WO2022245176A1 - 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법 - Google Patents

퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법 Download PDF

Info

Publication number
WO2022245176A1
WO2022245176A1 PCT/KR2022/007225 KR2022007225W WO2022245176A1 WO 2022245176 A1 WO2022245176 A1 WO 2022245176A1 KR 2022007225 W KR2022007225 W KR 2022007225W WO 2022245176 A1 WO2022245176 A1 WO 2022245176A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
pita
microorganism
gene
activity
Prior art date
Application number
PCT/KR2022/007225
Other languages
English (en)
French (fr)
Inventor
이지현
권희수
김대영
배현정
이지혜
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to EP22805029.0A priority Critical patent/EP4342990A1/en
Priority to BR112023024323A priority patent/BR112023024323A2/pt
Priority to JP2023572150A priority patent/JP2024518643A/ja
Priority to CN202280049499.8A priority patent/CN117980485A/zh
Priority to AU2022276997A priority patent/AU2022276997A1/en
Publication of WO2022245176A1 publication Critical patent/WO2022245176A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/32—Nucleotides having a condensed ring system containing a six-membered ring having two N-atoms in the same ring, e.g. purine nucleotides, nicotineamide-adenine dinucleotide

Definitions

  • the present application relates to a Corynebacterium stationis microorganism having an ability to produce purine nucleotides with enhanced activity of a phosphate uptake system (Pit system) and a method for producing purine nucleotides using the microorganism.
  • a phosphate uptake system Pan system
  • Purine nucleotides for example, 5'-inosine monophosphate; hereinafter IMP), 5'-xanthosine monophosphate; 5'-guanosine monophosphate;
  • GMP is an intermediate material in the nucleic acid biosynthesis metabolic system, and plays a physiologically important role in the body, and is widely used in food and medicine.
  • IMP itself is known to taste beef
  • GMP derived from XMP is known to taste mushroom, and both substances are known to enhance the flavor of monosodium glutamic acid (MSG) and are in the limelight as a flavorful nucleic acid-based seasoning. have.
  • Phosphoric acid is a component of purine nucleotides, provides energy necessary for the growth of microorganisms, and is essential for the biosynthesis of phospholipids, nucleic acids and proteins in cell membranes. It also plays a key role in cell signaling processes.
  • Pi inorganic orthophosphate
  • Influx of microbial Pi depends on the function of an importer present in the cell membrane.
  • Previously known Pi importers include the Pst system, a high-affinity Pi import system that regulates expression by recognizing the concentration of Pi outside the cell, and the Pst system, which is expressed regardless of the Pi concentration and imports Pi in a mixed form with metal ions.
  • a Pit system, an antiporter transport system that introduces glycerol-3-phosphate and glucose-6-phosphate in the form of organic phosphoric acid, and the like are known.
  • the problem to be solved by the present application is to provide a Corynebacterium stationis microorganism having a purine nucleotide production ability with enhanced activity of a phosphate inlet system (Pit system) and a method for producing purine nucleotides using the microorganism.
  • a phosphate inlet system Pit system
  • One object of the present application is to provide a Corynebacterium stationary microorganism having an enhanced activity of a phosphate inlet system (Pit system) and a nucleotide production ability.
  • Another object of the present application is to provide a method for producing purine nucleotides comprising culturing a Corynebacterium stationis microorganism having the ability to produce purine nucleotides in a medium.
  • Another object of the present application is a microorganism having the ability to produce the purine nucleotide, Corynebacterium stationis; medium in which it was cultured; Or to provide a composition for the production of purine nucleotides comprising a combination thereof.
  • Another object of the present application is to provide a use of a Corynebacterium stationis microorganism capable of producing purine nucleotides for producing purine nucleotides.
  • microorganisms capable of producing purine nucleotides can efficiently produce purine nucleotides, and can greatly contribute to cost reduction when purine nucleotides are produced on an industrial scale.
  • One aspect of the present application is to provide a Corynebacterium stationis microorganism having an enhanced activity of a phosphate uptake system (Pit system) encoded by a pit gene and an ability to produce purine nucleotides.
  • a phosphate uptake system Pan system
  • phosphate uptake system refers to a polypeptide having a function of introducing phosphoric acid into cells or a system including the same.
  • the phosphoric acid inlet system may include a phosphoric acid importer.
  • the phosphoric acid inlet system may be a Pit system.
  • phosphate importer refers to a polypeptide having a function of absorbing phosphoric acid into cells.
  • Phosphoric acid is mainly absorbed into cells in the form of inorganic orthophosphate (hereinafter referred to as Pi), and depends on the function of the importer present in the cell membrane.
  • Pi importers may include a Pst system, a Pit system, and an antiporter transport system that introduces glycerol-3-phosphate and glucose-6-phosphate, which are organic phosphoric acid forms. Not limited.
  • the term "Pit system” means a phosphate transporter (low-affinity; tellurite importer; hereinafter pit) showing low affinity with Pi. It is known that the expression of the Pit system does not depend on the concentration of Pi outside the cell, and Pi enters the cell in the form of a metal cation complex. (JOURNAL OF BACTERIOLOGY, Sept. 2001, p. 5008-5014 Vol. 183, No. 17)
  • the Pit system includes one or more polypeptides encoded by one or more genes selected from pit, pit1, pit2, pit3, pitA, pitB, and pitC , or one or more Pit, Pit1, Pit2, Pit3, PitA, PitB, and PitC polypeptides.
  • the Pit system may be a polypeptide encoded by an inorganic phosphate transporter ( pitA ) gene or a PitA polypeptide, but is not limited thereto.
  • the Pit system may include the polypeptide described in the amino acid sequence of SEQ ID NO: 1, but the system or polypeptide may have a difference in the amino acid sequence of the enzyme exhibiting the activity depending on the species or strain of the microorganism, Not limited to this.
  • the PitA polypeptide or the polypeptide encoded by the pitA gene may consist of the polypeptide described in the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.
  • the PitA polypeptide or the polypeptide encoded by the pitA gene may have, include, consist of, or consist essentially of the amino acid sequence shown in SEQ ID NO: 1, but is not limited thereto. More specifically, SEQ ID NO: 1 may be a polypeptide sequence encoded by the pitA gene and having a phosphoric acid importer activity.
  • the polypeptide encoded by the pitA gene is 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the amino acid sequence of SEQ ID NO: 1 It may include polypeptides having the above homology or identity, but is not limited thereto.
  • the amino acid sequence of SEQ ID NO: 1 can be obtained from various databases such as NCBI's GenBank, which is a known database, but is not limited thereto. For example, it may be derived from Escherichia coli , but is not limited thereto, and a sequence having the same activity as the amino acid may be included without limitation.
  • the polypeptide having the activity of the phosphoric acid importer, Pit system, or PitA in the present application is described as a polypeptide comprising the amino acid of SEQ ID NO: 1, meaningless sequences added to or behind the amino acid sequence of SEQ ID NO: 1 may occur naturally.
  • polypeptide having the activity of the phosphoric acid importer or Pit system of the present application contains the amino acid sequence of SEQ ID NO: 1 or 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% , 98%, or 99% or more homologous or identical amino acid sequences.
  • the polypeptide having the activity of the PitA polypeptide or the polypeptide encoded by the pitA gene of the present application is the amino acid sequence of SEQ ID NO: 1 or 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% , a polypeptide consisting of an amino acid sequence having 98%, or 99% or greater homology or identity.
  • polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted, or added is also included within the scope of the polypeptide of the present application. have.
  • polypeptides having amino acid sequences in which some sequences are deleted, modified, substituted, conservatively substituted, or added can also be used in the present application, provided that they have the same or corresponding activity as the polypeptide consisting of the amino acid sequence of .
  • the "conservative substitution” refers to the substitution of one amino acid with another amino acid having similar structural and/or chemical properties. Such amino acid substitutions can generally occur based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the polypeptide.
  • the Pit system may be encoded by one or more genes selected from pit, pit1, pit2, pit3, pitA, pitB , and pitC , but is not limited thereto.
  • the Pit system may be encoded by a polynucleotide containing the nucleotide sequence represented by SEQ ID NO: 2, but is not limited thereto due to codon degeneracy.
  • the Pit system is a base sequence having 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the base sequence of SEQ ID NO: 2. It may be encoded by a polynucleotide containing, but is not limited thereto.
  • the PitA polypeptide or the polypeptide encoded by the pitA gene may be encoded by a polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 2, but is not limited thereto.
  • the PitA polypeptide or the polypeptide encoded by the pitA gene is 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more of the nucleotide sequence of SEQ ID NO: 2. It may be encoded by a polynucleotide containing a nucleotide sequence having homology or identity, but is not limited thereto.
  • amino acid sequence of SEQ ID NO: 1 may be encoded by, for example, a polynucleotide containing the nucleic acid sequence of SEQ ID NO: 2.
  • polynucleotide refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are connected in a long chain shape by covalent bonds.
  • the polynucleotide may encode a phosphate importer having the amino acid sequence of SEQ ID NO: 1 or a polypeptide exhibiting the activity of the Pit system, but is not limited thereto.
  • the polynucleotide may be included without limitation as long as it is a polynucleotide encoding a polypeptide having the activity of the phosphate importer, Pit system, or PitA according to the present application.
  • the gene encoding the amino acid sequence of the phosphate importer or Pit system is any one or more genes selected from pit, pit1, pit2, pit3, pitA, pitB, and pitC , and the gene may be derived from Escherichia coli . but not limited thereto.
  • the polynucleotide encoding the polypeptide exhibiting the activity of the phosphate importer, Pit system, or PitA may include a nucleotide sequence encoding the amino acid described in SEQ ID NO: 1.
  • the polynucleotide may include, for example, the nucleotide sequence of SEQ ID NO: 2, and the homology or identity thereto is 80%, specifically 90% or more, more specifically 95% or more, 96% or more, 97% or more, 98% or more % or more, or more specifically, may consist of 99% or more of the nucleotide sequence, but is not limited thereto.
  • polynucleotide of the present application is hybridized with a probe that can be prepared from a known gene sequence, for example, a complementary sequence to all or part of the base sequence under stringent conditions to obtain the amino acid sequence of SEQ ID NO: 1 Any coding sequence may be included without limitation.
  • stringent condition refers to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in the literature (eg, J. Sambrook et al., ibid.).
  • polynucleotides with high homology or identity 40% or more, specifically 90% or more, more specifically 95% or more, 96% or more, 97% or more, 98% or more, more specifically 99% or more 60 ° C., 1 ⁇ SSC, 0.1 washing conditions for hybridization under conditions in which polynucleotides having the same identity or identity do not hybridize and polynucleotides having less homology or identity do not hybridize, or washing conditions for typical southern hybridization Washing once, specifically 2 to 3 times, at a salt concentration and temperature corresponding to % SDS, specifically 60 ° C, 0.1 ⁇ SSC, 0.1% SDS, more specifically 68 ° C, 0.1 ⁇ SSC, 0.1% SDS conditions can be listed.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization.
  • the term “complementary” is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine.
  • the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the entire sequence.
  • polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60 °C, 63 °C or 65 °C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • Appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotide and the degree of complementarity, parameters well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
  • the term 'homology' or 'identity' refers to the degree of relatedness between two given amino acid sequences or base sequences and can be expressed as a percentage.
  • the terms homology and identity are often used interchangeably.
  • Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms, together with default gap penalties established by the program used. Substantially homologous or identical sequences are generally under moderate or high stringency conditions along at least about 50%, 60%, 70%, 80% or 90% of the entire or full-length sequence. It can hybridize under stringent conditions. It is obvious that hybridization also includes polynucleotides containing common codons or codons considering codon degeneracy in polynucleotides.
  • GAP program can define the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or 10 gap opening penalty, 0.5 gap extension penalty); and (3) no penalty for end gaps.
  • the enhancement of the activity of the phosphate uptake system may be enhancement of the activity of a polypeptide encoded by the pitA gene, but is not limited thereto.
  • the pitA gene of the present application may be a foreign pitA gene.
  • the microorganism of the present application may be introduced with an exogenous pitA gene or an exogenous pit polypeptide, but is not limited thereto.
  • those in which introduced foreign genes or polypeptides are enhanced are included.
  • the exogenous pitA gene may be derived from Escherichia sp. , or may be derived from Escherichia coli , but is not limited thereto.
  • the term "enhancement" of polypeptide activity means that the polypeptide activity is increased compared to the intrinsic activity.
