WO2019235680A1 - 5'-크산틸산을 생산하는 미생물 및 이를 이용한 5'-크산틸산의 제조방법 - Google Patents

5'-크산틸산을 생산하는 미생물 및 이를 이용한 5'-크산틸산의 제조방법 Download PDF

Info

Publication number
WO2019235680A1
WO2019235680A1 PCT/KR2018/007027 KR2018007027W WO2019235680A1 WO 2019235680 A1 WO2019235680 A1 WO 2019235680A1 KR 2018007027 W KR2018007027 W KR 2018007027W WO 2019235680 A1 WO2019235680 A1 WO 2019235680A1
Authority
WO
WIPO (PCT)
Prior art keywords
xmpe
protein
strain
xmp
microorganism
Prior art date
Application number
PCT/KR2018/007027
Other languages
English (en)
French (fr)
Inventor
백민지
이지혜
임보람
윤병훈
이정은
임수빈
정재호
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to BR112019016482-0A priority Critical patent/BR112019016482B1/pt
Priority to AU2018386357A priority patent/AU2018386357B2/en
Priority to EP18899009.7A priority patent/EP3597756B1/en
Priority to SG11201904426XA priority patent/SG11201904426XA/en
Priority to MX2019009214A priority patent/MX2019009214A/es
Priority to JP2019528686A priority patent/JP6938633B2/ja
Priority to PL18899009.7T priority patent/PL3597756T3/pl
Priority to RU2019115576A priority patent/RU2720520C1/ru
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to US16/465,774 priority patent/US10844348B2/en
Priority to ES18899009T priority patent/ES2970730T3/es
Priority to ZA2019/03098A priority patent/ZA201903098B/en
Publication of WO2019235680A1 publication Critical patent/WO2019235680A1/ko
Priority to US17/076,074 priority patent/US11332708B2/en
Priority to AU2021204450A priority patent/AU2021204450B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/32—Nucleotides having a condensed ring system containing a six-membered ring having two N-atoms in the same ring, e.g. purine nucleotides, nicotineamide-adenine dinucleotide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/38—Nucleosides
    • C12P19/40—Nucleosides having a condensed ring system containing a six-membered ring having two nitrogen atoms in the same ring, e.g. purine nucleosides

