von den in SEQ ID NO. 22, 22 oder 24 dargestellten Polypeptidsequenzen durch Austausch, Insertion oder Deletion von mindestens einer, bis hin zu 10. bevorzugt 5 , besonders bevorzugt 5% aller Aminosäuren ergeben, und die die biologische Eigenschaft der Ausgangsproteine noch zu mindestens 50% besitzen, sind besonders bevorzugte Ausführungsformen. Unter biologischer Eigenschaft der Proteine wird hierbei die Änderung des Kontaktwinkels wie in Beispiel 10 beschrieben, verstanden.
Die erfindungsgemässen Proteine tragen an mindestens einer Position, die mit Xn oder Xm oder Xp abgekürzt wird, eine Polypeptidsequenz aus mindestens 20 bevorzugt mindestens 35 besonders bevorzugt mindestens 50 und insbesonders mindestens 100 Aminosäuren (im folgenden auch Fusionspartner genannt), die nicht natürlicherweise mit einem Hydrophobin verknüpft ist. Damit soll ausgedrückt werden, dass die erfindungsgemässen Proteine aus einem Hydrophobinteil und einem Fusionspartnerteil bestehen, die in der Natur nicht zusammen in dieser Form vorkommen.
Der Fusionspartnerteil kann aus einer Vielzahl von Proteinen ausgewählt werden. Es können auch mehrere Fusionspartner mit einem Hydrophobinteil verknüpft werden, beispielsweise am Aminoterminus (Xn) und am Carboxyterminus (Xm) oder inmitten (Xp) des Hydrophobinteils. Es können aber auch beispielsweise zwei Fusionspartner mit einer Position (Xn oder Xn,) des erfindungsgemässen Proteins verknüpft werden.
Als Fusionspartner sind besonders bevorzugt solche Polypeptidsequenzen, die dazu führen, dass das erfindungsgemässe Protein zur Beschichtung von Glasoberflächen fähig ist und die mit Protein behandelte Glasoberfläche resistent wird gegenüber einer Detergenzbehandlung, wie sie im experimentellen Teil (Beispiel 10) ausführlich beschrieben ist (z.B. 1% SDS / 800C / 10 min) ist.
Besonders geeignete Fusionspartner sind Polypeptide, die natürlicherweise in Mikroorganismen, insbesondere in E. coli oder Bacillus subtilis vorkommen. Beispiele für solche Fusionspartner sind die Sequenzen yaad (SEQ ID NO:15 und 16 ) , yaae(SEQ ID NO:17 und 18 ), und Thioredoxin. Gut geeignet sind auch Fragmente oder Derivate dieser genannten Sequenzen, die nur einen Teil, bevorzugt 10-90%, besonders bevorzugt 25-75% der genannten Sequenzen umfassen. Eine Deletion am C-terminalen Ende wird dabei bevorzugt; beispielsweise ein yaad-Fragment, das nur aus den ersten 75 N-terminalen Aminosäuren besteht, oder bei denen einzelne Aminosäuren, bzw. Nukleotide gegenüber der genannten Sequenz verändert sind. Beispielsweise können am C-terminalen Ende der Sequenzen yaad und yaae noch zusätzliche Aminosäuren, insbesondere zwei zusätzliche Aminosäuren, bevorzugt die Aminosäuren Arg, Ser, angefügt sein. Ferner können bevorzugt in der Sequenz yaae zusätzliche Aminosäuren gegenüber der natürlich vorkommenden Sequenz eingefügt sein, beispielsweise die Aminosäure Nr. 2 (GIy) in SEQ ID NO: 17 und 18.
Weitere Beispiele für Fusionspartner, insbesondere solche an der Position Xp in der allgemeinen Formel (I) sind enzymatisch-aktive Domänen, antimikrobielle Domänen, agonistisch-/antagonistisch- wirkende Polypeptidsequenzen auf Rezeptoren, Färb-, Geschmacks- und Geruchsstoffe, Metall-bindende Domänen. Weiterhin können gezielt Kopplungsstellen für die kovalente Bindung verschiedener Wirk- und Effektstoffe geschaffen werden. Beispielsweise können zusätzliche Lysine in diesen Loop eingefügt werden, um über die primäre Aminogruppe mit Hilfe der dem Fachmann bekannten heterobifunktionellen Linkern, Wirk- und Effektstoffe gezielt an das Hydrophobinmole- külgrundgerüst zu koppeln. Weiterhin können auch an den Verknüpfungsstellen zweier Fusionsparter zusätzliche Aminosäuren eingefügt werden, die sich dadurch ergeben, dass auf der Nukleinsäure- ebene Erkennungsstellen für Restriktionsendonukleasen entweder neu kreiert oder inaktiviert werden.
Die erfindungsgemässen Proteine können auch noch in ihrer Polypeptidsequenz modifiziert sein, beispielsweise durch Glycosilierung, Acetylierung oder auch durch chemische Quervernetzung beispielsweise mit Glutardialdehyd.
Eine Eigenschaft der erfindungsgemässen Proteine ist die Änderung von Oberflächeneigenschaften, wenn die Oberflächen mit den Proteinen beschichtet werden. Die Änderung der Oberflächeneigenschaften lässt sich experimentell dadurch bestimmen, dass der Kontaktwinkel eines Wassertropfens vor und nach der Beschichtung der Oberfläche mit dem erfindungsgemässen Protein gemessen wird und die Differenz der beiden Messungen ermittelt wird.
Die genauen experimentellen Bedingungen zur Messung des Kontaktwinkels sind im experimentellen Teil in Beispiel 10 niedergelegt. Unter diesen Bedingungen besitzen die erfindungsgemässen Proteine die Eigenschaft, den Kontaktwinkel um mindestens 20, bevorzugt 25, besonders bevorzugt 30 Grad zu vergrössem.
Im Hydrophobinteil der bisher bekannten Hydrophobine sind die Positionen der polaren und unpolaren Aminosäuren konserviert, was sich in einem charakteristischen Hy- drophobizitätsplot äußert. Unterschiede in den biophysikalischen Eigenschaften und in der Hydrophobizität führten zur Einteilung der bisher bekannten Hydrophobine in zwei Klassen, I und Il (Wessels et al. 1994, Ann. Rev. Phytopathol., 32, 413-437).
Die assemblierten Membranen aus Klasse I Hydrophobinen sind hochgradig unlöslich (selbst gegenüber 1% SDS bei erhöhter Temperatur) und können nur durch konzen- trierte Trifluoressigsäure (TFA), bzw. Ameisensäure wieder dissoziiert werden. Im Gegensatz dazu sind die assemblierten Formen von Klasse Il Hydrophobinen weniger stabil. Sie können bereits durch 60%iges Ethanol, bzw. 1% SDS (bei Raumtemperatur) wieder aufgelöst werden. Diese hohe Stabilität gegenüber Lösungsmitteln und Deter- gentien ist eine besondere Eigenschaft der Hydrophobine und unterscheidet Beschich- tungen mit den erfindungsgemäßen Polypeptiden von „unspezifischen" Proteinbe- schichtungen, wie sie eine Vielzahl von Proteinen an Oberflächen ausbilden. Ein Vergleich der Aminosäuresequenzen zeigt, dass die Länge des Bereichs zwischen Cystein C3 und C4bei Klasse Il Hydrophobinen deutlich kürzer ist, als bei Hydrophobinen der Klasse I.
Klasse Il Hydrophobine weisen weiterhin mehr geladene Aminosäuren als Klasse I auf.
Ein weiterer Gegenstand der Erfindung sind Verfahren zur Herstellung der erfindungs- gemässen Proteine. Diese Polypeptide lassen sich chemisch durch bekannte Verfahren der Peptidsynthese beispielsweise durch Festphasensynthese nach Merrifield her- stellen.
Besonders geeignet sind jedoch gentechnische Verfahren, bei denen eine für den Fusionspartner und eine für den Hydrophobinteil codierende Nukleinsäuresequenz, insbesondere DNA-Sequenz, so kombiniert werden, dass in einem Wirtsorganismus dur- ch Genexpression der kombinierten Nukleinsäuresequenz das gewünschte Protein erzeugt wird.
Geeignete Wirtsorganismen (Produktionsorganismen) können dabei Prokaryonten (einschliesslich der Archaea) oder Eukaryonten sein, besonders Bakterien einschliess- lieh Halobacterien und Methanococcen, Pilze, Insektenzellen, Pflanzenzellen und Säugerzellen, besonders bevorzugt Escherichia coli, Bacillus subtilis, Bacillus. megateri- um, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacillen, Hansenula polymorphe, Trichoderma reesei, SF9 (bzw. verwandte Zellen) u.a.