  • the enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.
  • activation, enhancement, upregulation, overexpression, and increase may include those that exhibit an activity that was not originally possessed, or those that exhibit enhanced activity compared to intrinsic activity or activity before modification.
  • intrinsic activity refers to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation when the character is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activation before transformation”.
  • the enhancement can be achieved by introducing a foreign polypeptide or by enhancing the activity and/or concentration (expression level) of an endogenous polypeptide. Whether or not the activity of the polypeptide is enhanced can be confirmed from an increase in the activity level, expression level, or amount of a product released from the corresponding polypeptide.
  • Enhancement of the activity of the polypeptide can be applied by various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to the microorganism before transformation. Specifically, it may be using genetic engineering and / or protein engineering, which is well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • modification of the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide eg, modification of the polynucleotide sequence of the polypeptide gene to encode the modified polypeptide to enhance the activity of the polypeptide
  • It may be a combination of two or more selected from 1) to 8), but is not particularly limited thereto.
  • the increase in the intracellular copy number of the polynucleotide encoding the polypeptide is achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the corresponding polypeptide is operably linked. it may be Alternatively, it may be achieved by introducing one copy or two or more copies of a polynucleotide encoding the corresponding polypeptide into the chromosome of the host cell.
  • the introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome of the host cell into the host cell, but is not limited thereto.
  • the vector is as described above.
  • the expression control region may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating termination of transcription and translation.
  • the original promoter may be replaced with a strong promoter, but is not limited thereto.
  • Examples of known strong promoters include the CJ1 to CJ7 promoter (US Patent US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, etc., but are not limited thereto.
  • Modification of the nucleotide sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a nucleotide sequence encoding another initiation codon with a higher polypeptide expression rate than the endogenous initiation codon. It may be substituted, but is not limited thereto.
  • Modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may include deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide.
  • the combination thereof may be a sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto.
  • the replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
  • the vector used at this time may further include a selection marker for checking whether the chromosome is inserted.
  • the selectable marker is as described above.
  • Introduction of a foreign polynucleotide exhibiting the activity of the polypeptide may be introduction of a foreign polynucleotide encoding a polypeptide exhibiting the same/similar activity as the polypeptide into a host cell.
  • the foreign polynucleotide is not limited in origin or sequence as long as it exhibits the same/similar activity as the polypeptide.
  • the method used for the introduction can be performed by appropriately selecting a known transformation method by a person skilled in the art, and expression of the introduced polynucleotide in a host cell can generate a polypeptide and increase its activity.
  • the codon optimization of the polynucleotide encoding the polypeptide is codon optimization of the endogenous polynucleotide to increase transcription or translation in the host cell, or optimization of the transcription or translation of the foreign polynucleotide in the host cell. It may be that the codons of this have been optimized.
  • Analyzing the tertiary structure of the polypeptide to select and modify or chemically modify the exposed site for example, by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, depending on the degree of sequence similarity. It may be to determine a template protein candidate according to the method, confirm the structure based on this, and modify or modify an exposed portion to be chemically modified to be modified or modified.
  • Such enhancement of polypeptide activity is an increase in the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or unmodified microbial strain, or an increase in the amount of the product produced from the corresponding polypeptide. It may be, but is not limited thereto.
  • Modification of some or all of the polynucleotides in the microorganism of the present application is (a) homologous recombination using a vector for chromosomal insertion into the microorganism or genome editing using engineered nuclease (e.g., CRISPR-Cas9) and / or (b) It may be induced by light and/or chemical treatment, such as ultraviolet light and radiation, but is not limited thereto.
  • a method of modifying part or all of the gene may include a method using DNA recombination technology.
  • a part or all of a gene may be deleted by injecting a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene into the microorganism to cause homologous recombination.
  • the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
  • the polypeptide to be targeted for activity enhancement may be a phosphoric acid importer, and specifically may be a Pit system, a polypeptide encoded by the pitA gene, or a PitA polypeptide.
  • the enhancement of activity may be, but is not limited to, introduction of a foreign Pit system, a foreign polypeptide encoded by the pitA gene, or a foreign PitA polypeptide.
  • enhancing the activity of the phosphate uptake system may be introduction of an exogenous pitA gene or a polypeptide encoded by an exogenous pitA , but is not limited thereto.
  • introduction of a polypeptide means that a microorganism exhibits an activity of a specific polypeptide that was not originally possessed or an enhanced activity compared to the intrinsic activity or activity of the corresponding polypeptide before modification.
  • a specific polypeptide may be introduced, a polynucleotide encoding a specific polypeptide may be introduced into a chromosome of a microorganism, or a vector including a polynucleotide encoding a specific polypeptide may be introduced into a microorganism to exhibit its activity.
  • “foreign gene” refers to a non-native (non-natural) gene included in a microorganism. Examples include (a) a gene that is not naturally found in a microorganism (exogenous), and (b) a gene that is endogenous in a microorganism or the result of transcription or translation of a gene in a microorganism in an unnatural amount (naturally (c) a polypeptide sequence endogenously present in the microorganism, or the sequence of the gene encoding it is different, and/or (d) the above-mentioned in the microorganism is two It may be a case of combining more than one, but is not limited thereto.
  • the foreign gene may be a foreign pitA gene, and may be a pitA gene derived from Escherichia sp. It may be a pitA gene derived from Escherichia coli , but is not limited thereto.
  • a vector may include a DNA preparation containing a nucleotide sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to express the target polypeptide in a suitable host.
  • the expression control region may include a promoter capable of initiating transcription, an arbitrary operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating termination of transcription and translation.
  • Vectors used in the present application are not particularly limited, and any vectors known in the art may be used.
  • Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors
  • pBR-based, pUC-based, and pBluescriptII-based plasmid vectors pGEM-based, pTZ-based, pCL-based, pET-based, etc. can be used.
  • pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used.
  • a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for chromosomal insertion into a cell. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • a selection marker for determining whether the chromosome is inserted may be further included. Selectable markers are used to select cells transformed with a vector, that is, to determine whether a target nucleic acid molecule has been inserted, and to give selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. markers may be used. In an environment treated with a selective agent, only cells expressing the selectable marker survive or exhibit other expression traits, so transformed cells can be selected.
  • the term "transformation” means introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide can be expressed in the host cell, it may be inserted into and located in the chromosome of the host cell or located outside the chromosome.
  • the polynucleotide includes DNA and/or RNA encoding a polypeptide of interest.
  • the polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a genetic construct containing all elements required for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.
  • operably linked means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates the transcription of the polynucleotide encoding the target variant of the present application.
  • strain or microorganism
  • strain includes both wild-type microorganisms and naturally or artificially genetically modified microorganisms, and causes such as insertion of foreign genes or enhancement or inactivation of endogenous gene activity.
  • a microorganism whose specific mechanism is attenuated or enhanced due to, it may be a microorganism containing genetic modification for the production of a desired polypeptide, protein or product.
  • the term "Corynebacterium stationis microorganism having the ability to produce purine nucleotides” means that when a microorganism is cultured in a medium, it produces and accumulates purine nucleotides as a target product in the organism, or it is stored in the medium. Microorganisms that have the ability to secrete or accumulate. In one embodiment, 'having the ability to produce purine nucleotides' may be used interchangeably with 'produces purine nucleotides'. The ability to produce purine nucleotides may be possessed as a property of wild strains of Corynebacterium stationis microorganisms, and may be imparted or enhanced by genetic modification.
  • the microorganism having the ability to produce purine nucleotides of the present application may be a recombinant strain having increased ability to produce purine nucleotides by enhancing the activity of a phosphate uptake system (Pit system) encoded by the pit gene.
  • a phosphate uptake system Pan system
  • the recombinant strain with increased purine nucleotide production ability is a natural wild-type microorganism or a microorganism without modification of the phosphate uptake system (i.e., a microorganism expressing a wild-type phosphate uptake system, a microorganism not having an enhanced phosphate uptake system, or a phosphate uptake system not expressed) purine nucleotide productivity may be enhanced compared to microorganisms without), but is not limited thereto.
  • the target strain for comparing the increase in the purine nucleotide production ability, the non-modified microorganism with the phosphoric acid influx system CJX1664 (KCCM12285P, KR 10-1950141 B1, US 2020-0392478 A1), CJX1665 (KCCM12286P, KR 10-1950141 B1, US 2020-0392478 A1), CJI2332 (KCCM12277P, KR 10-1950141 B1, US 2020-0392478 A1), or CJI2335 (KCCM12278P, KR 10-1956510 B1, EP 3705572 A1), but is not limited thereto.
  • the recombinant strain with increased production capacity is about 1% or more, specifically about 1% or more, about 2.5% or more, about 5% or more, about 6 % or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 11% or more, about 12% or more, or 13% or more (the upper limit is not particularly limited, e.g., about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 40% or less, or about 30% or less) may be increased, but compared to the production capacity of the parent strain before mutation or the unmodified microorganism, the + value As long as it has an increased amount, it is not limited thereto.
  • the recombinant strain with increased production capacity has a purine nucleotide production capacity of about 1.01 times or more, about 1.02 times or more, about 1.03 times or more, about 1.05 times or more, or about 1.06 times as compared to the parental strain or unmodified microorganism before the mutation. or more, about 1.07 times or more, about 1.08 times or more, about 1.09 times or more, about 1.10 times or more, about 1.11 times or more, about 1.12 times or more, or about 1.13 times or more (the upper limit is not particularly limited, for example, about 10 times) Or less, about 5 times or less, about 3 times or less, or about 2 times or less) may be increased, but is not limited thereto.
  • the term “about” includes all ranges of ⁇ 0.5, ⁇ 0.4, ⁇ 0.3, ⁇ 0.2, ⁇ 0.1, etc., and includes all ranges equivalent to or similar to the ranges following the term “about”. Not limited.
  • the microorganism having the ability to produce purine nucleotides of the present application includes the Pit system, the PitA polypeptide; polynucleotides encoding them; And it may be a microorganism having the ability to produce a target polypeptide or a target product involved in the production of the target polypeptide, including any one or more of vectors containing the polynucleotide, but is not limited thereto.
  • the microorganism may be, but is not limited to, a microorganism naturally having the ability to produce the target polypeptide or the target product, or a microorganism in which the ability to produce the target polypeptide or the target product is endowed with a parent strain having no target polypeptide or target product producing capability.
  • the term "unmodified microorganism” does not exclude strains containing mutations that may occur naturally in microorganisms, and are wild-type strains or wild-type strains themselves, or are genetically modified by natural or artificial factors. It may mean a strain before change.
  • the unmodified microorganism may refer to a strain that is not enhanced or introduced with the phosphorus phosphate influx system described herein or before enhanced or introduced.
  • the "unmodified microorganism” may be used interchangeably with "strain before transformation", “microorganism before transformation”, “non-mutated strain”, “unmodified strain”, “non-mutated microorganism” or "reference microorganism”.
