WO2021235855A1 - L- 분지쇄 아미노산 생산능이 강화된 미생물 및 이를 이용하여 l-분지쇄 아미노산을 생산하는 방법 - Google Patents

L- 분지쇄 아미노산 생산능이 강화된 미생물 및 이를 이용하여 l-분지쇄 아미노산을 생산하는 방법 Download PDF

Info

Publication number
WO2021235855A1
WO2021235855A1 PCT/KR2021/006262 KR2021006262W WO2021235855A1 WO 2021235855 A1 WO2021235855 A1 WO 2021235855A1 KR 2021006262 W KR2021006262 W KR 2021006262W WO 2021235855 A1 WO2021235855 A1 WO 2021235855A1
Authority
WO
WIPO (PCT)
Prior art keywords
polynucleotide
rama
seq
microorganism
nucleotide
Prior art date
Application number
PCT/KR2021/006262
Other languages
English (en)
French (fr)
Inventor
윤병훈
김선혜
장진숙
김주연
최선형
김경림
김주은
김형준
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to CN202180019796.3A priority Critical patent/CN115702244A/zh
Priority to US17/794,137 priority patent/US20230063145A1/en
Priority to EP21808090.1A priority patent/EP4083214A4/en
Priority to CA3169534A priority patent/CA3169534A1/en
Priority to BR112022017038A priority patent/BR112022017038A2/pt
Priority to MX2022009250A priority patent/MX2022009250A/es
Priority to JP2022543795A priority patent/JP2023511882A/ja
Publication of WO2021235855A1 publication Critical patent/WO2021235855A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • the present application relates to a microorganism for producing L-branched chain amino acids, in which the activity of regulators of acetate metabolism A is enhanced, and a method for producing L-branched chain amino acids using the same.
  • L-amino acid is a basic structural unit of protein and is used as an important material for pharmaceutical raw materials, food additives, animal feed, nutrients, pesticides, and disinfectants.
  • Branched Chain Amino Acids (BCAA) is a generic term for essential amino acids L-valine, L-leucine, and L-isoleucine. The branched chain amino acids directly promote antioxidant effects and protein synthesis in muscle cells. It is known to be effective.
  • the production of branched-chain amino acids using microorganisms is mainly made through microorganisms of the genus Escherichia or microorganisms of the genus Corynebacterium, and through several steps from pyruvic acid, ketoisocaproate (2-ketoisocaproate) is biosynthesized as a precursor (US 10316297 B2, US 10526586 B2, US 10072278 B2).
  • ketoisocaproate 2-ketoisocaproate
  • One object of the present application is to provide an L-branched-chain amino acid-producing microorganism with enhanced activity of regulators of acetate metabolism A (A).
  • Another object of the present application is to substitute another nucleotide at a position corresponding to any one or more positions selected from among the 34th, 36th, 37th, 41st and 43rd nucleotides of the polynucleotide sequence represented by SEQ ID NO: 1 It is to provide a microorganism comprising a polynucleotide having a promoter activity comprising a, L- branched chain amino acid production microorganisms.
  • Another object of the present application is to provide a method for producing L- branched chain amino acids, comprising the step of culturing the microorganism in a medium.
  • Another object of the present application is that any one or more nucleotides selected from among the 34th, 36th, 37th, 41st and 43rd nucleotides of the polynucleotide sequence represented by SEQ ID NO: 1 are substituted with other nucleotides, promoter activity To provide a polynucleotide having
  • L-branched chain amino acids When culturing a microorganism producing L-branched chain amino acids including the polynucleotide of the present application, L-branched chain amino acids can be produced with high efficiency.
  • amino acid prepared by the present application may be applied to various products such as human food or food additives, pharmaceuticals, as well as animal feed or animal feed additives.
  • One aspect of the present application is to provide an L-branched-chain amino acid-producing microorganism with enhanced activity of regulators of acetate metabolism A (A).
  • regulatory of acetate metabolism A refers to a regulatory protein involved in acetic acid metabolism as the target protein of the present application, and may be encoded by the ramA gene.
  • the expression of the acetic acid metabolism regulator A may be enhanced, and may result in an increase in the production capacity of L-branched chain amino acids due to the enhanced expression.
  • the term “enhancement” of the activity of the acetabular regulator A means that the activity of the acetic acid metabolism regulator A is increased compared to the intrinsic activity.
  • the reinforcement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.
  • activation, enhancement, upregulation, overexpression, and increase may include those that exhibit an activity that was not originally possessed, or that exhibit improved activity compared to intrinsic activity or activity before modification.
  • intrinsic activity refers to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors.
  • the enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and/or increasing the concentration (expression) of the endogenous polypeptide. Whether or not the activity of the acetic acid metabolism regulator A is enhanced can be confirmed from the improvement/increase of the activity, expression level, or amount of the product excreted from the polypeptide.
  • the enhancement of the activity of the acetic acid metabolism regulator A can be applied by various methods well known in the art, and is not limited as long as it can enhance the activity of the target polypeptide compared to the microorganism before modification. Specifically, it may be one using genetic engineering and/or protein engineering well known to those skilled in the art as a routine method of molecular biology, but is not limited thereto (eg, Sitnicka et al. Functional Analysis of Genes. Advances in Cell). Biology 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • modification of the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide eg, modification of the polynucleotide sequence of the polypeptide gene to encode a polypeptide that has been modified to enhance the activity of the polypeptide;
  • the increase in the intracellular copy number of the polynucleotide encoding the polypeptide is achieved by introduction of a vector to which the polynucleotide encoding the polypeptide is operably linked, which can replicate and function independently of the host, into a host cell.
  • the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of a host cell.
  • the introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome of the host cell into the host cell, but is not limited thereto.
  • the vector is as described below.
  • the expression control region is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence controlling the termination of transcription and translation, an enhancer, and the like.
  • the method may specifically be to link a strong heterologous promoter instead of the original promoter, but is not limited thereto.
  • Examples of known strong promoters include CJ1 to CJ7 promoter (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, etc., but is not limited thereto.
  • the modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a nucleotide sequence encoding another start codon having a higher expression rate of the polypeptide compared to the intrinsic start codon. It may be a substitution, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may include deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide;
  • a combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto.
  • the replacement may be specifically performed by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
  • the vector used may further include a selection marker for confirming whether or not the chromosome is inserted. Selection markers are as described below.
  • the introduction of the foreign polynucleotide exhibiting the activity of the polypeptide may be introduction of the foreign polynucleotide encoding the polypeptide exhibiting the same/similar activity as the polypeptide into a host cell.
  • the foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same/similar activity as the polypeptide.
  • the method used for the introduction can be performed by appropriately selecting a known transformation method by those skilled in the art, and the introduced polynucleotide is expressed in a host cell to generate a polypeptide and increase its activity.
  • Codon optimization of the polynucleotide encoding the polypeptide is codon-optimized so that the transcription or translation of the endogenous polynucleotide is increased in the host cell, or the transcription and translation of the foreign polynucleotide are optimized in the host cell. It may be that its codons are optimized so that the
  • Selecting an exposed site by analyzing the tertiary structure of the polypeptide and modifying or chemically modifying the sequence is, for example, by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of proteins with known structures is stored. It may be to determine a template protein candidate according to the degree, check the structure based on this, and select an exposed site to be modified or chemically modified and modified or modified.
  • Such enhancement of acetic acid metabolism regulator A activity, the activity or concentration (expression amount) of the corresponding polypeptide is increased relative to the activity or concentration of the acetic acid metabolism regulator A expressed in the wild-type or pre-modified microbial strain, or the corresponding The amount of the product produced from the polypeptide may be increased, but is not limited thereto.
  • the term "gene expression control sequence” is also used interchangeably with a 'gene expression control region' and is a sequence operably linked thereto so as to express a target gene, and refers to the variant polynucleotide of the present application.
  • the gene expression control sequence of the present application may refer to a promoter, enhancer, etc. for carrying out the transcription of a gene, in addition to any operator sequence for regulating transcription, a suitable mRNA encoding a ribosome binding site. It is a concept that may further include a sequence and a DNA that controls the termination of transcription and translation.
  • the gene expression control sequence may be a promoter, but is not limited thereto.
  • the expression of the acetic acid metabolism regulator A may be enhanced by introducing a mutation into the promoter or replacing it with a promoter with strong activity, but is not limited thereto.
  • promoter refers to an untranslated nucleotide sequence upstream of the coding region, including a binding site for polymerase, having an activity of initiating transcription into mRNA of a target gene, that is, polymerase. Refers to a region of DNA that allows me to bind and initiate transcription of a gene. The promoter may be located 5' of the mRNA transcription initiation site.
  • operably linked means that the polynucleotide having the promoter activity of the present application is functionally linked with the gene sequence to initiate and mediate transcription of the target gene.
  • the operable linkage may be prepared using a genetic recombination technique known in the art, and site-specific DNA cleavage and ligation may be made using a cleavage and ligation enzyme in the art, but is not limited thereto.
  • the target gene refers to a gene encoding a target protein to be regulated in expression in a microorganism.
  • the gene may be a gene encoding regulators of acetate metabolism A
  • the present invention is not limited thereto. More specifically, the gene may be a ramA gene, but is not limited thereto.
  • the ramA gene may be an endogenous gene or a foreign gene, and may include a mutation for regulating activity.
  • the sequence of the ramA gene can be easily obtained by those skilled in the art through a known database such as GenBank of the US National Institutes of Health.
  • Another aspect of the present application is a substitution with another nucleotide at a position corresponding to any one or more positions selected from among the 34th, 36th, 37th, 41st, and 43rd nucleotides of the polynucleotide sequence represented by SEQ ID NO: 1. It is to provide a microorganism comprising a polynucleotide having a promoter activity comprising a, L- branched chain amino acid production microorganisms.
  • polynucleotide refers to a DNA strand of a certain length or more as a polymer of nucleotides in which nucleotide monomers are connected in a long chain form by covalent bonds.
  • polynucleotide having promoter activity may be referred to as “variant polynucleotide”, “variant promoter”, or “mutant ramA promoter”, etc. In this specification, all of the above-described terms may be used.
  • mutation refers to a genetically or non-genetically stable phenotypic change, and may be used interchangeably with “mutation” in the present specification.
  • the variant polynucleotide of the present application may have a mutated (increased) promoter activity compared to a polynucleotide that does not include the mutation. Accordingly, it is possible to regulate (increase) the expression of the ramA gene, which is a target gene operably linked to the variant polynucleotide of the present application, and the activity of a protein encoded by the ramA gene, and furthermore, the expression of genes other than the target gene can be adjusted.
  • the polynucleotide having the promoter activity is an amino acid, specifically a branched chain amino acid, more specifically, leucine, valine, to increase the expression of a protein involved in increasing the production of amino acids including isoleucine. It means a polynucleotide capable of, but is not limited to.
  • polynucleotide sequence represented by SEQ ID NO: 1 may refer to a promoter sequence of a gene encoding regulators of acetate metabolism A (RamA).
  • the polynucleotide having the promoter activity of the present application is a mutant polynucleotide having promoter activity, not a naturally-derived sequence, and is capable of increasing the expression of a target protein operably linked compared to the polynucleotide sequence represented by SEQ ID NO: 1.
  • the polynucleotide sequence represented by SEQ ID NO: 1, that is, the promoter sequence of the ramA gene is mutated, and the 34th, 36th, 37th, 41st and 43rd of the sequence Any one or more nucleotides selected from among nucleotides may be substituted with other nucleotides.
  • the 34th nucleotide of the polynucleotide sequence represented by SEQ ID NO: 1 is substituted with T; the 36th nucleotide is replaced with T; the 37th nucleotide is replaced with G; the 41st nucleotide is replaced with T;
  • the 43 th nucleotide may be substituted with A or may include a combination thereof, but is not limited thereto.
  • the polynucleotide of the present application may consist of any one nucleotide sequence selected from SEQ ID NOs: 3 to 5.
  • the 34th nucleotide of the polynucleotide sequence represented by SEQ ID NO: 1 is substituted with T; the 36th nucleotide is replaced with T; and the 37th nucleotide may be substituted with G.
  • the variant polynucleotide of the present application may be composed of SEQ ID NO: 5.
  • the 41st nucleotide of the polynucleotide sequence represented by SEQ ID NO: 1 is substituted with T; and the 43rd nucleotide may be substituted with A.
  • the variant polynucleotide of the present application may be composed of SEQ ID NO: 4.
  • the 34th nucleotide of the polynucleotide sequence represented by SEQ ID NO: 1 is substituted with T; the 36th nucleotide is replaced with T; the 37th nucleotide is replaced with G; the 41st nucleotide is replaced with T; and the 43rd nucleotide may be substituted with A.
  • the variant polynucleotide of the present application may be composed of SEQ ID NO: 3.
  • L-branched chain amino acid-producing microorganism of the present application is a polynucleotide sequence represented by SEQ ID NO: 1, the 34th nucleotide is replaced with T; the 36th nucleotide is replaced with T; the 37th nucleotide is replaced with G; the 41st nucleotide is replaced with T; It may be a microorganism comprising a polynucleotide having promoter activity in which the 43rd nucleotide is substituted with A or a combination thereof.
  • the L-branched chain amino acid producing microorganism of the present application is composed of any one nucleotide sequence selected from SEQ ID NOs: 3 to 5 or a nucleotide sequence having at least 80% or more and less than 100% sequence homology thereto, the promoter activity
  • the branch may be a microorganism comprising a polynucleotide. Details of the variant polynucleotide of the present application are the same as those described in detail below.
  • branched chain amino acid refers to an amino acid having a branched alkyl group in the side chain, and includes valine, leucine and isoleucine.
  • the branched chain amino acid may be an L-branched chain amino acid, and the L-branched chain amino acid may be L-valine, L-leucine and L-isoleucine, but is not limited thereto.
  • microorganism that produces branched chain amino acids includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially, in which an external gene is inserted or the activity of an intrinsic gene is enhanced or inactivated. As a microorganism whose specific mechanism is weakened or strengthened due to a cause, it may be a microorganism in which genetic mutation or activity is enhanced for the production of a desired branched chain amino acid.
  • microorganism may be used interchangeably with "a microorganism producing branched-chain amino acids” and "a microorganism having the ability to produce branched-chain amino acids.”
  • the microorganism may be any microorganism capable of producing branched chain amino acids including the variant polynucleotide of the present application.
  • the microorganism producing the branched chain amino acid may be a microorganism characterized in that the desired branched chain amino acid production capacity is increased, including the mutant polynucleotide.
  • a microorganism producing a branched chain amino acid or a microorganism having a branched chain amino acid production ability a part of a gene in a branched chain amino acid biosynthesis pathway is enhanced or weakened, or a part of a gene in a branched chain amino acid degradation pathway is enhanced or weakened It may be a microorganism, but is not limited thereto.
  • the microorganism of the genus Corynebacterium having branched-chain amino acid production ability is transformed with a vector containing the mutant polynucleotide of the present application, or a gene encoding the polynucleotide of the present application It means a microorganism of the genus Corynebacterium that has been converted and has improved branched chain amino acid production ability.
  • the "microorganism of the genus Corynebacterium having improved branched chain amino acid production ability" refers to a microorganism having improved branched chain amino acid production capability than the parent strain or unmodified microorganism before transformation.
  • the 'unmodified microorganism' does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a native strain itself, or a microorganism that does not contain the polynucleotide of the present application, or contains the polynucleotide of the present application It means a microorganism that has not been transformed with a vector.
  • the Corynebacterium genus microorganism is specifically Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Brevibacterium lactofermentum ( Brevibacterium lactofermentum ), Brevibacter Leum flavum ( Brevibacterium flavum ), Corynebacterium thermoaminogenes ( Corynebacterium thermoaminogenes ), Corynebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium stationis ( Corynebacterium stationis ). It is not necessarily limited to this.
  • the vector of the present application is an artificial DNA molecule carrying genetic material so that the target polypeptide can be expressed in a suitable host, specifically encoding the target polypeptide operably linked to a suitable expression control region capable of expressing the target gene It may include a DNA preparation including the nucleotide sequence of the polynucleotide. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors may be used.
  • pBluescript II-based pGEM-based, pTZ-based, pCL-based, pET-based and the like
  • pDZ pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like
  • pC1BAC vectors and the like can be used.
  • a target polynucleotide may be inserted into a chromosome through a vector for intracellular chromosome insertion.
  • the insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted.
  • the selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. Markers to be given can be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
  • the term “transformation” refers to introducing a vector containing a target polynucleotide into a host cell or microorganism so that the polynucleotide can be expressed/functioned in the host cell.
  • the transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located extrachromosomally, as long as they can be expressed or function in the host cell.
  • the polynucleotide may include DNA and/or RNA encoding a target polypeptide.
  • the polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and expressed in the host cell, but is not limited thereto.
  • Another aspect of the present application provides a method for producing L-branched chain amino acids comprising the step of culturing the microorganism in a medium.
  • the method for producing the L-branched chain amino acid may further include the step of recovering or separating the target material from the medium or microorganism.
  • polynucleotide "Corynebacterium genus microorganism”, "vector” and "L-branched chain amino acid” are as described above.
  • the term "cultivation” means growing the microorganism of the present application under moderately controlled environmental conditions.
  • the culturing process of the present application may be made according to a suitable medium and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art according to the selected strain.
  • the culture may be a batch, continuous and/or fed-batch, but is not limited thereto.
  • the term "medium” refers to a material in which nutrients required for culturing the microorganism of the present application are mixed as a main component, and supplies nutrients and growth factors, including water, which are essential for survival and growth. .
  • the medium and other culture conditions used for culturing the microorganisms of the genus Corynebacterium of the present application may be used without any particular limitation as long as they are media used for culturing conventional microorganisms, but the microorganism of the present application is used as a suitable carbon source, It can be cultured under aerobic conditions in a normal medium containing a nitrogen source, phosphorus, inorganic compounds, amino acids and/or vitamins while controlling temperature, pH, and the like.