Gegenstand der Erfindung sind ausserdem Expressionskonstrukte, enthaltend unter der genetischen Kontrolle regulativer Nukleinsäuresequenzen eine für ein erfindungs- gemässes Polypeptid kodierende Nukleinsäuresequenz, sowie Vektoren, umfassend wenigstens eines dieser Expressionskonstrukte.
Vorzugsweise umfassen solche erfindungsgemässen Konstrukte 5"-stromaufwärts von der jeweiligen kodierenden Sequenz einen Promotor und 3"-stromabwärts eine Terminatorsequenz sowie gegebenenfalls weitere übliche regulative Elemente, und zwar jeweils operativ verknüpft mit der kodierenden Sequenz.
Unter einer'Operativen Verknüpfung'Versteht man die sequentielle Anordnung von Promotor, kodierender Sequenz, Terminator und gegebenenfalls weitererregulativer Elemente derart, dass jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäss erfüllen kann.
Beispiele für operativ verknüpfbare Sequenzen sind Targeting-Sequenzen sowie En- hancer, Polyadenylierungssignale und dergleichen. Weitere regulative Elemente umfassen selektierbare Marker, Amplifikationssignale, Replikationsursprünge und dergleichen. Geeignete regulatorische Sequenzen sind z. B. beschrieben in Goeddel, Gene Expression Techno- logy : Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
Zusätzlich zu diesenRegulationssequenzen kann die natürliche Regulation dieser Sequenzen vor den eigentlichen Strukturgenen noch vorhanden sein und gegebenenfalls genetisch verändert worden sein, so dass die natürliche Regulation ausgeschaltet und die Expression der Gene erhöht wurde.
Ein bevorzugtesNukleinsäurekonstrukt enthält vorteilhafterweise auch eine oder mehrere der schon erwähnten"Enhancer"Sequenzen, funktionell verknüpft mit dem Promotor, die eine erhöhte Expression der Nukleinsäuresequenz ermöglichen. Auch am 31- Ende der DNA-Sequenzen können zusätzliche vorteilhafte Sequenzen inseriert wer- den, wie weitere regulatorische Elemente oder Terminatoren.
Die erfindungsgemässen Nukleinsäuren können in einer oder mehreren Kopien im Konstrukt enthalten sein. Im Konstrukt können noch weitere Marker, wie Antibiotikaresistenzen oder Auxotrophien komplementierende Gene, gegebenenfalls zur Selektion auf das Konstrukt enthalten sein.
Vorteilhafte Regulationssequenzen für das erfindungsgemässe Verfahren sind beispielsweise in Promotoren wie cos-, tac-, trp-, tet-, trp-tet-,lpp-, lac-,lpp-lac-,laclq-T7- , T5-, T3-, gal-, trc-, ara-,rhaP(rhaPBAD) SP6-, lambda-PR-oder imlambda-P-Promotor enthalten, die vorteilhafterweise in gram-negativen Bakterien Anwendung finden. Weitere vorteilhafte Regulationssequenzen sind beispielsweise in den gram-positiven Promotoren amy und SP02, in den Hefe-oder Pilzpromotoren ADC1 ,MFalpha, AC, P- 60, CYC1 , GAPDH, TEF, rp28, ADH enthalten.
Es können auch künstliche Promotoren für die Regulation verwendet werden. Das Nukleinsäurekonstrukt wird zur Expression in einem Wirtsorganismus vorteilhafterweise in einen Vektor, wie beispielsweise einem Plasmid oder einem Phagen inseriert, der eine optimale Expression der Gene im Wirt ermöglicht. Unter Vektoren sind ausser Plasmiden und Phagen auch alle anderen dem Fachmann bekannten Vektoren, also z. B. Viren, wie SV40, CMV, Baculovirus und Adenovirus, TransposonsJS- Elemente, Phasmide, Cosmide, und lineare oder zirkuläre DNA, sowie das Agrobacterium- System zu verstehen.
Diese Vektoren können autonom im Wirtsorganismus repliziert oder chromosomal re- pliziert werden. Diese Vektoren stellen eine weitere Ausgestaltung der Erfindung dar. Geeig- nete Plasmide sind beispielsweise in E. coli pLG338,pACYC184, pBR322, pUC18,pUC19, pKC30, pRep4, pHS1 , pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290,plN-llllI3-B1, tgt11 oderpBdCI, in StreptomycesplJ101, plJ364,plJ702 oderplJ361 , in Bacillus pUB110, pC194 oder pBD214, in Corynebacteri- um pSA77 oder pAJ667, in Pilzen pALS1, plL2 oder pBB116, in Hefen 2alpha, pAG-1, YEp6, YEp13 oder pEMBLYe23 oder in Pflanzen pLGV23,pGHIac+,pBIN19, pAK2004 oder pDH51. Die genannten Plasmide stellen eine kleine Auswahl der möglichen Plasmide dar. Weitere Plasmide sind dem Fachmann wohl bekannt und können beispielsweise aus dem Buch Cloning Vectors (Eds. Pouwels P. H. et al. Elsevier, Ams- terdam-New York-Oxford, 1985, ISBN 0 444 904018) entnommen werden.
Vorteilhafterweise enthält das Nukleinsäurekonstrukt zur Expression der weiteren enthaltenen Gene zusätzlich noch 3"-und/oder δ'-terminale regulatorische Sequenzen zur Steigerung der Expression, die je nach ausgewähltem Wirtorganismus und Gen oder Gene für eine optimale Expression ausgewählt werden.
Diese regulatorischen Sequenzen sollen die gezielte Expression der Gene und der Proteinexpression ermöglichen. Dies kann beispielsweise je nach Wirtsorganismus bedeuten, dass das Gen erst nach Induktion exprimiert oder überexprimiert wird, oder dass es sofort exprimiert und/oder überexprimiert wird.
Die regulatorischen Sequenzen bzw. Faktoren können dabei vorzugsweise die Genexpression der eingeführten Gene positiv beeinflussen und dadurch erhöhen. So kann eine Verstärkung der regulatorischen Elemente vorteilhafterweise auf der Transkriptionsebene erfolgen, indem starke Transkriptionssignale wie Promotore- nund/oder"Enhancer"verwendet werden. Daneben ist aber auch eine Verstärkung der Translation möglich, indem beispielsweise die Stabilität dermRNA verbessert wird. In einer weiteren Ausgestaltungsform des Vektors kann der das erfindungsgemässe- Nukleinsäurekonstrukt oder die erfindungsgemässe Nukleinsäure enthaltende Vektor auch vorteilhafterweise in Form einer linearen DNA in die Mikroorganismen eingeführt werden und über heterologe oder homologe Rekombination in das Genom des Wirtsorganismus integriert werden. Diese lineare DNA kann aus einem linearisierten Vektor wie einem Plasmid oder nur aus dem Nukleinsäurekonstrukt oder der erfindungsge- mässen Nukleinsäure bestehen.
Für eine optimale Expression heterologer Gene in Organismen ist es vorteilhaft die Nukleinsäuresequenzen entsprechend des im Organismus verwendeten spezifischen "codon usage"zu verändern. Der"codon usage"lässt sich anhand von Computerauswertungen anderer, bekannter Gene des betreffenden Organismus leicht ermitteln.
Die Herstellung einer erfindungsgemässen Expressionskassette erfolgt durch Fusion eines geeigneten Promotors mit einer geeigneten kodierenden Nukleotidsequenz sowie einem Terminator-oder Polyadenylierungssignal. Dazu verwendet man gängige Rekombinations-und Klonierungstechniken, wie sie beispielsweise in T. Maniatis, E. F.Fritsch und J. Sambrook, Molecular Cloning : A Laboratory Manual, CoId Spring Har- bor Laboratory, CoId Spring Harbor, NY (1989) sowie in T. J. Silhavy, M. L. Berman und L. W. Enquist, Experiments with Gene Fusions, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1984) und in Ausubel, F. M. etal., Current Protocols in Molecular Biology, Greene Publishing Assoc. andWiley Interscience (1987) beschrieben sind.
Das rekombinante Nukleinsäurekonstrukt bzw. Genkonstrukt wird zur Expression in einem geeigneten Wirtsorganismus vorteilhafterweise in einen wirtsspezifischen Vektor insertiert, der eine optimale Expression der Gene im Wirt ermöglicht. Vektoren sind dem Fachmann wohl bekannt und können beispielsweise aus"Cloning Vectors" (Pou- weis P. H. etal., Hrsg, Elsevier, Amsterdam-New York-Oxford, 1985) entnommen werden.