  • purine nucleotide refers to 5'-inosine monophosphate (IMP), 5'-xanthosine monophosphate (XMP), and 5'-guanosine monophosphate, GMP) may be any one or more nucleotides selected from the group consisting of.
  • 5'-inosinic acid is a compound in which adenine is deaminated, and refers to a nucleotide composed of one molecule each of hypoxanthine, ribose, and phosphoric acid.
  • 5'-inosinic acid can be biosynthesized from 5'-phosphoribosyl-1-pyrophosphate (PRPP).
  • 5'-Xanthyl acid refers to a nucleotide dehydrogenated from 5'-inosinic acid.
  • the 5'-xanthyl acid may be synthesized from 5'-inosinic acid by 5'-inosine-5'-monophosphate dehydrogenase, but is not limited thereto.
  • 5'-guanynic acid has a structure in which a phosphoric acid group forms an ester bond with the ribose part of the guanosine molecule, and can be synthesized by adding ammonia molecules to 5'-xanthilic acid by GMP synthase. , but not limited thereto.
  • Another aspect of the present application is a method for producing purine nucleotides, comprising the step of culturing a Corynebacterium stationis microorganism having a purine nucleotide-producing ability with enhanced activity of a phosphate inlet system (Pit system) in a medium to provide.
  • a phosphate inlet system Pit system
  • the phosphate uptake system, Pit system, enrichment, purine nucleotides, and Corynebacterium stationis microorganisms, etc. are as described in other embodiments.
  • the term “cultivation” means growing the microorganisms under appropriately controlled environmental conditions.
  • the culture process of the present application may be performed according to suitable media and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art according to the selected strain. Specifically, the culture may be batch, continuous and fed-batch, but is not limited thereto.
  • the term "medium” refers to a material in which nutrients necessary for culturing the microorganisms are mixed as main components, and supplies nutrients and growth factors, including water indispensable for survival and growth.
  • the medium and other culture conditions used for culturing the microorganisms of the present application can be any medium without particular limitation as long as it is a medium used for culturing ordinary microorganisms, but the microorganisms of the present application are suitable as carbon sources, nitrogen sources, personnel, and inorganic materials. It can be cultured while controlling temperature, pH, etc. under aerobic conditions in a conventional medium containing compounds, amino acids, and/or vitamins.
  • Examples of the carbon source in the present application include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, and maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sorghum pomace and corn steep liquor can be used, specifically glucose and sterilized pretreated molasses (i.e. converted to reducing sugar).
  • Carbohydrates such as molasses
  • other carbon sources in an appropriate amount may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, etc., organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine, etc.
  • organic nitrogen sources such as peptone, NZ-amine,
  • the number of persons may include monopotassium phosphate, dipotassium phosphate, or a sodium-containing salt corresponding thereto.
  • the inorganic compound sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and amino acids, vitamins, and/or appropriate precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, it is not limited thereto.
  • the pH of the medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. to the medium in an appropriate manner during the culture of the microorganism.
  • an antifoaming agent such as a fatty acid polyglycol ester.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without gas injection or nitrogen, hydrogen or carbon dioxide gas may be injected to maintain the anaerobic and non-aerobic state. It is not.
  • the temperature of the medium may be 27 ° C to 37 ° C, specifically 30 ° C to 33 ° C, but is not limited thereto.
  • the culturing period may be continued until a desired production amount of a useful substance is obtained, specifically, it may be 20 hours to 120 hours, but is not limited thereto.
  • Purine nucleotides produced by the culture of the present application may be secreted into the medium or remain in the cells.
  • the method for producing purine nucleotides of the present application includes preparing a Corynebacterium stationis microorganism of the present application, preparing a medium for culturing the microorganism, or a combination thereof (in any order) For example, prior to the culturing step, it may be further included.
  • the method for producing purine nucleotides of the present application may further include a step of recovering purine nucleotides from the cultured medium (cultured medium) or microorganism (cultured microorganism).
  • the recovering step may be further included after the culturing step.
  • the recovery may be to collect the desired purine nucleotides using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method.
  • a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method.
  • centrifugation, filtration, treatment with a precipitating agent for crystallized proteins salting out method
  • extraction sonic disruption
  • ultrafiltration dialysis
  • molecular sieve chromatography gel filtration
  • adsorption chromatography ion exchange chromatography
  • affinity affinity It may be used in combination with various chromatography, HPLC, and these methods, such as doe chromatography, and a desired purine nucleotide may be recovered from a medium or microorganism using a suitable method known in the art.
  • the production method of the present application may include an additional purification step.
  • the purification may be performed using suitable methods known in the art.
  • the recovery step and the purification step are performed continuously or discontinuously regardless of order, or simultaneously or integrated into one step It may be performed, but is not limited thereto.
  • the culturing step is to convert 5'-xanthosine monophosphate (XMP) to 5'-guanine acid.
  • XMP 5'-xanthosine monophosphate
  • a conversion step may be further included.
  • the converting step may be further included after the culturing step or the recovering step.
  • the conversion may be performed using a suitable method known in the art.
  • the conversion may be performed using a coryneform microorganism, Escherichia coli, or 5'-xanthoyl acid aminase (KR 10-0655902 B1), but is not limited thereto.
  • Another aspect of the present application is the Corynebacterium stationis microorganism of the present application; medium in which it was cultured; Or to provide a composition for producing purine nucleotides comprising a combination thereof.
  • composition of the present application may further include any suitable excipient commonly used in compositions for producing purine nucleotides, such excipients may be, for example, a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffer, a stabilizer, or an isotonic agent. It may, but is not limited thereto.
  • the microorganism, medium, and purine nucleotides, etc. are as described in the other aspects above.
  • Another aspect of the present application is to provide a use of the Corynebacterium stationis microorganism of the present application for producing purine nucleotides.
  • Example 1 Production of exogenous pitA introduced strain and evaluation of IMP production ability
  • the pit system does not exist in wild-type strains of Corynebacterium staturenis. Accordingly, a vector for introducing an exogenous Pit system into Corynebacterium statures was constructed.
  • the CJ1 promoter (Korean Patent Registration No. 10-0620092, SEQ ID NO: 3) known as an enhanced promoter among promoters of microorganisms of the genus Corynebacterium was conjugated to the exogenous pitA gene.
  • the chromosome gene of ATCC6872 strain a wild type of Corynebacterium stethones
  • Intron's G-spin Total DNA extraction mini kit Cat. Maxime PCR PreMix (i-pfu) high-reliability DNA polymerase (Intron) was used as the polymerase, and PCR was denatured at 95 ° C for 5 minutes, denatured at 95 ° C for 30 seconds, annealed at 54 ° C for 30 seconds, and polymerization reaction at 72 ° C. 1 minute and 30 seconds was repeated 24 times.
  • fepBdel-A and fepBdel-B two different PCR products.
  • the fepB-A has a size of 1038 bp, and was amplified using SEQ ID NO: 4 and SEQ ID NO: 5 as primers.
  • the fepB-B has a size of 1111 bp and is amplified using SEQ ID NO: 6 and SEQ ID NO: 7 as primers.
  • Secondary PCR was performed using the sewing PCR technique using the above two types of amplification products as templates.
  • PCR was performed under the same conditions as the above PCR conditions, and as a result, a 2131 bp PCR product was obtained, in which the fepB gene was deleted and the SpeI and NotI restriction enzyme sites were included in the middle. Afterwards, the amplification products were cut using restriction enzyme sites located at both ends (fepBdel-A: HindIII, fepBdel-B: HindIII), and then cloned into the pDZ vector using the activity of T4 ligase, thereby eliminating the fepB gene defect. A pDZ-fepBdel vector was obtained for The sequences of the primers used above are respectively as follows.
  • sequence number designation order 4 fepBdel-A-F CCCAAGCTTCCGGTGTTCAGAATCGCTCCG 5 fepBdel-A-R GCGGCCGCAAAGGACTAGTCCTCCGGCATTCAGTCAGGTC 6 fepBdel-B-F CTAGTCCTTTGCGGCCGCCCATTCCGCCCTTCAACCTTCCGCCTAGATTACTTCTC 7 fepBdel-B-R CCCAAGCTTGTGCAAGCTGTGGATCGTCTTCC
  • a vector in which the nucleic acid portion of the fepB gene deleted from the pDZ-fepBdel vector was substituted with exogenous pitA was constructed as follows. Specifically, the chromosomes of the wild-type Corynebacterium statures ATCC6782 strain and Escherichia coli MG1655 were isolated, and Maxime PCR PreMix (i-pfu) high-reliability DNA polymerase (Intron) was used as the polymerase, PCR was repeated 24 times after denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 54°C for 30 seconds, and polymerization reaction at 72°C for 2 minutes and 30 seconds.
  • Maxime PCR PreMix i-pfu
  • Intron high-reliability DNA polymerase
  • the pCJ1-pitA-A is a PCR product of the promoter region and has a size of 341 bp, and is amplified using SEQ ID NO: 8 and SEQ ID NO: 9 as primers.
  • the pCJ1-pitA-B is a pitA gene PCR product with a size of 1537 bp, and was amplified using SEQ ID NO: 10 and SEQ ID NO: 11 as primers. Secondary PCR was performed using the sewing PCR technique using the two types of amplification products as templates.
  • PCR was performed under the same conditions as above, and as a result, the pitA gene coupled to the pCJ1 promoter containing nucleotide sequences homologous to the pDZ-fepBdel vector at both ends was obtained.
  • This gene was cloned into a pDZ-fepBdel vector treated with SpeI and NotI restriction enzymes by a method using homologous recombinase to obtain a pDZ- ⁇ fepB::pCJ1/pitA (Eco) vector.
  • the sequences of the primers used above are respectively as follows.
  • sequence number designation order 8 pCJ1-pitA-A-F TTCGACCTGACTGAATGCCGGAGGAACCGCGGGCTTATTCCATTACATG 9
  • pCJ1-pitA-A-R CAAACAAATGTAGCATTTAATCTCCTAGATTGGGTTTCACTCAAGG 10
  • pCJ1-pitA-B-F ACCCAATCTAGGAGATTAAATGCTACATTTGTTTTGCTGGCCTG
  • pCJ1-pitA-B-R CGGAAGGTTGAAGGCGGATTACAGGAACTGCAAGGAGAGCCAG
  • the IMP-producing strain CJI2332 IMP-producing strain derived from Corynebacterium stasis ATCC6872, KCCM12277P, Korean Patent No. 10-1950141, US 2020-0392478 A1
  • CJI2335 Corynebacterium stasis ATCC6872
  • the derived IMP producing strain, KCCM12278P, Korean Registered Patent No. 10-1956510, EP 3705572 A1 was transformed with the vector pDZ- ⁇ fepB::pCJ1/pitA (Eco) obtained above through electroporation into each strain.
  • CJ1 promoter-pitA gene in the middle of the endogenous fepB gene on the chromosome was obtained.
  • the newly inserted CJ1 promoter-pitA gene was identified using SEQ ID NO: 12 and SEQ ID NO: 13 as primers capable of amplifying the junction between both ends of the inserted gene and the fepB gene.
  • SEQ ID NO: 12 and SEQ ID NO: 13 as primers capable of amplifying the junction between both ends of the inserted gene and the fepB gene.
  • two strains, CJI2332_pCJ1/pitA and CJI2335_pCJ1/pitA, which always overexpress pitA introduced via the CJ1 promoter were obtained.
  • Example 1-1 For CJI2332_pCJ1/pitA and CJI2335_pCJ1/pitA strains prepared in Example 1-1, the following experiment was conducted to confirm the improvement in IMP production ability.
  • CJI2332_pCJ1/pitA, CJI2332, CJI2335_pCJ1/pitA, and CJI2335 were inoculated in 5 ml of autoclaved 18 mm diameter test tube seed medium, respectively, and cultured with shaking at 30° C. for 24 hours to be used as a seed culture medium. 29 ml of the fermentation medium was dispensed into a 250 ml conical flask for shaking, and after autoclaving at 121 ° C. for 15 minutes, 2 ml of the seed culture was inoculated and cultured for 3 days. Culture conditions were adjusted to a rotation speed of 170 rpm, a temperature of 30 ° C, and a pH of 7.5.
  • the composition of the seed medium and fermentation medium is as follows.
  • the CJI2335_pCJ1/pitA was named CJI2631, and was deposited with the Korea Microorganism Conservation Center, an entrusted institution under the Budapest Treaty, on April 13, 2021, and was given accession number KCCM12975P.
  • CJX1664 an XMP producing strain (XMP producing strain derived from Corynebacterium stationis, KCCM12285P, Korean Patent No. 10-1950141, US 2020-0392478 A1) and CJX1664 purA (G85S) mutant CJX1665 (KCCM12286P, Korea Registered Patent No.
  • Each strain was transformed with pDZ- ⁇ fepB::pCJ1/pitAA (Eco) through electroporation, and the endogenous chromosomal CJX1664_pCJ1/pitA strains and CJX1665_pCJ1/pitA strains containing the pCJ1-pitA gene in the fepB gene were obtained.
  • the newly inserted pCJ1-pitA gene was identified using SEQ ID NO: 12 and SEQ ID NO: 13 as primers capable of amplifying the junction between both ends of the inserted gene and the fepB gene.
  • Flask evaluation was performed to measure the XMP producing ability of the CJX1664_pCJ1/pitA strains and the CJX1665_pCJ1/pitA strains prepared in Example 2-1.
  • CJX1664, CJX1664_pCJ1/pitA, CJX1665, and CJX1665_pCJ1/pitA were each inoculated into a 14 ml tube containing 2.5 ml of the following seed medium, and incubated at 30° C. for 24 hours with shaking at 170 rpm.
  • 0.7 ml of seed culture was inoculated into a 250 ml corner-baffle flask containing 32 ml of the following production medium (24 ml of main medium + 8 ml of separate sterilization medium) and cultured with shaking at 170 rpm for 75 hours at 30 ° C.
  • the composition of the seed medium, main medium and separate sterilization medium is as follows.
  • Glucose 30g/L Peptone 15 g/L, Yeast Extract 15 g/L, Sodium Chloride 2.5 g/L, Urea 3 g/L, Adenine 150 mg/L, Guanine 150 mg/L, pH 7.0 (based on medium 1L)
  • XMP flask production medium (separate sterile medium)