Definitions

  • the present application relates to a microorganism producing 5'-xanthyl acid and a method for producing 5'-xanthyl acid using the same.
  • 5'-xanthosine monophosphate is an intermediate of the nucleic acid biosynthetic metabolic system, which has a physiological significance in the body of animals and plants, and is used in various fields for food, medicine and various medical uses.
  • XMP 5'-xanthosine monophosphate
  • MSG sodium glutamate
  • 5'-xanthyl acid is an intermediate product of the purine nucleotide biosynthetic metabolic system and is an important substance as a raw material for producing 5'-guanosine monophosphate (GMP).
  • GMP 5'-guanosine monophosphate
  • a widely used method for producing 5'-guanic acid, which has high taste and high commercial value, is a microbial fermentation method, which produces 5'-xanthyl acid and converts it enzymatically to 5'-guanic acid. This is the most economical, so 5'-xanthyl acid needs as much as 5'-guanylic acid demand.
  • the preparation method of 5'-xanthyl acid includes (1) chemical synthesis method, (2) deamination of the prepared 5'-guanic acid, and (3) xanthine as a precursor in fermentation medium. Fermentation production method, (4) 5'- xanthyl acid production method through direct fermentation of microbial mutant strains and the like are known. Among them, a direct fermentation method for producing 5'-xanthyl acid by microbial mutants is economically advantageous. However, there is still a need for research on how to efficiently produce 5'-xanthyl acid in high yield.
  • the present inventors earnestly studied to develop microorganisms capable of producing 5'-xanthyl acid with high efficiency, and completed the present application by confirming that the production yield of 5'-xanthyl acid increased when enhancing the activity of a specific protein. It was.
  • One object of the present application is to provide a microorganism of the genus Corynebacterium producing 5'-xanthyl acid, which is enhanced in the activity of a protein comprising the amino acid sequence of SEQ ID NO: 2.
  • Another object of the present application is to provide a method for producing 5'-xanthyl acid using the microorganism.
  • the present application provides a microorganism of the genus Corynebacterium producing 5'-xanthyl acid, which is enhanced in the activity of a protein comprising the amino acid sequence of SEQ ID NO: 2 as one embodiment.
  • 5'-xanthylic acid refers to a compound named as xanthosinyl phosphate, xanthic acid, xanthyl acid and the like.
  • the 5'-xanthyl acid may be interchangeably named "XMP”.
  • the term "protein comprising the amino acid sequence of SEQ ID NO: 2" refers to a coryne encoded by a MFS transporter (major facilitator superfamily transporter) gene that performs the function of excretion of 5'-xanthyl acid from a microorganism. It means a protein inherent in the microorganism of the genus Bacterium. Specifically, it may be an MFS transporter protein comprising the amino acid sequence of SEQ ID NO: 2 inherently present in a microorganism of the genus Corynebacterium.
  • MFS transporter major facilitator superfamily transporter
  • the protein may be a protein consisting of the amino acid sequence of SEQ ID NO: 2, a protein consisting of the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.
  • the MFS transporter protein may be named 'xmpE' or 'xmpE protein'.
  • a 'protein containing a specific sequence number' has no effect on protein variation before and after the amino acid sequence of the corresponding sequence number if it has the same or corresponding activity as the protein including the amino acid sequence of the sequence number.
  • Non-sequence addition or naturally occurring mutations, or all of the latent mutations thereof, and any such addition or mutation is within the scope of the present application.
  • the protein of the present application may include not only the amino acid sequence set forth in SEQ ID NO: 2, but also an amino acid sequence having at least 60% homology or identity with SEQ ID NO.
  • a protein comprising an amino acid having at least 60% homology or identity with the amino acid sequence of SEQ ID NO: 2 is at least 60%, specifically 70% or more, more specifically 80% relative to the amino acid sequence of SEQ ID NO: 2 At least 83%, at least 84%, at least 85%, at least 88%, at least 90%, at least 93%, at least 95%, or at least 97% homology or identity. Protein may be included.
  • An amino acid sequence having homology or identity may exclude sequences having 100% identity in the above categories or may be sequences having less than 100% identity.
  • sequence having homology or identity with the above sequence is an amino acid sequence having a biological activity substantially the same as or corresponding to the amino acid sequence of SEQ ID NO: 2, even if some sequences have an amino acid sequence deleted, modified, substituted or added It is obvious that it is included in the scope of the present application.
  • nucleotide sequence of the gene encoding the protein comprising the amino acid sequence of SEQ ID NO: 2 can be obtained from a known database, for example, GenBank of NCBI, but is not limited thereto.
  • the protein comprising the amino acid sequence of SEQ ID NO: 2 may be encoded by a gene comprising the nucleotide sequence of SEQ ID NO: 1.
  • the base sequence of SEQ ID NO: 1 may include not only the base sequence of SEQ ID NO: 1, but also a base sequence having at least 80% homology or identity with SEQ ID NO: 1.
  • the protein is included in the base sequence of SEQ ID NO: 1
  • a base sequence having at least 80%, specifically at least 83%, at least 84%, at least 85%, at least 88%, at least 90%, at least 93%, at least 95%, or at least 97% homology or identity It may be encoded by a gene containing.
  • it is a base sequence encoding a protein having activity corresponding to a protein comprising the amino acid sequence of SEQ ID NO: 2, it is obvious that it is included in the scope of the present application.
  • probes which can be prepared from known gene sequences, for example, have a activity of a protein comprising the amino acid sequence of SEQ ID NO: 2 by hydration under stringent conditions with complementary sequences for all or part of the nucleotide sequence. Any sequence encoding a protein can be included without limitation.
  • stringent conditions are meant conditions that enable specific hybridization between polynucleotides. Such conditions are described specifically in the literature (eg, J. Sambrook et al., Homology).
  • genes with high homology or identity, 40% or more, specifically 85% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly specifically are hybridized with genes having a homology or identity greater than or equal to 99%, and genes with less homology or identity are not hybridized with each other, or washing conditions of ordinary Southern hybridization are 60 ° C., 1 ⁇ SSC, and 0.1%.
  • SDS in particular at a salt concentration and temperature corresponding to 60 ° C., 0.1 ⁇ SSC, 0.1% SDS, more specifically 68 ° C., 0.1 ⁇ SSC, 0.1% SDS, once, specifically 2-3 times
  • clean can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of the hybridization.
  • complementary is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.
  • the present application may also include isolated nucleic acid fragments that are complementary to the entire sequence as well as substantially similar nucleic acid sequences.
  • polynucleotides having homology or identity can be detected using hybridization conditions comprising a hybridization step at a Tm value of 55 ° C. and using the conditions described above.
  • the Tm value may be 60 ° C, 63 ° C or 65 ° C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • homology means the degree of agreement with two given amino acid sequences or nucleotide sequences and can be expressed in percentage.
  • homologous sequences thereof having the same or similar activity as a given amino acid sequence or base sequence are designated as "% homology”.
  • identity refers to the degree of sequence relevance between amino acid or nucleotide sequences, and in some cases determined by the match between strings of such sequences.
  • sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and the default gap penalty established by the program used may be used together.
  • Substantially, homologous or identical polynucleotides or polypeptides generally have a medium stringency or along at least about 50%, 60%, 70%, 80% or 90% of all or the full-length of the target polynucleotide or polypeptide. Will hybrid at high stringency.
  • polynucleotides containing degenerate codons instead of codons in the hybridizing polynucleotides are also contemplated.
  • any two polynucleotide or polypeptide sequences are at least for example 50%, 55%, 60%, 65% 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98 Whether having% or 99% homology or identity is described, for example, in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: can be determined using known computer algorithms such as the " FASTA " program using default parameters such as at 2444. Or in the needle-only program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet.
  • Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as can be determined, can be determined.
  • GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] 403 (1990); including Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and CARILLO ETA /. (1988) SIAM J Applied Math 48: 1073).
  • homology or identity can be determined using BLAST, or ClustalW, of the National Biotechnology Information Database Center.
  • the homology or identity of a polynucleotide or polypeptide is described, for example, in Smith and Waterman, Adv. Appl. As known in Math (1981) 2: 482, for example, Needleman et al. (1970), J Mol Biol. 48: 443, and can be determined by comparing the sequence information using a GAP computer program.
  • the GAP program defines the total number of symbols in the shorter of the two sequences, divided by the number of similarly arranged symbols (ie, nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or gap opening penalty 10, gap extension penalty 0.5); And (3) no penalty for the end gap.
  • the term “homology” or “identity” refers to a comparison between polypeptides or polynucleotides.
  • the microorganism of the genus Corynebacterium producing the 5'-xanthyl acid may be the activity of the protein comprising the amino acid sequence of SEQ ID NO: 2.
  • the activity of the protein comprising the amino acid sequence of SEQ ID NO: 2 can be used interchangeably with the same meaning as enhancing the activity of xmpE, or the activity of the protein encoded by the gene comprising the nucleotide sequence of SEQ ID NO: 1. have.
  • the term "enhanced the activity of a protein comprising the amino acid sequence of SEQ ID NO: 2” is the expression amount of the protein compared to the parent strain or a strain unmodified a protein containing the amino acid sequence of SEQ ID NO: 2 It means that the activity is increased or the activity is increased while the expression amount is the same, or the activity is increased at the same time the expression amount is increased. It also includes an increase in the protein relative to endogenous activity. In addition, it means that the expression amount or activity of xmpE is increased compared to the parent strain or unmodified strain.
  • enhancing the activity of the protein can be achieved by the application of various methods well known in the art.
  • the enhancement of activity may be achieved by increasing the copy number of the polynucleotide encoding the protein, enhancing promoter activity, initiation codon replacement, or a combination thereof, specifically 1) a polynucleotide encoding the protein.
  • the sequence of expression regulators promoter, operator, etc.
  • the method of modifying the sequence of the expression regulator can be achieved by the application of various methods well known in the art. Examples of the method may be performed by inducing a mutation on the expression regulator sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the expression regulator sequence, or by performing stronger activity. It can be performed by replacing with a base sequence having.
  • expression regulators include, but are not limited to, promoters, enhancers, operators, ribosomal binding sites, and sequences that control the termination of transcription and translation.
  • the method of modifying the sequence of the gene is carried out by inducing a mutation on the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the protein, or stronger It may be carried out by replacing with a sequence of a gene that is improved to have activity, but is not limited thereto.
  • enhancing the activity of the protein increases the copy number of xmpE; replacing the promoter of xmpE with a promoter with enhanced activity; replacing the start codon of xmpE; Or a combination thereof.
  • the term "vector” refers to a DNA preparation containing a nucleotide sequence of a polynucleotide encoding said target protein operably linked to a suitable regulatory sequence to enable expression of the target protein in a suitable host.
  • the regulatory sequence includes a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation.
  • the term “transformation” means introducing a vector comprising a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • Transformed polynucleotides include all of them, as long as they can be expressed in the host cell, regardless of whether they are inserted into or located outside the chromosome of the host cell.
  • the polynucleotide also includes DNA and RNA encoding the target protein.
  • the polynucleotide may be introduced in any form as long as it can be introduced into and expressed in a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a polynucleotide construct containing all the elements necessary for self expression.
  • the expression cassette typically includes a promoter, transcription termination signal, ribosomal binding site, and translation termination signal operably linked to the gene.
  • the expression cassette may be in the form of an expression vector capable of self replication.
  • the polynucleotide may be introduced into the host cell in its own form and operably linked with a sequence required for expression in the host cell.
  • microorganism producing 5'-xanthyl acid or "microorganism having 5'-xanthyl acid producing ability” refers to the production of microorganisms having 5'-xanthyl acid producing ability or 5'-xanthyl acid. It means a microorganism to which the production capacity of 5'-xanthyl acid is given to the parent strain which has no ability.
  • the protein comprising the amino acid sequence of SEQ ID NO: 2 or the activity of xmpE protein may be enhanced microorganism having 5'-xanthyl acid production ability.
  • the production capacity of the 5'- xanthyl acid of the microorganism may be to enhance / increase the discharge capacity of the 5'- xanthyl acid.
  • the "productivity" may be used interchangeably with the same meaning as “discharge capacity”.
  • the microorganism may be used interchangeably with the same meaning as "microorganism that discharges 5'-xanthyl acid” or "microorganism having 5'-xanthyl acid emission ability," and naturally has 5'-xanthyl acid emission capability. It may refer to a microorganism which is present, or a microorganism to which 5'-xanthyl acid is excreted or enhanced to a parent strain having no excretion capacity of 5'-xanthyl acid.
  • the microorganism of the genus Corynebacterium producing 5'-xanthyl acid is Corynebacterium stationis or Corynebacterium glutamicum, Corynebacterium ammonia geese (Corynebacterium ammnoniagenes), and more specifically Corynebacterium status, but is not limited thereto.
  • microorganism and 5'-xanthyl acid according to the present application are as described above.
  • the microorganism of the genus Corynebacterium may be Corynebacterium stationis , but is not limited thereto.
