WO2023022490A1 - 폴리 a 테일을 안정적으로 유지하는 방법 - Google Patents

폴리 a 테일을 안정적으로 유지하는 방법 Download PDF

Info

Publication number
WO2023022490A1
WO2023022490A1 PCT/KR2022/012233 KR2022012233W WO2023022490A1 WO 2023022490 A1 WO2023022490 A1 WO 2023022490A1 KR 2022012233 W KR2022012233 W KR 2022012233W WO 2023022490 A1 WO2023022490 A1 WO 2023022490A1
Authority
WO
WIPO (PCT)
Prior art keywords
poly
tail
cell line
culturing
plasmid
Prior art date
Application number
PCT/KR2022/012233
Other languages
English (en)
French (fr)
Inventor
신진환
최영준
김훈
권용민
정혜원
Original Assignee
에스케이바이오사이언스 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 에스케이바이오사이언스 주식회사 filed Critical 에스케이바이오사이언스 주식회사
Priority to CN202280056262.2A priority Critical patent/CN117836418A/zh
Publication of WO2023022490A1 publication Critical patent/WO2023022490A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C12N15/68—Stabilisation of the vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C12N15/69—Increasing the copy number of the vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • the present invention relates to a method for stably maintaining a poly A tail.
  • mRNA has recently been attracting attention as an active pharmaceutical ingredient (API) of pharmaceuticals.
  • mRNA requires a component called poly(A) tail, which plays an important role in RNA stability and translation.
  • poly(A) tail In the case of mRNA constituting an mRNA vaccine, 120 poly A tails are recognized as a standard size (Mol Ther Nucleic Acids. 2021 Dec 3;26:945-956).
  • PolyA signal is present in the mRNA transcribed in the cell, and a polyA tail is added after the transcription process.
  • Poly A tails are also required to increase in vivo stability and translation efficiency even in mRNA produced by in vitro transcription (IVT).
  • One method is to synthesize a poly A tail using polyA polymerase after IVT, and the other method is to include an adenine repeat sequence in the template used for IVT to generate a poly A tail through IVT. am.
  • An object of the present invention relates to a method for stably maintaining a poly A tail.
  • the present invention provides a method for stably maintaining a poly A tail.
  • the poly A tail can be easily cloned and the poly A sequence can be stably maintained.
  • Figure 1 confirms the colony PCR results upon cloning of poly(A) sequences using DH5alpha at 37 degrees Celsius.
  • Figure 2 confirms the colony PCR results upon cloning of the poly(A) sequence using Stbl3 at 37 degrees Celsius.
  • Figure 4 is a graph showing the results of comparing the A124 ⁇ 1 ratio when a cell line transformed with a plasmid containing a sequence encoding a poly(A) tail is cultured under various temperature conditions.
  • Figure 5 is a graph showing the results of culture curves for each temperature obtained by measuring OD600 at a given time while incubating the prepared stock at 200 rpm for 48 hours at 13, 16, 19, 22, and 25 degrees.
  • One embodiment of the present invention is a method for stably maintaining a poly A tail in a plasmid.
  • the method includes culturing a cell line transformed with a plasmid containing a sequence encoding a poly(A) tail at a temperature of 31 °C or less.
  • the culturing step includes (1) restoring the cell line to a temperature condition of 31 °C or less.
  • the method includes, after the recovery step of (1), (2) culturing the cell line in a solid medium at a temperature of 31 ° C or less to form colonies.
  • the culturing further comprises (3) culturing the colonies formed by the solid medium culture in (2) in a liquid medium at a temperature of 31 ° C or less.
  • the method comprises (1) restoring a cell line transformed with a plasmid comprising a sequence encoding a poly A tail to a temperature condition of 31 ° C. or less; (2) forming colonies through solid culture of the recovered cell line at a temperature of 31 ° C or lower; and (3) performing liquid culture at a temperature of 31 °C or less.
  • the culturing in the liquid medium includes subculturing.
  • the temperature conditions in steps (1) to (3) are 16°C to 31°C.
  • the temperature conditions in steps (1) to (3) are 19°C to 25°C.
  • the cell line is E.coli.
  • the transformation includes introducing a plasmid containing a poly A tail-encoding sequence into a cell line using heat shock or electroporation.
  • the introduction is performed at a temperature of 37 °C to 42 °C.
  • the method further comprises preserving the cultured cell line.
  • the preserving step comprises freezing and/or drying the cell line.
  • the culturing comprises culturing and activating the conserved strain.
  • the method is characterized in that the stability of the poly A tail in the plasmid is increased compared to a method comprising culturing the cell line transformed with the plasmid at a temperature of 37 ° C. or higher.
  • the poly A tail comprises 20 to 400 adenine (A) atoms.
  • Another aspect embodying the present invention is a method for mass production of plasmids for mRNA production.
  • the method comprises culturing a cell line transformed with a plasmid containing a sequence encoding mRNA including a poly(A) tail at a temperature condition of 31 ° C. or less. .
  • the mRNA is a component of an immunogenic composition and/or therapeutic agent.
  • Another aspect embodying the present invention is a method for producing mRNA containing a poly A tail.
  • the method comprises culturing a cell line transformed with a plasmid containing a sequence encoding an mRNA containing a poly(A) tail at a temperature of 31 ° C. or less. .
  • the method comprises recovering the plasmid from the cell line and performing transcription in vitro.
  • the mRNA is a component of an immunogenic composition and/or therapeutic agent.
  • One aspect of the invention is a method for stably maintaining a poly A tail in a plasmid.
  • the method includes culturing a cell line transformed with a plasmid containing a sequence encoding a poly(A) tail at a temperature of 31° C. or less.
  • poly A tail refers to a contiguous or discontinuous sequence of adenylate residues typically located at the 3' end of an RNA molecule.
  • a poly A tail may follow the 3' of the mRNA, for example the 3'UTR.
  • Such poly A tails may consist of or include about 20 or more, 25 or more, 40 or more, 60 or more, 80 or more, or 100 or more adenyl (A) nucleotides.
  • the poly A tail may include 20 to 400 adenine (A) atoms.
  • A adenine
  • 20 to 300, 40 to 200, 50 to 190, 60 to 180, 70 to 170, 60 to 160, 70 to 150, or 80 to 140 adenines may be included. Examples may include, but are not limited to, about 120 adenines.
  • the poly A tail may contain modifications that delay the degradation of mRNA.
  • a plasmid containing a poly A tail includes a promoter capable of initiating transcription, an arbitrary operator sequence for regulating such transcription, a sequence encoding a target mRNA, and a sequence regulating termination of transcription and translation. can do.
  • the plasmid may include a restriction enzyme binding site that is easy to utilize for cloning.
  • the plasmid may include a selection marker for determining whether or not transformation occurs.
  • Markers conferring selectable phenotypes such as drug resistance, auxotrophy, and resistance to cytotoxic agents can be used, and only cells expressing the selectable marker survive or exhibit other phenotypes in the environment treated with the selective agent. Therefore, transformed cells can be selected.
  • it is not limited to the above examples.
  • the plasmid of the present invention can be prepared by introducing a sequence encoding the poly A tail into the plasmid.
  • the sequence encoding the poly A tail is amplified by PCR, treated with a restriction enzyme, and then ligated with the plasmid treated with the restriction enzyme to obtain a plasmid containing the sequence encoding the poly(A) tail can prepare
  • a polynucleotide sequence encoding mRNA may be linked to the upper end of the sequence encoding the poly A tail.
  • the plasmid may be used as a template for transcribing a target mRNA containing a polynucleotide sequence encoding an mRNA at the top of a sequence encoding a poly A tail.
  • a cell line transformed with a plasmid containing the sequence encoding the poly(A) tail of the present invention can be prepared by introducing a plasmid containing the sequence encoding the poly A tail into the cell line. .
  • introducing a plasmid containing a sequence encoding the poly A tail into a cell line may also be referred to as transforming the cell line with the plasmid.
  • transduction or “transformation” of a plasmid means transfer of the plasmid to a cell line. Such introduction can be easily performed according to a conventional method in the art.
  • cells may be treated to be permeable to DNA molecules, and cells that have undergone this process are referred to as competent cells.
  • the introduction may be performed using heat shock or electroporation.
  • Plasmid delivery using heat shock is accomplished by mixing DNA and cells and applying heat momentarily.
  • the introduction by thermal shock may be performed at a temperature condition of about 37° C. or higher, and specifically, at a temperature condition of about 37° C. to 42° C. Cooling the cells on ice before and/or after heat shocking may be included.
  • Electroporation is a method of delivering plasmids using electricity.
  • a short, high-voltage electrical pulse stimulus is applied to change the membrane potential of the cell membrane, nanometer-sized pores are created on the surface of the cell membrane to increase DNA permeability.
  • the introduction by electroporation may be performed at a temperature condition of about 37° C. or higher, and specifically, at a temperature condition of about 37° C. to 42° C. Chilling the cells on ice before and/or after application of electrical stimulation may be included.
  • the CaCl 2 precipitation method the Hanahan method with increased efficiency by using a reducing material called DMSO (dimethyl sulfoxide) in the CaCl 2 method
  • DMSO dimethyl sulfoxide
  • calcium phosphate precipitation method calcium phosphate precipitation method
  • protoplast fusion method stirring method using silicon carbide fibers
  • stirring method using silicon carbide fibers characterization using PEG transformation methods, dextran sulfate, lipofectamine and desiccation/inhibition mediated transformation methods and the like
  • a poly A tail is stably required for mRNA stability and translation efficiency, and the present applicant has stably cloned the poly A tail encoding sequence newly present in the plasmid without loss. and a method for culturing E. coli cloned in a method capable of mass production and maintenance.
  • the step of culturing the cell line into which the plasmid containing the sequence encoding the poly A tail has been introduced at a temperature of 31 ° C. or lower may include any one or more of the following steps:
  • the (i) step of recovering the cell line is a step of culturing the cell line, which was in a competent state after transformation, in a medium to recover physiological functions.
  • the medium in the recovery step may be a non-selective medium.
  • the culture temperature in the recovery step is about 31 ° C or less, for example, about 16 ° C to 31 ° C, about 16 ° C to 30 ° C, about 16 ° C to 29 ° C, about 16 ° C to 28 ° C, about 16 ° C to 27 °C, about 16 °C to 26 °C, about 16 °C to 25 °C, about 17 °C to 25 °C, about 18 °C to 25 °C, or about 19 °C to 25 °C.
  • the culture time in the recovery step may be about 5 minutes to 2 hours.
  • Colonies may be formed by culturing the transformed cell line through the step (ii) culturing the cell line in a solid medium.
  • Colony means a population of cell lines into which a plasmid of interest has been introduced.
  • Solid medium may also be referred to as "solid medium”.
  • solid medium culture it is possible to check the growth of the strain and the introduction of the plasmid, and a selective medium can be used to check the introduction of the plasmid.
  • the selective medium may contain antibiotics.
  • the temperature of the culturing in the solid medium is about 31 ° C or less, for example, about 16 ° C to 31 ° C, about 16 ° C to 30 ° C, about 16 ° C to 29 ° C, about 16 ° C to 28 ° C, about 16 °C to 27 °C, about 16 °C to 26 °C, about 16 °C to 25 °C, about 17 °C to 25 °C, about 18 °C to 25 °C, or about 19 °C to 25 °C.
  • Mass culture of the cell line is possible through the step (iii) culturing the cell line in a liquid medium.
