WO2023224248A1 - 글루코네이트 리프레서 단백질 활성이 약화된 미생물 및 이를 이용한 l-아르기닌 생산 방법 - Google Patents

글루코네이트 리프레서 단백질 활성이 약화된 미생물 및 이를 이용한 l-아르기닌 생산 방법 Download PDF

Info

Publication number
WO2023224248A1
WO2023224248A1 PCT/KR2023/004003 KR2023004003W WO2023224248A1 WO 2023224248 A1 WO2023224248 A1 WO 2023224248A1 KR 2023004003 W KR2023004003 W KR 2023004003W WO 2023224248 A1 WO2023224248 A1 WO 2023224248A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
arginine
microorganism
gntr1
seq
Prior art date
Application number
PCT/KR2023/004003
Other languages
English (en)
French (fr)
Inventor
김효경
최선형
이지원
심지현
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Publication of WO2023224248A1 publication Critical patent/WO2023224248A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/10—Citrulline; Arginine; Ornithine

Definitions

  • the present application relates to microorganisms with weakened gluconate repressor protein activity; Method for producing L-arginine using the microorganism of the present application; A composition for producing L-arginine containing the microorganism of the present application; And the present application relates to the use of microorganisms for producing L-arginine.
  • L-arginine is used for medicinal purposes such as liver function promoter, brain function promoter, and comprehensive amino acid preparation, and has recently been in the spotlight for food purposes such as fish cake additive, health drink additive, and salt substitute for patients with high blood pressure. It is a substance that exists. Research is continuously being conducted to use microorganisms to produce industrially usable high concentrations of arginine.
  • microorganisms of the genus Corynebacterium are gram-positive microorganisms that are widely used to produce L-amino acids.
  • the target substance is specific, such as increasing the expression of genes encoding enzymes mainly involved in L-arginine biosynthesis in Corynebacterium strains or removing genes unnecessary for L-arginine biosynthesis.
  • a traditional approach is mainly used (Korean Patent Publication No. 10-1102263).
  • the present inventors have disclosed a microorganism of the Corynebacterium genus with weakened gluconate repressor protein activity, a method for producing L-arginine using the microorganism, a composition for producing L-arginine containing the microorganism, and L-arginine production by the microorganism. The purpose was developed and this application was completed.
  • One object of the present application is to provide a microorganism of the genus Corynebacterium with weakened gluconate repressor protein activity.
  • Another object of the present application is to provide a method for producing L-arginine comprising culturing the microorganism of the Corynebacterium genus of the present application in a medium.
  • Another object of the present application is to provide a composition for producing L-arginine containing the microorganism of the Corynebacterium genus of the present application.
  • Another object of the present application is to provide a use for the production of L-arginine by the microorganism of the Corynebacterium genus of the present application.
  • Microorganisms of the Corynebacterium genus whose gluconate repressor protein activity is weakened in the present application can produce L-arginine with high efficiency compared to microorganisms of the Corynebacterium genus whose gluconate repressor protein activity is not weakened.
  • One aspect of the present application provides a microorganism of the genus Corynebacterium with weakened gluconate repressor protein activity.
  • the microorganism of the Corynebacterium genus of the present application may have the ability to produce L-arginine.
  • the Corynebacterium genus microorganism of the present application may have an increased L-arginine production ability compared to the Corynebacterium genus microorganism in which the gluconate repressor protein activity is not weakened.
  • Gluconate repressor (GntR) protein refers to a regulatory protein involved in gluconate metabolism or sugar influx.
  • the gluconate repressor protein is known in the art, and the protein and gene sequences of the gluconate repressor protein can be obtained from known databases, examples of which include NCBI's GenBank, but are not limited thereto. no. More specifically, the gluconate repressor protein may be a protein consisting of the amino acid sequence of SEQ ID NO: 1. In addition, the gluconate repressor protein of the present application may have and/or include the amino acid sequence shown in SEQ ID NO: 1, or may essentially consist of the amino acid sequence.
  • the gluconate repressor protein of the present application not only has the amino acid sequence shown in SEQ ID NO: 1, but also has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% of SEQ ID NO: 1. It may include an amino acid sequence having more than %, 98%, 99%, 99.5%, 99.7% or 99.9% homology or identity. In addition, if it is an amino acid sequence that has such homology or identity and has the same or corresponding biological activity as the gluconate repressor protein of the present application, if some of the sequences have amino acid sequences deleted, modified, substituted, conservatively substituted, or added. It is obvious that this is also included within the scope of this application.
  • the gluconate repressor protein having the amino acid sequence of SEQ ID NO: 1 has at least 70%, 75%, 80%, or 85% homology or identity with the base sequence of SEQ ID NO: 2 or the sequence of SEQ ID NO: 2. , has or includes a nucleotide sequence that is 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100%, or is homologous to the nucleotide sequence of SEQ ID NO. 2 or the sequence of SEQ ID NO.
  • Consists of or consists essentially of base sequences that are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100%. It may be encoded by a polynucleotide, but is not limited thereto.
  • L-Arginine refers to an L-amino acid with the chemical formula C 6 H 14 N 4 O 2 , which is a conditionally essential amino acid that exists in all living organisms.
  • L-arginine is Among microorganisms, it is known to be mainly produced by microorganisms of the genus Corynebacterium , but they are known to be subject to feedback inhibition by intracellular arginine (Vehary Sakanyan, et al, Microbiology, 142:9- 108, 1996), it is known that there are limits to producing high yields of L-arginine.
  • microorganism includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and can be caused by insertion of foreign genes or enhanced or inactivated activity of intrinsic genes. It is a microorganism whose specific mechanism is weakened or strengthened, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product.
  • microorganism of the genus Corynebacterium having the ability to produce L-arginine refers to a microbial strain of the genus Corynebacterium that is capable of producing L-arginine within a living organism, and the parent strain that does not have the ability to produce L-arginine is -Includes microorganisms endowed with the ability to produce arginine, or microorganisms that inherently have the ability to produce L-arginine.
  • L-arginine production capacity can be imparted or enhanced by species improvement.
  • non-modified microorganism does not exclude strains containing mutations that may occur naturally in microorganisms, and is either a wild-type strain or a natural strain itself, or a strain that has a genetic mutation caused by natural or artificial factors. It may refer to the strain before change.
  • the unmodified microorganism may refer to a strain in which the gluconate repressor protein activity described herein is not weakened or is not weakened compared to the intrinsic activity.
  • non-modified microorganism may be used interchangeably with “pre-transformed strain”, “pre-transformed microorganism”, “non-mutated strain”, “non-modified strain”, “non-mutated microorganism” or “reference microorganism”.
  • the unmodified microorganism may be a microorganism containing an amino acid sequence consisting of SEQ ID NO: 1 or a polynucleotide consisting of SEQ ID NO: 2.
  • the microorganism having the L-arginine production ability of the present application may be a genetically modified microorganism or a recombinant microorganism in which the activity of the gluconate repressor protein is weakened compared to the intrinsic activity and the L-arginine production ability is increased, but is limited thereto. It doesn't work.
  • the recombinant strain with increased L-arginine production ability may be a microorganism with increased L-arginine production ability compared to a natural wild-type microorganism or an unmodified microorganism with intrinsic activity of the gluconate repressor protein, but is limited thereto. That is not the case.
  • the strain with increased L-arginine production ability of the present application may be a microorganism with increased L-arginine production ability compared to a microorganism containing the polypeptide of SEQ ID NO: 1 or a polynucleotide encoding the same, but is not limited thereto.
  • the microorganism capable of producing L-arginine may be a microorganism that inherently contains a gluconate repressor protein.
  • the microorganism capable of producing L-arginine may be a microorganism that inherently contains a polynucleotide sequence capable of encoding the gluconate repressor protein.
  • the microorganism with increased L-arginine production ability is about 1% or more, specifically about 1% or more, compared to the L-arginine production ability of the parent strain before mutation or an unmodified microorganism with intrinsic activity of the gluconate repressor protein.
  • the recombinant strain with increased production capacity has an L-arginine production capacity of about 1.1 times or more, about 1.12 times or more, about 1.13 times or more, about 1.14 times or more, or about 1.15 times more than the parent strain or unmodified microorganism before mutation.
  • the upper limit is not particularly limited, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or more
  • the term “about” is a range that includes ⁇ 0.5, ⁇ 0.4, ⁇ 0.3, ⁇ 0.2, ⁇ 0.1, etc., and includes all values in a range that are equivalent or similar to the value that appears after the term “about.” Not limited.
  • microorganisms of the genus Corynebacterium may include all microorganisms of the genus Corynebacterium. Specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ( Corynebacterium deserti ), Corynebacterium efficiens , Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare , Corynebacterium halotolerans , Corynebacterium Corynebacterium striatum , Corynebacterium ammoniagenes, Corynebacterium pollutisoli , Corynebacterium imitans , Corynebacterium testudino It may be Corynebacterium testudinoris or Corynebacterium flavescens , and more specifically, it may be Corynebacterium glutamicum.
  • the microorganism of the Corynebacterium genus with L-arginine production ability of the present application has an improved L-arginine production ability by strengthening or weakening the activity of the natural wild type microorganism itself and the genes related to the L-arginine production mechanism. It includes all microorganisms of the genus Corynebacterium or microorganisms of the genus Corynebacterium that have improved L-arginine production ability by introducing or enhancing the activity of foreign genes.
  • gluconate repressor protein activity is a concept that includes both reduced activity or no activity compared to the intrinsic activity.
  • the gluconate repressor protein activity may be used interchangeably with terms such as polypeptide activity and protein activity.
  • the attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.
  • the weakening may be, but is not limited to, inactivation.
  • the weakening occurs when the gluconate protein activity is less than 100%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10% of the intrinsic activity. , may include all of 5% or less or 0%, but is not limited thereto.
  • the inactivation may mean that the expression of the gluconate repressor protein is not expressed at all compared to an unmodified microorganism, or even if expressed, its activity is absent or reduced.
  • the weakening occurs when the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, inhibition of expression of the gene of the polynucleotide encoding the polypeptide, or translation into a polypeptide.
  • the overall polypeptide activity level and/or concentration (expression amount) in the cell is lower than that of the natural strain due to (translation) inhibition, etc., when the polynucleotide is not expressed at all, and/or when the polynucleotide expression is low Even if there is no activity of the polypeptide, it may also be included.
  • the “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild type, or unmodified microorganism before the change in trait when the trait changes due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification.”
  • activity before modification The fact that the activity of a polypeptide is "inactivated, depleted, reduced, downregulated, reduced, or attenuated” compared to the intrinsic activity means that it is lowered compared to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before the transformation.
  • Attenuation of the activity of such a polypeptide may be performed by any method known in the art, but is not limited thereto, and may be achieved by applying various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
  • antisense oligonucleotide eg, antisense RNA
  • Deletion of part or all of the gene encoding the polypeptide may be removal of the entire polynucleotide encoding the target polypeptide endogenous in the chromosome, replacement with a polynucleotide with some nucleotides deleted, or replacement with a marker gene.
  • the above 2) modification of the expression control region is a mutation in the expression control region (or expression control sequence) caused by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or a weaker mutation. It may be replacement with an active sequence.
  • the expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates the termination of transcription and translation.
  • the modification of the amino acid sequence or polynucleotide sequence of 3) and 4) includes deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide.
  • a combination thereof may result in a mutation in the sequence, or a replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto.
  • gene expression can be inhibited or weakened by introducing a mutation in the polynucleotide sequence to form a stop codon, but is not limited thereto.
  • the base sequence modification encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a base encoding another start codon with a lower polypeptide expression rate compared to the internal start codon. It may be a substitution by sequence, but is not limited thereto.
  • antisense oligonucleotide e.g., antisense RNA
  • antisense RNA binds complementary to the transcript of the gene encoding the polypeptide
  • Weintraub, H. et al. Antisense-RNA as a molecular tool. for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
  • the microorganism of the Corynebacterium genus having the ability to produce L-arginine of the present application is a gluconate repressor whose amino acid sequence constituting the gluconate repressor protein is modified so that the activity of the gluconate repressor protein is removed or weakened. It may include a variant, a polynucleotide encoding the gluconate repressor variant, or a vector containing the polynucleotide, but is not limited thereto.
  • the gluconate repressor variant contains an amino acid corresponding to the 36th position, an amino acid corresponding to the 59th position, an amino acid corresponding to the 60th position, an amino acid corresponding to the 63rd position,
  • the gluconate repressor variant may be one in which one or more amino acids selected from the group consisting of the amino acid corresponding to the 79th position and the amino acid corresponding to the 92nd position are replaced with another amino acid, but is not limited thereto.
  • variant means that one or more amino acids are different from the amino acid sequence before the mutation due to conservative substitution and/or modification of the variant, but have functions or properties. This refers to the polypeptide that is maintained.
  • variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation.
  • variants may include variants in which one or more parts, such as the N-terminal leader sequence or transmembrane domain, have been removed.
  • variants may include variants with portions removed from the N- and/or C-terminus of the mature protein.
  • variant may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and mutant (English expressions include modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.). There is no limitation thereto if the term is used in a modified sense.
  • variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide.
  • a signal (or leader) sequence involved in protein translocation may be conjugated to the N-terminus of the variant, co-translationally or post-translationally.
  • the variants may also be conjugated with other sequences or linkers to enable identification, purification, or synthesis.
  • the “other amino acid” is not limited as long as it is an amino acid different from the amino acid before substitution. Meanwhile, in the present application, when it is expressed that 'a specific amino acid is substituted', it is obvious that it is substituted with an amino acid different from the amino acid before substitution, even if it is not separately indicated that it has been substituted with a different amino acid.