  • the culture medium for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology” by the American Society for Bacteriology (Washington D.C., USA, 1981)].
  • the carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, and the like; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine
  • organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract
  • the phosphorus may include monopotassium phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, the present invention is not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium.
  • an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without injection of gas or without injection of gas to maintain anaerobic and microaerobic conditions, which are limited thereto. it is not
  • the culture temperature may be maintained at 20 to 45° C., specifically, 25 to 40° C., and may be cultured for about 10 to 160 hours, but is not limited thereto.
  • the L-branched chain amino acids produced by the culture of the present application may be secreted into the medium or remain in the cells.
  • the L-branched chain amino acid production method of the present application includes a step of preparing the microorganism of the present application, a step of preparing a medium for culturing the strain, or a combination thereof (regardless of order, in any order), for example For example, before the culturing step, it may be further included.
  • the method for producing L-branched chain amino acids of the present application may further include recovering L-branched chain amino acids from the culture medium (cultured medium) or the microorganism of the present application.
  • the recovering step may be further included after the culturing step.
  • the recovery is to collect the desired L-branched chain amino acids using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method.
  • a suitable method known in the art can For example, centrifugation, filtration, treatment with a crystallized protein precipitating agent (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity
  • a suitable method known in the art for example, centrifugation, filtration, treatment with a crystallized protein precipitating agent (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity
  • chromatography such as island chromatography, HPLC, SMB, or a combination thereof may be used, and a desired L
  • the L-branched chain amino acid production method of the present application may additionally include a purification step.
  • the purification may be performed using a suitable method known in the art.
  • the recovery step and the purification step are performed continuously or discontinuously, regardless of the order, or simultaneously or in one step may be integrated and performed, but is not limited thereto.
  • any one or more nucleotides selected from among the 34th, 36th, 37th, 41st and 43rd nucleotides of the polynucleotide sequence represented by SEQ ID NO: 1 are substituted with other nucleotides, having promoter activity A polynucleotide is provided.
  • polynucleotide and “promoter” are as described above.
  • variant polynucleotide sequence of the present application may be modified by conventionally known mutagenesis methods, for example, direct evolution and site-directed mutagenesis.
  • the 34th sequence is fixed to T with respect to the nucleotide sequence of SEQ ID NO: 3; the 36th sequence is fixed at T; 37th sequence fixed at G; the 41st sequence is fixed at T; and the 43rd sequence is fixed to A, and has at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology with other sequences.
  • it may include a polynucleotide comprising a nucleotide sequence having the identity (identity).
  • the 41st sequence is fixed to T with respect to the nucleotide sequence of SEQ ID NO: 4; and the 43rd sequence is fixed to A, and has at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology with other sequences.
  • it may include a polynucleotide comprising a nucleotide sequence having the identity (identity).
  • the 34th sequence is fixed to T with respect to the nucleotide sequence of SEQ ID NO: 5; the 36th sequence is fixed at T; and the 37th sequence is fixed at G; and a nucleotide having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with other sequences polynucleotides comprising the sequence.
  • nucleotide sequence having homology or identity may be a sequence having less than 100% identity, except for a sequence having 100% identity in the above categories.
  • sequence having homology with the above sequence if it is a polynucleotide sequence substantially identical to or having a biological activity corresponding to any one nucleotide sequence selected from SEQ ID NOs: 3 to 5, the 34th, 36th, 37th, 41st or It is apparent that a case in which a partial sequence other than the 43rd position has a deleted, modified, substituted or added polynucleotide sequence is also included in the scope of the present application.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of the sequence under moderate or high stringent conditions. It is apparent that hybridization also includes hybridization with a polynucleotide containing a common codon in a polynucleotide or a codon in consideration of codon degeneracy.
  • a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • variant polynucleotides of the present application may be located in the coding region within a range that does not change the polynucleotide sequence due to codon degeneracy or in consideration of codons preferred in the organism in which the polynucleotide is to be expressed.
  • Various modifications may be made.
  • by hybridizing under stringent conditions with a probe that can be prepared from a known gene sequence, for example, a sequence complementary to all or part of the nucleotide sequence one or more nucleotides in the polynucleotide sequence of SEQ ID NO: 1 are different nucleotides Any polynucleotide sequence substituted with and having promoter activity may be included without limitation.
  • stringent condition refers to a condition that enables specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., supra). For example, genes with high homology or identity, 40% or more, specifically 70% or more, 80% or more, 85% or more, 90% or more, more specifically 95% or more, More specifically, the conditions under which genes having homology or identity of 97% or more, particularly specifically 99% or more, hybridize with each other, and genes with lower homology or identity do not hybridize, or normal southern hybridization (southern hybridization).
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other.
  • adenosine is complementary to thymine
  • cytosine is complementary to guanine.
  • the present application may also include isolated nucleic acid fragments that are complementary to substantially similar nucleic acid sequences as well as the entire sequence.
  • polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the conditions described above.
  • the Tm value may be 60° C., 63° C. or 65° C., but is not limited thereto and may be appropriately adjusted by those skilled in the art depending on the purpose.
  • the expression that the variant polynucleotide consists of any one nucleotide sequence selected from SEQ ID NOs: 3 to 5 or a nucleotide sequence having at least 80% or more and less than 100% sequence homology thereto is the polynucleotide
  • it means not to exclude cases of addition, and/or deletion, and/or mutation of nucleotides that may occur during the process of linking to the target gene, such as the use of restriction enzymes.
  • the polynucleotide having promoter activity consisting of a nucleotide sequence represented by any one of SEQ ID NOs: 3 to 5 is all or part of any one nucleotide sequence selected from SEQ ID NOs: 3 to 5 It may also include a polynucleotide sequence having the promoter activity of the present application by hybridizing under stringent conditions with a complementary sequence to.
  • microorganisms containing the variant polynucleotide of the present application it is characterized in that the production of branched chain amino acids including valine, leucine or isoleucine is increased.
  • This is significant in that the production of branched chain amino acids can be increased through the polynucleotide having the promoter activity of the present application, compared to the wild-type Corynebacterium sp. strain that can or cannot produce branched chain amino acids in a very trace amount.
  • Example 1-1 Artificial mutagenesis through UV irradiation
  • Example 1-2 Evaluation of fermentation potency of mutagenic strains and selection of strains
  • Glucose 10g broth 5g, polypeptone 10g, sodium chloride 2.5g, yeast extract 5g, agar 20g, urea 2g (based on 1 liter of distilled water)
  • Glucose 100g Ammonium Sulfate 40g, Soy Protein 2.5g, Corn Steep Solids 5g, Urea 3g, Potassium Dibasic 1g, Magnesium Sulfate 0.5g, Biotin 100 ⁇ g, Thiamine-HCl 1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, calcium carbonate 30 g (based on 1 liter of distilled water)
  • strain name L-valine (g/L) control KCCM11201P 2.8 experimental group A1 2.9 A2 2.5 A3 3.5 A4 3.0 A5 1.5 A6 1.2 A7 4.2 A8 3.9 A9 2.8 A10 2.4 A11 3.1 A12 3.3 A13 3.8 A14 2.7 A15 2.9
  • the strain A7 which had the largest increase in valine production compared to the control KCCM11201P strain, was selected (see Table 1).
  • the main genes of the A7 strain with increased valine production capacity were sequenced and compared with the KCCM11201P strain and the Corynebacterium glutamicum ATCC14067 wild-type strain. As a result, it was confirmed that the A7 strain contained a mutation in the promoter position of the regulators of acetate metabolism A (RamA).
  • the A7 strain has the nucleotide sequence of SEQ ID NO: 2 including a mutation in the promoter region (SEQ ID NO: 1) of the ramA gene.
  • the promoter improved and enhanced RamA expression by substitution of ramA gene Corynebacterium a branched-chain amino acids Solarium spp valine, isoleucine, To determine the effect on the amount of leucine production.
  • Example 3-1 Introduction of promoter mutations into Corynebacterium glutamicum KCCM11201P strain and evaluation of L-valine production ability
  • a vector including a target mutation was prepared.
  • the genomic DNA of the A7 strain was extracted according to the protocol provided in the kit using a G-spin Total DNA extraction mini kit (Intron, Cat. No 17045), and the genomic DNA was used as a template PCR was performed.
  • PCR conditions were denatured at 94°C for 5 minutes; After 25 repetitions of denaturation at 94° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 150 seconds; A polymerization reaction was performed at 72° C. for 7 minutes, and a PCR product of 1114 bp was obtained using SEQ ID NO: 9 and SEQ ID NO: 10 (hereinafter, referred to as "mutant introduction fragment 1").
  • the pDZ-Pm-ramA was transformed into Corynebacterium glutamicum KCCM11201P by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol). Biotechnol 52:541-545, 1999).
  • the strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was selected in a medium containing 25 mg/L of kanamycin.
  • the recombinant strain was named Corynebacterium glutamicum KCCM11201P-Pm-ramA.
  • Flask evaluation was performed to compare the valine-producing ability of the valine-producing strains, Corynebacterium glutamicum KCCM11201P and KCCM11201P-Pm-ramA. After each strain was subcultured in a nutrient medium, each strain was inoculated in a 250 ml corner-baffle flask containing 25 ml of the production medium, and cultured with shaking at 30° C. for 72 hours at 200 rpm. Thereafter, the concentration of L-valine was analyzed using HPLC, and the analyzed concentrations of L-valine are shown in Table 3 below.
  • Glucose 10g broth 5g, polypeptone 10g, sodium chloride 2.5g, yeast extract 5g, agar 20g, urea 2g (based on 1 liter of distilled water)
  • Glucose 100g Ammonium Sulfate 40g, Soy Protein 2.5g, Corn Steep Solids 5g, Urea 3g, Potassium Dibasic 1g, Magnesium Sulfate 0.5g, Biotin 100 ⁇ g, Thiamine-HCl 1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, calcium carbonate 30 g (based on 1 liter of distilled water)
  • Example 3-2 Production of improved and substituted strains of promoters in Corynebacterium glutamicum KCCM11201P strains and evaluation of L-valine production ability of the prepared strains
  • primers 3 (SEQ ID NO: 11) to primer 10 (SEQ ID NO: 18) of Table 4 were synthesized to have xbaI restriction enzyme sites at the 5' and 3' ends.
  • the improved ramA promoter was named Pm1, Pm2, and Pm3-ramA, and for the production of Pm1-ramA, a pair of primers of SEQ ID NO: 11 and SEQ ID NO: 13; And the primer pair of SEQ ID NO: 12 and SEQ ID NO: 14 was used, and the primer pair of SEQ ID NO: 11 and SEQ ID NO: 15 for Pm2-ramA production; and primer pairs of SEQ ID NO: 12 and SEQ ID NO: 14 were used.
  • the PCR conditions were denaturation at 95°C for 5 minutes, denaturation at 94°C/30 seconds, annealing at 56°C/30 seconds, and polymerization at 72°C/1 minute repeated 30 times, followed by polymerization at 72°C for 7 minutes. was carried out by
  • the PCR product obtained above was fusion cloned into the prepared pDZ-Pm-ramA vector after treatment with xbaI restriction enzyme. Fusion cloning was performed using the In-Fusion® HD Cloning Kit (Clontech). E. coli DH5 ⁇ was transformed and plated on LB solid medium containing kanamycin (25 mg/L). After selecting colonies transformed with the plasmid into which the desired gene was inserted through PCR, plasmids were obtained using a plasmid extraction method, and finally pDZ-Pm1-ramA, pDZ-Pm2-ramA, pDZ-Pm3-ramA named.
  • primer nucleotide sequence SEQ ID NO: Primer 3 gctcggtacccggggatcctctagataggccggttcggactcgccctgcc SEQ ID NO: 11 Primer 4 ttacgccaagcttgcatgctctagaaacgtgcgcgcagtcatggtgactt SEQ ID NO: 12 Primer 5 CGA CAA GGG TCC ATT ATA CCA CAC CTT TGG GGG T SEQ ID NO: 13 Primer 6 acccccaaaggTgTGgtaTaAtgGacccttgtcg SEQ ID NO: 14 Primer 7 TCG ACA AGG GTA CAT TAT ACT TCC CCT TT SEQ ID NO: 15 Primer 8 aaggggaagtaTaAtgtacccttgtcga SEQ ID NO: 16 Primer 9 AAG GGT ACA GTG TAC CAC ACC
  • primers 11 SEQ ID NO: 19
  • primers 16 SEQ ID NO: 24 in Table 4 to have xbaI restriction enzyme sites at the 5' and 3' ends was synthesized.
  • pDZ-Pcj7-ramA vector was prepared in the same manner as in the above mutation vector construction (Example 3-1) using the primer pair of SEQ ID NO: 23 and SEQ ID NO: 24.
  • the pDZ-Pm1-ramA, pDZ-Pm2-ramA, pDZ-Pm3-ramA, and pDZ-Pcj7-ramA were transformed into Corynebacterium glutamicum KCCM11201P by homologous recombination on the chromosome (van der Rest et al. ., Appl Microbiol Biotechnol 52:541-545, 1999).
  • the strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was selected in a medium containing 25 mg/L of kanamycin.
  • the ramA promoter was improved and the strain substituted with the Pcj7 promoter was confirmed on the chromosome through PCR using the primers of SEQ ID NO: 9 and SEQ ID NO: 10 for the Corynebacterium glutamicum transformant on which the secondary recombination was completed. .
  • Corynebacterium glutamicum KCCM11201P-Pm1-ramA, KCCM11201P-Pm2-ramA, and KCCM11201P-Pm3-ramA were named CA08-1518, CA08-1519, and CA08-1520, respectively. It was deposited with the depositary institution, the Korean Culture Center of Microorganisms (KCCM) on April 27, 2020 and was given deposit numbers KCCM12704P, KCCM12705P, and KCCM12706P, respectively.
  • the strain substituted with the Pcj7 promoter was named KCCM11201P-Pcj7-ramA. Thereafter, the valine production capacity was evaluated in the same manner as in 3-1 above, and the results are shown in Table 5 below.
  • the KCCM11201P-Pm1-ramA (CA08-1518), KCCM11201P-Pm2-ramA (CA08-1519) and KCCM11201P-Pm3-ramA (CA08-1520) strains containing a promoter improved from that of the KCCM11201P strain.
  • Example 3-3 In Corynebacterium glutamicum CJ7V strain ramA Gene promoter improvement and production of substituted strains and evaluation of L-valine production ability of the produced strains
  • the genomic DNA of the ATCC14067 strain which is a Corynebacterium glutamicum wild type, was extracted using a G-spin Total DNA extraction mini kit (Intron, Cat. No 17045) according to the protocol provided in the kit.
  • PCR was performed using the genomic DNA as a template.
  • gene fragments (A, B) were obtained using the primer pair of SEQ ID NO: 27 and SEQ ID NO: 28, respectively.
  • PCR conditions were denatured at 94°C for 5 minutes; After 25 repetitions of denaturation at 94° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C.; Polymerization was performed at 72° C. for 7 minutes.
  • the obtained mutagenesis fragment 2 was treated with restriction enzyme XbaI (New England Biolabs, Beverly, MA), and then ligated using a pDZ vector treated with the same restriction enzyme and T4 ligase (New England Biolabs, Beverly, MA). did.
  • restriction enzyme XbaI New England Biolabs, Beverly, MA
  • T4 ligase New England Biolabs, Beverly, MA
  • transforming the produced gene into E. coli DH5 ⁇ it was selected in LB medium containing kanamycin, and DNA was obtained using a DNA-spin plasmid DNA purification kit (iNtRON).
  • the vector for the purpose of introducing the A42V mutation of the ilvN gene was named pDZ-ilvN (A42V).
  • primer nucleotide sequence SEQ ID NO:
  • Primer 17 aatttctagaggcagaccctattctatgaagg SEQ ID NO: 25
  • Primer 18 agtgtttcggtctttacagacacgagggac SEQ ID NO: 26
  • Primer 19 gtccctcgtgtctgtaaagaccgaaacact SEQ ID NO: 27
  • Primer 20 aatttctagacgtgggagtgtcactcgcttgg SEQ ID NO: 28
  • the pDZ-ilvN (A42V) was transformed into a wild-type Corynebacterium glutamicum ATCC14067 by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol). Biotechnol 52:541-545, 1999).
  • the strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was selected in a medium containing 25 mg/L of kanamycin.
  • the gene fragment was amplified through PCR using SEQ ID NO: 25 and SEQ ID NO: 26 for the Corynebacterium glutamicum transformant, and then the mutant insertion strain was identified through gene sequence analysis. .
  • the recombinant strain was named Corynebacterium glutamicum CJ7V.
  • Corynebacterium glutamicum CJ7V was transformed to each vector in the same manner as in Examples 3-1 and 3-2, and each strain was prepared and each Corynebacterium glutamicum CJ7V-Pm1- They were named ramA, CJ7V-Pm2-ramA, CJ7V-Pm3-ramA and CJ7V-Pcj7-ramA.
  • ramA CJ7V-Pm2-ramA
  • CJ7V-Pm3-ramA CJ7V-Pcj7-ramA.
  • Example 3-4 In Corynebacterium glutamicum CJ8V strain ramA Gene promoter improvement and production of substituted strains and evaluation of L-valine production ability of the produced strains
  • Corynebacterium glutamicum CJ8V was transformed to each vector in the same manner as in Examples 3-1 and 3-2, and each strain was prepared and each Corynebacterium glutamicum CJ8V-Pm1- They were named ramA, CJ8V-Pm2-ramA, CJ8V-Pm3-ramA and CJ8V-Pcj7-ramA.
  • ramA CJ8V-Pm2-ramA
  • CJ8V-Pm3-ramA CJ8V-Pcj7-ramA.
  • Example 4 L- leucine-producing strain Corynebacterium glutamicum KCCM11661P, KCCM11662P strains in the promoter mutation introduced strain production and L- leucine production capacity evaluation
  • the pDZ-Pm1-ramA, pDZ-Pm2-ramA, pDZ-Pm3-ramA, and pDZ-Pcj7-ramA were transformed into Corynebacterium glutamicum KCCM11661P and KCCM11662P by homologous recombination on the chromosome (van der Rest). et al., Appl Microbiol Biotechnol 52:541-545, 1999).
  • the strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was selected in a medium containing 25 mg/L of kanamycin.
  • the ramA promoter improved and Pcj7 substituted strain was confirmed on the chromosome through PCR using SEQ ID NO: 9 and SEQ ID NO: 10 for the Corynebacterium glutamicum transformant on which the secondary recombination was completed, and the recombinant strains were Corynebacterium glutamicum KCCM11661P-Pm1-ramA, KCCM11661P Pm2-ramA, K KCCM11661P-Pm3-ramA, KCCM11661P-Pcj7-ramA and KCCM11662P-Pm1-ramA, KCCM11662P Pm2-ramA, K KCCM11662P, respectively It was named KCCM11662P-Pcj7-ramA.
  • the produced strain was cultured in the following way to compare the leucine production ability.
  • each strain was inoculated in a 250 ml corner-baffle flask containing 25 ml of the production medium, and cultured with shaking at 30° C. for 72 hours at 200 rpm. Then, the concentration of L- leucine was analyzed using HPLC, and the analyzed concentration of L- leucine is shown in Table 9 below.
  • Glucose 10g broth 5g, polypeptone 10g, sodium chloride 2.5g, yeast extract 5g, agar 20g, urea 2g (based on 1 liter of distilled water)
  • Glucose 50 g Ammonium Sulfate 20 g, Corn Steep Solids 20 g, Potassium Dibasic Phosphate 1 g, Magnesium Sulfate Heptahydrate 0.5 g, Biotin 100 ⁇ g, Thiamine-HCl 1 mg, Calcium Carbonate 15 g (distilled water) 1 liter)
  • the KCCM11661P-Pm1-ramA, KCCM11661P Pm2-ramA, and KCCM11661P-Pm3-ramA strains containing the improved promoter were able to confirm the increase in L-leucine production by 11%, 7%, and 11%, respectively, than that of KCCM11661P. It was confirmed that the L-leucine-producing ability at a similar level to that of the KCCM11661P-Pcj7-ramA strain substituted with the promoter was confirmed.
  • KCCM11662P-Pm1-ramA, KCCM11662P Pm2-ramA, KCCM11662P-Pm3-ramA strains containing the improved promoter were able to confirm 10%, 6%, and 10% L-leucine production increase rates, respectively, than KCCM11662P, and a strong promoter It was confirmed that the KCCM11662P-Pcj7-ramA strain substituted with L-leucine showed a similar level of production ability.
  • Example 5 In the L-isoleucine producing strain Corynebacterium glutamicum KCCM11248P strain ramA Gene promoter improvement and substituted strain production and L-isoleucine production capacity evaluation
  • KCCM11248P-Pm-ramA, KCCM11248P-Pm1-ramA, KCCM11248P-Pm2-ramA, KCCM11248P-Pm3-ramA and KCCM11248P-Pcj7-ramA strains were cultured in the following manner to evaluate isoleucine-producing ability.
  • Each strain was inoculated in a 250 ml corner-baffle flask containing 25 ml of the seed medium, and incubated at 30° C. for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium and cultured with shaking at 30° C. for 48 hours at 200 rpm.
  • the composition of the species medium and the production medium is as follows, respectively.
  • Glucose 50 g (NH 4 ) 2 SO 4 12.5 g, Soy Protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, KH 2 PO 4 1 g, MgSO 4 7H 2 O 0.5 g, Biotin 100 ⁇ g, thiamine hydrochloride 1000 ⁇ g, calcium-pantothenic acid 2000 ⁇ g, nicotinamide 3000 ⁇ g, CaCO 3 30 g (based on 1 liter of distilled water)
  • the KCCM11248P-Pm1-ramA, KCCM11248P-Pm2-ramA, and KCCM11248P-Pm3-ramA strains containing the improved promoter were able to confirm 39%, 32%, and 18% L-isoleucine production increase rates, respectively, than KCCM11248P. It was confirmed that L-isoleucine-producing ability at a level similar to or higher than that of the KCCM11248P-Pcj7-ramA strain substituted with the promoter was confirmed.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