  • the culturing in the liquid medium may be culturing a single colony obtained in the solid medium culturing step of (ii).
  • the temperature of the culturing in the liquid medium is about 31 ° C or less, for example, about 16 ° C to 31 ° C, about 16 ° C to 30 ° C, about 16 ° C to 29 ° C, about 16 ° C to 28 ° C, about 16 °C to 27 °C, about 16 °C to 26 °C, or about 16 °C to 25 °C, about 17 °C to 25 °C, about 18 °C to 25 °C, or about 19 °C to 25 °C.
  • culturing in the liquid medium may include subculturing.
  • Subculture means that some cells from the original culture are transplanted into a new medium and newly cultured.
  • Cell density can be appropriately controlled through subculture.
  • the subculture may be performed 2 or 3 times, or more, but is not limited thereto and can be appropriately adjusted by those skilled in the art.
  • the method of the present invention may further include preserving the cultured cell line.
  • the preserving step includes freezing and/or drying the cell line.
  • cryoprotectant for example, materials known in the art such as glycerol or dimethylsulfoxide may be used.
  • the culturing comprises culturing and activating the conserved strain.
  • Preserved strains may be frozen or dried.
  • Culture in the activating step may be solid culture or liquid culture.
  • the poly A tail in the plasmid can be stably maintained in the step of preserving and activating the cultured cell line.
  • the medium used in the culturing step of the present invention may contain nutrients required for culturing the cell line.
  • a conventional medium containing a carbon source, nitrogen source, phosphorus, inorganic compound, amino acid, and/or vitamin may be used.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid and the like may be added to the medium in an appropriate manner to adjust the pH of the medium.
  • the cell line of the present invention is not particularly limited, but may be E.coli.
  • E. coli is a host cell widely used for mass production or cloning of DNA, and the cell line of the present invention may include wild-type E. coli as well as mutant E. coli engineered to have characteristics advantageous to cloning.
  • a strain in which RecA is deleted may be used. However, it is not limited thereto.
  • the length of the poly A tail included in the plasmid may be shortened due to recombination or deletion in the cell line. However, when cells are cultured by the method of the present invention, the length of the poly A tail included in the plasmid can be stably maintained.
  • the method is characterized in that the stability of the poly A tail in the plasmid is increased compared to a method comprising culturing a cell line into which the plasmid is introduced at a temperature of 37° C. or higher.
  • the culturing may include one or more of (i) recovering the cell line, (ii) culturing the cell line in a solid medium, and (iii) culturing the cell line in a liquid medium.
  • Another aspect of the present invention is a method for mass production of a plasmid for mRNA production.
  • the method includes culturing a cell line transformed with a plasmid containing an mRNA encoding sequence including a poly(A) tail at a temperature of 31° C. or less.
  • Poly(A) tail, plasmid, cell line, culture and temperature conditions are as described above.
  • the produced plasmid can be used as a template for synthesizing mRNA in vitro.
  • the method may further include recovering the plasmid from the cell.
  • it is not limited thereto.
  • mRNA containing a poly A tail synthesized using the plasmid as a template may be used as one component of an immunogenic composition.
  • mRNA containing a poly A tail synthesized using the plasmid as a template can be used as a component of a therapeutic agent.
  • Another aspect of the present invention is a method for producing mRNA.
  • the method comprises the steps of culturing a cell line transformed with a plasmid containing a sequence encoding an mRNA containing a poly(A) tail at a temperature of 31 ° C. or less; and performing transcription using the plasmid of the cell line as a template.
  • the poly (A) tail and mRNA containing the tail, plasmid, cell line, culture and temperature conditions are the same as described above.
  • the plasmid may be recovered from the cell line.
  • the transcription step may be performed in vitro.
  • the production method may further include formulating the produced mRNA.
  • diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants may be used.
  • the preparation method may include preparing mRNA in a form included in lipid nanoparticles. However, it is not limited thereto.
  • the mRNA containing the poly A tail produced above may be used as one component of an immunogenic composition.
  • the mRNA containing the poly A tail produced above can be used as a component of a therapeutic agent.
  • DNA oligos consisting of sequences of SEQ ID NO: 1 and SEQ ID NO: 2 (made to order by Cosmogenetech) were mixed at a 1:1 molar ratio and heated at 95 degrees to -1 degrees per minute. was lowered and annealed, and a double-stranded polyA DNA fragment was prepared by filling the gap with Klenow large fragment (NEB). Then, after digestion with restriction enzymes SacII and HindIII (NEB), using T4 DNA ligase, the zygote was prepared by inserting it into the plasmid (pSKBS01, SEQ ID NO: 3) digested with the same restriction enzyme.
  • the prepared zygote was transformed into E. coli DH5alpha (Enzynomics, CP010).
  • the zygote was placed in E. coli for transformation on ice, allowed to stand for 30 minutes, and then subjected to heat shock at 42 degrees Celsius for 30 seconds. After cooling on ice for 2 minutes, SOC medium was added, and after recovery at 37 ° C. for 1 hour, E. coli was smeared on antibiotic-selective solid medium.
  • the culture medium on which E. coli was smeared was cultured at 37 degrees Celsius to form colonies.
  • the colonies formed on the selective medium after transformation are subjected to colony PCR to determine whether the poly(A) fragment can be inserted, and then plasmids are isolated from colonies in which the possibility of inserting the fragment is confirmed, and the inserted sequence is analyzed through nucleotide sequence analysis. confirmed.
  • M13-Forward and M13-Reverse primers (SEQ ID NOs: 4 and 5) were used.
  • a PCR product with a size of 550 bp was generated, and in the case of a plasmid that was not inserted, a size of 446 bp. was created.
  • PCR was performed on 40 colonies, and the PCR product was confirmed on an agarose gel.
  • 19 clearly showed 446 bp, indicating that poly(A) was not inserted.
  • the remaining 21 showed a multiband pattern, but contained a PCR product with a size of 550 bp (Fig. 1).
  • plasmids were isolated from these 21 cells for which fragment insertability was confirmed, and sequencing was performed using Sanger sequencing.
  • the Stbl3 strain one of strains specialized for cloning unstable fragments including repetitive sequences, was used. During transformation, the incubation temperature was 37 degrees Celsius as in Comparative Example 1 above.
  • the conjugate prepared in Comparative Example 1 was transformed into E. coli Stbl3 (Invitrogen, C737303).
  • the zygote was placed in E. coli for transformation on ice, allowed to stand for 30 minutes, and then subjected to heat shock at 42 degrees Celsius for 42 seconds. After cooling on ice for 2 minutes, SOC medium was added, and after recovery at 37 ° C. for 1 hour, E. coli was smeared on antibiotic-selective solid medium.
  • the culture medium on which E. coli was smeared was cultured at 37 degrees Celsius to form colonies.
  • Colony PCR was performed in the same manner as in Comparative Example 1. PCR was performed on 25 colonies and the PCR product was confirmed on an agarose gel. Seventeen clearly showed 446 bp, indicating that poly(A) was not inserted. The remaining 8 showed a multiband pattern, but contained a PCR product with a size of 550 bp (Fig. 2). After liquid culture at 37 degrees Celsius, plasmids were isolated from these 8 cells for which fragment insertability was confirmed, and sequencing was performed using Sanger sequencing.
  • the conjugate prepared in Comparative Example 1 was transformed into E. coli DH5alpha (Enzynomics, CP010) and Stbl3 (Invitrogen, C737303), respectively. Except for the E. coli culture temperature, other conditions were the same as those mentioned in Comparative Examples 1 and 2. E. coli was recovered at 25 degrees Celsius after heat shock, and colonies were formed by plating E. coli on antibiotic-selective solid medium and culturing at 25 degrees Celsius.
  • Colony PCR was performed in the same manner as in Comparative Example 1. PCR was performed on 10 colonies per each strain, and the PCR product was confirmed on an agarose gel.
  • poly(A) tail In order to explore the temperature range in which the poly(A) tail can be stably maintained, plasmid DNA containing the poly(A) tail is transformed and cultured in liquid under various temperature conditions, and their nucleotide sequences are analyzed to obtain poly(A) tail. (A) It was confirmed that the tail was maintained.
  • Plasmid DNA with a poly(A) tail length of 124 was prepared using the method described above (Comparative Example 1), and the plasmid DNA was transformed into E. coli DH5alpha (Enzynomics, CP010). Plasmid DNA was added to E. coli, left on ice for 30 minutes, and then subjected to heat shock at 42 degrees Celsius for 40 seconds. After cooling on ice for 2 minutes, SOC medium was added and incubated for 1 hour at 37 degrees, 34 degrees, 32 degrees, 31 degrees, 28 degrees, 25 degrees, 22 degrees, and 19 degrees Celsius, respectively. Escherichia coli was smeared. The culture medium on which E. coli was smeared was cultured at the same temperature as the temperature at which E. coli was recovered to form colonies.
  • plasmids for sequencing 24 or 25 colonies generated on the solid medium were selected and cultured in liquid at the same temperature as the solid medium. After liquid culture, the plasmid was isolated and the poly(A) sequence length and base sequence were analyzed using Sanger sequencing. Atail-seq-R (SEQ ID NO: 6) primer was used for sequencing.
  • NEB stable strain which is one of the strains specialized for maintaining unstable fragments, to check whether the poly(A) sequence can be maintained intact during continuous subculture under low temperature conditions proceeded.
  • the plasmid DNA used in Example 2 was transformed into E. coli NEB stable (NEB, C3040H). Plasmid DNA was added to E. coli for transformation on ice, allowed to stand for 30 minutes, and then subjected to heat shock at 42 degrees Celsius for 40 seconds. After cooling on ice for 5 minutes, NEB 10-beta/Stable Outgrowth medium was added, and after recovery at 37 degrees Celsius or 25 degrees Celsius for 1 hour, E. coli was plated on antibiotic-selective solid medium. The culture medium on which E. coli was smeared was cultured at the same temperature as the temperature at which E. coli was recovered to form colonies.
  • E. coli NEB stable NEB, C3040H
  • Plasmid DNA was added to E. coli for transformation on ice, allowed to stand for 30 minutes, and then subjected to heat shock at 42 degrees Celsius for 40 seconds. After cooling on ice for 5 minutes, NEB 10-beta/Stable Outgrowth medium was added, and after recovery at 37 degrees Celsius or 25 degrees
  • the transformed cell line which was identified as having 124 A lengths in Example 3 at 25 degrees, was made into a glycerol stock form and stored in a -70 ° C freezer. kept.
  • the stocks stored in a frozen state were taken out and liquid cultured in different test tubes at 16 degrees, 25 degrees, and 30 degrees, and then each plasmid was separated and sequenced.
  • a total of 124 A lengths were analyzed in the plasmid isolated from cultured E. coli, and it was confirmed that the A length was maintained intact during culture after stock preparation.
  • Stock culture# A length by incubation temperature 16 degrees 25 degrees 30 degrees One 124 124 124 2 124 124 124 3 124 124 124 4 124 124 124 5 124 124 124 6 124 124 124 124
  • the transformed cell lines DH5alpha and NEB stable which were confirmed to have 124 A lengths at 25 degrees, were each made into glycerol stocks and stored in a -70 ° C freezer.
  • the stock was taken out and cultured at 200 rpm for 48 hours at 13, 16, 19, 22, and 25 degrees, and the OD 600 was measured at a fixed time. As a result of the experiment, it was confirmed that there was almost no cell growth at 13 degrees below 16 degrees (FIG. 5).