Mit Hilfe der erfindungsgemässen Vektoren sind rekombinante Mikroorganismen herstellbar, welche beispielsweise mit wenigstens einem erfindungsgemässen Vektor transformiert sind und zur Produktion der erfindungsgemässen Polypeptide eingesetzt werden können. Vorteilhafterweise werden die oben beschriebenen erfindungsgemä- ssen rekombinanten Konstrukte in ein geeignetes Wirtssystem eingebracht und expri- miert. Dabei werden vorzugsweise dem Fachmann bekannte geläufige Klonierungsund Transfektionsmethoden, wie beispielsweise Co-Präzipitation, Protoplastenfusion, Elektroporation, retrovirale Transfektion und dergleichen, verwendet, um die genannten Nukleinsäuren im jeweiligen Expressionssystem zur Expression zu bringen. Geeignete Systeme werden beispielsweise in Current Protocols in Molecular Biology, F.Ausubel etal., Hrsg., Wiley Interscience, New York 1997, oder Sambrook et al. Molecular Clon- ing : A Laboratory Manual. 2. Aufl., CoId Spring Harbor Laboratory, CoId Spring Harbor Laboratory Press, CoId Spring Harbor, NY, 1989 beschrieben.
Erfindungsgemäss sind auch homolog rekombinierte Mikroorganismen herstellbar. Dazu wird ein Vektor hergestellt, der zumindest einen Abschnitt eines erfindungsgemä- ssen Gens oder einer kodierenden Sequenz enthält, worin gegebenenfalls wenigstens eine Aminosäure-Deletion, -Addition oder-Substitution eingebracht worden ist, um die erfin- dungsgemässe Sequenz zu verändern, z. B. funktionell zu disruptieren ("Knockout"- Vektor). Die eingebrachte Sequenz kann z. B. auch ein Homologes aus einem verwandten Mikroorganismus sein oder aus einer Säugetier-, Hefe-oder Insektenquelle abgeleitet sein. Der zur homologen Rekombination verwendete Vektor kann alternativ derart ausgestaltet sein, dass das endogene Gen bei homologer Rekombina- tion mu- tiert oder anderweitig verändert ist, jedoch noch das funktionelle Protein kodiert (z. B. kann der stromaufwärts gelegene regulatorische Bereich derart verändert sein, dass dadurch die Expression des endogenen Proteins verändert wird). Der veränderte Abschnitt des erfindungsgemässen Gens ist im homologen Rekombinationsvektor. Die Konstruktion geeigneter Vektoren zur homologen Rekombination ist z. B. beschrieben in Thomas, K. R. und Capecchi, M. R. (1987) Cell 51 : 503.
Als rekombinante Wirtsorganismen für die erfindungsgemässe Nukleinsäure oder dem Nukleinsäurekonstrukt kommen prinzipiell alle prokaryontischen oder eukaryontischen Organismen in Frage. Vorteilhafterweise werden als Wirtsorganismen Mikroorganis- men wie Bakterien, Pilze oder Hefen verwendet. Vorteilhaft werden gram-positive oder gram-negative Bakterien, bevorzugt Bakterien der Familien Enterobacteriaceae, Pseu- domonadaceae, Rhizobiaceae, Streptomycetaceae oder Nocardiaceae, besonders bevorzugt Bakterien der Gattungen Escherichia, Pseudomonas, Streptomyces, Nocar- dia, Burkholderia, Salmonella, Agrobacterium oder Rhodococcus verwendet.
Die im erfindungsgemässen Verfahren verwendeten Organismen werden je nach Wirtsorganismus in dem Fachmann bekannter Weise angezogen bzw. gezüchtet. Mi- kroorganismen werden in der Regel in einem flüssigen Medium, das eine Kohlenstoffquelle meist in Form von Zuckern, eine Stickstoffquelle meist in Form von organischen Stickstoffquellen wie Hefeextrakt oder Salzen wie Ammoniumsulfat, Spurenelemente wie Eisen-, Mangan-, Magnesiumsalze und gegebenenfalls Vitamine enthält, bei Te m- peraturen zwischenO C und100 C, bevorzugt zwischen 10 C bis60 C unter Sauerstoffbegasung angezogen. Dabei kann der pH der Nährflüssigkeit auf einen festen Wert gehalten werden, das heisst während der Anzucht reguliert werden oder nicht. Die Anzucht kann"batch"-weise,"semi batch"-weise oder kontinuierlich erfolgen. Nährstoffe können zu beginn der Fermentation vorgelegt oder semikontinuierlich oder konti- nuierlich nachgefüttert werden. Die Enzyme können nach dem in den Beispielen beschriebe- nen Verfahren aus den Organismen isoliert werden oder als Rohextrakt für die Reakti- on verwendet werden.
Gegenstand der Erfindung sind weiterhin Verfahren zur rekombinanten Herstellung erfindungsgemässe Polypeptide oder funktioneller, biologisch aktiver Fragmente davon, wobei man einen Polypeptide-produzierenden Mikroorganismus kultiviert, gegebenenfalls die Expression der Polypeptide induziert und diese aus der Kultur isoliert. Die Polypeptide können so auch in grosstechnischem Massstab produziert werden, falls dies erwünscht ist. Der rekombinante Mikroorganismus kann nach bekannten Ver- fahren kultiviert und fermentiert werden. Bakterien können beispielsweise in TB-oder LB-Medium und bei einer Temperatur von 20 bis40°C und einem pH-Wert von 6 bis 9 vermehrt werden. Im Einzelnen werden geeignete Kultivierungsbedingungen beispielsweise in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning : A Labo- ratory Manual, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1989) be- schrieben.
Die Zellen werden dann, falls die Polypeptide nicht in das Kulturmedium sezerniert werden, aufgeschlossen und das Produkt nach bekannten Proteinisolierungsverfahren aus dem Lysat gewonnen. Die Zellen können wahlweise durch hochfrequenten Ultra- schall, durch hohen Druck, wie z. B. in einer French-Druckzelle, durch Osmolyse, durch Einwirkung von Detergenzienjytischen Enzymen oder organischen Lösungsmitteln, durch Homogenisatoren oder durch Kombination mehrerer der aufgeführten Verfahren aufgeschlossen werden.
Eine Aufreinigung der Polypeptide kann mit bekannten, chromatographischen Verfahren erzielt werden, wie Molekularsieb-Chromatographie (Gelfiltration), wie Q- Sepharo- se-Chromatographie, lonenaustausch-Chromatographie und hydrophobe Chromato- graphie, sowie mit anderen üblichen Verfahren wie Ultrafiltration, Kristal I isati- on, Aussalzen, Dialyse und nativerGelelektrophorese. Geeignete Verfahren werden beispielsweise in Cooper, F. G., Biochemische Arbeitsmethoden, Verlag Water de Gruyter, Berlin, New York oder in Scopes, R., Protein Purification, Springer Verlag, New York, Hei- delberg, Berlin beschrieben.
Vorteilhaft kann es sein, zur Isolierung des rekombinanten Proteins Vektorsysteme oder Oligonukleotide zu verwenden, die die cDNA um bestimmte Nukleotidsequenzen verlängern und damit für veränderte Polypeptide oder Fusionsproteine kodieren, die z. B. einer einfacheren Reinigung dienen. Derartige geeignete Modifikationen sind beispielsweise als Anker fungierende sogenannte'Tags", wie z. B. die als Hexa-Histidin- Anker bekannte Modifikation oder Epitope, die als Antigene von Antikörpern erkannt werden können (beschrieben zum Beispiel inHarlow, E. and Lane, D., 1988, Antibodies : A Laboratory Manual. CoId Spring Harbor (N. Y. ) Press). Weitere geeignete Tags sind z.B. HA, Calmodulin-BD, GST, MBD; Chitin-BD, Steptavidin-BD-Avi-Tag, Flag- Tag, T7 etc. Diese Anker können zur Anheftung der Proteine an einen festen Träger, wie z. B. einer Polymermatrix, dienen, die beispielsweise in einer Chromatographiesäule eingefüllt sein kann, oder an einer Mikrotiterplatte oder an einem sonstigen Träger verwendet werden kann. Die entsprechenden Reinigungsprotokolle sind von den kommerziellen Affinitäts-Tag-Anbietern erhältlich.
Viele Hydrophobin-beschichtete pilzliche Oberflächen (Sporen, Fruchtkörper, Myzel) zeigen mikroskopisch nachweisbare, charakteristische Strukturen, sogenannte Rod- lets. Ähnliche Rodlets mit einer Stärke von ca. 10 nm können auch auf mit Hydropho- bin beschichteten hydrophilen Oberflächen (z.B. Glas, Glimmer etc.) nachgewiesen werden (Wösten et al., 1993, Plant Cell, 5, 1567-1574).