초산 대사 조절자 A의 활성이 강화된 L-분지쇄 아미노산 생산 미생물 및 상기 미생물을 배양하여, L-분지쇄 아미노산을 높은 효율로 생산하는 방법에 관한 것으로, 상기 초산 대사 조절자 A의 활성 강화는 초산 대사 조절자 A를 코딩하는 유전자의 프로모터 서열 내 변이를 도입하여 이루어지는 것이다.

Description

L- 분지쇄 아미노산 생산능이 강화된 미생물 및 이를 이용하여 L-분지쇄 아미노산을 생산하는 방법
본 출원은 초산 대사 조절자 A(regulators of acetate metabolism A)의 활성이 강화된, L-분지쇄 아미노산 생산 미생물 및 이를 이용한 L-분지쇄 아미노산 생산방법에 관한 것이다.
L-아미노산은 단백질의 기본 구성단위로서, 약품 원료와 식품첨가제, 동물 사료, 영양제, 살충제, 살균제 등의 중요 소재로 사용된다. 특히 분지쇄 아미노산(Branched Chain Amino Acids, BCAA)로 필수 아미노산인 L-발린, L-류신, L-이소류신을 총칭하는 것으로, 상기 분지쇄 아미노산은 항산화 효과 및 근육세포의 단백질 합성작용을 직접적으로 촉진시키는 효과가 있는 것으로 알려져 있다.
한편, 미생물을 이용한 분지쇄 아미노산의 생산은, 주로 에스케리키아 속 미생물 또는 코리네박테리움 속 미생물을 통해 이루어지며, 피루브산으로부터 여러 단계를 거쳐 케토이소카프로산 (2-ketoisocaproate)을 전구체로 생합성된다고 알려져 있다(US 10316297 B2, US 10526586 B2, US 10072278 B2). 그러나, 상기 미생물을 통한 L-분지쇄 아미노산의 생산은 공업적으로 대량 제조가 쉽지 않은 문제점이 있다.
이러한 배경 하에, 본 발명자들은 미생물을 이용한 L-분지쇄 아미노산의 생산능을 향상시키기 위해 예의 노력한 결과, 미생물의 초산 대사 조절자 A(regulators of acetate metabolism A, 이하 RamA)의 발현을 강화하였을 시, 분지쇄 아미노산 생산능이 현저하게 증가함을 확인함으로써 본 출원을 완성하였다.
본 출원의 하나의 목적은 초산 대사 조절자 A(regulators of acetate metabolism A)의 활성이 강화된, L-분지쇄 아미노산 생산 미생물을 제공하는 것이다.
본 출원의 다른 하나의 목적은 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 34번째, 36번째, 37번째, 41번째 및 43번째 뉴클레오티드 중 선택되는 어느 하나 이상의 위치에 상응하는 위치에서 다른 뉴클레오티드로의 치환을 포함하는 프로모터 활성을 가지는 폴리뉴클레오티드를 포함하는, L-분지쇄 아미노산 생산 미생물을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 미생물을 배지에서 배양하는 단계를 포함하는, L-분지쇄 아미노산을 생산하는 방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 34번째, 36번째, 37번째, 41번째 및 43번째 뉴클레오티드 중 선택되는 어느 하나이상의 뉴클레오티드가 다른 뉴클레오티드로 치환된, 프로모터 활성을 가지는 폴리뉴클레오티드를 제공하는 것이다.
본 출원의 폴리뉴클레오티드를 포함하는 L-분지쇄 아미노산을 생산하는 미생물을 배양하는 경우, L-분지쇄 아미노산을 높은 효율로 생산할 수 있다.
또한, 본 출원에 의해 제조된 아미노산은 동물 사료 또는 동물 사료 첨가제뿐만 아니라 인간의 식품 또는 식품 첨가제, 의약품 등 다양한 제품에 응용될 수 있다.
이하, 본 출원을 더욱 상세히 설명한다. 그러나, 본 출원에 개시한 일 실시 양태의 설명 및 실시예는 공통된 사항에 대하여 다른 실시 양태의 설명 및 실시예에서도 적용될 수 있다. 또한, 본 출원의 상세한 설명에 개시된 다양한 요소들의 모든 조합은 본 출원의 권리범위에 속하는 것은 물론이다. 그뿐만 아니라, 하기 기술된 구체적인 설명에 의하여 본 발명출원의 권리범위가 제한되는 것이 아니다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
본 출원의 하나의 양태는 초산 대사 조절자 A(regulators of acetate metabolism A)의 활성이 강화된, L-분지쇄 아미노산 생산 미생물을 제공하는 것이다.
본 출원에서, 용어 "초산 대사 조절자 A(regulators of acetate metabolism A)"는 본 출원의 목적 단백질로 초산 대사에 관련된 조절 단백질(regulatory protein)을 의미하며, ramA 유전자에 의해 코딩 될 수 있다.
본 출원에서, 상기 초산대사 조절자 A는 그 발현이 강화될 수 있으며, 상기 발현 강화로 인하여 L-분지쇄 아미노산의 생산능 증가를 가져올 수 있다.
본 출원에서 용어, 초산대사 조절자 A 활성의 "강화"는, 초산대사 조절자 A 의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 활성화(activation), 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 활성화, 강화, 상향조절, 과발현, 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 “내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "강화", "상향조절", "과발현" 또는 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성 및/또는 농도(발현량)에 비하여 향상되고/되거나 증가된 것을 의미한다.
상기 강화는 외래의 폴리펩티드를 도입하거나, 내재적인 폴리펩티드의 활성 강화 및/또는 농도(발현량) 증가를 통해 달성할 수 있다. 상기 초산대사 조절자 A의 활성의 강화 여부는 해당 폴리펩티드의 활성, 발현량 또는 해당 폴리펩티드로부터 배출되는 산물의 양의 향상/증가로부터 확인할 수 있다.
상기 초산대사 조절자 A의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 폴리펩티드의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법으로 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 초산대사 조절자 A 활성의 강화는
1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가;
2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현 조절 서열을 폴리펩티드의 발현을 향상시키는 서열로 교체하거나 변이를 도입;
3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
4) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드의 아미노산 서열의 변형;
5) 폴리펩티드 활성이 강화도록 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열의 변형 (예를 들어, 폴리펩티드의 활성이 강화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 폴리뉴클레오티드 서열의 변형);
6) 폴리펩티드의 활성을 나타내는 외래 폴리펩티드 또는 이를 코딩하는 외래 폴리뉴클레오티드의 도입;
7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
보다 구체적으로,
상기 1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터의 숙주세포 내로의 도입에 의해 달성되는 것일 수 있다. 또는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 숙주세포의 염색체 내에 1 카피 또는 2 카피 이상 도입에 의해 달성되는 것일 수 있다. 상기 염색체 내에 도입은 숙주세포의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내로 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다. 상기 벡터는 하기에 기술하는 바와 같다.
상기 2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현 조절 서열(또는 발현조절영역)을 서열을 폴리펩티드의 발현을 향상시키는 서열로 교체하거나 변이를 도입하는 것은, 예를 들면, 상기 발현 조절 영역의 활성을 더욱 강화하도록 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 유전자 발현 조절 서열을 폴리펩티드의 발현을 향상 시키는 서열로의 교체일 수 있다. 상기 발현 조절 영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 전사 및 해독의 종결을 조절하는 서열, 인핸서 등을 포함할 수 있다. 상기 방법은 구체적으로 본래의 프로모터 대신 강력한 이종 프로모터를 연결시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터, yccA 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 높은 다른 개시코돈을 코딩하는 염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 폴리펩티드의 활성을 강화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 증가하도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 상기 교체는 구체적으로 상동재조합에 의하여 폴리뉴클레오티드를 염색체내로 삽입함으로써 수행될 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 선별 마커는 하기 후술하는 내용과 같다.
상기 6) 폴리펩티드의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 상기 폴리펩티드와 동일/유사한 활성을 나타내는 폴리펩티드를 코딩하는 외래 폴리뉴클레오티드의 숙주세포 내 도입일 수 있다. 상기 외래 폴리뉴클레오티드는 상기 폴리펩티드와 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한이 없다. 상기 도입에 이용되는 방법은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 폴리펩티드가 생성되어 그 활성이 증가될 수 있다.
상기 7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩티드의 서열정보를 구조가 알려진 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 초산대사 조절자 A 활성의 강화는, 상응하는 폴리펩티드의 활성 또는 농도(발현량)가 야생형이나 변형 전 미생물 균주에서 발현된 초산대사 조절자 A의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩티드로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
보다 구체적으로, 본 출원에서 용어 "유전자 발현 조절 서열"은 '유전자 발현 조절 영역'으로도 혼용되며 목적 유전자를 발현시킬 수 있도록 이에 작동 가능하게 연결되어 있는 서열로서, 본 출원의 변이형 폴리뉴클레오티드를 포함할 수 있다. 상기 기술된 바와 같이 본 출원의 유전자 발현 조절 서열은 유전자의 전사를 실시하기 위한 프로모터, 인핸서 등을 의미할 수 있으며, 그 외에 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열 및, 전사 및 해독의 종결을 조절하는 DNA 등을 더 포함할 수 있는 개념이다.
본 출원의 일 구체예로 상기 유전자 발현 조절 서열은 프로모터 일 수 있으나, 이에 제한되지 않는다.
본 출원의 일 구체예로, 프로모터에 변이 도입, 또는 활성이 강한 프로모터로 교체함에 따라 초산대사 조절자 A는 그 발현이 강화될 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서, 용어 "프로모터"는 목적 유전자의 mRNA로의 전사 개시 활성을 가지는, 폴리머라제(polymerase)에 대한 결합 부위를 포함하는, 코딩 영역의 상위(upstream)의 비 해독된 뉴클레오티드 서열, 즉 폴리머라제가 결합하여 유전자의 전사를 개시하도록 하는 DNA 영역을 의미한다. 상기 프로모터는 mRNA 전사 개시부위의 5' 부위에 위치할 수 있다.
본 출원에서 용어 "작동 가능하게 연결된"(operatively linked)은 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드가 목적 유전자의 전사를 개시 및 매개하도록 상기 유전자 서열과 기능적으로 연결되어 있는 것을 의미한다. 작동 가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있으나, 이에 제한되지 않는다.
본 출원에서, 상기 목적 유전자는 미생물에서 발현을 조절하고자 하는 목적 단백질을 코딩하는 유전자를 의미하는 것으로, 구체적으로, 상기 유전자는 초산 대사 조절자 A(regulators of acetate metabolism A)을 코딩하는 유전자일 수 있으나, 이에 제한되는 것은 아니다. 더욱 구체적으로, 상기 유전자는 ramA 유전자일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 ramA 유전자는 내재적 유전자이거나 외래 유전자일 수 있으며, 활성 조절을 위한 변이를 포함하는 것일 수 있다. 상기 ramA 유전자의 서열은 미국 국립보건원의 GenBank와 같은 공지의 데이터 베이스를 통하여 당업자가 용이하게 입수할 수 있다.
본 출원의 다른 하나의 양태는 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 34번째, 36번째, 37번째, 41번째 및 43번째 뉴클레오티드 중 선택되는 어느 하나 이상의 위치에 상응하는 위치에서 다른 뉴클레오티드로의 치환을 포함하는 프로모터 활성을 가지는 폴리뉴클레오티드를 포함하는, L-분지쇄 아미노산 생산 미생물을 제공하는 것이다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 가닥이다.
상기 '프로모터'의 설명을 고려하면, 본 출원에서 "프로모터 활성을 가지는 폴리뉴클레오티드"는 "변이형 폴리뉴클레오티드","변이형 프로모터" 또는 "변이형 ramA 프로모터"등으로 혼용되어 명명될 수 있으며, 본 명세서에서는 상기 기술된 용어가 모두 사용될 수 있다.
이때, 상기 용어 "변이"는 유전적 또는 비유전적으로 안정적인 표현형적 변화를 의미하며, 본 명세서에서 "돌연변이"와 혼용되어 명명될 수 있다.
구체적으로, 본 출원의 변이형 폴리뉴클레오티드는 변이를 포함하지 않는 폴리뉴클레오티드에 비해 변이된(증가된) 프로모터 활성을 가질 수 있다. 따라서, 본 출원의 변이형 폴리뉴클레오티드와 작동 가능하게 연결된 목적 유전자인 ramA 유전자의 발현 및 상기 ramA 유전자에 의해 코딩되는 단백질의 활성을 조절(증가)할 수 있으며, 나아가 목적 유전자 이외의 다른 유전자의 발현을 조절할 수 있다.
