WO2019203435A1 - 유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법 - Google Patents

유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법 Download PDF

Info

Publication number
WO2019203435A1
WO2019203435A1 PCT/KR2019/002432 KR2019002432W WO2019203435A1 WO 2019203435 A1 WO2019203435 A1 WO 2019203435A1 KR 2019002432 W KR2019002432 W KR 2019002432W WO 2019203435 A1 WO2019203435 A1 WO 2019203435A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
organic acid
promoter
recombinant
strain
Prior art date
Application number
PCT/KR2019/002432
Other languages
English (en)
French (fr)
Other versions
WO2019203435A8 (ko
Inventor
박재연
이태영
이기성
코이비스토이넨오우티
코이부란타카리
Original Assignee
에스케이이노베이션 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 에스케이이노베이션 주식회사 filed Critical 에스케이이노베이션 주식회사
Priority to US17/047,805 priority Critical patent/US11655478B2/en
Priority to CN201980039165.0A priority patent/CN112639104B/xx
Priority to JP2020557290A priority patent/JP7304889B2/ja
Priority to EP19787990.1A priority patent/EP3800258A4/en
Publication of WO2019203435A1 publication Critical patent/WO2019203435A1/ko
Publication of WO2019203435A8 publication Critical patent/WO2019203435A8/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor
    • C12N1/165—Yeast isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42—Hydroxy-carboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/56—Lactic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01001—Alcohol dehydrogenase (1.1.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01027—L-Lactate dehydrogenase (1.1.1.27)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01075—Malonyl CoA reductase (malonate semialdehyde-forming)(1.2.1.75)