Aufgrund der außergewöhnlichen Eigenschaften von Hydrophobinen zur Beschichtung von Oberflächen (z.B. widerstandsfähig gegenüber Detergentien wie z.B. 1%iger SDS Lösung) besitzen diese Proteine ein hohes Potential für zahlreiche technische Anwendungen. In verschiedenen Patentschriften sind Beispiele für derartige Anwendungen benannt, auf die hiermit hinsichtlich der Anwendung von Hydrophobinen Bezug genommen wird. Nr. Prio Anmelder
Nr. Prio Anmelder
Die technische Nutzung von Hydrophobinen, insbesondere solchen der Klasse I scheiterte bislang an einer effizienten Herstellungs- und Reinigungsmethode. Die bisher beschriebenen Verfahren, ausgehend von natürlichen Quellen (Sporen, Pilzmyzel etc.,) führen nur zu Materialmengen im mg-Maßstab. (z.B. WO 96/41882).
Ebenso erwiesen sich Ansätze über eine rekombinante Herstellung in verschiedenen Produktionsorganismen als äußerst aufwendig und wenig zufriedenstellend.
Die erfindungsgemässen Hydrophobin-Proteine besitzen sowohl in ihrer fusionierten Form, d.h. zusammen mit dem Fusionspartnerteil, als auch in isolierter Form die wünschenswerten Eigenschaften von Hydrophobinen. Man kann also die erfindungsgemässen Proteine sowohl direkt als Fusionsproteine als auch nach Abspaltung und Abtrennung des Fusionspartners als „reine" Hydrophobine verwenden.
Wenn eine Abtrennung des Fusionspartners vorgesehen ist, empfiehlt es sich eine potentielle Spaltstelle (spezifische Erkennungsstelle für Proteasen) in das Fusionsprotein zwischen Hydrophobinteil und Fusionspartnerteil einzubauen. Als Spaltstelle geeignet sind insbesondere solche Peptidsequenzen geeignet, die ansonsten weder im Hydrophobinteil noch im Fusionspartnerteil vorkommen, was sich mit bioinformatischen Tools leicht ermitteln lässt. Besonders geeignet sind beispielsweise BrCN-Spaltung an Methionin, oder durch Protease vermittelte Spaltlung mit Faktor Xa-, Enterokinase-, Thrombin, TEV-Spaltung (Tobacca etch virus Protease). Experimenteller Teil
Beispiel 1
Vorarbeiten für die Klonierung von yaad-His6/ yaaE-His6
Mit Hilfe der Oligonukleotide Hal570 und Hal571 (HaI 572/ HaI 573) wurde eine Polymerase Kettenreaktion durchgeführt. Als Template DNA wurde genomische DNA des Bakteriums Bacillus subtilis verwendet. Das erhaltene PCR Fragment enthielt die codierende Sequenz des Gens yaaD / yaaE aus Bacillus subtilis, und an den Enden je eine Ncol bzw. BgIII Restriktionsschnittstelle. Das PCR Fragment wurde gereinigt und mit den Restriktionsendonukleasen Ncol und BgIII geschnitten. Dieses DNA Fragment wurde als I nsert verwendet, und in den zuvor mit den Restriktionsendonukleasen Ncol und BgIII linearisierten Vektor pQE60 der Firma Qiagen kloniert. Die so enstandenen Vektoren pQE60YAAD#2 / pQE60YaaE#5 können zur Expression von Proteinen bestehend aus, YAAD::HIS6 bzw. YAAE::HIS6 verwendet werden.
Hal570: gcgcgcccatggctcaaacaggtactga Hal571 : gcagatctccagccgcgttcttgcatac Hal572: ggccatgggattaacaataggtgtactagg Hal573: gcagatcttacaagtgccttttgcttatattcc
Beispiel 2a
Klonierung von yaad-Hydrophobin DewA-His6
Mit Hilfe der Oligonukleotide KaM 416 und KaM 417 wurde eine Polymerase Kettenre- aktion durchgeführt. Als Template DNA wurde genomische DNA des Schimmelpilzes Aspergillus nidulans verwendet. Das erhaltene PCR Fragment enthielt die codierende Sequenz des Hydrophobin Gens dewA und einer N-Terminalen FaktorXa Proteinase Schnittstelle. Das PCR Fragment wurde gereinigt und mit der Restriktionsendonuklea- se Barn H I geschnitten. Dieses DNA Fragment wurde als I nsert verwendet, und in den zuvor mit der Restriktionsendonuklease BgIII linearisierten Vektor pQE60YAAD#2 kloniert.
Der so enstandene Vektor #508 kann zur Expressions eines Fusionsproteins bestehend aus, YAAD::Xa::dewA::HIS6 verwendet werden.
KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT- GAAGTTCTCCGTCTCCGC
Beispiel 2b Herstellung eines Chimären Fusionsproteins mit anti-mikrobiellen Eigenschaften
Für das Einbringen einer Peptidsequenz mit antimikrobiellen Eigenschaften wurde nach der folgenden Klonierungsstrategie vorgegangen:
Ausgehend von unserem Yaad-DewA Expressionsplasmids „pQE60 Yaad dewA His" wurde zwischen die Cysteine 3 und 4 die antimikrobielle Peptidsequenz über Fusions PCR eingefügt.
Abb. 2
1a) PCR Bereich YaaD-dewA bis Cys3 incl. T7 Novispirin-Überhang Template: pQE60 YaaD dewA 6His Primer: Primer 1
(AATTAACCATGGCTCAAACA) 20-mer Primer 2 (GCCATATTTTTTAATAATATGAATAATTTTACGGGTAA-
TACGACGCAGGTTTTTGCAGCAAGCGATCGAGCCGA) 74-mer PCR-Bedingungen: 55°C, 1118 bp
1b) PCR Bereich Novispirin-Überhang bis 6His/Stop Template: pQE60 YaaD dewA 6His Primer: Primer 3
(ATATTATTAAAAAATATGGCAACTCCCCCGCTGAGACCAA) 40-mer
Primer 4
(CTAATTAAGCTTAGTGATGGT) 21-mer PCR-Bedingungen: 54°C, 306 bp
2) Annealing-PCR
50 pmol von PCR 1a und 1 b zusammengeben und mittels Pfu-Polymerase eine Annealing-PCR durchführen (1 min. 95°C, 5 min. 72°C - 10 Zyklen) Anschließend werden die außenliegenden Primer hinzugegeben und eine normale 35- Zyklen-PCR durchgeführt Primer: Primer 1
(AATTAACCATGGCTCAAACA) 20-mer Primer 4 (CTAATTAAGCTTAGTGATGGT) 21-mer PCR-Bedingungen: 53°C, 1404 bp
3) Ligation
Vektor: pQE60 YaaD dewA 6His Verdau mit Ncol/Kpnl
Präparatives Gel, Isolieren der 3428 bp-Bande Insert: Produkt aus Annealing-PCR
Verdau mit Ncol/Kpnl
Präparatives Gel, Isolieren der 1350 bp-Bande
4) Transformation in XL10/TG10 chemokomp. Zellen
Abb. 3
pQE60 YaaD-dewA Cys3-G10-Novispirin
1a) PCR Bereich YaaD-dewA bis Cys3 incl. G10 Novispirin-Überhang Template: pQE60 YaaD dewA 6His Primer: Primer 1
(AATTAACCATGGCTCAAACA) 20-mer
Primer 5 (G CCATATTTTTTAATAATATG AATG CCTTTACG AATAA-
TACGACGCAGGTTTTTGCAGCAAGCGATCGAGCCGA) 74-mer PCR-Bedingungen: 55°C, 1118 bp
1b) PCR Bereich Novispirin-Überhang bis 6His/Stop
Abb. 4
Template: pQE60 YaaD dewA 6His Primer: Primer 6
(ATATTATTAAAAAATATGGCAACTCCCCCGCTGAGACCAA) 40-mer Primer 4
(CTAATTAAGCTTAGTGATGGT) 21-mer PCR-Bedingungen: 54°C, 306 bp
2) Annealing-PCR 50 pmol von PCR 1a und 1b zusammengeben und mittels Pfu-Polymerase eine Annealing-PCR durchführen (1 min. 95°C, 5 min. 72°C - 10 Zyklen) Anschließend werden die außenliegenden Primer hinzugegeben und eine normale 35- Zyklen-PCR durchgeführt Primer: Primer 1
(AATTAACCATGGCTCAAACA) 20-mer Primer 4
(CTAATTAAGCTTAGTGATGGT) 21-mer PCR-Bedingungen: 53°C, 1404 bp
3) Ligation Vektor: pQE60 YaaD dewA 6His
Verdau mit Ncol/Kpnl
Präparatives Gel, Isolieren der 3428 bp-Bande Insert: Produkt aus Annealing-PCR
Verdau mit Ncol/Kpnl Präparatives Gel, Isolieren der 1350 bp-Bande
4) Transformation in XL10/TG10 chemokomp. Zellen
Abb. 5
Reinigung und Bewertung der Proteine erfolgt analog zu Beispiel 8.-10. Die anti-mikrobiellen Eigenschaften konnten getestet werden:
Der Test auf antimikrobielle Wirkung wird in 6-WeII Mikrotiterplatten durchgeführt. Diese werden mit dem für ein entsprechendes Wachstum benötigten Agar befüllt. (LB, YM ). Die Platten werden anschliessend mit Übernachtkulturen beimpft. Folgende Mikroorganismen sind im Test.
Bacillus subtilis
Bacillus megaterium
E. coli XU Blue MR Micrococcus luteus
Pantoea
Kurthia gibs.
Pseudomonas sp.
Carnobacterium Candida albicans
Fusarium oxysporum