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 출원은 인산 유입 시스템(Pit 시스템)의 활성이 강화된 퓨린 뉴클레오티드를 생산하는 코리네박테리움 스테이셔니스 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산 방법에 관한 것이다.

Description

퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
본 출원은 인산 유입 시스템(Pit 시스템)의 활성이 강화된 퓨린 뉴클레오티드 생산능을 갖는 코리네박테리움 스테이셔니스 미생물 및 상기 미생물을 이용한 퓨린 뉴클레오티드의 생산 방법에 관한 것이다.
퓨린 뉴클레오티드, 예를 들어, 5'-이노신산 (5'-inosine monophosphate; 이하 IMP), 5'-크산틸산 (5'-xanthosine monophosphate; 이하 XMP) 및 5'-구아닌산 (5'-guanosine monophosphate; 이하 GMP)은 핵산 생합성 대사계의 중간 물질로서, 체내에서 생리적으로 중요한 역할을 수행하고, 식품, 의약품 등에 널리 이용되고 있다. 구체적으로, IMP는 자체로 소고기 맛을 내며, XMP에서 유래되는 GMP는 버섯 맛을 내는 것으로 알려져 있으며, 두 물질 모두 모노소디움 글루탐산 (MSG)의 풍미를 강화하는 것으로 알려져 정미성 핵산계 조미료로 각광 받고 있다.
인산은 퓨린 뉴클레오티드의 구성물질로, 미생물 생장에 필요한 에너지를 제공하고, 세포막의 인지질과 핵산 및 단백질 생합성에 필수적이다. 또한 세포 신호 전달 과정에도 주요한 역할을 한다.
인산은 주로 무기인산 (inorganic orthophosphate; 이하 Pi로 표기) 형태로 세포 내로 흡수된다. 미생물의 Pi 유입은 세포막에 존재하는 임포터(importer)의 기능에 의존한다. 기존에 알려진 Pi 임포터에는 세포 외부의 Pi 농도를 인지하여 발현이 조절되는 고친화성(high-affinity) Pi 유입 시스템인 Pst 시스템과 Pi 농도에 관계없이 발현하여 금속이온과의 혼합형태로 Pi를 유입하는 Pit 시스템, 유기인산 형태인 글라이세롤-3-인산 및 글루코즈-6-인산을 유입하는 안티포터 (antiporter) 수송 시스템 등이 공지되어 있다.
상기 인산 유입 시스템 중 Pit 시스템을 조절하여 아미노산 생산에 이용하는 몇 종류의 방법이 보고되어 있으나 핵산 생산에 미치는 영향은 보고되어 있지 않다. 또한, 아미노산 생산 증대에 있어서도 Pit 시스템의 발현 약화 혹은 강화가 미생물 및 아미노산 별로 상이한 결과를 도출하는 것으로 확인되어 아미노산 생산의 경우 Pi 유입 시스템을 특정 방향으로 조절하는 것이 생산량 증대 혹은 감소에 일률적인 영향을 미치는 것이 아님을 확인할 수 있다(US 9506094 B2, US 9873898 B2).
본 출원의 해결하고자 하는 과제는 인산 유입 시스템(Pit 시스템)의 활성이 강화된 퓨린 뉴클레오티드 생산능을 갖는 코리네박테리움 스테이셔니스 미생물 및 상기 미생물을 이용한 퓨린 뉴클레오티드의 생산 방법을 제공하는 것이다.
본 출원의 하나의 목적은 인산 유입 시스템(Pit 시스템)의 활성이 강화된, 뉴클레오티드 생산능을 갖는, 코리네박테리움 스테이셔니스 미생물을 제공하는 것이다.
본 출원의 다른 하나의 목적은 상기 퓨린 뉴클레오티드 생산능을 갖는, 코리네박테리움 스테이셔니스 미생물을 배지에서 배양하는 단계를 포함하는 퓨린 뉴클레오티드의 생산 방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 퓨린 뉴클레오티드 생산능을 갖는, 코리네박테리움 스테이셔니스 미생물; 이를 배양한 배지; 또는 이들의 조합을 포함하는 퓨린 뉴클레오티드의 생산용 조성물을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 퓨린 뉴클레오티드 생산능을 갖는, 코리네박테리움 스테이셔니스 미생물의 퓨린 뉴클레오티드의 생산 용도를 제공하는 것이다.
본 출원에 따라 인산 임포터의 활성을 강화시킴으로써, 퓨린 뉴클레오티드 생산에 중요한 성분인 인산의 미생물내 유입을 원활하게 할 수 있다. 이로써, 퓨린 뉴클레오티드 생산능을 갖는 미생물은 퓨린 뉴클레오티드를 효율적으로 생산할 수 있으며, 퓨린뉴클레오티드를 산업적 규모로 생산할 경우 원가 절감에 크게 기여할 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 출원의 하나의 양태는 pit 유전자에 의하여 코딩되는 인산 유입 시스템(Pit 시스템)의 활성이 강화되고, 퓨린 뉴클레오티드 생산능을 갖는 코리네박테리움 스테이셔니스 미생물을 제공하는 것이다.
본 출원에서 용어 "인산 유입 시스템"은 세포 내로 인산을 유입시키는 기능을 갖는 폴리펩티드 또는 이를 포함하는 시스템을 의미한다. 상기 인산 유입 시스템은 인산 임포터를 포함할 수 있다. 본 출원의 목적상 상기 인산 유입 시스템은 Pit 시스템일 수 있다.
본 출원에서 용어, "인산 임포터"는 세포 내로 인산을 흡수하는 기능을 갖는 폴리펩티드를 의미한다. 인산은 주로 무기인산 (inorganic orthophosphate; 이하 Pi로 표기) 형태로 세포 내로 흡수되며, 세포막에 존재하는 임포터의 기능에 의존한다. 구체적으로, 기존에 알려진 Pi 임포터에는 Pst 시스템과 Pit 시스템, 및 유기인산 형태인 글라이세롤-3-인산 및 글루코즈-6-인산을 유입하는 안티포터 (antiporter) 수송 시스템 등이 포함될 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어 "Pit 시스템"은 Pi와 낮은 친화력을 보이는 인산 수송 임포터 (phosphate transporter, low-affinity; tellurite importer; 이하 pit)를 의미한다. Pit 시스템의 발현은 세포 외부 Pi 농도에 의존하지 않으며, Pi는 금속 양이온 복합체 형태로 세포 내부로 유입되는 것으로 알려져 있다. (JOURNAL OF BACTERIOLOGY, Sept. 2001, p. 5008-5014 Vol. 183, No. 17)
상기 Pit 시스템은 pit, pit1, pit2, pit3, pitA, pitB, 및 pitC에서 선택되는 하나 이상의 유전자에 의해 코딩되는 폴리펩티드 또는 Pit, Pit1, Pit2, Pit3, PitA, PitB, 및 PitC 폴리펩티드를 하나 이상 포함하는 것일 수 있으며, 본 출원의 목적상 상기 Pit 시스템은 pitA(inorganic phosphate transporter) 유전자에 의해 코딩되는 폴리펩티드 또는 PitA 폴리펩티드일 수 있으나, 이에 제한되지 않는다.
상기 Pit 시스템은 서열번호 1의 아미노산 서열로 기재된 폴리펩티드를 포함하는 것일 수 있으나, 상기 시스템 또는 폴리펩티드는 미생물의 종 또는 균주에 따라 상기 활성을 나타내는 효소의 아미노산 서열에 차이가 존재하는 경우가 있기 때문에, 이에 제한되지 않는다.
상기 PitA 폴리펩티드 또는 pitA 유전자에 의해 코딩되는 폴리펩티드는 서열번호 1의 아미노산 서열로 기재된 폴리펩티드로 이루어진 것일 수 있으나, 이에 제한되지 않는다.
상기 PitA 폴리펩티드 또는 pitA 유전자에 의해 코딩되는 폴리펩티드는 서열번호 1로 기재된 아미노산 서열을 가지거나, 포함하거나, 이루어지거나, 상기 아미노산 서열로 필수적으로 이루어진(essentially consisting of) 것일 수 있으나, 이에 제한되지 않는다. 보다 구체적으로, 상기 서열번호 1은 pitA 유전자에 의해 코딩되는 인산 임포터의 활성을 갖는 폴리펩티드 서열일 수 있다.
일 구현 예로, 상기 pitA 유전자에 의해 코딩되는 폴리펩티드는 서열번호 1의 아미노산 서열과 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리펩티드를 포함하는 것일 수 있으나, 이에 제한되지 않는다.
상기 서열번호 1의 아미노산은 공지의 데이터 베이스인 NCBI의 GenBank 등 다양한 데이터 베이스에서 그 서열을 얻을 수 있으나, 이에 제한되지 않는다. 일 예로, 대장균(Escherichia coli) 유래일 수 있으나, 이에 제한되지 않으며, 상기 아미노산과 동일한 활성을 갖는 서열은 제한 없이 포함될 수 있다. 또한, 본 출원에서의 인산 임포터, Pit 시스템, 또는 PitA의 활성을 갖는 폴리펩티드는 비록 서열번호 1의 아미노산을 포함하는 폴리펩티드로 기재하였으나, 서열번호 1의 아미노산 서열 앞뒤로의 무의미한 서열 추가 또는 자연적으로 발생할 수 있는 돌연변이, 또는 이의 잠재성 돌연변이(silent mutation)를 제외하는 것이 아니며, 서열번호 1의 아미노산 서열을 포함하는 폴리펩티드와 서로 동일 또는 상응하는 활성을 가지는 경우라면 본 출원의 인산 임포터, Pit 시스템, 또는 PitA의 활성을 갖는 폴리펩티드에 해당됨은 당업자에게 자명할 수 있다.
구체적인 예를 들어, 본 출원의 인산 임포터 또는 Pit 시스템의 활성을 갖는 폴리펩티드는 서열번호 1의 아미노산 서열 또는 이와 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 갖는 아미노산 서열로 구성되는 폴리펩티드일 수 있다.
본 출원의 PitA 폴리펩티드 또는 pitA 유전자에 의해 코딩되는 폴리펩티드의 활성을 갖는 폴리펩티드는 서열번호 1의 아미노산 서열 또는 이와 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 갖는 아미노산 서열로 구성되는 폴리펩티드일 수 있다
또한, 이러한 상동성 또는 동일성을 가지며 상기 폴리펩티드에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 폴리펩티드도 본 출원의 폴리펩티드의 범위 내에 포함됨은 자명할 수 있다.
본 출원에서 ‘특정 서열번호로 기재된 아미노산 서열을 포함하는 폴리펩티드’, ‘특정 서열번호로 기재된 아미노산 서열로 이루어진 폴리펩티드’ 또는 ‘특정 서열번호로 기재된 아미노산 서열을 갖는 폴리펩티드’라고 기재되어 있더라도, 해당 서열번호의 아미노산 서열로 이루어진 폴리펩티드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 폴리펩티드도 본 출원에서 사용될 수 있음은 자명하다. 예를 들어, 상기 아미노산 서열 N-말단 그리고/또는 C-말단에 단백질의 기능을 변경하지 않는 서열 추가, 자연적으로 발생할 수 있는 돌연변이, 이의 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다.
상기 “보존적 치환(conservative substitution)”은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
상기 Pit 시스템은, pit, pit1, pit2, pit3, pitA, pitB, 및 pitC 에서 선택되는 어느 하나 이상의 유전자에 의해 코딩되는 것일 수 있으나, 이에 제한되지 않는다. 구체적으로, 상기 Pit 시스템은 서열번호 2로 기재되는 염기서열을 포함하는 폴리뉴클레오티드에 의해 코딩되는 것일 수 있으나, 코돈의 축퇴성으로 인하여 이에 제한되지 않는다. 상기 Pit 시스템은 서열번호 2의 염기서열과 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가지는 염기서열을 포함하는 폴리뉴클레오티드에 의해 코딩되는 것일 수 있으나, 이에 제한되지 않는다.
상기 PitA 폴리펩티드 또는 pitA 유전자에 의해 코딩되는 폴리펩티드는, 서열번호 2로 기재되는 염기서열을 포함하는 폴리뉴클레오티드에 의해 코딩되는 것일 수 있으나, 이에 제한되지 않는다. 상기 PitA 폴리펩티드 또는 pitA 유전자에 의해 코딩되는 폴리펩티드는 서열번호 2의 염기서열과 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가지는 염기서열을 포함하는 폴리뉴클레오티드에 의해 코딩되는 것일 수 있으나, 이에 제한되지 않는다.
본 출원에 있어서, 상기 서열번호 1의 아미노산 서열은, 예를 들어, 서열번호 2의 염기서열(nucleic acid sequence)을 포함하는 폴리뉴클레오티드에 의해 코딩되는 것일 수 있다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥을 의미한다. 본 출원에 있어서, 상기 폴리뉴클레오티드는 서열번호 1의 아미노산 서열을 가지는 인산 임포터 또는 Pit 시스템의 활성을 나타내는 폴리펩티드를 코딩하는 것일 수 있으나, 이에 제한되지 않는다.