본 출원의 목적상 상기 프로모터 활성을 가지는 폴리뉴클레오티드는 아미노산, 구체적으로는 분지쇄 아미노산, 보다 구체적으로는 류신, 발린, 이소류신을 포함하는 아미노산의 생산 또는 생산량을 증가시키는데 관여하는 단백질의 발현을 증가시킬 수 있는 폴리뉴클레오티드를 의미하나, 이에 제한되지 않는다.
본 출원에서 용어, "서열번호 1로 표시되는 폴리뉴클레오티드 서열"은 초산 대사 조절자 A(regulators of acetate metabolism A: RamA)를 코딩하는 유전자의 프로모터 서열을 의미할 수 있다.
본 출원의 상기 프로모터 활성을 가지는 폴리뉴클레오티드는 자연 유래의 서열이 아닌 프로모터 활성을 갖는 변이형 폴리뉴클레오티드로, 작동 가능하게 연결되는 목적단백질의 발현을 서열번호 1로 표시되는 폴리뉴클레오티드 서열에 비해서 증대시킬 수 있다.
구체적으로, 본 출원의 변이형 폴리뉴클레오티드는 상기 서열번호 1로 표시되는 폴리뉴클레오티드 서열, 즉 ramA 유전자의 프로모터 서열이 변이된 것으로, 상기 서열의 34번째, 36번째, 37번째, 41번째 및 43번째 뉴클레오티드 중 선택되는 어느 하나이상의 뉴클레오티드가 다른 뉴클레오티드로 치환된 것일 수 있다.
더욱 구체적으로, 본 출원의 변이형 폴리뉴클레오티드는 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 34번째 뉴클레오티드가 T로 치환; 36번째 뉴클레오티드가 T로 치환; 37번째 뉴클레오티드가 G로 치환; 41번째 뉴클레오티드가 T로 치환; 43번째 뉴클레오티드가 A로 치환되거나 또는 이들의 조합을 포함할 수 있으나, 이에 제한 되는 것은 아니다. 상기 변이에 따라 본 출원의 폴리뉴클레오티드는 서열번호 3 내지 5 중에서 선택되는 어느 하나의 뉴클레오티드 서열로 이루어지는 것(consist of)일 수 있다.
일 구체예로, 본 출원의 변이형 폴리뉴클레오티드는 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 34번째 뉴클레오티드가 T로 치환; 36번째 뉴클레오티드가 T로 치환; 및 37번째 뉴클레오티드가 G로 치환된 것일 수 있다. 이때, 본 출원의 변이형 폴리뉴클레오티드는 서열번호 5로 이루어진 것일 수 있다.
다른 구체예로, 본 출원의 변이형 폴리뉴클레오티드는 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 41번째 뉴클레오티드가 T로 치환; 및 43번째 뉴클레오티드가 A로 치환된 것일 수 있다. 이때, 본 출원의 변이형 폴리뉴클레오티드는 서열번호 4로 이루어진 것일 수 있다.
또 다른 구체예로, 본 출원의 변이형 폴리뉴클레오티드는 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 34번째 뉴클레오티드가 T로 치환; 36번째 뉴클레오티드가 T로 치환; 37번째 뉴클레오티드가 G로 치환; 41번째 뉴클레오티드가 T로 치환; 및 43번째 뉴클레오티드가 A로 치환된 것일 수 있다. 이때, 본 출원의 변이형 폴리뉴클레오티드는 서열번호 3으로 이루어진 것일 수 있다.
본 출원의 L-분지쇄 아미노산 생산 미생물은 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 34번째 뉴클레오티드가 T로 치환; 36번째 뉴클레오티드가 T로 치환; 37번째 뉴클레오티드가 G로 치환; 41번째 뉴클레오티드가 T로 치환; 43번째 뉴클레오티드가 A로 치환되거나 또는 이들의 조합을 포함하는, 프로모터 활성을 가지는 폴리뉴클레오티드를 포함하는 미생물 일 수 있다.
구체적으로, 본 출원의 L-분지쇄 아미노산 생산 미생물은 서열번호 3 내지 5 중에서 선택되는 어느 하나의 뉴클레오티드 서열 또는 이와 적어도 80%이상 100%미만의 서열 상동성을 가지는 뉴클레오티드 서열로 이루어진, 프로모터 활성을 가지는 폴리뉴클레오티드를 포함하는 미생물일 수 있다. 본 출원의 변이형 폴리뉴클레오티드에 대한 자세한 내용은 하기에서 자세하게 설명한 내용과 같다.
본 출원에서, 용어 "분지쇄 아미노산"이란 곁사슬에 분지알킬기가 있는 아미노산을 말하며, 발린, 류신 및 이소류신을 포함한다. 구체적으로, 본 출원에서 상기 분지쇄 아미노산은 L-분지쇄 아미노산일 수 있고, 상기 L-분지쇄 아미노산은 L-발린, L-류신 및 L-이소류신 일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, “분지쇄 아미노산을 생산하는 미생물"은 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 분지쇄 아미노산 생산을 위하여 유전적 변이가 일어나거나 활성을 강화시킨 미생물 일 수 있다. 본 출원에서 상기 "L-분지쇄 아미노산을 생산할 수 있는 미생물"은 "분지쇄 아미노산을 생산하는 미생물", "분지쇄 아미노산 생산능을 갖는 미생물"과 혼용되어 사용될 수 있다.
본 출원의 목적상 상기 미생물은 본 출원의 변이형 폴리뉴클레오티드를 포함하여 분지쇄 아미노산을 생산할 수 있는 미생물이라면 모두 가능하다. 구체적으로, 상기 분지쇄 아미노산을 생산하는 미생물은 상기 변이형 폴리뉴클레오티드를 포함하여, 목적하는 분지쇄 아미노산 생산능이 증가된 것을 특징으로 하는 미생물일 수 있다. 구체적으로, 본 출원에서 분지쇄 아미노산을 생산하는 미생물 또는 분지쇄 아미노산 생산능을 갖는 미생물은, 분지쇄 아미노산 생합성 경로 내 유전자 일부가 강화 또는 약화되거나, 분지쇄 아미노산 분해 경로 내 유전자 일부가 강화 또는 약화된 미생물 일 수 있으나, 이에 제한되지 않는다.
하나의 구체예로, 본 출원에서 분지쇄 아미노산 생산능을 가지는 코리네박테리움 속 미생물은 본 출원의 변이형 폴리뉴클레오티드를 포함하거나, 또는 본 출원의 폴리뉴클레오티드를 코딩하는 유전자를 포함하는 벡터로 형질전환되어, 향상된 분지쇄 아미노산 생산능을 가지게 된 코리네박테리움 속 미생물을 의미한다. 상기 "향상된 분지쇄 아미노산 생산능을 가지게 된 코리네박테리움 속 미생물"은 형질 변화 전 모균주 또는 비변형 미생물보다 분지쇄 아미노산 생산능이 향상된 미생물을 의미한다. 상기 '비변형 미생물'은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 천연형 균주 자체이거나, 본 출원의 폴리뉴클레오티드를 포함하지 않는 미생물, 또는 본 출원의 폴리뉴클레오티드를 포함하는 벡터로 형질전환되지 않은 미생물을 의미한다.
상기 코리네박테리움 속 미생물은 구체적으로는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 브레비박테리움 락토퍼멘텀 (Brevibacterium lactofermentum), 브레비박테리움 플라범 (Brevibacterium flavum), 코리네박테리움 써모아미노게네스 (Corynebacterium thermoaminogenes), 코리네박테리움 에피션스 (Corynebacterium efficiens), 코리네박테리움 스테이셔니스(Corynebacterium stationis) 등을 포함할 수 있으나, 반드시 이에 한정되는 것은 아니다.
본 출원의 벡터는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 유전 물질을 보유하는 인위적 DNA 분자로, 구체적으로 목적 유전자를 발현시킬 수 있는 적합한 발현조절영역에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 포함하는 DNA 제조물을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 목적 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 목적 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 발현/기능할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현되거나 기능할 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함할 수 있다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현될 수도 있으며, 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 상기 미생물을 배지에서 배양하는 단계를 포함하는 L-분지쇄 아미노산을 생산하는 방법을 제공한다.
또한, 상기 L-분지쇄 아미노산을 생산하는 방법은 목적물질을 상기의 배지 또는 미생물로부터 회수 또는 분리하는 단계를 추가로 포함할 수 있다.
상기 "폴리뉴클레오티드", "코리네박테리움 속 미생물", “벡터” 및 "L-분지쇄 아미노산"은 앞서 설명한 바와 같다.
본 출원에서, 용어 "배양"은 본 출원의 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및/또는 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 본 출원의 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 코리네박테리움 속 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
구체적으로, 코리네박테리움 속 미생물에 대한 배양 배지는 문헌["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)]에서 찾아 볼 수 있다.
본 출원에서 탄소원은 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 본 출원의 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
본 출원의 배양에서 배양온도는 20 내지 45℃ 구체적으로는 25 내지 40℃ 를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 배양에 의하여 생산된 L-분지쇄 아미노산은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 L-분지쇄 아미노산 생산방법은, 본 출원의 미생물을 준비하는 단계, 상기 균주를 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 L-분지쇄 아미노산 생산방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 본 출원의 미생물로부터 L-분지쇄 아미노산을 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 L-분지쇄 아미노산을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC, SMB 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-분지쇄 아미노산을 회수할 수 있다.
또한, 본 출원의 L-분지쇄 아미노산 생산방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 L-분지쇄 아미노산 생산방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 연속적 또는 비연속적으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 하나의 양태는 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 34번째, 36번째, 37번째, 41번째 및 43번째 뉴클레오티드 중 선택되는 어느 하나이상의 뉴클레오티드가 다른 뉴클레오티드로 치환된, 프로모터 활성을 가지는 폴리뉴클레오티드를 제공한다.
상기 "폴리뉴클레오티드" 및 "프로모터"는 앞서 설명한 바와 같다.
또한, 본 출원의 변이형 폴리뉴클레오티드 서열은 종래 알려진 돌연변이 유발법, 예를 들면 방향성 진화법(direct evolution) 및 부위특이적 돌연변이법(site-directed mutagenesis)등에 의하여 변형될 수 있다.
따라서, 본 출원의 변이형 폴리뉴클레오티드는 상기 서열번호 3의 뉴클레오티드 서열에 대해서 34번째 서열은 T로 고정; 36번째 서열은 T로 고정; 37번째 서열은 G로 고정; 41번째 서열은 T로 고정; 및 43번째 서열은 A로 고정되며, 그 이외의 서열과는 적어도 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성(homology) 또는 동일성(identity)을 가지는 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드를 포함할 수 있다.
또한, 본 출원의 변이형 폴리뉴클레오티드는 상기 서열번호 4의 뉴클레오티드 서열에 대해서 41번째 서열은 T로 고정; 및 43번째 서열은 A로 고정되며, 그 이외의 서열과는 적어도 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성(homology) 또는 동일성(identity)을 가지는 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드를 포함할 수 있다.
또한, 본 출원의 변이형 폴리뉴클레오티드는 상기 서열번호 5의 뉴클레오티드 서열에 대해서 34번째 서열은 T로 고정; 36번째 서열은 T로 고정; 및 37번째 서열은 G로 고정; 되며, 그 이외의 서열과는 적어도 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성(homology) 또는 동일성(identity)을 가지는 뉴클레오티드 서열을 포함하는 폴리뉴클레오티드를 포함할 수 있다.
이때, 상동성 또는 동일성을 갖는 뉴클레오티드 서열은 상기 범주 중 100% 동일성을 갖는 서열은 제외되거나, 100% 미만의 동일성을 갖는 서열일 수 있다.
상기 서열과 상동성을 갖는 서열로서 실질적으로 서열번호 3 내지 5 중 선택되는 어느 하나의 뉴클레오티드 서열과 동일하거나 상응하는 생물학적 활성을 갖는 폴리뉴클레오티드 서열이라면, 34번째, 36번째, 37번째, 41번째 또는 43번째 위치 외의 일부 서열이 결실, 변형, 치환 또는 부가된 폴리뉴클레오티드 서열을 갖는 경우도 역시 본 출원의 범주에 포함됨은 자명하다.
본 출원에서 용어, '상동성 (homology)' 또는 '동일성 (identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
또한, 본 출원의 변이형 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 폴리뉴클레오티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리뉴클레오티드 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 또한 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, 서열번호 1의 폴리뉴클레오티드 서열에서 하나 이상의 뉴클레오티드가 다른 뉴클레오티드로 치환되고 프로모터 활성을 가지는 폴리뉴클레오티드 서열이라면 제한 없이 포함할 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌 (예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성(homology) 또는 동일성(identity)이 높은 유전자끼리, 40% 이상, 구체적으로는 70% 이상, 80% 이상, 85% 이상, 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성 또는 동일성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1XSSC, 0.1% SDS, 구체적으로는 60℃, 0.1XSSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1XSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