Bis auf Camobakterium und Pseudomonas werden alle MO in YPD über Nacht als 20ml Kulturen angezogen. ( 300C, 200 Upm ). Carnobacterium in TSB und Pseudomonas in CASO. Von der jeweiligen Bakterien- bzw. Pilzsuspension werden 20μl pro well der Mikrotiterplatte aufgetragen und leicht ausplattiert. Die Suspension lässt man etwas in den Agar einziehen. Anschließend werden ebenfalls 20μl einer Hydrophobinlösung in der Mitte des wells aufgetragen; Inkubation der Agarplatten bei 300C im Brutschrank. Erste Ergebnisse sind bereits nach Übernachtkultur zu beobachten: bei antimikrobieller Wirkung zeigt sich rund um den Auftragspunkt kein Wachstum, bei keiner antibakteriellen Wirkung ist das gesamte well bewachsen.
Beispiel 3
Klonierung von yaad-Hydrophobin RodA-His6
Die Klonierung des Plasmids #513 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 434 und KaM 435.
KaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
Beispiel 4
Klonierung von yaad-Hydrophobin BASF1-His6
Die Klonierung des Plasmids #507 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 417 und KaM 418.
Als Template DNA wurde ein künstlich synthetisierte DNA Sequenz - Hydrophobin BASF1 -eingesetzt (siehe Anhang).
KaM417!CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT- GAAGTTCTCCGTCTCCGC KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
Beispiel 5 Klonierung von yaad-Hydrophobin BASF2-His6
Die Klonierung des Plasmids #506 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 417 und KaM 418.
Als Template DNA wurde ein künstlich synthetisierte DNA Sequenz - Hydrophobin
BASF2 -eingesetzt (siehe Anhang).
KaM417:CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT-
GAAGTTCTCCGTCTCCGC KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
Beispiel 6
Klonierung von yaad-Hydrophobin SC3-His6
Die Klonierung des Plasmids #526 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM464 und KaM465.
Als Template DNA wurde cDNA von Schyzophyllum commune eingesetzt (siehe Anhang).
KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC KaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
Beispiel 7 Fermentation des rekombinanten E.coli Stammes yaad-Hydrophobin DewA-His6
Inokulation von 3ml LB Flüssigmedium mit einem yaad-Hydrophobin DewA-His6 expri- mierenden E.coli Stamm in 15ml Greiner Röhrchen. Inkubation für 8h bei 37°C auf einem Schüttler mit 200 UpM. Je 2 11 Erlenmeyer Kolben mit Schikanen und 250ml LB Medium (+ 100μg/ml Ampicillin) werden mit jeweils 1ml der Vorkultur angeimpft und 9h bei 37°C auf einem Schüttler mit 180 UpM inkubiert.
13.51 LB-Medium (+100μg/ml Ampicillin) in einem 2Ol Fermenter mit 0,51 Vorkultur (OD6oonm 1 :10 gegen H2O gemessen) animpfen. Bei einer OD60nm von -3.5 Zugabe von 140ml 10OmM IPTG. Nach 3h Fermenter auf 10°C abkühlen und Fermentationsbrühe abzentrifugieren. Zellpellet zur weiteren Aufreinigung verwenden.
Beispiel 8
Reinigung des rekombinanten Hydrohobin-Fusionsproteins
( Reinigung von Hydrophobin-Fusionsproteinen, die ein C-terminales His6-tag besitzen)
100 g Zellpellet (100 - 500 mg Hydrophobin) werden mit 50 rtiM Natriumphosphatpuffer, pH 7,5 auf 200 ml Gesamtvolumen aufgefüllt und resuspendiert. Die Suspension wird mit einem Ultraturrax Typ T25 (Janke und Kunkel; IKA-Labortechnik) für 10 Minuten behandelt und anschliessend für 1 Stunde bei Raumtemperatur mit 500 Einheiten Benzonase (Merck, Darmstadt; Best.-Nr. 1.01697.0001) zum Abbau der Nukleinsäuren inkubiert. Vor dem Zellaufschluss wird mit einer Glaskartusche (P1) filtriert. Zum Zellaufschluß und für das Scheren der restlichen genomischen DNA werden zwei Homo- genisatorläufe bei 1.500 bar durchgeführt (Microfluidizer M- 110EH; Microfluidics Corp.). Das Homogenisat wird zentrifugiert (Sorvall RC-5B, GSA-Rotor, 250 ml Zentrifugenbecher, 60 Minuten, 4°C, 12.000 Upm, 23.000 g), der Überstand auf Eis gestellt und das Pellet in 100 ml Natriumphosphatpuffer, pH 7,5 resuspendiert. Zentrifugation und Resuspendieren werden dreimal wiederholt, wobei der Natriumphosphatpuffer bei der dritten Wiederholung 1 % SDS enthält. Nach der Resuspension wird für eine Stunde gerührt und eine abschliessende Zentrifugation durchgeführt (Sorvall RC-5B, GSA- Rotor, 250 ml Zentrifugenbecher, 60 Minuten, 4°C, 12.000 Upm, 23.000 g). Gemäß SDS-PAGE Analyse ist das Hydrophobin nach der abschliessenden Zentrifugation im Überstand enthalten (Abbildung 1). Die Versuche zeigen, dass das Hydrophobin wahrscheinlich in Form von Einschlusskörpern in den entsprechenden E. coli Zellen enthalten ist. 50 ml des Hydrophobin-enthaltenden Überstandes werden auf eine 50 ml Nik- kel-Sepharose High Performance 17-5268-02 Säule aufgetragen (Amersham), die mit 50 rtiM Tris-Cl pH 8,0 Puffer äquilibriert wurde. Die Säule wird mit 50 mM Tris-Cl pH 8,0 Puffer gewaschen und das Hydrophobin anschliessend mit 50 mM Tris-Cl pH 8,0 Puffer, der 200 mM Imidazol enthält, eluiert. Zur Entfernung des Imidazols wird die Lösung gegen 50 mM Tris-Cl pH 8,0 Puffer dialysiert.
Abbildung 1 zeigt die Reinigung des erfindungsgemässen Hydrophobins: Spur 1 : Auftrag Nickel-Sepharose Säule (1 :10 Verdünnung)
Spur 2: Durchlauf = Eluat Waschschritt
Spuren 3 - 5: OD 280 Maxima der Elutionsfraktionen
Das erfindungsgemässe Hydrophobin der Abbildung 1 besitzt ein Molekulargewicht von ca. 53 kD. Die kleineren Banden repräsentieren zum Teil Abbauprodukte des Hy- drophobins.
Beispiel 9
Beschichtung/Evaluierung von Oberflächen mit Hydrophobin
Die Evaluierung der Beschichtungseigenschaften von Hydrophobin bzw. Hydrophobin- fusionsprotein wird bevorzugt auf Glas bzw. Teflon als Modelle für eine hydrophile bzw. hydrophobe Oberflächen vorgenommen. Standard-Versuche für Beschichtung
Glas:
Konzentration Hydrophobin: 1 - 100 μg/mL
- Inkubation von Glasplättchen über Nacht (Temperatur: 800C) in 5OmM Na- Acetat pH 4 + 0,1% Tween 20 nach Beschichtung waschen in VE-Wasser
- danach Inkubation 10min / 800C / 1% SDS
- waschen in VE-Wasser
Teflon:
Konzentration: 1 - 100 μg/mL
Inkubation von Teflonplättchen über Nacht (Temperatur: 80°C) in 1OmM Tris pH 8 nach Beschichtung waschen in VE-Wasser
- Inkubation 10min / 800C / 0,1% Tween 20
- waschen in VE-Wasser
- danach Inkubation 10min / 80°C / 1% SDS
- waschen in VE-Wasser
Die Proben werden an der Luft getrocknet und der Kontaktwinkel (in Grad) eines Tropfens von 5 μl Wasser bestimmt. Es ergeben sich z.B. folgende Werte:
Ansatz mit yaad-DewA Fusionsprotein gemäss Beispiel 8(Kontrolle: ohne Protein; y- aad-dewA-his6: 100 μg/ml gereinigter Fusionspartner):
Beispiel 10
Beschichtung/Evaluierung von Oberflächen mit Hydrophobin Glas (Fensterglas, Süddeutsche Glas, Mannheim):
- Konzentration Hydrophobin: 100 μg/mL
Inkubation von Glasplättchen über Nacht (Temperatur 80°C) in 5OmM Na- Acetat pH 4 + 0, 1 % Tween 20 nach Beschichtung waschen in destilliertem Wasser
- danach Inkubation 10min / 800C / 1% SDS-Lösung in dest. Wasser
- waschen in dest. Wasser
Die Proben werden an der Luft getrocknet und der Kontaktwinkel (in Grad) eines Tropfens von 5 μl Wasser bestimmt.
Die Kontaktwinkelmessung wurde auf einem Gerät Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002) bestimmt. Die Messung erfolgte gemäss den Herstellerangaben.
Unbehandeltes Glas ergab einen Kontaktwinkel von 30 ± 5°; eine Beschichtung mit einem funktionellen Hydrophobin gemäss Beispiel 8 (yaad-dewA-his6) ergab Kontaktwinkel von 75 ± 5°.
Zuordnung der Sequenznamen zu DNA- und Polypeptidsequenzen im Sequenzprotokoll