  • the culture of the genus Corynebacterium may be used any culture conditions and culture methods known in the art.
  • the term "culture” refers to the growth of microorganisms under appropriately artificially controlled environmental conditions.
  • the method of culturing the microorganism of the genus Corynebacterium may be performed using a method well known in the art.
  • the culture may be cultured batchwise, continuous or fed-batch in a batch process, injection batch or repeated injection batch process, but is not limited thereto.
  • the medium used for cultivation must meet the requirements of the particular strain in an appropriate manner.
  • Culture media for microorganisms of the genus Corynebacterium are known (eg, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).
  • sugar sources that can be used in the medium include glucose and saccharose, lactose, fructose, maltose, starch, cellulose and sugars such as carbohydrates, soybean oil, sunflower oil, castor oil, coconut oil and the like, palmit Acids, fatty acids such as stearic acid, linoleic acid, alcohols such as glycerol, ethanol, and organic acids such as acetic acid. These materials can be used individually or as a mixture, but are not limited thereto.
  • the carbon source that can be used may be raw sugar or glucose, may be molasses containing a large amount of raw sugar, specifically may be purified glucose, but is not limited thereto, and other carbon sources may be used in various ways.
  • Nitrogen sources that can be used include peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources can also be used individually or as a mixture, but are not limited thereto.
  • Personnel that can be used can include salts containing potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium.
  • the culture medium may include metal salts such as magnesium sulfate or iron sulfate required for growth.
  • metal salts such as magnesium sulfate or iron sulfate required for growth.
  • essential growth substances such as amino acids and vitamins can be used.
  • suitable precursors to the culture medium may be used. The above-mentioned raw materials may be added batchwise or continuously in a manner appropriate to the culture during the culturing process.
  • the pH of the culture can be adjusted by using a basic compound such as sodium hydroxide, potassium hydroxide, ammonia or an acid compound such as phosphoric acid or sulfuric acid in an appropriate manner during the culture of the microorganism.
  • a basic compound such as sodium hydroxide, potassium hydroxide, ammonia or an acid compound such as phosphoric acid or sulfuric acid
  • antifoaming agents such as fatty acid polyglycol esters can be used to inhibit bubble generation.
  • Oxygen or an oxygen-containing gas eg, air may be injected into the culture to maintain aerobic conditions.
  • the culture temperature may be usually 30 °C to 37 °C, more specifically 32 °C to 33 °C. Incubation time may be continued until the desired amount of 5'-xanthyl acid is obtained, but specifically 40 to 120 hours.
  • Separation of 5'-xanthyl acid from the culture can be separated by conventional methods known in the art.
  • methods such as centrifugation, filtration, ion exchange chromatography, and crystallization may be used.
  • the supernatant obtained by removing the biomass by centrifugation of the culture at low speed may be separated by ion exchange chromatography, but is not limited thereto.
  • the recovery step may further comprise a purification process.
  • a genomic DNA library of Corynebacterium stationis was constructed to identify membrane proteins of Corynebacterium involved in the excretion of 5'-xanthyl acid (XMP).
  • the genomic DNA of the ATCC6872 strain, Corynebacterium stainless wild type was extracted using an Intron G-Spin Total DNA Extraction Mini Kit (Cat. No 17045) according to the protocol provided in the kit.
  • a membrane protein library was prepared using the extracted genomic DNA as a template.
  • the prepared genomic DNA library was introduced into the strain of Corynebacterium KCCM-10530 which was used as a parent strain in Korean Patent Publication No. 10-2011-0105662.
  • KCCM-10530 strain exhibited growth inhibition.
  • Membrane protein genomic library plasmids of ATCC6872 strains were transformed into KCCM-10530 strains by electroporation, and colonies growing normally under medium conditions with excess XMP were selected. Plasmids of the selected colonies were obtained and analyzed by sequencing. From this study, one membrane protein involved in releasing growth deterioration under excessive XMP addition conditions was identified.
  • the one Corynebacterium membrane protein was identified by the nucleotide sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2 (NCBI GenBank: NZ_CP014279.1, WP_066795121, MFS transporter).
  • the membrane protein is known as an MFS transporter, but no clear function has been identified, and furthermore, no known function regarding XMP release. In the present application it is named 'xmpE'.
  • xmpE a protein involved in releasing the degradation of growth by XMP identified through Example 1, was deleted in an XMP producing strain, a vector of gene deletion was attempted to determine whether XMP excretion was decreased.
  • Gene fragments for the production of the vector was obtained by PCR with genomic DNA of ATCC6872 strain as a template. Specifically, PCR for the xmpE used the primers of SEQ ID NOs: 3 and 4. The primers used at this time were prepared based on information on the Corynebacterium stationis (ATCC6872) gene (NCBI Genbank: NZ_CP014279.1) and surrounding nucleotide sequences registered with the National Institutes of Health (NIH GenBank). It was.
  • PCR conditions were 5 minutes denaturation at 94 °C, 94 °C 30 seconds denaturation, 52 °C 30 seconds annealing, 72 °C 1 minute polymerization was repeated 25 times, and then polymerization was carried out at 72 °C 5 minutes.
  • About 1.0 kbp of polynucleotide template was obtained with xmpE gene fragment amplified using primers of SEQ ID NOs: 3 and 4.
  • a fragment of the obtained gene was cloned using Solgent's T vector to prepare a TOPO- ⁇ xmpE vector.
  • a 14 ml tube containing 3 ml of the following seed medium was inoculated with Corynebacterium stationary parent strain KCCM-10530 and one of the strains prepared above (KCCM-10530_ ⁇ xmpE) and at 24 ° C. for 24 hours. Shaking culture at 170 rpm. 0.7 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 32 ml of the following production medium (24 ml of this medium + 8 ml of separate sterilization medium) and shake-cultured at 170 rpm for 30 hours at 30 ° C. After the incubation, the production of XMP was measured by HPLC.
  • the medium composition used and the results of XMP concentration in the culture (Table 1) are as follows.
  • Glucose 2% Sodium sulfate 0.3%, Potassium phosphate 0.1%, Dipotassium phosphate 0.3%, Magnesium sulfate 0.3%, Calcium chloride 10 mg / L, Iron sulfate 10 mg / L, Zinc sulfate 1 mg / L, Manganese chloride 3.6 Mg / L, L-cysteine 20 mg / L, calcium pantothenate 10 mg / L, thiamine hydrochloride 5 mg / L, biotin 30 ⁇ g / L, adenine 20 mg / L, guanine 20 mg / L, pH 7.3
  • Glucose 50 g / L Magnesium sulfate 10 g / L, Calcium chloride 100 mg / L, Iron sulfate 20 mg / L, Manganese sulfate 10 mg / L, Zinc sulfate 10 mg / L, Copper sulfate 0.8 mg / L, Histidine 20 mg / L, cystine 15 mg / L, beta-alanine 15 mg / L, biotin 100 ⁇ g / L, thiamine 5 mg / L, adenine 50 mg / L, guanine 25 mg / L, niacin 5 mg / L, pH 7.0
  • xmpE is a protein involved in XMP excretion.
  • the activity of the xmpE protein in the strain was enhanced according to the following example, and the strain with enhanced xmpE activity was confirmed to increase the XMP production capacity / discharge capacity.
  • Example 3-1 Increased copy number of xmpE
  • Example 3-1-1 Construction of copy number increasing vector of xmpE
  • Gene fragments for the production of the vector was obtained by PCR with genomic DNA of ATCC6872 strain as a template. Specifically, amplification was carried out using primer pairs of SEQ ID NOs: 5 and 6 to include 484 bp of xmpE upstream, which is thought to be the promoter region of xmpE.
  • the amplified xmpE gene fragment was treated with restriction enzymes of XbaI and SpeI, cloned into the XbaI restriction enzyme site of the pDZ vector (Korean Patent Nos. 10-0924065 and 2008-033001), and the pDZ-xmpE vector Was produced.
  • xmpE PCR was performed with primer pairs of SEQ ID NOs: 7 and 6 for the production of two copy vectors.
  • Each DNA fragment thus obtained was digested with SpeI, a DNA restriction enzyme, and a fragment of the gene was cloned into a pDZ-xmpE vector digested with XbaI DNA restriction enzyme to prepare a vector.
  • the vector containing two copies of xmpE was named 'pDZ-xmpEmp2'.
  • Example 3-1-2 Evaluation of XMP Production Capacity of Copy Number Increase Strain of xmpE
  • Example 2 In order to measure the XMP production capacity of the strain was used the same culture method as in Example 2-2. After the incubation, the production of XMP was measured by the method using HPLC, and the culture results are shown in Table 2 below.
  • xmpE In order to enhance the activity of xmpE, which is expected to be involved in XMP excretion, we attempted to construct a vector that replaces the promoter of the xmpE gene with a promoter with high expression in order to confirm that the XMP excretion is increased.
  • a gene fragment for constructing a vector was obtained by PCR using genomic DNA of ATCC6872 strain as a template.
  • the promoter used Pcj7 (South Korea Patent No. 10-0620092), which is reported to be strongly expressed in Corynebacterium stance.
  • primer pairs of SEQ ID NOs: 10 and 11 using genomic DNA of ATCC6872 strain as a template, were used for PCR of the xmpE gene; And amplification using primer pairs of 14 and 15, respectively.
  • PCR conditions were 5 minutes denaturation at 94 °C, 94 °C 30 seconds denaturation, 52 °C 30 seconds annealing, 72 °C 1 min 30 seconds polymerization was repeated 25 times, and then polymerization was carried out at 72 °C 5 minutes.
  • Three amplified gene fragments Pcj7, xmpE-1, and xmpE-2 were subjected to overlapping polymerase chain reaction to obtain a 2.3 kbp polynucleotide template.
  • a fragment of the obtained gene was digested with restriction enzyme XbaI, and the fragment of the gene was cloned into a linear pDZ vector digested with XbaI restriction enzyme using T4 ligase to construct a 'pDZ-Pcj7 / xmpE' vector.
  • Example 3-2-2 Promoter replacement strain production of xmpE and evaluation of XMP production capacity
  • PDZ-Pcj7 / xmpE vector prepared in Example 3-2-1 was transformed to KCCM-10530 strain by puncture method (Appl. Microbiol. Biotechnol. (1999) 52: 541-545 Method), and the strain into which the vector was inserted on the chromosome by recombination of homologous sequences was selected in a medium containing 25 mg / L of kanamycin. The selected primary strains were again cross-overed to select strains with enhanced target genes. The gene promoter insertion of the final transformed strain was confirmed by performing PCR using primer pairs of SEQ ID NOs: 16 and 17. The strain replaced with a strong promoter through the method was named 'KCCM-10530_Pcj7 / xmpE', and the XMP production capacity of the strain was evaluated.
  • Example 3 In order to measure the XMP production capacity of the strain was used the same culture method as Example 2-2. After the incubation, the production of XMP was measured by the method using HPLC, and the culture results are shown in Table 3 below.
  • Example 3-3-1 Initiation Codon Replacement Vector Construction of xmpE
  • the vector to replace the existing start codon gtg with atg was prepared.
  • Gene fragments for the production of the vector was obtained by PCR with genomic DNA of ATCC6872 strain as a template.
  • Gene fragments (A, B) were obtained using primer pairs of SEQ ID NOs: 18 and 19 and primer pairs of SEQ ID NOs: 20 and 21, respectively, to prepare a vector to replace the existing start codon gtg with atg.
  • fragment A could obtain a polynucleotide of about 0.7 kbp and fragment B of about 1 kbp.
  • the two fragments were subjected to overlap PCR using the primers of SEQ ID NOs: 18 and 21 as templates to obtain a PCR product of about 1.7 kbp (hereinafter, referred to as 'g1a fragment').
  • the conditions of the overlapping PCR were modified for 5 minutes at 94 ° C., followed by repeating 25 times of 94 ° C. denaturation, 55 ° C. 30 seconds annealing, and 72 ° C. 120 seconds polymerization, followed by polymerization at 72 ° C. for 7 minutes.
  • a fragment of the obtained gene was digested with restriction enzyme XbaI, and a fragment of the gene was cloned into a linear pDZ vector digested with XbaI restriction enzyme using T4 ligase to construct a 'pDZ-xmpE (g1a)' vector.
  • Example 3-3-2 Preparation of initiation codon replacement strain of xmpE and evaluation of XMP production capacity
  • PDZ-xmpE (g1a) vector prepared in Example 3-3-1 was transformed to KCCM-10530 strain by puncture method (Appl. Microbiol. Biotechnol. (1999) 52: 541-545 Using a conversion method), the vector-inserted strain on the chromosome by recombination of the homologous sequence was selected in a medium containing kanamycin 25 mg / L. The selected primary strains were again cross-overed to select strains with enhanced target genes. Initiation codon replacement of the final transformed strain was confirmed by performing PCR using primer pairs of SEQ ID NOs: 18 and 21, and then analyzing the substituted nucleotide sequence through sequencing. The strain in which the selected xmpE start codon was replaced with atg was named 'KCCM-10530_xmpE (g1a), CJX1662', and the XMP production capacity of the strain was evaluated.
  • Example 2-2 In order to measure the XMP production capacity of the strain was used the same culture method as in Example 2-2. After the incubation, the production of XMP was measured by the method using HPLC, and the culture results are shown in Table 4 below.
  • the parent strain Corynebacterium station KCCM10530 xmpE initiation codon As a result of comparing the XMP concentration in the medium of CJX1662, as shown in Table 4, it was confirmed that under the same conditions, the CJX strain increased about 20% XMP concentration to 2.3 / L compared to the parent strain.
  • Example 3-4-1 Preparation of xmpE-enhanced strain based on XMP producer line derived from wild type
  • adenylosuccinate synthetase and XMP dehydrogenase corresponding to the degradation pathway of XMP were weakened to prepare a strain having xmp production capacity.
  • a strain was prepared in which the first bases of each base sequence of purA and guaA, which are genes encoding them, were changed from a to t. More specifically, in the ATCC6872 strain, the prepared strain, in which the expression of the two genes was weakened, was named 'CJX1663'.
  • the pDZ-xmpE (g1a) vector prepared in Example 3-3-2 was transformed into the prepared CJX1663 strain by electroporation, and kanamycin 25 mg of the vector-inserted strain on the chromosome by recombination of homologous sequences. Selection was made in medium containing / L. Strains to which the target genes were introduced were selected through the second cross again with respect to the selected primary strains. Gene introduction of the final transformed strain was confirmed by performing PCR using primer pairs of SEQ ID NOs: 18 and 21. .
  • the strain in which the selected xmpE start codon was replaced with atg was named 'CJX1663_xmpE (g1a)', and the XMP production capacity of the strain was evaluated.
  • the parent strain Corynebacterium stationus CJX1663 and the start codon of xmpE As a result of comparing the XMP concentration in the medium of CJX1663_xmpE (g1a), as shown in Table 5, the CJX1663_xmpE (g1a) strain increased about 33 % to 2.8 g / L compared to the parent strain under the same conditions. It was confirmed.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 5'-크산틸산을 생산하는 미생물 및 이를 이용하여 5'-크산틸산을 제조하는 방법에 관한 것이다.