특히, 상기 변이형 폴리뉴클레오티드는 서열번호 3 내지 5 중에 선택되는 어느 하나의 뉴클레오티드 서열 또는 이와 적어도 80%이상 100%미만의 서열 상동성을 가지는 뉴클레오티드 서열로 이루어진다(consist of)는 표현은 상기 폴리뉴클레오티드를 프로모터로서 목적 유전자에 연결하여 사용할 때, 제한효소 사용과 같이 목적 유전자에 연결하는 과정 중에 발생할 수 있는 뉴클레오티드의 추가, 및/또는 삭제, 및/또는 변이 등의 경우를 배제하지 않는 것을 의미한다.
예를 들어, 서열번호 3 내지 5 중에 선택되는 어느 하나의 서열번호로 표시되는 뉴클레오티드 서열로 이루어진 프로모터 활성을 갖는 상기 폴리뉴클레오티드는, 서열번호 3 내지 5 중에 선택되는 어느 하나의 뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이브리드화되어 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드 서열도 포함할 수 있다.
본 출원의 변이형 폴리뉴클레오티드를 포함하는 미생물의 경우, 발린, 류신 또는 이소류신을 포함하는 분지쇄 아미노산 생산량이 증가하는 것을 특징으로 한다. 이는 야생형 코리네박테리움속 균주가 분지쇄 아미노산을 아주 극미량으로 생산할 수 있거나 생산하지 못하는 것에 비해, 본 출원의 프로모터 활성을 갖는 폴리뉴클레오티드를 통해 분지쇄 아미노산 생산량을 증가시킬 수 있다는 것에 의의가 있다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 국한되는 것은 아니다.
실시예 1. 인공변이법을 통한 발린 생산능 증가 변이주 선별
실시예 1-1. UV조사를 통한 인공 돌연변이 유발
대표적인 분지쇄 아미노산인 발린 생산능이 증가된 변이주를 선별하기 위하여 발린 생산 균주인 코리네박테리움 글루타미쿰 KCCM11201P(대한민국 등록특허 제10-1117022호)를 한천을 포함하는 영양배지에 도말하여 30oC에서 36시간 배양하였다. 이렇게 획득한 수백 개의 콜로니를 실온에서 UV를 조사하여 균주 내 게놈상에 무작위 돌연변이를 유발시켰다.
실시예 1-2. 돌연변이 유발 균주 발효역가 평가 및 균주 선별
모균주로 사용된 코리네박테리움 글루타미쿰 KCCM11201P에 대비하여 L-발린의 생산능이 증가된 변이주를 선별하고자 무작위 돌연변이가 유발된 균주들을 대상으로 발효 역가 실험을 실시하였다. 각각의 콜로니는 영양배지에서 계대 배양된 후, 생산 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 72시간 동안, 200rpm에서 진탕 배양하였다. 이후, HPLC를 이용하여 L-발린의 농도를 분석하였고, 분석한 L-발린의 농도를 하기 표 1에 나타내었다.
영양배지 (pH 7.2)
포도당 10g, 육즙 5g, 폴리펩톤 10g, 염화나트륨 2.5g, 효모엑기스 5g, 한천 20g, 유레아 2g (증류수 1리터 기준)
생산배지 (pH 7.0)
포도당 100 g, 황산암모늄 40 g, 대두단백질 2.5 g, 옥수수침지고형분(Corn Steep Solids) 5 g, 요소 3 g, 제2인산칼륨 1 g, 황산마그네슘7수염 0.5 g, 바이오틴 100 ㎍, 티아민-HCl 1 ㎎, 판토텐산칼슘 2 ㎎, 니코틴아마이드 3 ㎎, 탄산칼슘 30 g (증류수 1리터 기준)
　 균주명 L-발린(g/L)
대조군 KCCM11201P 2.8
실험군 A1 2.9
A2 2.5
A3 3.5
A4 3.0
A5 1.5
A6 1.2
A7 4.2
A8 3.9
A9 2.8
A10 2.4
A11 3.1
A12 3.3
A13 3.8
A14 2.7
A15 2.9
대조군인 KCCM11201P 균주에 비하여 발린 생산량이 가장 많이 증가한 A7균주를 선별하였다(표 1 참고).
실시예 2. 유전자 시퀀싱을 통한 변이 확인
발린 생산능이 증가된 상기 A7 균주의 주요 유전자들을 시퀀싱하여 KCCM11201P 균주 및 코리네박테리움 글루타미쿰 ATCC14067 야생형 균주와 비교하였다. 그 결과, 상기 A7 균주가 초산 대사 조절자 A(regulators of acetate metabolism A, RamA)의 프로모터 위치에 변이를 포함하고 있음을 확인하였다.
구체적으로, A7 균주는 상기 ramA 유전자의 프로모터 영역(서열번호 1)에서 변이를 포함하는 서열번호 2의 염기서열을 갖는 것을 확인하였다.
이하 실시예에서는, 상기 ramA 유전자의 프로모터 영역 특정 위치에 삽입된 변이로 인한 효과와, ramA 유전자의 프로모터 개량 및 치환에 의한 RamA 발현 강화가 코리네박테리움 속 미생물의 분지쇄 아미노산인 발린, 이소류신, 루이신의 생성량에 미치는 영향을 확인하고자 하였다.
실시예 3. 변이가 도입된 균주 제작 및 발린 생산능 확인
실시예 3-1. 코리네박테리움 글루타미쿰 KCCM11201P 균주에 프로모터 변이 도입 및 L-발린 생산능 평가
서열번호 2로 표시되는 ramA 유전자 프로모터 변이형 폴리뉴클레오티드를 코리네글루타미쿰 KCCM11201P에 삽입하기 위하여 타겟 변이를 포함한 벡터를 제작하였다. 구체적으로, 상기 A7 균주의 게노믹(genomic) DNA를 G-spin Total DNA 추출 미니 키트(Intron사, Cat. No 17045)를 이용하여 키트에 제공된 프로토콜에 따라 추출하고, 상기 게노믹 DNA를 주형으로 PCR을 실시하였다. PCR의 조건은 94℃에서 5분간 변성한 후; 94℃에서 30초 변성, 55℃에서 30초 어닐링, 및 72℃ 150초 중합을 25회 반복한 후; 72℃에서 7분간 중합반응을 수행하였으며, 서열번호 9와 서열번호 10을 이용하여 1114bp의 PCR 결과물 (이하, "변이 도입 단편 1"이라 명명함)을 얻었다.
상기 얻어진 변이 도입 단편 1을 제한효소 XbaI (New England Biolabs, Beverly, MA)로 처리한 후, 동일한 제한효소로 처리된 pDZ벡터 (대한민국 등록특허 제10-0924065호 및 국제 공개특허 제2008-033001호)와 T4 리가아제(New England Biolabs, Beverly, MA)를 이용하여 라이게이션하였다. 상기 제작한 유전자를 대장균 DH5α에 형질전환시킨 후, 이를 카나마이신 함유 LB배지에서 선별하고, DNA-spin 플라스미드 DNA 정제 키트(iNtRON 사)로 DNA를 획득하여 상기 변이 도입 단편 1을 포함하는 벡터 pDZ-Pm-ramA를 제조하였다.
프라이머 염기 서열 서열번호
Pm(TATAAT)-F1 gctctagaTAGGCCGGTTCGGACTCGCCCTGCC 서열번호 9
Pm(TATAAT)-R1 gctctagaaacgtgcgcgcagtcatggtgactt 서열번호 10
상기 pDZ-Pm-ramA을 염색체 상에서의 상동 재조합에 의해 코리네박테리움 글루타미쿰 KCCM11201P에 형질전환시켰다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신(Kanamycin) 25㎎/ℓ를 함유한 배지에서 선별하였다. 이후 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질 전환주를 대상으로 서열번호 9과 서열번호 10을 이용한 PCR을 통하여 염색체상에서 ramA 업스트림 영역 내(서열번호 1) 프로모터에 변이가 삽입된 균주를 확인하였다. 상기 재조합 균주를 코리네박테리움 글루타미쿰 KCCM11201P-Pm-ramA이라 명명하였다.
발린 생산균주인 코리네박테리움 글루타미쿰 KCCM11201P와 KCCM11201P-Pm-ramA의 발린 생성능을 비교하기 위하여 플라스크 평가를 수행하였다. 각각 균주를 영양배지에서 계대 배양한 후, 생산 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 72시간 동안, 200rpm에서 진탕 배양하였다. 이후, HPLC를 이용하여 L-발린의 농도를 분석하였고, 분석한 L-발린의 농도를 하기 표 3에 나타내었다.
영양배지 (pH 7.2)
포도당 10g, 육즙 5g, 폴리펩톤 10g, 염화나트륨 2.5g, 효모엑기스 5g, 한천 20g, 유레아 2g (증류수 1리터 기준)
생산배지 (pH 7.0)
포도당 100 g, 황산암모늄 40 g, 대두단백질 2.5 g, 옥수수침지고형분(Corn Steep Solids) 5 g, 요소 3 g, 제2인산칼륨 1 g, 황산마그네슘7수염 0.5 g, 바이오틴 100 ㎍, 티아민-HCl 1 ㎎, 판토텐산칼슘 2 ㎎, 니코틴아마이드 3 ㎎, 탄산칼슘 30 g (증류수 1리터 기준)
KCCM11201P와 KCCM11201P-Pm-ramA의 L-발린 생산능
균주 L-발린 (g/L)
배치 1 배치 2 배치 3 평균
KCCM11201P 2.6 2.5 2.7 2.6
KCCM11201P-Pm-ramA 3.2 3.3 3.1 3.2
그 결과, KCCM11201P-Pm-ramA 균주의 L-발린 생산능은 KCCM11201P 대비 약 23% 증가함을 확인하였다.
실시예 3-2. 코리네박테리움 글루타미쿰 KCCM11201P 균주에서 프로모터의 개량 및 치환된 균주의 제작 및 제작된 균주의 L-발린 생산능 평가
상기 3-1 결과에서 보듯이 ramA 유전자 프로모터 변이에 의해 발린 생산능이 증가되는 것을 확인하여, 추가적으로 ramA 발현을 증가시키고자 서열번호 2의 변이형 프로모터를 기반으로 ramA 프로모터의 개량 또는 치환을 위한 벡터를 제작하였다.
변이가 포함된 벡터를 제작하기 위하여, 5' 말단과 3' 말단에 xbaI 제한효소 부위를 가지도록 표 4의 프라이머 3(서열번호 11) 내지 프라이머 10(서열번호 18)을 합성하였다.
개량되는 ramA 프로모터는 Pm1, Pm2, Pm3-ramA로 명명하였고, Pm1-ramA 제작을 위하여는 서열번호 11 및 서열번호 13의 프라이머 쌍; 및 서열번호 12 및 서열번호 14의 프라이머 쌍을 이용하였으며, Pm2-ramA 제작을 위하여 서열번호 11 및 서열번호 15의 프라이머 쌍; 및 서열번호 12 및 서열번호 14의 프라이머 쌍을 이용하였다. 또한, Pm3-ramA 제작을 위하여는 서열번호 11 및 서열번호 17의 프라이머 쌍; 및 서열번호 12 및 서열번호 18로 이루어지는 프라이머 쌍을 이용하였다.
상기 각 프라이머를 이용하여 야생형 코리네박테리움 글루타미쿰의 염색체 DNA를 주형으로 하여 PCR[Sambrook et al, Molecular Cloning, a Laboratory Manual (1989), Cold Spring Harbor Laboratories]을 수행하였다.
이때, PCR 조건은 변성 95℃도에서 5분간 변성 후, 94℃/30초 변성, 56℃/30초 어닐링, 72℃/1분 중합을 30회 반복한 후, 72℃에서 7분간 중합반응을 시켜서 수행되었다.
그 다음 상기에서 수득한 PCR 산물을 기 제작된 pDZ-Pm-ramA 벡터를 xbaI 제한효소 처리 후 퓨전 클로닝하였다. 퓨전 클로닝은 In-Fusion® HD Cloning Kit (Clontech)를 사용하여 수행하였다. 대장균 DH5α에 형질전환하고 카나마이신(25mg/ℓ)이 포함된 LB 고체배지에 도말하였다. PCR을 통해 상기 목적한 유전자가 삽입된 플라스미드로 형질전환된 콜로니를 선별한 후 플라스미드 추출법을 이용하여 플라스미드를 획득하였고, 최종적으로 pDZ-Pm1-ramA, pDZ-Pm2-ramA, pDZ-Pm3-ramA이라 명명하였다.
프라이머 염기 서열 서열번호
프라이머 3 gctcggtacccggggatcctctagataggccggttcggactcgccctgcc 서열번호11
프라이머 4 ttacgccaagcttgcatgctctagaaacgtgcgcgcagtcatggtgactt 서열번호12
프라이머 5 CGA CAA GGG TCC ATT ATA CCA CAC CTT TGG GGG T 서열번호13
프라이머 6 acccccaaaggTgTGgtaTaAtgGacccttgtcg 서열번호14
프라이머 7 TCG ACA AGG GTA CAT TAT ACT TCC CCT TT 서열번호15
프라이머 8 aaaggggaagtaTaAtgtacccttgtcga 서열번호16
프라이머 9 AAG GGT ACA GTG TAC CAC ACC TTT GGG GGT 서열번호17
프라이머 10 acccccaaaggTgTGgtacactgtaccctt 서열번호18
프라이머 11 attcgagctcggtacccggtctagatcaagaaactgcaggtgtgtaccga 서열번호19
프라이머 12 CAT CGG TAG GCT ATG CCG GCG GTA CCT TCA GAT TTC CTC CTG CTT TAC AC 서열번호20
프라이머 13 gtaccgccggcatagcctaccgatg 서열번호21
프라이머 14 AGT GTT TCC TTT CGT TGG GTA CGT A 서열번호22
프라이머 15 tacgtacccaacgaaaggaaacactgtggatacccagcggattaaagatg 서열번호23
프라이머 16 TGC ATG CCT GCA GGT CGA CTC TAG AAT CGC GGC GCA GAT CCT CAT CGG TC 서열번호24
또한 이와 별개로, ramA 프로모터를 강한 프로모터인 Pcj7으로 치환하기 위하여, 5' 말단과 3' 말단에 xbaI 제한효소 부위를 가지도록 표 4의 프라이머 11(서열번호 19) 내지 프라이머 16(서열번호 24)을 합성하였다.
서열번호 19 및 서열번호 20의 프라이머 쌍; 서열번호 21 및 서열번호 22의 프라이머 쌍; 및 서열번호 23 및 서열번호 24의 프라이머 쌍을 이용하여 위의 변이벡터 제작(실시예 3-1)과 같은 방법으로 pDZ-Pcj7-ramA 벡터를 제작하였다.
상기 pDZ-Pm1-ramA, pDZ-Pm2-ramA, pDZ-Pm3-ramA, pDZ-Pcj7-ramA을 염색체 상에서의 상동 재조합에 의해 코리네박테리움 글루타미쿰 KCCM11201P에 형질전환시켰다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신(Kanamycin) 25㎎/ℓ를 함유한 배지에서 선별하였다. 이후 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질 전환주를 대상으로 서열번호 9과 서열번호 10의 프라이머를 이용한 PCR을 통하여 염색체상에서 ramA 프로모터 개량 및 Pcj7 프로모터로 치환된 균주를 확인할 수 있었다.
상기 재조합 균주들 중 코리네박테리움 글루타미쿰 KCCM11201P-Pm1-ramA, KCCM11201P-Pm2-ramA, KCCM11201P-Pm3-ramA를 각각 CA08-1518, CA08-1519, CA08-1520이라 명명하였으며, 부다페스트 조약 하의 국제기탁기관인 한국미생물보존센터(Korean CultureCenter of Microorganisms, KCCM)에 2020년 4월 27일자로 기탁하여 각각 기탁번호 KCCM12704P, KCCM12705P, KCCM12706P 를 부여 받았다.