Claims

Patentansprüche
1. Polypeptide der allgemeinen Strukturformel (I)
Xn-C -Xi_5o-C -XQ-5-C -Xp-C -Xi-ioo-C -Xi-so-C -X0-S-C -Xi-S0-C -Xm (I)
wobei X für jede der 20 natürlich vorkommenden Aminosäuren steht, n und m für Zahlen zwischen 0 und 500 stehen, p für eine Zahl zwischen 1 und 250 steht, C für Cystein, Alanin, Serin, Glycin, Methionin oder Threonin steht, wobei mindestens vier der mit C benannten Reste für Cystein stehen, mit der Maßgabe, dass wenigstens eine der mit Xn oder Xm oder Xp abgekürzten Peptidsequenzen für eine mindestens 20 Aminosäuren lange Peptidsequenz steht , die natürlicherweise nicht mit einem Hydrophobin verknüpft ist, die nach Beschichten einer Glasoberfläche eine Kontaktwinkeländerung von mindestens 20° bewirken.
2. Polypeptide nach Anspruch 1 , dadurch gekennzeichnet, dass die Strukturformel
(I) ein Hydrophobin der Klasse I umfasst.
3. Polypeptide nach Anspruch 1, dadurch gekennzeichnet, dass die Strukturformel (I) ein Hydrophobin umfasst, das ausgewählt ist aus der Gruppe, die von dewA , rodA, sc3, hypA, hypB, basfi, basf2 gebildet wird.
4. Polypeptide nach Anspruch 1, dadurch gekennzeichnet, dass die Struktkurformel (I) eine Sequenz ausgewählt aus SEQ ID NO: 2,4,6,8,10,12,14 umfasst.
5. Polypeptide nach Anspruch 1 , dadurch gekennzeichnet, dass Xn oder Xn, eine polypeptidsequenz ausgewählt aus SEQ ID NO: 16, 18 umfasst.
6. Polypeptide nach Anspruch 1 , dadurch gekennzeichnet, dass Xn oder Xn, oder Xp für eine Sequenz (His)4-i0 steht.
7. Polypeptide nach Anspruch 1, dadurch gekennzeichnet, dass die Strukturformel (I) Polypeptide ausgewählt aus der Gruppe SEQ ID NO: 20, 22, 24 umfasst.
20050577 Dp/fe 10.06.05 Fig/Seq
8. Nukleinsäure, codierend für Polypeptide gemäß Anspruch 1 -7.
9. Verfahren zur Herstellung von Polypeptiden gemäss Anspruch 1-7, indem man eine Nukleinsäure gemäss Anspruch 8 in einem Wirtsorganismus exprimiert und das so erhaltene Protein ggf. nach Aufreinigung isoliert.
10. Verfahren nach Anspruch 9, dadurch gekennzeichnet, dass als Wirtsorganismus E.coli verwendet wird.
11. Verwendung von Hydrophobinen gemäss Anspruch 1-7 zur Beschichtung von Oberflächen.
EP06763632A 2005-06-10 2006-06-09 Neue cystein-verarmte hydrophobinfusionsproteine, deren herstellung und verwendung Withdrawn EP1893639A2 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102005027139A DE102005027139A1 (de) 2005-06-10 2005-06-10 Neue Cystein-verarmte Hydrophobinfusionsproteine, deren Herstellung und Verwendung
PCT/EP2006/063066 WO2006131564A2 (de) 2005-06-10 2006-06-09 Neue cystein-verarmte hydrophobinfusionsproteine, deren herstellung und verwendung

Publications (1)

Publication Number Publication Date
EP1893639A2 true EP1893639A2 (de) 2008-03-05

Family

ID=37498802

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06763632A Withdrawn EP1893639A2 (de) 2005-06-10 2006-06-09 Neue cystein-verarmte hydrophobinfusionsproteine, deren herstellung und verwendung

Country Status (7)

Country Link
US (1) US7910699B2 (de)
EP (1) EP1893639A2 (de)
JP (1) JP5302676B2 (de)
CN (1) CN101193911B (de)
CA (1) CA2611234A1 (de)
DE (1) DE102005027139A1 (de)
WO (1) WO2006131564A2 (de)