Description

5'-크산틸산을 생산하는 미생물 및 이를 이용한 5'-크산틸산의 제조방법
본 출원은 5'-크산틸산을 생산하는 미생물 및 이를 이용하여 5'-크산틸산을 제조하는 방법에 관한 것이다.
5'-크산틸산(5'-xanthosine monophosphate: XMP)은 핵산 생합성 대사계의 중간물질로 동식물의 체내에서 생리적으로 중요한 의미를 가질 뿐 아니라 식품, 의약품 및 각종 의료적 용도로 다방면에서 이용되고 있다. 특히, 글루타민산나트륨(MSG)과 같이 사용하면 맛의 상승 효과가 크므로 정미성 조미료로 각광을 받고 있는 핵산계 조미료 중의 하나이다.
또한, 5'-크산틸산은 퓨린 뉴클레오타이드(purine nucleotide) 생합성 대사계의 중간 생성물로 5'-구아닌산(5'-guanosine monophosphate: GMP)의 제조 원료로서도 중요한 물질이다. 정미성이 강하고 상품적 가치가 높은 5'-구아닌산의 제조방법으로서 현재 널리 이용되고 있는 방법은 미생물 발효법으로서, 5'-크산틸산을 생산하고 이를 효소학적으로 5'-구아닌산으로 전환시키는 과정이 가장 경제적이어서 5'-구아닐산의 수요만큼 5'-크산틸산도 필요하다.
5'-크산틸산의 제조방법에는 (1) 화학합성 방법, (2) 제조된 5'-구아닌산을 탈 아미노화하는 방법, (3) 발효 배지 내 전구물질로 크산틴(xanthine)을 첨가하여 발효 생산하는 방법, (4) 5'-크산틸산 생산 미생물 변이주의 직접 발효를 통한 생산법 등이 알려져 있다. 이 가운데 미생물 변이주에 의한 5'-크산틸산의 직접적인 발효 제조 방법이 경제적으로 유리하다. 그러나, 여전히 효율적으로 고수율로 5'-크산틸산을 생산할 수 있는 방법에 대한 연구의 필요성이 대두되고 있다.
본 발명자들은 5'-크산틸산을 고효율로 생산할 수 있는 미생물을 개발하고자 예의 연구한 결과, 특정 단백질의 활성을 강화시키는 경우 5'-크산틸산의 생산 수율이 증가한다는 사실을 확인하여 본 출원을 완성하였다.
본 출원의 하나의 목적은 서열번호 2의 아미노산 서열을 포함하는 단백질의 활성이 강화된, 5'-크산틸산을 생산하는 코리네박테리움 속 미생물을 제공하는 것이다.
본 출원의 또 하나의 목적은 상기 미생물을 이용한 5'-크산틸산의 제조방법을 제공하는 것이다.
본 출원의 코리네박테리움 속 유래의 미생물은 5'-크산틸산 배출 단백질의 활성이 강화되어 5'-크산틸산의 생산성이 증가된 것이므로, 5'-크산틸산의 생산에서 원가 절감에 크게 기여할 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
상기와 같은 목적을 달성하기 위하여, 본 출원은 하나의 양태로서 서열번호 2의 아미노산 서열을 포함하는 단백질의 활성이 강화된, 5'-크산틸산을 생산하는 코리네박테리움 속 미생물을 제공한다.
본 출원에서 용어, "5'-크산틸산"(5'-xanthylic acid, xanthosine)은 잔토신일인산염, 잔틸산, 크산틸산 등으로 명명되는 화합물을 의미한다. 본 출원에서, 상기 5'-크산틸산은 "XMP"로 혼용되어 명명될 수 있다.
본 출원에서 용어, "서열번호 2의 아미노산 서열을 포함하는 단백질"은 미생물에서 5'-크산틸산의 배출 기능을 수행하는 MFS 트랜스포터(MFS transporter; Major facilitator superfamily transporter) 유전자에 의해 암호화되는 코리네박테리움 속 미생물에 내재적으로 존재하는 단백질을 의미한다. 구체적으로 코리네박테리움 속 미생물에 내재적으로 존재하는 서열번호 2의 아미노산 서열을 포함하는 MFS 트랜스포터 단백질일 수 있다. 또한, 상기 단백질은 서열번호 2의 아미노산 서열로 구성되는 단백질, 서열번호 2의 아미노산 서열로 이루어지는 단백질일 수 있으나, 이에 제한되지 않는다. 또한, 본 출원에서 상기 MFS 트랜스포터 단백질은 'xmpE' 또는 'xmpE 단백질'로 명명될 수 있다.
또한, 본 출원에서 '특정 서열번호를 포함하는 단백질'은 해당 서열번호의 아미노산 서열을 포함하는 단백질과 동일 혹은 상응하는 활성을 가지는 경우라면 해당 서열번호의 아미노산 서열 앞뒤에 단백질 변이에 아무런 영향을 주지 않는 서열 추가 또는 자연적으로 발생할 수 있는 돌연변이, 혹은 이의 잠재성 돌연변이(silent mutation)를 모두 포함하며, 이러한 서열 추가 혹은 돌연변이를 가지는 경우에도 본 출원의 범위 내에 속하는 것이 자명하다.
또한, 본 출원의 단백질은 상기 서열번호 2로 기재한 아미노산 서열뿐만 아니라, 서열번호 2와 적어도 60% 상동성 또는 동일성을 갖는 아미노산 서열을 포함할 수 있다. 상기 서열번호 2의 아미노산 서열과 60% 이상의 상동성 또는 동일성을 갖는 아미노산을 포함하는 단백질은 상기 서열번호 2의 아미노산 서열에 대해서 적어도 60% 이상, 구체적으로는 70% 이상, 보다 구체적으로는 80% 이상, 보다 더 구체적으로는 83% 이상, 84% 이상, 85%이상, 88% 이상, 90% 이상, 93% 이상, 95% 이상, 또는 97% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함하는 단백질을 포함할 수 있다. 상동성 또는 동일성을 갖는 아미노산 서열은 상기 범주 중 100% 동일성을 갖는 서열은 제외되거나, 100% 미만의 동일성을 갖는 서열일 수 있다. 상기 서열과 상동성 또는 동일성을 갖는 서열로서 실질적으로 서열번호 2의 아미노산 서열과 동일하거나 상응하는 생물학적 활성을 갖는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 경우도 역시 본 출원의 범주에 포함됨은 자명하다.
아울러, 상기 서열번호 2의 아미노산 서열을 포함하는 단백질을 암호화하는 유전자의 염기 서열은 공지의 데이터 베이스에서 얻을 수 있으며, 그 예로 NCBI의 GenBank 등이 있으나, 이에 제한되지 않는다. 구체적으로, 상기 서열번호 2의 아미노산 서열을 포함하는 단백질은 서열번호 1의 염기 서열을 포함하는 유전자에 의해 암호화되는 것일 수 있다. 또한, 서열번호 1의 염기 서열을 포함하거나, 서열번호 1의 염기 서열로 구성되거나, 서열번호 1의 염기 서열로 이루어지는 유전자에 의해 암호화되는 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 서열번호 1의 염기 서열은 서열번호 1의 염기 서열뿐만 아니라, 서열번호 1과 적어도 80% 상동성 또는 동일성을 갖는 염기 서열도 포함하는 것일 수 있다.
구체적으로, 상기 서열번호 2와 적어도 80% 상동성 또는 동일성을 갖는 아미노산 서열을 포함하는 단백질을 암호화할 수 있는 염기 서열이면 본 출원의 범주에 포함되나, 상기 단백질은 상기 서열번호 1의 염기 서열에 대하여 적어도 80% 이상, 구체적으로는 83% 이상, 84% 이상, 85% 이상, 88% 이상, 90% 이상, 93% 이상, 95% 이상, 또는 97% 이상의 상동성 또는 동일성을 가지는 염기 서열을 포함하는 유전자에 의해 암호화될 수 있다. 그러나, 서열번호 2의 아미노산 서열을 포함하는 단백질에 상응하는 활성을 가지는 단백질을 암호화하는 염기 서열이라면, 이에 제한되지 않고 본 출원의 범주에 포함되는 것은 자명하다.
또한, 코돈의 축퇴성(genetic code degeneracy)에 기인하여 동일 아미노산 서열을 포함하는 단백질 또는 이와 상동성 또는 동일성을 가지는 단백질로 번역될 수 있는 폴리뉴클레오티드 역시 포함될 수 있음은 자명하다. 또한 공지의 유전자 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, 서열번호 2의 아미노산 서열을 포함하는 단백질의 활성을 가지는 단백질을 암호화하는 서열이라면 제한 없이 포함될 수 있다. 상기 "엄격한 조건"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 유전자끼리, 40% 이상, 구체적으로는 85% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성 또는 동일성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화의 세척 조건인 60℃, 1×SSC, 0.1% SDS, 구체적으로는 60℃, 0.1×SSC, 0.1% SDS, 보다 구체적으로는 68℃, 0.1×SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다. 혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
본 출원에서, 용어 "상동성"은 두 개의 주어진 아미노산 서열 또는 염기 서열과 일치하는 정도를 의미하며 백분율로 표시될 수 있다. 본 명세서에서, 주어진 아미노산 서열 또는 염기 서열과 동일하거나 유사한 활성을 가지는 그의 상동성 서열이 "% 상동성"으로 표시된다.
또한, 용어 "동일성"은 아미노산 또는 뉴클레오티드 서열 사이의 서열 관련성 정도를 의미하며, 경우에 따라서는 그러한 서열의 스트링 사이의 일치에 의해 결정된다.
용어 "상동성" 및 "동일성"은 종종 상호교환적으로 이용된다.
보존된 (conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성 또는 동일성이 있는 폴리뉴클레오티드 또는 폴리펩티드는 일반적으로 모두 또는 타겟 폴리뉴클레오티드 또는 폴리펩티드의 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90%를 따라 중간 엄격도 또는 높은 엄격도에서 하이브리드할 것이다. 하이브리드하는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 적어도 예를 들어, 50%, 55%, 60%, 65% 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% 또는 99% 상동성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(바람직하게는, 버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48 : 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 일진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다. 따라서, 본원에서 사용된 것으로서, 용어 "상동성" 또는 "동일성"은 폴리펩티드 또는 폴리뉴클레오티드 사이의 비교를 나타낸다.
본 출원에서, 상기 5'-크산틸산을 생산하는 코리네박테리움 속 미생물은 서열번호 2의 아미노산 서열을 포함하는 단백질의 활성이 강화된 것일 수 있다.
이때, 상기 서열번호 2의 아미노산 서열을 포함하는 단백질의 활성 강화는 xmpE의 활성 강화, 또는 상기 서열번호 1의 염기 서열을 포함하는 유전자에 의해 암호화되는 단백질의 활성 강화와 동일한 의미로 혼용되어 사용될 수 있다.
본 출원에서 용어 "서열번호 2의 아미노산 서열을 포함하는 단백질의 활성이 강화된"은 상기 단백질의 발현이 모균주 또는 서열번호 2의 아미노산 서열을 포함하는 단백질이 비변형된 균주에 비하여 발현양이 증가되거나, 발현양이 동일하면서 그 활성이 증가되거나, 또는 발현량이 증가함과 동시에 그 활성도 증가된 것을 의미한다. 또한 상기 단백질이 내재적 활성에 비해 증가된 것 역시 포함한다. 또한, xmpE의 발현양 또는 활성이 모균주 또는 비변형 균주에 비하여 증가된 것을 의미한다.
본 출원에 있어서, 상기 단백질의 활성 강화는 당업계에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다. 상기 방법의 예로, 상기 활성의 강화는 상기 단백질을 암호화하는 폴리뉴클레오티드의 카피수 증가, 프로모터 활성 강화, 개시코돈 교체 또는 이의 조합에 의해 달성될 수 있으며, 구체적으로 1) 상기 단백질을 암호화하는 폴리뉴클레오티드의 카피수를 증가시키는 방법; 2) 상기 폴리뉴클레오티드의 발현이 증가하도록 발현 조절인자(프로모터, 오퍼레이터 등)의 서열을 변형시키는 방법; 3) 상기 단백질의 활성이 강화되도록 염색체 상의 상기 유전자(개시코돈 등)의 서열을 변형시키는 방법 등이 있으며, 이들의 조합으로도 달성할 수 있으나, 특별히 이에 제한되는 것은 아니다.
구체적으로, 상기 단백질의 활성 강화에 있어서,
상기 발현 조절인자의 서열을 변형하는 방법은, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다. 상기 방법의 예로, 상기 발현 조절인자 서열의 활성을 더욱 강화하도록 염기 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 발현 조절인자 서열 상의 변이를 유도하여 수행하거나, 더욱 강한 활성을 갖는 염기 서열로 교체함으로써 수행할 수 있다. 상기 발현 조절인자는 프로모터, 인핸서, 오퍼레이터, 리보좀 결합 부위, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 제한되는 것은 아니다.
또한, 상기 유전자의 서열을 변형하는 방법은, 상기 단백질의 활성을 더욱 강화하도록 유전자 서열을 결실, 삽입, 비보전적 또는 보전적 치환 또는 이들의 조합으로 서열 상의 변이를 유도하여 수행하거나, 또는 더욱 강한 활성을 갖도록 개량된 유전자의 서열로 교체함으로써 수행할 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 일 구체예에서, 상기 단백질의 활성 강화는 xmpE의 카피수를 증가시키거나; xmpE의 프로모터를 활성이 강화된 프로모터로 교체하거나; xmpE의 개시코돈을 교체하거나; 또는 이들의 조합을 통해 달성될 수 있다.
