WO2016131052A1 - Nucleic acid products and methods of administration thereof - Google Patents
Nucleic acid products and methods of administration thereof Download PDFInfo
- Publication number
- WO2016131052A1 WO2016131052A1 PCT/US2016/018065 US2016018065W WO2016131052A1 WO 2016131052 A1 WO2016131052 A1 WO 2016131052A1 US 2016018065 W US2016018065 W US 2016018065W WO 2016131052 A1 WO2016131052 A1 WO 2016131052A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- rna
- cells
- acne
- seq
- human
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7115—Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/02—Peptides of undefined number of amino acids; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61M—DEVICES FOR INTRODUCING MEDIA INTO, OR ONTO, THE BODY; DEVICES FOR TRANSDUCING BODY MEDIA OR FOR TAKING MEDIA FROM THE BODY; DEVICES FOR PRODUCING OR ENDING SLEEP OR STUPOR
- A61M37/00—Other apparatus for introducing media into the body; Percutany, i.e. introducing medicines into the body by diffusion through the skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61M—DEVICES FOR INTRODUCING MEDIA INTO, OR ONTO, THE BODY; DEVICES FOR TRANSDUCING BODY MEDIA OR FOR TAKING MEDIA FROM THE BODY; DEVICES FOR PRODUCING OR ENDING SLEEP OR STUPOR
- A61M37/00—Other apparatus for introducing media into the body; Percutany, i.e. introducing medicines into the body by diffusion through the skin
- A61M37/0015—Other apparatus for introducing media into the body; Percutany, i.e. introducing medicines into the body by diffusion through the skin by using microneedles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/10—Anti-acne agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/20—Chemical, physico-chemical or functional or structural properties of the composition as a whole
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61M—DEVICES FOR INTRODUCING MEDIA INTO, OR ONTO, THE BODY; DEVICES FOR TRANSDUCING BODY MEDIA OR FOR TAKING MEDIA FROM THE BODY; DEVICES FOR PRODUCING OR ENDING SLEEP OR STUPOR
- A61M37/00—Other apparatus for introducing media into the body; Percutany, i.e. introducing medicines into the body by diffusion through the skin
- A61M2037/0007—Other apparatus for introducing media into the body; Percutany, i.e. introducing medicines into the body by diffusion through the skin having means for enhancing the permeation of substances through the epidermis, e.g. using suction or depression, electric or magnetic fields, sound waves or chemical agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61M—DEVICES FOR INTRODUCING MEDIA INTO, OR ONTO, THE BODY; DEVICES FOR TRANSDUCING BODY MEDIA OR FOR TAKING MEDIA FROM THE BODY; DEVICES FOR PRODUCING OR ENDING SLEEP OR STUPOR
- A61M37/00—Other apparatus for introducing media into the body; Percutany, i.e. introducing medicines into the body by diffusion through the skin
- A61M37/0015—Other apparatus for introducing media into the body; Percutany, i.e. introducing medicines into the body by diffusion through the skin by using microneedles
- A61M2037/0023—Drug applicators using microneedles
Definitions
- the present invention relates, in part, to methods, compositions, and products for producing and delivering nucleic acids to cells, tissues, organs, and patients, methods for expressing proteins in cells, tissues, organs, and patients, and cells, therapeutics, and cosmetics produced using these methods, compositions, and products.
- RNA Ribonucleic acid
- Ribonucleic acid is ubiquitous in both prokaryotic and eukaryotic cells, where it encodes genetic information in the form of messenger RNA, binds and transports amino acids in the form of transfer RNA, assembles amino acids into proteins in the form of ribosomal RNA, and performs numerous other functions including gene expression regulation in the forms of microRNA and long non-coding RNA.
- RNA can be produced synthetically by methods including direct chemical synthesis and in vitro transcription, and can be administered to patients for therapeutic use.
- previously described synthetic RNA molecules are unstable and trigger a potent innate-immune response in human cells.
- methods for efficient non-viral delivery of nucleic acids to patients, organs, tissues, and cells in vivo have not been previously described.
- the many drawbacks of existing synthetic RNA technologies and methods for delivery of nucleic acids make them undesirable for therapeutic or cosmetic use.
- Cells can be reprogrammed by exposing them to specific extracellular cues and/or by ectopic expression of specific proteins, microRNAs, etc. While several reprogramming methods have been previously described, most that rely on ectopic expression require the introduction of exogenous DNA, which can carry mutation risks. DNA- free reprogramming methods based on direct delivery of reprogramming proteins have been reported. However, these methods are too inefficient and unreliable for commercial use. In addition, RNA-based reprogramming methods have been described (see, e.g., Angel. MIT Thesis. 2008. 1-56; Angel ef a/. PLoS ONE. 2010. 5, 107; Warren ef a/. Cell Stem Cell. 2010.
- RNA-based reprogramming methods are slow, unreliable, and inefficient when performed on adult cells, require many transfections (resulting in significant expense and opportunity for error), can reprogram only a limited number of cell types, can reprogram cells to only a limited number of cell types, require the use of immunosuppressants, and require the use of multiple human-derived components, including blood-derived HSA and human fibroblast feeders.
- the many drawbacks of previously disclosed RNA-based reprogramming methods make them undesirable for research, therapeutic or cosmetic use.
- DNA-binding domains that can recognize specific DNA sequences, for example, zinc fingers (ZFs) and transcription activator-like effectors (TALEs). Fusion proteins containing one or more of these DNA-binding domains and the cleavage domain of Fokl endonuclease can be used to create a double-strand break in a desired region of DNA in a cell (see, e.g., US Patent Appl. Pub. No. US 2012/0064620, US Patent Appl. Pub. No. US 2011/0239315, US Patent No. 8,470,973, US Patent Appl. Pub. No. US 2013/0217119, US Patent No. 8,420,782, US Patent Appl. Pub. No.
- the present invention provides, in part, compositions, methods, articles, and devices for delivering nucleic acids to cells, tissues, organs, and patients, methods for inducing cells to express proteins, methods, articles, and devices for producing these compositions, methods, articles, and devices, and compositions and articles, including cells, organisms, cosmetics and therapeutics, produced using these compositions, methods, articles, and devices.
- certain embodiments of the present invention provide small doses of nucleic acids to achieve significant and lasting protein expression in humans.
- the present invention is based on the surprising discovery of safe and effective doses and administration parameters for nucleic acid drugs in human subjects.
- a method for delivering a nucleic acid drug comprising administering an effective dose of a nucleic acid drug to a human subject in need thereof.
- the nucleic acid drug comprises a RNA comprising one or more non-canonical nucleotides (a/k/a "modified RNA").
- the effective dose is an amount sufficient to substantially increase an amount of a protein encoded by the nucleic acid drug in the human subject and/or substantially avoid an immune reaction in a human subject, wherein the immune reaction is optionally mediated by the innate immune system.
- a method for expressing a protein of interest in a population of cells in a mammalian subject comprising administering a non-viral transfection composition comprising an effective dose of a RNA encoding the protein of interest to said cells, where the transfection composition is administered in an amount that allows for expression of said protein in said cells for at least about six hours to about five days without substantial cellular toxicity.
- the RNA contains one or more non-canonical nucleotides that avoid substantial cellular toxicity.
- the effective dose is about 100 ng to about 2000 ng (e.g., about, or no more than about, 100 ng, or 200 ng, or 300 ng, or 400 ng, or 500 ng, or 600 ng, or 700 ng, or 800 ng, or 900 ng, or 1000 ng, or 1 100 ng, or 1200 ng, or 1300 ng, or 1400 ng, or 1500 ng, or 1600 ng, or 1700 ng, or 1800 ng, or 1900 ng, or 2000 ng). In other embodiments, the effective dose is less than about 100 ng.
- the effective dose is about 10 ng to about 100 ng (e.g., about, or no more than about, 10 ng, or 20 ng, or 30 ng, or 40 ng, or 50 ng, or 60 ng, or 70 ng, or 80 ng, or 90 ng, or 100 ng).
- the effective dose is about 1.4 ng/kg to about 30 ng/kg (e.g., about, or no more than about, 1.4 ng/kg, or 2.5 ng/kg, or 5 ng/kg, or 10 ng/kg, or 15 ng/kg, or 20 ng/kg, or 25 ng/kg, or 30 ng/kg. In other embodiments, the effective dose is less than about 1.5 ng/kg.
- the effective dose is about 0.14 ng/kg to about 1.4 ng/kg (e.g., about, or no more than about, 0.14 ng/kg, or 0.25 ng/kg, or 0.5 ng/kg, or 0.75 ng/kg, or 1 ng/kg, or 1.25 ng/kg, or 1.4 ng/kg).
- the effective dose is about 350 ng/cm 2 to about 7000 ng/cm 2 (e.g., about, or no more than about, 350 ng/cm 2 , or 500 ng/cm 2 , or 750 ng/cm 2 , or 1000 ng/cm 2 , or 2000 ng/cm 2 , or 3000 ng/cm 2 , or 4000 ng/cm 2 , or 5000 ng/cm 2 , or 6000 ng/cm 2 , or 7000 ng/cm 2 ). In other embodiments, the effective dose is less than about 350 ng/cm 2 .
- the effective dose is about 35 ng/cm 2 to about 350 ng/cm 2 (e.g., about, or no more than about, 35 ng/cm 2 , or 50 ng/cm 2 , or 75 ng/cm 2 , or 100 ng/cm 2 , or 150 ng/cm 2 , or 200 ng/cm 2 , or 250 ng/cm 2 , or 300 ng/cm 2 , or 350 ng/cm 2 .
- ng/cm 2 e.g., about, or no more than about, 35 ng/cm 2 , or 50 ng/cm 2 , or 75 ng/cm 2 , or 100 ng/cm 2 , or 150 ng/cm 2 , or 200 ng/cm 2 , or 250 ng/cm 2 , or 300 ng/cm 2 , or 350 ng/cm 2 .
- the effective dose is about 0.28 picomoles to about 5.7 picomoles (e.g., about, or no more than about, 0.28 picomoles, or 0.5 picomoles, or 0.75 picomoles, or 1 picomole, or 2 picomoles, or 3 picomoles, or 4 picomoles, or 5 picomoles, or 5.7 picomoles). In other embodiments, the effective dose is less than about 0.28 picomoles.
- the effective dose is about 0.028 picomoles to about 0.28 picomoles (e.g., about, or no more than about, 0.028 picomoles, or 0.05 picomoles, or 0.075 picomoles, or 0.1 picomoles, or 0.15 picomoles, or 0.2 picomoles, or 0.25 picomoles, or 0.28 picomoles).
- the effective dose is about 0.004 picomoles/kg to about 0.082 picomoles/kg (e.g., about, or no more than about, 0.004 picomoles/kg, or 0.01 picomoles/kg, or 0.02 picomoles/kg, or 0.03 picomoles/kg, or 0.04 picomoles/kg, or 0.05 picomoles/kg, or 0.06 picomoles/kg, or 0.07 picomoles/kg, or 0.08 picomoles/kg, or 0.082 picomoles/kg). In other embodiments, the effective dose is less than about 0.004 picomoles/kg.
- the effective dose is about 0.0004 picomoles/kg to about 0.004 picomoles/kg (e.g., about, or no more than about, 0.0004 picomoles/kg, or 0.001 picomoles/kg, or 0.002 picomoles/kg, or 0.003 picomoles/kg, or 0.004 picomoles/kg).
- the effective dose is about 1 picomole/cm 2 to about 20 picomoles/cm 2 (e.g., about, or no more than about, 1 picomole/cm 2 , or 2 picomoles/cm 2 , or 3 picomoles/cm 2 , or 4 picomoles/cm 2 , or 5 picomoles/cm 2 , or 6 picomoles/cm 2 , or 7 picomoles/cm 2 , or 8 picomoles/cm 2 , or 9 picomoles/cm 2 , or 10 picomoles/cm 2 , or 12 picomoles/cm 2 , or 14 picomoles/cm 2 , or 16 picomoles/cm 2 , or 18 picomoles/cm 2 , or 20 picomoles/cm 2 ).
- the effective dose is less than about 1 picomole/cm 2 .
- the effective dose is about 0.1 picomoles/cm 2 to about 1 picomole/cm 2 (e.g., about, or no more than about, 0.1 picomoles/cm 2 , or 0.2 picomoles/cm 2 , or 0.3 picomoles/cm 2 , or 0.4 picomoles/cm 2 , or 0.5 picomoles/cm 2 , or 0.6 picomoles/cm 2 , or 0.7 picomoles/cm 2 , or 0.8 picomoles/cm 2 , or 0.9 picomoles/cm 2 , or 1 picomole/cm 2 ).
- the nucleic acid drug is administered in a pharmaceutically acceptable formulation, including a formulation suitable for one or more of injection (e.g. subcutaneous injection, intradermal injection (including to the dermis or epidermis), subdermal injection, intramuscular injection, intraocular injection, intravitreal injection, intra-articular injection, intracardiac injection, intravenous injection, epidural injection, intrathecal injection, intratumoral injection) and topical administration and/or for administration to the integumentary system (e.g.
- injection e.g. subcutaneous injection, intradermal injection (including to the dermis or epidermis), subdermal injection, intramuscular injection, intraocular injection, intravitreal injection, intra-articular injection, intracardiac injection, intravenous injection, epidural injection, intrathecal injection, intratumoral injection
- topical administration and/or for administration to the integumentary system e.g.
- the nucleic acid drug is formulated with one or more lipids to enhance uptake of the nucleic acid drug by cells, the lipids optionally selected from Table 1.
- the nucleic acid drug is formulated with one or more nanoparticles, optionally lipid or polymeric nanoparticles, to enhance uptake of the nucleic acid drug by cells, to enhance duration of protein expression, or to otherwise enhance the safety and/or efficacy of the nucleic acid drug.
- the nucleic acid drug is administered locally, optionally by one or more of subcutaneous injection, intradermal injection, subdermal injection and intramuscular injection, and the effective dose is administered to a surface area of about 4 mm 2 to about 1000 mm 2 (e.g. about, or no more than about, 4 mm 2 , or 5 mm 2 , or 10 mm 2 , or 25 mm 2 , or 50 mm 2 , or 75 mm 2 , or 100 mm 2 , or 125 mm 2 , or 150 mm 2 , or 200 mm 2 , or 500 mm 2 , or 1000 mm 2 ).
- mm 2 e.g. about, or no more than about, 4 mm 2 , or 5 mm 2 , or 10 mm 2 , or 25 mm 2 , or 50 mm 2 , or 75 mm 2 , or 100 mm 2 , or 125 mm 2 , or 150 mm 2 , or 200 mm 2 , or 500 mm 2 , or 1000
- the nucleic acid drug is administered in a treatment regimen, optionally with an additional agent or adjuvant therapy described herein, and the administration is about weekly to about once every 24 weeks (e.g. about, or not more than about, weekly, or once every 2 weeks, or once every 3 weeks, or once every 4 weeks, or once every 5 weeks, or once every 6 weeks, or once every 7 weeks, or once every 8 weeks, or once every 9 weeks, or once every 9 weeks, or once every 9 weeks, or once every 9 weeks, or once every 9 weeks, or once every 10 weeks, or once every 1 1 weeks, or once every 12 weeks, or once every 13 weeks, or once every 14 weeks, or once every 15 weeks, or once every 20 weeks, or once every 24 weeks).
- once every 24 weeks e.g. about, or not more than about, weekly, or once every 2 weeks, or once every 3 weeks, or once every 4 weeks, or once every 5 weeks, or once every 6 weeks, or once every 7 weeks, or once every 8 weeks, or once every 9 weeks, or once every 9 weeks, or once
- the nucleic acid drug is administered in a treatment regimen, optionally with an additional agent or adjuvant therapy described herein, and the administration is about daily to about weekly (e.g., about, or not more than about, daily, or once every 2 days, or once every 3 days, or once every 4 days, or once every 5 days, or once every 6 days, or weekly).
- the nucleic acid drug comprises RNA comprising one or more non-canonical nucleotides, optionally having one or more substitutions at the 2C and/or 4C and/or 5C positions for a pyrimidine or the 6C and/or 7N and/or 8C positions for a purine.
- the non-canonical nucleotide is one or more of the non-canonical nucleotides described herein, including, for example, 5-hydroxycytidine, 5- methylcytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-methoxycytidine, pseudouridine, 5-hydroxyuridine, 5-hydroxypseudouridine, 5-methyluridine, 5-methylpseudouridine, 5-hydroxymethyluridine, 5- hydroxymethylpseudouridine, 5-carboxyuridine, 5-carboxypseudouridine, 5-formyluridine, 5-formylpseudouridine, 5-methoxyuridine, and 5-methoxypseudouridine.
- RNA comprising one or more non-canonical nucleotides may have one or more of a 5'-UTR comprising a Kozak consensus sequence, a 5'-UTR or 3'-UTR comprising a sequence that increases RNA stability in vivo (e.g. an alpha-globin or beta-globin 5'-UTR or an alpha-globin or beta-globin 3'-UTR), and a 3' poly(A) tail from about 20 nucleotides to about 250 nucleotides in length (e.g.
- aspects of the methods described herein find use in various medical treatments, including, by way of illustration, treating a disease, disorder and/or condition of the integumentary system or altering, modifying and/or changing the integumentary system (e.g. cosmetically).
- kits suitable for use in human therapy comprising the nucleic acid drug described herein in a unit dosage form of about 10 ng to about 2000 ng (e.g. about, or no more than about, 10 ng, or 20 ng, or 50 ng, or 100 ng, or 200 ng, or 300 ng, or 400 ng, or 500 ng, or 600 ng, or 700 ng, or 800 ng, or 900 ng, or 1000 ng, or 1100 ng, or 1200 ng, or 1300 ng, or 1400 ng, or 1500 ng, or 1600 ng, or 1700 ng, or 1800 ng, or 1900 ng, or 2000 ng) and an injection needle.
- 10 ng to about 2000 ng e.g. about, or no more than about, 10 ng, or 20 ng, or 50 ng, or 100 ng, or 200 ng, or 300 ng, or 400 ng, or 500 ng, or 600 ng, or 700 ng, or 800 ng, or 900 ng
- the present invention provides a pharmaceutical formulation comprising the nucleic acid drug described herein and one or more of the vehicles (a/k/a "transfection reagents", e.g., lipids) described herein, the formulation optionally being suitable for one or more of subcutaneous injection, intradermal injection, subdermal injection, intramuscular injection, intraocular injection, intravitreal injection, intra-articular injection, intracardiac injection, intravenous injection, epidural injection, intrathecal injection, intratumoral injection, and topical administration.
- the vehicles a/k/a "transfection reagents", e.g., lipids
- nucleic acid delivery patches are provided.
- devices for delivering nucleic acids using electric fields are provided.
- Other aspects pertain to methods and compositions for delivery of nucleic acids to the skin.
- Still further aspects pertain to methods and compositions for expression of proteins in the skin.
- the invention provides methods and compositions for treating diseases and conditions in humans, including, but not limited to, prophylactic treatments, treatments for rare diseases, including, but not limited to, dermatologic rare diseases, and treatments for use in medical dermatology and aesthetic medicine.
- the invention provides cosmetics comprising nucleic acids.
- Still further aspects relate to methods and compositions for altering pigmentation, for example, for the treatment of pigmentation disorders.
- compositions for enhancing healing including, but not limited to, healing in response to a wound or surgery.
- the compositions of the present invention may alter, modify and/or change the appearance of a member of the integumenary system of a subject such as, but not limited, to skin, hair and nails.
- Such alteration, modification and/or change may be in the context of treatment methods and/or therapeutic uses as described herein including, by way of non-limiting example, dermatological treatments and cosmetics procedures.
- the present invention relates to the targeting of various therapeutic proteins that are not limited to dermatological applications.
- the present compositions and methods find use in methods of treatment that are mediated by the increased expression of, for example, various soluble proteins as illustrated herein.
- the nucleic acid drug encodes and/or increases the expression of one or more of a circulating protein, an extracellular matrix protein, an engineered protein, a gene-editing protein, a protein or peptide hormone, an enzyme, erythropoietin, darbepoetin alfa, NOVEPOETIN, elastin, collagen, an antibody or antibody fragment (e.g., a neutralizing antibody or antibody fragment), an intracellular protein, telomerase reverse transcriptase, a membrane protein, a fusion protein, a receptor, a ligand binding domain, a protein inhibitor, or a biologically active fragment, analogue or variant thereof.
- a circulating protein an extracellular matrix protein
- an engineered protein e.g., a gene-editing protein, a protein or peptide hormone, an enzyme, erythropoietin, darbepoetin alfa, NOVEPOETIN, elastin, collagen, an antibody or antibody fragment (e.