Definitions

  • the present invention relates to a novel promoter derived from an organic acid-resistant yeast, and more particularly, to a novel promoter for regulating ADH gene expression in organic acid-resistant yeast and a method for producing an organic acid through expression of an organic acid production-related gene using the same.
  • microorganisms that survive at low pH have very low growth rates and are unable to obtain sufficient cell mass required for material production, resulting in low raw material consumption rates, making them difficult to apply to industrial fermentation processes. Therefore, it is very important to select microorganisms having the characteristics of maintaining a high raw material consumption rate while growing at a lower pH than the product's pKa.
  • microorganisms can be selected from various strain libraries through various selection pressures, and examples of the selection pressures include resistance to target product concentrations, resistance to raw material concentrations, raw material consumption rates, pH conditions, and minimum media. Growth ability and the like.
  • the selection of microorganisms can be carried out through a manual, but when screened through automation, it is possible to quickly select strains having excellent characteristics in more subjects.
  • Selected microorganisms have excellent properties to withstand selection pressures, but in most cases they do not produce the desired product and often produce other products. Therefore, in order to give the selected microorganisms the ability to produce a target product, a genetically engineered conversion gene to the target product is carried out, and studies are conducted to remove the ability to produce the product originally produced.
  • a method of introducing a gene capable of converting the desired product or strengthening the originally possessed gene is used, but generally the activity of the possessed gene and the enzyme produced therefrom. Since these are often low, the foreign strong genes are often introduced. In addition, the introduction of a promoter capable of strongly expressing foreign DNA is essential in this process.
  • the target microorganism is a yeast
  • a promoter of Saccharomyces cerevisiae which is well known in yeast
  • various genetic engineering techniques developed in S. cerevisiae may be applied.
  • strong promoters can be selected from the promoters involved in the main carbon flux of the selected microorganisms, and through various techniques, it is necessary to first apply a method capable of expressing a gene of interest most effectively.
  • Promoters typically have a variety of regulatory domains, including the core promotor region in eukaryotic bacteria, and each regulatory gene is different for each microorganism. Therefore, by selecting a sequence of sufficient length from the 5 'top of the ORF, the optimal site can be found while confirming the role of the promoter. However, a separate study has been conducted on the regulation mechanisms of distant regulation (enhancer, silencer etc) or complex action. need.
  • the present inventors have made efforts to find a promoter suitable for foreign gene expression in order to screen yeasts resistant to organic acids and to give a production capacity for useful substances to the yeast.
  • the expression of the target gene is significantly increased, the production ability of the target product is increased, thereby completing the present invention.
  • Another object of the present invention is to provide a recombinant vector containing the promoter and a recombinant microorganism into which the recombinant vector is introduced.
  • Still another object of the present invention is to provide a gene construct in which the novel promoter and the gene encoding the protein of interest are operably linked.
  • Still another object of the present invention is to provide a method for preparing an organic acid using a recombinant microorganism into which a recombinant vector including a novel promoter and an organic acid generation gene is introduced.
  • the present invention provides a promoter represented by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • the present invention also provides a recombinant vector comprising the promoter.
  • the present invention also provides a recombinant microorganism into which the recombinant vector is introduced.
  • the present invention also comprises the steps of (a) culturing a recombinant microorganism into which the recombinant vector is introduced to produce an organic acid; And (b) provides a method for producing an organic acid comprising the step of obtaining the resulting organic acid.
  • the present invention also provides a gene construct in which a promoter represented by the nucleotide sequence of SEQ ID NO: 1 and a gene encoding a protein of interest are operably linked.
  • the present invention also provides a recombinant microorganism wherein the gene construct is introduced on a chromosome.
  • the present invention also comprises the steps of (a) culturing a recombinant microorganism into which the gene construct is introduced to produce an organic acid; And (b) provides a method for producing an organic acid comprising the step of obtaining the resulting organic acid.
  • the present invention also provides a recombinant strain characterized in that the g4423 gene is deleted or attenuated in an acid resistant yeast YBC strain (KCTC13508BP), thereby reducing the ethanol production ability.
  • KCTC13508BP acid resistant yeast YBC strain
  • the present invention also provides a recombinant microorganism for overexpression of a gene of interest in which a gene of interest is inserted downstream of the promoter of g4423 in the genome of the YBC strain (KCTC13508BP) and whose expression is regulated by the promoter of g4423.
  • the present invention also comprises the steps of (a) culturing the recombinant microorganism to produce an organic acid; And (b) provides a method for producing an organic acid comprising the step of obtaining the resulting organic acid.
  • the present invention also provides a method for overexpressing the target gene by culturing the recombinant microorganism.
  • FIG. 1 shows examples of gene cassettes for expressing one, two or three 3-HP pathway enzymes.
  • (a) is a cassette expressing a single enzyme in general,
  • (b) uses a g4423 promotor, a cassette for introducing the MCRsa1 enzyme,
  • (d) A cassette for introducing three 3-HP producing enzymes (MCR, HPDH, EUTE),
  • e) is a cassette for using a 1kb g4423 promotor as the promotor of the MCR enzyme.
  • Figure 2 is an example of Yeast expression plasmids for expressing one, two or three 3-HP pathway enzymes.
  • Figure 3 shows the results of confirming the expression level of the MCR genes (MCRsa1, MCRsa2) in the recombinant YBC strain produced using the promoter of S. cerevisiae and the promoter of YBC strain (1kb).
  • Figure 4 shows the results of confirming the expression of BDHcm gene, HPDHec gene and EUTEdz gene, other genes involved in 3-HP production in a recombinant strain using the ScTEF1p promoter.
  • Figure 6 shows the RT-qPCR results for confirming the expression level of the seven selected ADH gene candidates through genetic information of S. cerevisiae .
  • Figure 7 shows the results confirming the glucose usage (A) and ethanol productivity of the recombinant strain YBC-1563 from which the g4423 gene was removed.
  • Figure 9 shows the results of confirming the expression level of the MCRsa1 gene located at the site cut g4423 promoter and terminator region (terminator region) 1kb.
  • Figure 10 shows the results of confirming the lactate production of recombinant YBC strains substituted with three types of LDH gene g4423 gene.
  • the promoter is a control unit capable of strongly expressing an externally-derived target gene in a target microorganism or conditionally expressing it, and basically, a promoter for strongly expressing a target gene is required.
  • these strong promoters are usually chosen from promoters involved in glycolysis or the production of the main fermentation product produced by the microorganism.
  • Known strong promoters include, but are not limited to, TEF1, TPI1, HXT7, TDH3, PGK1, ADH1 and PYK1, but may vary by strain.
  • Crab-tree-positive yeasts including the microorganism selected in the present invention, often produce ethanol as a main fermentation product, and thus promoters are strongly expressed and are activated in conditions favorable for fermentation, that is, conditions with high sugar concentration. There are many.
  • a promoter derived from Saccharomyces cerevisiae or an intrinsic promoter of YBC is used to introduce an MCR gene related to 3-hydroxybutyl acid (3-HP) production. It was confirmed that the expression efficiency is remarkably low, and in another embodiment of the present invention, when the MCR is expressed using the promoter of the ADH gene, g4423, an enzyme involved in ethanol production, high expression and excellent 3-HP production capacity are shown. Confirmed.
  • the present invention relates to a promoter represented by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
  • the promoter of the present invention is strongly expressed in glucose culture and logarithmic growth phase, shows good expression rate even in culture in acidic condition medium, including a yeast derived gene, heterologous genes, especially Archaeal-derived and bacteria-derived Works well on yeast expression for genes.
  • the promoter of the present invention is a promoter necessary for producing various compounds in an acid resistant strain, and is a protein coded DNA which is affected by the promoter, in particular, a promoter capable of enhancing its expression when the DNA is an organic acid-producing DNA. It is a promoter that can be strongly expressed even in the presence of internal and external organic acids.
  • the present invention relates to a recombinant vector comprising the promoter and a recombinant microorganism into which the recombinant vector is introduced.
  • the recombinant vector may further comprise a terminator represented by SEQ ID NO: 3 or SEQ ID NO: 4.
  • the gene encoding the protein of interest may further include, the protein of interest may be characterized in that the protein involved in the production of organic acids.
  • the organic acid has been shown to be capable of generating 3-Hydroxy propionic acid and Lactic acid, but is not necessarily limited thereto.
  • Example genes related to organic acids expressed in association with such promoters include genes encoding Fumarate reductase, Succinyl coA synthetase, phosphoenolpyruvate carboxylase of the Succinic acid pathway (Progress of succinic acid production from renewable resources: Metabolic and fermentative strategies, Bioresource Technology 245 (B 1710-1717, 2017), a gene encoding the Butyryl kinase, enoate reductase, Adipyl coA transferase, Adipate semialdehyde dehydrogenase of the Adipic acid pathway (Development of a Platform Strain for Production of Adipic Acid Yields Insights into the Localized Redox Metabolism of S) cerevisiae, Patrick Hyland.A thesis of Master of Applied Science, graduate Department of Chemical Engineering and Applied Chemistry, University of Toronto, 2013), gene encoding Methylmalonyl CoA reductase of 3-Hydroxy
  • the promoter of the present invention comprises a nucleotide sequence set forth in SEQ ID NO: 1, and is a polynucleotide having strong activity even under the conditions for producing an organic acid.
  • SEQ ID NO: 1 due to the diploid nature of the YBC strain, there is a sequence with mutations such as deletion, insertion, and mutation in the nucleotide sequence of SEQ ID NO: 1, and the sequence including the variation sequence has the same characteristics.
  • the terminator that functions as the promoter of the present invention comprises a nucleotide sequence set forth in SEQ ID NO: 3/4.
  • the target protein is malonyl-CoA-reductase, lactate dehydrogenase, Fumarate reductase, Succinyl coA synthetase, phosphoenolpyruvate carboxylase, Butyryl kinase, enoate reductase, Adipyl coA transferase, Adipate semialdehyde dehydrogenase , Methylmalonyl CoA reductase, alpha-ketoisovalerate decarboxylase, potentially Phenylacetaldehyde dehydrogenase, Malate dehyderogenase, cis-aconitic acid decarboxylase, etc. may be used, but is not limited thereto.
  • the recombinant microorganism is preferably yeast, more preferably acid resistant yeast YBC (KCTC13508BP) can be used.
  • the present invention (a) culturing a recombinant microorganism into which the recombinant vector is introduced to produce an organic acid; And (b) relates to a method for producing an organic acid comprising the step of obtaining the resulting organic acid.
  • the present invention provides a gene construct in which a promoter represented by a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and a gene encoding a protein of interest are operably linked, and a recombinant in which the gene construct is introduced on a chromosome. It relates to a microorganism.
  • the target protein may be a protein involved in organic acid production, and the target protein may be selected from malonyl-CoA-reductase, lactate dehydrogenase, and the like. It is not necessary to use any protein that is involved in organic acid production without limitation.
  • the recombinant microorganism is preferably yeast, more preferably acid resistant yeast YBC (KCTC13508BP) can be used.
  • the present invention comprises the steps of (a) culturing a recombinant microorganism into which the gene construct is introduced to produce an organic acid; And (b) relates to a method for producing an organic acid comprising the step of obtaining the resulting organic acid.
  • the promoter of the present invention constitutes a DNA construct introduced into Yeast together with a gene encoding a protein of interest.
  • DNA constructs include constructs suitable for several Yeast transformation methods known to those of skill in the art, and examples thereof include DNA constructs for homologous recombination in SEQ ID NOs: 5 and 6.
  • the DNA construct is a two allele star deletion cassette for deletion of the g4423 gene.
  • a gene insertion cassette for each allele is made, which is well known to researchers with knowledge in the art.
  • the cassette may be characterized in that represented by the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 6, the cassette may comprise the target gene.
  • the present invention relates to a method for overexpressing a gene of interest, characterized in that by replacing the g4423 gene with the gene of interest in the genome of the YBC strain (KCTC13508BP).
  • the present invention relates to a recombinant microorganism for overexpression of a gene of interest, wherein the gene of interest is inserted downstream of the promoter of g4423 in the genome of the YBC strain (KCTC13508BP) and whose expression is regulated by the promoter of g4423.
  • the present invention provides a method for preparing an organic acid comprising: (a) culturing the recombinant microorganism to generate an organic acid; And (b) relates to a method for producing an organic acid comprising the step of obtaining the resulting organic acid.
  • the present invention relates to a method for overexpressing a target gene by culturing the recombinant microorganism.
  • the present invention relates to a recombinant strain, characterized in that the g4423 gene is deleted or attenuated in an acid resistant yeast YBC strain (KCTC13508BP), thereby reducing ethanol production ability.
  • KCTC13508BP acid resistant yeast YBC strain
  • homology or means the percent identity between two comparative amino acids or polynucleotide moieties.
  • similarity also means the degree to which a sequence is functionally or structurally identical based on amino acid or polynucleotide sequence through a window of comparison. Sequence homology or similarity can be compared by sequences using standard software, for example by a program called BLASTN or BLASTX, developed based on BLAST (Proc. Natl. Acad. Sci. USA, 90, 5873-5877, 1993). This can be confirmed by.
  • the g4423 promoter preferably has a sequence showing sequence homology of at least 90%, at least 92%, at least 93%, at least 95%, at least 97%, at least 98%, at least 99%, or at least 100% with the sequence of SEQ ID NO: 1.
  • the g4423 promoter of the present invention has a homologous expression level of 90% or more and exhibits the same level of expression efficiency, it may be said to be a substantially equivalent promoter.
  • the g4423 promoter according to the present invention may be mutated by applying a known technique known in the art to increase the expression efficiency of the gene of interest.
  • the recombinant yeast can be characterized by having acid resistance, and in order to produce an acid resistant recombinant yeast suitable for the present invention, it is preferable to use a host yeast having acid resistance to the organic acid.
  • the acid resistant yeast may be a yeast having acid resistance selected from the group consisting of Saccharomyces genus, Saccharomyces saccharomyces and Candida genus, for example Saccharomyces cerevisiae, Saccharomyces cerevisiae It may be characterized in that it is selected from the group consisting of Kazachstania exigua, Kazachstania bulderi, and Candida humilis, but is not limited thereto.
  • 'Acid-resistant yeast' means yeast having resistance to organic acids such as 3-HP or Lactic acid. Acid resistance can be confirmed by evaluating growth in a medium containing various concentrations of organic acids. That is, "acid resistant yeast” refers to yeast that exhibits a higher growth rate and biomass consumption rate than a general yeast in a medium containing a high concentration of organic acid.
  • 'acid resistant yeast' means a biomass consumption rate of at least 10% when the medium contains 1M or more of organic acid at a pH less than the pKa value of the organic acid, as compared with the case where the organic acid is not contained in the medium. Or yeast capable of maintaining a specific growth rate of at least 10%. More specifically, in the present invention, 'acid resistant yeast' is a yeast capable of maintaining a biomass consumption rate (such as sugar consumption rate) of at least 10% or a specific growth rate of at least 10% at pH 2 to 4, as compared to pH 7. define.
  • Recombinant yeast according to the present invention can be prepared by inserting the gene on the chromosome of the host yeast according to a conventional method, or by introducing a vector containing the gene into the host yeast.
  • the host yeast is a high efficiency of the introduction of DNA, host cells with high expression efficiency of the introduced DNA is commonly used, in one embodiment of the present invention used acid resistant yeast, but is not limited to this, the target DNA is sufficiently Any kind of yeast may be used as long as it can be expressed.
  • the recombinant yeast may be prepared according to any transformation method.
  • Transformation refers to a phenomenon in which DNA is introduced into a host so that DNA can be reproduced as a factor of a chromosome or by chromosome integration, thereby introducing an external DNA into a cell and causing an artificial genetic change.
  • Conversion methods include electroporation, lithium acetate-PEG method, and the like.
  • any method known in the art may be used as a method of inserting a gene on a chromosome of a host microorganism in the present invention.
  • a retroviral vector an adenovirus vector, an adeno-associated virus vector, and herpes simplex.
  • Rex virus vectors pox virus vectors, lentiviral vectors, non-viral vectors and the like.
  • Vector refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host.
  • Vectors can be plasmids, phage particles or simply potential genomic inserts. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Plasmids are currently the most commonly used form of vector and linearized DNA is also commonly used for genomic integration of yeast.
  • Typical plasmid vectors include (a) an initiation point for replication to efficiently replicate to include plasmid vectors per host cell, (b) antibiotic resistance genes or nutritional markers to allow selection of host cells transformed with plasmid vectors. It has a structure that includes an axotrophic marker gene and (c) a restriction enzyme cleavage site to allow insertion of foreign DNA fragments. Although no suitable restriction enzyme cleavage site is present, the use of synthetic oligonucleotide adapters or linkers according to conventional methods can facilitate ligation of the vector and foreign DNA.
  • genes are "operably linked” when placed in a functional relationship with other nucleic acid sequences.
  • This may be genes and regulatory sequence (s) linked in such a way as to enable gene expression when appropriate molecules (eg, transcriptional activating proteins) bind to regulatory sequence (s).
  • DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence;
  • the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence;
  • the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation.
  • operably linked means that the linked DNA sequences are in contact, and in the case of a secretory leader, are in contact and present within the reading frame. However, enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.
  • vectors function equally to express the DNA sequences of the present invention
  • hosts function equally for the same expression system.
  • one of ordinary skill in the art may, without departing from the scope of the present invention without undue experimental burden, select appropriately among other vectors, expression control sequences and hosts.
  • the host in selecting a vector, the host must be considered, since the vector must be replicated therein, and the number of copies of the vector, the ability to control the number of copies, and other proteins encoded by the vector, e.g. For example, the expression of antibiotic markers should also be considered.
  • the carbon source may be one or more selected from the group consisting of glucose, xylose, arabinose, sucrose, fructose, cellulose, galactose, glucose oligomer and glycerol, but is not limited thereto.
  • the culturing may be performed under conditions such that microorganisms such as E. coli and the like no longer function (eg, metabolic production is impossible).
  • the culture may be characterized in that pH 1.0 to 6.5, preferably pH 1.0 to 6.0, more preferably 2.6 to 4.0, but is not limited thereto.
  • Example 1 Confirmation of the expression pattern of malonyl-CoA reductase (MCR) using the existing promoter in the YBC strain
  • the present inventors have selected a group of strains having acid resistance through testing for various yeast strains (Korean Patent Publication No. 2017-0025315). Lactic acid was added to the medium for the selected yeast bacteria to select the strains having the best acid resistance while checking the growth and sugar consumption rate of the microorganisms. At this time, inoculation OD value was 4, Glucose 3.5% was used in YP medium (20g / L Peptone, 10g / L Yeast extract), and the experiment was conducted at 30 °C and 100rpm with 50ml Flask culture. Each initial 0 ⁇ 80g / L was changed to culture. The results were compared and analyzed to select the YBC strain, the strain having the best acid resistance.
  • the YBC strain ( Kazachstania exigua sB-018c) was deposited as KCTC13508BP at the Korea Institute of Bioscience and Biotechnology Biological Resource Center on April 11, 2018.
  • the YBC strain expressed a gene encoding MCR (malonyl-CoA reductase), which is a key enzyme for the production of 3-HP (3-hydroxy propionic acid).
  • MCR malonyl-CoA reductase
  • the malonyl-CoA pathway to produce 3-HP is a metabolic pathway in which acetyl-CoA is converted to malonyl-CoA through carboxylation and then to 3-HP through reduction (acetyl-CoA to malonyl-CoA).
  • ⁇ 3-HP malonyl-CoA pathway is the most studied as a 3-HP production pathway because it passes through the intermediates commonly produced by microorganisms including E. coli (US Patent Publication No. US 2013/0071893 A1). Since malonyl-CoA can be converted to 3-HP through the action of malonate reductase and 3-HP dehydrogenase, it is well known to convert to 3-HP using glucose or glycerol using recombinant E. coli. Known.
  • MCRsa1 and MCRsa2 which are highly efficient genes among known MCR genes.
  • MCRsa1 and MCRsa2 were synthesized by applying Yeast codon usage based on Genebank data, and the information of MCR gene used in this example is shown in Table 1.
  • the cassette was designed to have an antibiotic resistance gene and the restriction shown in FIG. 1 based on the full genome sequence or partial genome sequence of the 5'UTR and 3'UTR sites of the gene of interest for targeting the gene of interest. After designing with enzymes, they were obtained by PCR, and S. cerevisiae- derived promoters and terminators were constructed based on known genetic information (eg, Saccharomyces Genome Database).
  • the antibiotic resistance gene is HygR as an example in FIG. 1 (a), but other antibiotic resistance genes for eukaryote that can be used in the strain can be used, and anyone who knows the known techniques known in the art can easily produce it. have.
  • Donor DNA was digested by a restriction enzyme or plasmid containing a cassette or amplified by PCR, the parts of each gene can be exchanged using a restriction enzyme located at each end.
  • a cassette was also manufactured using a Gibson assembly, and a number of products and how to use such a method using the Gibson assembly are well prepared.
  • a NEB Gibson assembly master mix and a cloning kit are used. It was produced using.
  • the oligomers associated with the double MCR and G4423 are shown in Table 2 below.
  • Introducing the prepared cassette into the YBC strain was produced by PCR or restriction enzyme method of linearized (linearized) Donor DNA as in the transformation of general yeast, and then introduced using electroporation or Lithium acetate, respectively.
  • the medium was selected using the auxotroph marker or antibiotic marker. Whether the target was introduced into the correct locus of the chromosomes through colonies grown from the selection medium was confirmed by colony PCR using the ORF primers and the primers of the introduced genes, and then genomic DNA was extracted from the cultured cells. The correct genotype was confirmed.
  • Table 3 shows a recombinant strain in which the MCR gene was introduced together with a Saccharomyces cerbizi-produced promoter (TEF1) and a YBC strain-derived promoter (FBA1p).
  • TEF1 Saccharomyces cerbizi-produced promoter
  • FBA1p YBC strain-derived promoter
  • the recombinant strains were cultured in a 250 mL flask using 20 mL volume of YPD medium (20 g / L Peptone, 10 g / L Yeast extract, 20 g / L Dextrose) (30 oC, 250 rpm). After obtaining, RT-qPCR was performed on the MCR gene.
  • RNA is extracted from the exponential growth phase of the target strain, and then cDNA is prepared using this as a template.
  • Specific oligomers were synthesized for the target gene and the housekeeping gene (used as the Ref gene), and qPCR was performed.
  • the gene used in this experiment was ALG9 and the fragment size amplified by the primer used was 147 ⁇ 3 bp.
  • the primers for qPCR used in Table 4 and the primers used in the examples below are described.
  • MCR genes (MCRsa1, MCRsa2) is expressed in a recombinant strain produced using the acid-resistant strain YBC.
  • MCRsa2 is expressed in a recombinant strain produced using the acid-resistant strain YBC.
  • the expression characteristics were not high or rather low.
  • expression of MCRsa2 using the 1kb FBA promoter (YBC FBA1p) derived from the YBC strain showed lower expression results than the ScTEF1p promoter (YBC-1413 in FIG. 3B).
  • YPD medium (20 g / L Peptone, 10 g / L Yeast extract, 20 g / L Dextrose
  • YPD medium 20 g / L Peptone, 10 g / L Yeast extract, 20 g / L Dextrose
  • 15 ⁇ M of Cerulenin (Sigma-Aldrich, USA) was added. Cerulenin inhibits lipid synthesis from Cytosolic acetyl-CoA to Malonyl-CoA, which facilitates the production of 3-HP.
  • the cell density was measured and the production of main metabolite including 3-HP in the culture was confirmed.
  • the modified form of concentration, medium, culture conditions were performed in some cases, but not specifically described.
  • genes related to glycolysis should be avoided. If the genes related to glycolysis are lost or weak, the production of pyruvate, which is important for the growth of microorganisms, will be inhibited or the balance of the chain reaction will be compromised. It affects and consequently decreases fermentation capacity. Therefore, the replacement of the endogenous gene selects the pyruvate dehydrogenase complex (PDC) gene or the ADH gene when the target strain is an ethanol producing strain, and since PDC is used as an important pathway to produce 3-HP, the target compound, The gene was selected to be removed by selecting the ADH gene.
  • PDC pyruvate dehydrogenase complex
  • yeast Strains with strong ethanol fermentation potential, such as yeast, have ADHs that play a wide variety of strengths and roles.
  • the candidate genes were identified by comparing genome information of YBC strain and known ADH gene information of S. cerevisiae and qPCR was performed. .
  • ADH gene candidates were selected from the genome-wide sequence data of S. cerevisiae using Bioinformatics information (see Table 6). RT-qPCR was performed by designing oligomers specific to the selection gene (see Table 4 for primer sequences). ).
  • a strain (YBC-1563) from which the g4423 gene was removed was prepared. Based on the information of g4423 and UTR, a gene cassette similar to FIG. 1 (a) with g4423 ORF removed, 5 'and 3' UTR and antibiotic markers was constructed and used as Donor DNA. As described above, a cloning method using a restriction enzyme and a method using a Gibson assembly were used to prepare donor DNA.
  • the strain was incubated in a medium in which both sugar and ethanol were consumed at 30 ° C. at 250 rpm using a 250 ml flask with 50 ml medium and a Glucose of 40 g / L in a YPD medium and a starting OD value of 0.7, followed by glucose consumption and ethanol production. As a result, it was confirmed that ethanol production is reduced by 50% or more (FIG. 7).
  • Example 5 MCR expression level of YBC recombinant strain substituted with g4423 gene with MCR gene
  • the recombinant strain YBC-1684 was prepared by replacing the g4423 gene with the MCRsa1 gene in the genome of the YBC strain, and the expression amount of the MCRsa1 gene was confirmed.
  • the gene cassette of FIG. 1 (b) with the g4423 ORF removed, 5 'and 3' UTR and antibiotic marker was constructed, and optimized for the yeast codon usage of MCRsa1 in the ORF locus of g4423.
  • the sequence was introduced and used as Donor DNA. As described above, a cloning method using a restriction enzyme and a method using a Gibson assembly were used to prepare donor DNA.
  • the plasmid used for Donor DNA is shown in (pSK863) SEQ ID NO: 7.
  • Donor DNA was amplified in the completed cassette and introduced into the YBC strain using a primer identifying the following g4423 ORF for the colonies grown to confirm that the g4423 ORF was removed and the presence of MCRsa1 ORF confirmed that MCRsa1 was introduced.
  • Primer forward for confirmation (SEQ ID NO: 74): ATGAGAAGAACTTTGAAGGCTG,
  • Primer reverse (SEQ ID NO: 75) TTACTTAGGGATGTAACCCTTTTCGA)
  • the strain was incubated in a medium in which both sugar and ethanol were consumed at 30 ° C. at 250 rpm using a 250 ml flask with 50 ml medium and a Glucose of 40 g / L in YPD medium and a starting OD value of 0.7, followed by production of 3-HP. The amount and the amount of sugar and ethanol produced were confirmed. RT-qPCR conditions for the expression level was confirmed in the same manner as in Example 1, the culture was sampled in the logarithmic growth, and the specific genotype of the recombinant YBC strain produced is shown in Table 7.
  • the expression of the MCRsa1 gene was almost similar to that of the g4423 gene, and was much stronger than the strain using the TEF1 promoter, a strong promoter derived from S. cerevisiae (control YBC-061). .
  • Example 5 the production of 3-HP of the recombinant strain YBC-1684 confirming a significant increase in the expression level of the MCR gene was confirmed.
  • the YBC-1684 strain with only the MCRsa1 gene inserted at g4423 produced 200 mg / L of 3-HP, and additionally, 3-HP related genes (HiBADH gene and EUTE gene) were inserted.
  • the strains were different for each colony, but produced 146-710 mg / L of 3-HP, and compared with 3-HP production of the recombinant strain expressing the gene with the scTEF promoter or FBA promoter, it was confirmed that the yield was significantly higher.
  • the increased expression of the MCRsa1 gene by the g4423 promoter can greatly affect the production of 3-HP, thereby increasing the expression of the gene involved in the production of the target compound by the g4423 promoter. If so, it was found that the production of the target compound can be increased.
  • the expression level of MCRsa1 a gene for 3-HP production, was determined by cutting the G4423 promoter and terminator region into 1 kb. Based on the information of g4423 and UTR of the YBC strain genome, the amplification / extraction of the 1 kb region of the g4423 5 'UTR region using primers was carried out using the primers of oSK-1412 to oSK1419 in Table 2 and the promoter of g4423 and the yeast codon usage. A fragment of MCRsa1 optimized with was obtained.
  • the expression amount of MCRsa1 of the YBC-1693 recombinant strain prepared by the above method was confirmed to decrease the expression amount as when using the other YBC promoter (FBA) or S. cerevisiae TEF1p promoter (Fig. 9). This suggests that the promoter action of the YBC acid-resistant strains may require longer fragments or complex action by enhancers, silencers, or multifactors that work over long distances, and additional research is needed to elucidate these mechanisms. Do.
  • a recombinant YBC strain was prepared in which the lactate dehydrogenase (LDH) gene, which is a gene involved in lactate production in addition to the MCR gene, was substituted with the g4423 gene, and the lactate production ability of the strain was confirmed.
  • LDH lactate dehydrogenase
  • Recombinant strains were prepared to express three representative genes ( LH helveticus- derived LDH, R.oryzae- derived LDH, and L. plantarum-derived LDH) using the g4423 promoter.
  • R. oryzae Primer forward (SEQ ID NO: 78): ATGGTTTTGCATTCTAAAGT
  • R. oryzae Primer reverse (SEQ ID NO: 79): TTAACAAGAAGATTTAGAAA,
  • L. plantarum Primer forward (SEQ ID NO: 80): ATGTCTTCTATGCCAAATCA
  • L. plantarum Primer reverse (SEQ ID NO: 81): TTATTTATTTTCCAATTCAG
  • the recombinant strain prepared above was shaken in a flask for 24 hours at 30 ° C./100 rpm using YP (20 g / L Peptone, 10 g / L Yeast extract) medium in which 4% glucose and 150 mg / L of Uracil were added. Incubated.
  • YP (20 g / L Peptone, 10 g / L Yeast extract) medium in which 4% glucose and 150 mg / L of Uracil were added. Incubated.
  • Lactate and ethanol in the culture were confirmed by HPLC.
  • Glucose, ethanol, and L-lactate concentrations in the culture were analyzed by mounting a Bio-Rad Aminex 87-H column on a Waters 1525 Binary HPLC pump.
  • Glucose and ethanol were analyzed using Waters 2414 Refractive Index detector, and L-lactate was analyzed using Waters 2489 UV / Visible Detector (210nm), and the peak area standard curve was calculated by concentration for each component. As follows.
  • the substituted target gene exhibited LDH activity, producing lactate.
  • novel promoter according to the present invention When using the novel promoter according to the present invention to express the target genes related to organic acid production in the organic acid-resistant yeast, while having resistance to the organic acid, the growth ability of the strain is not inhibited, and the organic acid can be produced with high efficiency. have.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Botany (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 유기산 내성 효모에서 ADH 유전자 발현을 조절하는 신규 프로모터 및 이를 이용한 유기산 생성 관련 유전자의 발현을 통한, 유기산의 제조방법에 관한 것으로, 본 발명에 따른 신규 프로모터를 이용하여, 유기산 내성 효모에서 유기산 생성 관련 목적 유전자를 발현시키는 경우, 유기산에 대하여 내성을 가지면서, 균주의 성장능이 저해되지 않고, 유기산을 높은 효율로 생산할 수 있는 장점이 있다.