또한, 상기 Pcj7 프로모터로 치환된 균주는 KCCM11201P-Pcj7-ramA로 명명하였다. 이후 상기 3-1과 동일한 방법으로 발린 생산능 평가를 하였고, 결과는 하기 표 5와 같다.
균주 L-발린 (g/L)
배치 1 배치 2 배치 3 평균
KCCM11201P 2.6 2.5 2.7 2.6
KCCM11201P-Pm1-ramA(CA08-1518) 3.2 3.4 3.3 3.3
KCCM11201P-Pm2-ramA(CA08-1519) 3.1 3.2 3.3 3.2
KCCM11201P-Pm3-ramA(CA08-1520) 3.2 3.0 3.1 3.1
KCCM11201P-Pcj7-ramA 2.9 3.1 3.0 3.0
상기 표 5의 결과로서, KCCM11201P 균주보다 개량된 프로모터를 포함하는 KCCM11201P-Pm1-ramA(CA08-1518), KCCM11201P-Pm2-ramA(CA08-1519) 및 KCCM11201P-Pm3-ramA(CA08-1520) 균주의 경우 각각 약 27%, 23%, 19% L-발린 생산 증가율을 확인할 수 있었으며, 강한 프로모터로 치환된 KCCM11201P-Pcj7-ramA 균주와 동등 또는 그 이상의 L-발린 생산능을 보임을 확인할 수 있었다.
실시예3-3: 코리네박테리움 글루타미쿰 CJ7V 균주에서 ramA 유전자 프로모터 개량 및 치환된 균주의 제작 및 제작된 균주의 L-발린 생산능 평가
L-발린을 생산하는 다른 코리네박테리움 글루타미쿰에 속하는 균주들에서도 L-발린 생산능 증가 효과가 있는지를 확인하기 위하여, 야생주 코리네박테리움 글루타미쿰 ATCC14067에 1종의 변이[ilvN(A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467]를 도입하여 L-발린 생산능이 향상된 균주를 제작하였다.
구체적으로, 코리네박테리움 글루타미쿰 야생형인 ATCC14067 균주의 게노믹 DNA를 G-spin Total DNA 추출 미니 키트(Intron사, Cat. No 17045)를 이용하여 키트에 제공된 프로토콜에 따라 추출하였다. 상기 게노믹 DNA를 주형으로 PCR을 실시하였다. ilvN 유전자에 A42V 변이를 도입하는 벡터를 제작하기 위해서, 서열번호 25와 서열번호 26의 프라이머 쌍; 및 서열번호 27과 서열번호 28의 프라이머 쌍을 이용하여 유전자 단편(A, B)을 각각 얻었다. PCR의 조건은 94℃에서 5분간 변성한 후; 94℃에서 30초 변성, 55℃에서 30초 어닐링, 및 72℃초 중합을 25회 반복한 후; 72℃에서 7분간 중합반응을 수행하였다.
그 결과, 단편 A, B 모두 537bp의 폴리뉴클레오티드를 획득할 수 있었다. 상기 두 단편을 주형으로 서열번호 25와 서열번호 26를 이용하여 오버랩핑(Overlapping) PCR을 실시하여 1044bp의 PCR 결과물 (이하, "변이 도입 단편 2"라 명명함)을 얻었다.
상기 얻어진 변이 도입 단편 2를 제한효소 XbaI(New England Biolabs, Beverly, MA)로 처리한 후, 동일한 제한효소로 처리된 pDZ벡터와 T4 리가아제(New England Biolabs, Beverly, MA)를 이용하여 라이게이션하였다. 상기 제작한 유전자를 대장균 DH5α에 형질전환시킨 후, 이를 카나마이신 함유 LB배지에서 선별하고, DNA-spin 플라스미드 DNA 정제 키트(iNtRON 사)로 DNA를 획득하였다. 상기 ilvN 유전자의 A42V 변이 도입을 목적으로 하는 벡터를 pDZ-ilvN(A42V)라 명명하였다.
프라이머 염기 서열 서열번호
프라이머 17 aatttctagaggcagaccctattctatgaagg 서열번호 25
프라이머 18 agtgtttcggtctttacagacacgagggac 서열번호 26
프라이머 19 gtccctcgtgtctgtaaagaccgaaacact 서열번호 27
프라이머 20 aatttctagacgtgggagtgtcactcgcttgg 서열번호 28
이후, 상기 pDZ-ilvN(A42V)를 염색체 상에서의 상동 재조합에 의해 야생형인 코리네박테리움 글루타미쿰 ATCC14067에 형질전환시켰다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신(kanamycin) 25㎎/ℓ를 함유한 배지에서 선별하였다. 이후 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질 전환주를 대상으로 서열번호 25와 서열번호 26를 이용한 PCR을 통하여 유전자 단편을 증폭한 뒤, 유전자 서열 분석을 통하여 변이 삽입 균주를 확인하였다. 상기 재조합 균주를 코리네박테리움 글루타미쿰 CJ7V라 명명하였다.
마지막으로, 상기 코리네박테리움 글루타미쿰 CJ7V를 상기 실시예 3-1, 3-2 와 같은 방법으로 각각의 벡터들을 형질전환시킨 균주를 제작하고 각각 코리네박테리움 글루타미쿰 CJ7V-Pm1-ramA, CJ7V-Pm2-ramA, CJ7V-Pm3-ramA 및 CJ7V-Pcj7-ramA이라 명명하였다. 제작된 균주의 L-발린 생산능을 비교하고자 상기 실시예 3-1과 동일한 방법으로 배양하여 L-발린의 농도를 분석하였고, 분석한 L-발린의 농도를 하기 표 7에 나타내었다.
L-발린 생산능 비교
균주 L-발린 (g/L)
배치 1 배치 2 배치 3 평균
CJ7V 2.2 2.2 2.3 2.2
CJ7V-Pm1-ramA 2.8 2.7 2.7 2.7
CJ7V-Pm2-ramA 2.6 2.6 2.7 2.6
CJ7V-Pm3-ramA 2.6 2.4 2.5 2.5
CJ7V-Pcj7-ramA 2.4 2.5 2.6 2.5
상기 표 7에서 볼 수 있듯이, 개량된 프로모터를 포함하는 CJ7V-Pm1-ramA, CJ7V-Pm2-ramA 및 CJ7V-Pm3-ramA 균주의 경우 각각 약 23%, 18%, 14% L-발린 생산 증가율을 확인할 수 있었으며, 강한 프로모터로 치환된 균주인 CJ7V-Pcj7-ramA와 동등 또는 그 이상의 L-발린 생산능을 보임을 확인할 수 있었다.
실시예 3-4: 코리네박테리움 글루타미쿰 CJ8V 균주에서 ramA 유전자 프로모터 개량 및 치환된 균주의 제작 및 제작된 균주의 L-발린 생산능 평가
L-발린을 생산하는 다른 코리네박테리움 글루타미쿰에 속하는 균주들에서도 L-발린 생산능 증가 효과가 있는지를 확인하기 위하여, 상기 실시예 3-3와 같은 방법으로 야생주 코리네박테리움 글루타미쿰 ATCC13869에 1종의 변이[ilvN(A42V)]를 도입하여 L-발린 생산능을 갖게된 변이주를 제작하고, 상기 재조합 균주를 코리네박테리움 글루타미쿰 CJ8V라 명명하였다.
마지막으로, 상기 코리네박테리움 글루타미쿰 CJ8V를 상기 실시예 3-1, 3-2 와 같은 방법으로 각각의 벡터들을 형질전환시킨 균주를 제작하고 각각 코리네박테리움 글루타미쿰 CJ8V-Pm1-ramA, CJ8V-Pm2-ramA, CJ8V-Pm3-ramA 및 CJ8V-Pcj7-ramA이라 명명하였다. 제작된 균주의 L-발린 생산능을 비교하고자 상기 실시예 3-1과 동일한 방법으로 배양하여 L-발린의 농도를 분석하였고, 분석한 L-발린의 농도를 하기 표 8에 나타내었다.
L-발린 생산능
균주 L-발린 (g/L)
배치 1 배치 2 배치 3 평균
CJ8V 1.9 2.0 1.9 1.9
CJ8V-Pm1-ramA 2.3 2.3 2.3 2.3
CJ8V-Pm2-ramA 2.3 2.1 2.2 2.2
CJ8V-Pm3-ramA 2.0 2.1 2.2 2.1
CJ8V-Pcj7-ramA 2.1 2.0 1.9 2.0
상기 표 8에서 볼 수 있듯이, CJ8V 균주보다 개량된 프로모터를 포함하는 CJ8V-Pm1-ramA, CJ8V-Pm2-ramA 및 CJ8V-Pm3-ramA 균주의 경우 각각 약 21%, 16%, 10% L-발린 생산 증가율을 확인할 수 있었으며, 강한 프로모터로 치환된 CJ8V-Pcj7-ramA 균주와 동등 또는 그 이상의 L-발린 생산능을 보임을 확인할 수 있었다.
실시예 4. L-루이신 생산 균주 코리네박테리움 글루타미쿰 KCCM11661P, KCCM11662P 균주에서 프로모터 변이 도입주 제작 및 L-루이신 생산능 평가
상기 pDZ-Pm1-ramA, pDZ-Pm2-ramA, pDZ-Pm3-ramA, pDZ-Pcj7-ramA을 염색체 상에서의 상동 재조합에 의해 코리네박테리움 글루타미쿰 KCCM11661P, KCCM11662P 에 형질전환시켰다(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주는 카나마이신(Kanamycin) 25㎎/ℓ를 함유한 배지에서 선별하였다. 이후 2차 재조합이 완료된 상기 코리네박테리움 글루타미쿰 형질 전환주를 대상으로 서열번호 9와 서열번호 10을 이용한 PCR을 통하여 염색체상에서 ramA 프로모터 개량 및 Pcj7 치환된 균주를 확인하였고, 상기 재조합 균주들을 각각 코리네박테리움 글루타미쿰 KCCM11661P-Pm1-ramA, KCCM11661P Pm2-ramA, K KCCM11661P-Pm3-ramA, KCCM11661P -Pcj7-ramA 및 KCCM11662P-Pm1-ramA, KCCM11662P Pm2-ramA, K KCCM11662P-Pm3-ramA, KCCM11662P -Pcj7-ramA 이라 명명하였다.
제작된 균주를 아래와 같은 방법으로 배양하여 루이신 생산능을 비교하였다.
각각 균주를 영양배지에서 계대 배양한 후, 생산 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 72시간 동안, 200rpm에서 진탕 배양하였다. 이후, HPLC를 이용하여 L-루이신의 농도를 분석하였고, 분석한 L-루이신의 농도를 하기 표 9에 나타내었다.
<영양배지 (pH 7.2)>
포도당 10g, 육즙 5g, 폴리펩톤 10g, 염화나트륨 2.5g, 효모엑기스 5g, 한천 20g, 유레아 2g (증류수 1리터 기준)
<생산배지 (pH 7.0)>
포도당 50 g, 황산암모늄 20 g, 옥수수침지고형분(Corn Steep Solids) 20 g, 제2인산칼륨 1 g, 황산마그네슘7수염 0.5 g, 바이오틴 100 ㎍, 티아민-HCl 1 ㎎, 탄산칼슘 15 g (증류수 1리터 기준)
L-루이신 생산능
균주 L-루이신 (g/L)
배치 1 배치 2 배치 3 평균
KCCM11661P 2.8 2.6 2.7 2.7
KCCM11661P-Pm1-ramA 3.2 2.9 2.8 3.0
KCCM11661P Pm2-ramA 3.0 2.8 2.9 2.9
KCCM11661P-Pm3-ramA 3.1 3.1 3.0 3.0
KCCM11661P -Pcj7-ramA 3.2 3.1 3.1 3.1
KCCM11662P 3.0 3.1 2.9 3.0
KCCM11662P-Pm1-ramA 3.3 3.3 3.5 3.3
KCCM11662P Pm2-ramA 3.3 3.2 3.2 3.2
KCCM11662P-Pm3-ramA 3.2 3.5 3.3 3.3
KCCM11662P -Pcj7-ramA 3.4 3.4 3.3 3.3
그 결과, 개량된 프로모터를 포함하는 KCCM11661P-Pm1-ramA, KCCM11661P Pm2-ramA, KCCM11661P-Pm3-ramA균주는 KCCM11661P보다 각각 11%, 7%, 11% L-루이신 생산 증가율을 확인할 수 있었으며, 강한 프로모터로 치환된 KCCM11661P -Pcj7-ramA 균주와 유사한 수준의 L-루이신 생산능을 보임을 확인할 수 있었다.
또한, 개량된 프로모터를 포함하는 KCCM11662P-Pm1-ramA, KCCM11662P Pm2-ramA, KCCM11662P-Pm3-ramA 균주는 KCCM11662P 보다 각각 10%, 6%, 10% L-루이신 생산 증가율을 확인할 수 있었으며, 강한 프로모터로 치환된 KCCM11662P -Pcj7-ramA 균주와 유사한 수준의 L-루이신 생산능을 보임을 확인할 수 있었다.
실시예 5. L-이소류신 생산 균주 코리네박테리움 글루타미쿰 KCCM11248P 균주에서 ramA 유전자 프로모터 개량 및 치환된 균주 제작 및 L-이소류신 생산능 평가
L-이소류신을 생산하는 다른 코리네박테리움 글루타미쿰에 속하는 균주들에서도 L-이소류신 생산능 증가 효과가 있는지를 확인하기 위하여, L-이소류신 생산균주 코리네박테리움 글루타미쿰 KCCM11248P 균주에 상기 실시예 3-1, 3-2 와 같은 방법으로 각각의 벡터들을 형질전환시킨 균주를 제작하고 각각 코리네박테리움 글루타미쿰 KCCM11248P-Pm-ramA, KCCM11248P-Pm1-ramA, KCCM11248P-Pm2-ramA, KCCM11248P-Pm3-ramA 및 KCCM11248P-Pcj7-ramA이라 명명하였다. 상기 KCCM11248P-Pm-ramA, KCCM11248P-Pm1-ramA, KCCM11248P-Pm2-ramA, KCCM11248P-Pm3-ramA 및 KCCM11248P-Pcj7-ramA균주를 아래와 같은 방법으로 배양하여 이소류신 생산능을 평가하였다.
종 배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 각 균주들을 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 48시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종 배지와 생산 배지의 조성은 각각 하기와 같다.
<종 배지(pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4　4 g, K2HPO4　8 g, MgSO4　7H2O 0.5 g, 바이오틴 100 ㎍, 티아민 HCl 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 2000 ㎍ (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 50 g, (NH4)2SO4　12.5 g, 대두 단백질 2.5 g, 옥수수 침지 고형분(Corn Steep Solids) 5 g, 요소 3 g, KH2PO4　1 g, MgSO47H2O 0.5 g, 바이오틴 100 ㎍, 티아민 염산염 1000 ㎍, 칼슘-판토텐산 2000 ㎍, 니코틴아미드 3000 ㎍, CaCO3　30 g (증류수 1리터 기준)
배양종료 후 HPLC를 이용하여 L-이소류신의 농도를 측정하였고, 측정한 L-이소류신 농도는 하기 표 10과 같다.
균주 L-이소류신 (g/L)
배치 1 배치 2 배치 3 평균
KCCM11248P 1.6 1.3 1.4 1.43
KCCM11248P-Pm1-ramA 2.0 1.8 2.2 2.00
KCCM11248P-Pm2-ramA 1.8 2.0 1.9 1.90
KCCM11248P-Pm3-ramA 1.7 1.8 1.6 1.70
KCCM11248P-Pcj7-ramA 1.8 1.8 1.7 1.76
그 결과, 개량된 프로모터를 포함하는 KCCM11248P-Pm1-ramA, KCCM11248P-Pm2-ramA, KCCM11248P-Pm3-ramA 균주는 KCCM11248P 보다 각각 39%, 32%, 18% L-이소류신 생산 증가율을 확인할 수 있었으며, 강한 프로모터로 치환된 KCCM11248P-Pcj7-ramA 균주와 유사 또는 그 이상의 수준의 L-이소류신 생산능을 보임을 확인할 수 있었다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2021006262-appb-I000001
Figure PCTKR2021006262-appb-I000002
Figure PCTKR2021006262-appb-I000003