상기 폴리뉴클레오티드는, 본 출원에 따른 인산 임포터, Pit 시스템, 또는 PitA의 활성을 갖는 폴리펩티드를 코딩하는 폴리뉴클레오티드라면 제한없이 포함될 수 있다. 본 출원에서 인산 임포터 또는 Pit 시스템의 아미노산 서열을 코딩하는 유전자는 pit, pit1, pit2, pit3, pitA, pitB, 및 pitC 에서 선택되는 어느 하나 이상 유전자이며, 상기 유전자는 대장균(Escherichia coli) 유래일 수 있으나 이에 제한되지 않는다.
구체적으로, 상기 인산 임포터, Pit 시스템, 또는 PitA의 활성을 나타내는 폴리펩티드를 코딩하는 폴리뉴클레오티드는 상기 서열번호 1로 기재한 아미노산을 코딩하는 염기서열을 포함할 수 있다.
상기 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 상기 폴리펩티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩티드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 상기 폴리뉴클레오티드는 예를 들면 서열번호 2의 염기서열을 포함할 수 있으며, 이와 상동성 또는 동일성이 80%, 구체적으로 90% 이상, 보다 구체적으로 95% 이상, 96% 이상, 97% 이상, 98% 이상 또는 더욱 구체적으로 99% 이상인 염기서열로 이루어질 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, 서열번호 1의 아미노산 서열을 코딩하는 서열이라면 제한 없이 포함될 수 있다. 상기 “엄격한 조건(stringent condition)”이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 40% 이상, 구체적으로 90% 이상, 보다 구체적으로 95% 이상, 96% 이상, 97% 이상, 98% 이상, 더욱 구체적으로 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1×SSC, 0.1% SDS, 구체적으로 60℃, 0.1×SSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1×SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, “상보적”은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
본 출원에서 용어, ‘상동성 (homology)’ 또는 ‘동일성 (identity)’은 두 개의 주어진 아미노산 서열 또는 염기 서열과 관련된 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90%를 따라 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
또한, 임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다.
일 구현 예로, 상기 인산 유입 시스템의 활성 강화는, pitA 유전자에 의해 코딩되는 폴리펩티드의 활성 강화일 수 있으나, 이에 제한되지 않는다.
일 구현 예로, 본 출원의 pitA 유전자는 외래 pitA 유전자일 수 있다. 다른 일 구현 예로, 본 출원의 미생물은 외래 pitA 유전자 또는 외래 pit 폴리펩티드가 도입된 것일 수 있으나, 이에 제한되지 않는다. 또한, 도입된 외래 유전자 또는 폴리펩티드가 강화된 것을 포함한다. 구체적으로, 상기 외래 pitA 유전자는 에스케리키아 속(Escherichia sp.) 유래일 수 있으며, 대장균(Escherichia coli) 유래일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, 폴리펩티드 활성의 “강화”는, 폴리펩티드 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 활성화(activation), 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 활성화, 강화, 상향조절, 과발현, 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 “내재적 활성”은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 “변형 전 활성”과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 “강화”, "상향조절", "과발현", 또는 “증가”한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성에 비하여 향상된 것을 의미한다.
상기 강화는 외래의 폴리펩티드를 도입하거나, 내재적인 폴리펩티드의 활성 강화 및/또는 농도(발현량)를 통해 달성할 수 있다. 상기 폴리펩티드의 활성의 강화 여부는 해당 폴리펩티드의 활성 정도, 발현량 또는 해당 폴리펩티드로부터 배출되는 산물의 양의 증가로부터 확인할 수 있다.
상기 폴리펩티드의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 폴리펩티드의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드 활성의 강화는
1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가;
2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역을 활성이 강력한 서열로 교체;
3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
4) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드의 아미노산 서열의 변형;
5) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열의 변형(예를 들어, 폴리펩티드의 활성이 강화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 폴리뉴클레오티드 서열의 변형);
6) 폴리펩티드의 활성을 나타내는 외래 폴리펩티드 또는 이를 코딩하는 외래 폴리뉴클레오티드의 도입;
7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에 특별히 제한되는 것은 아니다.
보다 구체적으로,
상기 1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터의 숙주세포 내로의 도입에 의해 달성되는 것일 수 있다. 또는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 숙주세포 내의 염색체 내에 1 카피 또는 2 카피 이상 도입에 의해 달성되는 것일 수 있다. 상기 염색체 내에 도입은 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다. 상기 벡터는 전술한 바와 같다.
상기 2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역(또는 발현조절서열)을 활성이 강력한 서열로 교체는, 예를 들면, 상기 발현조절영역의 활성을 더욱 강화하도록 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 가지는 서열로의 교체일 수 있다. 상기 발현조절영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 그리고 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 일 예로, 본래의 프로모터를 강력한 프로모터로 교체시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터, yccA 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 높은 다른 개시코돈을 코딩하는 염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 폴리펩티드의 활성을 강화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 증가하도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 상기 교체는 구체적으로 상동재조합에 의하여 폴리뉴클레오티드를 염색체내로 삽입함으로써 수행될 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 전술한 바와 같다.
상기 6) 폴리펩티드의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 상기 폴리펩티드와 동일/유사한 활성을 나타내는 폴리펩티드를 코딩하는 외래 폴리뉴클레오티드의 숙주세포 내 도입일 수 있다. 상기 외래 폴리뉴클레오티드는 상기 폴리펩티드와 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한이 없다. 상기 도입에 이용되는 방법은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 폴리펩티드가 생성되어 그 활성이 증가될 수 있다.
상기 7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩티드의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 폴리펩티드 활성의 강화는, 상응하는 폴리펩티드의 활성 또는 농도 발현량이 야생형이나 변형 전 미생물 균주에서 발현된 폴리펩티드의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩티드로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 미생물에서 폴리뉴클레오티드의 일부 또는 전체의 변형은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위(engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오티드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 출원에 있어서, 상기 활성 강화의 대상이 되는 폴리펩티드는 인산 임포터일 수 있고, 구체적으로는 Pit 시스템, pitA 유전자에 의해 코딩되는 폴리펩티드 또는 PitA 폴리펩티드일 수 있다. 본 출원의 목적상, 상기 활성 강화는 외래 Pit 시스템, pitA 유전자에 의해 코딩되는 외래 폴리펩티드 또는 외래 PitA 폴리펩티드 도입에 의한 것일 수 있으나, 이에 제한되지 않는다.
본 출원의 목적상, 상기 인산 유입 시스템의 활성 강화는 외래 pitA 유전자 또는 외래 pitA에 의해 코딩되는 폴리펩티드를 도입하는 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서 "폴리펩티드의 도입"은, 미생물이 본래 가지고 있지 않았던 특정 폴리펩티드의 활성을 나타나게 되는 것 또는 해당 폴리펩티드의 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타나게 되는 것을 의미한다. 예를 들어, 특정 폴리펩티드가 도입되거나, 특정 폴리펩티드를 코딩하는 폴리뉴클레오티드가 미생물 내 염색체로 도입되거나, 특정 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터가 미생물 내로 도입되어 이의 활성이 나타나는 것일 수 있다.
본 출원에서 “외래 유전자”는 비자연적(non-native; non-natural)으로 미생물에 포함되는 유전자를 의미한다. 일례로 (a) 미생물에서 자연적으로 발견될 수 없는(exogenous) 유전자, (b) 미생물에서 자연적으로 발견될 수 있는(endogenous) 유전자이나 미생물에서 유전자의 전사 또는 번역 결과가 비자연적인 량(자연적으로 존재하는 양 대비 많거나 적은 량)의 유전자, (c) 미생물에 내재적으로 존재하는 폴리펩티드 서열이나, 이를 코딩하는 유전자의 서열이 상이한 경우, 및/또는 (d) 미생물 내에서 상기 언급한 사항이 두 가지 이상 조합한 경우일 수 있으나, 이에 제한되지 않는다.
본 출원의 목적상, 코리네박테리움 스테이셔니스 미생물 내에 pit 시스템이 부존재함에 따라, 상기 외래 유전자는 외래 pitA 유전자일 수 있으며, 에스케리키아 속(Escherichia sp.) 유래의 pitA 유전자일 수 있고, 대장균(Escherichia coli) 유래의 pitA 유전자일 수 있으나, 이에 제한되지 않는다.