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 폴리 A 테일 (poly(A) tail)을 코딩하는 서열이 포함된 플라스미드로 형질전환된 세포주를 31℃ 이하의 온도 조건에서 배양하는 단계를 포함하는, 폴리 A 테일을 플라스미드에서 안정적으로 유지하는 방법에 관한 것이다.

Description

폴리 A 테일을 안정적으로 유지하는 방법
본 발명은 폴리 A 테일을 안정적으로 유지하는 방법에 관한 것이다.
mRNA는 최근 의약품의 주약 성분 (API, Active Pharmaceutical Ingredient)으로 주목받고 있다. mRNA에는 폴리 A 테일(poly(A) tail)이라는 구성요소가 필요한데, 폴리 A 테일은 RNA의 안정성과 번역과정에 중요한 역할을 한다. mRNA 백신을 구성하는 mRNA의 경우 폴리 A 테일의 길이는 120개가 표준 사이즈(standard size)로 인식되고 있다 (Mol Ther Nucleic Acids. 2021 Dec 3;26:945-956). 세포내에서 전사되는 mRNA는 폴리 A 신호(PolyA signal)가 존재하며 전사과정 이후 폴리 A 테일이 더해지는 과정을 거친다. 인비트로 전사(In Vitro Transcription, IVT)에 의해 제작되는 mRNA에도 체내 안정성 및 번역 효율을 높이기 위해 폴리 A 테일이 필요하다.
폴리 A 테일을 더하는 방법은 2가지로 구분될 수 있다. 한 가지는 IVT 이후 polyA 폴리머라제(polymerase)를 사용하여 폴리 A 테일을 합성하는 방법이고 다른 한 가지는 IVT에 사용하는 주형(template)에 아데닌 반복서열을 포함시켜 IVT를 통해 폴리 A 테일이 생성되도록 하는 방법이다.
전자의 경우 폴리 A 폴리머라제(polyA polymerase)를 활용하여 mRNA에 폴리 A 테일을 합성하는 별도의 과정이 필요하며, 생성된 폴리 A 테일의 길이는 일정하지 않을 수 있다. 하지만, 후자의 경우, IVT과정 이외 별도의 과정이 필요하지 않으며, 생성되는 폴리 A 테일의 길이가 일정하게 제작될 수 있다. 그러므로, 공정의 효율성 및 폴리 A 테일 길이의 균일성 측면에서, 주형(template)에 폴리 A 테일 서열이 포함되도록 하는 것이 선호될 수 있다.
이를 위해서는 플라스미드(plasmid) DNA에 폴리 A 테일 서열을 클로닝하고 유지해야 하는데, 일반적인 방식으로 대장균을 활용하여 이러한 과정을 진행할 경우, 재조합(recombination) 및 결손(deletion)이 일어나므로 mRNA 백신에 사용하기 위한 표준 사이즈인 100개 이상의 아데닌 반복서열이 포함된 플라스미드 DNA를 확보하는 것이 어렵다.
이러한 문제를 해결하고자 아데닌 반복 서열 사이에 링커 서열을 포함시켜 안정성을 높이는 방법이 고안되었으나(RNA. 2019 Apr;25(4):507-518. doi: 10.1261/rna.069286.118. Epub 2019 Jan 15.) 아데닌 반복서열로만 이루어진 폴리 A 테일이 자연계에 존재하는 본래의 모습이므로 폴리 A 테일 사이에 링커 서열을 포함시키지 않고 플라스미드에 클로닝 및 유지하기 위한 다른 방법의 개발이 여전히 요구된다.
본 발명의 목적은 폴리 A 테일을 안정적으로 유지하는 방법에 관한 것이다.
본 발명은 폴리 A 테일을 안정적으로 유지하는 방법을 제공한다.
본 발명의 방법을 통해 폴리 A 테일을 용이하게 클로닝 할 수 있고, 폴리 A 서열이 안정적으로 유지될 수 있다.
도 1은 섭씨 37도 조건에서 DH5alpha를 이용한 poly(A) 서열 클로닝시 콜로니 PCR결과를 확인한 것이다.
도 2는 섭씨 37도 조건에서 Stbl3를 이용한 poly(A) 서열 클로닝시 콜로니 PCR결과를 확인한 것이다.
도 3은 저온 조건에서 poly(A) 서열 클로닝시 콜로니 PCR결과를 확인한 것이다.
도 4는 폴리 A 테일 (poly(A) tail) 을 코딩하는 서열이 포함된 플라스미드로 형질전환된 세포주를 다양한 온도조건에서 배양할 경우 A124±1 비율을 비교한 결과를 나타내는 그래프이다.
도 5는 준비된 스탁을 13, 16, 19, 22, 25도 조건에서 200rpm으로 48시간동안 배양하면서 정해진 시간에 OD600을 측정한 온도별 배양곡선 결과를 나타내는 그래프이다.
본 발명을 구현하는 하나의 양태는 폴리 A 테일을 플라스미드에서 안정적으로 유지하는 방법이다.
하나의 구체예에서, 상기 방법은 폴리 A 테일 (poly(A) tail) 을 코딩하는 서열이 포함된 플라스미드로 형질전환된 세포주를 31 ℃ 이하의 온도 조건에서 배양하는 단계를 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 배양하는 단계는 (1) 상기 세포주를 31 ℃이하의 온도 조건으로 회복시키는 것을 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 방법은 상기 (1)의 회복 단계 이후, (2) 상기 세포주를 31 ℃이하의 온도 조건으로 고체 배지에서 배양하여 콜로니를 형성하는 것을 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 배양은 (3) 상기 (2) 의 고체 배지 배양으로 형성된 콜로니를 31 ℃ 이하의 온도 조건으로 액체 배지에서 배양하는 단계를 더 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 방법은 (1) 폴리 A 테일을 코딩하는 서열을 포함하는 플라스미드로 형질전환된 세포주를 31 ℃이하의 온도 조건으로 회복시키는 단계; (2) 회복된 세포주를 31 ℃이하의 온도 조건으로 고체배양을 통해 콜로니를 형성하는 단계; 및 (3) 31 ℃이하의 온도 조건으로 액체배양을 수행하는 단계를 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 액체 배지에서 배양하는 단계는 계대배양하는 것을 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 단계 (1) 내지 (3) 의 온도 조건은 16 ℃ 내지 31 ℃이다.
전술한 구체예 중 어느 하나의 구체예로, 상기 단계 (1) 내지 (3) 의 온도 조건은 19 ℃ 내지 25 ℃이다.
전술한 구체예 중 어느 하나의 구체예로, 상기 세포주는 대장균(E.coli)이다.
전술한 구체예 중 어느 하나의 구체예로, 상기 형질전환은 열충격(heat shock) 또는 전기천공(electroporation)을 이용해 폴리 A 테일을 코딩하는 서열을 포함하는 플라스미드를 세포주에 도입하는 것을 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 도입은 37 ℃내지 42℃의 온도에서 수행된다.
전술한 구체예 중 어느 하나의 구체예로, 상기 방법은 배양된 세포주를 보존하는 단계를 더 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 보존하는 단계는 세포주를 동결 및/또는 건조하는 것을 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 배양은 보존된 균주를 배양하여 활성화하는 단계를 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 방법은 플라스미드로 형질전환된 세포주를 37 ℃이상의 온도에서 배양하는 단계를 포함하는 방법에 비해 플라스미드 내 폴리 A 테일의 안정성이 증가한 것을 특징으로 한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 폴리 A 테일은 20 내지 400개의 아데닌(A)을 포함한다.
본 발명을 구현하는 다른 하나의 양태는 mRNA 생산을 위한 플라스미드의 대량 생산방법이다.
하나의 구체예에서, 상기 방법은 폴리 A 테일 (poly(A) tail) 을 포함하는 mRNA를 코딩하는 서열이 포함된 플라스미드로 형질전환된 세포주를 31 ℃ 이하의 온도조건에서 배양하는 단계를 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 mRNA는 면역원성 조성물 및/또는 치료제의 일 구성성분이다.
본 발명을 구현하는 다른 하나의 양태는, 폴리 A 테일을 포함하는 mRNA의 생산방법이다.
하나의 구체예에서, 상기 방법은 폴리 A 테일 (poly(A) tail) 을 포함하는 mRNA를 코딩하는 서열이 포함된 플라스미드를 형질전환된 세포주를 31 ℃ 이하의 온도 조건으로 배양하는 단계를 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 방법은 세포주로부터 플라스미드를 회수하여 인비트로(in vitro)에서 전사를 수행하는 것을 포함한다.
전술한 구체예 중 어느 하나의 구체예로, 상기 mRNA는 면역원성 조성물 및/또는 치료제의 일 구성성분이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 발명에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 발명에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 볼 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 발명에 기재된 본 발명의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 발명에 포함되는 것으로 의도된다.
또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명의 하나의 양태는 폴리 A 테일을 플라스미드에서 안정적으로 유지하는 방법이다.
상기 방법은 폴리 A 테일 (poly(A) tail) 을 코딩하는 서열이 포함된 플라스미드로 형질전환된 세포주를 31 ℃ 이하의 온도 조건에서 배양하는 단계를 포함한다.
본 발명에서 용어 “폴리 A 테일(poly A tail)”은 전형적으로 RNA 분자의 3'말단에 위치하는 아데닐산(adenylate) 잔기들의 연속 또는 불연속 서열을 지칭한다. 폴리 A 테일은 mRNA의 3', 예를 들어 3'UTR의 뒤에 이어질 수 있다. 이러한 폴리 A 테일은 약 20개 이상, 25개 이상, 40개 이상, 60개 이상, 80개 이상, 또는 100개 이상의 아데닐(A) 뉴클레오타이드로 구성되거나 이를 포함할 수 있다.
일 구현예로, 폴리 A 테일은 20 내지 400개의 아데닌(A)을 포함할 수 있다. 예를 들어, 20 내지 300개, 40 내지 200개, 50 내지 190개, 60 내지 180개, 70 내지 170개, 60 내지 160개, 70 내지 150개, 80 내지 140개의 아데닌을 포함할 수 있다. 그 예로 약 120개의 아데닌을 포함할 수 있으나 이에 제한되지 않는다.