  • Amino acids can generally be classified based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic nature of the residues.
  • Examples of this classification include positively charged (basic) amino acids: arginine, lysine, and histidine; Negatively charged (acidic) amino acids include glutamic acid and aspartic acid; Amino acids with nonpolar side chains (nonpolar amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; Amino acids with polar or hydrophilic side chains (polar amino acids) can be classified into serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • amino acids with electrically charged side chains such as arginine, lysine, histidine, glutamic acid, and aspartic acid
  • amino acids with uncharged side chains also referred to as neutral amino acids
  • It can be classified into glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine and glutamine.
  • phenylalanine, tryptophan, and tyrosine can be classified as aromatic amino acids.
  • valine, leucine, and isoleucine can be classified as branched amino acids.
  • 20 types of amino acids are classified according to size, starting from the amino acid group with relatively small volume; glycine, alanine, serine; Cysteine, proline, threonine, aspartic acid, asparagine; Valine, histidine, glutamic acid, glutamine; Isoleucine, leucine, methionine, lysine, arginine; and phenylalanine, tryptophan, and tyrosine.
  • amino acid corresponding to the 36th position in SEQ ID NO: 1 has been replaced with another amino acid
  • asparagine excluding isoleucine which is the amino acid corresponding to the 36th position in SEQ ID NO: , phenylalanine, glycine, alanine, arginine, aspartate, cysteine, glutamate, leucine, glutamine, histidine ), proline, serine, tyrosine, lysine, tryptophan, valine, methionine, or threonine. It is not limited to this.
  • polypeptide or protein comprising an amino acid sequence described in a specific sequence number
  • polypeptide or protein composed of an amino acid sequence described in a specific sequence number or ‘polypeptide or protein having an amino acid sequence described in a specific sequence number’.
  • a protein with an amino acid sequence in which part of the sequence is deleted, modified, substituted, conservatively substituted, or added can also be used in the present application.
  • the amino acid sequence may have a sequence added to the N-terminus and/or C-terminus that does not change the function of the protein, a naturally occurring mutation, a silent mutation, or a conservative substitution. .
  • Porition N in the present application may include the N position and an amino acid position corresponding to the N position. Specifically, it may include an amino acid position corresponding to an arbitrary amino acid residue in a mature polypeptide disclosed in a specific amino acid sequence.
  • the specific amino acid sequence may be the amino acid sequence of SEQ ID NO: 1.
  • corresponding to refers to an amino acid residue at a recited position in a polypeptide, or to an amino acid residue that is similar, identical, or homologous to a recited residue in a polypeptide. Identifying the amino acid at the corresponding position may be determining the specific amino acid in the sequence that refers to the specific sequence.
  • corresponding region generally refers to a similar or corresponding position in a related or reference protein.
  • an arbitrary amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue in the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1.
  • sequence alignment algorithms such as those described in this application can identify the positions of amino acids or where modifications such as substitutions, insertions, or deletions occur compared to a query sequence (also referred to as a “reference sequence”).
  • Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277), etc. may be used, but are not limited thereto, and sequence alignment programs and pairwise sequence comparison algorithms known in the art may be appropriately used.
  • conservative substitution means replacing one amino acid with another amino acid having similar structural and/or chemical properties. These amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic nature of the residues.
  • positively charged (basic) amino acids include arginine, lysine, and histidine
  • Negatively charged (acidic) amino acids include glutamic acid and aspartate
  • Aromatic amino acids include phenylalanine, tryptophan, and tyrosine
  • hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan.
  • amino acids can be classified into amino acids with electrically charged side chains and amino acids with uncharged side chains.
  • Amino acids with electrically charged side chains include astratic acid, glutamic acid, and lysine.
  • Nonpolar amino acids include glycine, alanine, valine, leucine, and isoleucine. Methionine, phenylalanine. Tryptophan, proline, and polar amino acids can be classified to include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Typically, conservative substitutions have little or no effect on the activity of the resulting polypeptide. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences and can be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and may be used with a default gap penalty established by the program used. Substantially homologous or identical sequences are generally capable of hybridizing to all or part of a sequence under moderate or high stringent conditions. It is obvious that hybridization also includes hybridization with a polynucleotide containing a common codon or a codon taking codon degeneracy into account.
  • Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: It can be determined using a known computer algorithm such as the "FASTA” program using default parameters as in 2444. Or, as performed in the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol.
  • a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (i.e., nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing values 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: Weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • the variant has the following substitutions: substitution of the amino acid corresponding to the 36th position of the amino acid sequence of SEQ ID NO: 1 with asparagine, substitution of the amino acid corresponding to the 59th position with alanine, and substitution of the amino acid corresponding to the 60th position with leucine.
  • substitutions selected from the group consisting of substitution, substitution of the amino acid corresponding to the 63rd position with alanine, substitution of the amino acid corresponding to the 79th position with alanine, and substitution of the amino acid corresponding to the 92nd position with leucine. It may include, but is not limited to.
  • the variant provided in the present application may include substitution of the amino acid corresponding to position 36 from the N-terminus of SEQ ID NO: 1 with another amino acid.
  • the amino acid corresponding to position 36 from the N-terminus of SEQ ID NO: 1 in the variant is substituted with an amino acid selected from the polar amino acids serine, cysteine, tyrosine, asparagine, and glutamine. It may be.
  • the variant may be a variant in which the amino acid corresponding to position 36 from the N-terminus of SEQ ID NO: 1 is substituted with asparagine (N).
  • the variant provided in the present application may include substitution of the amino acid corresponding to position 59 from the N-terminus of SEQ ID NO: 1 with another amino acid.
  • the amino acid corresponding to position 59 from the N-terminus of SEQ ID NO: 1 in the variant may be substituted with a non-polar amino acid.
  • the amino acid may be an amino acid selected from glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline.
  • the variant may be a variant in which the amino acid corresponding to position 59 from the N-terminus of SEQ ID NO: 1 is substituted with alanine (A).
  • the variant provided in the present application may include substitution of the amino acid corresponding to position 60 from the N-terminus of SEQ ID NO: 1 with another amino acid.
  • the amino acid corresponding to position 60 from the N-terminus of SEQ ID NO: 1 in the variant may be substituted with a non-polar amino acid.
  • the amino acid may be an amino acid selected from glycine, alanine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline.
  • the variant may be a variant in which the amino acid corresponding to position 60 from the N-terminus of SEQ ID NO: 1 is substituted with leucine (L).
  • the variant provided in the present application may include substitution of the amino acid corresponding to position 63 from the N-terminus of SEQ ID NO: 1 with another amino acid.
  • the amino acid corresponding to position 63 from the N-terminus of SEQ ID NO: 1 in the variant may be substituted with a non-polar amino acid.
  • the amino acid may be an amino acid selected from glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline.
  • the variant may be a variant in which the amino acid corresponding to position 63 from the N-terminus of SEQ ID NO: 1 is substituted with alanine (A).
  • the variant provided in the present application may include substitution of the amino acid corresponding to position 79 from the N-terminus of SEQ ID NO: 1 with another amino acid.
  • the amino acid corresponding to position 79 from the N-terminus of SEQ ID NO: 1 in the variant may be substituted with a non-polar amino acid.
  • the amino acid may be an amino acid selected from glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline.
  • the variant may be a variant in which the amino acid corresponding to position 79 from the N-terminus of SEQ ID NO: 1 is substituted with alanine (A).
  • the variant provided in the present application may include substitution of the amino acid corresponding to position 92 from the N-terminus of SEQ ID NO: 1 with another amino acid.
  • the amino acid corresponding to position 92 from the N-terminus of SEQ ID NO: 1 in the variant may be substituted with a non-polar amino acid.
  • the amino acid may be an amino acid selected from glycine, alanine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline.
  • the variant may be a variant in which the amino acid corresponding to position 92 from the N-terminus of SEQ ID NO: 1 is substituted with leucine (L).
  • amino acid corresponding to the 36th position can identify the amino acid corresponding to the 36th position, the amino acid corresponding to the 59th position, and the amino acid corresponding to the 60th position of the amino acid sequence of SEQ ID NO: 1 of the present application in any amino acid sequence through sequence alignment known in the art.
  • amino acid corresponding to the 63rd position, the amino acid corresponding to the 79th position, and the amino acid corresponding to the 92nd position can be identified, and even if not separately described in the present application, the "amino acid at a specific position in the specific sequence number" is described. In this case, it is clear that the meaning includes the “amino acid at the corresponding position” in any amino acid sequence.
  • the variant of the present application is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% of the amino acid sequence shown in SEQ ID NO: 1.
  • amino acids corresponding to positions 36, 59, 60, 63, 79, and 92 from the N-terminus of SEQ ID NO: 1 It may include one or more amino acids selected from the group consisting of replaced with another amino acid.
  • the variant of the present application may have and/or include an amino acid sequence selected from the group consisting of the amino acid sequences shown in SEQ ID NO: 25 to SEQ ID NO: 31, or may essentially consist of the amino acid sequence.
  • Corynebacterium genus microorganism having the ability to produce L-arginine in the present application may have inactivated gluconate repressor protein activity, but is not limited thereto.
  • a method of deleting part or all of the gene encoding the protein can be used. Specifically, it can be performed by replacing the polynucleotide encoding the target protein endogenous in the chromosome with a polynucleotide or marker gene in which some nucleotide sequences have been deleted through a vector for insertion into a microorganism's chromosome.
  • a method for deleting part or all of a polynucleotide a method for deleting a polynucleotide by homologous recombination may be used, but is not limited thereto.
  • the method of deleting part or all of the gene can be performed by inducing a mutation using light such as ultraviolet rays or chemicals, and selecting a strain lacking the target gene from the obtained mutant.
  • the gene deletion method includes a method using genetic recombination technique. For example, this can be achieved by injecting a polynucleotide sequence or vector containing a polynucleotide sequence homologous to the target gene into the microorganism to cause homologous recombination. Additionally, the injected polynucleotide sequence or vector may include a dominant selection marker. However, it is not limited to this.
  • polynucleotide refers to a DNA or RNA strand of a certain length or more, which is a polymer of nucleotides in which nucleotide monomers are connected in a long chain by covalent bonds, and more specifically, encoding the variant. refers to a polynucleotide fragment.
  • the microorganism of the Corynebacterium genus having the ability to produce L-arginine of the present application is a gluconate repressor whose amino acid sequence constituting the gluconate repressor protein is modified so that the activity of the gluconate repressor protein is removed or weakened. It may include, but is not limited to, a polynucleotide encoding a variant.
  • the polynucleotide encoding the gluconate repressor variant may be included without limitation as long as it is a polynucleotide sequence encoding the gluconate repressor variant of the present application.
  • the polynucleotide encoding the gluconate repressor variant of the present application may be a polynucleotide sequence encoding the amino acid sequence of the variant of the present application, but is not limited thereto.
  • the polynucleotide encoding the gluconate repressor variant of the present application is a polynucleotide sequence selected from the group consisting of the polynucleotide sequences set forth in SEQ ID NO: 32 to SEQ ID NO: 38, or the polynucleotide sequence set forth in SEQ ID NO: 32 to SEQ ID NO: 38. At least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with a polynucleotide sequence selected from the group consisting of nucleotide sequences. It may be a polynucleotide sequence having a , but is not limited thereto. Nucleotide sequences with homology or identity may be sequences with less than 100% identity, or sequences with 100% identity among the above categories may be excluded.
  • the polynucleotide of the present application has various variations in the coding region within the range of not changing the amino acid sequence of the variant of the present application, taking into account codon degeneracy or preferred codons in organisms intended to express the variant of the present application. Transformations can occur. Therefore, it is clear that a polynucleotide that can be translated into a polypeptide consisting of the amino acid sequence of the variant of the present application or a polypeptide having homology or identity thereto due to codon degeneracy may also be included.
  • polynucleotide of the present application is without limitation any probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under strict conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. may be included.
  • stringent condition refers to conditions that enable specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • polynucleotides with high homology or identity 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, Or, conditions in which polynucleotides with 99% or more homology or identity hybridize with each other and polynucleotides with lower homology or identity do not hybridize with each other, or 60°C, which is the washing condition of normal southern hybridization, Washing once, specifically 2 to 3 times, at a salt concentration and temperature equivalent to 1 ⁇ SSC, 0.1% SDS, specifically 60°C, 0.1 ⁇ SSC, 0.1% SDS, more specifically 68°C, 0.1 ⁇ SSC, 0.1% SDS. Conditions can be listed.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases may be possible depending on the stringency of hybridization.
  • the term “complementary” is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments that are complementary to the entire sequence.
  • polynucleotides having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art depending on the purpose.
  • the appropriate stringency to hybridize the polynucleotide depends on the length of the polynucleotide and the degree of complementarity, variables that are well known in the art (e.g., J. Sambrook et al., supra).
  • the microorganism of the Corynebacterium genus having the ability to produce L-arginine of the present application may be a microorganism lacking a polynucleotide encoding a gluconate repressor protein, but is not limited thereto.
  • the microorganism of the Corynebacterium genus having the ability to produce L-arginine in the present application may be a microorganism lacking the nucleic acid sequence of SEQ ID NO: 2, but is not limited thereto.
  • the Corynebacterium genus microorganism having the ability to produce L-arginine of the present application includes an expression vector for expressing the gluconate repressor variant in the host, so that the gluconate repressor protein activity is weakened compared to the intrinsic activity.
  • an expression vector for expressing the gluconate repressor variant in the host so that the gluconate repressor protein activity is weakened compared to the intrinsic activity.