Claims (13)

  1. 초산 대사 조절자 A(regulators of acetate metabolism A)의 활성이 강화된, L-분지쇄 아미노산 생산 미생물.
  2. 제 1항에 있어서, 상기 활성 강화는 초산 대사 조절자 A 유전자 발현 조절 서열에 변이를 도입; 상기 유전자 발현 조절 서열을 발현을 향상시키는 서열로 교체; 활성이 강화되도록 해당 유전자에 변이를 추가적으로 도입 또는 이들의 조합에 의하여 달성되는 것인, 미생물.
  3. 제 2항에 있어서, 상기 유전자 발현 조절 서열은 프로모터인 것인, 미생물.
  4. 제 2항에 있어서, 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 34번째, 36번째, 37번째, 41번째 및 43번째 뉴클레오티드 중 선택되는 어느 하나 이상의 위치에 상응하는 위치에서 다른 뉴클레오티드로의 치환을 포함하는 프로모터 활성을 가지는 폴리뉴클레오티드를 포함하는, 미생물.
  5. 제 4항에 있어서, 상기 폴리뉴클레오티드는 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 34번째 뉴클레오티드가 T로 치환; 36번째 뉴클레오티드가 T로 치환; 37번째 뉴클레오티드가 G로 치환; 41번째 뉴클레오티드가 T로 치환; 43번째 뉴클레오티드가 A로 치환되거나 또는 이들의 조합을 포함하는 것인, 미생물.
  6. 제 4항에 있어서, 상기 폴리뉴클레오티드는, 서열번호 3 내지 5 중 선택되는 어느 하나의 뉴클레오티드 서열로 이루어지는 것인, 미생물.
  7. 제 1항에 있어서, 상기 미생물은 코리네박테리움 속인 것인, 미생물.
  8. 제 7항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰을 포함하는, 미생물.
  9. 제 1항 내지 제8항 중 어느 한 항의 미생물을 배지에서 배양하는 단계를 포함하는, L-분지쇄 아미노산을 생산하는 방법.
  10. 제 9항에 있어서, 상기의 배지 또는 미생물로부터 회수 또는 분리하는 단계를 추가로 포함하는, L-분지쇄 아미노산을 생산하는 방법.
  11. 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 34번째, 36번째, 37번째, 41번째 및 43번째 뉴클레오티드 중 선택되는 어느 하나 이상의 위치에 상응하는 위치에서 다른 뉴클레오티드로의 치환을 포함하는, 프로모터 활성을 가지는 폴리뉴클레오티드.
  12. 제 11항에 있어서, 상기 폴리뉴클레오티드는 서열번호 1로 표시되는 폴리뉴클레오티드 서열의 34번째 뉴클레오티드가 T로 치환; 36번째 뉴클레오티드가 T로 치환; 37번째 뉴클레오티드가 G로 치환; 41번째 뉴클레오티드가 T로 치환; 43번째 뉴클레오티드가 A로 치환되거나 또는 이들의 조합을 포함하는 것인, 폴리뉴클레오티드.
  13. 제 11항에 있어서, 상기 폴리뉴클레오티드는, 서열번호 3 내지 5 중 선택되는 어느 하나의 뉴클레오티드 서열로 이루어지는, 폴리뉴클레오티드.
PCT/KR2021/006262 2020-05-21 2021-05-20 L- 분지쇄 아미노산 생산능이 강화된 미생물 및 이를 이용하여 l-분지쇄 아미노산을 생산하는 방법 WO2021235855A1 (ko)