Description

유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법
본 발명은 유기산 내성 효모 유래 신규 프로모터에 관한 것으로, 더욱 자세하게는 유기산 내성 효모에서 ADH 유전자 발현을 조절하는 신규 프로모터 및 이를 이용한 유기산 생성 관련 유전자의 발현을 통한, 유기산의 제조방법에 관한 것이다.
바이오 공정을 통하여, 다양한 원료를 유기산, 알코올, 아민 등의 화학물질로 생물전환(bioconversion)시키는 것은 친환경, 이산화탄소 저감, 지속가능성, 새로운 플랫폼 화학물질의 공급 측면에서 각광받고 있으며, 이러한 생전환을 통하여, 식품, 화장품, 약효식품(Nutraceuticals), 의약 관련 화학제품을 공급하고 있다.
그러나 일반적으로 생물전환을 통하여, 생산되는 제품들은 생산과정에서 생성되는 불순물들을 제거하는 정제과정을 거쳐야 한다. 또한 유기산을 생산하는 경우, 생성되는 유기산에 의하여 균주의 성장이 저해되는 것을 막기 위하여 염(base)에 의한 중성 pH 발효를 수행하는 경우가 대부분이며 이를 분리/정제하기 위하여 다시 산성화를 하면서 다량의 중화 염(salt)이 부산물로 발생하고, 공정이 복잡해지면서 생산 단가가 높아진다. 이러한 정제 공정의 높은 가격부담이 발효제품의 화학물질 시장 진입을 저해하는 요인으로 작용하고 있다.
상기의 문제들을 해결하기 위하여, 유기산과 같은 산성 물질을 생산하는 경우 낮은 pH 에서도 성장가능하면서 높은 발효능을 보이는 미생물을 이용하면 배지의 pH를 중화하고, 다시 산성화하는 공정을 생략할 수 있어, 공정 단순화 및 첨가물 저감을 통하여 비용을 절감할 수 있다.
그러나 많은 경우 낮은 pH 에서 생존하는 미생물들은 성장속도가 매우 낮아, 물질 생산에 요구되는 충분한 균체량을 얻을 수 없어, 낮은 원료 소모 속도를 나타내어, 산업적 발효공정에 적용하기 어렵다. 따라서, 생성물의 pKa 보다 낮은 pH에서 빠른 성장을 하면서도 원료 소모 속도를 높게 유지하는 특성을 갖는 미생물을 선별하는 것이 매우 중요하다.
이러한 미생물은 여러 균주 라이브러리로부터 다양한 선택압력(selection pressure)을 통하여 선별할 수 있으며, 선택 압력의 일예로 목적 산물 농도에 대한 저항성, 원료 농도에 대한 저항성, 원료의 소모 속도, pH 조건, 최소 배지에서의 성장능 등을 들 수 있다. 미생물의 선별은 매뉴얼을 통하여 진행할 수 있으나 자동화(automation)를 통하여 스크리닝할 경우, 보다 많은 대상체에서 우수한 특성을 갖는 균주를 빠르게 선별할 수 있다.
선별된 미생물들은 선택압력에 견디는 우수한 특성을 보유하고 있으나, 대부분의 경우, 목적 산물을 생산하지 못하고 다른 산물을 생산하는 경우가 많다. 따라서 상기 선별된 미생물에 목적산물을 생산하는 능력을 부여하기 위하여, 유전공학적으로 목적산물로의 전환 유전자를 도입하고, 원래 생성 중인 산물의 생성능을 없애는 연구를 진행한다.
선택된 미생물에 목적산물의 생성능을 부여하기 위하여, 목적산물을 전환할 수 있는 유전자를 도입하거나, 원래 보유하고 있는 유전자를 강화하는 방법을 사용하나, 일반적으로는 보유 유전자 및 이로부터 생산되는 효소의 활성이 낮은 경우가 많으므로 외래 강한 유전자를 도입하는 경우가 대부분이다. 또한 이러한 과정에서 외래 DNA를 강하게 발현할 수 있는 프로모터의 도입이 필수적이다.
사용가능한 프로모터로는 일반적으로 대상 미생물이 효모인 경우에는, 효모에서 잘 알려진 Saccharomyces cerevisiae의 프로모터를 이용할 수 있으며, S. cerevisiae에서 개발된 다양한 유전공학 기법 또한 적용할 수 있다. 또한 선별된 미생물의 주된 탄소 플럭스에 관여하는 프로모터들로부터 강한 프로모터를 선별할 수 있으며, 다양한 기법을 통하여, 가장 효과적으로 목적유전자를 발현할 수 있는 방법을 최우선적으로 적용하는 것이 필요하다. 특히 선별된 내산성 효모에 대하여, 관련한 유전공학적 연구가 되지 않은 경우에는 S. cerevisiae의 프로모터를 사용하거나, 선별된 미생물에 내재된 프로모터를 사용하는 것이 일반적인 접근법이다.
프로모터는 일반적으로는 진핵세균에서는 core promotor region을 포함하여 다양한 조절담당 부분이 있으며 각 조절 담당 유전자는 미생물마다 다르다. 따라서 ORF의 5' 상부에서 충분한 길이의 서열을 선택하여, 프로모터의 역할을 확인하면서 최적의 부위를 찾을 수 있으나, 원거리 조절(enhancer, silencer etc) 또는 복합적으로 작용하는 조절 기작에 대해서는 별도의 연구가 필요하다.
이에, 본 발명자들은 유기산에 대하여 내성을 가지는 효모를 선별하고, 상기 효모에 유용 물질을 생산능을 부여하기 위하여, 외래 유전자 발현에 적합한 프로모터를 찾고자 예의 노력한 결과, 에탄올 생산대사 경로 유래 프로모터를 이용하여 목적유전자를 발현시키는 경우, 목적유전자의 발현이 현저히 증가하여, 목적 산물의 생성능이 증가하는 것을 확인하고, 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 유기산 내성 효모 유래 신규 프로모터를 제공하는데 있다.
본 발명의 다른 목적은 상기 프로모터를 함유하는 재조합 벡터 및 상기 재조합 벡터가 도입되어 있는 재조합 미생물을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 신규 프로모터와 목적단백질을 코딩하는 유전자가 작동가능하게 연결되어 있는 유전자 구조물을 제공하는데 있다.
본 발명의 또 다른 목적은 신규 프로모터와 유기산 생성 관련 유전자를 포함하는 재조합 벡터가 도입되어 있는 재조합 미생물을 이용하여 유기산을 제조하는 방법을 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 1 또는 서열번호 2의 염기서열로 표시되는 프로모터를 제공한다.
본 발명은 또한, 상기 프로모터를 포함하는 재조합 벡터를 제공한다.
본 발명은 또한, 상기 재조합 벡터가 도입되어 있는 재조합 미생물을 제공한다.
본 발명은 또한, (a) 상기 재조합 벡터가 도입되어 있는 재조합 미생물을 배양하여 유기산을 생성하는 단계; 및 (b) 생성된 유기산을 수득하는 단계를 포함하는 유기산의 제조방법을 제공한다.
본 발명은 또한, 서열번호 1의 염기서열로 표시되는 프로모터와 목적단백질을 코딩하는 유전자가 작동가능하게 연결되어 있는 유전자 구조물을 제공한다.
본 발명은 또한, 상기 유전자 구조물이 염색체 상에 도입되어 있는 재조합 미생물을 제공한다.
본 발명은 또한, (a) 상기 유전자 구조물이 도입되어 있는 재조합 미생물을 배양하여 유기산을 생성하는 단계; 및 (b) 생성된 유기산을 수득하는 단계를 포함하는 유기산의 제조방법을 제공한다.
본 발명은 또한, 내산성 효모 YBC 균주(KCTC13508BP)에서 g4423 유전자가 결실 또는 약화되어, 에탄올 생성능이 감소되어 있는 것을 특징으로 하는 재조합 균주를 제공한다.
본 발명은 또한, YBC 균주(KCTC13508BP)의 게놈에서 g4423의 프로모터의 하류에 목적유전자가 삽입되어 있고, g4423의 프로모터에 의해 발현이 조절되는 목적유전자 과발현용 재조합 미생물을 제공한다.
본 발명은 또한, (a) 상기 재조합 미생물을 배양하여 유기산을 생성하는 단계; 및 (b) 생성된 유기산을 수득하는 단계를 포함하는 유기산의 제조방법을 제공한다.
본 발명은 또한, 상기 재조합 미생물을 배양하여 목적유전자를 과발현시키는 방법을 제공한다.
도 1은 한 개 두 개 혹은 세 개의 3-HP pathway 효소를 발현하기 위한 gene cassette 의 예제 들이다. (a)는 일반적인 한 개의 효소를 발현하는 cassette, (b)는 g4423 promotor를 사용하며 MCRsa1 효소를 도입하기 위한 cassette, (c)는 g4423 promotor를 사용하며 LDH를 도입하기 위한 cassette, (d)는 3개의 3-HP 생산 효소 (MCR, HPDH, EUTE) 를 도입하기 위한 cassette, (e)는 MCR 효소의 promotor 로 1kb 의 g4423 promotor를 사용하기 위한 cassette이다.
도 2는 한 개 두 개 혹은 세 개의 3-HP pathway 효소를 발현하기 위한 Yeast expression plasmids의 예이다.
도 3은 S. cerevisiae의 프로모터 및 YBC 균주의 프로모터(1kb)를 이용하여 제작된 재조합 YBC 균주에서 MCR 유전자(MCRsa1, MCRsa2)의 발현량을 확인한 결과를 나타낸 것이다.
도 4는 ScTEF1p 프로모터를 사용한 재조합 균주에서 3-HP 생산에 관여하는 다른 유전자인 BDHcm유전자와 HPDHec 유전자 및 EUTEdz 유전자의 발현을 확인한 결과를 나타낸 것이다.
도 5에서 S. cerevisiae 균주에서 MCR 유전자 및 3-HP 생산 관련 유전자의 발현율을 비교한 결과를 나타낸 것으로, 995-1과 995-3 은 동일 genotype의 다른 표현형을 나타낸다.
도 6는 S. cerevisiae의 유전정보를 통하여 선별된 7종의 ADH 유전자 후보에 대한 발현 정도를 확인하기 위한 RT-qPCR 결과를 나타낸 것이다.
도 7는 g4423 유전자를 제거한 재조합 균주 YBC-1563의 글루코스 사용량(A) 및 에탄올 생산성을 확인한 결과를 나타낸 것이다.
도 8은 g4423 유전가 MCRsa1 유전자로 치환된 재조합 YBC 균주의 MCRsa1 발현을 확인한 결과를 나타낸 것이다.
도 9은 g4423 프로모터와 터미네이터 부위(terminator region)가 1kb로 잘린 부위에 위치하는 MCRsa1 유전자의 발현수준을 확인한 결과를 나타낸 것이다.
도 10은 3종의 LDH 유전자를 g4423 유전자와 치환한 재조합 YBC 균주들의 락테이트 생산량을 확인한 결과를 나타낸 것이다.
발명의 상세한 설명 및 바람직한 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
생물전환공정에서 다양한 산물 중 유기산과 같이 산성환경을 만드는 산물을 생산하는 경우 후단 공정의 복잡성과 이에 따르는 화합물 및 시설 투자 비용 절감을 위하여 내산성 미생물, 특히 산성에서도 빠른 성장을 보이며 원료 흡수 속도가 높은 상태를 유지할 수 있는 미생물을 선별하는 경우, 선별된 미생물은 많은 경우 내재적으로 목적 산물 생산능이 없는 경우가 많기 때문에 다양한 유전공학적 Tool을 개발하여 대상 미생물에 효과적으로 목적 산물을 생산능을 부여할 필요가 있다.
프로모터는 대상 미생물에서 외부 유래 목적유전자를 강하게 발현하거나 혹은 조건에 따른 발현을 할 수 있는 조절부이며, 기본적으로는 목적 유전자를 강하게 발현할 수 있는 프로모터의 선별이 필요하다. 글루코스 조건에서 이러한 강한 프로모터는 일반적으로 해당과정 혹은 해당 미생물이 생산하는 주 발효 산물의 생산에 관여하는 프로모터에서 선택하게 된다.
알려진 강한 프로모터로는 TEF1, TPI1, HXT7, TDH3, PGK1, ADH1 및 PYK1 등이 있으나 반드시 이에 국한되지는 않으며 균주 별로 차이가 있을 수 있다.
본 발명에서 선택된 미생물을 포함하여 일반적인 Crab-tree 양성 효모들은 에탄올을 주 발효 산물로 생산하는 경우가 많으며, 그에 따른 프로모터들도 강하게 발현하고 발효에 유리한 조건, 즉 당농도가 높은 조건에서 발동하는 프로모터들이 많다.
특히 에탄올 대사에 관여하는 프로모터의 경우, 외래 유전자를 발현하면서 에탄올 생산은 차단을 하려는 목적을 갖고 기술을 개발하는 경우가 많기 때문에 균주가 가지는 내재 프로모터를 직접적으로 이용하고자 할 경우에는 에탄올 생성을 차단하는 효과와 외부 유전자를 강하게 발현하는 효과를 한 번에 수행할 수 있는 장점이 있다.
본 발명에서는 내산성 효모인 YBC(KCTC13508BP) 효모에 유기산 생성능을 부여하기 위하여, 유기산 생성 관련 유전자를 고효율로 도입하고자, 이에 적합한 프로모터를 선별하고자 하였다. 본 발명의 일 양태에서는 기존에 사용되던 사카로마이세스 세레비지에 유래의 프로모터나 YBC의 내재 프로모터를 사용하여, 3-하이드록시부틸 산 (3-HP) 생성관련 유전자인 MCR 유전자를 도입한 경우, 발현 효율이 현저히 낮은 것을 확인하였으며, 본 발명의 다른 양태에서는 에탄올 생성에 관여하는 효소인 ADH유전자인 g4423의 프로모터를 이용하여, MCR을 발현시키는 경우, 높은 발현양과 우수한 3-HP 생성능을 나타내는 것을 확인하였다.
따라서, 본 발명은 일 관점에서, 서열번호 1 또는 서열번호 2의 염기서열로 표시되는 프로모터에 관한 것이다.
본 발명의 프로모터는 글루코오스 배양 및 대수증식기에서 강하게 발현하며, 산성 조건 배지에서 배양하여도 좋은 발현율을 보이고 있으며, Yeast 유래 유전자를 포함하여, 이종 유래 유전자(heterologous gene) 특히, Archaeal 유래 및 bacteria 유래의 유전자에 대한 효모 발현에 잘 작용한다. 특히 본 발명의 프로모터는 내산성 균주에서 다양한 화합물을 생산하기 위하여 반드시 필요한 프로모터로써 프로모터의 영향을 받는 단백질 코드 DNA, 특히 그 DNA가 유기산을 생산하는 DNA일 경우 그 발현을 강하게 할 수 있는 프로모터이며, 세포 내부 및 외부의 유기산의 존재 하에서도 강하게 발현할 수 있는 프로모터이다.
다른 관점에서, 본 발명은 상기 프로모터를 포함하는 재조합 벡터 및 상기 재조합 벡터가 도입되어 있는 재조합 미생물에 관한 것이다.
본 발명에 있어서, 상기 재조합 벡터는 서열번호 3 또는 서열번호 4로 표시되는 터미테이터를 추가로 포함하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 목적단백질을 코딩하는 유전자를 추가로 포함할 수 있으며, 상기 목적단백질은 유기산 생산 관여하는 단백질인 것을 특징으로 할 수 있다.
본 발명에서 상기 유기산은 3-Hydroxy propionic acid 및 Lactic 산의 생성이 가능함을 보였으나 반드시 이에 한정되는 것은 아니다.