일 구현예로, 폴리 A 테일의 뉴클레오티드의 개수를 기준으로 전형적으로 적어도 75%, 적어도 80%, 적어도 85%, 적어도 90%, 적어도 95%, 적어도 96%, 적어도 97%, 적어도 98%, 또는 적어도 99%는 A 뉴클레오티드이지만, 나머지 뉴클레오티드는 A 뉴클레오티드 이외의 뉴클레오티드, 예컨대 U, T 또는 C 일 수 있다. 일 예로, 폴리 A 테일은 mRNA의 분해를 지연시키도록 하는 변형을 포함할 수 있다.
본 발명에서 폴리 A 테일을 포함하는 플라스미드는 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 목적하는 mRNA를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 일 구현예로, 상기 플라스미드는 클로닝에 활용하기 용이한 제한효소 결합부위를 포함할 수 있다.
일 구현예로, 상기 플라스미드는 형질 전환 여부를 확인하기 위한 선별 마커(selection marker)를 포함할 수 있다. 약물 내성, 영양 요구성, 세포 독성제에 대한 내성과 같은 선택 가능 표현형을 부여하는 마커들이 사용될 수 있으며, 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다. 그러나 전술한 예시에 한정되는 것은 아니다.
본 발명의 플라스미드는, 플라스미드에 폴리 A 테일을 코딩하는 서열을 도입하여 플라스미드를 제조할 수 있다.
일 예로, 폴리 A 테일을 코딩하는 서열을 PCR로 증폭하고, 제한효소를 처리한 후, 제한효소가 처리된 플라스미드와 연결하여 폴리 A 테일 (poly(A) tail) 을 코딩하는 서열이 포함된 플라스미드를 준비할 수 있다. 일 예로, 상기 폴리 A 테일을 코딩하는 서열의 상단에 mRNA를 코딩하는 폴리뉴클레오티드 서열이 연결되어 있을 수 있다. 일 예로, 상기 플라스미드는 폴리 A 테일을 코딩하는 서열의 상단에 mRNA를 코딩하는 폴리뉴클레오티드의 서열이 포함된, 목적하는 mRNA를 전사하기 위한 주형으로 사용 될 수 있다.
본 발명의 폴리 A 테일 (poly(A) tail) 을 코딩하는 서열이 포함된 플라스미드로 형질전환된 세포주는 폴리 A 테일을 코딩하는 서열을 포함하는 플라스미드를 세포주에 도입(introduce)하여 준비 될 수 있다.
본 발명에서 폴리 A 테일을 코딩하는 서열을 포함하는 플라스미드를 세포주에 도입하는 것은 세포주를 플라스미드로 형질전환하는 것으로도 칭해질 수 있다.
본 발명에서 플라스미드의 “도입” 혹은 “형질전환”은 세포주에 플라스미드를 전달하는 것을 의미한다. 이와 같은 도입은 당업계의 통상적인 방법에 따라 용이하게 수행할 수 있다. 플라스미드를 세포주에 도입하기 위해 세포를 DNA 분자에 투과적일 수 있도록 처리하는 과정을 거칠 수 있고, 이러한 과정을 거친 세포를 컴피턴트 세포(competent cell)라고 한다.
일 구현예로, 상기 도입은 열충격(heat shock) 또는 전기천공법(electroporation)을 이용한 것일 수 있다.
열충격을 이용한 플라스미드 전달은 DNA와 세포를 혼합하고 순간적으로 열을 가하여 수행된다. 일 예로 상기 열충격에 의한 도입은 약 37 ℃ 이상의 온도조건에서 수행될 수 있고, 구체적으로는 약 37℃ 내지 42℃의 온도조건에서 수행될 수 있다. 열충격을 가하기 이전 및/또는 이후 얼음에서 세포를 식히는 단계가 포함될 수 있다.
전기천공법은 전기를 이용하여 플라스미드를 전달하는 방법으로, 짧고 높은 전압의 전기 펄스 자극을 인가하여 세포막 막전위에 변화를 주면, 나노미터 크기의 작은 기공이 세포막의 표면에 생성되어 DNA 투과율이 높아지게 된다. 일 예로 상기 전기천공에 의한 도입은 약 37 ℃ 이상의 온도조건에서 수행될 수 있고, 구체적으로는 약 37℃ 내지 42℃의 온도조건에서 수행될 수 있다. 전기 자극을 가하기 이전 및/또는 이후로 얼음에서 세포를 식히는 단계가 포함 될 수 있다.
다른 예로, CaCl2침전법, CaCl2방법에 DMSO(dimethyl sulfoxide)라는 환원물질을 사용함으로써 효율을 높인 Hanahan 방법, 인산칼슘 침전법, 원형질 융합법, 실리콘 카바이드 섬유를 이용한 교반법, PEG를 이용한 형질전환법, 덱스트란 설페이트, 리포펙타민 및 건조/억제 매개된 형질전환 방법 등을 사용할 수 있다. 그러나 이에 제한되는 것은 아니다.
mRNA 백신 등 치료 목적의 mRNA의 경우, mRNA의 안정성 및 번역 효율성을 위해 폴리 A 테일이 안정적으로 필요하며, 본 출원인은 새롭게 상기 플라스미드에 존재하는 폴리 A 테일을 코딩하는 서열이 소실되지 않고 안정적으로 클로닝 및 대량 생산, 유지할 수 있는 방법으로 클로닝된 대장균의 배양 방법을 제공한다.
본 발명에서 폴리 A 테일을 코딩하는 서열을 포함하는 플라스미드가 도입된 세포주를 31 ℃ 이하의 온도 조건에서 배양하는 단계는, 다음 단계 중 어느 하나 이상을 포함할 수 있다:
(i) 세포주를 회복(recovery)하는 단계,
(ii) 세포주를 고체 배지에서 배양하는 단계, 및
(iii) 세포주를 액체 배지에서 배양하는 단계.
상기 (i) 세포주를 회복(recovery)하는 단계는 형질전환 후 컴피턴트(competent) 상태에 있던 세포주를 배지에서 배양하여 생리학적 기능을 회복하도록 하는 단계이다. 일 예로 회복 단계의 배지는 비선택 배지일 수 있다.
일 예로, 상기 회복 단계에서의 배양 온도는 약 31 ℃ 이하, 예를 들어 약 16 ℃ 내지 31 ℃, 약 16 ℃ 내지 30 ℃, 약 16 ℃ 내지 29 ℃, 약 16 ℃ 내지 28 ℃, 약 16 ℃ 내지 27 ℃, 약 16 ℃ 내지 26 ℃, 약 16 ℃ 내지 25 ℃, 약 17 ℃ 내지 25℃, 약 18 ℃ 내지 25℃, 또는 약 19 ℃ 내지 25℃ 일 수 있다.
일 예로, 상기 회복 단계에서의 배양 시간은 약 5 분 내지 2 시간 일 수 있다.
상기 (ii) 세포주를 고체 배지에서 배양하는 단계를 통해 형질전환된 세포주를 배양하여 콜로니를 형성할 수 있다.
“콜로니”는 목적하는 플라스미드가 도입된 세포주의 군집을 의미한다.
“고체 배지”는 “고형 배지”로도 지칭할 수 있다. 고체 배지 배양에서 균주의 생육 여부와 플라스미드의 도입 여부를 확인할 수 있으며, 플라스미드의 도입 여부를 확인하기 위해 선택배지(selective medium)를 사용할 수 있다. 일 예로, 선택배지에는 항생제가 포함될 수 있다.
일 예로, 상기 고체 배지에서 배양하는 단계의 온도는 약 31 ℃ 이하, 예를 들어 약 16 ℃ 내지 31 ℃, 약 16 ℃ 내지 30 ℃, 약 16 ℃ 내지 29 ℃, 약 16 ℃ 내지 28 ℃, 약 16 ℃ 내지 27 ℃, 약 16 ℃ 내지 26 ℃, 약 16 ℃ 내지 25 ℃, 약 17 ℃ 내지 25℃, 약 18 ℃ 내지 25℃, 또는 약 19 ℃ 내지 25℃ 일 수 있다.
상기 (iii) 세포주를 액체 배지에서 배양하는 단계를 통해 세포주의 대량 배양이 가능하다. 상기 액체 배지에서 배양하는 단계는 상기 (ii)의 고체 배지 배양 단계에서 수득한 단일 콜로니를 배양하는 것일 수 있다.
일 예로, 상기 액체 배지에서 배양하는 단계의 온도는 약 31 ℃ 이하, 예를 들어 약 16 ℃ 내지 31 ℃, 약 16 ℃ 내지 30 ℃, 약 16 ℃ 내지 29 ℃, 약 16 ℃ 내지 28 ℃, 약 16 ℃ 내지 27 ℃, 약 16 ℃ 내지 26 ℃, 또는 약 16 ℃ 내지 25 ℃, 약 17 ℃ 내지 25℃, 약 18 ℃ 내지 25℃, 또는 약 19 ℃ 내지 25℃ 일 수 있다.
일 예로, 상기 액체 배지에서 배양하는 단계는 계대배양하는 단계를 포함할 수 있다. 계대배양(subculture) 이란 원래 배양에서 일부 세포를 새로운 배지로 이식하여 새롭게 배양하는 것을 의미한다. 계대배양을 통해 세포의 밀도를 적절하게 조절할 수 있다. 일 예로, 상기 계대배양은 2회 또는 3회, 또는 그 이상 수행될 수 있으나, 이에 제한되는 것은 아니며 당업자가 적절히 조절할 수 있다.
본 발명의 방법은 상기 배양된 세포주를 보존하는 단계를 더 포함할 수 있다.
상기 보존하는 단계는 세포주를 동결 및/또는 건조하는 것을 포함한다. 동결보존제는 예를 들어 글리세롤(glycerol) 또는 디메틸설폭사이드(dimethylsulfoxide)와 같이 당업계에 공지된 물질을 사용할 수 있다.
전술한 구체예 중 어느 하나의 구체예로, 상기 배양은 보존된 균주를 배양하여 활성화하는 단계를 포함한다. 보존된 균주는 동결되거나, 건조된 상태일 수 있다. 상기 활성화하는 단계에서의 배양은 고체배양 또는 액체배양일 수 있다.
본 발명의 방법에 따르면 배양된 세포주를 보존하고 활성화하는 단계에 있어서 플라스미드 내 폴리 A 테일이 안정적으로 유지될 수 있다.
본 발명의 배양 단계에서 사용되는 배지는 세포주를 배양하기 위해 필요로 하는 영양물질을 포함할 수 있다. 예를 들어 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지가 사용될 수 있다. 또한, 배양 단계에서 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다.
본 발명의 세포주는 특별히 제한되는 것은 아니지만, 대장균(E.coli)일 수 있다. 대장균은 DNA의 대량 생산이나 클로닝에 널리 사용되는 숙주 세포로, 본 발명의 세포주는 야생형 대장균뿐만 아니라 클로닝에 유리한 특성을 갖도록 조작한 변이형 대장균 역시 포함할 수 있다. 그 예로 RecA를 결실시킨 균주를 사용할 수 있다. 그러나 이에 제한되는 것은 아니다.
플라스미드에 포함된 폴리 A 테일은 세포주 내에서 재조합(recombination) 또는 결실(deletion) 등으로 인해 길이가 짧아질 수 있다. 그러나 본 발명의 방법을 통해 세포를 배양할 경우, 플라스미드에 포함된 폴리 A 테일의 길이를 안정적으로 유지할 수 있다.
일 예로, 상기 방법은 플라스미드가 도입된 세포주를 37 ℃이상의 온도에서 배양하는 단계를 포함하는 방법에 비해, 플라스미드 내 폴리 A 테일의 안정성이 증가한 것을 특징으로 한다. 상기 배양은 (i) 세포주를 회복(recovery)하는 단계, (ii) 세포주를 고체 배지에서 배양하는 단계, 및 (iii) 세포주를 액체 배지에서 배양하는 단계 중 1 이상을 포함할 수 있다.
본 발명의 다른 하나의 양태는 mRNA 생산을 위한 플라스미드의 대량 생산방법이다.