- administration of the nucleic acid drug results in one or more of an increase in hematocrit, an increase in tissue elasticity, an increase in tissue strength, and increase in skin hydration and/or water retention, hair growth, fat reduction, an insertion, deletion or mutation in DNA, conversion of a prodrug to an active drug, a decrease in tumor size and/or number, a decrease in plaque size and/or number, an increase in vascularization, a decrease in vascularization, an increase in visual acuity, a decrease in pain, an increase in cardiac output (e.g., ejection fraction and stroke volume), a decrease in abnormal heart rhythm, a decrease in fibrosis, a decrease in one or more adverse neurological symptoms, conditions, or disorders (e.g., depression, dysregulation of appetite, polyphagia, anorexia, dementia, headache, fatigue, numbness, tremors, and dizziness), a decrease in erectile dysfunction, an increase in vitality, an increase in pulmonary function, an increase in
- RNA molecules with low toxicity and high translation efficiency are provided.
- a cell-culture medium for high-efficiency in vivo transfection, reprogramming, and gene editing of cells is provided.
- Other aspects pertain to methods for producing RNA molecules encoding reprogramming proteins.
- Still further aspects pertain to methods for producing RNA molecules encoding gene-editing proteins.
- the invention provides high-efficiency gene-editing proteins comprising engineered nuclease cleavage domains. In another aspect, the invention provides high-fidelity gene-editing proteins comprising engineered nuclease cleavage domains. Other aspects relate to high-efficiency gene-editing proteins comprising engineered DNA-binding domains. Still further aspects pertain to high-fidelity gene-editing proteins comprising engineered DNA-binding domains. Still further aspects relate to gene-editing proteins comprising engineered repeat sequences. Some aspects relate to methods for altering the DNA sequence of a cell by transfecting the cell with or inducing the cell to express a gene-editing protein. Other aspects relate to methods for altering the DNA sequence of a cell that is present in an in vitro culture.
- Still further aspects relate to methods for altering the DNA sequence of a cell that is present in vivo.
- the invention provides methods for treating cancer comprising administering to a patient a therapeutically effective amount of a gene-editing protein or a nucleic-acid encoding a gene-editing protein.
- the gene-editing protein is capable of altering the DNA sequence of a cancer associated gene.
- the cancer-associated gene is the BIRC5 gene.
- nucleic acids and/or cells relate to therapeutics comprising nucleic acids and/or cells and methods of using therapeutics comprising nucleic acids and/or cells for the treatment of, for example, type 1 diabetes, heart disease, including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, cystic fibrosis, sickle-cell anemia, thalassemia, Fanconi anemia, severe combined immunodeficiency, hereditary sensory neuropathy, xeroderma pigmentosum, Huntington's disease, muscular dystrophy, amyotrophic lateral sclerosis, Alzheimer's disease, cancer, and infectious diseases including hepatitis and HIV/AIDS.
- the nucleic acids comprise RNA.
- the RNA comprises one or more non-canonical nucleotides.
- the nucleic acids are delivered to cells using a virus.
- the virus is a replication-competent virus. In other aspects, the virus is a replication-incompetent virus.
- FIG. 1 depicts primary adult human dermal fibroblasts transfected with RNA encoding green fluorescent protein ("GFP”) and comprising the indicated nucleotides.
- GFP green fluorescent protein
- FIG. 2 depicts the result of a gene-expression analysis of the primary adult human dermal fibroblasts of FIG. 1 using a one-step real-time RT-PCR and primers designed to amplify human interferon beta mRNA. Data were normalized to the untransfected sample ("Neg.”). GAPDH was used as a loading control.
- FIG. 3 depicts the results of a gene-expression analysis of cells transfected with RNA comprising the indicated nucleotides, conducted as in FIG. 2. Data were normalized to the untransfected sample ("Neg.”). GAPDH was used as a loading control.
- FIG. 4 depicts the results of a gene-expression analysis of cells transfected with RNA comprising the indicated nucleotides, conducted as in FIG. 2, and using primers designed to amplify the indicated transcripts. Data were normalized to the untransfected sample ("Neg.”). GAPDH was used as a loading control.
- FIG. 5 depicts the results of a gene-expression analysis of primary human epidermal keratinocytes transfected with RNA encoding NOVEPOETIN, and comprising the indicated nucleotides, conducted as in FIG. 2. Data were normalized to the untransfected sample ("Neg.”). GAPDH was used as a loading control.
- FIG. 6 depicts intradermal injection of a solution comprising RNA encoding GFP into the ventral forearm of a healthy, 33 year-old, 70 kg, male human subject.
- FIG. 7 depicts a region of the ventral forearm of the subject shown in FIG. 6 after treatment with RNA comprising 5-methoxyuridine and encoding GFP (injection sites 1-3) or COL7 (injection site 4). The image was taken immediately following the final injection.
- FIG. 8 depicts the region of FIG. 7, 24 hours after injection.
- FIG. 9 depicts the results of fluorescent imaging of the region of FIG. 7, using the indicated fluorescent channels. The dose at each injection site is also indicated. Images were taken 24 hours after injection.
- FIG. 10 depicts the results of fluorescent imaging of the region of FIG. 7, using the FITC fluorescent channel. The dose at each injection site is indicated. Images were taken 48 hours after injection.
- FIG. 11 depicts the results of quantitative fluorescent imaging of the region of FIG. 7, using the FITC fluorescent channel.
- the horizontal axis indicates time after injection.
- FIG. 12 depicts the results of fluorescent imaging of an independent experiment in which a region of the ventral forearm of as the subject shown in FIG. 6 treated with RNA comprising 5-methoxyuridine and encoding GFP. The image was taken 24 hours after injection.
- FIG. 13 depicts the results of an ELISA designed to detect darbepoetin alfa in culture media of primary human epidermal keratinocytes transfected with RNA comprising the indicated nucleotides and encoding NOVEPOETIN.
- FIG. 14 depicts the results of an ELISA designed to detect darbepoetin alfa in culture media of primary human epidermal keratinocytes transfected with RNA comprising the indicated nucleotides and encoding NOVEPOETIN.
- FIG. 15 depicts the results of an ELISA designed to detect darbepoetin alfa in culture media of primary human epidermal keratinocytes transfected with RNA comprising the indicated nucleotides and encoding NOVEPOETIN.
- FIG. 16 depicts primary human dermal fibroblasts transfected with RNA comprising 5-methoxyuridine and encoding hTERT. Cells were fixed and stained using an antibody targeting hTERT 24 hours after transfection.
- FIG. 17 depicts primary adult human dermal fibroblasts transfected with RNA encoding green fluorescent protein ("GFP”), prepared and stored as indicated.
- GFP green fluorescent protein
- FIG. 18 depicts single administration of NOVECRIT induced a rapid increase and sustained level of NOVEPOETIN in serum.
- the Y axis shows concentration of NOVEPOETIN protein (mU/mL).
- FIG. 19 depicts a single administration of NOVECRIT stimulated erythropoiesis, yielding elevated hematocrit for at least 14 days.
- the left panel shows % hematocrit on the Y axis, while the right panel shows % reticulocytes.
- FIG. 20 depicts a table summarizing TNFa, IL-6, and IFNa cytokine levels in plasma samples collected from a maximum tolerated dose of NOVECRIT in male Sprague Dawley rats study of Example 35.
- FIG. 21 depicts a SURVEYOR assay using the DNA of primary adult human dermal fibroblasts transfected with RNA TALENs targeting the sequence TGAGCAGAAGTGGCTCAGTG (SEQ ID NO:467) and TGGCTGTACAGCTACACCCC (SEQ ID NO: 468), located within the COL7A1 gene.
- the bands present in the +RNA lane indicate editing of a region of the gene that is frequently involved in dystrophic epidermolysis bullosa.
- FIG. 22 depicts a SURVEYOR assay using the DNA of primary adult human dermal fibroblasts transfected with RNA TALENs targeting the sequence TTCCACTCCTGCAGGGCCCC (SEQ ID NO:469) and TCGCCCTTCAGCCCGCGTTC (SEQ ID NO:470), located within the COL7A1 gene.
- the bands present in the +RNA lane indicate editing of a region of the gene that is frequently involved in dystrophic epidermolysis bullosa.
- FIG. 23 shows the immunogenicity of various synthetic RNA constructs in the context of a gene-editing (i.e. unmodified nucleotides "A,G,U,C”; pseudouridine only “psU”; 5-methylcytidine only “5mC”; both pseudouridine and 5-methylcytidine “psU+5mC”; and a negative control "neg”).
- a gene-editing i.e. unmodified nucleotides "A,G,U,C”; pseudouridine only “psU”; 5-methylcytidine only “5mC”; both pseudouridine and 5-methylcytidine “psU+5mC”; and a negative control "neg”).
- FIG. 24 shows the gene-editing activity in cells transfected with various synthetic RNA constructs (; ' .e. unmodified nucleotides "A,G,U,C”; psuedouridine only “psU”; 5-methylcytidine only “5mC”; both psuedouridine and 5- methylcytidine “psU+5mC”; and a negative control "neg").
- FIG. 25 depicts gene editing of the COL7A1 gene in primary human epidermal keratinocytes transfected with RNA encoding TALENs and a single-stranded DNA repair template ("RT") of the indicated length.
- RT single-stranded DNA repair template
- * indicates successful gene editing.
- FIG. 26 depicts gene editing of the COL7A1 gene in primary human epidermal keratinocytes transfected with RNA encoding TALENs and an 80 nt single-stranded DNA repair template ("RT") at the indicated ratios of RNA to repair template.
- RT RNA encoding TALENs
- 80 nt single-stranded DNA repair template RT
- FIG. 27 depicts gene correction of the COL7A1 gene in primary human epidermal keratinocytes transfected with RNA encoding TALENs and a single-stranded DNA repair template ("RT") of the indicated length.
- RT DNA repair template
- * indicates successful gene correction.
- FIG. 28 depicts gene correction of the COL7A1 gene in primary human epidermal keratinocytes transfected with RNA encoding TALENs and an 80 nt single-stranded DNA repair template ("RT") at the indicated ratios of RNA to repair template.
- RT RNA encoding TALENs
- 80 nt single-stranded DNA repair template RT
- FIG. 29 depicts gene editing ("T7E1") and correction ("Digestion") of the COL7A1 gene in primary human epidermal keratinocytes transfected with RNA encoding TALENs and an 80 nt single-stranded DNA repair template ("RT").
- RT RNA encoding TALENs
- RT 80 nt single-stranded DNA repair template
- FIG. 30 depicts the amount of BMP7 protein secreted by primary human dermal fibroblasts and primary human epidermal keratinocytes transfected with RNA encoding the indicated BMP7 variant, measured by ELISA.
- Asterisks (“*") indicate saturation of the ELISA assay.
- FIG. 31 depicts the amount of parathyroid hormone secreted by primary human epidermal keratinocytes transfected with RNA encoding PTH, measured by ELISA.
- FIG. 32 demonstrates that repeated administration of NOVECRIT stimulated erythropoiesis, yielding elevated hematocrit for at least 14 days.
- the order of histograms from left to right is: Group 1 , Group 2, Group 3, Group 4, and Group 5.
- FIG. 33 provides an illustrative experimental design for studying the effects of RNAs encoding BMP7 variants for the prevention and treatment of diabetic nephropathy.
- FIG. 35 depicts the urine volume, urine albumin, and urine creatinine levels in rats treated with RNAs encoding BMP7 variants as described in Example 42.
- the order of histograms from left to right is: urine volume, urine creatinine, and urine albumin.
- FIG. 36 depicts the effect of RNAs encoding BMP7 variants in treating diabetic nephropathy as described in Example 42.
- the order of histograms from left to right is: Group 6 - vehicle and Group 7 - FTB-2 (BMP7 variant A).
- FIG. 37 panels A-l, depict the results of gene-expression analysis of human epidermal keratinocytes transfected with RNA encoding BDNF, BMP-2, BMP-6, I L-2, IL-6, IL-15, IL-22, LIF or FGF-21.
- FIG. 38 depicts the results of gene-expression analysis of human epidermal keratinocytes transfected with RNA encoding IL-15 or IL-15 and IL-15RA.
- FIG. 39 depicts the serum levels of FGF21 , IL15, IL6, IL22, and Novepoietin following a single intradermal injection of various RNAs encoding these proteins as described in Example 45. Three rats were analyzed for each RNA tested.
- the present invention is based, in part, on the discovery of a safe and effective dosing strategy for nucleic acid drugs, including RNA, such as RNA comprising non-canonical (or "modified") nucleotides, in humans.
- RNA such as RNA comprising non-canonical (or "modified") nucleotides
- the inventors believe this to be the first report of safe and effective dosing of RNA molecules, including those comprising non-canonical nucleotides, in humans.
- very large doses of RNA molecules are needed for mammalian dosing, and minimal therapeutic effect is achieved despite high dosing (see, e.g. US Patent Publication No. 2013/0245103)
- the present inventors have surprisingly managed to dose synthetic RNA in a human and achieve significant target protein expression with minimal immunological or other side effects.
- the present invention provides improved doses, formulations, administration and methods of use of nucleic acid drugs, which include RNA, which may contain non-canonical nucleotides (e.g. a residue other than adenine, guanine, thymine, uracil, and cytosine or the standard nucleoside, nucleotide, deoxynucleoside or deoxynucleotide derivatives thereof).
- RNA comprising non- canonical nucleotides leads to the expression of a protein encoded by the RNA, the protein often being one of therapeutic benefit (sometimes called the "target" or "protein of interest"). Further, this expression of therapeutic protein is achieved with minimal or negligible toxicity.
- nucleic acid drugs include a dsDNA molecule, a ssDNA molecule, a RNA molecule, a dsRNA molecule, a ssRNA molecule, a plasmid, an oligonucleotide, a synthetic RNA molecule, a miRNA molecule, an mRNA molecule, and an siRNA molecule.
- the RNA comprises non-canonical nucleotides.
- a method for delivering a nucleic acid drug comprising administering an effective dose of a nucleic acid drug to a human subject in need thereof, wherein the nucleic acid drug comprises a synthetic RNA.
- the effective dose is an amount sufficient to substantially increase an amount of a protein encoded by the nucleic acid drug in the human subject.
- the nucleic acid drug is a synthetic RNA comprising one or more modified nucleotides
- the nucleic acid drug may result in higher protein expression than levels obtainable with a nucleic acid drug that does not comprise one or more modified nucleotides (e.g., RNA comprising the canonical nucleotides A, G, U, and C).
- the nucleic acid drug results in about a 2-fold, or about a 3-fold, or about a 4-fold, or about a 5-fold, or about a 10-fold, or about a 15-fold, or about a 20-fold, or about a 25-fold, or about a 30-fold, or about a 35-fold, or about a 40-fold, or about a 45-fold, or about a 50-fold, or about a 100-fold increase in protein expression as compared to levels obtainable with a nucleic acid drug that does not comprise one or more modified nucleotides.
- the nucleic acid drug provides a sustained therapeutic effect that is optionally mediated by a sustained expression of target protein.
- the therapeutic effect is present for over about 1 day, or over about 2 days, or over about 3 days, or over about 4 days, or over about 5 days, or over about 6 days, or over about 7 days, or over about 8 days, or over about 9 days, or over about 10 days, or over about 14 days after administration.
- this sustained effect obviates the need for, or reduces the amount of, maintenance doses.
- the nucleic acid drug provides a sustained target protein level.
- the target protein is present (e.g. in measurable amounts, e.g.
- this sustained effect obviates the need for, or reduces the amount of, maintenance doses.
- the nucleic acid drug provides therapeutic action without sustained presence of the nucleic acid drug itself.
- the nucleic acid drug is rapidly metabolized, for instance, within about 6 hours, or about 12 hours, or about 18 hours, or about 24 hours, or about 2 days, or about 3 days, or about 4 days, or about 5 days, or about 1 week from administration.
- the effective dose is an amount that substantially avoids cell toxicity in vivo. In various embodiments, the effective dose is an amount that substantially avoids an immune reaction in a human subject.
- the immune reaction may be an immune response mediated by the innate immune system. Immune response can be monitored using markers known in the art (e.g. cytokines, interferons, TLRs).
- the effective dose obviates the need for treatment of the human subject with immune suppressants agents (e.g. B18R) used to moderate the residual toxicity. Accordingly, in some embodiments, the present methods allow for dosing that provides increased protein expression and reduces toxicity.
- the immune response is reduced by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, about 99.9%, or greater than about 99.9% as compared to the immune response induced by a corresponding unmodified nucleic acid.
- upregulation of one or more immune response markers is reduced by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, about 99.9%, or greater than about 99.9% as compared to the upregulation of the one or more immune response markers induced by a corresponding unmodified nucleic acid.
- the immune response marker comprises an mRNA or protein product of an interferon gene, including an interferon alpha gene, IFNB1 , TLR3, RARRES3, EIF2AK2, STAT1 , STAT2, IFIT1 , IFIT2, IFIT3, IFIT5, OAS1 , OAS2, OAS3, OASL, ISG20 or a fragment, variant, analogue, or family-member thereof.
- an interferon gene including an interferon alpha gene, IFNB1 , TLR3, RARRES3, EIF2AK2, STAT1 , STAT2, IFIT1 , IFIT2, IFIT3, IFIT5, OAS1 , OAS2, OAS3, OASL, ISG20 or a fragment, variant, analogue, or family-member thereof.
- the immune response marker comprises an mRNA or protein product of an TNF gene, including an TNF alpha gene, TNFRSF1A; TNFRSF1 B; LTBR; TNFRSF4; CD40; FAS; TNFRSF6B; CD27; TNFRSF8; TNFRSF9; TNFRSF10A; TNFRSF10B; TNFRSF10C; TNFRSF10D; TNFRSF1 1A; TNFRSF1 1 B; TNFRSF12A; TNFRSF13B; TNFRSF13C; TNFRSF14; NGFR; TNFRSF17; TNFRSF18; TNFRSF19; TNFRSF21 ; TNFRSF25; and EDA2R or a fragment, variant, analogue, or family-member thereof.
- TNF alpha gene TNFRSF1A; TNFRSF1 B; LTBR; TNFRSF4; CD40; FAS; TNFRSF6B; CD27;
- the immune response marker comprises an mRNA or protein product of an interleukin gene, including an IL-6 gene, IL-1 ; IL- 2; IL-3; IL-4; IL-5; IL-6; IL-7; IL-8 or CXCL8; IL-9; IL-10; IL-1 1 ; IL-12; IL-13; IL-14; I L-15; IL-16; IL-17; IL-18; IL-19; IL-20; IL-21 ; IL-22; IL-23; IL-24; IL-25; I L-26; IL-27; I L-28; IL-29; IL-30; IL-31 ; I L-32; IL-33; IL-35; I L-36 or a fragment, variant, analogue, or family-member thereof.
- an interleukin gene including an IL-6 gene, IL-1 ; IL- 2; IL-3; IL-4; IL-5; IL-6; IL-7; IL-8 or C
- cell death is about 10%, about 25%, about 50%, about 75%, about 85%, about 90%, about 95%, or over about 95% less than the cell death observed with a corresponding unmodified nucleic acid. Moreover, cell death may affect fewer than about 50%, about 40%, about 30%, about 20%, about 10%, about 5%, about 1 %, about 0.1 %, about 0.01 % or fewer than about 0.01 % of cells contacted with the modified nucleic acids.
- a method for expressing a protein of interest in a population of cells in a mammalian subject comprising administering a non-viral transfection composition comprising an effective dose of a RNA encoding the protein of interest to said cells, the RNA containing one or more non-canonical nucleotides that avoid substantial cellular toxicity, where the transfection composition is administered in an amount that allows for expression of said protein in said cells for at least about five days (e.g. about 5, or about 6, or about 7, about 8, or about 9, or about 10, or about 14 days) without substantial cellular toxicity.
- a method for expressing a protein of interest in a population of cells in a mammalian subject comprising administering a non-viral transfection composition comprising an effective dose of a RNA encoding the protein of interest to said cells, the RNA containing one or more non-canonical nucleotides that avoid substantial cellular toxicity, where the transfection composition is administered in an amount that allows for expression of said protein in said cells for at least about six hours (e.g. about six hours, or about 12 hours, or about 1 day, or about 2 days, or about 3 days, or about 4 days, or about 5 days) without substantial cellular toxicity.