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1848734A2 (de) * 2005-02-07 2007-10-31 Basf Aktiengesellschaft Verfahren zum beschichten von oberflächen mit hydrophobinen
EP1848733B1 (de) 2005-02-07 2017-06-21 Basf Se Neue hydrophobinfusionsproteine, deren herstellung und verwendung
EP1866150B1 (de) 2005-03-31 2016-10-19 Basf Se Metallische substrate mit polypeptiden als haftvermittler
BRPI0608678A2 (pt) 2005-04-01 2010-11-30 Basf Ag uso de uma hidrofobina, processo para perfurar um furo de sondagem para desenvolver depósitos subterráneos, lama de perfuração, e, processo para produzir uma lama de perfuração
JP2008534554A (ja) 2005-04-01 2008-08-28 ビーエーエスエフ ソシエタス・ヨーロピア 乳化破壊剤としての蛋白質の使用
DE102005027139A1 (de) 2005-06-10 2006-12-28 Basf Ag Neue Cystein-verarmte Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005029704A1 (de) * 2005-06-24 2007-01-11 Basf Ag Verwendung von Hydrophobin-Polypeptiden sowie Konjugaten aus Hydrophobin-Polypeptiden mit Wirk-oder Effektstoffen und ihre Herstellung sowie deren Einsatz in der Kosmetik
DE102005033002A1 (de) * 2005-07-14 2007-01-18 Basf Ag Wässrige Monomeremulsionen enthaltend Hydrophobin
DE102005048720A1 (de) 2005-10-12 2007-04-19 Basf Ag Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen
EP2054687B1 (de) * 2006-08-15 2011-10-19 Basf Se Verfahren zur herstellung von trockenen freifliessenden hydrophobinzubereitungen
WO2008107439A1 (de) * 2007-03-06 2008-09-12 Basf Se Mit hydrophobinen modifizierte offenzellige schaumstoffe
US20100166627A1 (en) * 2007-05-24 2010-07-01 Basf Se Use of hydrophobins as additives in the crystallization of solids
WO2009037061A2 (de) * 2007-09-13 2009-03-26 Basf Se Verwendung von hydrophobin-polypeptiden als penetrationsverstärker
EP2042155A1 (de) * 2007-09-28 2009-04-01 Basf Se Verfahren zum Entfernen von wasserunlöslichen Substanzen von Substratoberflächen
WO2010072665A1 (de) 2008-12-23 2010-07-01 Basf Se Modifizierung von nano- oder mesofasern oder textilen flächengebilden hergestellt mittels elektrospinnen mit amphiphilen proteinen
EP2395969A2 (de) 2009-02-10 2011-12-21 Basf Se Verwendung von hydrophobin als spreitmittel
WO2010102934A1 (de) 2009-03-09 2010-09-16 Basf Se Verwendung einer mischung aus wasserloslichen polymeren und hydrophobinen zum verdicken wässriger phasen
EP2462166A2 (de) 2009-08-03 2012-06-13 Basf Se Verfahren zur abscheidung von dünnen metalloxidschichten
EP2371844A1 (de) 2010-03-25 2011-10-05 B.R.A.I.N. Biotechnology Research and Information Network AG Chimäre oberflächenaktive Proteine
AU2011234510A1 (en) 2010-03-31 2012-10-25 Basf Se Coated stents and process for coating with protein
WO2012004255A1 (de) 2010-07-07 2012-01-12 Basf Se Zusammensetzung enthaltend ein hydrophobin und verfahren zum reinigen von hydrophoben oberflächen
WO2012049250A2 (de) 2010-10-13 2012-04-19 Basf Se Verfahren zum immobilisieren kationischer wirkstoffe auf oberflächen
CA2832975A1 (en) 2011-04-15 2012-10-18 Danisco Us Inc. Methods of purifying hydrophobin
US20130219559A1 (en) 2012-02-22 2013-08-22 Kimmo Koivu Method for hydrophobin production in plants and methods to produce hydrophobin multimers in plants and microbes
BR112014021521B1 (pt) 2012-04-05 2022-05-10 Basf Plant Science Company Gmbh Método para aumentar a resistência à infecção por phakopsora em uma planta de soja transgênica, método para a produção de uma planta de soja transgênica, método para a produção de um produto e método para criar uma planta transgênica resistente a fungos
AU2013266516A1 (en) 2012-05-21 2014-10-09 Danisco Us Inc. Trichoderma hydrophobin production
US9982229B2 (en) * 2013-12-19 2018-05-29 Danisco Us Inc. Use of hydrophobins to increase gas transfer in aerobic fermentation processes
WO2016071136A1 (en) 2014-11-05 2016-05-12 Basf Se A method of preparing an agrochemical composition with reduced toxicity by milling a premix of a pesticide and a hydrophobin
CN108004254B (zh) * 2017-12-13 2020-04-17 天津大学 疏水蛋白mHGFI基因及表达的蛋白及应用
CN108060169B (zh) * 2017-12-13 2020-04-17 天津大学 疏水蛋白mHFBI基因及表达的蛋白及应用