이와 같은 프로모터와 연관되어 발현되는 유기산 관련 예시 유전자는 Succinic acid 경로의 Fumarate reductase, Succinyl coA synthetase, phosphoenolpyruvate carboxylase를 코딩하는 유전자(Progress of succinic acid production from renewable resources: Metabolic and fermentative strategies, Bioresource Technology 245(B);1710-1717, 2017), Adipic acid 경로의 Butyryl kinase, enoate reductase, Adipyl coA transferase, Adipate semialdehyde dehydrogenase를 코딩하는 유전자 (Development of a Platform Strain for Production of Adipic Acid Yields Insights into the Localized Redox Metabolism of S. cerevisiae, Patrick Hyland. A thesis of Master of Applied Science, Graduate Department of Chemical Engineering and Applied Chemistry, University of Toronto, 2013), 3-Hydroxy isobutyric acid 경로의 Methylmalonyl CoA reductase를 코딩하는 유전자 (한국특허출원 2016-0075640), isobutyric acid 경로의 alpha-ketoisovalerate decarboxylase 및 potentially Phenylacetaldehyde dehydrogenase 를 코딩하는 유전자 (ChemSusChem 2011, 4, 1068-1070), Malic acid 경로의 Malate dehyderogenase를 코딩하는 유전자(Malic Acid Production by Saccharomyces cerevisiae: Engineering of Pyruvate Carboxylation, Oxaloacetate Reduction, and Malate Export, Appl. Environ. Microbiol. ,74:2766-2777, 2008), Itaconic acid 경로의 cis-aconitic acid decarboxylase를 코딩하는 유전자 (Biochemistry of microbial itaconic acid production, Front Microbiol. 2013; 4: 23.) 등을 들 수 있으며, 각 경로의 마지막 step 유전자 혹은 Rate Determining Step 유전자등의 과발현에 사용할 수 있으며 이에 대해서는 관련 선행문헌(JP4700395B2)에도 명시되어 있다. 또한 상기의 예시된 유전자 이외에도 동일 경로의 다른 유전자에도 적용이 가능하다.
본 발명의 프로모터는 서열번호 1에 기재되는 염기서열을 포함하여 구성되며, 유기산의 생성 조건에서도 강한 활성을 가지는 폴리뉴클레오타이드이다. 또한 YBC 균주의 diploid 특성에 의하여 상기 서열번호 1의 염기서열에 삭제(deletion), 삽입(insertion), 변이(mutation)와 같은 변이가 있는 서열이 존재하며 이러한 변이 서열을 포함하는 sequence도 동일한 특성을 나타낼 수 있다(The Baker's Yeast Diploid Genome Is Remarkably Stable in Vegetative Growth and Meiosis, PLoS Genet 6(9):2010. Ploidy changes and genome stability in yeast, Yeast 31: 421-430, 2014).
또한, 본 발명의 프로모터와 같이 작용하는 터미네이터는 서열번호 3/4에 기재되는 염기서열을 포함하여 구성된다.
본 발명에서, 상기 목적 단백질은 목적단백질은 말로닐-CoA-리덕테이즈, 락테이트 디하이드로게나아제, Fumarate reductase, Succinyl coA synthetase, phosphoenolpyruvate carboxylase, Butyryl kinase, enoate reductase, Adipyl coA transferase, Adipate semialdehyde dehydrogenase, Methylmalonyl CoA reductase, alpha-ketoisovalerate decarboxylase, potentially Phenylacetaldehyde dehydrogenase, Malate dehyderogenase, cis-aconitic acid decarboxylase 등을 사용할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 재조합 미생물은 효모인 것이 바람직하며, 더욱 바람직하게는 내산성 효모 YBC(KCTC13508BP)를 사용할 수있다.
또 다른 관점에서, 본 발명은 또한, (a) 상기 재조합 벡터가 도입되어 있는 재조합 미생물을 배양하여 유기산을 생성하는 단계; 및 (b) 생성된 유기산을 수득하는 단계를 포함하는 유기산의 제조방법에 관한 것이다.
또 다른 관점에서, 본 발명은 서열번호 1 또는 서열번호 2의 염기서열로 표시되는 프로모터와 목적단백질을 코딩하는 유전자가 작동가능하게 연결되어 있는 유전자 구조물 및 상기 유전자 구조물이 염색체 상에 도입되어 있는 재조합 미생물에 관한 것이다.
본 발명에 있어서, 상기 목적단백질은 유기산 생산 관여하는 단백질인 것을 특징으로 할 수 있고, 상기 목적단백질은 말로닐-CoA-리덕테이즈, 락테이트 디하이드로게나아제 등을 선택할 수 있으나, 이에 한정되는 것은 아니며, 유기산 생성에 관여하는 단백질이라면 제한없이 사용할 수 있다.
본 발명에 있어서, 상기 재조합 미생물은 효모인 것이 바람직하며, 더욱 바람직하게는 내산성 효모 YBC(KCTC13508BP)를 사용할 수있다.
또다른 관점에서, 본 발명은 (a) 상기 유전자 구조물이 도입되어 있는 재조합 미생물을 배양하여 유기산을 생성하는 단계; 및 (b) 생성된 유기산을 수득하는 단계를 포함하는 유기산의 제조방법에 관한 것이다.
본 발명의 프로모터는 목적단백질을 코딩하는 유전자와 함께 Yeast 에 도입하는 DNA구축물을 구성한다. 이러한 DNA 구축물은 당 업자에게 알려진 여러 Yeast transformation 방법에 적절한 구축물을 포함하며, 그 일 예로 상동성 재조합(homologous recombination)을 위한 DNA 구축물의 예를 서열번호 5과 6에 제시하였다. 상기 DNA 구축물은 g4423 유전자를 Deletion 하기 위한 2개의 allele 별 Deletion cassette이다. 또한 이 cassette에 목적 DNA를 삽입할 경우 각 Allele 별 유전자 삽입용 cassette가 만들어 지며 이는 당해 분야의 지식을 갖고 있는 연구자들에게는 잘 알려진 사실이다.
본 발명에 있어서, 상기 카세트는 서열번호 5 또는 서열번호 6의 염기서열로 표시되는 것을 특징으로 할 수 있고, 상기 카세트는 목적유전자를 포함할 수 있다.
본 발명은 또 다른 관점에서, 상기 YBC 균주(KCTC13508BP)의 게놈에서 g4423 유전자를 목적유전자와 치환하는 것을 특징으로 하는 목적유전자를 과발현시키는 방법에 관한 것이다.
본 발명은 또 다른 관점에서, YBC 균주(KCTC13508BP)의 게놈에서 g4423의 프로모터의 하류에 목적유전자가 삽입되어 있고, g4423의 프로모터에 의해 발현이 조절되는 목적유전자 과발현용 재조합 미생물에 관한 것이다.
본 발명은 또 다른 관점에서, (a) 상기 재조합 미생물을 배양하여 유기산을 생성하는 단계; 및 (b) 생성된 유기산을 수득하는 단계를 포함하는 유기산의 제조방법에 관한 것이다.
본 발명은 또 다른 관점에서, 상기 재조합 미생물을 배양하여 목적유전자를 과발현시키는 방법에 관한 것이다.
본 발명은 또 다른 관점에서, 내산성 효모 YBC 균주(KCTC13508BP)에서 g4423 유전자가 결실 또는 약화되어, 에탄올 생성능이 감소되어 있는 것을 특징으로 하는 재조합 균주에 관한 것이다.
본 명세서에서 사용되는 "상동성"또는 은 두 개의 비교대상 아미노산 또는 폴리뉴클레오티드 모이티 사이의 동일성 퍼센트를 의미한다. 또한 "유사성"은 비교창(comparison window)을 통해 아미노산 또는 폴리뉴클레오티드 서열에 기반하여 서열이 기능적 또는 구조적으로 동일한 정도를 의미한다. 서열 상동성 또는 유사성은 표준 소프트웨어를 사용, 예를 들면 BLAST(Proc. Natl. Acad. Sci. USA, 90, 5873-5877, 1993)에 기초하여 개발된 BLASTN 이나 BLASTX라 불리는 프로그램에 의해 서열을 비교함으로써 확인할 수 있다.
상기 g4423 프로모터는 서열번호 1의 서열과 바람직하게 90% 이상, 92% 이상, 93% 이상, 95% 이상, 97% 이상, 98% 이상, 99% 이상 또는 100%의 서열 상동성을 나타내는 서열을 가질 수 있다.
본 발명의 g4423 프로모터와 90% 이상의 상동성을 가지면서 동등한 수준의 발현효율을 나타낸다면 실질적으로 균등한 프로모터라 할 수 있다.
경우에 따라서, 본 발명에 따른 g4423 프로모터는 목적 유전자의 발현 효율을 높이기 위해 당업계에 알려진 공지의 기술을 적용하여 변이시킬 수도 있다.
본 발명에 있어서, 재조합 효모가 내산성이 있는 것을 특징으로 할 수 있고, 본 발명에 적합한 내산성 재조합 효모를 제작하기 위해서는 유기산에 내산성을 가지는 숙주효모를 사용하는 것이 바람직하다.
상기 내산성 효모는 사카로마이세스 속, 카자크스타니아 사카로마이세스 및 칸디다 속으로 구성된 군에서 선택되는 내산성을 가지는 효모일 수 있으며, 예를 들어 사카로마이세스 세레비지애 (Saccharomyces cerevisiae), 카자크스타니아 엑시구아 (Kazachstania exigua), 카자크스타니아 불데리 (Kazachstania bulderi), 및 칸디다 휴밀리스 (Candida humilis)로 구성된 군에서 선택된 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
'내산성 효모'란 3-HP나 Lactic acid 등의 유기산에 대한 저항성을 가지는 효모를 의미하는 것으로, 내산성은 다양한 농도의 유기산을 포함하는 배지에서의 생장을 평가하여 확인할 수 있다. 즉, '내산성 효모'란 고농도의 유기산을 포함하는 배지 내에서 일반 효모에 비하여 높은 생장률 및 바이오매스 소모율을 나타내는 효모를 의미한다.
본 발명에 있어서,'내산성 효모'란 유기산의 pKa 값 미만의 pH에서, 배지에 유기산이 함유되지 않은 경우에 비해, 배지에 1M 이상의 유기산이 함유된 경우, 적어도 10%의 바이오매스 소모율 (당소모율 등) 또는 적어도 10%의 비생장률을 유지할 수 있는 효모로 정의한다. 보다 구체적으로, 본 발명에서,'내산성 효모'란 pH 7인 경우에 비해, pH 2~4에서 적어도 10%의 바이오매스 소모율 (당소모율 등) 또는 적어도 10%의 비생장률을 유지할 수 있는 효모로 정의한다.
본 발명에 따른 재조합효모는 통상의 방법에 따라 상기 유전자를 숙주 효모의 염색체(chromosome) 상에 삽입시키거나, 상기 유전자를 포함하는 벡터를 숙주 효모에 도입시킴으로써 제조할 수 있다.
상기 숙주효모는 DNA의 도입효율이 높고, 도입된 DNA의 발현 효율이 높은 숙주세포가 통상적으로 사용되며, 본 발명의 일 실시예에서는 내산성 효모를 이용하였으나, 이에 한정되는 것은 아니고, 목적 DNA가 충분히 발현될 수 있는 것이라면 어떠한 종류의 효모라도 무방하다.
상기 재조합효모는 임의의 형질전환(transformation) 방법에 따라 제조할 수 있다. "형질전환"이란 DNA를 숙주로 도입하여 DNA가 염색체의 인자로서 또는 염색체 통합완성에 의해 복제가능하게 되는 것으로 외부의 DNA를 세포 내로 도입하여 인위적으로 유전적인 변화를 일으키는 현상을 의미하며, 일반적인 형질전환 방법에는 전기천공법(electroporation), 초산 리튬-PEG법 등이 있다.
또한, 본 발명에서 유전자를 숙주 미생물의 염색체 상에 삽입하는 방법으로는 통상적으로 알려진 임의의 유전자 조작방법을 사용할 수 있으며, 일 예로는 레트로바이러스벡터, 아데노바이러스벡터, 아데노-연관 바이러스벡터, 헤르페스심플렉스 바이러스벡터, 폭스바이러스벡터, 렌티바이러스벡터, 비바이러스성벡터 등을 이용하는 방법이 있다. "벡터"는 적합한 숙주 내에서 DNA를 발현시킬 수 있는 적합한 조절 서열에 작동가능하게 연결된 DNA 서열을 함유하는 DNA 제조물을 의미한다. 벡터는 플라스미드, 파지 입자 또는 간단하게 잠재적 게놈 삽입물 일 수 있다. 적당한 숙주로 형질전환되면, 벡터는 숙주게놈과 무관하게 복제하고 기능할 수 있거나, 또는 일부경우에 게놈 그 자체에 통합될 수 있다. 플라스미드가 현재 벡터의 가장 통상적으로 사용되는 형태이며 또한 Linearized DNA 또한 효모의 게놈 Integration을 위하여 통상적으로 사용하는 형태이다.
전형적인 플라스미드 벡터는 (a) 숙주세포당 플라스미드 벡터를 포함하도록 복제가 효율적으로 이루어지도록하는 복제 개시점, (b) 플라스미드 벡터로 형질전환된 숙주세포가 선발될 수 있도록 하는 항생제 내성 유전자 또는 영양 요구 마커 유전자 (auxotrophic marker gene) 및 (c) 외래 DNA 절편이 삽입될 수 있도록 하는 제한효소 절단부위를 포함하는 구조를 지니고 있다. 적절한 제한효소 절단부위가 존재하지 않을지라도, 통상의 방법에 따른 합성 올리고뉴클레오타이드어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용하면 벡터와 외래 DNA를 용이하게 라이게이션(ligation) 할 수 있다.
아울러, 상기 유전자는 다른 핵산 서열과 기능적 관계로 배치될 때 "작동가능하게 연결(operably linked)"된다. 이것은 적절한 분자(예를 들면, 전사 활성화 단백질)가 조절 서열(들)에 결합될 때 유전자 발현을 가능하게 하는 방식으로 연결된 유전자 및 조절 서열(들)일 수 있다. 예를 들면, 전서열(pre-sequence) 또는 분비리더(leader)에 대한 DNA는 폴리펩타이드의 분비에 참여하는 전단백질로서 발현되는 경우 폴리펩타이드에 대한 DNA에 작동가능하게 연결되고; 프로모터 또는 인핸서는 서열의 전사에 영향을 끼치는 경우 코딩서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 서열의 전사에 영향을 끼치는 경우 코딩 서열에 작동가능하게 연결되거나; 또는 리보좀 결합 부위는 번역을 용이하게 하도록 배치되는 경우 코딩 서열에 작동가능하게 연결된다.