- the effective dose of the nucleic acid drug, including synthetic RNA is about 100 ng to about 2000 ng, or about 200 ng to about 1900 ng, or about 300 ng to about 1800 ng, or about 400 ng to about 1700 ng, or about 500 ng to about 1600 ng, or about 600 ng to about 1500 ng, or about 700 ng to about 1400 ng, or about 800 ng to about 1300 ng, or about 900 ng to about 1200 ng, or about 1000 ng to about 1 100 ng, or about 500 ng to about 2000 ng, or about 500 ng to about 1500 ng, or about 500 ng to about 1000 ng, or about 1000 ng to about 1500 ng, or about 1000 ng to about 2000 ng, or about 1500 ng to about 2000 ng, or about 100 ng to about 500 ng, or about 200 ng to about 400 ng, or about 10 ng to about 100 ng, or about 20 ng to about 90 ng, or about 30 ng to about 80
- the effective dose of the nucleic acid drug, including synthetic RNA is no more than about 50 ng, or about 100 ng, or about 200 ng, or about 300 ng, or about 400 ng, or about 500 ng, or about 600 ng, or about 700 ng, or about 800 ng, or about 900 ng, or about 1000 ng, or about 1 100 ng, or about 1200 ng, or about 1300 ng, or about 1400 ng, or about 1500 ng, or about 1600 ng, or about 1700 ng, or about 1800 ng, or about 1900 ng, or about 2000 ng.
- the effective dose of the nucleic acid drug, including synthetic RNA is about 50 ng, or about 100 ng, or about 200 ng, or about 300 ng, or about 400 ng, or about 500 ng, or about 600 ng, or about 700 ng, or about 800 ng, or about 900 ng, or about 1000 ng, or about 1100 ng, or about 1200 ng, or about 1300 ng, or about 1400 ng, or about 1500 ng, or about 1600 ng, or about 1700 ng, or about 1800 ng, or about 1900 ng, or about 2000 ng.
- the effective dose of the nucleic acid drug, including synthetic RNA is about 0.028 pmol, or about 0.05 pmol, or about 0.1 pmol, or about 0.2 pmol, or about 0.3 pmol, or about 0.4 pmol, or about 0.5 pmol, or about 0.6 pmol, or about 0.7 pmol, or about 0.8 pmol, or about 0.9 pmol, or about 1.0 pmol, or about 1.2 pmol, or about 1.4 pmol, or about 1.6 pmol, or about 1.8 pmol, or about 2.0 pmol, or about 2.2 pmol, or about 2.4 pmol, or about 2.6 pmol, or about 2.8 pmol, or about 3.0 pmol, or about 3.2 pmol, or about 3.4 pmol, or about 3.6 pmol, or about 3.8 pmol, or about 4.0 pmol, or about 4.2 pmol, or about 4.4 pmol, or about
- the nucleic acid drug including synthetic RNA, is administered at a concentration of about 0.1 nM, or about 0.25 nM, or about 0.5 nM, or about 0.75 nM, or about 1 nM, or about 2.5 nM, or about 5 nM, or about 7.5 nM, or about 10 nM, or about 20 nM, or about 30 nM, or about 40 nM, or about 50 nM, or about 60 nM, or about 70 nM, or about 80 nM, or about 90 nM, or about 100 nM, or about 1 10 nM, or about 120 nM, or about 150 nM, or about 175 nM, or about 200 nM.
- the effective dose of the nucleic acid drug is about 350 ng/cm 2 , or about 500 ng/cm 2 , or about 750 ng/cm 2 , or about 1000 ng/cm 2 , or about 2000 ng/cm 2 , or about 3000 ng/cm 2 , or about 4000 ng/cm 2 , or about 5000 ng/cm 2 , or about 6000 ng/cm 2 , or about 7000 ng/cm 2 . In other embodiments, the effective dose is less than about 350 ng/cm 2 .
- the effective dose is about 35 ng/cm 2 , or about 50 ng/cm 2 , or about 75 ng/cm 2 , or about 100 ng/cm 2 , or about 150 ng/cm 2 , or about 200 ng/cm 2 , or about 250 ng/cm 2 , or about 300 ng/cm 2 , or about 350 ng/cm 2 .
- the effective dose of the nucleic acid drug is about 35 ng/cm 2 to about 7000 ng/cm 2 , or about 50 ng/cm 2 to about 5000 ng/cm 2 , or about 100 ng/cm 2 to about 3000 ng/cm 2 , or about 500 ng/cm 2 to about 2000 ng/cm 2 , or about 750 ng/cm 2 to about 1500 ng/cm 2 , or about 800 ng/cm 2 to about 1200 ng/cm 2 , or about 900 ng/cm 2 to about 1100 ng/cm 2 .
- the effective dose of the nucleic acid drug is about 1 picomole/cm 2 , or about 2 picomoles/cm 2 , or about 3 picomoles/cm 2 , or about 4 picomoles/cm 2 , or about 5 picomoles/cm 2 , or about 6 picomoles/cm 2 , or about 7 picomoles/cm 2 , or about 8 picomoles/cm 2 , or about 9 picomoles/cm 2 , or about 10 picomoles/cm 2 , or about 12 picomoles/cm 2 , or about 14 picomoles/cm 2 , or about 16 picomoles/cm 2 , or about 18 picomoles/cm 2 , or about 20 picomoles/cm 2 .
- the effective dose is less than about 1 picomole/cm 2 .
- the effective dose is about 0.1 picomoles/cm 2 , or about 0.2 picomoles/cm 2 , or about 0.3 picomoles/cm 2 , or about 0.4 picomoles/cm 2 , or about 0.5 picomoles/cm 2 , or about 0.6 picomoles/cm 2 , or about 0.7 picomoles/cm 2 , or about 0.8 picomoles/cm 2 , or about 0.9 picomoles/cm 2 , or about 1 picomole/cm 2 .
- the effective dose of the nucleic acid drug is about 0.1 picomoles/cm 2 to about 20 picomoles/cm 2 , or about 0.2 picomoles/cm 2 to about 15 picomoles/cm 2 , or about 0.5 picomoles/cm 2 to about 10 picomoles/cm 2 , or about 0.8 picomoles/cm 2 to about 8 picomoles/cm 2 , or about 1 picomole/cm 2 to about 5 picomoles/cm 2 , or about 2 picomoles/cm 2 to about 4 picomoles/cm 2 .
- the nucleic acid drug, including synthetic RNA is administered in a pharmaceutically acceptable formulation.
- the nucleic acid drug, including synthetic RNA is formulated for one or more of injection and topical administration.
- the nucleic acid drug, including synthetic RNA may be formulated for injection to a tissue of interest, e.g. a disease site (by way of non-limiting example, a tumor).
- injection includes delivery via a patch.
- the delivery is mediated by electrical stimulation.
- the nucleic acid drug is formulated for administration to one or more of the epidermis (optionally selected from the stratum corneum, stratum lucidum, stratum granulosum, stratum spinosum, and stratum germinativum), basement membrane, dermis (optionally selected from the papillary region and the reticular region), subcutis, conjunctiva cornea, sclera, iris, lens, corneal limbus, optic nerve, choroid, ciliary body, anterior segment, anterior chamber, and retina.
- the epidermis optionally selected from the stratum corneum, stratum lucidum, stratum granulosum, stratum spinosum, and stratum germinativum
- basement membrane optionally selected from the papillary region and the reticular region
- dermis optionally selected from the papillary region and the reticular region
- subcutis conjunctiva cornea, sclera, iris, lens, corneal limbus, optic nerve, choroid
- the nucleic acid drug, including synthetic RNA is formulated for one or more of subcutaneous injection, intradermal injection, subdermal injection, intramuscular injection, intraocular injection, intravitreal injection, intra-articular injection, intracardiac injection, intravenous injection, epidural injection, intrathecal injection, intratumoral injection, and topical administration.
- the nucleic acid drug, including synthetic RNA is formulated for intradermal (ID) injection to one or more of the dermis or epidermis.
- the nucleic acid drug, including synthetic RNA is administered in a manner such that it effects one or more of keratinocytes and fibroblasts (e.g. causes these cells to express one or more therapeutic proteins).
- the present invention provides various formulations as described herein.
- the formulations described herein find use in the various delivery and/or treatment methods of the present invention.
- formulations can comprise a vesicle, for instance, a liposome (see Langer, 1990, Science 249: 1527-1533; Treat ef a/., in Liposomes in the Therapy of infectious Disease and Cancer, Lopez- Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989).
- the formulation comprises an aqueous suspension of liposomes.
- Illustrative liposome components are set forth in Table 1 , and are given by way of example, and not by way of limitation. In various embodiments, one or more, or two or more, or three or more, or four or more, or five or more of the lipids of Table 1 are combined in a formulation.
- the liposomes include LIPOFECTAMINE 3000.
- the liposomes include one or more lipids described in US Patent Nos. 4,897,355 or 7,479,573 or in International Patent Publication No. WO/2015/089487, or in Feigner, P. L. et al. (1987) Proc. Natl. Acad. Sci. USA 84:7413-7417, the entire contents of each is incorporated by reference in their entireties).
- the liposome comprises N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA). In some embodiments, the liposome comprises dioleoylphosphatidylethanolamine (DOPE).
- DOPE dioleoylphosphatidylethanolamine
- the liposomes include one or more polyethylene glycol (PEG) chains, optionally selected from PEG200, PEG300, PEG400, PEG600, PEG800, PEG1000, PEG1500, PEG2000, PEG3000, and PEG4000.
- PEG polyethylene glycol
- the PEG is PEG2000.
- the liposomes include 1 ,2- distearoyl-sn-glycero-3-phosphoethanolamine (DSPE) or a derivative thereof.
- DSPE distearoyl-sn-glycero-3-phosphoethanolamine
- the formulation comprises one or more of N-(carbonyl-ethoxypolyethylene glycol 2000)- 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine (MPEG2000-DSPE), fully hydrogenated phosphatidylcholine, cholesterol, LIPOFECTAMINE 3000, a cationic lipid, a polycationic lipid, and 1 ,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[folate(polyethylene glycol)-5000] (FA-MPEG5000-DSPE).
- MPEG2000-DSPE N-(carbonyl-ethoxypolyethylene glycol 2000)- 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine
- the formulation comprises about 3.2 mg/mL N-(carbonyl-ethoxypolyethylene glycol 2000)- 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine (MPEG2000-DSPE), about 9.6 mg/mL fully hydrogenated phosphatidylcholine, about 3.2 mg/mL cholesterol, about 2 mg/mL ammonium sulfate, and histidine as a buffer, with about 0.27 mg/mL 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[folate(polyethylene glycol)-5000] (FA-MPEG5000-DSPE) added to the lipid mixture.
- MPEG2000-DSPE N-(carbonyl-ethoxypolyethylene glycol 2000)- 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine
- the nucleic acids are complexed by combining 1 ⁇ of LIPOFECTAMINE 3000 per about 1 ⁇ g of nucleic acid and incubating at room temperature for at least about 5 minutes.
- the LIPOFECTAMINE 3000 is a solution comprising a lipid at a concentration of about 1 mg/mL.
- nucleic acids are encapsulated by combining about 10 ⁇ of the liposome formulation per about of nucleic acid and incubating at room temperature for about 5 minutes.
- the formulation comprises one or more nanoparticles.
- the nanoparticle is a polymeric nanoparticle.
- the formulation comprises one or more of a diblock copolymer, a triblock copolymer, a tetrablock copolymer, and a multiblock copolymer.
- the formulation comprises one or more of polymeric nanoparticles comprising a polyethylene glycol (PEG)-modified polylactic acid (PLA) diblock copolymer (PLA-PEG) and PEG-polypropylene glycol-PEG- modified PLA-tetrablock copolymer (PLA-PEG-PPG-PEG).
- the formulation comprises one or more lipids that are described in WO/2000/027795, the entire contents of which are hereby incorporated by reference.
- the therapeutic comprises one or more ligands.
- the therapeutic comprises at least one of: androgen, CD30 (TNFRSF8), a cell-penetrating peptide, CXCR, estrogen, epidermal growth factor, EGFR, HER2, folate, insulin, insulin-like growth factor-l, interleukin-13, integrin, progesterone, stromal-derived-factor-1 , thrombin, vitamin D, and transferrin or a biologically active fragment or variant thereof.
- compositions of the present invention may include classic pharmaceutical preparations. Administration of these compositions according to the present invention may be via any common route so long as the target tissue is available via that route. This includes oral, nasal, or buccal. Alternatively, administration may be by intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection, or by direct injection into diseased, e.g. cancer, tissue. The agents disclosed herein may also be administered by catheter systems. Such compositions would normally be administered as pharmaceutically acceptable compositions as described herein. Administration of the compositions described herein may be, for example, by injection, topical administration, ophthalmic administration and intranasal administration. The injection, in some embodiments, may be linked to an electrical force (e.g.
- the topical administration may be, but is not limited to, a cream, lotion, ointment, gel, spray, solution and the like.
- the topical administration may further include a penetration enhancer such as, but not limited to, surfactants, fatty acids, bile salts, chelating agents, non-chelating non- surfactants, polyoxyethyl ene-9-l au ryl ether, polyoxyethylene-20-cetyl ether, fatty acids and/or salts in combination with bile acids and/or salts, sodium salt in combination with lauric acid, capric acid and UDCA, and the like.
- the topical administration may also include a fragrance, a colorant, a sunscreen, an antibacterial and/or a moisturizer.
- compositions described herein may be administered to at least one site such as, but not limited to, forehead, scalp, hair follicles, hair, upper eyelids, lower eyelids, eyebrows, eyelashes, infraorbital area, periorbital areas, temple, nose, nose bridge, cheeks, tongue, nasolabial folds, lips, periobicular areas, jaw line, ears, neck, breast, forearm, upper arm, palm, hand, finger, nails, back, abdomen, sides, buttocks, thigh, calf, feet, toes and the like.
- site such as, but not limited to, forehead, scalp, hair follicles, hair, upper eyelids, lower eyelids, eyebrows, eyelashes, infraorbital area, periorbital areas, temple, nose, nose bridge, cheeks, tongue, nasolabial folds, lips, periobicular areas, jaw line, ears, neck, breast, forearm, upper arm, palm, hand, finger,
- Routes of administration include, for example: intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intranasal, intracerebral, intravaginal, transdermal, rectally, by inhalation, or topically, particularly to the ears, nose, eyes, or skin.
- the administering is effected orally or by parenteral injection.
- solutions may be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective, as described herein.
- the formulations may easily be administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like.
- aqueous solution for example, the solution generally is suitably buffered and the liquid diluent first rendered isotonic with, for example, sufficient saline or glucose.
- aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
- sterile aqueous media are employed as is known to those of skill in the art, particularly in light of the present disclosure.
- the nucleic acid drug including RNA comprising one or more non-canonical nucleotides, and/or formulations comprising the same, is administered locally, optionally by one or more of subcutaneous injection, intradermal injection, subdermal injection and intramuscular injection, and the effective dose is administered to a surface area of about 4 mm 2 to about 150 mm 2 (e.g. about, or no more than about, 4 mm 2 , or about 5 mm 2 , or about 6mm 2 , or about 7 mm 2 , or about 8 mm 2 , or about 10 mm 2 , or about 20 mm 2 , or about 50 mm 2 , or about 100 mm 2 , or about 150 mm 2 ).
- the nucleic acid drug including RNA comprising one or more non-canonical nucleotides, and/or formulations comprising the same, is administered locally, optionally by one or more of subcutaneous injection, intradermal injection, subdermal injection and intramuscular injection, and the effective dose administered to a surface area of no more than about 4 mm 2 , or about 5 mm 2 , or about 6mm 2 , or about 7 mm 2 , or about 8 mm 2 , or about 10 mm 2 , or about 20 mm 2 , or about 50 mm 2 , or about 100 mm 2 , or about 150 mm 2 .
- the nucleic acid drug including RNA comprising one or more non-canonical nucleotides, and/or formulations comprising the same, is administered locally, optionally by one or more of subcutaneous injection, intradermal injection, subdermal injection and intramuscular injection, and the effective dose administered to a surface area of about 4 mm 2 , or about 5 mm 2 , or about 6 mm 2 , or about 7 mm 2 , or about 8 mm 2 , or about 10 mm 2 , or about 20 mm 2 , or about 50 mm 2 , or about 100 mm 2 , or about 150 mm 2 .
- the nucleic acid drug including RNA comprising one or more non-canonical nucleotides, and/or formulations comprising the same, is administered locally, optionally by one or more of subcutaneous injection, intradermal injection, subdermal injection and intramuscular injection, and the effective dose (weight RNA / surface area of injection) is about 35 ng/cm 2 to about 7000 ng/cm 2 .
- the nucleic acid drug including RNA comprising one or more non-canonical nucleotides, and/or formulations comprising the same, is administered locally, optionally by one or more of subcutaneous injection, intradermal injection, subdermal injection and intramuscular injection, and the effective dose (weight RNA / surface area of injection) is no more than about 35 ng/cm 2 , or about 50 ng/cm 2 , or about 75 ng/cm 2 , or about 100 ng/cm 2 , or about 125 ng/cm 2 , or about 150 ng/cm 2 , or about 175 ng/cm 2 , or about 200 ng/cm 2 , or about 225 ng/cm 2 , or about 250 ng/cm 2 , or about 500 ng/cm 2 , or about 1000 ng/cm 2 , or about 2000 ng/cm 2 , or about 5000 ng/cm 2 , or about 7000 ng/c
- the nucleic acid drug including RNA comprising one or more non- canonical nucleotides, and/or formulations comprising the same, is administered locally, optionally by one or more of subcutaneous injection, intradermal injection, subdermal injection and intramuscular injection, and the effective dose (weight RNA / surface area of injection) is about 35 ng/cm 2 , or about 50 ng/cm 2 , or about 75 ng/cm 2 , or about 100 ng/cm 2 , or about 125 ng/cm 2 , or about 150 ng/cm 2 , or about 175 ng/cm 2 , or about 200 ng/cm 2 , or about 225 ng/cm 2 , or about 250 ng/cm 2 , or about 500 ng/cm 2 , or about 1000 ng/cm 2 , or about 2000 ng/cm 2 , or about 5000 ng/cm 2 , or about 7000 ng/cm 2
- compositions may additionally comprise delivery reagents (a.k.a. "transfection reagents", a.k.a. “vehicles", a.k.a. “delivery vehicles”) and/or excipients.
- delivery reagents a.k.a. "transfection reagents", a.k.a. “vehicles", a.k.a. “delivery vehicles”
- excipients a.k.a. "delivery vehicles
- Delivery reagents a.k.a. "transfection reagents”
- excipients a.k.a. "vehicles
- excipients a.k.a. "delivery vehicles
- Pharmaceutically acceptable delivery reagents, excipients, and methods of preparation and use thereof, including methods for preparing and administering pharmaceutical preparations to patients (a.k.a. "subjects) are well known in the art, and are set forth in numerous publications, including, for example, in US Patent Appl
- compositions can be in the form of pharmaceutically acceptable salts.
- pharmaceutically acceptable salts include those listed in, for example, J. Pharma. Sci. 66, 2-19 (1977) and The Handbook of Pharmaceutical Salts; Properties, Selection, and Use. P. H. Stahl and C. G. Wermuth (eds.), Verlag, Zurich (Switzerland) 2002, which are hereby incorporated by reference in their entirety.
- Non-limiting examples of pharmaceutically acceptable salts include: sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, camphorsulfonate, pamoate, phenylacetate, trifluoroacetate, acrylate, chlorobenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, methylbenzoate,
- the present pharmaceutical compositions can comprises excipients, including liquids such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
- the pharmaceutical excipients can be, for example, saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea and the like.
- auxiliary, stabilizing, thickening, lubricating, and coloring agents can be used.
- the pharmaceutically acceptable excipients are sterile when administered to a subject.
- Suitable pharmaceutical excipients also include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. Any agent described herein, if desired, can also comprise minor amounts of wetting or emulsifying agents, or pH buffering agents.
- Dosage forms suitable for parenteral administration include, for example, solutions, suspensions, dispersions, emulsions, and the like. They may also be manufactured in the form of sterile solid compositions (e.g. lyophilized composition), which can be dissolved or suspended in sterile injectable medium immediately before use. They may contain, for example, suspending or dispersing agents known in the art.
- the formulations described herein may comprise albumin and a nucleic acid molecule.
- the invention relates to a cosmetic composition.
- the cosmetic composition comprises albumin.
- the albumin is treated with an ion-exchange resin or charcoal.
- the cosmetic composition comprises a nucleic acid molecule.
- the nucleic acid molecule encodes a member of the group: elastin, collagen, tyrosinase, melanocortin 1 receptor, keratin, filaggren, an antibody, and hyaluronan synthase or a biologically active fragment, variant, analogue or family member thereof.