본 출원에서 벡터는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 함유하는 DNA 제조물을 포함할 수 있다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 염색체 내에 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 표적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 폴리펩티드가 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 변이체를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원에서 용어, "균주(또는, 미생물)"는 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 폴리펩티드, 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
본 출원에서 용어, "퓨린 뉴클레오티드를 생산능을 갖는 코리네박테리움 스테이셔니스 미생물"이란 미생물이 배지에서 배양되는 경우, 생물체내에서 퓨린 뉴클레오티드'를 목적산물로 생산하여 축적하거나, 또는 이를 배지내에 분비하거나 축적하는 능력을 갖는 미생물을 의미한다. 일 구현 예로, 상기 '퓨린 뉴클레오티드 생산능을 갖는 '은 '퓨린 뉴클레오티드를 생산하는'과 혼용될 수 있다. 당해 퓨린 뉴클레오티드 생산 능력은 코리네박테리움 스테이셔니스 미생물의 야생주의 성질로서 갖는 것일 수 있고, 유전자 개량에 의해 부여되거나 증진된 것일 수 있다.
본 출원의 퓨린 뉴클레오티드 생산능을 갖는 미생물은 pit 유전자에 의하여 코딩되는 인산 유입 시스템(Pit 시스템)의 활성이 강화되어 퓨린 뉴클레오티드 생산능이 증가된 재조합 균주일 수 있다. 상기 퓨린 뉴클레오티드 생산능이 증가된 재조합 균주는, 천연의 야생형 미생물 또는 인산 유입 시스템 비변형 미생물 (즉, 야생형 인산 유입시스템을 발현하는 미생물, 인산 유입 시스템이 강화되지 않은 미생물, 또는 인산 유입시스템을 발현하지 않는 미생물)에 비하여 퓨린 뉴클레오티드 생산성이 증진된 것일 수 있으나, 이에 제한되지 않는다. 그 예로, 상기 퓨린 뉴클레오티드 생산능의 증가 여부를 비교하는 대상 균주인, 인산 유입 시스템 비변형 미생물은 CJX1664 (KCCM12285P, KR 10-1950141 B1, US 2020-0392478 A1), CJX1665 (KCCM12286P, KR 10-1950141 B1, US 2020-0392478 A1), CJI2332(KCCM12277P, KR 10-1950141 B1, US 2020-0392478 A1), 또는 CJI2335(KCCM12278P, KR 10-1956510 B1, EP 3705572 A1) 일 수 있으나, 이에 제한되지 않는다.
일 예로, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물의 퓨린 뉴클레오티드 생산능에 비하여 약 1% 이상, 구체적으로는 약 1% 이상, 약 2.5% 이상, 약 5% 이상, 약 6% 이상, 약 7% 이상, 약 8% 이상, 약 9% 이상, 약 10% 이상, 약 11% 이상, 약 12% 이상, 또는 13% 이상 (상한값은 특별한 제한은 없으며, 예컨대, 약 200% 이하, 약 150% 이하, 약 100% 이하, 약 50% 이하, 약 40% 이하, 약 30% 이하일 수 있음) 증가된 것일 수 있으나, 변이 전 모균주 또는 비변형 미생물의 생산능에 비해 +값의 증가량을 갖는 한, 이에 제한되지 않는다. 다른 예에서, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물에 비하여, 퓨린 뉴클레오티드 생산능이 약 1.01배 이상, 약 1.02배 이상, 약 1.03배 이상, 약 1.05배 이상, 약 1.06배 이상, 약 1.07배 이상, 약 1.08배 이상, 약 1.09배 이상, 약 1.10배 이상, 약 1.11배 이상, 약 1.12배 이상, 또는 약 1.13배 이상 (상한값은 특별한 제한은 없으며, 예컨대, 약 10배 이하, 약 5배 이하, 약 3배 이하, 또는 약 2배 이하일 수 있음) 증가된 것일 수 있으나, 이에 제한되지 않는다. 상기 용어 "약(about)"은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
본 출원의 퓨린 뉴클레오티드 생산능을 갖는 미생물은 상기 상기 Pit 시스템, PitA 폴리펩티드; 이를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하여, 목적 폴리펩티드 또는 상기 목적 폴리펩티드가 생산에 관여하는 목적 산물의 생산능을 갖는 미생물일 수 있으나 이에 제한되지 않는다. 상기 미생물은, 자연적으로 목적 폴리펩티드 또는 목적산물 생산능을 가지고 있는 미생물, 또는 목적 폴리펩티드 또는 목적산물 생산능이 없는 모균주에 목적 폴리펩티드 또는 목적산물 생산능이 부여된 미생물 일 수 있으나 이에 제한되지 않는다.
본 출원에서 용어, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 본 명세서에 기재된 인인산 유입시스템이 강화 또는 도입되지 않거나 강화 또는 도입되기 전의 균주를 의미할 수 있다. 상기 "비변형 미생물"은 "변형 전 균주", "변형 전 미생물", "비변이 균주", "비변형 균주", "비변이 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
본 출원에서 용어, "퓨린 뉴클레오티드"는 5'-이노신산(5'-inosine monophosphate, IMP), 5'-크산틸산(5'-xanthosine monophosphate, XMP), 및 5'-구아닌산(5'-guanosine monophosphate, GMP)으로 이루어진 군에서 선택되는 어느 하나 이상의 뉴클레오티드일 수 있다. 5'-이노신산은 아데닌이 탈아미노된 화합물로 히포잔틴·리보스·인산 각 1분자로 구성된 뉴클레오타이드를 의미한다. 5'-이노신산 은 5'-포스포라이보실-1-파이로포스페이트(5-phosphoribosyl-1-pyrophosphate; PRPP)로부터 생합성될 수 있으며, 구체적으로 PRPP의 1번 탄소에 결합되어 있던 피로인산기가 질소 원자로 치환되고, 9단계에 걸쳐 이미다졸 고리와 피리미딘 고리를 구성하여 형성될 수 있으나, 이에 제한되지 않는다. 5'-크산틸산은 5'-이노신산에서 탈수소화된 뉴클레오타이드를 의미한다. 상기 5'-크산틸산은 5'-이노신산 탈수소효소(inosine-5'-monophosphate dehydrogenase)에 의해 5'-이노신산으로부터 합성될 수 있으나, 이에 제한되지 않는다. 5'-구아닌산은 구아노신 분자 내의 리보오스 부분에 인산기가 에스테르결합을 이루고 있는 구조이며, 5'-구아닌산 생합성효소(GMP synthase)에 의해 5'-크산틸산에 암모니아 분자가 추가되어 합성될 수 있으나, 이에 제한되지 않는다.
본 출원의 다른 하나의 양태는 인산 유입 시스템(Pit 시스템)의 활성이 강화된 퓨린 뉴클레오티드 생산능을 갖는 코리네박테리움 스테이셔니스 미생물을 배지에서 배양하는 단계를 포함하는, 퓨린 뉴클레오티드의 생산방법을 제공한다.
상기 인산 유입 시스템, Pit 시스템, 강화, 퓨린 뉴클레오티드, 및 코리네박테리움 스테이셔니스 미생물 등은 다른 양태에서 기재한 바와 같다.
본 출원에서, 용어 "배양"은 상기 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 상기 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 상기 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
배지의 온도는 27℃ 내지 37℃, 구체적으로는 30℃ 내지 33℃일 수 있으나 이에 제한되지 않는다. 배양 기간은 유용 물질의 원하는 생성량이 수득될 때까지 계속될 수 있으며, 구체적으로는 20 시간 내지 120 시간일 수 있으나 이에 제한되지 않는다.
구체적으로, 코리네박테리움 속 균주에 대한 배양 배지는 문헌["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)]에서 찾아 볼 수 있다.
본 출원의 배양에 의하여 생산된 퓨린 뉴클레오티드는 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 퓨린 뉴클레오티드 생산방법은, 본 출원의 코리네박테리움 스테이셔니스 미생물을 준비하는 단계, 상기 미생물을 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 퓨린 뉴클레오티드의 생산방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 미생물(배양이 수행된 미생물)로부터 퓨린 뉴클레오티드를 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 퓨린 뉴클레오티드를 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 및 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 퓨린 뉴클레오티드를 회수할 수 있다.
본 출원의 생산방법은, 추가적인 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 퓨린 뉴클레오티드 생산방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 연속적 또는 비연속적으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 본 출원의 5'-구아닌산 (5'-guanosine monophosphate, GMP) 생산방법은, 상기 배양하는 단계는 5'-크산틸산(5'-xanthosine monophosphate, XMP)을 5'-구아닌산으로 전환하는 단계를 추가로 포함할 수 있다. 본 출원의 GMP 생산방법에 있어서, 상기 전환하는 단계는 상기 배양하는 단계 또는 상기 회수하는 단계 이후에 추가로 포함될 수 있다. 상기 전환하는 단계는 당해 기술 분야에 공지된 적합한 방법을 이용하여 수행할 수 있다. 예컨대, 상기 전환은 코리네형 미생물, 대장균 또는 5'-크산틸산 아미나아제를 이용하여 수행할 수 있으나(KR 10-0655902 B1), 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 본 출원의 코리네박테리움 스테이셔니스 미생물; 이를 배양한 배지; 또는 이들의 조합을 포함하는 퓨린 뉴클레오티드 생산용 조성물을 제공하는 것이다.
본 출원의 조성물은 퓨린 뉴클레오티드 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 조성물에서, 미생물, 배지, 및 퓨린 뉴클레오티드 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 본 출원의 코리네박테리움 스테이셔니스 미생물의 퓨린 뉴클레오티드 생산 용도를 제공하는 것이다.
본 출원의 퓨린 뉴클레오티드 생산 용도에서, 미생물, 퓨린 뉴클레오티드 등은 상기 다른 양태에서 기재한 바와 같다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 출원을 예시적으로 설명하기 위한 것으로, 본 출원의 범위가 이들 실시예에 의해 제한되는 것은 아니며, 본 출원이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어 명백할 것이다.
실시예 1: 외래 pitA 도입 균주 제작 및 IMP 생산능 평가
1-1: 외래 pitA 유전자 도입을 위한 재조합벡터 제작 및 IMP 생산 균주 제작
코리네박테리움 스테셔니스의 야생형 균주에는 pit 시스템이 존재하지 않는다. 이에, 코리네박테리움 스테셔니스에 외래의 Pit 시스템을 도입하기 위한 벡터를 제작하였다. 또한, 상기 외래 pitA 유전자에 코리네박테리움 속 미생물의 프로모터 중 강화 프로모터로 공지된 CJ1 프로모터(대한민국 특허 등록번호 제10-0620092호, 서열번호 3)를 결합하였다. 이를 코리네박테리움 속 미생물의 페리플라즈믹 결합 단백질(periplasmic binding protein) 중 하나인 fepB 유전자 자리에 치환하는 벡터를 제작하였다.