  • it is not limited to this.
  • the Corynebacterium genus microorganism having the L-arginine production ability of the present application may contain an expression vector for inactivating the gluconate repressor protein in the host cell, thereby inactivating the gluconate repressor protein activity.
  • an expression vector for inactivating the gluconate repressor protein in the host cell thereby inactivating the gluconate repressor protein activity.
  • the vector of the present application may include a DNA preparation containing the base sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable expression control region (or expression control sequence) to enable expression of the target polypeptide in a suitable host.
  • the expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating termination of transcription and translation.
  • the vector After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can be integrated into the genome itself.
  • the vector used in this application is not particularly limited, and any vector known in the art can be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors can be used.
  • pBluescriptII series pGEM series
  • pTZ series pCL series
  • pSK series pSKH series
  • pET series pET series
  • pDZ pDC, pDCM2, pACYC177, pACYC184, pCL, pSK, pSKH130, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc.
  • a polynucleotide encoding a target polypeptide can be inserted into a chromosome using a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • a selection marker may be additionally included to confirm whether the chromosome has been inserted. The selection marker is used to select cells transformed with a vector, that is, to confirm the insertion of the target nucleic acid molecule, and to display selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface polypeptides. Markers that provide may be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or show other expression traits, so transformed cells can be selected.
  • the term “transformation” refers to introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoding the polynucleotide can be expressed within the host cell.
  • the transformed polynucleotide can include both of these, regardless of whether it is inserted into the chromosome of the host cell or located outside the chromosome.
  • the polynucleotide includes DNA and/or RNA encoding the polypeptide of interest.
  • the polynucleotide can be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a genetic structure containing all elements necessary for self-expression.
  • the expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal that are operably linked to the polynucleotide.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into the host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target variant of the present application.
  • Modification of part or all of the polynucleotide in the microorganism of the present application is (a) homologous recombination using a vector for chromosome insertion into the microorganism or genome editing using engineered nuclease (e.g., CRISPR-Cas9) and/or (b) It may be induced by, but is not limited to, light and/or chemical treatment, such as ultraviolet rays and radiation.
  • the method of modifying part or all of the gene may include a method using DNA recombination technology.
  • a nucleotide sequence or vector containing a nucleotide sequence homologous to the gene of interest is injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene.
  • the injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.
  • Another aspect of the present application provides a method for producing L-arginine comprising culturing the Corynebacterium genus microorganism of the present application in a medium.
  • any culture conditions and culture methods known in the art can be used to culture microorganisms.
  • This culture process can be easily adjusted and used by those skilled in the art according to the selected strain.
  • the term “culture” means growing the microorganism of this application under appropriately controlled environmental conditions.
  • the culture process of the present application can be carried out according to appropriate media and culture conditions known in the art. This culture process can be easily adjusted and used by a person skilled in the art depending on the strain selected. Specifically, the culture may be batch, continuous, or fed-batch, but is not limited thereto.
  • the term "medium” refers to a material that is mainly mixed with nutrients necessary for cultivating the microorganisms of this application, and supplies nutrients and growth factors, including water, which are essential for survival and development.
  • the medium and other culture conditions used for cultivating the microorganisms of the present application can be any medium used for cultivating ordinary microorganisms without particular restrictions, but the microorganisms of the present application can be grown with an appropriate carbon source, nitrogen source, personnel, and inorganic substances. It can be cultured under aerobic conditions in a typical medium containing compounds, amino acids, and/or vitamins, while controlling temperature, pH, etc.
  • the carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; Sugar alcohols such as mannitol, sorbitol, etc., organic acids such as pyruvic acid, lactic acid, citric acid, etc.; Amino acids such as glutamic acid, methionine, lysine, etc. may be included.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice bran, cassava, bagasse and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e. converted to reducing sugars).
  • Carbohydrates such as molasses
  • various other carbon sources in an appropriate amount can be used without limitation. These carbon sources may be used alone or in combination of two or more types, but are not limited thereto.
  • the nitrogen source includes inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. can be used These nitrogen sources may be used individually or in combination of two or more types, but are not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, peptone, NZ-amine, meat extract, yeast extract,
  • the agent may include monopotassium phosphate, dipotassium phosphate, or a corresponding sodium-containing salt.
  • Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, and calcium carbonate, and may also include amino acids, vitamins, and/or appropriate precursors. These components or precursors can be added to the medium batchwise or continuously. However, it is not limited to this.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be added to the culture in an appropriate manner to adjust the pH of the culture. Additionally, during culturing, foam generation can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester.
  • an antifoaming agent such as fatty acid polyglycol ester.
  • oxygen or oxygen-containing gas can be injected into the culture, or to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas can be injected without gas injection, but is limited to this. It doesn't work.
  • the temperature of the culture may be 25°C to 40°C, and more specifically, 28°C to 37°C, but is not limited thereto.
  • the culturing period may continue until the desired amount of useful substance is obtained, and may specifically be from 1 hour to 100 hours, but is not limited thereto.
  • L-arginine produced by the culture of the present application may be secreted into the medium or remain within the cells.
  • the L-arginine production method of the present application includes preparing a microorganism of the Corynebacterium genus of the present application, preparing a medium for culturing the Corynebacterium genus microorganism, or a combination thereof (regardless of the order, in any order) may be additionally included, for example, before the culturing step.
  • the method for producing L-arginine of the present application may further include the step of recovering L-arginine from the culture medium (medium in which the culture was performed) or microorganisms.
  • the recovering step may be additionally included after the culturing step.
  • the recovery may be to collect the desired L-arginine using a suitable method known in the art according to the microorganism culture method of the present application, such as a batch, continuous, or fed-batch culture method. .
  • a suitable method known in the art such as a batch, continuous, or fed-batch culture method.
  • Various chromatography such as chromatography, HPLC, or a combination of these methods can be used, and the desired L-arginine can be recovered from the medium or microorganism using a suitable method known in the art.
  • the L-arginine production method of the present application may additionally include a purification step.
  • the purification can be performed using a suitable method known in the art.
  • the recovery step and the purification step are performed sequentially or discontinuously, simultaneously or integrated into one step, regardless of the order. may be performed, but is not limited thereto.
  • Another aspect of the present application provides a composition for producing L-arginine containing the Corynebacterium genus microorganism.
  • compositions of the present application may further comprise any suitable excipients commonly used in compositions for L-arginine production, such as preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents. It may be, but is not limited to this.
  • Another aspect of the present application is to provide a use of the Corynebacterium genus microorganism for producing L-arginine.
  • Example 1 Construction of vector for attenuating gluconate repressor activity
  • gntR1(I36N), gntR1(R59A), gntR1(T60L), gntR1(R63A), gntR1(R79A), and gntR1(A92L) variants represented by SEQ ID NO: 25 to SEQ ID NO: 31, respectively. was attempted to be inserted into Corynebacterium glutamicum KCCM10741P strain. Accordingly, a vector containing a target mutation to weaken gluconate repressor activity was constructed.
  • primer pairs in Table 1 SEQ ID NOs: 3 and 5, SEQ ID NOs: 4 and 6, SEQ ID NOs: 3 and 7, SEQ ID NOs: 4 and 8, SEQ ID NOs: 3 and 9, SEQ ID NO: 4 and 10, SEQ ID NO: 3 and 11, SEQ ID NO: 4 and 12, SEQ ID NO: 3 and 13, SEQ ID NO: 4 and 14, SEQ ID NO: 3 and 15, SEQ ID NO: 4 and 16
  • Overlapping PCR using primer pairs 3 and 4 was performed to produce homologous recombinant fragments (hereinafter referred to as "mutation introduction fragment 1" to “Mutation introduction fragment 6”) was obtained.
  • the PCR reaction was performed at 95°C, denaturation for 30 seconds; 55°C, 30 s annealing; and 72°C, 1 minute elongation procedure was repeated 30 times.
  • the pDCM2 (Korea Publication No. 10-2020-0136813) vector, which cannot replicate in Corynebacterium glutamicum, and the fragment amplified by PCR were treated with restriction enzymes BamHI and XbaI for chromosome introduction, and then DNA After ligating using a conjugation enzyme to prepare a plasmid with each mutant introduction fragment inserted, it was transformed into E. coli DH5 ⁇ and plated on LB solid medium containing kanamycin (25 mg/l).
  • DNA was obtained using a DNA-spin plasmid DNA purification kit (iNtRON), and the vector containing the mutation introduction fragment 1 to mutation introduction fragment 6, respectively (recombinant Plasmids) pDCM2-gntR1(I36N), pDCM2-gntR1(R59A), pDCM2-gntR1(T60L), pDCM2-gntR1(R63A), pDCM2-gntR1(R79A), and pDCM2-gntR1(A92L) were prepared.
  • iNtRON DNA-spin plasmid DNA purification kit
  • Example 2 Production of strain with weakened gluconate repressor activity based on KCCM10741P strain and evaluation of L-arginine production ability
  • Recombinant plasmids (pDCM2-gntR1(I36N), pDCM2-gntR1) prepared in Example 1 to weaken the gluconate repressor protein activity of Corynebacterium glutamicum KCCM10741P (US 8034602 B2), an L-arginine producing strain. (R59A), pDCM2-gntR1(T60L), pDCM2-gntR1(R63A), pDCM2-gntR1(R79A), and pDCM2-gntR1(A92L)), respectively (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).
  • the above transformants were KCCM10741P-gntR1(I36N), KCCM10741P-gntR1(R59A), KCCM10741P-gntR1(T60L), KCCM10741P-gntR1(R63A), KCCM10741P-gntR1(R79A), and KCCM10741P-g, respectively. It was named ntR1(A92L). .
  • the parent strain, Corynebacterium glutamicum KCCM10741P, and the transformant produced in Example 1-2 were placed in a 250 ml corner-baffle flask containing 25 ml of the following seed medium. ) were inoculated and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 30°C for 72 hours with shaking at 200 rpm.
  • the compositions of the seed medium and production medium are as follows.
  • Dextrose 20g ammonium sulfate 45g, magnesium sulfate heptahydrate 2g, potassium phosphate monobasic 2g, ammonium chloride 10g, biotin 0.01mg, thiamine-HCl 0.1mg, calcium pantothenate 2mg, nicotinamide 3mg, ferrous sulfate 10mg, manganese sulfate 10mg , zinc sulfate 0.02mg, copper sulfate 0.5mg (based on 1 liter of distilled water)
  • the transformants strains with weakened gluconate repressor protein activity, KCCM10741P-gntR1(I36N), KCCM10741P-gntR1(R59A), KCCM10741P-gntR1(T60L), KCCM10741P-gntR1(R63A), KCCM10741P-gntR1 ( In both R79A) and KCCM10741P-gntR1(A92L)), it was confirmed that the L-arginine production capacity increased by about 17% on average compared to the parent strain.
  • Example 3 Construction of strain with weakened gluconate repressor protein activity based on CJ1R strain and evaluation of L-arginine production ability
  • a homologous recombinant fragment containing the argR deletion mutant sequence was obtained.
  • the PCR reaction was performed at 95°C, denaturation for 30 seconds; 55°C, 30 s annealing; and 72°C, 1 minute elongation procedure was repeated 30 times.
  • the constructed vector (recombinant plasmid) was named pDCM2- ⁇ argR.
  • DNA sequence 5’-3’
  • SEQ ID NO: 17 argR-AF tcggtacccggggatccAGCAGGCCTTTAAGGGTAAG
  • SEQ ID NO: 18 argR-AR AGGGGCCTGTCTTACCTCGGCTGGTGGGCCAGC
  • SEQ ID NO: 19 argR-BF GGTAAGACAGCGCCCCTAGTTCAAGGCTTGTTAATC
  • Corynebacterium glutamicum wild strain (ATCC13869) was transformed with the constructed pDCM2- ⁇ argR (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999), followed by 4 Secondary recombination was performed on a solid plate medium containing % sucrose, and the strain with argR deleted on the chromosome was identified through PCR using a pair of primers (SEQ ID NOs: 19 and 22) for the transformant for which secondary recombination was completed. did. At this time, the PCR reaction was performed at 95°C, denaturation for 30 seconds; 55°C, 30 s annealing; and 72°C, 1 minute elongation procedure was repeated 30 times. The transformant was named CJ1R.
  • Example 3-2 Creation of strain with weakened gluconate repressor activity based on CJ1R strain
  • mutant strains into which the vectors constructed in Example 1 were introduced were prepared in the same manner as Example 2-1, and the mutant strains were CJ1R-gntR1(I36N), They were named CJ1R-gntR1(R59A), CJ1R-gntR1(T60L), CJ1R-gntR1(R63A), CJ1R-gntR1(R79A), and CJ1R-gntR1(A92L).
  • Corynebacterium glutamicum CJ1R an L-arginine producing strain, mutant strains prepared in Example 3-2 (strains with weakened gluconate repressor protein activity, CJ1R-gntR1(I36N), CJ1R-gntR1(R59A),
  • culture medium was cultured in the same manner as in Example 2-2. The concentration of L-arginine was analyzed.
  • the mutant strains strains with weakened gluconate repressor protein activity, CJ1R-gntR1(I36N), CJ1R-gntR1(R59A), CJ1R-gntR1(T60L), CJ1R-gntR1(R63A), CJ1R-gntR1(R79A) ), CJ1R-gntR1(A92L)
  • the L-arginine production capacity increased by about 19% on average compared to the parent strain.
  • a recombinant vector for deletion of the gene gntR1 was constructed in the same manner as Example 3-1, and the primers used to construct the vector are shown in Table 5 below. Specifically, PCR using the primer pairs of Table 5 (SEQ ID NOs: 21 and 22, SEQ ID NOS: 23 and 24) using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, and over PCR using the primer pairs of SEQ ID NOS: 21 and 24. By performing overlapping PCR, a homologous recombinant fragment containing the argR deletion mutant sequence was obtained. At this time, the PCR reaction was performed at 95°C, denaturation for 30 seconds; 55°C, 30 s annealing; and 72°C, 1 minute elongation procedure was repeated 30 times.
  • the constructed vector (recombinant plasmid) was named pDCM2- ⁇ gntR1.
  • DNA sequence 5’-3’
  • SEQ ID NO: 21 gntR1 del-AF tcggtacccggggatccTTGACCGTGACTACACC
  • SEQ ID NO: 22 gntR1 del-AR GTATCACGGGTGCCTCTTTAATGGGCCGGTGTAC
  • SEQ ID NO: 23 gntR1 del-BF AGAGGCACCCGTGATACGCGCACTGCGTTTGCCA
  • SEQ ID NO: 24 gntR1 del-BR tgcaggtcgactctagaGGCTTCGTCAATTACCG
  • the prepared pDCM2- ⁇ gntR1 was transformed into Corynebacterium glutamicum strains KCCM10741P and CJ1R strains capable of producing L-arginine (van der Rest et al., Appl Microbiol Biotechnol 52:541- 545, 1999), then secondary recombination was performed on a solid plate medium containing 4% sucrose, and the transformant for which secondary recombination was completed was subjected to PCR using a pair of primers (SEQ ID NOs: 21 and 24). A strain lacking gntR1 was confirmed in the above.
  • the transformants were named KCCM10741P- ⁇ gntR1 and CJ1R- ⁇ gntR1, respectively.
  • Example 4-1 To compare the L-arginine production ability of the L-arginine producing strains Corynebacterium glutamicum KCCM10741P, CJ1R and the gntR1 deletion strain (KCCM10741P- ⁇ gntR1, CJ1R- ⁇ gntR1) produced in Example 4-1. Culture was performed in the same manner as in Example 2-2, and the concentration of L-arginine in the culture medium was analyzed.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 글루코네이트 리프레서 단백질 활성이 약화된 미생물; 본 출원의 미생물을 이용한 L-아르기닌의 생산방법; 본 출원의 미생물을 포함하는 L-아르기닌 생산용 조성물; 및 본 출원의 미생물의 L-아르기닌 생산 용도에 관한 것이다.