- the present invention provides treatment regimens.
- the inventors have discovered that the doses and administration described herein can produce a substantial protein expression effect quickly (e.g. in about 6, or about 12, or about 24, or about 36, or about 48 hours). Further, these effects can be sustained for about 7 days, or longer.
- the present methods provide for administration of a nucleic acid drug, including RNA comprising one or more non-canonical nucleotides, about weekly to about once every 20 weeks.
- the nucleic acid drug, including RNA comprising one or more non-canonical nucleotides is administered about weekly, for at least 2 weeks (e.g. 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 weeks). In some embodiments, the nucleic acid drug, including RNA comprising one or more non-canonical nucleotides, is administered about every other week for at least one month (e.g. 1 , or 2, or 3, or 4, or 5, or 6, or 12 months). In some embodiments, the nucleic acid drug, including RNA comprising one or more non-canonical nucleotides, is administered monthly or about every other month.
- the nucleic acid drug, including RNA comprising one or more non-canonical nucleotides, is administered is administered for at least two months, or at least 4 months, or at least 6 months, or at least 9 months, or at least one year.
- the nucleic acid drug including RNA comprising one or more non-canonical nucleotides, is administered about weekly, or about once every 2 weeks, or about once every 3 weeks, or about once every 4 weeks, or about once every 5 weeks, or about once every 6 weeks, or about once every 7 weeks, or about once every 8 weeks, or about once every 9 weeks, or about once every 10 weeks, or about once every 1 1 weeks, or about once every 12 weeks, or about once every 13 weeks, or about once every 14 weeks, or about once every 15 weeks, or about once every 20 weeks, or about once every 24 weeks.
- the nucleic acid drug including RNA comprising one or more non-canonical nucleotides, is administered no more than about weekly, or about once every 2 weeks, or about once every 3 weeks, or about once every 4 weeks, or about once every 5 weeks, or about once every 6 weeks, or about once every 7 weeks, or about once every 8 weeks, or about once every 9 weeks, or about once every 10 weeks, or about once every 1 1 weeks, or about once every 12 weeks, or about once every 13 weeks, or about once every 14 weeks, or about once every 15 weeks, or about once every 20 weeks, or about 24 weeks.
- Certain proteins have long half-lives, and can persist in tissues for several hours, days, weeks, months or years. It has now been discovered that certain methods of treating a patient can result in accumulation of one or more proteins, including, for example, one or more beneficial proteins. Certain embodiments are therefore directed to a method for treating a patient comprising delivering to a patient in a series of doses a nucleic acid encoding one or more proteins.
- the nucleic acid comprises RNA comprising one or more non-canonical nucleotides.
- a first dose is given at a first time-point.
- a second dose is given at a second time-point.
- the amount of at least one of the one or more proteins in the patient at the second time-point is greater than the amount of said protein at the first time- point.
- the method results in the accumulation of said protein in the patient.
- the present invention relates to nucleic acid drugs, which, in various embodiments are RNA comprising one or more non-canonical nucleotides.
- Certain non-canonical nucleotides when incorporated into RNA molecules, can reduce the toxicity of the RNA molecules, in part, without wishing to be bound by theory, by interfering with binding of proteins that detect exogenous nucleic acids, for example, protein kinase R, Rig-1 and the oligoadenylate synthetase family of proteins.
- Non-canonical nucleotides that have been reported to reduce the toxicity of RNA molecules when incorporated therein include: pseudouridine, 5-methyluridine, 2- thiouridine, 5-methylcytidine, N6-methyladenosine, and certain combinations thereof.
- pseudouridine 5-methyluridine
- 2- thiouridine 5-methylcytidine
- N6-methyladenosine and certain combinations thereof.
- the chemical characteristics of non-canonical nucleotides that can enable them to lower the in vivo toxicity of RNA molecules have, until this point, remained unknown.
- RNA molecules containing these nucleotides can reduce the efficiency with which RNA molecules can be translated into protein, limiting the utility of RNA molecules containing these nucleotides in applications that require protein expression.
- pseudouridine can be completely substituted for uridine in RNA molecules without reducing the efficiency with which the synthetic RNA molecules can be translated into protein, in certain situations, for example, when performing frequent, repeated transfections, synthetic RNA molecules containing only adenosine, guanosine, cytidine, and pseudouridine can exhibit excessive toxicity.
- RNA molecules containing one or more non-canonical nucleotides that include one or more substitutions at the 2C and/or 4C and/or 5C positions in the case of a pyrimidine or the 6C and/or 7N and/or 8C positions in the case of a purine can be less toxic than synthetic RNA molecules containing only canonical nucleotides, due in part to the ability of substitutions at these positions to interfere with recognition of synthetic RNA molecules by proteins that detect exogenous nucleic acids, and furthermore, that substitutions at these positions can have minimal impact on the efficiency with which the synthetic RNA molecules can be translated into protein, due in part to the lack of interference of substitutions at these positions with base-pairing and base-stacking interactions.
- non-canonical nucleotides that include one or more substitutions at the 2C and/or 4C and/or 5C positions in the case of a pyrimidine or the 6C and/or 7N and/or 8C positions in the case of a purine include, but are not limited to: 2-thiouridine, 5-azauridine, pseudouridine, 4-thiouridine, 5-methyluridine, 5- methylpseudouridine, 5-aminouridine, 5-aminopseudouridine, 5-hydroxyuridine, 5-hydroxypseudouridine, 5- methoxyuridine, 5-methoxypseudouridine, 5-hydroxymethyluridine, 5-hydroxymethylpseudouridine, 5- carboxyuridine, 5-carboxypseudouridine, 5-formyluridine, 5-formylpseudouridine, 5-methyl-5-azauridine, 5- amino-5-azauridine, 5-hydroxy-5-azauridine, 5-methylpseudouridine, 5-aminopseud
- the invention relates to one or more non-canonical nucleotides selected from 5- hydroxycytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5- methoxycytidine, 5-hydroxyuridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-formyluridine, 5-methoxyuridine, pseudouridine, 5-hydroxypseudouridine, 5-methylpseudouridine, 5-hydroxymethylpseudouridine, 5- carboxypseudouridine, 5-formylpseudouridine, and 5-methoxypseudouridine.
- At least 50%, or at least 55%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or 100% of the non-canonical nucleotides are one or more of 5- hydroxycytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5- methoxycytidine, 5-hydroxyuridine, 5-methyluridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-formyluridine, 5- methoxyuridine, pseudouridine, 5-hydroxypseudouridine, 5-methylpseudouridine, 5-hydroxymethylpseudouridine, 5-carboxypseudouridine, 5-formylpseudouridine, and 5-methoxypseudouridine.
- At least about 50%, or at least about 55%%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or 100% of cytidine residues are non-canonical nucleotides selected from 5-hydroxycytidine, 5-methylcytidine, 5- hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5-methoxycytidine.
- At least about 20%, or about 30%, or about 40%, or about 50%, or at least about 55%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or 100% of uridine residues are non-canonical nucleotides selected from 5-hydroxyuridine, 5- methyluridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5-formyluridine, 5-methoxyuridine, pseudouridine, 5- hydroxypseudouridine, 5-methylpseudouridine, 5-hydroxymethylpseudouridine, 5-carboxypseudouridine, 5- formylpseudouridine, and 5-methoxypseudouridine.
- guanosine residues are non-canonical nucleotides, and the non-canonical nucleotide is optionally 7- deazaguanosine.
- the RNA contains no more than about 50% 7-deazaguanosine in place of guanosine residues.
- the RNA does not contain non-canonical nucleotides in place of adenosine residues.
- non-canonical nucleotides in place of adenosine residues.
- alternative naming schemes exist for certain non-canonical nucleotides.
- 5-methylpseudouridine can be referred to as "3-methylpseudouridine” or “N3-methylpseudouridine” or "1 -methylpseudouridine” or "N 1 -methylpseudouridine”.
- Nucleotides that contain the prefix "amino” can refer to any nucleotide that contains a nitrogen atom bound to the atom at the stated position of the nucleotide, for example, 5-aminocytidine can refer to 5-aminocytidine, 5- methylaminocytidine, and 5-nitrocytidine.
- RNA comprising one or more non-canonical nucleotides, wherein the RNA molecule contains one or more nucleotides that includes one or more substitutions at the 2C and/or 4C and/or 5C positions in the case of a pyrimidine or the 6C and/or 7N and/or 8C positions in the case of a purine.
- the therapeutic contains one or more RNA molecules comprising one or more non-canonical nucleotides, and wherein the one or more RNA molecules comprising one or more non-canonical nucleotides contains one or more nucleotides that includes one or more substitutions at the 2C and/or 4C and/or 5C positions in the case of a pyrimidine or the 6C and/or 7N and/or 8C positions in the case of a purine.
- the therapeutic comprises a transfection reagent.
- the transfection reagent comprises a cationic lipid, liposome or micelle.
- the liposome or micelle comprises folate and the therapeutic composition has anti-cancer activity.
- the one or more nucleotides includes at least one of pseudouridine, 2-thiouridine, 4-thiouridine, 5-azauridine, 5- hydroxyuridine, 5-methyluridine, 5-aminouridine, 2-thiopseudouridine, 4-thiopseudouridine, 5- hydroxypseudouridine, 5-methylpseudouridine, 5-aminopseudouridine, pseudoisocytidine, N4-methylcytidine, 2- thiocytidine, 5-azacytidine, 5-hydroxycytidine, 5-aminocytidine, 5-methylcytidine, N4-methylpseudoisocytidine, 2- thiopseudoisocytidine, 5-hydroxypseudoisocytidine, 5-aminopseudoisocytidine, 5-methylpseudoisocytidine, 5-methylpseu
- the one or more nucleotides includes at least one of pseudouridine, 2-thiouridine, 4-thiouridine, 5-azauridine, 5- hydroxyuridine, 5-methyluridine, 5-aminouridine, 2-thiopseudouridine, 4-thiopseudouridine, 5- hydroxypseudouridine, 5-methylpseudouridine, and 5-aminopseudouridine and at least one of pseudoisocytidine, N4-methylcytidine, 2-thiocytidine, 5-azacytidine, 5-hydroxycytidine, 5-aminocytidine, 5-methylcytidine, N4- methylpseudoisocytidine, 2-thiopseudoisocytidine, 5-hydroxypseudoisocytidine, 5-aminopseudoisocytidine, and 5-methylpseudoisocytidine.
- the one or more nucleotides include at least one of pseudouridine, 2-thiouridine, 4-thiouridine, 5-azauridine, 5-hydroxyuridine, 5-methyluridine, 5-aminouridine, 2- thiopseudouridine, 4-thiopseudouridine, 5-hydroxypseudouridine, and 5-methylpseudouridine, 5- aminopseudouridine and at least one of pseudoisocytidine, N4-methylcytidine, 2-thiocytidine, 5-azacytidine, 5- hydroxycytidine, 5-aminocytidine, 5-methylcytidine, N4-methylpseudoisocytidine, 2-thiopseudoisocytidine, 5- hydroxypseudoisocytidine, 5-aminopseudoisocytidine, and 5-methylpseudoisocytidine and at least one of 7- deazaguanosine, 6-thioguanosine
- the one or more nucleotides includes: 5-methylcytidine and 7-deazaguanosine.
- the one or more nucleotides also includes pseudouridine or 4-thiouridine or 5-methyluridine or 5-aminouridine or 4- thiopseudouridine or 5-methylpseudouridine or 5-aminopseudouridine.
- the one or more nucleotides also includes 7-deazaadenosine.
- the one or more nucleotides includes: pseudoisocytidine and 7-deazaguanosine and 4-thiouridine.
- the one or more nucleotides includes: pseudoisocytidine or 7-deazaguanosine and pseudouridine. In still another embodiment, the one or more nucleotides includes: 5-methyluridine and 5-methylcytidine and 7-deazaguanosine. In a further embodiment, the one or more nucleotides includes: pseudouridine or 5-methylpseudouridine and 5- methylcytidine and 7-deazaguanosine. In another embodiment, the one or more nucleotides includes: pseudoisocytidine and 7-deazaguanosine and pseudouridine. In one embodiment, the RNA comprising one or more non-canonical nucleotides is present in vivo.
- Certain non-canonical nucleotides can be incorporated more efficiently than other non-canonical nucleotides into RNA molecules by RNA polymerases that are commonly used for in vitro transcription, due in part to the tendency of these certain non-canonical nucleotides to participate in standard base-pairing interactions and base-stacking interactions, and to interact with the RNA polymerase in a manner similar to that in which the corresponding canonical nucleotide interacts with the RNA polymerase.
- certain nucleotide mixtures containing one or more non-canonical nucleotides can be beneficial in part because in v/fro-transcription reactions containing these nucleotide mixtures can yield a large quantity of RNA.
- Certain embodiments are therefore directed to a nucleotide mixture containing one or more nucleotides that includes one or more substitutions at the 2C and/or 4C and/or 5C positions in the case of a pyrimidine or the 6C and/or 7N and/or 8C positions in the case of a purine.
- Nucleotide mixtures include, but are not limited to (numbers preceding each nucleotide indicate an exemplary fraction of the non-canonical nucleotide triphosphate in an in wfro-transcription reaction, for example, 0.2 pseudoisocytidine refers to a reaction containing adenosine-5'-triphosphate, guanosine-5'-triphosphate, uridine-5'-triphosphate, cytidine-5'-triphosphate, and pseudoisocytidine-5'- triphosphate, wherein pseudoisocytidine-5'-triphosphate is present in the reaction at an amount approximately equal to 0.2 times the total amount of pseudoisocytidine-5'-triphosphate + cytidine-5'-triphosphate that is present in the reaction, with amounts measured either on a molar or mass basis, and wherein more than one number preceding a nucleoside indicates a range of exemplary fractions): 1.0 pseudouridine, 0.1 -
- the RNA comprising one or more non-canonical nucleotides composition or synthetic polynucleotide composition contains substantially or entirely the canonical nucleotide at positions having adenine or "A" in the genetic code.
- substantially in this context refers to at least 90%.
- the RNA composition or synthetic polynucleotide composition may further contain (e.g., consist of) 7-deazaguanosine at positions with "G" in the genetic code as well as the corresponding canonical nucleotide "G", and the canonical and non-canonical nucleotide at positions with G may be in the range of 5: 1 to 1 :5, or in some embodiments in the range of 2: 1 to 1 :2.
- the RNA composition or synthetic polynucleotide composition may further contain (e.g., consist of) one or more (e.g., two, three or four) of 5-hydroxycytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5- carboxycytidine, 5-formylcytidine, 5-methoxycytidine at positions with "C” in the genetic code as well as the canonical nucleotide "C", and the canonical and non-canonical nucleotide at positions with C may be in the range of 5:1 to 1 :5, or in some embodiments in the range of 2: 1 to 1 :2.
- the level of non- canonical nucleotide at positions of "C" are as described in the preceding paragraph.
- the RNA composition or synthetic polynucleotide composition may further contain (e.g., consist of) one or more (e.g., two, three, or four) of 5-hydroxyuridine, 5-methyluridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5- formyluridine, 5-methoxyuridine, pseudouridine, 5-hydroxypseudouridine, 5-methylpseudouridine, 5- hydroxymethylpseudouridine, 5-carboxypseudouridine, 5-formylpseudouridine, and 5-methoxypseudouridineat positions with "U” in the genetic code as well as the canonical nucleotide "U", and the canonical and non- canonical nucleotide at positions with "U” may be in the range of 5: 1 to 1 :5, or in some embodiment
- nucleotide mixture contains more than one of the non-canonical nucleotides listed above, for example, the nucleotide mixture contains both pseudoisocytidine and 7-deazaguanosine or the nucleotide mixture contains both N4-methylcytidine and 7- deazaguanosine, etc.
- the nucleotide mixture contains more than one of the non-canonical nucleotides listed above, and each of the non-canonical nucleotides is present in the mixture at the fraction listed above, for example, the nucleotide mixture contains 0.1 - 0.8 pseudoisocytidine and 0.2 - 1.0 7-deazaguanosine or the nucleotide mixture contains 0.2 - 1.0 N4-methylcytidine and 0.2 - 1.0 7-deazaguanosine, etc.
- nucleotide fractions other than those given above may be used.
- the exemplary fractions and ranges of fractions listed above relate to nucleotide-triphosphate solutions of typical purity (greater than 90% purity). Larger fractions of these and other nucleotides can be used by using nucleotide-triphosphate solutions of greater purity, for example, greater than about 95% purity or greater than about 98% purity or greater than about 99% purity or greater than about 99.5% purity, which can be achieved, for example, by purifying the nucleotide triphosphate solution using existing chemical-purification technologies such as high-pressure liquid chromatography (HPLC) or by other means.
- nucleotides with multiple isomers are purified to enrich the desired isomer.
- RNA molecules that contains one or more non-canonical nucleotides that includes one or more substitutions at the 2C and/or 4C and/or 5C positions in the case of a pyrimidine or the 6C and/or 7N and/or 8C positions in the case of a purine.
- Still other embodiments are directed to a method for transfecting, reprogramming, and/or gene-editing a cell in vivo by contacting the cell with a RNA molecule that contains one or more non-canonical nucleotides that includes one or more substitutions at the 2C and/or 4C and/or 5C positions in the case of a pyrimidine or the 6C and/or 7N and/or 8C positions in the case of a purine.
- the RNA molecule is produced by in vitro transcription.
- the RNA molecule encodes one or more reprogramming factors.
- the one or more reprogramming factors includes Oct4 protein.
- the cell is also contacted with a RNA molecule that encodes Sox2 protein. In yet another embodiment, the cell is also contacted with a RNA molecule that encodes Klf4 protein. In yet another embodiment, the cell is also contacted with a RNA molecule that encodes c-Myc protein. In yet another embodiment, the cell is also contacted with a RNA molecule that encodes Lin28 protein.
- Enzymes such as T7 RNA polymerase may preferentially incorporate canonical nucleotides in an in vitro- transcription reaction containing both canonical and non-canonical nucleotides.
- an in vitro- transcription reaction containing a certain fraction of a non-canonical nucleotide may yield RNA containing a different, often lower, fraction of the non-canonical nucleotide than the fraction at which the non-canonical nucleotide was present in the reaction.
- references to nucleotide incorporation fractions therefore can refer both to RNA molecules containing the stated fraction of the nucleotide, and to RNA molecules synthesized in a reaction containing the stated fraction of the nucleotide (or nucleotide derivative, for example, nucleotide-triphosphate), even though such a reaction may yield RNA containing a different fraction of the nucleotide than the fraction at which the non-canonical nucleotide was present in the reaction.
- references to nucleotide incorporation fractions therefore can refer both to RNA molecules containing the stated fraction of the nucleotide, and to RNA molecules encoding the same protein as a different RNA molecule, wherein the different RNA molecule contains the stated fraction of the nucleotide.
- kits containing one or more materials needed to practice the present invention.
- the kit contains one or more synthetic RNA molecules.
- the kit contains one or more synthetic RNA molecules that encode one or more reprogramming factors and/or gene- editing proteins.
- the one or more synthetic RNA molecules contain one or more non- canonical nucleotides that include one or more substitutions at the 2C and/or 4C and/or 5C positions in the case of a pyrimidine or the 6C and/or 7N and/or 8C positions in the case of a purine.
- the kit contains one or more of: a transfection medium, a transfection reagent, a complexation medium, and a matrix solution.
- the matrix solution contains fibronectin and/or vitronectin or recombinant fibronectin and/or recombinant vitronectin.
- one or more of the components of the kit are present as a plurality of aliquots.
- the kit contains aliquots of nucleic acid transfection-reagent complexes.
- the kit contains aliquots of nucleic acid transfection-reagent complexes that are provided in a solid form, for example, as frozen or freeze-dried pellets.
- the kit contains aliquots of medium, wherein each aliquot contains transfection reagent-nucleic acid complexes that are stabilized either by chemical treatment or by freezing.
- Transfection in general, and reprogramming, in particular, can be difficult and time-consuming techniques that can be repetitive and prone to error. However, these techniques are often performed manually due to the lack of automated transfection equipment. Certain embodiments are therefore directed to a system that can transfect, reprogram, and/or gene-edit cells in vivo in an automated or semi-automated manner.
- non-canonical nucleotide members of the 5-methylcytidine de-methylation pathway when incorporated into synthetic RNA, can increase the efficiency with which the synthetic RNA can be translated into protein in vivo, and can decrease the toxicity of the synthetic RNA in vivo.
- These non-canonical nucleotides include, for example: 5-methylcytidine, 5-hydroxymethylcytidine, 5-formylcytidine, and 5- carboxycytidine (a.k.a. "cytidine-5-carboxylic acid"). Certain embodiments are therefore directed to a nucleic acid. In some embodiments, the nucleic acid is present in vivo.