상기 방법은 폴리 A 테일 (poly(A) tail) 을 포함하는 mRNA를 코딩하는 서열이 포함된 플라스미드로 형질전환된 세포주를 31 ℃ 이하의 온도조건에서 배양하는 단계를 포함한다.
폴리 A 테일 (poly(A) tail), 플라스미드, 세포주, 배양 및 온도 조건에 대해서는 전술한 바와 같다.
일 예로, 생산된 플라스미드는 인비트로(in vitro)에서 mRNA를 합성하기 위한 주형으로 사용 될 수 있다. 일 예로 상기 방법은 플라스미드를 세포로부터 회수하는 단계를 더 포함할 수 있다. 그러나 이에 제한되지 않는다.
일 예로, 상기 플라스미드를 주형으로 합성된, 폴리 A 테일을 포함하는 mRNA는 면역원성 조성물의 일 구성성분으로 사용될 수 있다.
일 예로, 상기 플라스미드를 주형으로 합성된, 폴리 A 테일을 포함하는 mRNA는 치료제의 일 구성성분으로 사용될 수 있다.
본 발명의 다른 하나의 양태는 mRNA 생산방법이다.
상기 방법은 폴리 A 테일 (poly(A) tail) 을 포함하는 mRNA를 코딩하는 서열이 포함된 플라스미드를 형질전환된 세포주를 31 ℃ 이하의 온도 조건으로 배양하는 단계; 및 상기 세포주의 플라스미드를 주형으로 전사(transcription)를 수행하는 단계를 포함한다.
상기 폴리 (A) 테일 및 이를 포함하는 mRNA, 플라스미드, 세포주, 배양 및 온도 조건에 대해서는 전술한 바와 같다.
일 예로, 상기 배양 단계 이후 플라스미드는 세포주로부터 회수 될 수 있다.
일 예로, 상기 전사 단계는 인비트로(in vitro)에서 수행될 수 있다.
일 예로, 상기 생산 방법은 생산된 mRNA를 제제화 하는 단계를 더 포함할 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용할 있다. 그 예로, 상기 제조방법은 mRNA를 지질 나노입자에 포함된 형태로 제조하는 단계를 포함할 수 있다. 그러나 이에 제한되지 않는다.
일 예로, 상기 생산된 폴리 A 테일을 포함하는 mRNA는 면역원성 조성물의 일 구성성분으로 사용될 수 있다.
일 예로, 상기 생산된 폴리 A 테일을 포함하는 mRNA는 치료제의 일 구성성분으로 사용될 수 있다.
이하 본 발명을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다.
비교예 1. 일반 균주를 이용한 통상조건의 클로닝
Poly(A) 서열이 삽입된 Plasmid DNA를 확보하기 위해 통상적으로 사용하는 DH5alpha 균주와 방법을 이용하였다.
Poly(A) 절편 및 접합체 준비
Plasmid에 삽입할 Poly(A) 절편을 준비하기 위해 서열번호 1과 서열번호 2의 서열로 이루어진 DNA oligo (코스모진텍 주문제작)를 1:1 molar ratio로 혼합하고 95도에서 분당 -1도씩 온도를 낮추어 annealing시키고, Klenow large fragment (NEB)로 gap부위를 채워서 double strand polyA DNA 절편을 제작하였다. 이후 제한효소 SacII와 HindIII (NEB)로 절단 후 T4 DNA ligase를 활용하여 동일한 제한효소로 절단된 plasmid (pSKBS01, 서열번호 3)에 삽입시켜 접합체를 준비하였다.
형질전환 (DH5alpha)
준비된 접합체를 대장균 DH5alpha (Enzynomics, CP010)에 형질전환하였다. 얼음에서 형질전환용 대장균에 접합체를 넣고 30분동안 정치 후 섭씨 42도에서 30초간 열 충격을 주었다. 이후 2분간 얼음에서 식힌 후 SOC배지를 첨가하고 섭씨 37도에서 1시간 동안 회복시킨 후 항생제 선택 고형배지에 대장균을 도말하였다. 대장균이 도말된 배지는 섭씨 37도에서 배양하여 콜로니가 생성되도록 하였다.
Poly(A) 서열 삽입 확인
형질전환 후 선택배지에 형성된 콜로니는 콜로니 PCR을 통해 poly(A) 절편의 삽입 가능성 여부를 파악하고 난 후, 절편의 삽입가능성이 확인된 콜로니에서 plasmid를 분리한 후 염기서열 분석을 통해 삽입된 서열을 확인하였다.
콜로니 PCR은 M13-Foward와 M13-Reverse 프라이머 (서열번호 4,5)를 사용하였고, poly(A)가 삽입되었을 경우 550bp의 크기의 PCR product가 생성되며, 삽입되지 않은 plasmid의 경우 446 bp의 크기가 생성되도록 하였다. 40개 콜로니에 대해 PCR을 진행하고 agarose젤에서 PCR product를 확인하였다. 콜로니 PCR결과, 19개는 명확히 446 bp를 보여 poly(A) 가 삽입되지 않은 것을 알 수 있었다. 나머지 21개는 multiband의 양상을 보이지만, 550 bp 크기의 PCR product가 포함되어 보였다 (도 1). 절편 삽입가능성이 확인된 이들 21개는 섭씨 37도에서 액체 배양 후 plasmid를 분리하여 sanger sequencing을 이용해 염기서열분석을 진행하였다.
하지만, 염기서열을 분석한 모든 콜로니에서 poly(A) 서열이 삽입되지 않았음을 확인하였다.
이는 통상 조건의 클로닝 시에는 폴리 A 테일이 모두 소실되는 것을 뒷받침하는 결과이다.
비교예 2. 불안정한 절편 클로닝에 특화된 균주를 이용한 클로닝
poly(A) 서열이 삽입된 plasmid DNA를 확보하기 위해서, 반복서열을 포함한 불안정한 절편 클로닝에 특화된 균주 중 하나인 Stbl3 균주를 사용하였다. 형질전환 시 배양온도는 앞선 비교예1과 동일하게 섭씨 37도로 진행하였다.
형질전환 (Stbl3)
비교예1에서 준비한 접합체를 대장균 Stbl3 (Invitrogen, C737303)에 형질전환하였다. 얼음에서 형질전환용 대장균에 접합체를 넣고 30분동안 정치 후 섭씨 42도에서 42초간 열충격을 주었다. 이후 2분간 얼음에서 식힌 후 SOC배지를 첨가하고 섭씨 37도에서 1시간동안 회복시킨 후 항생제 선택 고형배지에 대장균을 도말하였다. 대장균이 도말된 배지는 섭씨 37도에서 배양하여 콜로니가 생성되도록 하였다.
Poly(A) 서열 삽입 확인
비교예1과 동일한 방법으로 콜로니 PCR을 진행하였다. 25개 콜로니에 대해 PCR을 진행하고 agarose젤에서 PCR product를 확인하였다. 17개는 명확히 446 bp를 보여 poly(A) 가 삽입되지 않을 것을 알 수 있었다. 나머지 8개는 multiband의 양상을 보이지만, 550 bp 크기의 PCR product가 포함되어 보였다 (도 2). 절편 삽입가능성이 확인된 이들 8개는 섭씨 37도에서 액체 배양 후 plasmid를 분리하여 sanger sequencing을 이용해 염기서열분석을 진행하였다.
하지만, 염기서열을 분석한 모든 콜로니에서 poly(A) 서열이 삽입되지 않았음을 확인하였다.
이는 불안정한 절편을 안정적으로 클로닝할 수 있는 특수 균주 역시 폴리 A 테일을 모두 소실시키는 것으로, 안정적인 mRNA 백신을 제조하기에는 불안정함을 뒷받침하는 결과이다.
실시예 1. 저온조건을 이용한 클로닝
상기 비교예로부터, poly(A) 서열을 대장균에 도입한 후 섭씨 37도에서 배양하는 통상적인 방법으로는 poly(A) 서열이 제대로 삽입되거나 안정적으로 유지되지 않는 문제가 있음을 확인하였다.
이에 안정적인 폴리 A 테일 유지를 위한 방법을 새롭게 정립하였다. 이를 위해, 형질전환시 대장균 배양온도를 통상의 섭씨 37보다 낮게 적용하였다.
형질전환 (DH5alpha, Stbl3)
비교예1에서 준비한 접합체를 대장균 DH5alpha (Enzynomics, CP010)와 Stbl3 (Invitrogen, C737303)에 각각 형질전환하였다. 대장균 배양 온도를 제외한 다른 조건은 비교예 1, 2에 언급한 조건과 동일하게 진행하였다. 대장균에 열 충격 후 섭씨 25도에서 회복시켰으며, 항생제 선택 고형배지에 대장균을 도말한 후 섭씨 25도에서 배양하여 콜로니가 생성되도록 하였다.
Poly(A) 서열 삽입 확인
비교예 1과 동일한 방법으로 콜로니 PCR을 진행하였다. 각 균주당 10개 콜로니에 대해 PCR를 진행하고 agarose젤에서 PCR product를 확인하였다.
DH5alpha 에서는 5개, Stbl3에서는 7개가 명확히 446 bp를 보여 poly(A) 가 삽입되지 않은 것을 알 수 있었고, 나머지 콜로니에서는 비교예1, 2에서 와는 달리 multiband의 양상이 아닌 명확한 550 bp 크기의 PCR product가 관찰되었다 (도 3). 절편 삽입가능성이 확인된 이들 콜로니는 섭씨 25도에서 액체 배양 후 plasmid를 분리하여 sanger sequencing을 이용해 염기서열분석을 진행하였다.
실험 결과, 염기서열을 분석한 모든 콜로니에서 poly(A) 서열이 삽입되었음을 확인하였다.
이를 통해, 일반균주 및 불안정한 절편 클로닝에 특화된 균주 모두에서 poly(A) tail을 안정적으로 클로닝하기 위해서는 섭씨 37도보다 낮은 저온 조건이 유리함을 확인하였다.
실시예 2. 온도조건 탐색: 일반 균주를 이용한 형질전환 및 서열확인
poly(A) tail을 안정하게 유지할 수 있는 온도범위를 탐색하기 위해, 다양한 온도 조건에서 poly(A) tail을 포함하는 plasmid DNA를 형질전환 및 액체 배양을 진행하고, 이들의 염기서열을 분석하여 poly(A) tail이 유지됨을 확인하였다.
형질전환 (DH5alpha)
앞서 기술한 방식(비교예 1)을 이용하여 poly(A) tail의 길이가 124개인 plasmid DNA를 제작하였고, plasmid DNA를 대장균 DH5alpha (Enzynomics, CP010)에 형질전환 하였다. 대장균에 plasmid DNA를 넣고 얼음에서 30분동안 정치 후 섭씨 42도에서 40초간 열충격을 주었다. 이후 얼음에서 2분간 식힌 후 SOC 배지를 첨가하고 섭씨 37도, 34도, 32도, 31도, 28도, 25도, 22도, 19도에서 각각 1시간 동안 배양하여 회복시킨 후 항생제 선택 고형배지에 대장균을 도말하였다. 대장균이 도말된 배지는 대장균을 회복시킨 온도와 동일한 온도에서 배양하여 콜로니가 생성되도록 하였다.
Poly(A) 서열의 길이 확인
염기서열 분석을 위한 plasmid를 분리하기 위해서 고형배지에 생성된 콜로니를 24개 또는 25개씩 선택하여, 고형배지를 배양한 온도와 동일한 온도에서 액체 배양하였다. 액체 배양 후 plasmid를 분리하여 poly(A) 서열의 길이 및 염기서열을 sanger sequencing을 이용해 분석하였다. 염기서열 분석에는 Atail-seq-R (서열번호 6) 프라이머를 사용하였다.
염기서열분석 결과 섭씨 37도에서는 poly(A) 서열이 유지되지 않았으나, 섭씨 31도 이하에서 배양 시 poly(A) 길이의 안정성이 크게 증가되는 것을 확인하였다. 이로써 poly(A) 서열의 안정성은 대장균 배양 온도가 낮아짐에 따라 증가함을 확인하였다.