Description

글루코네이트 리프레서 단백질 활성이 약화된 미생물 및 이를 이용한 L-아르기닌 생산 방법
본 출원은 글루코네이트 리프레서 단백질 활성이 약화된 미생물; 본 출원의 미생물을 이용한 L-아르기닌의 생산방법; 본 출원의 미생물을 포함하는 L-아르기닌 생산용 조성물; 및 본 출원의 미생물의 L-아르기닌 생산 용도에 관한 것이다.
L-아르기닌(L-arginine)은 간기능 촉진제, 뇌기능 촉진제, 종합 아미노산 제제 등의 의약용으로 사용되고 있으며, 생선묵 첨가제, 건강음료 첨가제, 고혈압 환자의 식염 대체용 등의 식품용으로도 최근 각광받고 있는 물질이다. 산업적으로 이용 가능한 고농도의 아르기닌을 생산하기 위하여 미생물을 이용하려는 연구가 지속적으로 이루어지고 있다.
한편, 코리네박테리움 속 미생물, 특히 코리네박테리움 글루타미쿰은 L-아미노산 생산에 많이 이용되고 있는 그람 양성의 미생물이다. L-아르기닌의 생산을 위해 코리네박테리움 속 균주에서 주로 L-아르기닌 생합성에 관여하는 효소를 암호화하는 유전자의 발현을 증가시키거나 또는 L-아르기닌의 생합성에 불필요한 유전자를 제거하는 것과 같은 목적 물질 특이적인 접근 방법이 주로 이용되고 있다(한국 등록특허공보 제10-1102263호).
그러나, 여전히 효율적으로 고수율로 L-아르기닌을 생산할 수 있는 방법에 대한 연구의 필요성이 대두되고 있다.
본 발명자들은 글루코네이트 리프레서 단백질 활성이 약화된, 코리네박테리움 속 미생물, 상기 미생물을 이용한 L-아르기닌의 생산방법, 상기 미생물을 포함하는 L-아르기닌 생산용 조성물 및 상기 미생물의 L-아르기닌 생산 용도를 개발하여 본 출원을 완성하였다.
본 출원의 하나의 목적은 글루코네이트 리프레서 단백질 활성이 약화된, 코리네박테리움 속 미생물을 제공하는 것이다.
본 출원의 다른 하나의 목적은 본 출원의 코리네박테리움 속 미생물을 배지에서 배양하는 단계를 포함하는 L-아르기닌의 생산 방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 본 출원의 코리네박테리움 속 미생물을 포함하는 L-아르기닌 생산용 조성물을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 본 출원의 코리네박테리움 속 미생물의 L-아르기닌 생산 용도를 제공하는 것이다.
본 출원의 글루코네이트 리프레서 단백질 활성이 약화된 코리네박테리움 속 미생물은 글루코네이트 리프레서 단백질 활성이 약화되지 않은 코리네박테리움 속 미생물에 비하여 L-아르기닌을 고효율로 생산할 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 출원이 속하는 기술 분야의 수준 및 본 출원의 내용이 보다 명확하게 설명된다.
본 출원의 하나의 양태는 글루코네이트 리프레서 단백질 활성이 약화된 코리네박테리움 속 미생물을 제공한다.
본 출원의 코리네박테리움 속 미생물은 L-아르기닌 생산능을 가지는 것일 수 있다. 또한, 본 출원의 코리네박테리움 속 미생물은 글루코네이트 리프레서 단백질 활성이 약화되지 않은 코리네박테리움 속 미생물에 비해 L-아르기닌 생산능이 증가된 것일 수 있다.
본 출원에서, 용어 　"글루코네이트 리프레서(Gluconate repressor, GntR) 단백질"은 글루코네이트 대사 또는 당 유입 등에 관여하는 조절 단백질을 의미한다.
구체적으로, 상기 글루코네이트 리프레서 단백질은 당업계에 공지되어 있으며, 상기 글루코네이트 리프레서 단백질의 단백질 및 유전자 서열은 공지의 데이터베이스에서 얻을 수 있으며, 그 예로 NCBI의 GenBank 등이 있으나, 이에 제한되는 것은 아니다. 더욱 구체적으로, 상기 글루코네이트 리프레서 단백질은 글루코네이트 리프레서 단백질은 서열번호 1의 아미노산 서열로 이루어진 단백질일 수 있다. 또한, 본 출원의 글루코네이트 리프레서 단백질은 서열번호 1로 기재된 아미노산 서열을 가지거나 및/또는 포함하거나, 상기 아미노산 서열로 필수적으로 이루어질(essentially consisting of) 수 있다.
또한, 본 출원의 글루코네이트 리프레서 단백질은 상기 서열번호 1로 기재한 아미노산 서열뿐만 아니라, 서열번호 1과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 글루코네이트 리프레서 단백질과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 경우도 역시 본 출원의 범위 내에 포함됨은 자명하다.
또한, 상기 서열번호 1의 아미노산 서열을 갖는 글루코네이트 리프레서 단백질은 서열번호 2의 염기서열 또는 서열번호 2의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열을 가지거나 포함하거나, 또는 서열번호 2의 염기서열 또는 서열번호 2의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열로 이루어지거나 필수적으로 이루어질 수 있는 폴리뉴클레오티드에 의해 코딩되는 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "L-아르기닌"(L-Arginine)"은 모든 생물체에 존재하는 조건부 필수 아미노산으로서, C6H14N4O2의 화학식을 갖는 L-아미노산을 의미한다.　L-아르기닌은 미생물 중에서도 주로 코리네박테리움(Corynebacterium) 속 미생물에 의해 생산되는 것으로 알려져 있으나, 이들은 세포 내 아르기닌에 의해서 피드백 저해(feedback inhibition)를 받는 것으로 알려져 있어(Vehary Sakanyan, et al, Microbiology, 142:9-108, 1996), 고수율의　L-아르기닌을 생산하는 데에는 한계가 있는 것으로 알려져 있다.
본 출원에서 용어, "미생물(또는, 균주)"은 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 폴리펩티드, 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
본 출원에서 용어, "L-아르기닌 생산능을 가지는 코리네박테리움 속 미생물"은　L-아르기닌을 생물체 내에서 생산할 수 있는 코리네박테리움 속 미생물 균주로서,　L-아르기닌　생산능이 없는 모균주에　L-아르기닌의 생산능이 부여된 미생물, 또는 내재적으로　L-아르기닌　생산능을 갖는 미생물을 포함한다.　L-아르기닌　생산 능력은 종 개량에 의해 부여되거나 증진될 수 있다.
본 출원에서 용어, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 본 명세서에 기재된 글루코네이트 리프레서 단백질 활성이 내재적 활성에 비해 약화되지 않거나 약화되기 전의 균주를 의미할 수 있다. 상기 "비변형 미생물"은 “변형 전 균주”, “변형 전 미생물”, “비변이 균주”, “비변형 균주”, “비변이 미생물” 또는 “기준 미생물”과 혼용될 수 있다.
상기 비변형 미생물은 서열번호 1로 이루어진 아미노산 서열 또는 서열번호 2로 이루어진 폴리뉴클레오티드를 포함하는 미생물일 수 있다.
본 출원의 L-아르기닌 생산능을 가지는 미생물은 상기 글루코네이트 리프레서 단백질의 활성이 내재적 활성에 비해 약화되어, L-아르기닌 생산능이 증가된, 유전적으로 변형된 미생물 또는 재조합 미생물일 수 있으나, 이에 제한되지 않는다. 구체적으로, 상기 L-아르기닌 생산능이 증가된 재조합 균주는, 천연의 야생형 미생물 또는 글루코네이트 리프레서 단백질의 내재적 활성을 가지는 비변형 미생물에 비하여 L-아르기닌 생산능이 증가된 미생물일 수 있으나, 이에 제한되는 것은 아니다. 일 예로, 본 출원의 L-아르기닌 생산능이 증가된 균주는 서열번호 1의 폴리펩티드 또는 이를 코딩하는 폴리뉴클레오티드를 포함하는 미생물과 비교하여 L-아르기닌 생산능이 증가된 미생물일 수 있으나, 이에 제한되지 않는다.
예를 들어, 상기 L-아르기닌을 생산능을 가지는 미생물은 글루코네이트 리프레서 단백질을 내재적으로 포함하는 미생물일 수 있다.
예를 들어, 상기 L-아르기닌을 생산능을 가지는 미생물은 상기 글루코네이트 리프레서 단백질을 암호화할 수 있는 폴리뉴클레오티드 서열을 내재적으로 포함하는 미생물일 수 있다.
일 예로, 상기 L-아르기닌 생산능이 증가된 미생물은 변이 전 모균주 또는 글루코네이트 리프레서 단백질의 내재적 활성을 가지는 비변형 미생물의 L-아르기닌 생산능에 비하여 약 1% 이상, 구체적으로는 약 1% 이상, 약 2.5% 이상, 약 5% 이상, 약 6% 이상, 약 7% 이상, 약 8% 이상, 약 9% 이상, 약 10% 이상, 약 10.5% 이상, 약 11% 이상, 약 11.5%이상, 약 12% 이상, 약 12.5% 이상, 약 13% 이상, 약 13.5% 이상, 약 14% 이상, 약 14.5% 이상, 약 15% 이상, 약 15.5% 이상, 약 16% 이상, 약 16.5% 이상, 약 17% 이상, 약 17.5% 이상, 약 18% 이상, 약 18.5% 이상, 또는 약 19% 이상 (상한값은 특별한 제한은 없으며, 예컨대, 약 200% 이하, 약 150% 이하, 약 100% 이하, 약 50% 이하, 약 45% 이하, 약 40% 이하, 약 35% 이하, 약 30% 이하 또는 약 25% 이하일 수 있음) 증가된 것일 수 있으나, 변이 전 모균주 또는 비변형 미생물의 생산능에 비해 +값의 증가량을 갖는 한, 이에 제한되지 않는다. 다른 예에서, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물에 비하여, L-아르기닌 생산능이 약 1.1배 이상, 약 1.12배 이상, 약 1.13배 이상, 약 1.14배 이상, 약 1.15배 이상, 약 1.16배 이상, 약 1.17배 이상, 약 1.18배 이상, 또는 약 1.19배 이상 (상한값은 특별한 제한은 없으며, 예컨대, 약 10배 이하, 약 5배 이하, 약 3배 이하, 약 2배 이하, 약 1.5배 이하 또는 약 1.3배 이하일 수 있음) 증가된 것일 수 있으나, 이에 제한되지 않는다. 상기 용어 “약(about)”은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
본 출원에서 "코리네박테리움 속 미생물"은 모든 코리네박테리움 속 미생물을 포함할 수 있다. 구체적으로, 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있고, 더욱 구체적으로 코리네박테리움 글루타미쿰일 수 있다.
한편, 코리네박테리움 속 미생물이 L-아르기닌을 생산할 수 있음은 이미 알려져 있었으나, 이의 생산능이 현저히 낮으며 생산 기작에 작용하는 유전자나 기작 원리가 모두 밝혀지지는 않은 상태이다. 따라서, 본 출원의 L-아르기닌 생산능을 가지는 코리네박테리움 속 미생물은 천연의 야생형 미생물 자체, L-아르기닌 생산 기작과 관련된 유전자의 활성을 강화시키거나 약화시켜 향상된 L-아르기닌 생산능을 가지게 된 코리네박테리움 속 미생물, 또는 외부 유전자의 활성을 도입 또는 강화시켜 향상된 L-아르기닌 생산능을 가지게 된 코리네박테리움 속 미생물을 모두 포함한다.
본 출원에서 용어, 글루코네이트 리프레서 단백질 활성의 "약화"는 내재적 활성에 비하여 활성이 감소되거나 또는 활성이 없는 것을 모두 포함하는 개념이다. 상기 글루코네이트 리프레서 단백질 활성은 폴리펩티드 활성, 단백질 활성 등의 용어와 혼용될 수 있다. 상기 약화는 불활성화(inactivation), 결핍(deficiency), 하향조절(down-regulation), 감소(decrease), 저하(reduce), 감쇠(attenuation) 등의 용어와 혼용될 수 있다.
상기 약화는 불활성화일 수 있으나, 이에 제한되는 것은 아니다. 상기 약화는 글루코네이트 단백질 활성이 내재적 활성의 100% 미만, 90% 이하, 80% 이하, 70% 이하, 60% 이하, 50% 이하, 40% 이하, 30% 이하, 20% 이하, 10% 이하, 5% 이하이거나 또는 0%인 것을 모두 포함할 수 있으나, 이에 제한되는 것은 아니다.
상기 불활성화는 글루코네이트 리프레서 단백질의 발현이 비변형 미생물에 비하여 전혀 발현이 되지 않거나 또는 발현이 되더라도 그 활성이 없거나 감소된 것을 의미할 수 있다.
상기 약화는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드의 변이 등으로 폴리펩티드 자체의 활성이 본래 미생물이 가지고 있는 폴리펩티드의 활성에 비해 감소 또는 제거된 경우, 이를 코딩하는 폴리뉴클레오티드의 유전자의 발현 저해 또는 폴리펩티드로의 번역(translation) 저해 등으로 세포 내에서 전체적인 폴리펩티드 활성 정도 및/또는 농도(발현량)가 천연형 균주에 비하여 낮은 경우, 상기 폴리뉴클레오티드의 발현이 전혀 이루어지지 않은 경우, 및/또는 폴리뉴클레오티드의 발현이 되더라도 폴리펩티드의 활성이 없는 경우 역시 포함할 수 있다.
상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주, 야생형 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "불활성화, 결핍, 감소, 하향조절, 저하, 감쇠"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성에 비하여 낮아진 것을 의미한다.
이러한 폴리펩티드의 활성의 약화는, 당업계에 알려진 임의의 방법에 의하여 수행될 수 있으나 이로 제한되는 것은 아니며, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다(예컨대, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드 활성의 약화는
1) 폴리펩티드를 코딩하는 유전자 전체 또는 일부의 결손;
2) 폴리펩티드를 코딩하는 유전자의 발현이 감소하도록 발현조절영역(또는 발현조절서열)의 변형;
3) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 구성하는 아미노산 서열의 변형(예컨대, 아미노산 서열 상의 1 이상의 아미노산의 삭제/치환/부가);
4) 폴리펩티드의 활성이 제거 또는 약화되도록 상기 폴리펩티드를 코딩하는 유전자 서열의 변형 (예를 들어, 폴리펩티드의 활성이 제거 또는 약화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 핵산염기 서열 상의 1 이상의 핵산염기의 삭제/치환/부가);
5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입;
7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가;
8) 폴리펩티드를 코딩하는 유전자 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE); 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
예컨대,
상기 1) 폴리펩티드를 코딩하는 상기 유전자 일부 또는 전체의 결손은, 염색체 내 내재적 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드 전체의 제거, 일부 뉴클레오티드가 결실된 폴리뉴클레오티드로의 교체 또는 마커 유전자로 교체일 수 있다.
또한, 상기 2) 발현조절영역(또는 발현조절서열)의 변형은, 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절영역(또는 발현조절서열) 상의 변이 발생, 또는 더욱 약한 활성을 갖는 서열로의 교체일 수 있다. 상기 발현조절영역에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 3) 및 4)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은 폴리펩티드의 활성을 약화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 약한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 없도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 예를 들면, 폴리뉴클레오티드 서열 내 변이를 도입하여 종결 코돈을 형성시킴으로써, 유전자의 발현을 저해하거나 약화시킬 수 있으나, 이에 제한되지 않는다.