- the nucleic acid is a synthetic RNA molecule. In another embodiment, the nucleic acid comprises one or more non-canonical nucleotides. In one embodiment, the nucleic acid comprises one or more non-canonical nucleotide members of the 5-methylcytidine de-methylation pathway. In another embodiment, the nucleic acid comprises at least one of: 5-methylcytidine, 5- hydroxymethylcytidine, 5-formylcytidine, and 5-carboxycytidine or a derivative thereof.
- the nucleic acid comprises at least one of: pseudouridine, 5-methylpseudouridine, 5-hydroxyuridine, 5- methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, N4-methylcytidine, N4-acetylcytidine, and 7- deazaguanosine or a derivative thereof.
- Certain embodiments are directed to a protein. Other embodiments are directed to a nucleic acid that encodes a protein.
- the protein is a protein of interest.
- the protein is selected from: a reprogramming protein and a gene-editing protein.
- the nucleic acid is a plasmid.
- the nucleic acid is present in a virus or viral vector.
- the virus or viral vector is replication incompetent.
- the virus or viral vector is replication competent.
- the virus or viral vector includes at least one of: an adenovirus, a retrovirus, a lentivirus, a herpes virus, an adeno-associated virus or a natural or engineered variant thereof, and an engineered virus.
- non-canonical nucleotides can be particularly effective at increasing the efficiency with which synthetic RNA can be translated into protein in vivo, and decreasing the toxicity of synthetic RNA in vivo, for example, the combinations: 5-methyluridine and 5-methylcytidine, 5- hydroxyuridine and 5-methylcytidine, 5-hydroxyuridine and 5-hydroxymethylcytidine, 5-methyluridine and 7- deazaguanosine, 5-methylcytidine and 7-deazaguanosine, 5-methyluridine, 5-methylcytidine, and 7- deazaguanosine, and 5-methyluridine, 5-hydroxymethylcytidine, and 7-deazaguanosine.
- Certain embodiments are therefore directed to a nucleic acid comprising at least two of: 5-methyluridine, 5-methylcytidine, 5- hydroxymethylcytidine, and 7-deazaguanosine or one or more derivatives thereof.
- Other embodiments are directed to a nucleic acid comprising at least three of: 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, and 7-deazaguanosine or one or more derivatives thereof.
- Other embodiments are directed to a nucleic acid comprising all of: 5-methyluridine, 5-methylcytidine, 5-hydroxymethylcytidine, and 7-deazaguanosine or one or more derivatives thereof.
- the nucleic acid comprises one or more 5-methyluridine residues, one or more 5-methylcytidine residues, and one or more 7-deazaguanosine residues or one or more 5- methyluridine residues, one or more 5-hydroxymethylcytidine residues, and one or more 7-deazaguanosine residues.
- RNA molecules containing certain fractions of certain non-canonical nucleotides and combinations thereof can exhibit particularly high translation efficiency and low toxicity in vivo.
- Certain embodiments are therefore directed to a nucleic acid comprising at least one of: one or more uridine residues, one or more cytidine residues, and one or more guanosine residues, and comprising one or more non- canonical nucleotides.
- a nucleic acid comprising at least one of: one or more uridine residues, one or more cytidine residues, and one or more guanosine residues, and comprising one or more non- canonical nucleotides.
- between about 20% and about 80% of the uridine residues are 5- methyluridine residues.
- between about 30% and about 50% of the uridine residues are 5-methyluridine residues.
- about 40% of the uridine residues are 5-methyluridine residues.
- between about 60% and about 80% of the cytidine residues are 5-methylcytidine residues. In another embodiment, between about 80% and about 100% of the cytidine residues are 5- methylcytidine residues. In a further embodiment, about 100% of the cytidine residues are 5-methylcytidine residues. In a still further embodiment, between about 20% and about 100% of the cytidine residues are 5- hydroxymethylcytidine residues. In one embodiment, between about 20% and about 80% of the guanosine residues are 7-deazaguanosine residues. In another embodiment, between about 40% and about 60% of the guanosine residues are 7-deazaguanosine residues.
- guanosine residues are 7-deazaguanosine residues. In one embodiment, between about 20% and about 80% or between about 30% and about 60% or about 40% of the cytidine residues are N4-methylcytidine and/or N4-acetylcytidine residues. In another embodiment, each cytidine residue is a 5-methylcytidine residue. In a further embodiment, about 100% of the cytidine residues are 5-methylcytidine residues and/or 5-hydroxymethylcytidine residues and/or N4-methylcytidine residues and/or N4-acetylcytidine residues and/or one or more derivatives thereof.
- about 40% of the uridine residues are 5-methyluridine residues, between about 20% and about 100% of the cytidine residues are N4-methylcytidine and/or N4-acetylcytidine residues, and about 50% of the guanosine residues are 7-deazaguanosine residues.
- about 40% of the uridine residues are 5-methyluridine residues and about 100% of the cytidine residues are 5-methylcytidine residues.
- about 40% of the uridine residues are 5-methyluridine residues and about 50% of the guanosine residues are 7-deazaguanosine residues.
- cytidine residues are 5-methylcytidine residues and about 50% of the guanosine residues are 7-deazaguanosine residues.
- about 100% of the uridine residues are 5-hydroxyuridine residues.
- about 40% of the uridine residues are 5-methyluridine residues, about 100% of the cytidine residues are 5-methylcytidine residues, and about 50% of the guanosine residues are 7-deazaguanosine residues.
- each uridine residue in the synthetic RNA molecule is a pseudouridine residue or a 5-methylpseudouridine residue.
- uridine residues are pseudouridine residues and/or 5-methylpseudouridine residues. In a further embodiment, about 100% of the uridine residues are pseudouridine residues and/or 5-methylpseudouridine residues, about 100% of the cytidine residues are 5-methylcytidine residues, and about 50% of the guanosine residues are 7- deazaguanosine residues.
- non-canonical nucleotides that can be used in place of or in combination with 5-methyluridine include, but are not limited to: pseudouridine, 5-hydroxyuridine, 5-hydroxypseudouridine, 5-methoxyuridine, 5- methoxypseudouridine, 5-carboxyuridine, 5-carboxypseudouridine, 5-formyluridine, 5-formylpseudouridine, 5- hydroxymethyluridine, 5-hydroxymethylpseudouridine, and 5-methylpseudouridine (a.k.a. "1 - methylpseudouridine", a.k.a. "N1 -methylpseudouridine”) or one or more derivatives thereof.
- pseudouridine 5-hydroxyuridine, 5-hydroxypseudouridine, 5-methoxyuridine, 5- methoxypseudouridine
- 5-carboxyuridine 5-carboxypseudouridine
- 5-formyluridine 5-form
- Non-canonical nucleotides that can be used in place of or in combination with 5-methylcytidine and/or 5-hydroxymethylcytidine include, but are not limited to: pseudoisocytidine, 5-methylpseudoisocytidine, 5-hydroxymethylcytidine, 5- formylcytidine, 5-carboxycytidine, 5-methoxycytidine, N4-methylcytidine, N4-acetylcytidine or one or more derivatives thereof.
- the fractions of non-canonical nucleotides can be reduced. Reducing the fraction of non-canonical nucleotides can be beneficial, in part, because reducing the fraction of non-canonical nucleotides can reduce the cost of the nucleic acid. In certain situations, for example, when minimal immunogenicity of the nucleic acid is desired, the fractions of non- canonical nucleotides can be increased.
- Enzymes such as T7 RNA polymerase may preferentially incorporate canonical nucleotides in an in vitro- transcription reaction containing both canonical and non-canonical nucleotides.
- an in vitro- transcription reaction containing a certain fraction of a non-canonical nucleotide may yield RNA containing a different, often lower, fraction of the non-canonical nucleotide than the fraction at which the non-canonical nucleotide was present in the reaction.
- references to nucleotide incorporation fractions therefore can refer both to nucleic acids containing the stated fraction of the nucleotide, and to nucleic acids synthesized in a reaction containing the stated fraction of the nucleotide (or nucleotide derivative, for example, nucleotide-triphosphate), even though such a reaction may yield a nucleic acid containing a different fraction of the nucleotide than the fraction at which the non-canonical nucleotide was present in the reaction.
- nucleotide sequences can encode the same protein by utilizing alternative codons.
- references to nucleotide incorporation fractions therefore can refer both to nucleic acids containing the stated fraction of the nucleotide, and to nucleic acids encoding the same protein as a different nucleic acid, wherein the different nucleic acid contains the stated fraction of the nucleotide.
- Certain embodiments are directed to a nucleic acid comprising a 5'-cap structure selected from Cap 0, Cap 1 , Cap 2, and Cap 3 or a derivative thereof.
- the nucleic acid comprises one or more UTRs.
- the one or more UTRs increase the stability of the nucleic acid.
- the one or more UTRs comprise an alpha-globin or beta-globin 5 -UTR.
- the one or more UTRs comprise an alpha-globin or beta-globin 3 -UTR.
- the synthetic RNA molecule comprises an alpha-globin or beta-globin 5'-UTR and an alpha-globin or beta-globin 3 -UTR.
- the 5 -UTR comprises a Kozak sequence that is substantially similar to the Kozak consensus sequence.
- the nucleic acid comprises a 3'-poly(A) tail.
- the 3'- poly(A) tail is between about 20 nt and about 250 nt or between about 120 nt and about 150 nt long.
- the 3'-poly(A) tail is about 20 nt, or about 30 nt, or about 40 nt, or about 50 nt, or about 60 nt, or about 70 nt, or about 80 nt, or about 90 nt, or about 100 nt, or about 110 nt, or about 120 nt, or about 130 nt, or about 140 nt, or about 150 nt, or about 160 nt, or about 170 nt, or about 180 nt, or about 190 nt, or about 200 nt, or about 210 nt, or about 220 nt, or about 230 nt, or about 240 nt, or about 250 nt long.
- Certain embodiments are directed to methods of making nucleic acid drugs, including RNA comprising one or more non-canonical nucleotides. Such methods yield substantially stable RNA.
- the present methods and compositions find use in methods of treating, preventing or ameliorating a disease, disorder and/or condition.
- the described methods of in vivo delivery including various effective doses, administration strategies and formulations are used in a method of treatment.
- the present methods and compositions find use in methods of altering, modifying and/or changing a tissue (e.g. cosmetically).
- the present methods and compositions include using a nucleic acid drug, including a synthetic RNA, in the diagnosing, treating, preventing or ameliorating of a disease, disorder and/or condition described herein.
- the present methods and compositions include using a nucleic acid drug, including a synthetic RNA, in the altering, modifying and/or changing of a tissue (e.g. cosmetically).
- a synthetic RNA as described herein is administered to a human at specific doses described herein and the synthetic RNA comprises a sequence, sometimes referred to as a target sequence that encodes a protein of interest, which may be a therapeutic protein.
- Synthetic RNA comprising only canonical nucleotides can bind to pattern recognition receptors, can be recognized as a pathogen-associated molecular pattern, and can trigger a potent immune response in cells, which can result in translation block, the secretion of inflammatory cytokines, and cell death. It has now been discovered that synthetic RNA comprising certain non-canonical nucleotides can evade detection by the innate immune system, and can be translated at high efficiency into protein, including in humans.
- synthetic RNA comprising at least one of the non-canonical nucleotides described herein, including, for example, a member of the group: 5-methylcytidine, 5-hydroxycytidine, 5-hydroxymethylcytidine, 5- carboxycytidine, 5-formylcytidine, 5-methoxycytidine, pseudouridine, 5-hydroxyuridine, 5-methyluridine, 5- hydroxymethyluridine, 5-carboxyuridine, 5-methoxyuridine, 5-formyluridine, 5-hydroxypseudouridine, 5- methylpseudouridine, 5-hydroxymethylpseudouridine, 5-carboxypseudouridine, 5-methoxypseudouridine, and 5- formylpseudouridine can evade detection by the innate immune system, and can be translated at high efficiency into protein, including in humans.
- Certain embodiments are therefore directed to a method for inducing a cell to express a protein of interest comprising contacting a cell with synthetic RNA.
- Other embodiments are directed to a method for transfecting a cell with synthetic RNA comprising contacting a cell with a solution comprising one or more synthetic RNA molecules.
- Still other embodiments are directed to a method for treating a patient comprising administering to the patient synthetic RNA.
- the synthetic RNA comprises at least one of the non-canonical nucleotides described herein, including, for example, a member of the group: 5- methylcytidine, 5-hydroxycytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcytidine, 5- methoxycytidine, pseudouridine, 5-hydroxyuridine, 5-methyluridine, 5-hydroxymethyluridine, 5-carboxyuridine, 5- methoxyuridine, 5-formyluridine, 5-hydroxypseudouridine, 5-methylpseudouridine, 5- hydroxymethylpseudouridine, 5-carboxypseudouridine, 5-methoxypseudouridine, and 5-formylpseudouridine.
- a member of the group including, for example, a member of the group: 5- methylcytidine, 5-hydroxycytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-formylcy
- the synthetic RNA encodes a protein of interest.
- Exemplary RNAs may contain combinations and levels of non-canonical and non-canonical nucleotides as described elsewhere herein, including with respect to the expression of any protein of interest described herein.
- the method results in the expression of the protein of interest.
- the method results in the expression of the protein of interest in the patient's skin.
- inventions are directed to a method for delivering a nucleic acid to a cell in vivo. Still other embodiments are directed to a method for inducing a cell in vivo to express a protein of interest. Still other embodiments are directed to a method for treating a patient. In one embodiment, the method comprises disrupting the stratum corneum. In another embodiment, the method comprises contacting a cell with a nucleic acid. In yet another embodiment, the method results in the cell internalizing the nucleic acid. In a further embodiment, the method results in the cell expressing the protein of interest. In a still further embodiment, the method results in the expression of the protein of interest in the patient. In a still further embodiment, the method results in the amelioration of one or more of the patient's symptoms. In a still further embodiment, the patient is in need of the protein of interest. In a still further embodiment, the patient is deficient in the protein of interest.
- Still other embodiments are directed to a method for treating a patient comprising delivering to a patient a composition.
- the composition comprises albumin that is treated with an ion-exchange resin or charcoal.
- the composition comprises one or more nucleic acid molecules.
- at least one of the one or more nucleic acid molecules encodes a protein of interest.
- the method results in the expression of the protein in the patient's skin.
- the method results in the expression of a therapeutically or cosmetically effective amount of the protein of interest in the patient.
- the method comprises administering a steroid.
- the steroid is a member of the group: hydrocortisone and dexamethasone.
- Some embodiments are directed to a therapeutic composition and/or methods of treatment comprising a nucleic acid molecule encoding one or more proteins, wherein at least one of the one or more proteins is an extracellular matrix protein. Still other embodiments are directed to a cosmetic composition comprising a nucleic acid molecule encoding one or more proteins, wherein at least one of the one or more proteins is an extracellular matrix protein.
- Pigmentation disorders can cause severe symptoms in patients. It has now been discovered that pigmentation disorders can be treated by delivering to a patient a nucleic acid encoding tyrosinase. Certain embodiments are therefore directed to a method for treating a pigmentation disorder. Other embodiments are directed to a method for altering the pigmentation of a patient. In one embodiment, the method comprises delivering to a patient a nucleic acid encoding tyrosinase. Other embodiments are directed to a cosmetic composition comprising a nucleic acid encoding tyrosinase. Still other embodiments are directed to a therapeutic composition comprising a nucleic acid encoding tyrosinase.
- Still other embodiments are directed to a method for increasing the ultraviolet absorption of a patient's skin.
- the method comprises delivering to a patient a nucleic acid encoding tyrosinase.
- the method results in an increase in the ultraviolet absorption of the patient's skin.
- Still other embodiments are directed to a method for reducing photodamage to a person's skin upon exposure to ultraviolet light.
- the method results in the reduction of photodamage to the person's skin upon exposure to ultraviolet light.
- Still other embodiments are directed to a method for treating xeroderma pigmentosum.
- the method comprises delivering to a patient a nucleic acid encoding tyrosinase.
- Still other embodiments are directed to a method for treating epidermolysis bullosa.
- the method comprises delivering to a patient a nucleic acid encoding one or more of keratin 5, keratin 14, plectin, an integrin family member, laminin, a laminin subunit, collagen XVII, collagen VII or a biologically active fragment, variant, analogue or family-member thereof.
- the method comprises delivering to a patient a nucleic acid encoding collagen type VII.
- the method comprises delivering to a patient a nucleic acid encoding melanocortin 1 receptor.
- Still other embodiments are directed to a method for treating xerosis.
- the method comprises delivering to a patient a nucleic acid encoding a hyaluronan synthase.
- the patient is diagnosed with atopic dermatitis.
- the patient is diagnosed with ichthyosis.
- Certain embodiments are directed to a method for treating a cosmetic condition.
- Other embodiments are directed to a method for inducing tissue healing.
- the method comprises delivering to a patient a nucleic acid encoding a hyaluronan synthase.
- the cosmetic condition is a member of the group: wrinkles, sagging skin, thin skin, discoloration, and dry skin.
- the patient has had cataract surgery.
- the nucleic acid is synthetic RNA.
- the method results in the amelioration of one or more of the patient's symptoms.
- Other embodiments are directed to a method for treating an indication by delivering to a cell or a patient a nucleic acid encoding a protein or a peptide.
- Still other embodiments are directed to a composition comprising a nucleic acid encoding a protein or a peptide.
- Indications that can be treated using the methods and compositions of the present invention and proteins and peptides that can be encoded by compositions of the present invention are set forth in Table 2A and/or Table 2B, and are given by way of example, and not by way of limitation.
- the indication is selected from Table 2A and/or Table 2B.
- the protein or peptide is selected from Table 2A and/or Table 2B.
- the indication and the protein or peptide are selected from the same row of Table 2A and/or Table 2B.
- the protein of interest is a member of the group: UCP1 , UCP2, and UCP3.
- Other embodiments are directed to methods for inducing a cell to express a plurality of proteins of interest.
- the proteins of interest include at least two members of the group: a lipase, UCP1 , UCP2, and UCP3.
- the proteins of interest include a lipase and a member of the group: UCP1 , UCP2, and UCP3.
- the protein is a gene-editing protein.
- the gene-editing protein targets a gene that is at least partly responsible for a disease phenotype.
- the gene-editing protein targets a gene that encodes a protein selected from Table 2A and/or Table 2B.
- the gene-editing protein corrects or eliminates, either alone or in combination with one or more other molecules or gene-editing proteins, a mutation that is at least partly responsible for a disease phenotype.
- the present invention contemplates the targeting of the precursor forms and/or mature forms and/or isoforms and/or mutants of any of the proteins disclosed in Table 2A and/or Table 2B and such proteins.
- any of the precursor forms and/or mature forms and/or isoforms and/or mutants have enhanced secretion relative to the corresponding wild type proteins.
- any of the precursor forms and/or mature forms and/or isoforms and/or mutants have altered half-lives (e.g. serum, plasma, intracellular) - for instance, longer or shorter half-lives. In some embodiments, this is relative to wild type.
- Additional illustrative targets of the present invention include the cosmetic targets listed in Table 6 of International Patent Publication No. WO 2013/151671 , the contents of which are hereby incorporated by reference in their entirety.
- the agents of the present invention are used in methods the effect the integumentary system of a human.
- the present compositions and methods may be used to alter a biological and/or physiological process to, for example, reduce skin sagging, increase skin thickness, increase skin volume, reduce the number of wrinkles, the length of wrinkles and/or the depth of wrinkles, increase skin tightness, firmness, tone and/or elasticity, increase skin hydration and ability to retain moisture, water flow and osmotic balance, increase the levels of skin lipids; increase the extracellular matrix and/or adhesion and communication polypeptides; increase skin energy production; utilization and conservation; improve oxygen utilization; improve skin cell life; improve skin cell immunity defense, heat shock stress response, antioxidant defense capacity to neutralize free radicals, and/or toxic defense; improve the protection and recovery from ultraviolet rays; improve skin cell communication and skin cell innervations; improve cell cohesion/adhesion; improve calcium mineral and other mineral metabolism; improve cell turnover; and improve cell circadian rhythms.