본 출원에서, 상기 용어 "벡터"는 적합한 숙주 내에서 목적 단백질을 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 단백질을 암호화하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 암호화하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다. 벡터는 적당한 숙주 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서, 상기 용어 "형질전환"은 표적 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터를 숙주 세포 내에 도입하여 숙주 세포 내에서 상기 폴리뉴클레오티드가 암호화하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주 세포 내에 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하든지 상관없이 이들 모두를 포함한다. 또한, 상기 폴리뉴클레오티드는 표적 단백질을 암호화하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주 세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는, 자체적으로 발현되는데 필요한 모든 요소를 포함하는 폴리뉴클레오티드 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 유전자에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결 신호, 리보좀 결합부위 및 번역 종결신호를 포함한다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어, 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있다.
본 출원에서 용어 "5'-크산틸산을 생산하는 미생물" 또는 "5'-크산틸산 생산능을 가지는 미생물"은 자연적으로 5'-크산틸산 생산능을 가지고 있는 미생물 또는 5'-크산틸산의 생산능이 없는 모균주에 5'-크산틸산의 생산능이 부여된 미생물을 의미한다. 구체적으로, 서열번호 2의 아미노산 서열을 포함하는 단백질 또는 xmpE 단백질의 활성이 강화되어 5'-크산틸산 생산능을 갖는 미생물일 수 있다.
또한, 본 출원의 목적상, 상기 미생물의 5'-크산틸산의 생산능은 5'-크산틸산의 배출능이 강화되어 향상/증가되는 것일 수 있다.
구체적으로, 본 출원에서 상기 "생산능"은 "배출능"과 동일한 의미로 혼용되어 사용될 수 있다. 또한, 상기 미생물은 "5'-크산틸산을 배출하는 미생물" 또는 "5'-크산틸산 배출능을 가지는 미생물"과 동일한 의미로 혼용되어 사용될 수 있으며, 자연적으로 5'-크산틸산 배출능을 가지고 있는 미생물 또는 5'-크산틸산의 배출능이 없는 모균주에 5'-크산틸산의 배출능이 부여되거나 강화된 미생물을 의미할 수 있다.
구체적으로, 상기 5'-크산틸산을 생산하는 코리네박테리움 속 미생물은 코리네박테리움 스테셔니스(Corynebacterium stationis) 또는 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 암모니아게제스(Corynebacterium ammnoniagenes)일 수 있으며, 더욱 구체적으로 코리네박테리움 스테셔니스일 수 있으나, 이에 제한되지 않는다.
다른 하나의 양태로서, 본 출원에 따른 상기 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및 상기 미생물 또는 배지로부터 5'-크산틸산을 회수하는 단계를 포함하는, 5'-크산틸산을 제조방법을 제공한다.
본 출원에 따른 상기 미생물 및 5'-크산틸산은 앞서 설명한 바와 같다.
본 출원에서, 상기 코리네박테리움 속 미생물은 코리네박테리움 스테셔니스(Corynebacterium stationis)일 수 있으나, 이에 제한되지 않는다.
본 출원의 방법에 있어서, 코리네박테리움 속 미생물의 배양은 당업계에 알려진 임의의 배양 조건 및 배양 방법이 사용될 수 있다.
본 출원에서 용어 "배양"은 미생물을 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다. 본 출원에서 코리네박테리움 속 미생물을 배양하는 방법은 당업계에 널리 알려져 있는 방법을 이용하여 수행할 수 있다. 구체적으로, 상기 배양은 배치 공정, 주입 배치 또는 반복 주입 배치 공정에서 회분식, 연속식 또는 유가식으로 배양할 수 있으나, 이에 제한되는 것은 아니다.
배양에 사용되는 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 한다. 코리네박테리움 속 미생물에 대한 배양 배지는 공지되어 있다(예를 들면, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).
구체적으로, 배지 중에서 사용될 수 있는 당원으로는 포도당, 사카로즈, 유당, 과당, 말토즈, 전분, 셀룰로즈와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있으며, 이에 제한되는 것은 아니다.
사용될 수 있는 탄소원으로는 원당 또는 포도당일 수 있고, 원당을 다량으로 포함한 당밀일 수 있으며, 구체적으로 정제 포도당일 수 있으나, 이에 제한되는 것은 아니며, 이외의 탄소원이 다양하게 이용될 수 있다.
사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함된다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있으며, 이에 제한되는 것은 아니다.
사용될 수 있는 인원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨을 함유하는 염이 포함될 수 있다.
또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 포함할 수 있다. 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장 물질이 사용될 수 있다. 또한, 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기된 원료들은 배양과정에서 배양물에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있다.
또한, 상기 미생물의 배양 중 수산화나트륨, 수산화칼륨, 암모니아와 같은 기초 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다. 또한, 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 호기 상태를 유지하기 위해 배양물 내로 산소 또는 산소-함유 기체(예, 공기)를 주입할 수 있다.
구체적으로, 배양 온도는 보통 30℃ 내지 37℃, 더욱 구체적으로는 32℃ 내지 33℃일 수 있다. 배양 시간은 원하는 5'-크산틸산의 생성량이 얻어질 때까지 계속될 수 있으나, 구체적으로는 40 내지 120시간일 수 있다.
배양물로부터의 5'-크산틸산의 분리는 당업계에 알려진 통상적인 방법에 의하여 분리될 수 있다. 이러한 분리방법에는, 원심분리, 여과, 이온교환 크로마토그래피 및 결정화 등의 방법이 이용될 수 있다. 예를 들면, 배양물을 저속 원심분리하여 바이오매스를 제거하고 얻어진 상등액을, 이온교환 크로마토그래피를 통하여 분리할 수 있으나, 이에 한정되는 것은 아니다.
상기 회수 단계는 정제 공정을 추가로 포함할 수 있다.
이하 본 출원을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 5'-크산틸산(XMP) 배출 단백질의 발굴
5'-크산틸산(XMP)의 배출에 관여하는 코리네테박테리움의 막 단백질을 동정하기 위해 코리네박테리움 스테셔니스(Corynebacterium stationis, ATCC6872)의 게노믹 DNA 라이브러리를 제작하였다. 코리네박테리움 스테셔니스 야생형인 ATCC6872 균주의 게노믹 DNA는 인트론(Intron) 사의 G-스핀 토탈 DNA 추출 미니 키트(Cat. No 17045)를 이용하여 키트에 제공된 프로토콜에 따라 추출하였다. 상기 추출한 게노믹 DNA를 주형으로 막 단백질 라이브러리를 제작하였다.
어느 단백질이 배출 기능을 하는지 알아보기 위하여, 제작된 게노믹 DNA 라이브러리를 대한민국 공개특허 제10-2011-0105662에서 모균주로 사용된 코리네박테리움 KCCM-10530 균주에 도입하였다.
이후, 1.7%의 한천을 첨가한 최소 배지 내에 추가적으로 XMP를 첨가하여 KCCM-10530 균주가 생육 저하(growth inhibition)를 나타내는 스크리닝 조건을 수립하였다. ATCC6872 균주의 막 단백질 게노믹 라이브러리 플라스미드를 KCCM-10530 균주에 전기천공법으로 형질전환시키고, 과량의 XMP가 첨가된 배지 조건에서 정상적으로 생육하는 콜로니들을 선별하였다. 선별된 콜로니의 플라스미드를 획득하여 염기서열 분석법을 통해 염기 서열을 분석하였다. 이와 같은 연구로부터 과량의 XMP 첨가 조건에서 생육 저하를 해제시키는데 관여하는 막 단백질 1종을 동정하였다.
상기 1종의 코리네박테리움 막 단백질은 서열번호 1의 염기 서열 및 서열번호 2의 아미노산 서열(NCBI GenBank: NZ_CP014279.1, WP_066795121, MFS transporter)로 확인되었다. 상기 막 단백질은 MFS 트랜스포터(MFS transporter)로 알려져 있으나 명확한 기능이 확인되지 않았으며, 더욱이 XMP 배출에 관한 기능에 대해서는 알려져 있지 않았다. 본 출원에서는 이를 'xmpE'로 명명하였다.
실시예 2: xmpE의 동정
실시예 2-1: xmpE 결손 벡터 제작
상기 실시예 1을 통하여 동정한 XMP에 의한 생육 저하를 해제시키는데 관여하는 단백질인 xmpE를 XMP 생산 균주에서 결손시키는 경우, XMP 배출능이 감소하는지 확인하기 위하여 유전자의 결손 벡터를 제작하고자 하였다.
벡터를 제작하기 위한 유전자 단편은 ATCC6872 균주의 게노믹 DNA를 주형으로 PCR을 통하여 획득하였다. 구체적으로, 상기 xmpE에 대한 PCR은 서열번호 3 및 4의 프라이머를 이용하였다. 이때 이용한 프라이머는 미국 국립보건원 유전자은행(NIH GenBank)에 등록되어 있는 코리네박테리움 스테셔니스(Corynebacterium stationis, ATCC6872) 유전자(NCBI Genbank: NZ_CP014279.1) 및 주변 염기서열에 대한 정보를 바탕으로 제작하였다.
PCR의 조건은 94℃에서 5분간 변성 후, 94℃ 30초 변성, 52℃ 30초 어닐링, 72℃ 1분 중합을 25회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다. 서열번호 3 과 4의 프라이머를 이용해 증폭된 xmpE의 유전자 단편으로 약 1.0kbp의 폴리뉴클레오티드 주형을 얻을 수 있었다. 얻어진 유전자의 단편을 솔젠트(Solgent) 사의 T 벡터를 이용하여 클로닝함으로써 TOPO-△xmpE 벡터를 제작하였다.
실시예 2-2: xmpE 결손 균주 제작
상기 실시예 2-1에서 제작된 1종의 벡터를 KCCM-10530 균주에 전기천공법으로 형질전환한 후(Appl. Microbiol.Biotechnol. (1999) 52:541-545에 의한 형질 전환법 이용), 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주를 카나마이신(kanamycin) 25 ㎎/L를 함유한 영양 배지에서 선별하였다. 선별한 xmpE 결손 균주는 'KCCM-10530_△xmpE'로 명명하고, 상기 균주의 XMP의 생산능을 평가하였다.
하기 종배지 3 ml을 함유하는 14 ml 튜브(tube)에 코리네박테리움 스테이셔니스 모균주 KCCM-10530과 상기 제작한 1종의 균주(KCCM-10530_△xmpE)를 접종하고 30℃에서 24시간 동안 170 rpm으로 진탕 배양하였다. 하기의 생산배지 32 ml(본배지 24 ml + 별도 살균 배지 8 ml)을 포함하고 있는 250 ml 코너-바플 플라스크에 0.7 ml의 종 배양액을 접종하고 30℃에서 72시간 동안 170 rpm으로 진탕 배양하였다. 배양 종료 후 HPLC를 이용한 방법에 의해 XMP의 생산량을 측정하였다. 사용된 배지 조성과 배양액 중의 XMP 농도 결과(표 1)는 하기와 같다.
XMP 최소배지
포도당 2%, 황산나트륨 0.3%, 인산제1칼륨 0.1%, 인산제2칼륨 0.3%, 황산마그네슘 0.3%, 염화칼슘 10 ㎎/L, 황산철 10 ㎎/L, 황산아연 1 ㎎/L, 염화망간 3.6 ㎎/L, L-시스테인 20 ㎎/L, 칼슘 판토테네이트 10 ㎎/L, 티아민 염산염 5 ㎎/L, 바이오틴 30 ㎍/L, 아데닌 20 ㎎/L, 구아닌 20 ㎎/L, pH 7.3
XMP 영양배지
펩톤 1%, 육즙 0.5%, 염화나트륨 0.25%, 효모 엑기스 1%, 우레아 0.3%, 아데닌 50 ㎎/L, 구아닌 50 ㎎/L, 한천 2%, pH 7.2
XMP 플라스크 종배지
포도당 20 g/L, 펩톤 10 g/L, 효모엑기스 10 g/L, 염화나트륨 2.5 g/L, 우레아 3 g/L, 아데닌 150 ㎎/L, 구아닌 150 ㎎/L, pH 7.0
XMP 플라스크 생산배지(본배지)
포도당 50 g/L, 황산마그네슘 10 g/L, 염화칼슘 100 ㎎/L, 황산철 20 ㎎/L, 황산망간 10 ㎎/L, 황산아연 10 ㎎/L, 황산구리 0.8 ㎎/L, 히스티딘 20 ㎎/L, 시스틴 15 ㎎/L, 베타-알라닌 15 ㎎/L, 비오틴 100 ㎍/L, 티아민 5 ㎎/L, 아데닌 50 ㎎/L, 구아닌 25 ㎎/L, 니아신 5 ㎎/L, pH 7.0
XMP 플라스크 생산배지(별도 살균 배지)
인산 제1칼륨 18 g/L, 인산 제2칼륨 42 g/L, 우레아 7 g/L, 황산암모늄 5 g/L
균주번호 XMP(g/L) 수율(%)
KCCM10530 11.8 23.6
KCCM10530-△xmpE 1.6 3.2
모균주인 KCCM-10530과 xmpE 결손 균주인 KCCM-10530_△xmpE의 배지 내 XMP 농도를 비교한 결과, 상기의 표 1에 나타난 바와 같이, 동일한 조건 하에서 KCCM10530-△xmpE 균주는 모균주 대비 XMP의 농도가 대략 10g/L 이상 감소함을 확인하였다.
따라서, xmpE는 XMP 배출에 관여하는 단백질임을 확인하였다.
실시예 3: xmpE 단백질의 활성 강화
균주 내 xmpE 단백질의 활성을 하기 실시예 에 따라 강화하였고, xmpE의 활성이 강화된 균주는 XMP 생산능/배출능이 증가하는지 확인하였다.
실시예 3-1: xmpE의 카피수 증가
실시예 3-1-1: xmpE의 카피수 증가 벡터 제작