또한, 상기 5) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 낮은 다른 개시코돈을 코딩하는 염기서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 6) 폴리펩티드를 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입은 예를 들어 문헌 [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986]을 참고할 수 있다.
상기 7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 폴리펩티드를 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가는 mRNA 번역을 불가능하게 하거나 속도를 저하시키는 것일 수 있다.
상기 8) 폴리펩티드를 코딩하는 유전자서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE)는 상기 폴리펩티드를 코딩하는 유전자의 전사체에 상보적인 안티센스 뉴클레오티드를 만들어 활성을 약화하는 것일 수 있다.
구체적으로, 본 출원의 L-아르기닌 생산능을 가지는 코리네박테리움 속 미생물은 글루코네이트 리프레서 단백질의 활성이 제거 또는 약화되도록 상기 글루코네이트 리프레서 단백질을 구성하는 아미노산 서열의 변형된 글루코네이트 리프레서　변이체, 상기 글루코네이트 리프레서 변이체를 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 벡터를 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
더욱 구체적으로, 상기 글루코네이트 리프레서　변이체는 서열번호 1의 아미노산 서열의 36번째 위치에 상응하는 아미노산, 59번째 위치에 상응하는 아미노산, 60번째 위치에 상응하는 아미노산, 63번째 위치에 상응하는 아미노산, 79번째 위치에 상응하는 아미노산 및 92번째 위치에 상응하는 아미노산으로 이루어진 군으로부터 선택된 하나 이상의 아미노산이 다른 아미노산으로 치환된 글루코네이트 리프레서 변이체일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "변이체(variant)"는 하나 이상의 아미노산이 보존적 치환(conservative substitution) 및/또는 변형(modification)되어 상기 변이체의 변이 전 아미노산 서열과 상이하나 기능(functions) 또는 특성(properties)이 유지되는 폴리펩티드를 지칭한다. 이러한 변이체는 일반적으로 상기 폴리펩티드의 아미노산 서열 중 하나 이상의 아미노산을 변형하고, 상기 변형된 폴리펩티드의 특성을 평가하여 동정(identify)될 수 있다. 즉, 변이체의 능력은 변이 전 폴리펩티드에 비하여 증가되거나, 변하지 않거나, 또는 감소될 수 있다. 또한, 일부 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변이체를 포함할 수 있다. 다른 변이체는 성숙 단백질(mature protein)의 N- 및/또는 C-말단으로부터 일부분이 제거된 변이체를 포함할 수 있다. 상기 용어 "변이체"는 변이형, 변형, 변이형 폴리펩티드, 변이된 단백질, 변이 및 변이체 등의 용어(영문 표현으로는 modification, modified polypeptide, modified protein, mutant, mutein, divergent 등)가 혼용되어 사용될 수 있으며, 변이된 의미로 사용되는 용어라면 이에 제한되지 않는다.
또한, 변이체는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실 또는 부가를 포함할 수 있다. 예를 들면 변이체의 N-말단에는 번역-동시에(co-translationally) 또는 번역-후에(post-translationally) 단백질의 이동(translocation)에 관여하는 시그널(또는 리더) 서열이 컨쥬게이트 될 수 있다. 또한 상기 변이체는 확인, 정제, 또는 합성할 수 있도록 다른 서열 또는 링커와 컨쥬게이트 될 수 있다.
상기 "다른 아미노산"은 치환 전의 아미노산과 다른 아미노산이면 제한되지 않는다. 한편, 본 출원에서 '특정 아미노산이 치환되었다'고 표현하는 경우, 다른 아미노산으로 치환되었다고 별도로 표기하지 않더라도 치환 전의 아미노산과 다른 아미노산으로 치환되는 것임은 자명하다.
아미노산은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 분류할 수 있다.
이러한 분류의 예로, 양으로 하전된(염기성) 아미노산은 아르기닌, 리신, 및 히스티딘; 음으로 하전된(산성) 아미노산은 글루탐산 및 아스파르트산; 비극성 곁사슬(nonpolar side chain)을 갖는 아미노산(비극성 아미노산)은 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판 및 프롤린; 극성(polar) 또는 친수성(hydrophilic) 곁사슬을 갖는 아미노산(극성 아미노산)은 세린, 쓰레오닌, 시스테인, 타이로신, 아스파라긴 및 글루타민이 속하는 것으로 분류할 수 있다. 다른 일 예로, 전하를 띠는 곁사슬을 가지는 아미노산인(electrically charged amino acid) 아르기닌, 리신, 히스티딘, 글루탐산, 아스파르트산과, 전하를 띠지 않는 곁사슬을 갖는 아미노산(uncharged amino acid; neutral amino acid로도 지칭)인 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판, 프롤린, 세린, 쓰레오닌, 시스테인, 타이로신, 아스파라긴 및 글루타민으로 분류할 수 있다. 다른 일 예로, 페닐알라닌, 트립토판 및 타이로신은 방향족 아미노산(aromatic amino acid)으로 분류할 수 있다. 다른 일 예로, 발린, 류신, 이소류신은 분지쇄 아미노산(branched amino acid)으로 분류할 수 있다. 다른 일 예로, 20종 아미노산을 크기에 따라 분류하여 상대적으로 부피(volume)가 작은 아미노산 그룹부터 글리신, 알라닌, 세린; 시스테인, 프롤린, 쓰레오닌, 아스파르트산, 아스파라긴; 발린, 히스티딘, 글루탐산, 글루타민; 이소류신, 류신, 메치오닌, 리신, 아르기닌; 및 페닐알라닌, 트립토판, 타이로신의 5군으로 분류할 수 있다. 그러나 반드시 이에 제한되는 것은 아니다.
예를 들어, "서열번호 1에서 36번째 위치에 상응하는 아미노산이 다른 아미노산으로 치환되었다"고 기재하는 경우, 서열번호 1에서 36번째 위치에 상응하는 아미노산인 이소류신 (isoleucine)을 제외한 아스파라긴 (asparagine), 페닐알라닌(phenylalanine), 글리신(glycine), 알라닌 (alanine), 아르기닌 (arginine), 아스파테이트 (aspartate), 시스테인 (cysteine), 글루탐산 (glutamate), 류신(leucine), 글루타민 (glutamine), 히스티딘 (histidine), 프롤린 (proline), 세린 (serine), 타이로신 (tyrosine), 리신 (lysine), 트립토판 (tryptophan), 발린 (valine), 메티오닌 (methionine) 또는 트레오닌 (threonine)으로 치환되는 것을 의미할 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 '특정 서열번호로 기재된 아미노산 서열을 포함하는 폴리펩티드 또는 단백질', '특정 서열번호로 기재된 아미노산 서열로 이루어진 폴리펩티드 또는 단백질' 또는 '특정 서열번호로 기재된 아미노산 서열을 갖는 폴리펩티드 또는 단백질'라고 기재되어 있더라도, 해당 서열번호의 아미노산 서열로 이루어진 폴리펩티드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원에서 사용될 수 있음은 자명하다. 예를 들어, 상기 아미노산 서열 N-말단 그리고/또는 C-말단에 단백질의 기능을 변경하지 않는 서열 추가, 자연적으로 발생할 수 있는 돌연변이, 이의 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다.
예를 들어, 상기 아미노산 서열 N-말단, C-말단 그리고/또는 내부에 본 출원의 글루코네이트 리프레서 단백질의 기능을 변경하지 않는 서열 추가 또는 결실, 자연적으로 발생할 수 있는 돌연변이, 잠재성 돌연변이(silent mutation) 또는 보존적 치환을 가지는 경우이다.
본 출원의 "N번 위치"는 N번 위치 및 N번 위치와 상응(Correspoding)하는 아미노산 위치를 포함할 수 있다. 구체적으로 특정 아미노산 서열에 개시된 성숙 폴리펩티드(mature polypeptide)에서 임의의 아미노산 잔기에 상응하는 아미노산 위치를 포함할 수 있다. 상기 특정 아미노산 서열은 서열번호 1의 아미노산 서열일 수 있다.
본 출원에서, 용어 "상응하는(corresponding to)"은, 폴리펩티드에서 열거되는 위치의 아미노산 잔기이거나, 또는 폴리펩티드에서 열거되는 잔기와 유사하거나 동일하거나 상동한 아미노산 잔기를 지칭한다. 상응하는 위치의 아미노산을 확인하는 것은 특정 서열을 참조하는 서열의 특정 아미노산을 결정하는 것일 수 있다. 본 출원에 사용된 "상응 영역"은 일반적으로 관련 단백질 또는 참조 (reference) 단백질에서의 유사하거나 대응되는 위치를 지칭한다.
예를 들어, 임의의 아미노산 서열을 서열번호 1과 정렬(align)하고, 이를 토대로 상기 아미노산 서열의 각 아미노산 잔기는 서열번호 1의 아미노산 잔기와 상응하는 아미노산 잔기의 숫자 위치를 참조하여 넘버링 할 수 있다. 예를 들어, 본 출원에 기재된 것과 같은 서열 정렬 알고리즘은, 쿼리 시퀀스("참조 서열"이라고도 함)와 비교하여 아미노산의 위치, 또는 치환, 삽입 또는 결실 등의 변형이 발생하는 위치를 확인할 수 있다.
이러한 정렬에는 예를 들어 Needleman-Wunsch 알고리즘(Needleman 및 Wunsch, 1970, J. Mol. Biol. 48: 443-453), EMBOSS 패키지의 Needleman 프로그램 (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) 등을 이용할 수 있으나, 이에 제한되지 않고 당업계에 알려진 서열 정렬 프로그램, 쌍 서열(pairwise sequence) 비교 알고리즘 등을 적절히 사용할 수 있다.
본 출원에서 용어 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 예를 들면, 양으로 하전된 (염기성) 아미노산은 아르기닌, 라이신, 및 히스티딘을 포함하고; 음으로 하전된 (산성) 아미노산은 글루탐산 및 아스파테이트를 포함하고; 방향족 아미노산은 페닐알라닌, 트립토판 및 타이로신을 포함하고, 소수성 아미노산은 알라닌, 발린, 이소류신, 류신, 메치오닌, 페닐알라닌, 타이로신 및 트립토판을 포함한다. 또한, 아미노산은 전하를 띠는(electrically charged) 곁사슬을 갖는 아미노산과 전하를 띠지 않는(uncharged) 곁사슬을 갖는 아미노산으로 분류할 수 있으며, 전하를 띠는 곁사슬을 갖는 아미노산은 아스르트산, 글루탐산, 라이신, 아르기닌, 히스티딘을 포함하고, 전하를 띠지 않는 곁사슬을 갖는 아미노산은 다시 비극성(nonpolar) 아미노산 또는 극성 아미노산(polar)으로 분류할 수 있으며, 비극성 아미노산은 글리신, 알라닌, 발린, 류신, 이소류신. 메치오닌, 페닐알라닌. 트립토판, 프롤린, 극성 아미노산은 세린, 트레오닌, 시스테인, 타이로신, 아스파라긴, 글루타민을 포함하는 것으로 분류할 수 있다. 통상적으로, 보존성 치환은 생성된 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않는다. 통상적으로, 보존적 치환은 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
본 출원에서 용어, '상동성(homology)' 또는 '동일성(identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지(Devereux, J., et al, Nucleic Acids Research 12: 387(1984)), BLASTP, BLASTN, FASTA(Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math(1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al.(1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358(1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티(또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
일 구현예로, 상기 변이체는 서열번호 1의 아미노산 서열의 36번째 위치에 상응하는 아미노산의 아스파라긴으로의 치환, 59번째 위치에 상응하는 아미노산의 알라닌으로의 치환, 60번째 위치에 상응하는 아미노산의 류신으로의 치환, 63번째 위치에 상응하는 아미노산의 알라닌으로의 치환, 79번째 위치에 상응하는 아미노산의 알라닌으로의 치환 및 92번째 위치에 상응하는 아미노산의 류신으로의 치환으로 이루어진 군으로부터 선택된 하나 이상의 치환을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원에서 제공하는 변이체는 서열번호 1의 N-말단으로부터 36번 위치에 상응하는 아미노산의 다른 아미노산으로의 치환을 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 상기 변이체에서 서열번호 1의 N-말단으로부터 36번 위치에 상응하는 아미노산은 극성 아미노산인 세린, 시스테인, 타이로신, 아스파라긴 및 글루타민 중 선택되는 아미노산으로 치환된 것일 수 있다. 전술한 구현예 중 어느 하나의 구현예로, 상기 변이체는 서열번호 1의 N-말단으로부터 36번 위치에 상응하는 아미노산이 아스파라긴(N)으로 치환된 변이체일 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원에서 제공하는 변이체는 서열번호 1의 N-말단으로부터 59번 위치에 상응하는 아미노산의 다른 아미노산으로의 치환을 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 상기 변이체에서 서열번호 1의 N-말단으로부터 59번 위치에 상응하는 아미노산은 비극성 아미노산으로 치환된 것일 수 있다. 그 예로, 상기 아미노산은 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판 및 프롤린 중 선택되는 아미노산일 수 있다. 전술한 구현예 중 어느 하나의 구현예로, 상기 변이체는 서열번호 1의 N-말단으로부터 59번 위치에 상응하는 아미노산이 알라닌(A)으로 치환된 변이체일 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원에서 제공하는 변이체는 서열번호 1의 N-말단으로부터 60번 위치에 상응하는 아미노산의 다른 아미노산으로의 치환을 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 상기 변이체에서 서열번호 1의 N-말단으로부터 60번 위치에 상응하는 아미노산은 비극성 아미노산으로 치환된 것일 수 있다. 그 예로, 상기 아미노산은 글리신, 알라닌, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판 및 프롤린 중 선택되는 아미노산일 수 있다. 전술한 구현예 중 어느 하나의 구현예로, 상기 변이체는 서열번호 1의 N-말단으로부터 60번 위치에 상응하는 아미노산이 류신(L)으로 치환된 변이체일 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원에서 제공하는 변이체는 서열번호 1의 N-말단으로부터 63번 위치에 상응하는 아미노산의 다른 아미노산으로의 치환을 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 상기 변이체에서 서열번호 1의 N-말단으로부터 63번 위치에 상응하는 아미노산은 비극성 아미노산으로 치환된 것일 수 있다. 그 예로, 상기 아미노산은 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판 및 프롤린 중 선택되는 아미노산일 수 있다. 전술한 구현예 중 어느 하나의 구현예로, 상기 변이체는 서열번호 1의 N-말단으로부터 63번 위치에 상응하는 아미노산이 알라닌(A)으로 치환된 변이체일 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원에서 제공하는 변이체는 서열번호 1의 N-말단으로부터 79번 위치에 상응하는 아미노산의 다른 아미노산으로의 치환을 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 상기 변이체에서 서열번호 1의 N-말단으로부터 79번 위치에 상응하는 아미노산은 비극성 아미노산으로 치환된 것일 수 있다. 그 예로, 상기 아미노산은 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판 및 프롤린 중 선택되는 아미노산일 수 있다. 전술한 구현예 중 어느 하나의 구현예로, 상기 변이체는 서열번호 1의 N-말단으로부터 79번 위치에 상응하는 아미노산이 알라닌(A)으로 치환된 변이체일 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 본 출원에서 제공하는 변이체는 서열번호 1의 N-말단으로부터 92번 위치에 상응하는 아미노산의 다른 아미노산으로의 치환을 포함할 수 있다.