- the present compositions may be used in the treatment, control, or prevention of a disease, disorder and/or condition and/or may alter, modify or change the appearance of a member of the integumentary system of a subject suffering from a disease, disorder and/or condition such as, but not limited to, acne vulgaris, acne aestivalis, acne conglobata, acne cosmetic, acne fulminans, acne keloidalis nuchae, acne mechanica, acne medicamentosa, acne miliaris necrotica, acne necrotica, acne rosacea, actinic keratosis, acne vulgaris, acne aestivalis, acne conglobata, acne cosmetic, acne fulminans, acne keloidalis nuchae, acne mechanica, acne medicamentosa, acne miliaris necrotica, acne necrotica, acne rosacea, acute urticaria, allergic contact dermatitis, alopecia areata, angioedema, athlete's foot, atopic dermatiti
- hidradenitis suppurativa hives, hyperhidrosis, hyperpigmentation, hypohidrotic ectodermal dysplasia, hypopigmentation, impetigo, ingrown hair, heat type urticara, ingrown toenail, infantile acne or neonatal acne, itch, irritant contact dermatitis, jock itch, keloid, keratosis pilaris, lichen planus, lichen sclerosus, lupus miliaris disseminatus faciei, melasma, moles, molluscum contagiosum, nail growth rate, nail health, neurodermatitis, nummular eczema, occupational acne, oil acne, onychomycosis, physical urticara, pilonidal cyst, pityriasis rosea, pityriasis versicolor, poison ivy, pomade acne, pseudofolliculitis barba
- profilaggrin a protein which is converted to filaggrin
- a protein of interest e.g. when treating ichthyosis vulgaris.
- the protein of interest is any of the products of the genes psoriasis susceptibility 1 through 9 (PSORSI - PSORS9).
- eczema e.g. atopic dermatitis, nummular eczema, dyshidrotic eczema, seborrheic dermatitis, irritant contact dermatitis, allergic contact dermatitis, dyshidrosis, venous eczema, dermatitis herpetiformis, neurodermatitis, autoeczematization and xerotic eczema
- filaggrin three genetic variants, ovo-like 1 (OVOL1), actin-like 9 (ACTL9) and kinesin family member 3 A (KIF3A) have been associated with eczema; and the genes brain-derived neurotrophic factor (BDNF) and tachykinin, precursor 1 (TAC1 ).
- BDNF brain-derived neurotrophic factor
- TAC1 tachykinin, precursor 1
- Hives or urticaria, including, but not limited to, acute urticaria, chronic urticara and angioedema, physical urticara, pressure or delayed pressue urticara, cholinergic or stress uricara, cold type urticara, heat type urticara, solar type urticara, rare or water type urticara, vibratory angioedema, exercise-induced anaphylasis and dermatographism may be treated with the present compositions by, for example, targeting PLCG-2.
- rosacea which includes, but is not limited to, erthematotelangiectatic rosacea, papulopustular rosacea, phymatous rosacea, and ocular rosacea.
- CAMP cathelicidin antimicrobial peptide
- SCTE stratum corneum tryptic enzyme
- acne may include, but is not limited to, acneiform eruptions, acne aestivalis, acne conglobata, acne cosmetic, acne fulminans, acne keloidalis nuchae, acne mechanica, acne medicamentosa, acne miliaris necrotica, acne necrotica, acne rosacea, baby acne, blackheads, chloracne, excoriated acne, halogen acne, infantile acne or neonatal acne, lupus miliaris disseminatus faciei, occupational acne, oil acne, pomade acne, tar acne, tropical acne, tycoon's cap or acne necrotica miliaris, pseudofolliculitis barbae or acne keloidalis nuchae, and hidradenitis suppurativa.
- the protein of interest may be one or more matrix metalloproteinases (MMP), e.g., matrix metalloproteinase-1 (MMP-1 or interstitial collagenase), matrix metalloproteinase-9 (MMP-9), and matrix metalloproteinase-13 (MMP-13).
- MMP matrix metalloproteinases
- MMP-1 or interstitial collagenase matrix metalloproteinase-1
- MMP-9 matrix metalloproteinase-9
- MMP-13 matrix metalloproteinase-13
- vitiligo is treated with the present compositions, e.g. wherein the NLR family, pyrin domain containing 1 gene (NALP1 ) gene is targeted.
- the present compositions find use in the treatment, control, or prevention of hyprohidrotic ectodermal dysplasia (HED), e.g. via the ectodysplasin A gene (EDA), receptor (EDAR), and receptor associated death domain (EDARADD).
- HED hyprohidrotic ectodermal dysplasia
- EDA ectodysplasin A gene
- EDAR receptor associated death domain
- EDARADD receptor associated death domain
- the present compositions find use in the treatment, control, or prevention of balding, or hair thinning (e.g. male pattern baldness, or androgenetic alopecia (AGA)) and, optionally, one or more of the following may be the protein of interest: androgen receptor (AR), ectodysplasin A2 receptor (EDA2R) and lysophosphatidic acid receptor 6 (P2RY5).
- AGA androgenetic alopecia
- AR androgen receptor
- EDA2R ectodysplasin A2 receptor
- P2RY5 lysophosphatidic acid receptor 6
- compositions also find use in methods of treatment, control, or prevention of scars and stretch marks (striae), e.g. via collagen, ribosomal s6 kinase, sectrected phosphoprotein 1 (also known as osteopontin), or transforming growth factor beta 3.
- striae e.g. via collagen, ribosomal s6 kinase, sectrected phosphoprotein 1 (also known as osteopontin), or transforming growth factor beta 3.
- Epidermodysplasia verruciformis also known as Lutz-Lewandowsky epidermodysplasia
- a rare autosomal recessive genetic hereditary skin disorder may also be treated with compositions of the present invention, e.g. by targeted transmembrane channel-like 6 (EVER1) or transmembrane channellike 8 (EVER2) genes.
- EVER1 transmembrane channel-like 6
- EVER2 transmembrane channellike 8
- skin sagging, thinning or wrinkling may be treated, controlled or prevented with present composition, e.g. by targeting one or more of the proteins of interest such as collagen, elastin, fibroblast growth factor 7, TIMP metallopeptidase inhibitors, matrix metallopeptidases, superoxide dismutase and other extracellular matrix proteins and proteoglycans.
- proteins of interest such as collagen, elastin, fibroblast growth factor 7, TIMP metallopeptidase inhibitors, matrix metallopeptidases, superoxide dismutase and other extracellular matrix proteins and proteoglycans.
- Further embodiments are used in tanning of the skin, such as via melanocyte-stimulating hormone and/or proopiomelanocortin.
- the present compositions may be used for wound treatment.
- methods of treating, controlling or preventing wounds with the present compositions comprises additional steps of, for example, cleaning the wound bed to facilitate wound healing and closure, including, but not limited to: debridement, sharp debridement (surgical removal of dead or infected tissue from a wound), optionally including chemical debriding agents, such as enzymes, to remove necrotic tissue; wound dressings to provide the wound with a moist, warm environment and to promote tissue repair and healing (e.g., wound dressings comprising hydrogels (e.g., AQUASORB; DUODERM), hydrocolloids (e.g., AQUACEL; COMFEEL), foams (e.g., LYOFOAM; SPYROSORB), and alginates (e.g., ALGISITE; CURASORB); administration of growth factors to stimulate cell division and proliferation and to promote wound healing e.g.
- debridement sharp debridement (surgical removal of dead or in
- a skin graft may be necessary to obtain coverage of clean, non-healing wounds (e.g., autologous skin grafts, cadaveric skin graft, bioengineered skin substitutes (e.g., APLIGRAF; DERMAGRAFT)).
- clean, non-healing wounds e.g., autologous skin grafts, cadaveric skin graft, bioengineered skin substitutes (e.g., APLIGRAF; DERMAGRAFT)).
- the nucleic acid drug described herein can be used in a variety of cosmetic/plastic surgery procedures, including, without limitation, a surgical procedure involving skin grafting and an aesthetic or cosmetic surgery (e.g. a facial plastic surgery procedure including, but not limited to blepharoplast , rhinoplasty, rhytidectomy, genioplasty, facial implants, otoplasty, hair implantation, cleft lip and cleft palate repair, and/or a body plastic surgery procedure including but not limited to abdominoplasty, brachioplasty, thigh lift, breast reduction, breast augmentation, body contouring, liposuction, hand surgery).
- a surgical procedure involving skin grafting and an aesthetic or cosmetic surgery
- a facial plastic surgery procedure including, but not limited to blepharoplast , rhinoplasty, rhytidectomy, genioplasty, facial implants, otoplasty, hair implantation, cleft lip and cleft palate repair
- a body plastic surgery procedure including but not limited to abdomin
- a variety of cancers are treated, controlled or prevented with the present compositions (e.g., colorectal cancer, gallbladder cancer, lung cancer, pancreatic cancer, and stomach cancer).
- skin cancer is treated with the present compositions.
- the skin cancer is one or more of actinic keratosis, basal cell carcinoma, melanoma, Kaposi's sarcoma, and squamous cell carcinoma.
- the present compositions are used adjuvant to complete circumferential peripheral and deep margin assessment, Mohs surgery, radiation (e.g. external beam radiotherapy or brachytherapy), chemotherapy (including but not limited to topical chemotherapy, e.g.
- compositions also find use in the treatment of various stages of cancers, including skin cancers (e.g. basal cell cancer (BCC), squamous cell cancer (SCC), and melanoma), such as a stage of the American Joint Committee on Cancer (AJCC) TNM system (e.g. one or more of TX, TO, Tis, T1 , T1 a, T1 b, T2, T2A, T2B, T3, T3a, T3b, T4, T4a, T4b, NX, NO, N 1 , N2, N3, MO, M1 a, M 1 b, M1 c) and/or a staging system (e.g. Stage 0, Stage IA, Stage IB, Stage IIA, Stage IIB, Stage IIC, Stage IIIA, Stage IIIB, Stage NIC, Stage IV).
- BCC basal cell cancer
- SCC squamous cell cancer
- melanoma such as a stage of the American Joint Committee on Cancer (AJCC) TNM system
- Illustrative cancers and/or tumors of the present invention include, but are not limited to, a basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; brain and central nervous system cancer; breast cancer; cancer of the peritoneum; cervical cancer; choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck; gastric cancer (including gastrointestinal cancer); glioblastoma; hepatic carcinoma; hepatoma; intra- epithelial neoplasm; kidney or renal cancer; larynx cancer; leukemia; liver cancer; lung cancer (e.g., small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, and squamous carcinoma of the lung); melanoma; myeloma; neuroblastoma; oral cavity cancer (lip, tongue, mouth, and pharynx);
- one or more rare diseases are treated, controlled or prevented with the present compositions, including, by way of illustration, Erythropoietic Protoporphyria, Hailey-Hailey Disease, Epidermolysis Bullosa (EB), Xeroderma Pigmentosum, Ehlers-Danlos Syndrome, Cutis Laxa, Protein C & Protein S Deficiency, Alport Syndrome, Striate Palmoplantar Keratoderma, Lethal Acantholytic EB, Pseudoxanthoma Elasticum (PXE), Ichthyosis Vulgaris, Pemphigus Vulgaris, and Basal Cell Nevus Syndrome.
- Erythropoietic Protoporphyria Hailey-Hailey Disease
- EB Epidermolysis Bullosa
- Xeroderma Pigmentosum Ehlers-Danlos Syndrome
- Cutis Laxa Protein C & Protein S Deficiency
- Alport Syndrome Striate Palmoplant
- the present compositions are used to treat, control or prevent one or more inflammatory diseases or conditions, such as inflammation, acute inflammation, chronic inflammation, respiratory disease, atherosclerosis, restenosis, asthma, allergic rhinitis, atopic dermatitis, septic shock, rheumatoid arthritis, inflammatory bowel disease, inflammatory pelvic disease, pain, ocular inflammatory disease, celiac disease, Leigh Syndrome, Glycerol Kinase Deficiency, Familial eosinophilia (FE), autosomal recessive spastic ataxia, laryngeal inflammatory disease; Tuberculosis, Chronic cholecystitis, Bronchiectasis, Silicosis and other pneumoconioses.
- inflammatory diseases or conditions such as inflammation, acute inflammation, chronic inflammation, respiratory disease, atherosclerosis, restenosis, asthma, allergic rhinitis, atopic dermatitis, septic shock, rheumatoi
- the present compositions are used to treat, control or prevent one or more autoimmune diseases or conditions, such as multiple sclerosis, diabetes mellitus, lupus, celiac disease, Crohn's disease, ulcerative colitis, Guillain-Barre syndrome, scleroderms, Goodpasture's syndrome, Wegener's granulomatosis, autoimmune epilepsy, Rasmussen's encephalitis, Primary biliary sclerosis, Sclerosing cholangitis, Autoimmune hepatitis, Addison's disease, Hashimoto's thyroiditis, Fibromyalgia, Menier's syndrome; transplantation rejection (e.g., prevention of allograft rejection) pernicious anemia, rheumatoid arthritis, systemic lupus erythematosus, dermatomyositis, Sjogren's syndrome, lupus erythematosus, multiple sclerosis, myasclerosis, mya
- the present compositions are used to treat, control or prevent one or more neurologic diseases, including ADHD, AIDS— Neurological Complications, Absence of the Septum Pellucidum, Acquired Epileptiform Aphasia, Acute Disseminated Encephalomyelitis, Adrenoleukodystrophy, Agenesis of the Corpus Callosum, Agnosia, Aicardi Syndrome, Alexander Disease, Alpers' Disease, Alternating Hemiplegia, Alzheimer's Disease, Amyotrophic Lateral Sclerosis, Anencephaly, Aneurysm, Angelman Syndrome, Angiomatosis, Anoxia, Aphasia, Apraxia, Arachnoid Cysts, Arachnoiditis, Arnold-Chiari Malformation, Arteriovenous Malformation, Aspartame, Asperger Syndrome, Ataxia Telangiectasia, Ataxia, Attention Deficit-Hyperactivity Disorder, Autism, Autonomic Dysfunction, Back Pain, Barth Syndrome, Batten Disease
- the present compositions are used to treat one or more respiratory diseases, such as asthma, chronic obstructive pulmonary disease (COPD), bronchiectasis, allergic rhinitis, sinusitis, pulmonary vasoconstriction, inflammation, allergies, impeded respiration, respiratory distress syndrome, cystic fibrosis, pulmonary hypertension, pulmonary vasoconstriction, emphysema, Hantavirus pulmonary syndrome (HPS), Loeffler's syndrome, Goodpasture's syndrome, Pleurisy, pneumonitis, pulmonary edema, pulmonary fibrosis, Sarcoidosis, complications associated with respiratory syncitial virus infection, and other respiratory diseases.
- respiratory diseases such as asthma, chronic obstructive pulmonary disease (COPD), bronchiectasis, allergic rhinitis, sinusitis, pulmonary vasoconstriction, inflammation, allergies, impeded respiration, respiratory distress syndrome, cystic fibrosis, pulmonary hypertension, pulmonary va
- the present compositions are used to treat, control or prevent cardiovascular disease, such as a disease or condition affecting the heart and vasculature, including but not limited to, coronary heart disease (CHD), cerebrovascular disease (CVD), aortic stenosis, peripheral vascular disease, atherosclerosis, arteriosclerosis, myocardial infarction (heart attack), cerebrovascular diseases (stroke), transient ischaemic attacks (TIA), angina (stable and unstable), atrial fibrillation, arrhythmia, vavular disease, and/or congestive heart failure.
- cardiovascular disease such as a disease or condition affecting the heart and vasculature
- CVD cerebrovascular disease
- aortic stenosis aortic stenosis
- peripheral vascular disease atherosclerosis
- arteriosclerosis myocardial infarction
- cerebrovascular diseases stroke
- TIA transient ischaemic attacks
- angina stable and unstable
- atrial fibrillation arrhythmia, va
- the present compositions are used to treat, control or prevent one or more metabolic- related disorders.
- the present invention is useful for the treatment, controlling or prevention of diabetes, including Type 1 and Type 2 diabetes and diabetes associated with obesity.
- the compositions and methods of the present invention are useful for the treatment or prevention of diabetes-related disorders, including without limitation diabetic nephropathy, hyperglycemia, impaired glucose tolerance, insulin resistance, obesity, lipid disorders, dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL levels, high LDL levels, atherosclerosis and its sequelae, vascular restenosis, irritable bowel syndrome, inflammatory bowel disease, including Crohn's disease and ulcerative colitis, other inflammatory conditions, pancreatitis, abdominal obesity, neurodegenerative disease, retinopathy, neoplastic conditions, adipose cell tumors, adipose cell carcinomas, such as liposarcoma, prostate cancer and other cancers, including gastric, breast
- a person has three or more of the following disorders: abdominal obesity, hypertriglyceridemia, low HDL cholesterol, high blood pressure, and high fasting plasma glucose), ovarian hyperandrogenism (polycystic ovary syndrome), and other disorders where insulin resistance is a component, such as sleep apnea.
- the compositions and methods of the present invention are useful for the treatment, control, or prevention of obesity, including genetic or environmental, and obesity-related disorders.
- the obesity-related disorders herein are associated with, caused by, or result from obesity.
- obesity-related disorders include obesity, diabetes, overeating, binge eating, and bulimia, hypertension, elevated plasma insulin concentrations and insulin resistance, dyslipidemia, hyperlipidemia, endometrial, breast, prostate, kidney and colon cancer, osteoarthritis, obstructive sleep apnea, gallstones, heart disease, abnormal heart rhythms and arrythmias, myocardial infarction, congestive heart failure, coronary heart disease, sudden death, stroke, polycystic ovary disease, craniopharyngioma, Prader-Willi Syndrome, Frohlich's syndrome, GH-deficient subjects, normal variant short stature, Turner's syndrome, and other pathological conditions showing reduced metabolic activity or a decrease in resting energy expenditure as a percentage of total fat-free mass, e.g, children with acute lymphoblastic leukemia.
- obesity-related disorders are Metabolic Syndrome, insulin resistance syndrome, reproductive hormone abnormalities, sexual and reproductive dysfunction, such as impaired fertility, infertility, hypogonadism in males and hirsutism in females, fetal defects associated with maternal obesity, gastrointestinal motility disorders, such as obesity-related gastro-esophageal reflux, respiratory disorders, such as obesity- hypoventilation syndrome (Pickwickian syndrome), breathlessness, cardiovascular disorders, inflammation, such as systemic inflammation of the vasculature, arteriosclerosis, hypercholesterolemia, lower back pain, gallbladder disease, hyperuricemia, gout, and kidney cancer, and increased anesthetic risk.
- the compositions and methods of the present invention are also useful to treat Alzheimer's disease.
- nucleic acids including liposomal formulations containing nucleic acids, when delivered in vivo, can accumulate in the liver and/or spleen. It has now been discovered that nucleic acids encoding proteins can modulate protein expression in the liver and spleen, and that nucleic acids used in this manner can constitute potent therapeutics for the treatment of liver and spleen diseases. Certain embodiments are therefore directed to a method for treating liver and/or spleen disease by delivering to a patient a nucleic acid encoding a protein of interest. Other embodiments are directed to a therapeutic composition comprising a nucleic acid encoding a protein of interest, for the treatment of liver and/or spleen disease.
- Diseases and conditions of the liver and/or spleen that can be treated include, but are not limited to: hepatitis, alcohol-induced liver disease, drug-induced liver disease, Epstein Barr virus infection, adenovirus infection, cytomegalovirus infection, toxoplasmosis, Rocky Mountain spotted fever, non-alcoholic fatty liver disease, hemochromatosis, Wilson's Disease, Gilbert's Disease, and cancer of the liver and/or spleen.
- the present compositions and methods relate to the treatment of type 1 diabetes, heart disease, including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, cystic fibrosis, sickle-cell anemia, thalassemia, Fanconi anemia, severe combined immunodeficiency, hereditary sensory neuropathy, xeroderma pigmentosum, Huntington's disease, muscular dystrophy, amyotrophic lateral sclerosis, Alzheimer's disease, cancer, and infectious diseases including hepatitis and HIV/AIDS.
- type 1 diabetes including ischemic and dilated cardiomyopathy, macular degeneration, Parkinson's disease, cystic fibrosis, sickle-cell anemia, thalassemia, Fanconi anemia, severe combined immunodeficiency, hereditary sensory neuropathy, xeroderma pigmentosum, Huntington's disease, muscular dystrophy, amyotrophic lateral sclerosis, Alzheimer's disease, cancer, and infectious diseases including hepatitis and HIV/AIDS
- the present methods and compositions find use in targeting any of the proteins or in treatment of any of the diseases or disorders of Table 2B.
- the present invention contemplates the targeting of the full-length and/or truncated forms of any of the proteins disclosed in Table 2B.
- the present invention contemplates the targeting of the precursor forms and/or mature forms and/or isoforms of any of the proteins disclosed in Table 2B.