XMP 배출능에 관여하는 것으로 예상되는 xmpE의 활성을 강화하는 경우, XMP 배출능이 증가하는지 확인하기 위하여 xmpE 유전자의 강화 벡터를 제작하였으며, 강화의 방법 중 하나인 카피수(copy number) 증가 방법을 이용하여 다음과 같은 실험을 진행하였다.
벡터를 제작하기 위한 유전자 단편은 ATCC6872 균주의 게노믹 DNA를 주형으로 PCR을 통하여 획득하였다. 구체적으로, xmpE의 프로모터 부위로 생각되는 xmpE 업스트림(upstream) 484bp를 포함하도록 하는 서열번호 5 및 6의 프라이머 쌍을 이용해 증폭하였다. 증폭된 xmpE 유전자 단편을 XbaI과 SpeI의 제한효소로 처리하였으며, pDZ 벡터(대한민국 등록특허 제10-0924065호 및 국제 공개특허 제2008-033001호)의 XbaI 제한효소 자리에 클로닝하여, pDZ-xmpE 벡터를 제작하였다. 이후, 2 카피 벡터 제작을 위해 xmpE는 서열번호 7 및 6의 프라이머 쌍으로 PCR을 수행하였다. 확보된 각각의 DNA 단편은 DNA 제한효소인 SpeI으로 절단하고, XbaI DNA 제한효소로 절단한 pDZ-xmpE 벡터에 상기 유전자의 단편을 클로닝하여 벡터를 제조하였다. 2 카피의 xmpE가 포함된 상기 벡터는 'pDZ-xmpEⅩ2'로 명명하였다.
실시예 3-1-2: xmpE의 카피수 증가 균주의 XMP 생산능 평가
상기 실시예 3-1-1에서 제작된 pDZ-xmpEX2 벡터를 KCCM-10530 균주에 전기천공법으로 형질전환한 후(Appl. Microbiol.Biotechnol. (1999) 52:541-545에 의한 형질 전환법 이용), 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주를 카나마이신(kanamycin) 25 ㎎/L를 함유한 배지에서 선별하였다. 선별된 1차 균주에 대하여 다시 2차 교차(cross-over)를 거쳐, 목표 유전자가 도입된 균주를 선별하였다. 최종 형질전환된 균주의 유전자 도입 여부는 서열번호 8 및 9의 프라이머 쌍을 이용하여 PCR을 수행함으로써 확인하였다. 선별된 xmpE 카피수 증가 균주는 'KCCM-10530_xmpEⅩ2'로 명명하고, 상기 균주의 XMP의 생산능을 평가하였다.
상기 균주의 XMP 생산능을 측정하기 위하여 상기 실시예 2-2와 같은 배양 방법을 이용하였다. 배양 종료 후 HPLC를 이용한 방법에 의해 XMP의 생산량을 측정하였으며, 배양 결과는 아래 표 2와 같다.
균주번호 XMP(g/L) 수율(%)
KCCM10530 11.8 23.6
KCCM10530-xmpEⅩ2 13.1 26.1
모균주인 코리네박테리움 스테이셔니스 KCCM10530와 xmpE 카피수 증가 균주인 KCCM-10530_xmpEⅩ2의 배지 내 XMP 농도를 비교한 결과, 상기의 표 2에 나타난 바와 같이, 동일한 조건 하에서 KCCM-10530_xmpEⅩ2 균주는 모균주 대비 XMP의 농도가 1.3g/L로 약 11% 증가함을 확인하였다.
상기와 같은 xmpE 단백질의 활성의 증가로 인한 XMP 생산량 증가 결과는 매우 의미 있는 것으로 해석할 수 있다.
실시예 3-2: xmpE의 프로모터 교체 발현 강화
실시예 3-2-1: xmpE의 프로모터 교체 벡터 제작
XMP 배출능에 관여하는 것으로 예상되는 xmpE의 활성을 강화하는 경우, XMP 배출능이 증가하는지 확인하기 위하여 xmpE 유전자의 프로모터를 발현이 강한 프로모터로 교체하는 벡터를 제작하고자 하였다. 먼저 벡터를 제작하기 위한 유전자 단편은 ATCC6872 균주의 게노믹 DNA를 주형으로 PCR을 통하여 획득하였다.
프로모터는 코리네박테리움 스테셔니스에서 강하게 발현된다고 보고되어있는 Pcj7(대한민국 등록 특허 10-0620092)를 사용하였다.
Pcj7 유전자 단편을 증폭하기 위해서 ATCC6872 균주의 게노믹 DNA를 주형으로 하여 서열번호 10 및 11의 프라이머 쌍을 이용하고, xmpE 유전자에 대한 PCR은 서열번호 12 및 13; 및 14 및 15의 프라이머 쌍을 이용하여 각각 증폭하였다. PCR의 조건은 94℃에서 5분간 변성 후, 94℃ 30초 변성, 52℃ 30초 어닐링, 72℃ 1분 30초 중합을 25회 반복한 후, 72℃에서 5분간 중합반응을 수행하였다. 증폭된 유전자 세 단편 Pcj7과 xmpE-1, xmpE-2를 주형으로 중첩(overlapping) 중합효소 연쇄 반응을 실시하여 2.3 kbp의 폴리뉴클레오티드 주형을 얻었다. 얻어진 유전자의 단편은 제한효소 XbaI으로 절단하고, T4 리가아제를 이용하여 XbaI 제한효소로 절단시킨 선상의 pDZ 벡터에 상기 유전자의 단편을 클로닝하여 'pDZ-Pcj7/xmpE' 벡터를 제작하였다.
실시예 3-2-2: xmpE의 프로모터 교체 균주 제작 및 XMP 생산능 평가
상기 실시예 3-2-1에서 제작된 pDZ-Pcj7/xmpE 벡터를 KCCM-10530 균주에 천기천공법으로 형질전환한 후(Appl. Microbiol.Biotechnol. (1999) 52:541-545에 의한 형질 전환법 이용), 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주를 카나마이신(kanamycin) 25 ㎎/L를 함유한 배지에서 선별하였다. 선별된 1차 균주에 대하여 다시 2차 교차(cross-over)를 거쳐, 목표 유전자가 강화된 균주를 선별하였다. 최종 형질전환된 균주의 유전자 프로모터 삽입 여부는 서열번호 16 및 17의 프라이머 쌍을 이용하여 PCR을 수행함으로써 확인하였다. 상기 방법을 통하여 강한 프로모터로 교체된 균주는 'KCCM-10530_Pcj7/xmpE'로 명명하고, 상기 균주의 XMP의 생산능을 평가하였다.
균주의 XMP 생산능을 측정하기 위하여 상기 실시예 2-2와 같은 배양 방법을 이용하였다. 배양 종료 후 HPLC를 이용한 방법에 의해 XMP의 생산량을 측정하였으며, 배양 결과는 아래 표 3과 같다.
균주번호 XMP(g/L) 수율(%)
KCCM10530 11.8 23.6
KCCM10530-Pcj7/xmpE 12.5 25.0
모균주인 코리네박테리움 스테이셔니스 KCCM10530와 강한 프로모터로 xmpE의 발현이 강화된 균주인 KCCM-10530_Pcj7/xmpE의 배지 내 XMP 농도를 비교한 결과, 상기의 표 3에 나타난 바와 같이, 동일한 조건 하에서 KCCM-10530_Pcj7/xmpE 균주는 모균주 대비 XMP의 농도가 0.7g/L로 약 6% 증가함을 확인하였다.
상기와 같은 xmpE 단백질의 활성의 증가로 인한 XMP 생산량 증가 결과는 매우 의미 있는 것으로 해석할 수 있다.
실시예 3-3: xmpE의 개시코돈 교체
실시예 3-3-1: xmpE의 개시코돈 교체 벡터 제작
XMP 배출능에 관여하는 것으로 예상되는 xmpE의 단백질 발현을 강화하는 경우, XMP 배출능이 증가하는지 확인하기 위하여 기존 개시코돈인 gtg를 atg로 교체하는 벡터를 제작하고자 하였다. 벡터를 제작하기 위한 유전자 단편은 ATCC6872 균주의 게노믹 DNA를 주형으로 PCR을 통하여 획득하였다. 기존 개시코돈인 gtg를 atg로 교체하는 벡터를 제작하고자 서열번호 18 및 19의 프라이머 쌍 및 서열번호 20 및 21의 프라이머 쌍을 이용해 유전자 단편(A, B)을 각각 얻었다. PCR의 조건은 94℃에서 5분간 변성 후, 94℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 1분 중합을 25회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다. 그 결과 단편 A는 약 0.7kbp, 단편 B는 약1kbp의 폴리뉴클레오티드를 획득할 수 있었다. 상기 두 단편을 주형으로 서열번호 18 및 21의 프라이머를 이용하여 중첩 PCR을 실시하여 약 1.7kbp의 PCR 결과물(이하, 'g1a 단편'이로 명명함)을 얻었다. 중첩 PCR의 조건은 94℃에서 5분간 변성 후, 94℃ 30초 변성, 55℃ 30초 어닐링, 72℃ 120초 중합을 25회 반복한 후, 72℃에서 7분간 중합반응을 수행하였다.
얻어진 유전자의 단편은 제한효소 XbaI으로 절단하고, T4 리가아제를 이용하여 XbaI 제한효소로 절단시킨 선상의 pDZ 벡터에 상기 유전자의 단편을 클로닝하여 'pDZ-xmpE(g1a)' 벡터를 제작하였다.
실시예 3-3-2: xmpE의 개시코돈 교체 균주제작 및 XMP 생산능 평가
상기 실시예 3-3-1에서 제작된 pDZ-xmpE(g1a) 벡터를 KCCM-10530 균주에 천기천공법으로 형질전환한 후(Appl. Microbiol.Biotechnol. (1999) 52:541-545에 의한 형질 전환법 이용), 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주를 카나마이신(kanamycin) 25 ㎎/L를 함유한 배지에서 선별하였다. 선별된 1차 균주에 대하여 다시 2차 교차(cross-over)를 거쳐, 목표 유전자가 강화된 균주를 선별하였다. 최종 형질전환된 균주의 개시코돈 교체 여부는 서열번호 18 및 21의 프라이머 쌍을 이용하여 PCR을 수행한 뒤, 염기서열 분석법을 통해 치환된 염기서열을 분석하여 확인하였다. 선별된 xmpE 개시코돈이 atg로 교체된 균주는 'KCCM-10530_ xmpE(g1a), CJX1662'로 명명하고, 상기 균주의 XMP의 생산능을 평가하였다.
상기 균주의 XMP 생산능을 측정하기 위하여 상기 실시예 2-2와 같은 배양 방법을 이용하였다. 배양 종료 후 HPLC를 이용한 방법에 의해 XMP의 생산량을 측정하였으며, 배양 결과는 아래 표 4와 같다.
균주번호 XMP(g/L) 수율(%)
KCCM10530 11.8 23.6
CJX662 14.1 28.2
모균주인 코리네박테리움 스테이셔니스 KCCM10530와 xmpE의 개시코돈이 교체된 균주인 CJX1662의 배지 내 XMP 농도를 비교한 결과, 상기의 표 4에 나타난 바와 같이, 동일한 조건 하에서 CJX 균주는 모균주 대비 XMP의 농도가 2.3/L로 약 20% 증가함을 확인하였다.
상기와 같은 xmpE 단백질의 활성의 증가로 인한 XMP 생산량 증가 결과는 매우 의미 있는 것으로 해석할 수 있다.
또한, 상기 제작된 KCCM10530-xmpE(g1a), CJX1662 균주를 부다페스트조약 하의 수탁기관인 한국미생물보존센터에 2018년 4월 11일자로 기탁하여 수탁번호 KCCM12248P를 부여받았다.
실시예 3-4 야생형 유래의 XMP 생산주 기반 xmpE 강화 균주 제작
실시예 3-4-1: 야생형 유래의 XMP 생산주 기반 xmpE 강화 균주 제작
야생형 ATCC6872 균주에서 XMP의 분해경로에 해당하는 아데닐로석시네이트 신타아제(adenylosuccinate synthetase) 및 XMP 디하이드로게나아제(XMP dehydrogenase)의 활성을 약화시켜, xmp 생산능을 갖는 균주를 제작하였다. 상기 두 효소의 활성을 약화하기 위하여, 이들을 각각 암호화하는 유전자인 purA 및 guaA의 각 염기서열의 1번째 염기가 a에서 t로 변경된, 균주를 제작하였다. 보다 구체적으로, ATCC6872 균주에서 상기 두 유전자의 발현이 약화된, 제조된 균주는 'CJX1663'으로 명명하였다.
제조된 CJX1663 균주에 상기 실시예 3-3-2에서 제작된 pDZ-xmpE(g1a) 벡터를 전기천공법으로 형질전환하여 상동성 서열의 재조합에 의해 염색체 상에 벡터가 삽입된 균주를 카나마이신 25 ㎎/L를 함유한 배지에서 선별하였다. 선별된 1차 균주에 대하여 다시 2차 교차를 거쳐, 목표 유전자가 도입된 균주를 선별하였다. 최종 형질전환된 균주의 유전자 도입 여부는 서열번호 18 및 21의 프라이머 쌍을 이용하여 PCR을 수행함으로써 확인하였다. .
선별된 xmpE 개시코돈이 atg로 교체 된 균주는 'CJX1663_xmpE(g1a)'로 명명하고, 상기 균주의 XMP의 생산능을 평가하였다.
배양 종료 후 HPLC를 이용한 방법에 의해 XMP의 생산량을 측정하였으며, 배양 결과는 아래 표 5와 같다.
균주번호 XMP(g/L) 수율(%)
CJX1663 2.1 4.2
CJX1663_ xmpE(g1a) 2.8 5.6
모균주인 코리네박테리움 스테이셔니스 CJX1663와 xmpE의 개시코돈이 교체된 균주인 CJX1663_xmpE(g1a)의 배지 내 XMP 농도를 비교한 결과, 상기의 표 5에 나타난 바와 같이, 동일한 조건 하에서 CJX1663_ xmpE(g1a) 균주는 모균주 대비 XMP의 농도가 2.8g/L로 약 33% 증가함을 확인하였다.
이로부터 본 출원의 5'-크산틸산을 배출하는 단백질(xmpE)의 활성을 강화함으로써, XMP 생산량을 증가시킬 수 있음을 확인하였다.
한편, 본 출원에서 사용된 프라이머의 서열은 하기 표 6과 같다.
서열번호 서열
3 GTCAAACTCTTTACGCCGACG
4 CGACAACACCAACAGATACTGC
5 atgctctagaCTAGATCTTCTCGACGGGCAG
6 ATGATactagtCCTTGGGGACTTCGCGTGTCG
7 ATGATactagtCTAGATCTTCTCGACGGGCAG
8 TTCGGCTCAGCATTTTCCAC
9 CAATAGTGGTCGCGATGACG
10 GCAGTAAGGAGAATCagaaacatcccagcgctacta
11 ACCTCTTCGGTTGTGTGCAcGAGTGTTTCCTTTCGTTGGG
12 atgctctagaTCCAGTGTGGTTAAGAAGTCG
13 cgctgggatgtttctGATTCTCCTTACTGCAGT
14 GTACCCAACGAAAGGAAACACTcgTGCACACAACCGAAGAGGT
15 atgctctagaTTATTGAGCCAGAACCATGG
16 CTAGATCTTCTCGACGGGCAG
17 CAATAGTGGTCGCGATGACG
18 atgctctagaTCCAGTGTGGTTAAGAAGTCG
19 GACCTCTTCGGTTGTGTGCAtGATTCTCCTTACTGCAGTTA
20 TAACTGCAGTAAGGAGAATCaTGCACACAACCGAAGAGGTC
21 atgctctagaCTCGCTCTTGTCGACAACAC
이상의 설명으로부터, 본원이 속하는 기술분야의 당업자는 본원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2018007027-appb-I000001