sanger sequencing을 이용한 염기서열 분석에서 한가지 서열이 길게 반복된 주형을 분석할 때 polymerase의 미끄러짐 현상으로 인해 분석 결과에서 뉴클레오타이드 한 개가 빠지거나 더해져서 분석될 수 있다(https://www.nucleics.com/DNA_sequencing_support/DNA-sequencing-AT-slippage.html). 그러므로, 삽입한 poly (A) 서열의 길이에서 오차범위 1개 이내인 A124±1 비율을 지표로 하였다. 그 결과를 표 1과 도 4에 나타내었다.
DH5alpha에서 온도별 형질전환 후 poly(A) 서열의 길이
　콜로니# 형질전환 및 배양온도
19℃ 22℃ 25℃ 28℃ 31℃ 32℃ 34℃ 37℃
1 n/a 123 121 26 123 19 19 19
2 124 92 124 123 15 17 19 n/a
3 122 122 117 15 121 17 19 15
4 19 102 124 n/a 123 19 19 19
5 122 124 122 122 19 9 9 19
6 123 124 122 124 121 15 n/a 15
7 n/a 124 57 19 122 16 17 24
8 n/a 124 122 121 15 19 15 15
9 19 120 124 122 123 17 n/a 15
10 124 122 125 123 19 15 19 15
11 124 124 123 123 123 n/a 15 19
12 123 124 124 121 112 19 19 18
13 122 90 123 121 19 121 122 17
14 n/a 119 106 19 123 15 19 20
15 124 123 124 15 15 n/a 19 20
16 123 123 19 122 122 n/a 19 18
17 122 35 108 122 19 19 n/a 19
18 125 122 66 19 19 n/a n/a 17
19 123 123 44 19 123 19 19 17
20 123 15 17 15 120 27 15 18
21 123 19 120 122 121 n/a n/a 13
22 n/a 15 124 119 122 n/a n/a 36
23 121 123 124 123 19 19 15 17
24 15 n/a 122 122 19 n/a n/a 16
25 19 15 n/a 　 n/a 106 n/a 　 19 n/a 　
A124±1 비율 55.0% 45.8% 41.7% 21.7% 24.0% 0.0% 0.0% 0.0%
* n/a: sanger sequencing결과 mixed peak으로 분석에서 제외
상기 표 1 및 도 4에 나타낸 바와 같이, 폴리 A 테일 (poly(A) tail) 을 코딩하는 서열이 포함된 플라스미드로 형질전환된 세포주를 31 ℃ 이하의 온도 조건에서 배양할 경우 A124±1 비율이 21.7 내지 55.0%로 나타나 플라스미드에서 폴리 A 테일이 안정적으로 유지됨을 알 수 있다. 다만, 16℃ 미만의 온도조건에서는 대장균의 생장이 거의 일어나지 않기 때문에(비특허문헌 1, Acta Alimentaria 50 (2021) 2, 180-188), 16℃ 미만 온도조건은 대량의 백신제품 생산공정에 적용할 수 없다. 16℃ 미만 온도조건이 공정적용에 적절하지 않음은 후술하는 실시예 5에서도 재차 확인할 수 있다.
실시예 3. 계대배양시 안정성: 불안정한 절편 유지에 특화된 균주를 이용한 형질전환 및 계대배양
저온조건에서 연속된 계대배양시 poly(A) 서열이 온전히 유지될 수 있는지 확인해 보기 위해서, 불안정한 절편 유지에 특화된 균주 중 하나인 NEB stable 균주를 이용하여 섭씨 37도와 섭씨 25도에서 형질전환 및 계대배양을 진행하였다.
형질전환 (NEB stable)
실시예 2에서 사용한 plasmid DNA를 대장균 NEB stable (NEB, C3040H)에 형질전환 하였다. 얼음에서 형질전환용 대장균에 plasmid DNA를 넣고 30분동안 정치 후 섭씨 42도에서 40초간 열 충격을 주었다. 이후 5분간 얼음에서 식힌 후 NEB 10-beta/Stable Outgrowth 배지를 첨가하고 섭씨 37도 혹은 25도에서 1시간 동안 회복시킨 후 항생제 선택 고형 배지에 대장균을 도말하였다. 대장균이 도말된 배지는 대장균을 회복시킨 온도와 동일한 온도에서 배양하여 콜로니가 생성되도록 하였다.
형질전환 후 poly(A) 서열의 길이 확인
각각의 온도에서 형질전환 후 생성된 콜로니 중 25개를 선택하여 고체 배양한 온도와 동일한 온도에서 액체 배양하였다. plasmid를 분리하여 Sanger sequencing 이용하여 poly(A) 서열의 길이를 분석하였다. 염기서열 분석에는 3UTR-Xba1-F (서열번호 7) 프라이머를 사용하였다. 앞서 실시예 2에서 통상적으로 사용하는 DH5alpha에서 얻은 결과에 비해 섭씨 37도에서 형질전환시 poly(A) 서열의 길이가 120개 이상 유지된 콜로니 비율이 비교적 높은 것을 확인할 수 있었다. 불안정한 절편 유지에 특화된 균주를 사용하여 이러한 결과가 나온 것으로 생각할 수 있다.
하지만, A124±1 비율을 통해 확인할 수 있는 바와 같이, 형질전환에 사용한 plasmid가 본래 가지고 있던 poly(A) 124개에 근접하여 유지된 콜로니는 섭씨 25도에 비해 섭씨 37도에서는 현저히 낮으므로, 균주와 무관하게 poly(A) 서열의 길이 유지에 저온이 유리함을 다시 한번 확인할 수 있었다.
NEB stable에서 형질전환시 온도에 따른 poly(A) 서열의 길이 변화
콜로니# 배양온도
섭씨 25도 섭씨 37도
1 62 120
2 123 121
3 125 122
4 122 122
5 123 122
6 124 125
7 124 122
8 124 120
9 122 19
10 125 118
11 124 121
12 15 120
13 74 53
14 123 120
15 124 122
16 124 120
17 124 122
18 124 15
19 123 15
20 124 121
21 54 45
22 124 122
23 123 120
24 124 120
25 124 122
A124±1 비율 76.00% 4.00%
계대배양
앞서 형질전환 후 염기서열 분석을 통해 poly(A) 서열의 길이가 확인된 콜로니 중 섭씨 37도에서 6개, 섭씨 25도에서는 9개를 선택하였다. 선택된 콜로니의 배양액을 새로운 액체 배지에 1/1000의 부피로 접종한 후 동일한 온도에서 계대배양을 진행하였다. 섭씨 37도에서는 2회 계대배양을 섭씨 25도에서는 3회 계대배양을 거쳤다.
계대배양에 따른 poly(A) 서열의 길이 확인
계대배양 진행 중 일부의 배양액에서 plasmid를 분리하여 Sanger sequencing 이용하여 poly(A) 서열의 길이를 분석하였다. 염기서열 분석에는 3UTR-Xba1-F (서열번호 7) 프라이머를 사용하였다.
섭씨 37도에서 계대배양 진행 결과 대부분의 콜로니에서 poly(A) 서열의 길이가 유지되지 않는 것을 확인하였다 (표 3). 반면 섭씨 25도에서 계대배양을 진행하였을 때에는 모든 콜로니의 poly(A) 서열의 길이가 유지됨을 확인하였다(표 4).
섭씨 37도 계대배양시 poly(A) 서열의 길이 유지 결과
콜로니# 배양온도 37도 1차 배양액의 A 길이
±1 유지
1차 2차 3차
3 122 16 16 X
5 122 60 60 X
6 125 70 n/a X
7 122 124 122 O
15 122 60 62 X
22 122 123 122 O
섭씨 25도 계대배양시 poly(A) 서열의 길이 유지 결과
콜로니# 배양온도25도 1차 배양액의 A 길이
±1 유지
1차 2차 3차 4차
3 125 125 125 125 O
5 123 123 122 122 O
7 124 124 124 124 O
9 122 122 122 121 O
11 124 124 124 124 O
15 124 124 123 123 O
17 124 124 124 123 O
19 123 123 123 123 O
23 123 123 123 123 O
이를 통해 계대배양 시 31℃ 이하의 온도에서 배양하는 것이 플라스미드의 poly(A) 서열 유지에 적합한 조건임을 확인하였다.
실시예 4. 세포주 스탁 제조 후 안정성 확인
형질전환을 통해 제작한 세포주의 보관 용이성을 확인해 보기 위해, 앞서 실시예 3에서 25도 조건으로 A길이가 124개로 확인된 형질전환된 세포주를 글리세롤　스탁 (glycerol stock) 형태로 만들어 -70℃ 냉동고에 보관하였다. 냉동 상태로 보관된 스탁을 꺼내어 서로 다른 시험관에서 16도, 25도, 30도 조건에서 액체배양 후 각각의 plasmid를 분리하여 서열분석을 진행하였다. 배양된 대장균에서 분리한 plasmid에서 분석된 A 길이는 모두 124개로 스탁 제조 후 배양시 A 길이가 온전히 유지되는 것을 확인하였다.
스탁배양# 배양온도별 A 길이
16도 25도 30도
1 124 124 124
2 124 124 124
3 124 124 124
4 124 124 124
5 124 124 124
6 124 124 124
실시예 5. 온도별 배양곡선 확인
16도 미만 조건에서의 배양은 공정적용에 적절하지 않음을 확인하기 위하여 하기와 같은 실험을 수행하였다.
실시예 2와 3에서 25도 조건으로 A길이가 124개로 확인된 형질전환된 세포주 DH5alpha와 NEB stable을 각각 글리세롤　스탁 (glycerol stock) 형태로 만들어 -70℃ 냉동고에 보관하였다. 온도별 배양곡선을 확인하기 위해서 스탁을 꺼내어 13, 16, 19, 22, 25도 조건에서 200rpm으로 48시간동안 배양하면서 정해진 시간에 OD600을 측정하였다. 실험결과 16도 미만인 13도에서는 세포의 성장이 거의 없는 것을 확인하였다 (도 5).
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
[서열목록]
서열번호 1
ATTTTCATTGCCCGCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTCTTCGATATCAAGCTTGGC
서열번호 2
GCCAAGCTTGATATCGAAGACTTT
서열번호 3 (pSKBS01)
CCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC
서열번호 4 (M13-Forward)
GTAAAACGACGGCCAGT
서열번호 5 (M13-Reverse)
CAGGAAACAGCTATGAC
서열번호 6 (Atail-seq-R)
TGGATAACCGTATTACCGCC
서열번호 7 (3UTR-Xba1-F)
TCCTCTAGAAGCTCGCTTGTCAATTTCTA