- the present invention contemplates the targeting of a protein having about 60% (e.g. about 60%, or about 61 %, or about 62%, or about 63%, or about 64%, or about 65%, or about 66%, or about 67%, or about 68%, or about 69%, or about 70%, or about 71 %, or about 72%, or about 73%, or about 74%, or about 75%, or about 76%, or about 77%, or about 78%, or about 79%, or about 80%, or about 81 %, or about 82%, or about 83%, or about 84%, or about 85%, or about 86%, or about 87%, or about 88%, or about 89%, or about 90%, or about 91 %, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99%) sequence identity with any of the protein sequences disclosed herein (e.g. in Table 2B).
- the present invention contemplates the targeting of a protein comprising an amino acid sequence having one or more amino acid mutations relative to any of the protein sequences described herein (e.g. in Table 2B).
- the present invention contemplates the targeting of a protein comprising an amino acid sequence having 1 , or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 1 1 , or 12 amino acid mutations relative to any of the protein sequences described herein (e.g. in Table 2B).
- the one or more amino acid mutations may be independently selected from substitutions, insertions, deletions, and truncations.
- the amino acid mutations are amino acid substitutions, and may include conservative and/or non-conservative substitutions.
- Constant substitutions may be made, for instance, on the basis of similarity in polarity, charge, size, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the amino acid residues involved.
- the 20 naturally occurring amino acids can be grouped into the following six standard amino acid groups: (1 ) hydrophobic: Met, Ala, Val, Leu, lie; (2) neutral hydrophilic: Cys, Ser, Thr; Asn, Gin; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; and (6) aromatic: Trp, Tyr, Phe.
- conservative substitutions are defined as exchanges of an amino acid by another amino acid listed within the same group of the six standard amino acid groups shown above. For example, the exchange of Asp by Glu retains one negative charge in the so modified polypeptide.
- glycine and proline may be substituted for one another based on their ability to disrupt a-helices.
- non-conservative substitutions are defined as exchanges of an amino acid by another amino acid listed in a different group of the six standard amino acid groups (1 ) to (6) shown above.
- the substitutions may also include non-classical amino acids (e.g. selenocysteine, pyrrolysine, N-formylmethionine ⁇ -alanine, GABA and ⁇ -Aminolevulinic acid, 4-aminobenzoic acid (PABA), D- isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, ⁇ -Abu, ⁇ -Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosme, citrulline, homocitrulline, cysteic acid, t-butylglycine, t- butylalanine, phenylglycine,
- PTHY_HUMAN PTH is secreted by the chief cells of the parathyroid glands. PTH plays an important Parathyroid hormone role in the regulation of serum calcium, serum phosphate, and vitamin D synthesis.
- BMP1 belongs to the transforming growth factor-beta (TGFB) super- family. Bone morphogenic proteins induce cartilage and bone formation, play important role in TGFB.
- TGFB transforming growth factor-beta
- BMP-1 activity can morphogenetic protein 1 be determined using the following assays known in the art: Nat Genet. 2001 Jan; (isoform BMP1 -4) 27(1 ): 84- 8; Eur J Biochem 1996 Apr 1 ; 237(1 ): 295-302; J Biol Chem, Vol. 274,
- TGF-beta family of proteins initiate cell signaling by binding to heteromeric receptor complexes of type I (TbetaRI) and type II (TbetaRII)
- TbetaRII binds to TbetaRII, which then recruits and phosphorylates TbetaRI. Activated TbetaRI then
- betas on signaling can be assayed by treating Primary BAECs transfected with a construct called p3TP-Lux, containing a TGF- beta responsive promoter fused to a construct called p3TP-Lux, containing a TGF- beta responsive promoter fused to a construct called p3TP-Lux, containing a TGF- beta responsive promoter fused to a construct called p3TP-Lux, containing a TGF- beta responsive promoter fused to a
- TGF-beta family of proteins initiate cell signaling by binding to heteromeric receptor complexes of type I (TbetaRI) and type II (TbetaRII)
- TbetaRII binds to TbetaRII, which then recruits and phosphorylates TbetaRI. Activated TbetaRI then
- betas on signaling can be assayed by treating Primary BAECs transfected with a construct called p3TP-Lux, containing a TGF- beta responsive promoter fused to a construct called p3TP-Lux, containing a TGF- beta responsive promoter fused to a construct called p3TP-Lux, containing a TGF- beta responsive promoter fused to a construct called p3TP-Lux, containing a TGF- beta responsive promoter fused to a
- TGF-beta family of proteins initiate cell signaling by binding to heteromeric receptor complexes of type I (TbetaRI) and type II (TbetaRII)
- ZTGF-beta 9 GeneSeq serine/threonine kinase receptors (reviewed by Massague, J. ef al. (1994) Trends Accession Y70654 Cell Biol. 4: 172 178; Miyazono, K. ef al. (1994) Adv. Immunol. 55: 181-220).
- WO0015798 Activation of this heteromeric receptor complex occurs when TGF-beta. binds to
- TbetaRII which then recruits and phosphorylates TbetaRI. Activated TbetaRI then recruits and phosphorylates TbetaRI.
- SEQ ID NO:2 of propagates the signal to downstream targets (Chen, F. and Weinberg. R. A. (1995) WO0015798 PNA892: 1565-1569; Wrana, J. L. ef al. (1994) Nature 370: 341.
- the effect of TGF betas on signaling can be assayed by treating Primary BAECs transfected with a
- SEQ ID NO: 192 construct called p3TP-Lux, containing a TGF- beta responsive promoter fused to a reporter gene, and measuring luciferase gene expression (Wrana ef al., 1994, Nature 370: 341 -347). Useful for treating cancer and to promote wound healing.
- TGF-betaRI type I serine/threonine kinase receptors
- TbetaRII which then recruits and phosphorylates TbetaRI.
- Activated TbetaRI then antibodies GB2305921
- TGF betas propagates the signal to downstream targets (Chen, F. and Weinberg. R. A. (1995) PNA892: 1565-1569; Wrana, J. L. ef al. (1994) Nature 370: 341.
- the effect of TGF betas on signaling in the presence of an anti-TGF beta antibody can be assayed by treating Primary BAECs transfected with a construct called p3TP-Lux, containing a TGF-beta responsive promoter fused to a reporter gene, and measuring luciferase gene expression (Wrana ef al., 1994, Nature 370: 341 -347).
- TGF-betaRI protein II GeneSeq heteromeric receptor complexes of type I (TbetaRI) and type II (TbetaRII) Accession Y70552 serine/threonine kinase receptors (reviewed by Massague, J. ef al. (1994) Trends Fibroblast growth factor 6 flt-3 ligand GeneSeq
- Stem Cell Progenitor Chemokine activities can be determined using assays known in
- VEGF activity can be WO0013702
- Antagonists may be useful as anti- WO0013702
- angiogenic agents and may be applicable for cancer.
- VEGF activity can be WO0071713
- Antagonists may be useful as anti- WO0071713
- angiogenic agents and may be applicable for cancer.
- VEGF activity can be WO9940197
- Antagonists may be useful as anti- WO99/40197
- angiogenic agents and may be applicable for cancer.
- VEGF activity can be WO0013702
- Antagonists may be useful as anti- WO0013702
- angiogenic agents and may be applicable for cancer.
- VEGF activity can be W09940197
- Antagonists may be useful as anti- WO99/40197
- angiogenic agents and may be applicable for cancer.
- VEGF-165 GeneSeq Promotes the growth and/or proliferation of endothelial cells.
- VEGF activity can be Accession Y69414 determined using assays known in the art, such as those disclosed in International WO0013702 Publication No. WO0045835, for example. Promotion of growth and proliferation of growth factor receptor 2
- Vascular Endothelial Growth Factor VEGF activity can be determined using assays known in the art, such as those disclosed in International Publication No.
- Promotion of growth and proliferation of cells such as Neuropilin-2 vascular endothelial cells.
- Antagonists may be useful as anti-angiogenic agents, and (isoform A22) may be applicable for cancer.
- Troponins are contractile proteins that are thought to inhibit angiogenesis. High levels W22597 W09730085
- soluble Troponins may contribute to the difficulty encountered in revascularizing the ischemic myocardium after cardiovascular injury.
- angiogenesis can be determined using assays known in the art:. Proc Natl Acad Sci Troponin C, skeletal muscle
- Troponins are contractile proteins that are thought to inhibit angiogenesis. High levels may contribute to the difficulty encountered in revascularizing the ischemic
- GeneSeq Accession Troponins are contractile proteins that are thought to inhibit angiogenesis. High levels W22599 W09730085 may contribute to the difficulty encountered in revascularizing the ischemic myocardium after cardiovascular injury. Ability of soluble Troponins to inhibit
- SEQ ID NO:3 of angiogenesis can be determined using assays known in the art:. Proc Natl Acad Sci WO9730085 USA 1999 Mar 16; 96(6): 2645-50. Anti-angiogenesis
- GeneSeq Accession Troponins are contractile proteins that are thought to inhibit angiogenesis. High levels W18053 W09719955 may contribute to the difficulty encountered in revascularizing the ischemic myocardium after cardiovascular injury. Ability of soluble Troponins to inhibit
- SEQ ID NO:3 of angiogenesis can be determined using assays known in the art:. Proc Natl Acad Sci W09719955 USA 1999 Mar 16; 96(6): 2645-50. Anti-angiogenesis
- Troponins are contractile proteins that are thought to inhibit angiogenesis. High levels troponin I GeneSeq may contribute to the difficulty encountered in revascularizing the ischemic Accession W18054 myocardium after cardiovascular injury. Ability of soluble Troponins to inhibit W09719955 angiogenesis can be determined using assays known in the art:. Proc Natl Acad Sci
- Troponins are contractile proteins that are thought to inhibit angiogenesis. High levels GeneSeq Accession may contribute to the difficulty encountered in revascularizing the ischemic W18054 W09730085 myocardium after cardiovascular injury. Ability of soluble Troponins to inhibit angiogenesis can be determined using assays known in the art:. Proc Natl Acad Sci
- Troponin I fast skeletal muscle
- GeneSeq Accession Troponins are contractile proteins that are thought to inhibit angiogenesis. High levels B00134 WO0054770 may contribute to the difficulty encountered in revascularizing the ischemic myocardium after cardiovascular injury. Ability of soluble Troponins to inhibit
- SEQ ID NO: 1 of angiogenesis can be determined using assays known in the art:. Proc Natl Acad Sci WO0054770 USA 1999 Mar 16; 96(6): 2645-50. Anti-angiogenesis
- Troponins are contractile proteins that are thought to inhibit angiogenesis. High levels Protein GeneSeq
- angiogenesis can be determined using assays known in the art:. Proc Natl Acad Sci
- GeneSeq Accession Troponins are contractile proteins that are thought to inhibit angiogenesis. High levels B00136 WO0054770 may contribute to the difficulty encountered in revascularizing the ischemic myocardium after cardiovascular injury. Ability of soluble Troponins to inhibit
- SEQ ID NO:3 of angiogenesis can be determined using assays known in the art:. Proc Natl Acad Sci WO0054770 USA 1999 Mar 16; 96(6): 2645-50. Anti-angiogenesis
- PAIs are believed to play a role in cancer, and cardiovascular disease and blood- R08411 WO9013648
- PAI plasminogen activator inhibitor
- Plasminogen activator plasminogen activator (tPA) or urokinase (uPA): J Biochem Biophys Methods 2000 Plasminogen activator
- PAIs are believed to play a role in cancer, and cardiovascular disease and blood- GeneSeq Accession
- PAIs GeneSeq Accession PAIs are believed to play a role in cancer, and cardiovascular disease and blood- R10921 WO9102057 clotting disorders. Methods that measure plasminogen activator inhibitor (PAI) activity are known in the art, for example, assay the ability of PAI to inhibit tissue
- Methods that inhibitor 2 measure anti- angiogenesis activity are known in the art, for example, Proc Natl Acad
- PAIs are believed to play a role in cancer, and cardiovascular disease and blood- R1 1761 , R11762 and clotting disorders.
- Methods that measure plasminogen activator inhibitor (PAI) activity R1 1763 WO9105048 are known in the art, for example, assay the ability of PAI to inhibit tissue plasminogen activator (tPA) or urokinase (uPA): J Biochem Biophys Methods 2000
- Wildtype PAI-1 is provided Sep 1 1 ; 45(2): 127-40, Breast Cancer Res Treat 1996; 41 (2): 141 -6.
- Methods that as P05121/PAI 1_HUMAN measure anti- angiogenesis activity are known in the art, for example, Proc Natl Acad Plasminogen activator Sci USA 1999 Mar 16; 96(6): 2645-50. Anti-angiogenesis; blood-clotting disorders.
- inhibitor 1
- Chemokines are a family of related small, secreted proteins involved in biological
- chemokines exert their effects by acting on a family of seven transmembrane G-
- Chemokine activities can be determined type 3
- Modified Rantes GeneSeq Chemokines are a family of related small, secreted proteins involved in biological Accession W38129 processes ranging from hematopoiesis, angiogenesis, and leukocyte trafficking. WO9737005 Members of this family are involved in a similarly diverse range of pathologies including inflammation, allergy, tissue rejection, viral infection, and tumor biology. The
- Wildtype Rantes provided chemokines exert their effects by acting on a family of seven transmembrane G- herein as protein coupled receptors. Over 40 human chemokines have been described, which P13501/CCL5_HUMAN C- bind to -17 receptors thus far identified. Chemokine activities can be determined C motif chemokine 5 using assays known in the art: Methods in Molecular Biology, 2000, vol. 138:
- Chemokine Protocols Edited by: A. E. I. Proudfoot, T. N. C. Wells, and C. A. Power.
- Chemokines are a family of related small, secreted proteins involved in biological
- RANTES GeneSeq processes ranging from hematopoiesis, angiogenesis, and leukocyte trafficking. Accession Y05299 Members of this family are involved in a similarly diverse range of pathologies EP905240 including inflammation, allergy, tissue rejection, viral infection, and tumor biology.
- the chemokines exert their effects by acting on a family of seven transmembrane G-
- MCP-la GeneSeq Chemokines are a family of related small, secreted proteins involved in biological Accession R73914 processes ranging from hematopoiesis, angiogenesis, and leukocyte trafficking. WO9509232 Members of this family are involved in a similarly diverse range of pathologies including inflammation, allergy, tissue rejection, viral infection, and tumor biology.
- MCP-1 provided as chemokines exert their effects by acting on a family of seven transmembrane G- P13500/CCL2_HUMAN C- protein coupled receptors. Over 40 human chemokines have been described, which C motif chemokine 2 bind to -17 receptors thus far identified. Chemokine activities can be determined using assays known in the art: Methods in Molecular Biology, 2000, vol. 138:
- Chemokines are a family of related small, secreted proteins involved in biological
- chemokines exert their effects by acting on a family of seven transmembrane G-
- Chemokines are a family of related small, secreted proteins involved in biological processes ranging from hematopoiesis, angiogenesis, and leukocyte trafficking.
- MCP-IA Members of this family are involved in a similarly diverse range of pathologies SEQ ID NO:2 of including inflammation, allergy, tissue rejection, viral infection, and tumor biology.
- the W09519436 chemokines exert their effects by acting on a family of seven transmembrane G- protein coupled receptors. Over 40 human chemokines have been described, which
- Soluble MCP-1 Receptor polypep- tides may be W09519436 useful for inhibiting chemokine activities and viral infection.
- Chemokines are a family of related small, secreted proteins involved in biological
- the chemokines exert their effects by acting on a family of seven transmembrane G-
- Chemokines are a family of related small, secreted proteins involved in biological processes ranging from hematopoiesis, angiogenesis, and leukocyte trafficking.
- chemokines exert their effects by acting on a family of seven transmembrane G- protein coupled receptors. Over 40 human chemokines have been described, which
- Chemokine activities can be determined WO9809171
- Soluble MCP-4 Receptor polypep- tides may be useful for inhibiting chemokine activities and viral infection.
- Chemokines are a family of related small, secreted proteins involved in biological
- RANTES receptor processes ranging from hematopoiesis, angiogenesis, and leukocyte trafficking. GeneSeq Accession Members of this family are involved in a similarly diverse range of pathologies W29588 US Pat. No. including inflammation, allergy, tissue rejection, viral infection, and tumor biology.
- the 5,652, 133 chemokines exert their effects by acting on a family of seven transmembrane G- protein coupled receptors. Over 40 human chemokines have been described, which
- Chemokine Protocols Edited by: A. E. I. Proudfoot, T. N. C. Wells, and C. A. Power.
- Soluble RANTES Receptor polypep- tides may be useful for inhibiting chemokine activities and viral infection.
- CCR5 variant GeneSeq Chemokines are a family of related small, secreted proteins involved in biological Accession W88238 processes ranging from hematopoiesis, angiogenesis, and leukocyte trafficking. W09854317 Members of this family are involved in a similarly diverse range of pathologies including inflammation, allergy, tissue rejection, viral infection, and tumor biology.
- Variants of wildtype CCR5 chemokines exert their effects by acting on a family of seven transmembrane G- which has the sequence protein coupled receptors. Over 40 human chemokines have been described, which of : bind to -17 receptors thus far identified. Chemokine activities can be determined using assays known in the art: Methods in Molecular Biology, 2000, vol. 138:
- CCR5_HUMAN Chemokine Protocols Edited by: A. E. I. Proudfoot, T. N. C. Wells, and C. A. Power. C-C chemokine receptor Humana Press Inc., Totowa, NJ. Soluble CCR5 polypeptides may be useful for type 5 inhibiting chemokine activities and viral infection.
- Chemokines are a family of related small, secreted proteins involved in biological
- the chemokines exert their effects by acting on a family of seven transmembrane G-
- Chemokine Protocols Edited by: A. E. I. Proudfoot, T. N. C. Wells, and C. A. Power.
- Soluble CCR7 polypeptides may be useful for inhibiting chemokine activities and viral infection.
- Chemokines are a family of related small, secreted proteins involved in biological
- the chemokines exert their effects by acting on a family of seven transmembrane G-
- P78423/X3CL1_HUMAN protein coupled receptors Over 40 human chemokines have been described, which Fractalkine bind to -17 receptors thus far identified. Chemokine activities can be determined using assays known in the art: Methods in Molecular Biology, 2000, vol. 138:
- Chemokines are a family of related small, secreted proteins involved in biological
- Eotaxin GeneSeq processes ranging from hematopoiesis, angiogenesis, and leukocyte trafficking. Accession W10099 Members of this family are involved in a similarly diverse range of pathologies WO9700960 including inflammation, allergy, tissue rejection, viral infection, and tumor biology.
- the chemokines exert their effects by acting on a family of seven transmembrane G-
- P51671/CCL1 1_HUMAN protein coupled receptors Over 40 human chemokines have been described, which Eotaxin bind to -17 receptors thus far identified. Chemokine activities can be determined using assays known in the art: Methods in Molecular Biology, 2000, vol. 138:
- Neurotactin may play a role in chemotactic leukocyte migration and brain
- Chemotactic leukocyte migration assays are known in the art, for example: J. Immunol. Methods 33, ((1980)); Nature 1997 Jun 5; 387(6633):
- CKbeta-9 Chemokines are a family of related small, secreted proteins involved in biological GeneSeq Accession processes ranging from hematopoiesis, angiogenesis, and leukocyte trafficking. B50860 US Pat. No. Members of this family are involved in a similarly diverse range of pathologies 6, 153,441 including inflammation, allergy, tissue rejection, viral infection, and tumor biology. The chemokines exert their effects by acting on a family of seven transmembrane G-
- Chemokines are a family of related small, secreted proteins involved in biological
- chemokines exert their effects by acting on a family of seven transmembrane G.
- Chemokine activities can be determined using assays known in the art: Methods in Lymphotactin
- MIP-3 alpha GeneSeq Chemokines are a family of related small, secreted proteins involved in biological Accession W44398 processes ranging from hematopoiesis, angiogenesis, and leukocyte trafficking. WO9801557 Members of this family are involved in a similarly diverse range of pathologies including inflammation, allergy, tissue rejection, viral infection, and tumor biology. The
- P78556/CCL20_HUMAN chemokines exert their effects by acting on a family of seven transmembrane G.
- C-C motif chemokine 20 Chemokine activities can be determined using assays known in the art: Methods in (isoform 1 ) Molecular Biology, 2000, vol. 138: Chemokine Protocols. Edited by: A. E. I.
- Chemokines are a family of related small, secreted proteins involved in biological
- chemokines exert their effects by acting on a family of seven transmembrane G.
- Chemokine activities can be determined using assays known in the art: Methods in C-C motif chemokine 19
- Chemokines are a family of related small, secreted proteins involved in biological processes ranging from hematopoiesis, angiogenesis, and leukocyte trafficking.