전술한 구현예 중 어느 하나의 구현예로, 상기 변이체에서 서열번호 1의 N-말단으로부터 92번 위치에 상응하는 아미노산은 비극성 아미노산으로 치환된 것일 수 있다. 그 예로, 상기 아미노산은 글리신, 알라닌, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판 및 프롤린 중 선택되는 아미노산일 수 있다. 전술한 구현예 중 어느 하나의 구현예로, 상기 변이체는 서열번호 1의 N-말단으로부터 92번 위치에 상응하는 아미노산이 류신(L)으로 치환된 변이체일 수 있다.
한편, 당업자라면 당업계에 알려진 서열 얼라인먼트를 통해 임의의 아미노산 서열에서 본 출원의 서열번호 1의 아미노산 서열의 36번째 위치에 상응하는 아미노산, 59번째 위치에 상응하는 아미노산, 60번째 위치에 상응하는 아미노산, 63번째 위치에 상응하는 아미노산, 79번째 위치에 상응하는 아미노산 및 92번째 위치에 상응하는 아미노산을 파악할 수 있으며, 본 출원에서 별도로 기재하지 않더라도 "특정 서열번호에서 특이적 위치의 아미노산"를 기재하는 경우, 임의의 아미노산 서열에서 그와 "상응하는 위치의 아미노산"까지 포함하는 의미임은 자명하다.
또한 본 출원의 변이체는 상기 서열번호 1로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열에서, 서열번호 1의 N-말단으로부터 36번 위치, 59번 위치, 60번 위치, 63번 위치, 79번 위치, 92번 위치에 상응하는 아미노산으로 이루어진 군으로부터 선택된 하나 이상의 아미노산이 다른 아미노산으로 치환된 것을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 변이체에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 변이체도 본 출원의 범위 내에 포함됨은 자명하다.
예를 들어, 본 출원의 변이체는 서열번호 25 내지 서열번호 31로 기재된 아미노산 서열로 이루어진 군으로부터 선택된 아미노산 서열을 가지거나 및/또는 포함하거나, 상기 아미노산 서열로 필수적으로 이루어질(essentially consisting of) 수 있다. 또는, 상기 서열번호 25 내지 서열번호 31로 기재된 아미노산 서열로 이루어진 군으로부터 선택된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다.
또는 구체적으로, 본 출원의 L-아르기닌 생산능을 가지는 코리네박테리움 속 미생물은 글루코네이트 리프레서 단백질 활성이 불활성화된 것일 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 상기 글루코네이트 리프레서 단백질 활성을 불활성화시키기 위해 단백질을 암호화하는 상기 유전자의 일부 또는 전체를 결실하는 방법을 사용할 수 있다. 구체적으로, 미생물 내 염색체 삽입용 벡터를 통해 염색체 내 내재적 목적 단백질을 암호화하는 폴리뉴클레오티드를 일부 뉴클레오티드 서열이 결실된 폴리뉴클레오티드 또는 마커 유전자로 교체함으로써 수행될 수 있다. 이러한 폴리뉴클레오티드의 일부 또는 전체를 결실하는 방법의 일례로 상동 재조합에 의하여 폴리뉴클레오티드를 결실시키는 방법을 사용할 수 있으나, 이에 한정되지는 않는다. 또 다른 예로, 상기 유전자의 일부 또는 전체를　결손시키는 방법은 자외선과 같은 빛 또는 화학물질을 이용하여 돌연변이를 유발하고, 얻어진 돌연변이체로부터 목적 유전자가　결손된 균주를 선별하여 수행될 수 있다.
상기 유전자　결손　방법에는 유전자 재조합 기술(Genetic recombination technique)에 의한 방법이 포함된다. 예를 들면, 목적 유전자와 상동성이 있는 폴리뉴클레오티드 서열을 포함하는 폴리뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 이루어질 수 있다. 또한, 상기 주입되는 폴리뉴클레오티드 서열 또는 벡터에는 우성 선별 마커를 포함할 수 있다. 그러나 이에 제한되는 것은 아니다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이체를 코딩하는 폴리뉴클레오티드 단편을 의미한다.
구체적으로, 본 출원의 L-아르기닌 생산능을 가지는 코리네박테리움 속 미생물은 글루코네이트 리프레서 단백질의 활성이 제거 또는 약화되도록 상기 글루코네이트 리프레서 단백질을 구성하는 아미노산 서열의 변형된 글루코네이트 리프레서 변이체를 코딩하는 폴리뉴클레오티드를 포함할 수 있으나, 이에 제한되는 것은 아니다.
상기 글루코네이트 리프레서 변이체를 코딩하는 폴리뉴클레오티드는, 본 출원의 글루코네이트 리프레서 변이체를 코딩하는 폴리뉴클레오티드 서열이라면 제한없이 포함될 수 있다. 일 예로, 본 출원의 글루코네이트 리프레서 변이체를 코딩하는 폴리뉴클레오티드는 본 출원의 변이체의 아미노산 서열을 코딩하는 폴리뉴클레오티드 서열일 수 있으나, 이에 제한되는 것은 아니다.
예를 들어, 본 출원의 글루코네이트 리프레서 변이체를 코딩하는 폴리뉴클레오티드는 서열번호 32 내지 서열번호 38로 기재된 폴리뉴클레오티드 서열로 이루어진 군으로부터 선택된 폴리뉴클레오티드 서열, 또는 서열번호 32 내지 서열번호 38로 기재된 폴리뉴클레오티드 서열로 이루어진 군으로부터 선택된 폴리뉴클레오티드 서열과 적어도 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성(homology) 또는 동일성(identity)을 가지는 폴리뉴클레오티드 서열일 수 있으나, 이에 제한되는 것은 아니다. 상동성 또는 동일성을 갖는 뉴클레오티드 서열은 상기 범주 중 100% 동일성을 갖는 서열은 제외되거나, 100% 미만의 동일성을 갖는 서열일 수 있다.
본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 출원의 변이체를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 본 출원의 변이체의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 따라서, 코돈 축퇴성 (codon degeneracy)에 의해 본 출원의 변이체의 아미노산 서열로 이루어진 폴리펩타이드 또는 이와 상동성 또는 동일성을 가지는 폴리펩타이드로 번역될 수 있는 폴리뉴클레오티드 역시 포함될 수 있음은 자명하다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화할 수 있는 서열이라면 제한없이 포함될 수 있다.
상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1ХSSC, 0.1% SDS, 구체적으로 60℃, 0.1ХSSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1ХSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
또는 구체적으로, 본 출원의 L-아르기닌 생산능을 가지는 코리네박테리움 속 미생물은 글루코네이트 리프레서 단백질을 코딩하는 폴리뉴클레오티드가 결손된 미생물일 수 있으나, 이에 제한되는 것은 아니다. 예를 들어, 본 출원의 L-아르기닌 생산능을 가지는 코리네박테리움 속 미생물은 서열번호 2의 핵산 염기서열이 결손된 미생물일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 L-아르기닌 생산능을 가지는 코리네박테리움 속 미생물은 상기 글루코네이트 리프레서 변이체를 숙주에서 발현시키기 위한 발현 벡터를 포함함으로써, 상기 글루코네이트 리프레서 단백질 활성이 내재적 활성에 비해 약화된 것일 수 있으나, 이에 제한되는 것은 아니다.
또는 본 출원의 L-아르기닌 생산능을 가지는 코리네박테리움 속 미생물은 글루코네이트 리프레서 단백질을 숙주 세포에서 불활성화시키기 위한 발현 벡터를 포함함으로써, 상기 글루코네이트 리프레서 단백질 활성이 불활성화된 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 벡터는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 포함하는 DNA 제조물을 포함할 수 있다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계, pSK계, pSKH계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pSK, pSKH130, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 표적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 폴리펩티드가 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 변이체를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 미생물에서 폴리뉴클레오티드의 일부 또는 전체의 변형은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위 (engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오티드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 다른 하나의 양태는 본 출원의 코리네박테리움 속 미생물을 배지에서 배양하는 단계를 포함하는 L-아르기닌의 생산 방법을 제공한다.
본 출원의 방법에 있어서, 미생물의 배양은 당업계에 알려진 임의의 배양 조건 및 배양 방법이 사용될 수 있다. 이러한 배양 과정은 당업자라면 선택되는 균주에 따라 용이하게 조정하여 사용할 수 있다.
본 출원에서 용어, "배양"은 본 출원의 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양 조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및 유가식 일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 본 출원의 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메치오닌, 라이신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메치오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
본 출원에서는 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배양물에 적절한 방식으로 첨가하여, 배양물의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배양물의 호기 상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으나, 이에 제한되지 않는다.
배양물의 온도는 25℃내지 40℃일 수 있으며, 보다 구체적으로는 28℃ 내지 37℃일 수 있으나 이에 제한되지 않는다. 배양 기간은 원하는 유용 물질의 생성량이 수득될 때까지 계속될 수 있으며, 구체적으로는 1 시간 내지 100 시간일 수 있으나 이에 제한되지 않는다.
본 출원의 배양에 의하여 생산된 L-아르기닌은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 L-아르기닌 생산 방법은, 본 출원의 코리네박테리움 속 미생물을 준비하는 단계, 상기 코리네박테리움 속 미생물을 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 L-아르기닌 생산 방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 미생물로부터 L-아르기닌을 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 L-아르기닌을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-아르기닌을 회수할 수 있다.
또한, 본 출원의 L-아르기닌 생산 방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 L-아르기닌 생산 방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 연속적 또는 비연속적으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 또 다른 하나의 양태는 상기 코리네박테리움 속 미생물을 포함하는 L-아르기닌 생산용 조성물을 제공한다.
본 출원의 조성물은 L-아르기닌 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 또 다른 하나의 양태는 상기 코리네박테리움 속 미생물의 L-아르기닌 생산 용도를 제공하는 것이다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 하기 실시예는 본 출원을 예시하기 위한 바람직한 실시양태에 불과한 것이며 따라서, 본 출원의 권리범위를 이에 한정하는 것으로 의도되지는 않는다. 한편, 본 명세서에 기재되지 않은 기술적인 사항들은 본 출원의 기술 분야 또는 유사 기술 분야에서 숙련된 통상의 기술자이면 충분히 이해하고 용이하게 실시할 수 있다.
실시예 1. 글루코네이트 리프레서 활성 약화를 위한 벡터 제작
글루코네이트 리프레서 활성 약화를 위하여 각각 서열번호 25 내지 서열번호 31로 표시되는 gntR1(I36N), gntR1(R59A), gntR1(T60L), gntR1(R63A), gntR1(R79A), gntR1(A92L) 변이형을 코리네박테리움 글루타미쿰 KCCM10741P 균주에 삽입하고자 하였다. 이에, 글루코네이트 리프레서 활성 약화를 위한 타겟 변이를 포함한 벡터를 제작하였다. 구체적으로 코리네박테리움 클루타미쿰 ATCC13869의 게놈 DNA를 주형으로 표 1의 프라이머 쌍 (서열번호 3 및 5, 서열번호 4 및 6, 서열번호 3 및 7, 서열번호 4 및 8, 서열번호 3 및 9, 서열번호 4 및 10, 서열번호 3 및 11, 서열번호 4 및 12, 서열번호 3 및 13, 서열번호 4 및 14, 서열번호 3 및 15, 서열번호 4 및 16) 들을 이용한 PCR 및 서열번호 3 및 4의 프라이머 쌍을 이용한 오버랩핑(overlapping) PCR을 수행하여 각각의 gntR1-I36N, R59A, T60L, R63A, R79A, A92L 변이 서열을 가지는 상동재조합 단편(이하, 각각 "변이 도입 단편 1" 내지 "변이 도입 단편 6")을 수득하였다. 이때 PCR 반응은 95 ℃, 30 초 변성; 55 ℃, 30 초 어닐링; 및 72 ℃, 1 분 신장 과정을 30 회 반복하여 수행하였다.