일반적으로 "작동가능하게 연결된"은 연결된 DNA 서열이 접촉하고, 또한 분비 리더의 경우 접촉하고 리딩 프레임 내에 존재하는 것을 의미한다. 그러나, 인핸서(enhancer)는 접촉할 필요가 없다. 이들 서열의 연결은 편리한 제한 효소 부위에서 라이게이션 (연결)에 의해 수행된다. 그러한 부위가 존재하지 않는 경우, 통상의 방법에 따른 합성 올리고뉴클레오티드 어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용한다.
물론 모든 벡터가 본 발명의 DNA 서열을 발현하는데 모두 동등하게 기능을 발휘하지는 않고, 마찬가지로 모든 숙주가 동일한 발현 시스템에 대해 동일하게 기능을 발휘하지는 않는다. 그러나, 당업자라면 과도한 실험적 부담없이 본 발명의 범위를 벗어나지 않는 상태에서, 다른 여러 벡터, 발현 조절 서열 및 숙주 중에서 적절한 선택하여 적용할 수 있다. 예를 들어, 벡터를 선택함에 있어서는 숙주를 고려하여야 하는데, 이는 벡터가 그 안에 서 복제되어야만 하기 때문이고, 벡터의 복제 수, 복제 수를 조절할 수 있는 능력 및 당해 벡터에 의해 코딩되는 다른 단백질, 예를 들어 항생제 마커의 발현도 또한 고려되어야만 한다.
본 발명에 있어서, 탄소원은 글루코즈, 자일로즈, 아라비노즈, 수크로즈, 프룩토즈, 셀룰로오즈, 갈락토오스, 글루코즈 올리고머 및 글리세롤로 구성된 군에서 선택된 하나 이상인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 배양은 미생물 예를 들어 대장균 등이 더 이상 작용하지 못하도록 (예를 들어, 대사체 생산 불가능) 하는 조건에서 이루어질 수 있다. 예를 들어, 배양은 pH 1.0 내지 6.5, 바람직하게 pH 1.0 내지 6.0, 보다 바람직하게는 2.6 내지 4.0인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1: YBC 균주에서 기존 프로모터를 이용한 MCR(malonyl-CoA reductase) 발현패턴 확인
(1)내산성 균주 선정
본 발명자들은 다양한 효모 균주에 대한 테스트를 통하여 내산성을 갖는 균주 군을 선별한바 있다(대한민국 특허공개 제2017-0025315호). 상기 선별된 효모 균에 대하여 젖산을 배양 초기에 배지에 첨가하여 미생물의 성장 및 당소모 속도를 확인하면서 내산성이 가장 좋은 균주를 선별하였다. 이때 접종 OD 값은 4, 배지는 YP 배지(20g/L Peptone, 10g/L Yeast extract)에 Glucose 3.5%를 사용하였으며 50ml의 Flask culture로 30℃, 100 rpm 조건에서 실험을 실시하였으며, 젖산 농도는 각 초기 0~80g/L로 변화를 주며 배양을 실시하였다. 이 결과를 비교 분석하여 내산성이 가장 우수한 균주인 YBC 균주를 선정하였다.
상기 YBC 균주(Kazachstania exigua sB-018c)는 2018 년 4월 11일자로 기탁기관 한국생명공학연구원 생물자원센터에 KCTC13508BP으로 기탁하였다.
(2)내산성 균주 YBC에서 기존 프로모터를 이용한 MCR 발현
본 실시예에서는 YBC 균주에서 3-HP(3-hydroxy propionic acid)를 생산 관련 핵심 효소인 MCR(malonyl-CoA reductase)을 코딩하는 유전자를 발현시켰다.
3-HP를 생산하는 말로닐-CoA 경로는 아세틸-CoA가 카복시화를 통하여 말로닐-CoA로 전환된 뒤 환원반응을 통해 3-HP로 전환되는 대사경로이며(아세틸-CoA → 말로닐-CoA → 3-HP), 말로닐-CoA경로는 대장균을 비롯한 미생물이 일반적으로 생산하는 중간물질을 거치므로 3-HP 생산경로로써 가장 많이 연구되고 있다(미국 공개특허공보 US 2013/0071893 A1). 말로닐-CoA는 말로네이트 리덕타아제와 3-HP 디하이드로제나제의 작용을 통해 3-HP로 전환될 수 있으므로 재조합 대장균을 이용하여 포도당이나 글리세롤을 이용하여 3-HP로 전환하는 방법이 잘 알려져 있다.
본 실시예에서는 알려진 MCR 유전자 중 효율이 높은 유전자인 MCRsa1과 MCRsa2에 대상으로 실험을 실시하였다. MCRsa1과 MCRsa2는 Genebank의 data를 기초로 하여 Yeast codon usage를 적용하여 합성한 뒤 사용하였으며, 본 실시예에서 사용한 MCR 유전자의 정보를 표 1에 나타내었다.
Figure PCTKR2019002432-appb-T000001
YBC 균주에 유전자 도입을 위하여 도 1(a)의 카세트를 제작하였다.
해당 카세트는 항생제 내성 유전자를 갖도록 하였으며 목적하는 유전자의 타겟팅을 위하여 목적 유전자의 5'UTR 및 3'UTR 부위를 전체 게놈 서열(full genome sequence) 또는 부분 게놈 서열을 바탕으로 하여, 도 1에 나타낸 제한효소를 갖도록 디자인한 후, PCR로 수득하였고, S. cerevisiae 유래 프로모터 및 터미네이터는 알려진 유전정보 (일예로 Saccharomyces Genome Database)를 기초로 하여 제작하였다. 항생제 내성 유전자는 도 1(a)에 HygR을 일예로 하였으나 해당 균주에 사용할 수 있는 다른 eukaryote 용 항생제 내성 유전자를 사용할 수 있으며 이에 대해서는 당업계에 알려진 공지의 기술을 알고 있는 사람은 누구나 용이하게 제작할 수 있다. 항생제 내성 유전자는 사용 후 제거를 해야 다음 step의 유전조작을 수행할 수 있기 때문에 양 끝단의 Cre-loxp 를 위한 site (lox71 과 lox66)를 도입하였다. 또한 YBC 균주에서 유래한 프로모터와 터미네이터의 경우에는 상기의 UTR 부위를 추출하는 것과 동일한 방법을 사용하여 제작하였다. 발현시켜야 할 목적 유전자가 다수일 경우에는 도 1(d)의 그림과 같이 다수의 유전자를 발현할 수 있는 카세트를 구현하였으며, 각 부위 말단에 위치한 제한효소를 이용하여, 해당 UTR 및 ORF 유전자와 항생제 내성 유전자는 목적에 맞도록 교환 제작하였다.
Donor DNA는 카세트를 포함하는 플라스미드를 제한효소를 이용하여 절단하거나 또는 PCR을 통하여 증폭하였으며, 각 유전자의 부분들은 각 말단에 위치한 제한효소를 이용하여 교환할 수 있다. 제한효소를 이용하는 방법 외에 Gibson assembly를 이용하여 카세트를 제작하기도 하였으며, 이러한 Gibson assembly를 사용하는 방법에 대해서는 다수의 제품 및 사용법이 잘 갖춰져 있으며, 본 실시예에서는 NEB사의 Gibson assembly Master mix 및 Cloning kit를 이용하여 제작하였다. 이중 MCR 및 G4423과 관련된 올리고머에 대하여는 하기 표 2에 나타 내었다.
Figure PCTKR2019002432-appb-T000002
Figure PCTKR2019002432-appb-I000001
내산성 S. cerevisiae 균주의 경우는 상기의 카세트를 이용하거나 혹은 도 2에 나타낸 발현 플라스미드(pSK-084 and/or pSK-085)를 이용하여 발현시켰다 (도 2).
상기 제작된 카세트를 YBC 균주로 도입하는 것은 일반적인 효모의 형질전환과 같이 선형화(linearized)된 Donor DNA를 PCR이나 제한효소법으로 제작한 뒤 전기천공법이나 Lithium acetate법 등을 이용하여 도입한 후, 각각 사용한 auxotroph 마커 혹은 항생제 마커에 따른 배지를 이용하여 선별하였다. 선별 배지로부터 자란 콜로니를 통하여 크로모좀의 정확한 locus에 도입되었는 지 여부를 타겟이 도입될 유전자 ORF 프라이머 및 도입된 유전자의 프라이머를 이용하여 콜로니 PCR로 확인을 하였으며, 이후 배양된 균체로부터 게놈 DNA를 추출하여 정확한 Genotype을 확인하였다.
이들 제작된 균주들은 20mL 부피의 selective SC-based medium (20 g/L of glucose) 또는 YPD 배지를 이용하여 250 mL 플라스크에서 배양하였으며 (30 oC, 250rpm) 배양은 모든 당 및 에탄올이 소모되는 시점까지 지속되었다.
상기 방법으로 제작된 사카로마이세스 세르비지에 유래 프로모터(TEF1) 및 YBC 균주 유래 프로모터(FBA1p)와 함께 MCR 유전자가 도입된 재조합 균주를 표 3에 나타내었다.
Figure PCTKR2019002432-appb-T000003
상기 재조합 균주들을 20mL 부피의 YPD 배지(20g/L Peptone, 10g/L Yeast extract, 20g/L Dextrose)를 이용하여 250 mL 플라스크에서 배양 하였으며 (30 oC, 250rpm) 에탄올 생산 시기와 에탄올 소모시기에서 균체를 수득한 후, MCR 유전자에 대하여 RT-qPCR을 수행하였다.
본 실시예에서 사용한 RT-qPCR 방법을 기술하자면 목적 균주의 exponential 성장기에 RNA 를 추출한 후 이를 주형으로 하여 cDNA를 만든다. Target 유전자와 Housekeeping 유전자 (Ref 유전자로 사용)에 각각 특이적인 oligomer 를 합성하고 이를 이용하여 qPCR을 실시하였다. 당해 실험에 사용한 유전자는 ALG9 이며 사용한 프라이머로 증폭되는 단편의 크기는 147±3 bp 이다. 표 4에 사용한 qPCR용 프라이머 및 이후 예제에 사용한 프라이머를 기재하였다.
Figure PCTKR2019002432-appb-T000004
Figure PCTKR2019002432-appb-I000002
그 결과, 도 3에 나타난 바와 같이, 내산성 균주 YBC를 이용하여 제작된 재조합 균주에서 MCR 유전자(MCRsa1, MCRsa2)가 발현되는 것을 확인하였다. Saccharomyces cerevisiae의 프로모터 및 YBC 균주의 프로모터(1kb)를 이용하여 발현양을 확인한 결과, 모두 qPCR의 Ref 유전자와 대비하여, 발현 특성이 높지 않거나 오히려 낮은 결과를 나타내었다. 또한, YBC 균주 유래 1kb FBA 프로모터(YBC FBA1p)를 이용한 MCRsa2의 발현은 ScTEF1p 프로모터 대비 낮은 발현 결과를 보여주었다(도 3B의 YBC-1413).
ScTEF1p 프로모터를 사용한 재조합 균주 YBC-061, YBC-062, YBC-067,YBC-068에서 3-HP 생산에 관여하는 다른 유전자인 BDHcm유전자와 HPDHec 유전자 및 EUTEdz 유전자를 대상으로 하여 발현을 확인하였다.
그 결과, 도 4에 나타난 바와 같이, MCR 유전자와 유사하게 YBC 균주의 내재 프로모터인 FBA1p에 의한 유전자 발현양, 사카로마이세스 세르비지에 유래 프로모터(TEF1)에 의한 유전자 발현양 보다 낮은 것을 확인하였다.
아울러, 재조합 균주에 의한 3-HP의 생산량도 매우 낮은 수준이었으며 2 copy의 유전자를 이용하여, 발현양이 높아진 재조합 균주인 YBC-1497 균주(MCRsa2, HPDH, EUTE 3개 유전자가 모두 발현양은 향상) 가 오히려 3-HP 생산량은 YBC-1178 균주 보다 낮아지는 현상이 발생하였다.
실시예 2: 기존 프로모터로 발현한 MCR 유전자 및 관련 유전자에 의한 3-HP 생산능 확인
실시예 1에서 제작한 재조합 균주에서의 3-HP 생산 성능을 확인하였다.
먼저, 25mL의 YPD 배지(20g/L Peptone, 10g/L Yeast extract, 20g/L Dextrose)로 Shake flask를 이용하여 250rpm, 30℃에서 배양하였으며 15μM의 Cerulenin(Sigma-Aldrich, USA)을 첨가하였다. Cerulenin은 Cytosolic acetyl-CoA to Malonyl-CoA로부터 지질 합성을 저해하여 3-HP의 생산을 원활하게 도와주는 역할을 한다. 상기 배양 조건에서 모든 Glucose를 소모할 때까지 배양한 후, Cell density를 측정하고 배양액 내의 3-HP를 포함하는 main metabolite 생산량을 확인하였다. 이 외에도 특정 조건을 위하여 변형된 형태의 농도, 배지, 배양 조건에서 수행을 한 경우도 있으나 특별히 기재 하지는 않았다.
세포 배양 상층액에서 3-HP 분석은 주입 부피가 10 ㎕인 Waters Alliance e2695 HPLC system (Waters, Milford, USA)을 사용하여 배양 상층액 샘플을 분석하였다. HPLC에서 Fast Acid Analysis Column (100 mm X 7.8 mm) (Bio-Rad, USA)에 연결된 Aminex HPX-87H Organic Acid Column (300 mm X 7.8 mm) (Bio-Rad, USA)을 정체기로 사용하였다. 컬럼을 +55℃로 유지하고, 0.3 또는 0.5 ml min-1의 유량으로 5.0 mM H2SO4 (Merck KgaA, Germany)를 용출액으로 사용하였다.
3-hydroxypropionic acid, 글루코스, 아세테이트, 숙시네이트, 피루베이트, 글리세롤 및 에탄올의 검출에 Waters 2489 dual wavelength UV (210 nm) detector (Waters, Milford, USA) 및 Waters 2414 differential refractometer (Waters, Milford, USA)을 사용하였다.
그 결과, 표 5에 나타난 바와 같이, 재조합 균주 모두에서 낮은 3-HP 생산능을 보였으며, 이러한 낮은 생산 성능은 주요 유전자 특히 MCR의 발현율이 생산에 큰 영향을 미치고 있는 것으로 판단하였다.
Figure PCTKR2019002432-appb-T000005
실시예 3: S. cerevisiae 에서 해당 MCR 유전자의 발현율 확인
유전 정보 및 gene tool이 잘 set-up 되어 있는 S. cerevisiae 균주에서 MCR 유전자 및 이와 관련 유전자의 발현율을 비교하기 위하여 3-HP 생산 유전자 특히 발현율이 낮은 MCR 유전자의 발현양을 실시예 1의 RT-qPCR 방법으로 확인하였다.