구체적으로, 코리네박테리움 스테셔니스의 fepB 유전자를 탈락시킬 수 있는 삽입용 벡터제작을 위해 코리네박테리움 스테셔니스 야생형인 ATCC6872 균주의 염색체 유전자를 Intron사의 G-spin Total DNA extraction mini kit (Cat. No 17045)를 이용하여 kit에 제공된 protocol에 따라 분리하고, 이를 주형으로 하여 PCR을 진행하였다. 중합효소는 Maxime PCR PreMix (i-pfu) 고-신뢰 DNA 폴리머라제(Intron)를 사용하였으며, PCR은 변성 95℃ 5분 후, 변성 95℃ 30초, 어닐링 54℃ 30초, 및 중합반응 72℃ 1분 30초를 24회 반복하였다. 그 결과, 두 종류의 서로 다른 PCR 생성물(fepBdel-A, fepBdel-B)을 얻었다. 상기 fepB-A는 1038 bp의 크기이며, 서열번호 4 및 서열번호 5를 프라이머로 사용하여 증폭한 것이다. 상기 fepB-B는 1111 bp 크기이며, 서열번호 6 및 서열번호 7을 프라이머로 하여 증폭한 것이다. 상기 두 종류의 증폭 산물을 주형으로 하여 sewing PCR 기법으로 2차 PCR을 수행하였다. PCR은 상기 PCR 조건과 동일 조건에서 수행하였고, 그 결과 fepB 유전자가 결손되고 SpeI과 NotI 제한효소 사이트를 가운데에 포함하는 2131 bp의 PCR 생성물을 얻었다. 이후에 상기 증폭 산물을 양 말단에 위치한 제한효소 사이트(fepBdel-A: HindIII, fepBdel-B: HindIII)를 이용하여 자른 후, T4 리가아제의 활성을 이용해 pDZ 벡터에 클로닝하였으며 이를 통해 fepB 유전자 결손을 위한 pDZ-fepBdel 벡터를 얻었다. 상기에서 사용된 프라이머의 서열들은 각각 다음과 같다.
서열번호 명칭 서열
4 fepBdel-A-F CCCAAGCTTCCGGTGTTCAGAATCGCTCCG
5 fepBdel-A-R GCGGCCGCAAAGGACTAGTCCTCCGGCATTCAGTCAGGTC
6 fepBdel-B-F CTAGTCCTTTGCGGCCGCCCATTCCGCCCTTCAACCTTCCGCCTAGATTACTTCTC
7 fepBdel-B-R CCCAAGCTTGTGCAAGCTGTGGATCGTCTTCC
상기 pDZ-fepBdel 벡터에서 탈락된 fepB 유전자의 핵산 부분을 외래 pitA로 치환한 벡터를 다음과 같은 방법으로 제작하였다. 구체적으로, 야생형 코리네박테리움 스테셔니스 ATCC6782 균주 및 대장균 MG1655의 염색체를 분리하고, 이를 주형으로 하여 중합효소는 Maxime PCR PreMix (i-pfu) 고-신뢰 DNA 폴리머라제(Intron)를 사용하였으며, PCR은 변성 95℃ 5분 후, 변성 95℃ 30초, 어닐링 54℃ 30초, 및 중합반응 72℃ 2분 30초를 24회 반복하였다. PCR 결과, CJ1 프로모터와 연결된 pitA 유전자 PCR 생성물 두 종 (pCJ1-pitA-A, pCJ1-pitA-B)을 얻었다. 상기 pCJ1-pitA-A는 프로모터 부분의 PCR 산물로서 341 bp의 크기이며, 서열번호 8과 서열번호 9를 프라이머로 하여 증폭한 것이다. 상기 pCJ1-pitA-B는 pitA 유전자 PCR 산물로서 1537 bp의 크기이며, 서열번호 10과 서열번호 11을 프라이머로 하여 증폭한 것이다. 상기 두 종류의 증폭 산물을 주형으로 하여 sewing PCR 기법으로 2차 PCR을 수행하였다. PCR은 상기 동일 조건에서 수행하였고, 그 결과 pDZ-fepBdel 벡터와 상동성을 가지는 염기서열을 양 말단에 포함하는 pCJ1 프로모터와 결합된 pitA 유전자를 획득하였다. 이 유전자를 SpeI 및 NotI 제한효소로 처리한 pDZ-fepBdel 벡터에 상동재조합 효소(homologous recombinase)를 이용한 방법으로 클로닝하여 pDZ-△fepB::pCJ1/pitA(Eco) 벡터를 수득하였다. 상기에서 사용된 프라이머의 서열들은 각각 다음과 같다.
서열번호 명칭 서열
8 pCJ1-pitA-A-F TTCGACCTGACTGAATGCCGGAGGAACCGCGGGCTTATTCCATTACATG
9 pCJ1-pitA-A-R CAAACAAATGTAGCATTTAATCTCCTAGATTGGGTTTCACTCAAGG
10 pCJ1-pitA-B-F ACCCAATCTAGGAGATTAAATGCTACATTTGTTTGCTGGCCTG
11 pCJ1-pitA-B-R CGGAAGGTTGAAGGCGGATTACAGGAACTGCAAGGAGAGCCAG
이후, IMP 생산 균주인 CJI2332(코리네박테리움 스테셔니스 ATCC6872 유래의 IMP 생산주, KCCM12277P, 대한민국 등록특허 제10-1950141호, US 2020-0392478 A1) 및 CJI2335 (코리네박테리움 스테셔니스 ATCC6872 유래의 IMP 생산주, KCCM12278P, 대한민국 등록특허 제10-1956510호, EP 3705572 A1) 각각의 균주에 일렉트로포레이션 법을 통하여 상기 수득한 벡터 pDZ-△fepB::pCJ1/pitA(Eco)를 형질전환하고, 2차 교차 과정을 거쳐 염색체 상의 내재적 fepB 유전자 가운데에 CJ1 프로모터-pitA 유전자가 포함되는 균주를 획득하였다. 새로이 삽입된 CJ1 프로모터-pitA 유전자는 삽입된 유전자의 양 말단과 fepB 유전자가 만나는 부분을 증폭할 수 있는 서열번호 12와 서열번호 13을 프라이머로 하여 확인하였다. 위와 같은 방법으로 CJ1 프로모터를 통해 외래 도입된 pitA가 항상 과발현 되는 균주인 CJI2332_pCJ1/pitA 및 CJI2335_pCJ1/pitA 두 균주를 획득하였다.
서열번호 명칭 서열
12 fepBdel-check-F GACCTGACTGAATGCCGGAGG
13 fepBdel-check-R GGAAGGTTGAAGGCGGAGTGG
1-2. 외래 pitA 도입 균주의 IMP 생산능 평가
실시예 1-1에서 제작한 CJI2332_pCJ1/pitA, CJI2335_pCJ1/pitA 균주에 대해, IMP 생산능 향상을 확인하기 위하여 다음의 실험을 진행하였다.
구체적으로, 가압 살균한 지름 18mm 시험관 종배지 5ml에 CJI2332_pCJ1/pitA, CJI2332, CJI2335_pCJ1/pitA, 및 CJI2335를 각각 접종하고 30℃ 온도에서 24시간 진탕 배양하여 종배양액으로 사용하였다. 발효배지 29ml를 250ml 진탕용 삼각플라스크에 분주하고 121℃온도에서 15분간 가압 살균한 후, 종 배양액 2ml을 접종하여 3일간 배양하였다. 배양 조건은 회전 수 170rpm, 온도 30℃, pH 7.5로 조절하였다. 상기 종배지 및 발효배지의 조성은 다음과 같다.
IMP 종배지
포도당 1%, 펩톤1%, 육즙 1%, 효모엑기스 1%, 염화나트륨 0.25%, 아데닌 100㎎/L, 구아닌 100㎎/L, pH 7.2 (배지 1L 기준)
IMP 플라스크 발효배지
글루타민산 나트륨 0.1%, 암모늄클로라이드 1%, 황산마그네슘 1.2%, 염화칼슘 0.01%, 황산철 20㎎/L, 황산망간 20㎎/L, 황산아연 20㎎/L, 황산구리 5㎎/L, L-시스테인 23㎎/L, 알라닌 24㎎/L, 니코틴산 8㎎/L, 비오틴 45㎍/L, 티아민염산 5㎎/L, 아데닌 30㎎/L, 인산(85%) 1.9%, 포도당4.2%, 원당 2.4% (배지 1L 기준)
배양 종료 후 HPLC를 이용한 방법에 의해 IMP 생산량을 측정한 결과는 하기 표 4와 같다.
균주 IMP (g/L) IMP 생산능
(%)
Flask1 Flask2 Flask3
대조군1-1 CJI2332 1.0 1.1 1.0 100
실험군1-1 CJI2332_pCJ1/pitA 1.2 1.2 1.1 113.0
대조군1-2 CJI2335 1.1 1.1 1.0 100
실험군1-2 CJI2335_pCJ1/pitA 1.2 1.2 1.2 112.5
상기 표 4에서 나타낸 바와 같이, 동일한 조건하에서 CJI2332_pCJ1/pitA 및 CJI2335_pCJ1/pitA 균주에서 생산된 IMP 축적량 수율이 모균주 CJI2332 및 CJI2335에 대비하여 각각 약 13%, 약 12.5% 증가함을 확인하였다.상기 CJI2332_pCJ1/pitA는 CJI2630으로 명명하였으며, 부다페스트조약 하의 수탁기관인 한국미생물보존센터에 2021년 4월 13일자로 기탁하여 수탁번호 KCCM12974P를 부여받았다.
상기 CJI2335_pCJ1/pitA는 CJI2631으로 명명하였으며, 부다페스트조약 하의 수탁기관인 한국미생물보존센터에 2021년 4월 13일자로 기탁하여 수탁번호 KCCM12975P를 부여받았다.
실시예 2 : 외래 pitA 도입 균주 제작 및 XMP 생산능 평가
2-1: 외래 pitA 도입 균주 제작
XMP 생산 균주인 CJX1664 (코리네박테리움 스테셔니스 유래의 XMP 생산주, KCCM12285P, 대한민국 등록특허 제10-1950141호, US 2020-0392478 A1) 및 CJX1664의 purA(G85S) 변이주인 CJX1665 (KCCM12286P, 대한민국 등록특허 제10-1950141호, US 2020-0392478 A1) 각각의 균주에 일렉트로포레이션법을 통하여 pDZ-△fepB::pCJ1/pitAA(Eco)를 형질전환하고, 2차 교차 과정을 거쳐 염색체 상의 내재적 fepB 유전자 가운데에 pCJ1-pitA 유전자를 포함하는 CJX1664_pCJ1/pitA 균주 및 CJX1665_pCJ1/pitA 균주를 획득하였다. 새로이 삽입된 pCJ1-pitA 유전자는 삽입된 유전자의 양 말단과 fepB 유전자가 만나는 부분을 증폭할 수 있는 서열번호 12 및 서열번호 13을 프라이머로 하여 확인하였다.
2-2. 외래 pitA 도입 균주의 XMP 생산능 평가
실시예 2-1에서 제작한 CJX1664_pCJ1/pitA 균주 및 CJX1665_pCJ1/pitA 균주의 XMP 생산능을 측정하기 위하여 플라스크 평가를 실시하였다. 하기 종배지 2.5 ml을 함유하는 14 ml 튜브에 CJX1664, CJX1664_pCJ1/pitA, CJX1665, 및 CJX1665_pCJ1/pitA를 각각 접종하고 30℃에서 24시간 동안 170 rpm으로 진탕 배양하였다. 하기의 생산배지 32 ml (본배지 24 ml + 별도 살균 배지 8 ml)을 포함하고 있는 250 ml 코너-바플 플라스크에 0.7 ml의 종 배양액을 접종하고 30℃에서 75시간동안 170 rpm으로 진탕 배양하였다. 상기 종배지, 본배지 및 별도 살균 배지의 조성은 다음과 같다.
XMP 플라스크 종배지
포도당 30g/L, 펩톤 15 g/L, 효모엑기스 15 g/L, 염화나트륨 2.5 g/L, 우레아 3 g/L, 아데닌 150 mg/L, 구아닌 150 mg/L, pH 7.0 (배지 1L 기준)
XMP 플라스크 생산배지 (본배지)
포도당 50 g/L, 황산마그네슘 10 g/L, 염화칼슘 100 mg/L, 황산철 20 mg/L, 황산망간 10 mg/L, 황산아연 10 mg/L, 황산구리 0.8 mg/L, 히스티딘 20 mg/L, 시스틴 15 mg/L, 베타-알라닌 15 mg/L, 비오틴 100 ug/L, 티아민 5 mg/L, 아데닌 50 mg/L, 구나닌 25 mg/L, 니아신 15 mg/L, pH 7.0 (배지 1L 기준)
XMP 플라스크 생산배지 (별도 살균 배지)
인산 제1칼륨 18 g/L, 인산 제2칼륨 42 g/L, 우레아 7 g/L, 황산암모늄 5 g/L (배지 1L 기준)
배양 종료 후 HPLC를 이용한 방법에 의해 XMP의 생산량을 측정한 결과는 하기 표 5와 같다.
균주 XMP (g/L) XMP 생산능
(%)
Flask1 Flask2 Flask3
대조군2-1 CJX1664 2.5 2.5 2.4 100
실험군2-1 CJX1664_ pCJ1/pitA 2.6 2.7 2.6 106.7
대조군2-2 CJX1665 2.7 2.6 2.5 100
실험군2-2 CJX1665_pCJ1/pitA 2.8 2.8 2.7 106.4
상기 표 5에서 나타낸 바와 같이, 대장균의 pitA를 항상발현하는 균주인 CJX1664_ pCJ1/pitA 및 CJX1665_pCJ1/pitA가 생산한 XMP 농도가 모균주 CJX1664 및 CJX1665에 비하여 각각 6.7%, 6.4% 증가하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 제한적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2022007225-appb-img-000001
Figure PCTKR2022007225-appb-img-000002