Claims (14)

  1. 폴리 A 테일 (poly(A) tail) 을 코딩하는 서열이 포함된 플라스미드로 형질전환된 세포주를 31 ℃ 이하의 온도 조건에서 배양하는 단계를 포함하는,
    폴리 A 테일을 플라스미드에서 안정적으로 유지하는 방법.
  2. 제1항에 있어서, 상기 배양하는 단계는 (1) 상기 세포주를 31 ℃ 이하의 온도 조건으로 회복시키는 것을 포함하는, 방법.
  3. 제2항에 있어서, 상기 (1)의 회복 단계 이후 (2) 상기 세포주를 31 ℃ 이하의 온도 조건으로 고체 배지에서 배양하여 콜로니를 형성하는 것을 포함하는, 방법.
  4. 제3항에 있어서, 상기 배양은 (3) 상기 (2) 의 고체 배지 배양으로 형성된 콜로니를 31 ℃ 이하의 온도 조건으로 액체 배지에서 배양하는 단계를 더 포함하는, 방법.
  5. 제4항에 있어서, 상기 액체 배지에서 배양하는 단계는 계대배양하는 것을 포함하는, 방법.
  6. 제1항 내지 제4항 중 어느 한 항에 있어서, 상기 온도 조건은 16 ℃내지 31 ℃인, 방법.
  7. 제1항 내지 제4항 중 어느 한 항에 있어서, 상기 온도 조건은 19 ℃내지 25 ℃인, 방법.
  8. 제1항에 있어서, 상기 세포주는 대장균(E. coli)인, 방법.
  9. 제1항에 있어서, 상기 형질전환은 열충격(heat shock) 또는 전기천공(electroporation)을 이용해 폴리 A 테일을 코딩하는 서열을 포함하는 플라스미드를 세포주에 도입하는 것을 포함하는, 방법.
  10. 제9항에 있어서, 상기 도입은 37 ℃ 내지 42 ℃의 온도에서 수행되는, 방법.
  11. 제1항에 있어서, 상기 방법은 폴리 A 테일 (poly(A) tail) 을 코딩하는 서열이 포함된 플라스미드로 형질전환된 세포주를 37 ℃ 이상의 온도 조건에서 배양하는 단계를 포함하는 방법에 비해 플라스미드 내 폴리 A 테일의 안정성이 증가한 것인, 방법.
  12. 제1항에 있어서, 상기 폴리 A 테일은 20 내지 400개의 아데닌(A)을 포함하는, 방법.
  13. 폴리 A 테일 (poly(A) tail) 을 포함하는 mRNA를 코딩하는 서열이 포함된 플라스미드로 형질전환된 세포주를 31 ℃ 이하 온도조건에서 배양하는 단계를 포함하는,
    mRNA 생산을 위한 플라스미드의 대량 생산방법.
  14. 폴리 A 테일 (poly(A) tail) 을 포함하는 mRNA를 코딩하는 서열이 포함된 플라스미드로 형질전환된 세포주를 31 ℃ 이하의 온도 조건으로 배양하는 단계; 및
    상기 세포주의 플라스미드를 주형으로 전사(transcription)를 수행하는 단계를 포함하는,
    폴리 A 테일을 포함하는 mRNA의 생산방법.
PCT/KR2022/012233 2021-08-17 2022-08-17 폴리 a 테일을 안정적으로 유지하는 방법 WO2023022490A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202280056262.2A CN117836418A (zh) 2021-08-17 2022-08-17 稳定保持聚a尾的方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0108264 2021-08-17
KR20210108264 2021-08-17