그 결과, 도 5에 나타난 바와 같이, S. cerevisiae의 자체 프로모터를 사용한 재조합 균주에서도 MCRsa2 유전자의 발현율이 낮게 나타나, MCR 유전자의 발현을 높일 수 있는 새로운 프로모터를 선별할 필요성을 확인하였다.
실시예 4: YBC 균주에서 알코올 생산 유전자의 발현 확인
본 실시예에서는 YBC 균주에서 외래 유전자의 발현을 높일 수 있는 프로모터 선별을 위하여, YBC 균주 자체에서 높은 발현율을 가지는 유전자의 발현을 조절하는 프로모터를 이용하여, 해당 유전자를 외래 유전자로 바꾸어 발현시키는 방식을 사용하였다.
글루코오스 존재 하에서 강하게 발현하는 해당과정 및 에탄올 생산 관련 유전자를 대상으로 강하게 발현하는 유전자 중 다른 유전자로 치환하였을 때, 성장에 영향이 없으면서도 효과가 높은 유전자를 선택하였으며, ADH(Alcohol dehydrogenase) 유전자의 발현을 조절하는 프로모터를 타겟으로 하였다.
특히 미생물 성장에 직접적인 영향을 주지 않기 위해서는 해당과정과 관련된 유전자를 회피하여야 하는데 이는 해당과정 관련 유전자가 없어지거나 약할 경우 미생물 성장에 중요한 피루브산 생성이 억제되거나 연쇄반응의 균형에 문제가 생기게 되어 미생물의 성장성에 영향을 주고 결론적으로 발효능이 떨어지게 된다. 따라서 내재 유전자의 교체는 대상 균주가 에탄올 생산 균주인 경우는 PDC(pyruvate dehydrogenase complex) 유전자 혹은 ADH 유전자를 선택하게 되며 이 중 대상 화합물인 3-HP를 생산하기 위하여는 PDC를 중요 경로로 사용하기 때문에, ADH 유전자를 선택하여 제거하는 것으로 선정하였다.
효모와 같이 에탄올 발효능이 강한 균주는 매우 다양한 강도 및 역할을 담당하는 ADH들을 가지고 있다. 효모의 ADH 중 에탄올을 생산하는 주된 ADH를 확인하고 해당 프로모터를 선택하여 사용하기 위하여 YBC 균주의 유전체 정보와 S. cerevisiae의 알려진 ADH 유전자 정보를 비교하여 여러 후보 유전자를 확인하였고 이에 대한 qPCR 을 실시하였다.
S. cerevisiae의 게놈 전체 서열 데이터에서 Bioinformatics 정보를 이용하여 ADH 유전자 후보 7종을 선별하였으며(표 6 참고), 선별 유전자에 특이적인 올리고머를 디자인하여 RT-qPCR 를 수행하였다(프라이머 서열은 표 4 참조).
Figure PCTKR2019002432-appb-T000006
그 결과, 도 6에 나타난 바와 같이, g4423 유전자의 발현량이 현저히 높은 것으로 확인되었다.
g4423 유전자를 제거한 균주(YBC-1563)를 제작하였다. g4423 및 UTR의 정보를 바탕으로 하여 g4423 ORF가 제거되고 5' 과 3' UTR 및 항생제 마커가 있는 도 1(a)와 유사한 유전자 카세트를 제작하여 Donor DNA로 사용하였다. Donor DNA의 제작에는 전술한 바와 같이 제한효소를 이용한 클로닝 방법과 Gibson assembly를 이용한 방법이 사용되었다. 제작된 Donor DNA를 도입하고 마커유전자에 대응하는 plate에서 자란 콜로니에 대하여 g4423을 확인하기 위한 ORF 용 프라이머(Primer forward(서열번호 72): GAGATAGCACACCATTCACCA, Primer reverse(서열번호 73): CAACGTT72AAGTACTCTGGTGTTTG)를 이용하여 ORF가 제거되었음을 확인하였다.
상기 균주를 YPD 배지에서 Glucose를 40g/L로 하고 starting OD 값 0.7로 하여 50ml 배지로 250ml 플라스크를 이용하여 30℃ 250rpm에서 당과 에탄올이 모두 소모되는 배지에서 배양한 후, 글루코오스 소비량과 에탄올 생산량을 확인한 결과, 에탄올 생산이 50% 이상 감소하는 것을 확인하였다(도 7).
실시예 5: g4423 유전자를 MCR 유전자로 치환한 YBC 재조합 균주의 MCR 발현량 학인
실시예 4에서 확인된 g4423 유전자의 강한 발현력을 이용하기 위하여, YBC 균주의 게놈에서 g4423 유전자를 MCRsa1 유전자로 치환하여 재조합 균주 YBC-1684를 제작하고, MCRsa1 유전자의 발현양을 확인하였다. g4423 및 UTR의 정보를 바탕으로 하여 g4423 ORF가 제거되고 5' 과 3' UTR 및 항생제 마커가 있는 도 1(b)의 유전자 카세트를 제작하였으며, g4423의 ORF 자리에는 MCRsa1의 Yeast codon usage로 최적화된 서열을 도입하여 Donor DNA로 사용하였다. Donor DNA의 제작에는 전술한 바와 같이 제한효소를 이용한 클로닝 방법과 Gibson assembly를 이용한 방법이 사용되었다. Donor DNA에 사용한 플라스미드는 (pSK863) 서열번호 7 에 표시하였다.
완성된 카세트에서 Donor DNA를 증폭하고 이를 YBC 균주에 도입하여 자란 콜로니에 대하여 하기 g4423 ORF를 확인하는 프라이머를 이용하여 g4423 ORF가 제거되고 MCRsa1 ORF가 존재함을 확인하여 MCRsa1 이 도입되었음을 확인하였다.
확인용 Primer forward(서열번호 74) : ATGAGAAGAACTTTGAAGGCTG,
Primer reverse(서열번호 75) TTACTTAGGGATGTAACCCTTTTCGA)
상기 균주를 YPD 배지에서 Glucose를 40g/L로 하고 starting OD 값을 0.7로 하여 50ml 배지로 250ml 플라스크를 이용하여 30℃ 250rpm에서 당과 에탄올이 모두 소모되는 배지에서 배양한 후, 3-HP의 생산양 및 당과 에탄올 생산양을 확인하였다. 발현양 확인을 위한 RT-qPCR의 조건은 실시예 1과 동일하게 수행하였으며, 배양액의 샘플링은 대수증식기에 추출하였고, 제작된 재조합 YBC 균주의 특이 유전형에 대해서는 표 7에 나타내었다.
Figure PCTKR2019002432-appb-T000007
그 결과, 도 8에 나타난 바와 같이, MCRsa1 유전자의 발현이 g4423 유전자와 거의 비슷하고, S. cerevisiae 유래의 강한 프로모터인 TEF1 프로모터를 사용한 균주(대조군 YBC-061) 보다 훨씬 강한 발현을 나타내는 것을 확인하였다.
G4423의 프로모터는 기존에 사용되는 S. cerevisiae 유래의 다양한 ADH isozymes들의 프로모터와 비교하여 상동성을 비교한 결과, 상동성이 매우 낮다는 것을 알 수 있었다(표 8).
Figure PCTKR2019002432-appb-T000008
실시예 6: g4423 유전자를 MCRsa1 유전자로 치환하여 재조합 균주의 3-HP의 생산
실시예 5에서 MCR 유전자의 발현량의 현저한 증가를 확인한 재조합 균주 YBC-1684의 3-HP 생산량을 확인하였다.
비교군으로 실시예 2의 표 3의 결과와 비교하였으며, 표 3에 나타난 바와 같이, scTEF 프로모터 또는 FBA 프로모터를 이용하여 3-HP 생성관련 핵심 유전자 3개를 발현하는 경우, 플라스크 배양에서 1~16mg/L의 3-HP가 생산되는 수준이었다.
재조합 균주 YBC-1684 및 g4423 자리에 MCRsa1이 치환되어 발현된 YBC-1684에 3-HP 관련 유전자를 추가로 삽입한 재조합 균주(YBC- trans)에 대하여 생산량을 확인하였다.
YP 배지(20g/L Peptone, 10g/L Yeast extract)에 4% 의 glucose 및 15μM 의 Cerulenin 을 첨가하고, 30℃ 플라스크 배양에서 배양하였으며 당이 완전히 소모된 5일차에 배양액을 샘플링하여 3-HP의 생성능을 확안하였다.
그 결과, 표 9에 나타난 바와 같이, g4423 자리에 MCRsa1 유전자만 삽입된 YBC-1684 균주는 200mg/L의 3-HP를 생산하였고, 추가적으로 3-HP 관련 유전자(HiBADH 유전자 및 EUTE 유전자)가 삽입된 균주는 콜로니마다 차이가 있었으나 146~710mg/L의 3-HP를 생산하여, scTEF 프로모터 또는 FBA 프로모터로 해당 유전자가 발현된 재조합 균주의 3-HP 생산과 비교하여, 현저히 높은 생산량을 확인할 수 있었다.
Figure PCTKR2019002432-appb-T000009
이러한 결과로, g4423 프로모터에 의한 MCRsa1 유전자의 발현 증대가 3-HP의 생산 증대에 크게 영향을 줄 수 있음을 확인하였으며, 이를 통하여, g4423 프로모터에 의하여 목적 화합물의 생산에 관여하는 유전자의 발현을 증대한다면, 목적 화합물 생산을 증대할 수 있다는 것을 알 수 있었다.
실시예 7: g4423 프로모터의 이동성 확인
YBC 균주의 게놈 DNA에서 G4423 프로모터와 터미네이터 부위(terminator region)를 1kb로 잘라서 3-HP 생산용 유전자인 MCRsa1의 발현수준을 확인하였다. YBC 균주 게놈의 g4423 및 UTR의 정보를 바탕으로 하여 g4423 5' UTR 부분 1kb region을 프라이머를 이용하여 증폭/추출한 뒤 이를 표 2의 oSK-1412~oSK1419의 프라이머를 이용하여 g4423의 프로모터와 Yeast codon usage로 최적화된 MCRsa1 의 단편을 확보하였다. 이를 다수 유전자를 발현할 수 있는 도 1(e)의 카세트에 제한효소를 이용하여 도입하였으며 사용한 플라스미드 (pSK-865)를 서열번호 8에 표시하였다. 이로부터 Donor DNA 카세트를 증폭 정제하여 YBC에 도입하고 성장한 콜로니의 genotype을 확인하였다.
상기 방법으로 제조된 YBC-1693 재조합 균주의 MCRsa1의 발현양은 다른 YBC의 프로모터(FBA)나 S. cerevisiae의 TEF1p 프로모터를 사용하였을 때처럼 발현양이 낮아지는 것을 확인하였다(도 9). 이는 해당 YBC 내산성 균주의 프로모터 작용에는 보다 긴 단편이 필요하거나 먼 거리에서도 작용하는 기작 (enhancer, silencer) 또는 다중인자에 의한 복합 작용이 있는 것으로 추정되며 이러한 기작을 정확히 밝히기 위한 별도의 추가 연구가 필요하다.
g4423의 유전자를 목적 유전자로 바꿀 경우 목적 유전자를 강하게 발현시킬 수 있다는 점과 에탄올 생산을 담당하는 g4423 유전자를 제거하는 2가지 효과를 얻을 수 있으므로, 해당 균주를 이용하여 다양한 화합물을 생산하는 연구의 목적 달성을 효과적으로 수행할 수 있을 것이다.
실시예 8: g4423 프로모터에 의한 LDH 유전자의 발현
본 실시예에서는 MCR 유전자 이외에 락테이트 생산에 관여하는 유전자인 LDH(lactate dehydrogenase) 유전자를 g4423 유전자와 치환한 재조합 YBC 균주를 제작하고, 상기 균주의 락테이트 생산능을 확인하였다.
Lactic acid 생산 관련 유전자 중 대표적인 3종의 유전자(L. helveticus 유래 LDH, R.oryzae 유래 LDH, L. plantarum 유래 LDH)에 대하여 g4423 프로모터를 이용하여 발현하도록 재조합 균주를 제작하였다.
g4423 및 UTR의 정보를 바탕으로 하여 g4423 ORF가 제거되고 5' 과 3' UTR 및 항생제 마커가 있는 도 1(e)와 유사한 유전자 카세트를 제작하였으며, g4423의 ORF 자리에는 NCBI의 각 3종의 유전자 정보를 바탕으로 Yeast codon usage로 최적화된 서열을 합성한 후 제한효소 (ApaI, SacI)를 이용하여 카세트에 도입하였다. 완성된 카세트에서 Donor DNA를 증폭하고 이를 YBC 균주에 도입하여 성장한 콜로니에 대하여 g4423 ORF를 확인하는 프라이머를 이용하여 g4423 ORF 의 allele 하나가 제거되고 각 LDH 유전자가 도임됨을 확인하였다.
L. helveticus Primer forward(서열번호 76) : ATGAAAATTTTTGCTTATGG
L. helveticus Primer reverse(서열번호 77) TTAATATTCAACAGCAATAG;
R. oryzae Primer forward(서열번호 78) : ATGGTTTTGCATTCTAAAGT
R. oryzae Primer reverse(서열번호 79): TTAACAAGAAGATTTAGAAA,
L. plantarum Primer forward(서열번호 80) : ATGTCTTCTATGCCAAATCA
L. plantarum Primer reverse(서열번호 81): TTATTTATTTTCCAATTCAG
상기 제작된 재조합 균주를 플라스크에서, YP(20g/L Peptone, 10g/L Yeast extract) 배지에 4% glucose 와 150mg/L의 Uracil을 첨가한 배지를 사용하여, 30℃/100 rpm 에서 24시간 진탕배양하였다.
배양액 내의 락테이트와 에탄올은 HPLC를 통하여 확인하였다. 배양액 중의 Glucose, ethanol, L-lactate 농도는 Waters 1525 Binary HPLC pump에 Bio-Rad Aminex 87-H column 을 장착하여 분석하였다. Glucose와 ethanol은 Waters 2414 Refractive Index detector를, L-lactate는 Waters 2489 UV/Visible Detector(210nm)를 사용하여 분석하였으며 각 성분 별로 농도에 따른 Peak area Standard curve를 작성하여 농도를 계산하였으며 구체적인 분석 조건은 다음과 같다.
1. Mobile Phase Condition: 0.005M H2SO4 solution
2. Flow rate: 0.6 mL/min
3. Run time: 40 min
4. Column Oven temperature: 60℃
5. Detector temperature: 40℃
6. Injection volume: 10 μL
7. Auto sampler tray temperature: 4℃
그 결과, 도 10에 나타난 바와 같이, 치환된 대상 유전자가 LDH 활성을 나타내어, 락테이트를 생산하는 것을 확인하였다.
[기탁정보]
기탁기관명 : 한국생명공학연구원
수탁번호 : KCTC13508BP
수탁일자 : 20180411
본 발명에 따른 신규 프로모터를 이용하여, 유기산 내성 효모에서 유기산 생성 관련 목적 유전자를 발현시키는 경우, 유기산에 대하여 내성을 가지면서, 균주의 성장능이 저해되지 않고, 유기산을 높은 효율로 생산할 수 있는 장점이 있다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.
Figure PCTKR2019002432-appb-I000003