Claims (6)

  1. 서열번호 2의 아미노산 서열을 포함하는 단백질의 활성이 강화된, 5'-크산틸산을 생산하는 코리네박테리움 속 미생물.
  2. 제1항에 있어서, 상기 단백질은 서열번호 1의 염기서열을 포함하는 유전자로 암호화되는 것인, 코리네박테리움 속 미생물.
  3. 제1항에 있어서, 상기 활성의 강화는 상기 단백질을 암호화하는 폴리뉴클레오티드의 카피수 증가, 프로모터 활성 강화, 개시코돈 교체 또는 이의 조합에 의해 달성되는 것인, 코리네박테리움 속 미생물.
  4. 제1항에 있어서, 상기 5'-크산틸산을 생산하는 코리네박테리움 속 미생물은 코리네박테리움 스테셔니스(Corynebacterium stationis)인, 5'-크산틸산을 생산하는 코리네박테리움 속 미생물.
  5. 제1항 내지 제4항 중 어느 한 항의 코리네박테리움 속 미생물을 배지에서 배양하는 단계; 및
    상기 미생물 또는 배지에서 5'-크산틸산을 회수하는 단계를 포함하는, 5'-크산틸산의 제조방법.
  6. 제5항에 있어서, 상기 5'-크산틸산을 생산하는 코리네박테리움 속 미생물은 코리네박테리움 스테셔니스(Corynebacterium stationis)인, 5'-크산틸산의 제조방법.
PCT/KR2018/007027 2018-06-07 2018-06-21 5'-크산틸산을 생산하는 미생물 및 이를 이용한 5'-크산틸산의 제조방법 WO2019235680A1 (ko)

Priority Applications (13)

Application Number Priority Date Filing Date Title
PL18899009.7T PL3597756T3 (pl) 2018-06-07 2018-06-21 Mikroorganizm wytwarzający kwas 5’-ksantylowy i sposób wytwarzania kwasu 5’-ksantylowego z jego użyciem
EP18899009.7A EP3597756B1 (en) 2018-06-07 2018-06-21 Microorganism producing 5'-xanthylic acid and method for producing 5'-xanthylic acid by using same
SG11201904426XA SG11201904426XA (en) 2018-06-07 2018-06-21 Microorganism of the genus Corynebacterium producing 5'-xanthosine monophosphate and method for preparing 5'-xanthosine monophosphate using the same
MX2019009214A MX2019009214A (es) 2018-06-07 2018-06-21 Microorganismo del genero corynebacterium que produce 5'-xantosina monofosfato y procedimiento de preparacion de 5'-xantosina monofosfato mediante el uso del mismo.
JP2019528686A JP6938633B2 (ja) 2018-06-07 2018-06-21 ５’−キサンチル酸を生産する微生物及びこれを用いた５’−キサンチル酸の製造方法
BR112019016482-0A BR112019016482B1 (pt) 2018-06-07 2018-06-21 Micro-organismo do gênero corynebacterium que produz monofosfato de 5'-xantosina e método para produzir monofosfato de 5'-xantosina
RU2019115576A RU2720520C1 (ru) 2018-06-07 2018-06-21 Микроорганизм рода Corynebacterium, продуцирующий ксантозин-5'-монофосфат, и способ получения ксантозин-5'-монофосфата c использованием этого микроорганизма
AU2018386357A AU2018386357B2 (en) 2018-06-07 2018-06-21 Microorganism of the genus Corynebacterium producing 5’-xanthosine monophosphate and method for preparing 5’-xanthosine monophosphate using the same
US16/465,774 US10844348B2 (en) 2018-06-07 2018-06-21 Microorganism of the genus Corynebacterium producing 5′-xanthosine monophosphate and method for preparing 5′-xanthosine monophosphate using the same
ES18899009T ES2970730T3 (es) 2018-06-07 2018-06-21 Microorganismo productor de ácido 5'-xantílico y método para producir ácido 5'-xantílico utilizando el mismo
ZA2019/03098A ZA201903098B (en) 2018-06-07 2019-05-17 Microorganism of the genus corynebacterium producing 5'-xanthosine monophosphate and method for preparing 5'-xanthosine monophosphate using the same
US17/076,074 US11332708B2 (en) 2018-06-07 2020-10-21 Microorganism of the genus Corynebacterium producing 5′-xanthosine monophosphate and method for preparing 5′-xanthosine monophosphate using the same
AU2021204450A AU2021204450B2 (en) 2018-06-07 2021-06-29 Microorganism Of The Genus Corynebacterium Producing 5'-Xanthosine Monophosphate And Method For Preparing 5'-Xanthosine Monophosphate Using The Same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020180065681A KR101929158B1 (ko) 2018-06-07 2018-06-07 5'-크산틸산을 생산하는 미생물 및 이를 이용한 5'-크산틸산의 제조방법
KR10-2018-0065681 2018-06-07