Priority Applications (7)

Application Number Priority Date Filing Date Title
CN202180019796.3A CN115702244A (zh) 2020-05-21 2021-05-20 L-支链氨基酸生产能力增强的微生物和利用其生产l-支链氨基酸的方法
US17/794,137 US20230063145A1 (en) 2020-05-21 2021-05-20 Microorganism with enhanced l-branched-chain amino acid producing ability and method for producing l-branched-chain amino acid using same
EP21808090.1A EP4083214A4 (en) 2020-05-21 2021-05-20 MICROORGANISM HAVING INCREASED CAPACITY FOR THE PRODUCTION OF L-BRANCH CHAIN AMINO ACIDS AND METHOD FOR PRODUCING L-BRANCH CHAIN AMINO ACIDS USING THE SAME
CA3169534A CA3169534A1 (en) 2020-05-21 2021-05-20 Microorganism with enhanced l-branched-chain amino acid producing ability and method for producing l-branched-chain amino acid using same
BR112022017038A BR112022017038A2 (pt) 2020-05-21 2021-05-20 Microrganismo com capacidade aprimorada de produção de aminoácido de cadeia ramificada l e método para produção de aminoácido de cadeia ramificada l usando o mesmo
MX2022009250A MX2022009250A (es) 2020-05-21 2021-05-20 Microorganismo con capacidad de produccion de l-aminoacidos de cadena ramificada mejorada y procedimiento para producir aminoacidos de cadena ramificada utilizando el mismo.
JP2022543795A JP2023511882A (ja) 2020-05-21 2021-05-20 Ｌ－分枝鎖アミノ酸生産能が強化された微生物及びそれを用いてｌ－分枝鎖アミノ酸を生産する方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200061175A KR102311391B1 (ko) 2020-05-21 2020-05-21 L- 분지쇄 아미노산 생산능이 강화된 미생물 및 이를 이용하여 l-분지쇄 아미노산을 생산하는 방법
KR10-2020-0061175 2020-05-21

Publications (1)

Publication Number Publication Date
WO2021235855A1 true WO2021235855A1 (ko) 2021-11-25

Family

ID=78078728

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/006262 WO2021235855A1 (ko) 2020-05-21 2021-05-20 L- 분지쇄 아미노산 생산능이 강화된 미생물 및 이를 이용하여 l-분지쇄 아미노산을 생산하는 방법

Country Status (9)

Country Link
US (1) US20230063145A1 (ko)
EP (1) EP4083214A4 (ko)
JP (1) JP2023511882A (ko)
KR (1) KR102311391B1 (ko)
CN (1) CN115702244A (ko)
BR (1) BR112022017038A2 (ko)
CA (1) CA3169534A1 (ko)
MX (1) MX2022009250A (ko)
WO (1) WO2021235855A1 (ko)

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002191370A (ja) * 1999-12-16 2002-07-09 Kyowa Hakko Kogyo Co Ltd 新規ポリヌクレオチド
US20040229305A1 (en) * 2003-05-16 2004-11-18 Ajinomoto Co. Inc Novel polynucleotides encoding useful polypeptides in corynebacterium glutamicum SSP. lactofermentum
KR20080033001A (ko) 2006-10-12 2008-04-16 삼성전자주식회사 백라이트 유닛 및 이를 구비하는 액정 표시 장치
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
KR101117022B1 (ko) 2011-08-16 2012-03-16 씨제이제일제당 (주) Ｌ-발린 생산능이 향상된 미생물 및 이를 이용한 ｌ-발린 제조방법
US10072278B2 (en) 2013-03-11 2018-09-11 Cj Cheiljedang Corporation Strain having enhanced L-valine productivity and L-valine production method using the same
KR101947945B1 (ko) * 2018-01-25 2019-02-13 씨제이제일제당 (주) L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US10316297B2 (en) 2014-08-05 2019-06-11 Cj Cheiljedang Corporation Feedback-resistant acetohydroxy acid synthase variant and method for producing L-valine using the same
US10526586B2 (en) 2015-03-18 2020-01-07 Cj Cheiljedang Corporation Pyruvate dehydrogenase variants, a microorganism comprising the same and a method for producing L-amino acid using the same
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110885364B (zh) * 2019-12-26 2021-02-02 江南大学 一种促进N-乙酰氨基葡萄糖生产的RamA转录因子突变体及其应用

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002191370A (ja) * 1999-12-16 2002-07-09 Kyowa Hakko Kogyo Co Ltd 新規ポリヌクレオチド
US20040229305A1 (en) * 2003-05-16 2004-11-18 Ajinomoto Co. Inc Novel polynucleotides encoding useful polypeptides in corynebacterium glutamicum SSP. lactofermentum
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
KR20080033001A (ko) 2006-10-12 2008-04-16 삼성전자주식회사 백라이트 유닛 및 이를 구비하는 액정 표시 장치
KR101117022B1 (ko) 2011-08-16 2012-03-16 씨제이제일제당 (주) Ｌ-발린 생산능이 향상된 미생물 및 이를 이용한 ｌ-발린 제조방법
US10072278B2 (en) 2013-03-11 2018-09-11 Cj Cheiljedang Corporation Strain having enhanced L-valine productivity and L-valine production method using the same
US10316297B2 (en) 2014-08-05 2019-06-11 Cj Cheiljedang Corporation Feedback-resistant acetohydroxy acid synthase variant and method for producing L-valine using the same
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US10526586B2 (en) 2015-03-18 2020-01-07 Cj Cheiljedang Corporation Pyruvate dehydrogenase variants, a microorganism comprising the same and a method for producing L-amino acid using the same
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof
KR101947945B1 (ko) * 2018-01-25 2019-02-13 씨제이제일제당 (주) L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법

Non-Patent Citations (18)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence and Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
ATSCHUL, S. F ET AL., J MOLEC BIOL, vol. 215, 1990, pages 403
BIOTECHNOLOGY AND BIOPROCESS ENGINEERING, vol. 19, June 2014 (2014-06-01), pages 456 - 467
CARILLO ET AL., SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
LANGE C ET AL: "Global expression profiling and physiological characterization of Corynebacterium glutamicum grown in the presence of L-valine.", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 69, no. 5, 1 May 2003 (2003-05-01), US , pages 2521 - 2532, XP002401827, ISSN: 0099-2240, DOI: 10.1128/AEM.69.5.2521-2532.2003 *
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL., TRENDS GENET, vol. 16, 2000, pages 276 - 277
SAMBROOK ET AL.: "Molecular Cloning", 2012
SAMBROOK ET AL.: "Molecular Cloning, a Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORIES
SITNICKA ET AL.: "Functional Analysis of Genes", ADVANCES IN CELL BIOLOGY, vol. 2, 2010, pages 1 - 16
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482
VAN DER REST ET AL., APPL MICROBIOL BIOTECHNOL, vol. 52, 1999, pages 541 - 545
ZHANG HAILING, LI YANYAN, WANG CHENHUI, WANG XIAOYUAN: "Understanding the high l-valine production in Corynebacterium glutamicum VWB-1 using transcriptomics and proteomics", SCIENTIFIC REPORTS, vol. 3632, no. 8, 1 December 2018 (2018-12-01), XP055869154, DOI: 10.1038/s41598-018-21926-5 *

Also Published As

Publication number Publication date
BR112022017038A2 (pt) 2022-11-29
US20230063145A1 (en) 2023-03-02
CA3169534A1 (en) 2021-11-25
KR102311391B1 (ko) 2021-10-12
JP2023511882A (ja) 2023-03-23
EP4083214A1 (en) 2022-11-02
MX2022009250A (es) 2022-08-16
CN115702244A (zh) 2023-02-14
EP4083214A4 (en) 2023-10-25

Similar Documents

Publication Publication Date Title
WO2020130236A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2019231159A1 (ko) 변이형 호모세린 디하이드로게나제 및 이를 이용한 호모세린 또는 호모세린 유래 l-아미노산의 생산 방법
WO2019190192A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2021177731A1 (ko) 글루타민 신테타아제 변이형 폴리펩티드 및 이를 이용한 l-글루타민 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022050671A1 (ko) L-발린 생산 미생물 및 이를 이용한 l-발린 생산 방법
WO2021045472A1 (ko) 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법
WO2022124708A1 (ko) 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2021235855A1 (ko) L- 분지쇄 아미노산 생산능이 강화된 미생물 및 이를 이용하여 l-분지쇄 아미노산을 생산하는 방법
WO2022005022A1 (ko) L-이소류신 생산능이 강화된 미생물 및 이를 이용한 l-이소류신 생산방법
WO2021261733A1 (ko) L-쓰레오닌 디하이드라타아제의 신규 변이체 및 이를 이용한 l-이소류신 생산 방법
WO2022124511A1 (ko) 변이형 atp-의존적 프로테아제 및 이를 이용한 l-아미노산의 생산 방법
WO2018230978A1 (ko) 신규 폴리펩타이드 및 이를 이용한 오르니틴계 산물 생산방법
WO2022191635A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-아미노산 생산 방법
WO2022186487A1 (ko) 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2024085671A1 (ko) 변이형 리보뉴클레아제 활성 조절 단백질 및 이를 이용한 l-발린 생산 방법
WO2024096545A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산 방법
WO2022108383A1 (ko) L-글루타민 생산능이 향상된 미생물 및 이를 이용한 l-글루타민 생산 방법
WO2024035191A1 (ko) 케톨산 리덕토아이소머라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022216088A1 (ko) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
WO2023224248A1 (ko) 글루코네이트 리프레서 단백질 활성이 약화된 미생물 및 이를 이용한 l-아르기닌 생산 방법
WO2023121055A1 (ko) L-이소루신 생산 미생물 및 이를 이용한 l-이소루신 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21808090

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022543795

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 21808090.1

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2021808090

Country of ref document: EP

Effective date: 20220725

ENP Entry into the national phase

Ref document number: 3169534

Country of ref document: CA

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022017038

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112022017038

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220825

NENP Non-entry into the national phase

Ref country code: DE