Claims (25)

  1. 서열번호 1 또는 서열번호 2의 염기서열로 표시되는 프로모터.
  2. 제1항의 프로모터를 포함하는 재조합 벡터.
  3. 제2항에 있어서, 서열번호 3 또는 서열번호 4로 표시되는 터미테이터를 추가로 포함하는 것을 특징으로 하는 재조합 벡터.
  4. 제2항에 있어서, 목적단백질을 코딩하는 유전자를 추가로 포함하는 재조합 벡터.
  5. 제4항에 있어서, 상기 목적단백질은 유기산 생산 관여하는 단백질인 것을 특징으로 하는 재조합 벡터.
  6. 제5항에 있어서, 목적단백질은 말로닐-CoA-리덕테이즈 또는 락테이트 디하이드로게나아제인 것을 특징으로 하는 재조합 벡터.
  7. 제2항 내지 제6항 중 어느 한 항의 재조합 벡터가 도입되어 있는 재조합 미생물.
  8. 제7항에 있어서, 효모인 것을 특징으로 하는 재조합 미생물.
  9. 제8항에 있어서, 내산성 효모 YBC(KCTC13508BP)인 것을 특징으로 하는 재조합 미생물.
  10. 다음 단계를 포함하는 유기산의 제조방법:
    (a) 제5항의 재조합 벡터가 도입되어 있는 재조합 미생물을 배양하여 유기산을 생성하는 단계; 및
    (b) 생성된 유기산을 수득하는 단계.
  11. 내산성 효모 YBC 균주(KCTC13508BP)에서 g4423 유전자가 결실 또는 약화되어, 에탄올 생성능이 감소되어 있는 것을 특징으로 하는 재조합 균주.
  12. 서열번호 1의 염기서열로 표시되는 프로모터와 목적단백질을 코딩하는 유전자가 작동가능하게 연결되어 있는 유전자 구조물.
  13. 제12항에 있어서, 서열번호 3 또는 서열번호 4로 표시되는 터미테이터를 추가로 포함하는 것을 특징으로 하는 유전자 구조물.
  14. 제12항에 있어서, 상기 목적단백질은 유기산 생산 관여하는 단백질인 것을 특징으로 하는 유전자 구조물.
  15. 제12항에 있어서, 상기 목적단백질은 말로닐-CoA-리덕테이즈 또는 락테이트 디하이드로게나아제인 것을 특징으로 하는 유전자 구조물.
  16. 제12항의 유전자 구조물이 염색체 상에 도입되어 있는 재조합 미생물.
  17. 제16항에 있어서, 효모인 것을 특징으로 하는 재조합 미생물.
  18. 제17항에 있어서, 내산성 효모 YBC(KCTC13508BP)인 것을 특징으로 하는 재조합 미생물.
  19. 다음 단계를 포함하는 유기산의 제조방법:
    (a) 제14항의 유전자 구조물이 도입되어 있는 재조합 미생물을 배양하여 유기산을 생성하는 단계; 및
    (b) 생성된 유기산을 수득하는 단계.
  20. YBC 균주(KCTC13508BP)의 게놈에서 g4423의 프로모터의 하류에 목적유전자가 삽입되어 있고, 94423의 프로모터에 의해 발현이 조절되는 목적유전자 과발현용 재조합 미생물.
  21. 제20항에 있어서, 상기 목적유전자는 g4423 유전자와 치환되어 도입되는 것을 특징으로 하는 재조합 미생물.
  22. 제20항에 있어서, 목적유전자는 유기산 생성에 관여하는 단백질을 코딩하는 유전자 인 것을 특징으로 하는 재조합 미생물.
  23. 제22항에 있어서, 상기 유기산 생성에 관여하는 단백질은 말로닐-CoA-리덕테이즈 또는 락테이트 디하이드로게나아제인 것을 특징으로 하는 재조합 미생물.
  24. 다음 단계를 포함하는 유기산의 제조방법:
    (a) 제22항의 재조합 미생물을 배양하여 유기산을 생성하는 단계; 및
    (b) 생성된 유기산을 수득하는 단계.
  25. 제20항의 재조합 미생물을 배양하여 목적유전자를 과발현시키는 방법.
PCT/KR2019/002432 2018-04-17 2019-02-28 유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법 WO2019203435A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US17/047,805 US11655478B2 (en) 2018-04-17 2019-02-28 Promoter derived from organic acid-resistant yeast and method for expression of target gene by using same
CN201980039165.0A CN112639104B (en) 2018-04-17 2019-02-28 Novel promoter derived from organic acid-tolerant yeast and method for expressing target gene using the same
JP2020557290A JP7304889B2 (ja) 2018-04-17 2019-02-28 有機酸耐性酵母由来新規プロモーター及びこれを用いた目的遺伝子の発現方法
EP19787990.1A EP3800258A4 (en) 2018-04-17 2019-02-28 NOVEL ORGANIC ACID RESISTANT YEAST PROMOTER AND METHOD FOR EXPRESSING A TARGET GENE USING THE SAME

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2018-0044508 2018-04-17
KR1020180044508A KR102140596B1 (ko) 2018-04-17 2018-04-17 유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법

Publications (2)