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/465,774 A-371-Of-International US10844348B2 (en) 2018-06-07 2018-06-21 Microorganism of the genus Corynebacterium producing 5′-xanthosine monophosphate and method for preparing 5′-xanthosine monophosphate using the same
US17/076,074 Continuation US11332708B2 (en) 2018-06-07 2020-10-21 Microorganism of the genus Corynebacterium producing 5′-xanthosine monophosphate and method for preparing 5′-xanthosine monophosphate using the same

Publications (1)

Publication Number Publication Date
WO2019235680A1 true WO2019235680A1 (ko) 2019-12-12

Family

ID=64671316

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/007027 WO2019235680A1 (ko) 2018-06-07 2018-06-21 5'-크산틸산을 생산하는 미생물 및 이를 이용한 5'-크산틸산의 제조방법

Country Status (17)

Country Link
US (2) US10844348B2 (ko)
EP (1) EP3597756B1 (ko)
JP (1) JP6938633B2 (ko)
KR (1) KR101929158B1 (ko)
CN (2) CN112210522B (ko)
AU (2) AU2018386357B2 (ko)
BR (1) BR112019016482B1 (ko)
ES (1) ES2970730T3 (ko)
HU (1) HUE065774T2 (ko)
MX (1) MX2019009214A (ko)
PL (1) PL3597756T3 (ko)
PT (1) PT3597756T (ko)
RU (1) RU2720520C1 (ko)
SG (2) SG10202103819XA (ko)
TW (1) TWI790378B (ko)
WO (1) WO2019235680A1 (ko)
ZA (1) ZA201903098B (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111363694A (zh) * 2020-01-21 2020-07-03 中国科学院城市环境研究所 一株停滞棒杆菌、筛选方法及其用途

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113755374B (zh) * 2021-09-08 2022-05-03 山东省神农生态科技股份有限公司 一种降解2,4-二氯酚的停滞棒杆菌及其应用
KR102419166B1 (ko) * 2021-09-23 2022-07-08 씨제이제일제당 주식회사 신규한 글루타민 가수분해 gmp 합성효소 변이체 및 이를 이용한 퓨린 뉴클레오티드의 생산방법

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
WO2008033001A1 (en) 2006-09-15 2008-03-20 Cj Cheiljedang Corporation A corynebacteria having enhanced l-lysine productivity and a method of producing l-lysine using the same
KR20090080654A (ko) * 2008-01-22 2009-07-27 씨제이제일제당 (주) 5'-크산틸산 생산능이 향상된 코리네박테리움 속 미생물및 이를 이용한 5'-크산틸산의 생산 방법
KR20100070219A (ko) * 2008-12-17 2010-06-25 씨제이제일제당 (주) ５＇－크산틸산 생산능이 향상된 미생물 및 이를 이용한 ５＇－크산틸산의 생산방법
KR20110105662A (ko) 2010-03-19 2011-09-27 씨제이제일제당 (주) ５'－크산틸산 및 ５'－구아닐산 생산능이 향상된 미생물 및 이를 이용한 5'－크산틸산 또는 ５'－구아닐산의 생산방법
US20140080185A1 (en) * 2008-01-10 2014-03-20 Ajinomoto Co., Inc. Method for Producing a Target Substance by Fermentation

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6822084B1 (en) * 1999-06-25 2004-11-23 Basf Aktiengesellschaft Corynebacterium glutamicum genes encoding stress, resistance and tolerance proteins
KR100344016B1 (ko) * 2000-04-08 2002-07-20 제일제당주식회사 5'-크산틸산을 생산하는 미생물
RU2209249C2 (ru) * 2000-11-22 2003-07-27 Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика" Способ получения ксантозин-5'-монофосфата, штамм corynebacterium ammoniagenes - продуцент ксантозин-5'-монофосфата (варианты)
KR101072720B1 (ko) * 2008-12-17 2011-10-11 씨제이제일제당 (주) ５＇－구아닐산 생산능이 향상된 미생물 및 이를 이용한 ５＇－구아닐산의 생산방법
JP5636648B2 (ja) * 2009-08-10 2014-12-10 味の素株式会社 ５’−グアニル酸の製造法
SG11201506127WA (en) * 2013-02-11 2015-09-29 Evolva Sa Efficient production of steviol glycosides in recombinant hosts

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
WO2008033001A1 (en) 2006-09-15 2008-03-20 Cj Cheiljedang Corporation A corynebacteria having enhanced l-lysine productivity and a method of producing l-lysine using the same
KR100924065B1 (ko) 2006-09-15 2009-10-27 씨제이제일제당 (주) Ｌ－라이신 생산능이 향상된 코리네박테리아 및 그를 이용한 ｌ－라이신 생산 방법
US20140080185A1 (en) * 2008-01-10 2014-03-20 Ajinomoto Co., Inc. Method for Producing a Target Substance by Fermentation
KR20090080654A (ko) * 2008-01-22 2009-07-27 씨제이제일제당 (주) 5'-크산틸산 생산능이 향상된 코리네박테리움 속 미생물및 이를 이용한 5'-크산틸산의 생산 방법
KR20100070219A (ko) * 2008-12-17 2010-06-25 씨제이제일제당 (주) ５＇－크산틸산 생산능이 향상된 미생물 및 이를 이용한 ５＇－크산틸산의 생산방법
KR20110105662A (ko) 2010-03-19 2011-09-27 씨제이제일제당 (주) ５'－크산틸산 및 ５'－구아닐산 생산능이 향상된 미생물 및 이를 이용한 5'－크산틸산 또는 ５'－구아닐산의 생산방법

Non-Patent Citations (19)

* Cited by examiner, † Cited by third party
Title
"Atlas of Protein Sequence and Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
"NCBI Genbank", Database accession no. NZ CP0 14279.1
"NCBI GenBank", Database accession no. NZ_CP014279.1
APPL. MICROBIOL. BIOTECHNOL., vol. 52, 1999, pages 541 - 545
ATSCHUL, [S.] [F., J MOLEC BIOL, vol. 215, 1990, pages 403
CARILLO, SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DATABASE GenBank 7 July 2017 (2017-07-07), "MFS transporter [Corynebacterium stationis", XP055632680, Database accession no. WP_088859234 *
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
GRIBSKOV ET AL., NUCL. ACIDS RES., vol. 14, 1986, pages 6745
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
NEEDLEMAN ET AL., J MOL BIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
NOGUCHI, Y.: "31P NMR studies of energy metabolism in xanthosine-5'-monophosphate overproducing Corynebacterium ammoniagenes", EUR. J. BIOCHEM., vol. 0, no. 12, 27 June 2003 (2003-06-27), pages 2622 - 2626, XP055632676 *
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET., vol. 16, 2000, pages 276 - 277, XP004200114, doi:10.1016/S0168-9525(00)02024-2
See also references of EP3597756A4
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482
WASHINGTON D.C., MANUAL OF METHODS FOR GENERAL BACTERIOLOGY BY THE AMERICAN SOCIETY FOR BACTERIOLOGY, 1981

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111363694A (zh) * 2020-01-21 2020-07-03 中国科学院城市环境研究所 一株停滞棒杆菌、筛选方法及其用途

Also Published As

Publication number Publication date
CN109913397A (zh) 2019-06-21
EP3597756A1 (en) 2020-01-22
US10844348B2 (en) 2020-11-24
BR112019016482A2 (pt) 2020-12-22
ZA201903098B (en) 2020-02-26
EP3597756A4 (en) 2020-09-30
ES2970730T3 (es) 2024-05-30
AU2021204450A1 (en) 2021-07-29
KR101929158B1 (ko) 2018-12-13
JP2020521431A (ja) 2020-07-27
PT3597756T (pt) 2024-02-19
AU2018386357B2 (en) 2021-04-29
AU2021204450B2 (en) 2023-08-03
US20200263126A1 (en) 2020-08-20
JP6938633B2 (ja) 2021-09-22
AU2018386357A1 (en) 2020-01-02
US11332708B2 (en) 2022-05-17
HUE065774T2 (hu) 2024-06-28
TWI790378B (zh) 2023-01-21
MX2019009214A (es) 2019-12-16
EP3597756B1 (en) 2023-12-13
CN112210522B (zh) 2024-01-05
CN109913397B (zh) 2020-07-07
TW202012429A (zh) 2020-04-01
US20210040441A1 (en) 2021-02-11
RU2720520C1 (ru) 2020-04-30
SG11201904426XA (en) 2020-01-30
CN112210522A (zh) 2021-01-12
PL3597756T3 (pl) 2024-05-06
SG10202103819XA (en) 2021-05-28
BR112019016482B1 (pt) 2022-11-01

Similar Documents

Publication Publication Date Title
WO2019147078A1 (ko) 퓨린 뉴클레오티드를 생산하는 코리네박테리움 속 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2019117671A1 (ko) 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법
WO2020027362A1 (ko) 신규 아데닐로석시네이트 신세타아제 및 이를 이용한 퓨린 뉴클레오티드 생산방법
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
WO2020175735A1 (ko) 신규 프로모터 및 이를 이용한 퓨린 뉴클레오티드 제조방법
WO2013095071A2 (ko) Ｌ-라이신 생산능을 갖는 미생물을 이용하여 ｌ-라이신을 생산하는 방법
WO2019164346A1 (ko) L-트립토판을 생산하는 재조합 코리네형 미생물 및 이를 이용한 l-트립토판을 생산하는 방법
WO2020022547A1 (ko) 신규 5'-이노신산 디하이드로게나아제 및 이를 이용한 5'-이노신산 제조방법
WO2019190192A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2019235680A1 (ko) 5'-크산틸산을 생산하는 미생물 및 이를 이용한 5'-크산틸산의 제조방법
WO2020218736A1 (ko) L-히스티딘 생산능이 강화된 미생물 및 이를 이용한 히스티딘 생산방법
WO2017007159A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2020196993A1 (ko) 변이형 포스포리보실피로포스페이트 아미도트랜스퍼라아제 및 이를 이용한 퓨린 뉴클레오티드 제조방법
WO2015163682A1 (ko) 2，3－부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2，3－부탄디올의 생산 방법
WO2020067618A1 (ko) 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법
WO2022245176A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2022239953A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163923A1 (ko) 신규한 atp 포스포리보실트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2021125867A1 (ko) 화합물을 생산하는 미생물 및 이를 이용한 화합물의 생산 방법
WO2021045472A1 (ko) 신규한 프로모터 및 이를 이용한 목적 물질 생산 방법
WO2022149865A2 (ko) GlxR 단백질 변이체 또는 이를 이용한 쓰레오닌 생산방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2019528686

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018899009

Country of ref document: EP

Effective date: 20190715

ENP Entry into the national phase

Ref document number: 2018386357

Country of ref document: AU

Date of ref document: 20180621

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019016482

Country of ref document: BR

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 112019016482

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190808