이어서, 코리네박테리움 글루타미쿰 내에서 복제가 불가능한 pDCM2 (대한민국 공개번호 제 10-2020-0136813호) 벡터 와 PCR로 증폭된 상기 단편을 염색체 도입용 제한효소 BamHI과 XbaI으로 처리한 뒤, DNA 접합 효소를 이용하여 연결하여 각 변이 도입 단편이 삽입된 플라스미드를 제조한 후, 대장균 DH5α에 형질전환하고 카나마이신(25mg/ℓ)이 포함된 LB 고체배지에 도말하였다. 상기 LB 고체배지에서 상기 플라스미드로 형질전환된 콜로니를 선별한 후, DNA-spin 플라스미드 DNA 정제 키트(iNtRON 사)로 DNA를 획득하여 각각 상기 변이 도입 단편 1 내지 변이 도입 단편 6을 포함하는 벡터(재조합 플라스미드) pDCM2-gntR1(I36N), pDCM2-gntR1(R59A), pDCM2-gntR1(T60L), pDCM2-gntR1(R63A), pDCM2-gntR1(R79A), pDCM2-gntR1(A92L)를 제조하였다.
No. 명칭 DNA 서열 (5'-3')
서열번호 3 gntR1-AF tcggtacccggggatccAAGCAACCGTCGGCGAG
서열번호 4 gntR1-BR tgcaggtcgactctagaTTTCGGGACGCAGTTTC
서열번호 5 gntR1(I36N)-AR AGCAACCTTGCCACTGtTGATATCTTGACCGAGC
서열번호 6 gntR1(I36N)-BF aCAGTGGCAAGGTTGCTGTCGGAGATACCTTCAAG
서열번호 7 gntR1(R59A)-AR TCGCGTGCCACTGTGgcGGAAATACCAAAACGC
서열번호 8 gntR1(R59A)-BF gcCACAGTGGCACGCGAAGCAATGCGCGCTTTG
서열번호 9 gntR1(T60L)-AR GCTTCGCGTGCCACTagGCGGGAAATACCAAAACG
서열번호 10 gntR1(T60L)-BF ctAGTGGCACGCGAAGCAATGCGCGCTTTGGAGCA
서열번호 11 gntR1(R63A)-AR GCGCGCATTGCTTCGgcTGCCACTGTGCGGG
서열번호 12 gntR1(R63A)-BF gcCGAAGCAATGCGCGCTTTGGAGCAGCTCGGTC
서열번호 13 gntR1(R79A)-AR GTAATGCCAATGCGAgcTGAAGAAGCGACAAGACC
서열번호 14 gntR1(R79A)-BF gcTCGCATTGGCATTACTGTTTTGCCACAGGAAG
서열번호 15 gntR1(A92L)-AR GACTTATCAAAAACAagCCACTCTTCCTGTGGC
서열번호 16 gntR1(A92L)-BF ctTGTTTTTGATAAGTCCATCATTCGCTGGCGTC
실시예 2. KCCM10741P 균주 기반 글루코네이트 리프레서 활성 약화 균주 제작 및 L-아르기닌 생산능 평가
실시예 2-1. 균주 제작
L-아르기닌 생산균주인 코리네박테리움 글루타미쿰 KCCM10741P (US 8034602 B2)의 글루코네이트 리프레서 단백질 활성을 약화 시키기 위해 상기 실시예 1에서 제작된 재조합 플라스미드(pDCM2-gntR1(I36N), pDCM2-gntR1(R59A), pDCM2-gntR1(T60L), pDCM2-gntR1(R63A), pDCM2-gntR1(R79A), pDCM2-gntR1(A92L))를 이용하여 각각 형질 전환시켰다 (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). 이어서, 4%의 수크로오스를 포함하는 고체평판배지에서 2차 재조합을 하고, 2차 재조합이 완료된 형질 전환주를 대상으로 프라이머 쌍 (서열번호 3 및 4)을 이용해 PCR을 수행하여 염색체상 gntR1 유전자에 각각의 변이가 도입되었음을 확인하였다. 이때, PCR 반응은 95 ℃, 30 초 변성; 55 ℃, 30 초 어닐링; 및 72 ℃, 1 분 신장 과정을 30 회 반복하여 수행하였다.
상기 형질 전환주를 각각 KCCM10741P-gntR1(I36N), KCCM10741P-gntR1(R59A), KCCM10741P-gntR1(T60L), KCCM10741P-gntR1(R63A), KCCM10741P-gntR1(R79A), KCCM10741P-gntR1(A92L) 라 명명하였다.
실시예 2-2. L-아르기닌 생산능 평가
L-아르기닌 생산균주인 코리네박테리움 글루타미쿰 KCCM10741P, 상기 실시예 2-1에서 제작된 형질 전환주(각 글루코네이트 리프레서 단백질 활성 약화 균주, KCCM10741P-gntR1(I36N), KCCM10741P-gntR1(R59A), KCCM10741P-gntR1(T60L), KCCM10741P-gntR1(R63A), KCCM10741P-gntR1(R79A), KCCM10741P-gntR1(A92L))들의 L-아르기닌 생산능을 비교하기 위하여 아래와 같은 방법으로 배양하여 배양액 중 L-아르기닌의 농도를 분석하였다.
하기의 종배지 25 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 모균주인 코리네박테리움 글루타미쿰 KCCM10741P와 상기 실시예 1-2에서 제작된 형질 전환주(각 글루코네이트 리프레서 단백질 활성 약화 균주)들을 접종하고, 30 ℃에서 20 시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산배지 24 ㎖을 함유하는 250 ㎖ 코너-바플 플라스크에 1 ㎖의 종 배양액을 접종하고 30 ℃에서 72시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종배지와 생산배지의 조성은 각각 하기와 같다.
<종배지 (pH 7.2)>
포도당 20g, 황산암모늄 45g, 황산마그네슘7수염 2g, 제1인산칼륨 2g, 염화암모늄 10g, 비오틴 0.01mg, 티아민-HCl 0.1mg, 판토텐산칼슘 2mg, 니코틴아마이드 3mg, 황산제1철 10mg, 황산망간 10mg, 황산아연 0.02mg, 황산구리 0.5mg (증류수 1리터 기준)
<생산배지 (pH 7.2)>
포도당 60g, 황산암모늄 45g, 황산마그네슘7수염 2g, 제1인산칼륨 2g, 염화암모늄 10g, 비오틴 0.01mg, 티아민-HCl 0.1mg, 판토텐산칼슘 2mg, 니코틴아마이드 3mg, 황산제1철 10mg, 황산망간 10mg, 황산아연 0.02mg, 황산구리 0.5mg , 탄산칼슘 30 g (증류수 1리터 기준)
배양 종료 후 HPLC (Waters 2478)를 사용하여 L-아르기닌의 생산능(농도)을 분석하였고, 분석한 L-아르기닌의 농도를 하기 표 2에 나타내었다.
균주명 L-아르기닌 (g/L)
배치1 배치2 배치3 평균
대조군 KCCM10741P 2.9 3.0 3.1 3.0
실험군 KCCM10741P-gntR1(I36N) 3.4 3.6 3.5 3.5
KCCM10741P-gntR1(R59A) 3.6 3.3 3.5 3.5
KCCM10741P-gntR1(T60L) 3.4 3.5 3.5 3.5
KCCM10741P-gntR1(R63A) 3.6 3.5 3.0 3.4
KCCM10741P-gntR1(R79A) 3.4 3.7 3.5 3.5
KCCM10741P-gntR1(A92L) 3.6 3.5 3.3 3.5
그 결과, 상기 형질 전환주(각 글루코네이트 리프레서 단백질 활성 약화 균주, KCCM10741P-gntR1(I36N), KCCM10741P-gntR1(R59A), KCCM10741P-gntR1(T60L), KCCM10741P-gntR1(R63A), KCCM10741P-gntR1(R79A), KCCM10741P-gntR1(A92L))들 모두에서 모균주 대비 L-아르기닌 생산능이 평균 약 17% 증가함을 확인하였다.
실시예 3. CJ1R 균주 기반 글루코네이트 리프레서 단백질 활성 약화 균주 제작 및 L-아르기닌 생산능 평가
실시예 3-1. CJ1R 균주 제작
L-아르기닌 생산능을 가지는 다른 코리네박테리움 글루타미쿰 균주에서도 L-아르기닌 생산능 증가 효과가 있는지를 확인하기 위하여, 야생주(ATCC13869)에 1종의 변이(△argR)를 도입하여 L-아르기닌을 생산능을 가진 코리네박테리움 글루타미쿰 균주 CJ1R을 추가 제작하였다. 구체적으로, 코리네박테리움 클루타미쿰 ATCC13869의 게놈 DNA를 주형으로 표 3의 프라이머 쌍 (서열번호 17 및 18, 서열번호 19 및 20) 들을 이용한 PCR 및 서열번호 17 및 20의 프라이머 쌍을 이용한 오버랩핑 (overlapping) PCR을 수행하여 argR 결손 변이 서열을 가지는 상동재조합 단편을 수득하였다. 이때 PCR 반응은 95 ℃, 30 초 변성; 55 ℃, 30 초 어닐링; 및 72 ℃, 1 분 신장 과정을 30 회 반복하여 수행하였다.
제작된 벡터(재조합 플라스미드)는 pDCM2-△argR 이라 명명하였다.
No. 명칭 DNA 서열 (5’-3’)
서열번호 17 argR-AF tcggtacccggggatccAGCAGGCCTTAAGGGTAAG
서열번호 18 argR-AR AGGGGCGCTGTCTTACCTCGGCTGGTGGGCCAGC
서열번호 19 argR-BF GGTAAGACAGCGCCCCTAGTTCAAGGCTTGTTAATC
서열번호 20 argR-BR tgcaggtcgactctagaACCGTTGAACTGCTTGCCAG
이어서, 코리네박테리움 글루타미쿰 야생주(ATCC13869)에 상기 제작된 pDCM2-△argR을 형질 전환시켰으며(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999), 이어, 4%의 수크로오스를 포함하는 고체평판배지에서 2차 재조합을 하고, 2차 재조합이 완료된 형질 전환주를 대상으로 프라이머 쌍(서열번호 19 및 22)을 이용한 PCR을 통하여 염색체상에서 argR이 결손된 균주를 확인하였다. 이때, PCR 반응은 95 ℃, 30 초 변성; 55 ℃, 30 초 어닐링; 및 72 ℃, 1 분 신장 과정을 30 회 반복하여 수행하였다. 상기 형질 전환주를 CJ1R라 명명하였다.
실시예 3-2. CJ1R 균주 기반 글루코네이트 리프레서 활성 약화 균주 제작
CJ1R 균주의 글루코네이트 리프레서 단백질 활성을 약화시키기 위하여 상기 실시예 2-1과 같은 방법으로 실시예 1에서 제작한 벡터가 각각 도입된 변이주를 제작하고, 상기 변이주를 각각 CJ1R-gntR1(I36N), CJ1R-gntR1(R59A), CJ1R-gntR1(T60L), CJ1R-gntR1(R63A), CJ1R-gntR1(R79A), CJ1R-gntR1(A92L) 라 명명하였다.
실시예 3-3. L-아르기닌 생산능 평가
L-아르기닌 생산균주인 코리네박테리움 글루타미쿰 CJ1R, 상기 실시예 3-2에서 제작된 변이주(각 글루코네이트 리프레서 단백질 활성 약화 균주, CJ1R-gntR1(I36N), CJ1R-gntR1(R59A), CJ1R-gntR1(T60L), CJ1R-gntR1(R63A), CJ1R-gntR1(R79A), CJ1R-gntR1(A92L))들의 L-아르기닌 생산능을 비교하기 위하여 실시예 2-2와 같은 방법으로 배양하여 배양액 중 L-아르기닌의 농도를 분석하였다.
배양 종료 후 HPLC (Waters 2478)를 사용하여 L-아르기닌의 생산능(농도)을 분석하였고, 분석한 L-아르기닌의 농도를 하기 표 4에 나타내었다.
균주명 L-아르기닌 (g/L)
배치1 배치2 배치3 평균
대조군 CJ1R 2.0 2.2 2.1 2.1
실험군 CJ1R-gntR1(I36N) 2.5 2.7 2.5 2.6
CJ1R-gntR1(R59A) 2.3 2.6 2.8 2.6
CJ1R-gntR1(T60L) 2.6 2.5 2.4 2.5
CJ1R-gntR1(R63A) 2.4 2.4 2.6 2.5
CJ1R-gntR1(R79A) 2.5 2.6 2.7 2.6
CJ1R-gntR1(A92L) 2.5 2.5 2.3 2.4
그 결과, 상기 변이주(각 글루코네이트 리프레서 단백질 활성 약화된 균주, CJ1R-gntR1(I36N), CJ1R-gntR1(R59A), CJ1R-gntR1(T60L), CJ1R-gntR1(R63A), CJ1R-gntR1(R79A), CJ1R-gntR1(A92L))들 모두에서 모균주 대비 L-아르기닌 생산능이 평균 약 19% 증가함을 확인하였다.
실시예 4. 글루코네이트 리프레서 활성 약화 균주 제작 및 L-아르기닌 생산능 평가
실시예 4-1. 균주 제작
글루코네이트 리프레서 활성 약화가 L-아르기닌 생산에 미치는 영향을 확인하기 위해 L-아르기닌 생산능을 가지는 코리네박테리움 글루타미쿰 균주 KCCM10741P 및 CJ1R에 gntR1유전자를 결손시킨 균주를 제작하였다.
구체적으로, 상기 유전자 gntR1의 결손을 위한 재조합 벡터를 상기 실시예 3-1과 동일한 방법으로 제작하였으며, 벡터 제작에 사용된 프라이머는 하기 표 5와 같다. 구체적으로, 코리네박테리움 클루타미쿰 ATCC13869의 게놈 DNA를 주형으로 표 5의 프라이머 쌍 (서열번호 21 및 22, 서열번호 23 및 24) 들을 이용한 PCR 및 서열번호 21 및 24의 프라이머 쌍을 이용한 오버랩핑 (overlapping) PCR을 수행하여 argR 결손 변이 서열을 가지는 상동재조합 단편을 수득하였다. 이때 PCR 반응은 95 ℃, 30 초 변성; 55 ℃, 30 초 어닐링; 및 72 ℃, 1 분 신장 과정을 30 회 반복하여 수행하였다.
제작된 벡터(재조합 플라스미드)는 pDCM2-△gntR1 이라 명명하였다.
No. 명칭 DNA 서열 (5’-3’)
서열번호 21 gntR1 del-AF tcggtacccggggatccTTGACCGTGACTACACC
서열번호 22 gntR1 del-AR GTATCACGGGTGCCTCTTTAATGGGCCGGTGTAC
서열번호 23 gntR1 del-BF AGAGGCACCCGTGATACGCGCACTGCGTTTGCCA
서열번호 24 gntR1 del-BR tgcaggtcgactctagaGGCTTCGTCAATTACCG
이어서, L-아르기닌을 생산능을 가진 코리네박테리움 글루타미쿰 균주 KCCM10741P 및 CJ1R 균주에 상기 제작된 pDCM2-△gntR1을 형질 전환시켰으며(van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999), 이어, 4%의 수크로오스를 포함하는 고체평판배지에서 2차 재조합을 하고, 2차 재조합이 완료된 형질 전환주를 대상으로 프라이머 쌍 (서열번호 21 및 24)을 이용한 PCR을 통하여 염색체상에서 gntR1이 결손된 균주를 확인하였다. 이때, PCR 반응은 95 ℃, 30 초 변성; 55 ℃, 30 초 어닐링; 및 72 ℃, 1 분 신장 과정을 30 회 반복하여 수행하였다. 상기 형질 전환주를 각각 KCCM10741P-△gntR1, CJ1R-△gntR1라 명명하였다.
실시예 4-2. L-아르기닌 생산능 평가
L-아르기닌 생산균주인 코리네박테리움 글루타미쿰 KCCM10741P, CJ1R 및 상기 실시예 4-1에서 제작된 gntR1 결손 균주(KCCM10741P-△gntR1, CJ1R-△gntR1)들의 L-아르기닌 생산능을 비교하기 위하여 실시예 2-2와 같은 방법으로 배양하여 배양액 중 L-아르기닌의 농도를 분석하였다.
배양 종료 후 HPLC (Waters 2478)를 사용하여 L-아르기닌의 생산능(농도)을 분석하였고, 분석한 L-아르기닌의 농도를 하기 표 6에 나타내었다.
균주명 L-아르기닌 (g/L)
배치1 배치2 배치3 평균
대조군 KCCM10741P 3.0 3.0 3.1 3.0
실험군 KCCM10741P-△gntR1 3.3 3.4 3.5 3.4
대조군 CJ1R 2.2 2.2 2.0 2.1
실험군 CJ1R-△gntR1 2.6 2.4 2.5 2.5
그 결과, 상기 gntR1 결손 균주(KCCM10741P-△gntR1, CJ1R-△gntR1)들 모두에서 모균주 대비 L-아르기닌 생산능이 평균 13% 내지 19% 증가함을 확인하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.