Publications (1)

Publication Number Publication Date
WO2023022490A1 true WO2023022490A1 (ko) 2023-02-23

Family

ID=85239582

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/012233 WO2023022490A1 (ko) 2021-08-17 2022-08-17 폴리 a 테일을 안정적으로 유지하는 방법

Country Status (3)

Country Link
KR (1) KR20230026965A (ko)
CN (1) CN117836418A (ko)
WO (1) WO2023022490A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100323400A1 (en) * 2003-07-01 2010-12-23 Haskins Darin J Compositions and Methods for Controlling Copy Number for a Broad Range of Plasmids and Uses Thereof
WO2016005324A1 (en) * 2014-07-11 2016-01-14 Biontech Rna Pharmaceuticals Gmbh Stabilization of poly(a) sequence encoding dna sequences

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100323400A1 (en) * 2003-07-01 2010-12-23 Haskins Darin J Compositions and Methods for Controlling Copy Number for a Broad Range of Plasmids and Uses Thereof
WO2016005324A1 (en) * 2014-07-11 2016-01-14 Biontech Rna Pharmaceuticals Gmbh Stabilization of poly(a) sequence encoding dna sequences

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ACTA ALIMENTARIA, vol. 2, 2021, pages 180 - 188
GRIER ALEXANDRA E ET AL: "pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A) Sequences.", MOLECULAR THERAPY. NUCLEIC ACIDS 19 APR 2016, vol. 5, 19 April 2016 (2016-04-19), pages 1 - 10, XP002787530, DOI: 10.1038/mtna.2016.21 *
MOL THER NUCLEIC ACIDS., vol. 26, 3 December 2021 (2021-12-03), pages 945 - 956
RNA, vol. 25, no. 4, April 2019 (2019-04-01), pages 507 - 518
TREPOTEC ZELJKA; GEIGER JOHANNES; PLANK CHRISTIAN; ANEJA MANISH K; RUDOLPH CARSTEN: "Segmented poly(A) tails significantly reduce recombination of plasmid DNA without affecting mRNA translation efficiency or half-life", RNA, COLD SPRING HARBOR LABORATORY PRESS, US, vol. 25, no. 4, 31 March 2019 (2019-03-31), US , pages 507 - 518, XP009517039, ISSN: 1355-8382, DOI: 10.1261/rna.069286.118 *
TUDEK AGNIESZKA, KRAWCZYK PAWEŁ S., MROCZEK SEWERYN, TOMECKI RAFAŁ, TURTOLA MATTI, MATYLLA-KULIŃSKA KATARZYNA, JENSEN TORBEN HEICK: "Global view on the metabolism of RNA poly(A) tails in yeast Saccharomyces cerevisiae", NATURE COMMUNICATIONS, vol. 12, no. 1, XP093036347, DOI: 10.1038/s41467-021-25251-w *

Also Published As

Publication number Publication date
KR20230026965A (ko) 2023-02-27
CN117836418A (zh) 2024-04-05

Similar Documents

Publication Publication Date Title
WO2020175735A1 (ko) 신규 프로모터 및 이를 이용한 퓨린 뉴클레오티드 제조방법
WO2018124440A2 (ko) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2019117399A1 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
WO2019117671A1 (ko) 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법
WO2009125924A2 (ko) 퓨트레신 고생성능을 가지는 변이 미생물 및 이를 이용한 퓨트레신의 제조방법
WO2019004778A2 (ko) 신규한 아스파토키나제 변이체 및 이를 이용한 l-아미노산의 제조방법
WO2019190192A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2019231159A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2012018226A2 (ko) 카다베린 고생성능을 가지는 변이 미생물 및 이를 이용한 카다베린의 제조방법
WO2019147059A1 (ko) L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법
WO2020130236A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2014208970A1 (ko) 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2019135445A1 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
WO2021201653A1 (ko) Crispr/cas9 시스템을 기반으로 한 유전체 편집 방법 및 이의 용도
WO2016148490A1 (ko) 피루브산 디하이드로게나아제 변이체, 이를 포함하는 미생물 및 이를 이용한 l-아미노산 생산 방법
WO2019172702A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2020196993A1 (ko) 변이형 포스포리보실피로포스페이트 아미도트랜스퍼라아제 및 이를 이용한 퓨린 뉴클레오티드 제조방법
WO2023022490A1 (ko) 폴리 a 테일을 안정적으로 유지하는 방법
WO2015163682A1 (ko) 2，3－부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2，3－부탄디올의 생산 방법
WO2019004779A2 (ko) 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법
WO2022098191A1 (ko) 하이드로겔화 핵산을 이용한 고분자량 단백질 생산용 원형 핵산 템플릿의 제조방법 및 고분자량 단백질 생산 시스템
WO2019031804A9 (ko) 목적 유전자 발현 조절을 위한 대장균 및 코리네박테리움 글루타미쿰 셔틀 벡터
WO2022239953A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2019004780A2 (ko) 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22858727

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 202280056262.2

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 2022858727

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022858727

Country of ref document: EP

Effective date: 20240318