Family Cites Families (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB195876A (en) 1922-04-25 1923-04-12 Sharples Specialty Co Process for resolving water-in-oil emulsions
US2399161A (en) * 1942-06-30 1946-04-30 Claude R Wickard Process for producing glues and adhesives from keratin protein materials
GB1278924A (en) * 1970-02-06 1972-06-21 Ici Ltd Improvements in synthetic film materials
DE2609104A1 (de) * 1976-03-05 1977-09-15 Basf Ag Verfahren zur herstellung von styrol-suspensionspolymerisaten
DE2638839A1 (de) * 1976-08-28 1978-03-02 Basf Ag Verfahren zur herstellung von styrol-suspensionspolymerisaten
JPS60206893A (ja) 1984-03-31 1985-10-18 Yoshinari Shimada 油中水滴型乳状燃料油の製造方法
US5049504A (en) * 1986-11-24 1991-09-17 Genex Corporation Bioadhesive coding sequences
JPS6323670A (ja) * 1986-04-25 1988-01-30 バイオ−ポリマ−ズ　インコ−ポレ−テツド 接着・被覆組成物とその使用方法
IT1196484B (it) 1986-07-11 1988-11-16 Sclavo Spa Vettore ad espressione e secrezione in lieviti,utile per la preparazione di proteine eterologhe
GB8918185D0 (en) 1989-08-09 1989-09-20 Secr Defence Ochrobactrum surfactant
DE4024871A1 (de) 1990-08-06 1992-02-13 Basf Ag Perlfoermige antistatische expandierbare styrolpolymerisate
DE4220225A1 (de) * 1992-06-20 1993-12-23 Basf Ag Verfahren zur Herstellung von perlförmigen expandierbaren Styrolpolymerisaten
WO1994009094A1 (en) 1992-10-09 1994-04-28 Won Jae Yim A process for preparing emulsified fuel oil
FR2701490B1 (fr) 1993-02-16 1995-04-14 Inst Francais Du Petrole Procédé de production d'un mout de xanthane ayant une propriété améliorée, composition obtenue et application de la composition dans une boue de forage de puits.
JP3508157B2 (ja) 1993-05-19 2004-03-22 旭硝子株式会社 分裂酵母接合フェロモン前駆体遺伝子
ATE197608T1 (de) 1993-12-10 2000-12-15 Korea Inst Sci & Tech Signalsequenzen für die secretion heterologer proteine von hefe
JP3537487B2 (ja) 1994-04-27 2004-06-14 株式会社海洋バイオテクノロジー研究所 ムラサキイガイ接着蛋白質遺伝子
IL110938A (en) * 1994-09-12 2001-01-28 Haber Meir Adhesive proteins isolated from mature macro and microalgae
DE69636536T2 (de) 1995-02-03 2007-10-25 Asahi Glass Co., Ltd. Sekretionssignal-Gen und dieses enthaltender Expressionsvektor
JPH08266281A (ja) 1995-03-31 1996-10-15 Kaiyo Bio Technol Kenkyusho:Kk イガイ接着蛋白質遺伝子
WO1996041882A1 (en) 1995-06-12 1996-12-27 Proefstation Voor De Champignoncultuur Hydrophobins from edible fungi, genes, nucleotide sequences and dna-fragments encoding for said hydrophobins, and expression thereof
US6093222A (en) 1996-04-04 2000-07-25 Ck Witco Corporation Diesel fuel antifoam composition
EP1223219A3 (de) 1997-10-31 2002-10-23 Asahi Glass Company Ltd. Induzierbarer Promoter und Sekretionssignal zur Verwendung in Schizosaccharomyces pombe, Expressionsvektor diese enthaltend und ihre Verwendungen
US6572845B2 (en) 1998-10-16 2003-06-03 Burt D. Ensley Recombinant hair treatment compositions
AU778477B2 (en) 1999-03-25 2004-12-09 Valtion Teknillinen Tutkimuskeskus Process for partitioning of proteins
DE19942539A1 (de) 1999-09-07 2001-03-08 Cognis Deutschland Gmbh Waschmittel
DE19956802A1 (de) * 1999-11-25 2001-06-13 Cognis Deutschland Gmbh Waschmitteltabletten
GB0002663D0 (en) * 2000-02-04 2000-03-29 Biomade B V Method of stabalizing a hydrophobin-containing solution and a method of coating a surface with a hydrophobin
GB0002660D0 (en) 2000-02-04 2000-03-29 Biomade B V Method of stabilizing a hydrophobin-containing solution and a method of coatinga surface with a hydrophobin
FR2805278B1 (fr) 2000-02-17 2006-09-29 Chalen Papier Europ Service Compositions utiles comme surfactants et leurs utilisations
AU2001292574A1 (en) * 2000-09-06 2002-03-22 Zymogenetics Inc. Human phermone polypeptide
GB0030038D0 (en) 2000-12-08 2001-01-24 Univ Warwick Yeast-based assay
DE10061280A1 (de) 2000-12-08 2002-06-13 Novaprot Gmbh Reinigungswirksame, grenzflächenaktive Kombination aus nachwachsenden Rohstoffen mit hoher Fettlösekraft
EP1430090A4 (de) 2001-08-31 2006-10-11 Keratec Ltd Herstellung von film-, folien-, faser-, schaumstoff- und klebstoff-biopolymermaterialien aus löslichen s-sulfonierten keratinderivaten
AT410669B (de) 2001-10-11 2003-06-25 Bcd Rohstoffe F Bauchemie Hand Sprühgetrocknete dispersionen, verfahren zu ihrer herstellung und deren anwendung
FR2833490B1 (fr) 2001-12-14 2004-12-10 Oreal Utilisition cosmetique d'au moins une hydrophobine pour le traitement des matieres keratiniques et compositions mises en oeuvre
AU2003216019A1 (en) 2002-03-26 2003-10-08 Magnus Qvist Method for attaching two surfaces to each other using a bioadhesive polyphenolic protein and periodate ions.
WO2004000880A1 (en) 2002-06-21 2003-12-31 Applied Nanosystems B.V. Method of binding a compound to a surface
DE10342794A1 (de) 2003-09-16 2005-04-21 Basf Ag Sekretion von Proteinen aus Hefen
CN1909979A (zh) 2004-01-16 2007-02-07 应用超微系统股份有限公司 在低温下用疏水蛋白涂覆物体的方法
NZ551366A (en) 2004-05-24 2009-01-31 Basf Ag Keratin-binding polypeptides
US7241734B2 (en) * 2004-08-18 2007-07-10 E. I. Du Pont De Nemours And Company Thermophilic hydrophobin proteins and applications for surface modification
EP1848734A2 (de) 2005-02-07 2007-10-31 Basf Aktiengesellschaft Verfahren zum beschichten von oberflächen mit hydrophobinen
EP1848733B1 (de) * 2005-02-07 2017-06-21 Basf Se Neue hydrophobinfusionsproteine, deren herstellung und verwendung
DE102005005737A1 (de) * 2005-02-07 2006-08-17 Basf Ag Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
US20090305930A1 (en) 2005-03-30 2009-12-10 Basf Aktiengesellschaft Use of hydrophobin for hard surface soil-repellent treatment
EP1866106B1 (de) 2005-03-30 2010-05-26 Basf Se Verwendung von hydrophobinen zur oberflächenbehandlung von gehärteten mineralischen baustoffen, naturstein, kunststein und keramiken
EP1866150B1 (de) 2005-03-31 2016-10-19 Basf Se Metallische substrate mit polypeptiden als haftvermittler
BRPI0608678A2 (pt) 2005-04-01 2010-11-30 Basf Ag uso de uma hidrofobina, processo para perfurar um furo de sondagem para desenvolver depósitos subterráneos, lama de perfuração, e, processo para produzir uma lama de perfuração
EP1868698A1 (de) 2005-04-01 2007-12-26 Basf Aktiengesellschaft Verwendung von proteinen als demulgatoren
JP2008534554A (ja) 2005-04-01 2008-08-28 ビーエーエスエフ ソシエタス・ヨーロピア 乳化破壊剤としての蛋白質の使用
DE102005027039A1 (de) 2005-06-10 2006-12-21 Basf Ag Hydrophobin als Beschichtungsmittel für expandierbare oder expandierte, thermoplastische Polymerpartikel
DE102005027139A1 (de) 2005-06-10 2006-12-28 Basf Ag Neue Cystein-verarmte Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005029704A1 (de) 2005-06-24 2007-01-11 Basf Ag Verwendung von Hydrophobin-Polypeptiden sowie Konjugaten aus Hydrophobin-Polypeptiden mit Wirk-oder Effektstoffen und ihre Herstellung sowie deren Einsatz in der Kosmetik
DE102005033002A1 (de) 2005-07-14 2007-01-18 Basf Ag Wässrige Monomeremulsionen enthaltend Hydrophobin
CN101233220B (zh) 2005-08-01 2012-11-21 巴斯福股份公司 表面活性非酶促蛋白质用于织物洗涤的应用
DE102005048720A1 (de) 2005-10-12 2007-04-19 Basf Ag Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
NAKARI-SETALA T ET AL: "Expression of a fungal hydrophobin in the Saccharomyces cerevisiae cell wall: Effect on cell surface properties and immobilization", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 68, no. 7, 1 July 2002 (2002-07-01), pages 3385 - 3391, XP002319522, ISSN: 0099-2240, DOI: 10.1128/AEM.68.7.3385-3391.2002 *
W\STEN H A B ET AL: "Interfacial self-assembly of a fungal hydrophobin into a hydrophobic rodlet layer", THE PLANT CELL, AMERICAN SOCIETY OF PLANT BIOLOGISTS, US, vol. 5, no. 11, 1 November 1993 (1993-11-01), pages 1567 - 1574, XP002976225, ISSN: 1040-4651, DOI: 10.1105/TPC.5.11.1567 *
WOESTEN H A B ET AL: "THE FUNGAL HYDROPHOBIN SC3P SELF-ASSEMBLIES AT THE SURFACE OF AERIAL HYPHAE AS A PROTEIN MEMBRANE CONSTITUTING THE HYDROPHOBIC RODLET LAYER", EUROPEAN JOURNAL OF CELL BIOLOGY, WISSENSCHAFLICHE VERLAGSGESELLSCHAFT, STUTTGART, DE, vol. 63, 1 January 1994 (1994-01-01), pages 122 - 129, XP008065983, ISSN: 0171-9335 *

Also Published As

Publication number Publication date
JP5302676B2 (ja) 2013-10-02
CA2611234A1 (en) 2006-12-14
CN101193911A (zh) 2008-06-04
US7910699B2 (en) 2011-03-22
JP2008545435A (ja) 2008-12-18
DE102005027139A1 (de) 2006-12-28
WO2006131564A2 (de) 2006-12-14
WO2006131564A3 (de) 2007-06-07
US20090136996A1 (en) 2009-05-28
CN101193911B (zh) 2013-06-12

Similar Documents

Publication Publication Date Title
EP1893639A2 (de) Neue cystein-verarmte hydrophobinfusionsproteine, deren herstellung und verwendung
EP1848733B1 (de) Neue hydrophobinfusionsproteine, deren herstellung und verwendung
EP1866401B1 (de) Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen
EP1866150B1 (de) Metallische substrate mit polypeptiden als haftvermittler
EP1866106B1 (de) Verwendung von hydrophobinen zur oberflächenbehandlung von gehärteten mineralischen baustoffen, naturstein, kunststein und keramiken
EP1869138B1 (de) Bohrspülung enthaltend hydrophobin
EP1893675B1 (de) Hydrophobin als beschichtungsmittel für expandierbare oder expandierte, thermoplastische polymerpartikel
EP1848734A2 (de) Verfahren zum beschichten von oberflächen mit hydrophobinen
EP1904534B1 (de) Wässrige monomeremulsionen enthaltend hydrophobin
WO2006128877A1 (de) Verfahren zur verringerung der verdunstungsgeschwindigkeit von flüssigkeiten
EP1891261A2 (de) Verfahren zur beschichtung von oberflächen von faserigen substraten
DE102005048720A1 (de) Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen
DE102005007480A1 (de) Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005015043A1 (de) Verwendung von Polypeptiden als Haftvermittler
DE102005005737A1 (de) Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005051515A1 (de) Verfahren zum Beschichten von Oberflächen mit Hydrophobinen
DE102005045770A1 (de) Verwendung von Polypeptiden als Haftvermittler
DE102005030786A1 (de) Verfahren zur Beschichtung von Oberflächen von faserigen Substraten
DE102005026143A1 (de) Verfahren zur Beschichtung von Oberflächen von faserigen Substraten
DE102005036341A1 (de) Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20080110

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

DAX Request for extension of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20091201

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20130724