Claims (6)

  1. 글루코네이트 리프레서 단백질 활성이 약화된, 코리네박테리움 속 미생물.
  2. 제1항에 있어서, 상기 미생물은 L-아르기닌 생산능을 가지는 것인, 코리네박테리움 속 미생물.
  3. 제1항에 있어서, 상기 글루코네이트 리프레서 단백질은 서열번호 1의 아미노산 서열로 이루어진 단백질인 것인, 코리네박테리움 속 미생물.
  4. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰인 것인, 미생물.
  5. 제1항 내지 제4항 중 어느 한 항에 있어서, 상기 미생물은 L-아르기닌 생산능이 증가된 것인, 코리네박테리움 속 미생물.
  6. 글루코네이트 리프레서 단백질 활성이 약화된 코리네박테리움 속 미생물을 배지에서 배양하는 단계를 포함하는, L-아르기닌의 생산 방법.
PCT/KR2023/004003 2022-05-18 2023-03-27 글루코네이트 리프레서 단백질 활성이 약화된 미생물 및 이를 이용한 l-아르기닌 생산 방법 WO2023224248A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0061012 2022-05-18
KR1020220061012A KR20230161245A (ko) 2022-05-18 2022-05-18 글루코네이트 리프레서 단백질 활성이 약화된 미생물 및 이를 이용한 l-아르기닌 생산 방법

Publications (1)

Publication Number Publication Date
WO2023224248A1 true WO2023224248A1 (ko) 2023-11-23

Family

ID=88835382

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/004003 WO2023224248A1 (ko) 2022-05-18 2023-03-27 글루코네이트 리프레서 단백질 활성이 약화된 미생물 및 이를 이용한 l-아르기닌 생산 방법

Country Status (2)

Country Link
KR (1) KR20230161245A (ko)
WO (1) WO2023224248A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101596605B1 (ko) * 2011-07-29 2016-02-22 미쓰이 가가쿠 가부시키가이샤 이산화탄소 고정 회로를 도입한 미생물
US20160130618A1 (en) * 2013-07-09 2016-05-12 Ajinomoto Co., Inc. Method for Manufacturing Useful Substance
KR101640711B1 (ko) * 2015-04-20 2016-07-19 씨제이제일제당 (주) 글루코네이트 리프레서 변이체, 이를 포함하는 l-라이신을 생산하는 미생물 및 이를 이용한 ｌ－라이신 생산방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101596605B1 (ko) * 2011-07-29 2016-02-22 미쓰이 가가쿠 가부시키가이샤 이산화탄소 고정 회로를 도입한 미생물
US20160130618A1 (en) * 2013-07-09 2016-05-12 Ajinomoto Co., Inc. Method for Manufacturing Useful Substance
KR101640711B1 (ko) * 2015-04-20 2016-07-19 씨제이제일제당 (주) 글루코네이트 리프레서 변이체, 이를 포함하는 l-라이신을 생산하는 미생물 및 이를 이용한 ｌ－라이신 생산방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE Protein 11 July 2016 (2016-07-11), ANONYMOUS : "GntR family transcriptional regulator [Corynebacterium glutamicum ZL-6]", XP093109430, retrieved from NCBI Database accession no. ANR66410.1 *
S. KLAFFL, M. BROCKER, J. KALINOWSKI, B. J. EIKMANNS, M. BOTT: "Complex Regulation of the Phosphoenolpyruvate Carboxykinase Gene pck and Characterization of Its GntR-Type Regulator IolR as a Repressor of myo-Inositol Utilization Genes in Corynebacterium glutamicum", JOURNAL OF BACTERIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 195, no. 18, 15 September 2013 (2013-09-15), US , pages 4283 - 4296, XP055409058, ISSN: 0021-9193, DOI: 10.1128/JB.00265-13 *

Also Published As

Publication number Publication date
KR20230161245A (ko) 2023-11-27

Similar Documents

Publication Publication Date Title
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022231368A1 (ko) 신규한 글루타메이트 합성 효소 서브 유니트 알파 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022055094A1 (ko) L-글루탐산 생산 재조합 미생물 및 이를 이용한 l-글루탐산의 제조방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2021177731A1 (ko) 글루타민 신테타아제 변이형 폴리펩티드 및 이를 이용한 l-글루타민 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154177A1 (ko) 신규한 3d-(3,5/4)-트리하이드록시사이클로헥세인-1,2-다이온 아실하이드롤라아제 변이체 및 이를 이용한 imp 생산 방법
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2023224248A1 (ko) 글루코네이트 리프레서 단백질 활성이 약화된 미생물 및 이를 이용한 l-아르기닌 생산 방법
WO2024085671A1 (ko) 변이형 리보뉴클레아제 활성 조절 단백질 및 이를 이용한 l-발린 생산 방법
WO2022154189A1 (ko) 신규한 피토엔 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2023224183A1 (ko) 신규한 글루타메이트 글루코네이트 리프레서 변이체 및 이를 이용한 l-아르기닌 생산 방법
WO2022163919A1 (ko) 신규한 우레아제 부속 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163937A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154188A1 (ko) 신규한 폴리케타이드 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163930A1 (ko) 신규한 2-숙시닐-5-엔도피루빌-6-하이드록시-3-사이클로헥센-1-카복실레이트 신타아제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163941A1 (ko) 신규한 스퍼미딘 신타아제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2023063763A1 (ko) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
WO2022163929A1 (ko) 신규한 펩티딜-디펩티다제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163940A1 (ko) 신규한 갈락토사이드 o-아세틸트랜스퍼라제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2023177161A1 (ko) 카르바모일 인산 합성효소 라지 서브유닛 변이체 및 이를 이용한 l-오르니틴 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23807771

Country of ref document: EP

Kind code of ref document: A1