Publication Number Publication Date
WO2019203435A1 true WO2019203435A1 (ko) 2019-10-24
WO2019203435A8 WO2019203435A8 (ko) 2020-09-24

Family

ID=68238958

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/002432 WO2019203435A1 (ko) 2018-04-17 2019-02-28 유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법

Country Status (5)

Country Link
US (1) US11655478B2 (ko)
EP (1) EP3800258A4 (ko)
JP (1) JP7304889B2 (ko)
KR (1) KR102140596B1 (ko)
WO (1) WO2019203435A1 (ko)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102330595B1 (ko) * 2018-04-17 2021-11-24 에스케이이노베이션 주식회사 에탄올 생산 경로가 억제된 내산성 효모 및 이를 이용한 젖산의 제조방법
KR102140596B1 (ko) 2018-04-17 2020-08-04 에스케이이노베이션 주식회사 유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법
KR102140597B1 (ko) 2018-04-17 2020-08-03 에스케이이노베이션 주식회사 에탄올 생산 경로가 억제된 내산성 효모 및 이를 이용한 젖산의 제조방법
KR20210041903A (ko) 2019-10-08 2021-04-16 에스케이이노베이션 주식회사 락테이트 대사 및 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
KR20210158676A (ko) 2020-06-24 2021-12-31 에스케이이노베이션 주식회사 젖산 생산능이 증가된 재조합 내산성 효모
KR20220064647A (ko) 2020-11-12 2022-05-19 에스케이이노베이션 주식회사 내산성 효모 유전자 기반 합성 프로모터

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005137306A (ja) * 2003-11-07 2005-06-02 Toyota Central Res & Dev Lab Inc 有機酸存在下におけるプロモーター及びその利用
JP4700395B2 (ja) 2005-04-13 2011-06-15 株式会社豊田中央研究所 酸性条件下で使用するためのプロモーター及びその利用
US20130071893A1 (en) 2009-09-27 2013-03-21 Opx Biotechnologies, Inc. Methods for producing 3-hydroxypropionic acid and other products
KR20160012561A (ko) * 2014-07-24 2016-02-03 삼성전자주식회사 Erg5의 활성이 증가되도록 유전적으로 조작된, 내산성을 갖는 효모 세포 및 그를 이용하여 락테이트를 생산하는 방법
KR20160075640A (ko) 2013-10-24 2016-06-29 로베르트 보쉬 게엠베하 입자 필터를 모니터링하기 위한 방법 및 장치
KR20160133308A (ko) * 2015-05-12 2016-11-22 삼성전자주식회사 내산성을 갖는 효모 세포, 상기 효모 세포를 제조하는 방법 및 이의 용도
KR20170025315A (ko) 2014-08-29 2017-03-08 에스케이이노베이션 주식회사 3-hp를 생산할 수 있는 재조합 효모 및 이를 이용한 3-hp의 제조방법
KR20180015591A (ko) * 2016-08-03 2018-02-13 한국생명공학연구원 Upc2를 발현하는 재조합 균주 및 이의 용도

Family Cites Families (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IT1294728B1 (it) 1997-09-12 1999-04-12 Biopolo S C A R L Ceppi di lievito per la riproduzione di acido lattico
JP2001204464A (ja) 2000-01-27 2001-07-31 Toyota Motor Corp 乳酸の製造方法
US7141410B2 (en) 2000-11-22 2006-11-28 Natureworks Llc Methods and materials for the production of organic products in cells of Candida species
US7232664B2 (en) 2002-05-30 2007-06-19 Natureworks Llc Fermentation process using specific oxygen uptake rates as a process control
JP4095889B2 (ja) 2002-12-13 2008-06-04 トヨタ自動車株式会社 高光学純度な乳酸の製造方法
US20050112737A1 (en) 2003-11-20 2005-05-26 A. E. Staley Manufacturing Co. Lactic acid producing yeast
JP4692173B2 (ja) 2005-09-13 2011-06-01 東レ株式会社 Ｄ−乳酸デヒドロゲナーゼ活性を有するポリペプチド、これをコードする遺伝子およびｄ−乳酸の製造方法
JP5121070B2 (ja) 2005-11-23 2013-01-16 ネイチャーワークス・エル・エル・シー Ｌ−又はｄ−ラクタート：フェリチトクロームｃ酸化還元酵素遺伝子が機能しない乳酸産生酵母
DK2586313T3 (en) 2006-03-13 2017-03-27 Cargill Inc Fermentation process using yeast cells with interrupted conversion pathway from dihydroxyacetone phosphate to glycerol
EP2060632A1 (en) 2007-10-29 2009-05-20 Technische Universität Berlin Method of modifying a yeast cell for the production of ethanol
JP2010075171A (ja) 2008-08-25 2010-04-08 Kirin Holdings Co Ltd キャンディダ・ユティリスによる高効率乳酸製造法
IN2012DN01521A (ko) 2009-08-21 2015-06-05 Asahi Glass Co Ltd
KR101576186B1 (ko) 2012-06-26 2015-12-10 한국생명공학연구원 에탄올 생산 경로가 봉쇄된 클루이베로마이세스 막시아누스 균주 및 이의 용도
JP2014150800A (ja) 2013-02-05 2014-08-25 Samsung Electronics Co Ltd 乳酸トランスポーターを高レベルに発現させる乳酸生産微生物、及びそれを利用した乳酸生産方法
KR102144998B1 (ko) 2013-08-30 2020-08-14 삼성전자주식회사 효모에 내산성을 부여하는 폴리펩티드, 그를 코딩하는 폴리뉴클레오티드, 그 양이 증가되어 있는 효모 세포, 상기 효모 세포를 이용한 산물의 생산 방법 및 내산성 효모 세포를 생산하는 방법
EP2873725B1 (en) 2013-11-15 2016-09-07 Samsung Electronics Co., Ltd Genetically Engineered Yeast Cell Producing Lactate Including Acetaldehyde Dehydrogenase, Method of Producing Yeast Cell, and Method of Producing Lactate Using the Same
KR20150064802A (ko) 2013-12-03 2015-06-12 삼성전자주식회사 글리세롤-3-포스페이트 데히드로게나제가 불활성화되고 글리세르알데히드-3-포스페이트 데히드로게나제가 활성화된 효모 세포 및 그를 이용한 락테이트를 생산하는 방법
KR102163724B1 (ko) 2014-02-13 2020-10-08 삼성전자주식회사 내산성을 갖는 효모 세포 및 이의 용도
WO2015194921A1 (ko) 2014-06-20 2015-12-23 한국생명공학연구원 신규한 피키아 쿠드리압즈비 ng7 균주 및 이의 용도
KR102227975B1 (ko) 2014-07-24 2021-03-15 삼성전자주식회사 방사선 감수성 보완 키나아제의 활성이 증가되도록 유전적으로 조작된, 내산성을 갖는 효모 세포 및 그를 이용하여 락테이트를 생산하는 방법
KR101759673B1 (ko) 2015-12-28 2017-07-31 서울대학교산학협력단 생장 속도가 증대된 유전적으로 조작된 효모 세포 및 그를 사용하여 목적 물질을 생산하는 방법
KR102140597B1 (ko) * 2018-04-17 2020-08-03 에스케이이노베이션 주식회사 에탄올 생산 경로가 억제된 내산성 효모 및 이를 이용한 젖산의 제조방법
KR102140596B1 (ko) 2018-04-17 2020-08-04 에스케이이노베이션 주식회사 유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법
KR20200040017A (ko) 2018-10-08 2020-04-17 에스케이이노베이션 주식회사 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
KR20210041903A (ko) 2019-10-08 2021-04-16 에스케이이노베이션 주식회사 락테이트 대사 및 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
KR20210128742A (ko) 2020-04-17 2021-10-27 에스케이이노베이션 주식회사 글리세롤 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
KR20210158676A (ko) 2020-06-24 2021-12-31 에스케이이노베이션 주식회사 젖산 생산능이 증가된 재조합 내산성 효모

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005137306A (ja) * 2003-11-07 2005-06-02 Toyota Central Res & Dev Lab Inc 有機酸存在下におけるプロモーター及びその利用
JP4700395B2 (ja) 2005-04-13 2011-06-15 株式会社豊田中央研究所 酸性条件下で使用するためのプロモーター及びその利用
US20130071893A1 (en) 2009-09-27 2013-03-21 Opx Biotechnologies, Inc. Methods for producing 3-hydroxypropionic acid and other products
KR20160075640A (ko) 2013-10-24 2016-06-29 로베르트 보쉬 게엠베하 입자 필터를 모니터링하기 위한 방법 및 장치
KR20160012561A (ko) * 2014-07-24 2016-02-03 삼성전자주식회사 Erg5의 활성이 증가되도록 유전적으로 조작된, 내산성을 갖는 효모 세포 및 그를 이용하여 락테이트를 생산하는 방법
KR20170025315A (ko) 2014-08-29 2017-03-08 에스케이이노베이션 주식회사 3-hp를 생산할 수 있는 재조합 효모 및 이를 이용한 3-hp의 제조방법
KR20160133308A (ko) * 2015-05-12 2016-11-22 삼성전자주식회사 내산성을 갖는 효모 세포, 상기 효모 세포를 제조하는 방법 및 이의 용도
KR20180015591A (ko) * 2016-08-03 2018-02-13 한국생명공학연구원 Upc2를 발현하는 재조합 균주 및 이의 용도

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
"Biochemistry of microbial itaconic acid production", FRONT MICROBIOL, vol. 4, 2013, pages 23
"Malic Acid Production by Saccharomyces cerevisiae: Engineering of Pyruvate Carboxylation, Oxaloacetate Reduction, and Malate Export", APPL. ENVIRON. MICROBIOL., vol. 74, 2008, pages 2766 - 2777
"Ploidy changes and genome stability in yeast", YEAST, vol. 31, 2014, pages 421 - 430
"Progress of succinic acid production from renewable resources: Metabolic and fermentative strategies", BIORESOURCE TECHNOLOGY, vol. 245, no. B, 2017, pages 1710 - 1717
"The Baker's Yeast Diploid Genome Is Remarkably Stable in Vegetative Growth and Meiosis", PLOS GENET, vol. 6, no. 9, 2010
ABBOTT, D. A. ET AL.: "Metabolic engineering of Saccharomyces cerevisiae for production oi carboxylic acids: current status and challenges", FEMS YEAST RESEARCH, vol. 9, 2009, pages 1123 - 1136, XP002557537, DOI: 10.1111/j.1567-1364.2009.00537.x *
CHEMSUSCHEM, vol. 4, 2011, pages 1068 - 1070
PATRICK HYLAND: "A thesis of Master of Applied Science", 2013, GRADUATE DEPARTMENT OF CHEMICAL ENGINEERING AND APPLIED CHEMISTRY, article "Development of a Platform Strain for Production of Adipic Acid Yields Insights into the Localized Redox Metabolism of S. cerevisiae"
PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5877
See also references of EP3800258A4

Also Published As

Publication number Publication date
US11655478B2 (en) 2023-05-23
KR20190121030A (ko) 2019-10-25
EP3800258A4 (en) 2022-01-26
EP3800258A1 (en) 2021-04-07
WO2019203435A8 (ko) 2020-09-24
JP7304889B2 (ja) 2023-07-07
CN112639104A (zh) 2021-04-09
KR102140596B1 (ko) 2020-08-04
US20210108216A1 (en) 2021-04-15
JP2021520835A (ja) 2021-08-26

Similar Documents

Publication Publication Date Title
WO2019203435A1 (ko) 유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법
WO2015194921A1 (ko) 신규한 피키아 쿠드리압즈비 ng7 균주 및 이의 용도
WO2020027362A1 (ko) 신규 아데닐로석시네이트 신세타아제 및 이를 이용한 퓨린 뉴클레오티드 생산방법
WO2016032279A1 (en) Recombinant Yeast Producing 3-Hydroxypropionic Acid and Method for Producing 3-Hydroxypropionic Acid Using the Same
WO2019117673A2 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
WO2016200207A1 (ko) 젖산을 생산하는 미생물 및 이를 이용한 젖산 제조 방법
KR20180077008A (ko) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2014148743A1 (ko) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법
WO2020075986A2 (ko) 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법
WO2019203436A1 (ko) 에탄올 생산 경로가 억제된 내산성 효모 및 이를 이용한 젖산의 제조방법
WO2011037415A2 (ko) 부탄올 생성능이 증가된 재조합 미생물 및 이를 이용한 부탄올의 제조방법
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2012046924A1 (ko) 아라비노스 대사경로가 도입된 자일리톨 생산균주 및 이를 이용한 자일리톨 생산방법
WO2015163682A1 (ko) 2，3－부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2，3－부탄디올의 생산 방법
WO2013103246A2 (ko) 퀴놀린산을 생산하는 재조합 미생물 및 이를 이용한 퀴놀린산의 생산 방법
WO2019235680A1 (ko) 5'-크산틸산을 생산하는 미생물 및 이를 이용한 5'-크산틸산의 제조방법
WO2020075943A1 (ko) 고활성의 말산 탈수소효소가 도입된 숙신산 생성용 변이 미생물 및 이를 이용한 숙신산 제조방법
WO2018208120A2 (ko) 바이오매스에서 유래한 탄소원의 고성능 대사를 위한 신규 미생물 균주
WO2022098163A1 (ko) 포도당으로부터 3-히드록시프로피온산의 생산능을 가지는 미생물 및 이의 용도
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
US10006008B2 (en) Recombinant microorganism having enhanced ability to produce 2,3-butanediol and method for producing 2,3-butanediol using same
WO2016122107A1 (ko) 2,3-부탄다이올 또는 아세토인 생산능을 갖는 유전적으로 조작된 효모 세포 및 그를 사용하여 2,3-부탄다이올 또는 아세토인을 생산하는 방법
KR102157781B1 (ko) 디카르복시산 생산을 위한 미생물 및 이를 이용한 디카르복시산 생산방법
WO2022163904A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022211212A1 (ko) 부산물 생성이 저감된 2,3-부탄다이올 생산용 재조합 미생물 및 이를 이용한 2,3-부탄다이올 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19787990

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020557290

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019787990

Country of ref document: EP

Effective date: 20201117