Claims (11)

  1. pit 유전자에 의하여 코딩되는 인산 유입 시스템의 활성이 강화되고 퓨린 뉴클레오티드 생산능을 갖는, 코리네박테리움 스테이셔니스 미생물.
  2. 제1항에 있어서, 상기 인산 유입 시스템의 활성 강화는, pitA 유전자에 의해 코딩되는 폴리펩티드의 활성 강화인, 미생물.
  3. 제2항에 있어서, 상기 pitA 유전자는 외래 pitA 유전자인, 미생물.
  4. 제3항에 있어서, 상기 외래 pitA 유전자는 대장균 유래인 것인, 미생물.
  5. 제2항에 있어서, 상기 pitA 유전자에 의해 코딩되는 폴리펩티드는 서열번호 1의 아미노산 서열과 99% 이상의 동일성을 갖는 폴리펩티드를 포함하는 것인, 미생물.
  6. 제1항에 있어서, 상기 퓨린 뉴클레오티드는 5'-이노신산, 5'-크산틸산, 및 5'-구아닌산으로 이루어진 군에서 선택되는 어느 하나 이상인, 미생물.
  7. 제1항 내지 제6항 중 어느 한 항의 미생물을 배지에서 배양하는 단계를 포함하는, 퓨린 뉴클레오티드의 생산방법.
  8. 제7항에 있어서, 상기 방법은 상기 배양에 따른 미생물 또는 배지로부터 퓨린 뉴클레오티드를 회수하는 단계를 추가로 포함하는 것인, 퓨린 뉴클레오티드의 생산방법.
  9. 제7항에 있어서, 상기 퓨린 뉴클레오티드는 5'-이노신산, 5'-크산틸산, 및 5'-구아닌산으로 이루어진 군에서 선택되는 어느 하나 이상인, 퓨린 뉴클레오티드의 생산방법.
  10. pit 유전자에 의하여 코딩되는 인산 유입 시스템의 활성이 강화되고 퓨린 뉴클레오티드 생산능을 갖는, 코리네박테리움 스테이셔니스 미생물; 이를 배양한 배지; 또는 이들의 조합을 포함하는 퓨린 뉴클레오티드 생산용 조성물.
  11. pit 유전자에 의하여 코딩되는 인산 유입 시스템의 활성이 강화되고 퓨린 뉴클레오티드 생산능을 갖는, 코리네박테리움 스테이셔니스 미생물의 퓨린 뉴클레오티드 생산 용도.
PCT/KR2022/007225 2021-05-21 2022-05-20 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법 WO2022245176A1 (ko)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP22805029.0A EP4342990A1 (en) 2021-05-21 2022-05-20 Microorganism producing purine nucleotide, and purine nucleotide production method using same
BR112023024323A BR112023024323A2 (pt) 2021-05-21 2022-05-20 Microrganismo que produz nucleotídeos de purina e método para produzir nucleotídeos de purina usando o mesmo
JP2023572150A JP2024518643A (ja) 2021-05-21 2022-05-20 プリン・ヌクレオチドを生産する微生物及びそれを用いたプリン・ヌクレオチドの生産方法
CN202280049499.8A CN117980485A (zh) 2021-05-21 2022-05-20 生产嘌呤核苷酸的微生物及其生产嘌呤核苷酸的方法
AU2022276997A AU2022276997A1 (en) 2021-05-21 2022-05-20 Microorganism producing purine nucleotides and method for producing purine nucleotides using the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0065740 2021-05-21
KR1020210065740A KR102634303B1 (ko) 2021-05-21 2021-05-21 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법

Publications (1)

Publication Number Publication Date
WO2022245176A1 true WO2022245176A1 (ko) 2022-11-24

Family

ID=84140702

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/007225 WO2022245176A1 (ko) 2021-05-21 2022-05-20 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법

Country Status (7)

Country Link
EP (1) EP4342990A1 (ko)
JP (1) JP2024518643A (ko)
KR (1) KR102634303B1 (ko)
CN (1) CN117980485A (ko)
AU (1) AU2022276997A1 (ko)
BR (1) BR112023024323A2 (ko)
WO (1) WO2022245176A1 (ko)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
KR100655902B1 (ko) 2005-11-25 2006-12-08 씨제이 주식회사 Ｘｍｐ에서 ｇｍｐ로의 전환율이 향상된 코리네박테리움암모니아게네스 ｃｊｘｃｖ24 ｋｃｃｍ-10693ｐ
KR20150099809A (ko) * 2013-05-13 2015-09-01 아지노모토 가부시키가이샤 Ｌ-아미노산의 제조법
US20160201100A1 (en) * 2013-10-02 2016-07-14 Ajinomoto Co., Inc. Method for Producing an L-Amino Acid Using a Bacterium of the Family Enterobacteriaceae Having Attenuated Expression of a Phosphate Transporter-Encoding Gene
KR101950141B1 (ko) 2018-08-01 2019-02-19 씨제이제일제당 (주) 신규 아데닐로석시네이트 신세타아제 및 이를 이용한 퓨린 뉴클레오티드 생산방법
KR101956510B1 (ko) 2018-07-27 2019-03-08 씨제이제일제당 (주) 신규 5'-이노신산 디하이드로게나아제 및 이를 이용한 5'-이노신산 제조방법
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof
KR102185850B1 (ko) * 2020-02-21 2020-12-02 씨제이제일제당 주식회사 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7662943B2 (en) 2004-12-16 2010-02-16 Cj Cheiljedang Corporation Promoter sequences from Corynebacterium ammoniagenes
KR100620092B1 (ko) 2004-12-16 2006-09-08 씨제이 주식회사 코리네박테리움 속 세포로부터 유래된 신규한 프로모터서열, 그를 포함하는 발현 카세트 및 벡터, 상기 벡터를포함하는 숙주 세포 및 그를 이용하여 유전자를 발현하는방법
KR100655902B1 (ko) 2005-11-25 2006-12-08 씨제이 주식회사 Ｘｍｐ에서 ｇｍｐ로의 전환율이 향상된 코리네박테리움암모니아게네스 ｃｊｘｃｖ24 ｋｃｃｍ-10693ｐ
US9506094B2 (en) 2013-05-13 2016-11-29 Ajinomoto Co., Inc. Method for producing L-amino acid using microorganism having increased phosphate transporter activity
KR20150099809A (ko) * 2013-05-13 2015-09-01 아지노모토 가부시키가이샤 Ｌ-아미노산의 제조법
US9873898B2 (en) 2013-10-02 2018-01-23 Ajinomoto Co., Inc. Method for producing an L-amino acid using a bacterium of the family Enterobacteriaceae having attenuated expression of a phosphate transporter-encoding gene
US20160201100A1 (en) * 2013-10-02 2016-07-14 Ajinomoto Co., Inc. Method for Producing an L-Amino Acid Using a Bacterium of the Family Enterobacteriaceae Having Attenuated Expression of a Phosphate Transporter-Encoding Gene
US10273491B2 (en) 2015-01-29 2019-04-30 Cj Cheiljedang Corporation Promoter and uses thereof
US10584338B2 (en) 2016-08-31 2020-03-10 Cj Cheiljedang Corporation Promoter and use thereof
KR101956510B1 (ko) 2018-07-27 2019-03-08 씨제이제일제당 (주) 신규 5'-이노신산 디하이드로게나아제 및 이를 이용한 5'-이노신산 제조방법
EP3705572A1 (en) 2018-07-27 2020-09-09 CJ Cheiljedang Corporation Novel 5'-inosine monophosphate dehydrogenase and 5'-inosine monophosphate production method using same
KR101950141B1 (ko) 2018-08-01 2019-02-19 씨제이제일제당 (주) 신규 아데닐로석시네이트 신세타아제 및 이를 이용한 퓨린 뉴클레오티드 생산방법
US20200392478A1 (en) 2018-08-01 2020-12-17 Cj Cheiljedang Corporation Novel adenylosuccinate synthetase and method for producing purine nucleotides using the same
KR102185850B1 (ko) * 2020-02-21 2020-12-02 씨제이제일제당 주식회사 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법

Non-Patent Citations (18)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence And Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
"Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
ATSCHUL, S. F. ET AL., J MOLEC BIOL, vol. 215, 1990, pages 403
CARILLO ET AL., SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DATABASE Protein ANONYMOUS : "inorganic phosphate transporter PitA [Escherichia coli] ", XP093007022, retrieved from NCBI *
DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
FRIDMAN ALLA, SAHA ARINDAM, CHAN ADRIANO, CASTEEL DARREN E., PILZ RENATE B., BOSS GERRY R.: "Cell cycle regulation of purine synthesis by phosphoribosyl pyrophosphate and inorganic phosphate", BIOCHEMICAL JOURNAL, vol. 454, no. 1, 15 August 2013 (2013-08-15), GB , pages 91 - 99, XP009541222, ISSN: 0264-6021, DOI: 10.1042/BJ20130153 *
GRIBSKOV ET AL., NUCL ACIDS RES., vol. 14, 1986, pages 6745
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
JOURNAL OF BACTERIOLOGY, vol. 183, no. 17, September 2001 (2001-09-01), pages 5008 - 5014
NEEDLEMAN ET AL., J MOLBIOL., vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, pages 2444
RICE ET AL.: "The European Molecular Biology Open Software Suite", TRENDS GENET., vol. 16, 2000, pages 276 - 277, XP004200114, DOI: 10.1016/S0168-9525(00)02024-2
SAMBROOK ET AL., MOLECULAR CLONING, 2012
SITNICKA ET AL.: "Advances in Cell Biology", FUNCTIONAL ANALYSIS OF GENES, vol. 2, 2010, pages 1 - 16
SMITHWATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482

Also Published As

Publication number Publication date
CN117980485A (zh) 2024-05-03
KR102634303B1 (ko) 2024-02-06
BR112023024323A2 (pt) 2024-02-06
JP2024518643A (ja) 2024-05-01
KR20220157782A (ko) 2022-11-29
AU2022276997A1 (en) 2024-01-18
EP4342990A1 (en) 2024-03-27

Similar Documents

Publication Publication Date Title
WO2019117671A1 (ko) 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2022231369A1 (ko) 신규한 포르메이트 의존성 포스포리보실글리신아미드 포밀 전이효소 변이체 및 이를 이용한 imp 생산 방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154177A1 (ko) 신규한 3d-(3,5/4)-트리하이드록시사이클로헥세인-1,2-다이온 아실하이드롤라아제 변이체 및 이를 이용한 imp 생산 방법
WO2022154181A1 (ko) 신규한 1,4-알파-글루칸-분지 효소 변이체 및 이를 이용한 imp 생산 방법
WO2022154178A1 (ko) 신규한 혐기성 코프로포르피리노겐 iii 옥시다제 변이체 및 이를 이용한 imp 생산 방법
WO2022163923A1 (ko) 신규한 atp 포스포리보실트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163922A1 (ko) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022231371A1 (ko) 신규한 5-(카르복시아미노)이미다졸리보뉴클레오티드합성효소 변이체 및 이를 이용한 imp 생산 방법
WO2022231370A1 (ko) 신규한 2중기능성 포스포리보실아미노이미다졸카르복사미드 포밀트랜스퍼라아제/imp 사이클로하이드롤라아제 변이체 및 이를 이용한 imp 생산 방법
WO2022245176A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2022163930A1 (ko) 신규한 2-숙시닐-5-엔도피루빌-6-하이드록시-3-사이클로헥센-1-카복실레이트 신타아제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154188A1 (ko) 신규한 폴리케타이드 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154184A1 (ko) 신규한 셀레니드, 물 디키나제 변이체 및 이를 이용한 imp 생산 방법
WO2022154179A1 (ko) 신규한 d-알라닌--d-알라닌 리가아제 변이체 및 이를 이용한 imp 생산 방법
WO2022154180A1 (ko) 신규한 포름아미도피리미딘-dna 글리코실라제 변이체 및 이를 이용한 imp 생산 방법
WO2022154189A1 (ko) 신규한 피토엔 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154185A1 (ko) 신규한 펩타이드 메티오닌 설폭사이드 환원효소 변이체 및 이를 이용한 imp 생산 방법
WO2022163919A1 (ko) 신규한 우레아제 부속 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163918A1 (ko) 신규한 테트라하이드로디피콜리네이트 n-숙시닐트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163924A1 (ko) 신규한 5,10-메틸렌테트라하이드로폴레이트 리덕타제 변이체 및 이를 이용한 l-발린 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22805029

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023572150

Country of ref document: JP

Ref document number: 2301007629

Country of ref document: TH

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023024323

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2022276997

Country of ref document: AU

Ref document number: AU2022276997

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2023134123

Country of ref document: RU

Ref document number: 2022805029

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022805029

Country of ref document: EP

Effective date: 20231221

WWE Wipo information: entry into national phase

Ref document number: 202280049499.8

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2022276997

Country of ref document: AU

Date of ref document: 20220520

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112023024323

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20231121