- MIP-Gamma GeneSeq Members of this family are involved in a similarly diverse range of pathologies Accession R70798 including inflammation, allergy, tissue rejection, viral infection, and tumor biology.
- the WO2006135382 chemokines exert their effects by acting on a family of seven transmembrane G.
- Chemokine activities can be determined using assays known in the art: Methods in
- GeneSeq Accession Chemokines are a family of related small, secreted proteins involved in biological R1 1553 WO9104274 processes ranging from hematopoiesis, angiogenesis, and leukocyte trafficking.
- Thrombopoietin is involved in the regulation of the growth and differentiation of megakaryocytes and preceptors thereof.
- TPO Thrombopoietin
- TPO_HUMAN determine regulation of growth and differentiation of megakaryocytes. Mol Cell Biol Thrombopoietin 2001 Apr; 21 (8): 2659-70; Exp Hematol 2001 Jan; 29(1 ): 51 -8 and within. (isoform 1 ) Hematopoietic growth factors.
- MGF growth factor
- C-kit ligan is thought to stimulate the proliferation of mast cells, and is able to Accession Y53284, augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in R83978 and R83977 bone marrow culture.
- C-kit ligand is also though to act synergistically with other
- Chemokine activities can be determined using assays known in the art:
- Vascular Endothelial Growth Factor VEGF activity can be determined using assays (Isoform long) known in the art, such as those disclosed in International Publication No.
- WO0045835 for example. Promotion of growth and proliferation of cells, such as
- Antagonists may be useful as anti-angiogenic agents, and may be applicable for cancer.
- Melanoma inhibiting Melanoma inhibiting protein has melanoma-inhibiting activity and can be used to treat protein GeneSeq cancer (melanoma, glioblastoma, neuroblastoma, small cell lung cancer, Accession R6981 1 neuroectodermal tumors) or as an immunosuppressant (it inhibits IL-2 or WO9503328 phytohaemagglutinin induced proliferation of peripheral blood lymphocytes.
- Tumor suppressor activity of melanoma inhibiting protein can be determined using assays
- Glioma-derived growth Vascular Endothelial Growth Factor VEGF activity can be determined using assays factor GeneSeq Accession known in the art, such as those disclosed in International Publication No. P49763-3/PLGF_HUMAN may be applicable for cancer.
- WO0000612 (e.g. Table 3)
- Thrombopoietin is involved in the regulation of the growth and differentiation of
- Thrombopoietin can be assayed to provided as: determine regulation of growth and differentiation of megakaryocytes.
- WO0000612 (e.g. Table 3)
- Thrombopoietin is involved in the regulation of the growth and differentiation of
- Thrombopoietin can be assayed to provided as: determine regulation of growth and differentiation of megakaryocytes.
- WO0000612 (e.g. Table 3)
- Thrombopoietin is involved in the regulation of the growth and differentiation of
- Thrombopoietin can be assayed to provided as:
- Thrombopoietin is involved in the regulation of the growth and differentiation of Y77267 megakaryocytes and preceptors thereof.
- Thrombopoietin (TPO) can be assayed to WO0000612 (e.g. Table 3) determine regulation of growth and differentiation of megakaryocytes.
- WO0000612 e.g. Table 3
- WO0000612 (e.g. Table 3)
- Thrombopoietin is involved in the regulation of the growth and differentiation of
- Thrombopoietin can be assayed to provided as: determine regulation of growth and differentiation of megakaryocytes.
- WO0000612 (e.g. Table 3)
- Thrombopoietin is involved in the regulation of the growth and differentiation of
- Thrombopoietin can be assayed to provided as: determine regulation of growth and differentiation of megakaryocytes.
- WO0000612 (e.g. Table 3)
- Thrombopoietin is involved in the regulation of the growth and differentiation of
- Thrombopoietin can be assayed to provided as: determine regulation of growth and differentiation of megakaryocytes.
- Fractalkine is believed to play a role in chemotactic leukocyte migration and neurological disorders. Fractalkine activity can be determined using Chemotactic
- P78423/X3CL1_HUMAN leukocyte migration assays known in the art, for example: J. Immunol. Methods 33, Fractalkine ((1980)); Nature 1997 Jun 5; 387(6633): 611 -7. Immune disorders.
- Neurotrophin- 4a Neurotrophins regulate neuronal cell survival and synaptic plasticity. aee- erve grow (mature truncated form can be determined using assays known in the art: Matthews et ai, in Lymphokines wherein the precursor is and Interferens: A Practical Approach, Clemens ef al., eds, IRL Press, Washington, cleaved between amino D.C. 1987, pp. 221 -225; and Orencole & Dinarclio (1989) Cytokine 1 , 14-20. acids 1 16-117) inflammatory disorders immunologic disorders, cancer
- IL-1 beta GeneSeq Interleukins are a group of multi- functional cytokines synthesized by lymphocytes, Accession Y08322 monocytes, and macrophages.
- Known functions include stimulating proliferation of W09922763 immune cells (e.g., T helper cells, B cells, eosinophils, and lymphocytes), chemotaxis of neutrophils and T lymphocytes, and/or inhibition of interferons.
- W09922763 immune cells e.g., T helper cells, B cells, eosinophils, and lymphocytes
- chemotaxis of neutrophils and T lymphocytes chemotaxis of neutrophils and T lymphocytes
- interferons Interleukin activity
- IL1 B_HUMAN can be determined using assays known in the art: Matthews et ai, in Lymphokines lnterleukin-1 beta and Interferens: A Practical Approach, Clemens ef a/., eds, IRL Press, Washington,
- P80383, P80384, and Interleukins are a group of multi- functional cytokines synthesized by lymphocytes, P80381 WO8806161 monocytes, and macrophages.
- Known functions include stimulating proliferation of immune cells (e.g., T helper cells, B cells, eosinophils, and lymphocytes), chemotaxis
- Interleukin activity which has the sequence: can be determined using assays known in the art: Matthews et ai., in Lymphokines and Interferens: A Practical Approach, Clemens ef a/., eds, IRL Press, Washington,
- IL-4 GeneSeq Accession Interleukins are a group of multi- functional cytokines synthesized by lymphocytes, P70615 WO8702990 monocytes, and macrophages.
- Known functions include stimulating proliferation of immune cells (e.g., T helper cells, B cells, eosinophils, and lymphocytes), chemotaxis
- Interleukin activity lnterleukin-4 can be determined using assays known in the art: Matthews ef al., in Lymphokines (isoform 1 ) and Interferens: A Practical Approach, Clemens ef al., eds, IRL Press, Washington,
- Interleukins are a group of multi- functional cytokines synthesized by lymphocytes, W52161 W52162 W52163
- monocytes and macrophages.
- Known functions include stimulating proliferation of W52164 and W52165
- immune cells e.g., T helper cells, B cells, eosinophils, and lymphocytes
- chemotaxis W09747744 e.g., T helper cells, B cells, eosinophils, and lymphocytes
- Interleukin activity can be determined using assays known in the art: Matthews et ai., in Lymphokines
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Dermatology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Anesthesiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hematology (AREA)
- Medical Informatics (AREA)
- Heart & Thoracic Surgery (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicinal Preparation (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP19162770.2A EP3543339A1 (en) | 2015-02-13 | 2016-02-16 | Nucleic acid products and methods of administration thereof |
| AU2016218977A AU2016218977C1 (en) | 2015-02-13 | 2016-02-16 | Nucleic acid products and methods of administration thereof |
| EP24172111.7A EP4406585A3 (en) | 2015-02-13 | 2016-02-16 | Nucleic acid products and methods of administration thereof |
| EP16750065.1A EP3256585A4 (en) | 2015-02-13 | 2016-02-16 | Nucleic acid products and methods of administration thereof |
| CN201680021235.6A CN109477102A (zh) | 2015-02-13 | 2016-02-16 | 核酸产品及其施用方法 |
| CA2976376A CA2976376A1 (en) | 2015-02-13 | 2016-02-16 | Nucleic acid products and methods of administration thereof |
| US15/550,280 US11241505B2 (en) | 2015-02-13 | 2016-02-16 | Nucleic acid products and methods of administration thereof |
| JP2017542098A JP7199809B2 (ja) | 2015-02-13 | 2016-02-16 | 核酸製品及びその投与方法 |
| US16/789,831 US20200261599A1 (en) | 2015-02-13 | 2020-02-13 | Nucleic acid products and methods of administration thereof |
| AU2022206783A AU2022206783A1 (en) | 2015-02-13 | 2022-07-21 | Nucleic acid products and methods of administration thereof |
Applications Claiming Priority (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562116232P | 2015-02-13 | 2015-02-13 | |
| US62/116,232 | 2015-02-13 | ||
| US201562195462P | 2015-07-22 | 2015-07-22 | |
| US62/195,462 | 2015-07-22 | ||
| US201562242383P | 2015-10-16 | 2015-10-16 | |
| US62/242,383 | 2015-10-16 | ||
| US201562245726P | 2015-10-23 | 2015-10-23 | |
| US62/245,726 | 2015-10-23 | ||
| US201662289617P | 2016-02-01 | 2016-02-01 | |
| US62/289,617 | 2016-02-01 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/550,280 A-371-Of-International US11241505B2 (en) | 2015-02-13 | 2016-02-16 | Nucleic acid products and methods of administration thereof |
| US16/789,831 Continuation US20200261599A1 (en) | 2015-02-13 | 2020-02-13 | Nucleic acid products and methods of administration thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016131052A1 true WO2016131052A1 (en) | 2016-08-18 |
Family
ID=56615771
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/018065 Ceased WO2016131052A1 (en) | 2015-02-13 | 2016-02-16 | Nucleic acid products and methods of administration thereof |
Country Status (7)
| Country | Link |
|---|---|
| US (2) | US11241505B2 (cg-RX-API-DMAC7.html) |
| EP (3) | EP4406585A3 (cg-RX-API-DMAC7.html) |
| JP (3) | JP7199809B2 (cg-RX-API-DMAC7.html) |
| CN (1) | CN109477102A (cg-RX-API-DMAC7.html) |
| AU (2) | AU2016218977C1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2976376A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2016131052A1 (cg-RX-API-DMAC7.html) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018104540A1 (en) * | 2016-12-08 | 2018-06-14 | Curevac Ag | Rnas for wound healing |
| WO2018154413A1 (en) * | 2017-02-22 | 2018-08-30 | Crispr Therapeutics Ag | Materials and methods for treatment of dystrophic epidermolysis bullosa (deb) and other collagen type vii alpha 1 chain (col7a1) gene related conditions or disorders |
| WO2018178215A1 (en) | 2017-03-31 | 2018-10-04 | Accanis Biotech F&E Gmbh & Co Kg | Prevention and treatment of non-melanoma skin cancer (nmsc) |
| EP3437650A1 (en) | 2017-07-31 | 2019-02-06 | Accanis Biotech F&E GmbH & Co KG | Treatment of local skin hypotrophy conditions |
| WO2019158745A1 (de) * | 2018-02-16 | 2019-08-22 | Bontana Therapies Gmbh | Nukleinsäure-basiertes botulinum neurotoxin zur therapeutischen anwendung |
| US10501404B1 (en) | 2019-07-30 | 2019-12-10 | Factor Bioscience Inc. | Cationic lipids and transfection methods |
| WO2020146700A1 (en) * | 2019-01-10 | 2020-07-16 | Massachusetts Institute Of Technology | Lipid nanoparticles |
| US10815463B2 (en) | 2014-11-02 | 2020-10-27 | Arcturus Therapeutics, Inc. | Messenger UNA molecules and uses thereof |
| CN116675780A (zh) * | 2023-06-02 | 2023-09-01 | 东北农业大学 | 犬成纤维细胞生长因子21融合蛋白制备及其在治疗特应性皮炎中的用途 |
| US20240398983A1 (en) * | 2021-03-22 | 2024-12-05 | Recode Therapeutics, Inc. | Polynucleotide compositions, related formulations, and methods of use thereof |
| US12344572B2 (en) | 2019-07-03 | 2025-07-01 | Factor Bioscience Inc. | Cationic lipids and transfection methods |
Families Citing this family (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RS60410B1 (sr) * | 2016-04-08 | 2020-07-31 | Krystal Biotech Inc | Kompozicije za upotrebu u metodama za tretman rana, poremećaja i bolesti kože |
| IL308824A (en) | 2016-08-17 | 2024-01-01 | Factor Bioscience Inc | Nucleic acid products and methods of administration thereof |
| CA3051839A1 (en) | 2017-02-17 | 2018-08-23 | Bristol-Myers Squibb Company | Antibodies to alpha-synuclein and uses thereof |
| CA3266235A1 (en) * | 2018-09-26 | 2025-11-29 | Krystal Biotech, Inc. | COMPOSITIONS AND METHODS FOR THE TREATMENT OF SKIN DISEASES |
| EP3921334A1 (en) | 2019-02-08 | 2021-12-15 | Krystal Biotech, Inc. | Compositions and methods for delivering cftr polypeptides |
| AU2020232238B2 (en) * | 2019-03-01 | 2025-10-30 | Flagship Pioneering Innovations Vi, Llc | Polyribonucleotides and cosmetic uses thereof |
| MA55082A (fr) * | 2019-03-01 | 2022-01-05 | Flagship Pioneering Innovations Vi Llc | Compositions, procédés, et kits pour l'administration de polyribonucléotides |
| WO2020223674A2 (en) * | 2019-05-01 | 2020-11-05 | Board Of Regents Of The University Of Texas System | Methods and compositions for regulating adipogenesis |
| MX2022001664A (es) | 2019-08-09 | 2022-07-19 | Nutcracker Therapeutics Inc | Aparato microfluídico y metodos de uso del mismo. |
| WO2021231549A2 (en) * | 2020-05-12 | 2021-11-18 | Factor Bioscience Inc. | Engineered gene-editing proteins |
| CN114717229B (zh) * | 2021-01-05 | 2024-09-10 | 麦塞拿治疗(香港)有限公司 | 治疗性mRNA的无细胞和无载体体外RNA转录方法和核酸分子 |
| BR112023020209A2 (pt) | 2021-04-02 | 2023-12-19 | Krystal Biotech Inc | Genoma do vírus do herpes recombinante, vírus do herpes, composição farmacêutica, uso do vírus do herpes ou da composição farmacêutica, método para expressar, realçar, aumentar, ampliar e/ou suplementar os níveis de um polipeptídeo imunomodulatório, método para prover alívio profilático, paliativo ou terapêutico, e, método para tratar câncer |
| EP4334330A1 (en) | 2021-05-07 | 2024-03-13 | Helix Nanotechnologies, Inc. | Modified ribonucleic acids and uses thereof |
| CN114350801B (zh) * | 2022-01-05 | 2023-10-20 | 华北理工大学 | 一种尘肺病人早期筛查的mRNA检测引物组和探针、试剂盒及应用 |
| WO2024229116A2 (en) * | 2023-05-01 | 2024-11-07 | Factor Bioscience Inc. | Methods for reprogramming and gene editing cells |
| WO2025024500A1 (en) * | 2023-07-25 | 2025-01-30 | Passport Technologies, Inc. | Methods and systems for transdermal immunotherapy |
| CN117783501B (zh) * | 2024-02-26 | 2024-05-10 | 四川大学华西第二医院 | 辛酸钠在注意缺陷与多动障碍中的应用及产品 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050272634A1 (en) * | 2002-07-26 | 2005-12-08 | Bahlmann Ferdinand H | Use of erythropoietin |
| US20110213335A1 (en) * | 2008-11-18 | 2011-09-01 | Burton Scott A | Hollow microneedle array and method |
| WO2013078199A2 (en) * | 2011-11-23 | 2013-05-30 | Children's Medical Center Corporation | Methods for enhanced in vivo delivery of synthetic, modified rnas |
| US20140356906A1 (en) * | 2011-12-05 | 2014-12-04 | Factor Bioscience Inc. | Methods and products for transfecting cells |
| WO2015117021A1 (en) * | 2014-01-31 | 2015-08-06 | Factor Bioscience Inc. | Methods and products for nucleic acid production and delivery |
Family Cites Families (160)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3034507A (en) | 1960-05-10 | 1962-05-15 | American Cyanamid Co | Intracutaneous injection device |
| US3539465A (en) | 1968-10-08 | 1970-11-10 | Ncr Co | Encapsulation of hydrophilic liquid-in-oil emulsions |
| US3675766A (en) | 1970-02-04 | 1972-07-11 | Sol Roy Rosenthal | Multiple puncture injector device |
| US4897355A (en) | 1985-01-07 | 1990-01-30 | Syntex (U.S.A.) Inc. | N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| US6506729B1 (en) | 1991-03-11 | 2003-01-14 | Curis, Inc. | Methods and compositions for the treatment and prevention of Parkinson's disease |
| US6949505B1 (en) | 1991-03-11 | 2005-09-27 | Curis, Inc. | Morphogen-induced dendritic growth |
| US6800603B2 (en) | 1991-03-11 | 2004-10-05 | Curis, Inc. | Morphogen-induced neural cell adhesion |
| US5656593A (en) | 1991-03-11 | 1997-08-12 | Creative Biomolecules, Inc. | Morphogen induced periodontal tissue regeneration |
| US5849686A (en) | 1991-03-11 | 1998-12-15 | Creative Biomolecules, Inc. | Morphogen-induced liver regeneration |
| US5674844A (en) | 1991-03-11 | 1997-10-07 | Creative Biomolecules, Inc. | Treatment to prevent loss of and/or increase bone mass in metabolic bone diseases |
| US5993434A (en) | 1993-04-01 | 1999-11-30 | Genetronics, Inc. | Method of treatment using electroporation mediated delivery of drugs and genes |
| US5843780A (en) | 1995-01-20 | 1998-12-01 | Wisconsin Alumni Research Foundation | Primate embryonic stem cells |
| US5711964A (en) | 1995-06-07 | 1998-01-27 | United States Of America | Method for the intracellular delivery of biomolecules using liposomes containing cationic lipids and vitamin D |
| EP0894004B2 (en) | 1996-03-22 | 2007-02-21 | Curis, Inc. | Method for enhancing functional recovery of motor coordination, speech or sensory perception after central nervous system ischemia or trauma |
| US6498142B1 (en) | 1996-05-06 | 2002-12-24 | Curis, Inc. | Morphogen treatment for chronic renal failure |
| US6602693B1 (en) | 1996-07-03 | 2003-08-05 | Clear Solutions Biotech, Inc. | Gene encoding hyaluronan synthase |
| US6413544B1 (en) | 1996-08-19 | 2002-07-02 | The United States Of America As Represented By The Department Of Health And Human Services | Liposome complexes for increased systemic delivery |
| US6770291B2 (en) | 1996-08-30 | 2004-08-03 | The United States Of America As Represented By The Department Of Health And Human Services | Liposome complexes for increased systemic delivery |
| TW520297B (en) | 1996-10-11 | 2003-02-11 | Sequus Pharm Inc | Fusogenic liposome composition and method |
| US6653104B2 (en) | 1996-10-17 | 2003-11-25 | Immunomedics, Inc. | Immunotoxins, comprising an internalizing antibody, directed against malignant and normal cells |
| CA2277278A1 (en) | 1997-01-10 | 1998-07-16 | Life Technologies, Inc. | Embryonic stem cell serum replacement |
| US6316260B1 (en) | 1997-08-22 | 2001-11-13 | Bernina Biosystems Gmbh | Tetraether lipid derivatives and liposomes and lipid agglomerates containing tetraether lipid derivatives, and use thereof |
| US20030083272A1 (en) | 1997-09-19 | 2003-05-01 | Lahive & Cockfield, Llp | Sense mrna therapy |
| NZ512244A (en) | 1998-11-12 | 2003-12-19 | Invitrogen Corp | Polycationic transfection reagents for introducing anions into a cell |
| GB9902000D0 (en) | 1999-01-30 | 1999-03-17 | Delta Biotechnology Ltd | Process |
| CA2376128C (en) | 1999-06-04 | 2009-01-06 | Georgia Tech Research Corporation | Devices and methods for enhanced microneedle penetration of biological barriers |
| US20110171185A1 (en) | 1999-06-30 | 2011-07-14 | Klimanskaya Irina V | Genetically intact induced pluripotent cells or transdifferentiated cells and methods for the production thereof |
| US20020054895A1 (en) | 1999-07-23 | 2002-05-09 | Alwyn Company, Inc. | Allantoin-containing skin cream |
| US6595947B1 (en) | 2000-05-22 | 2003-07-22 | Becton, Dickinson And Company | Topical delivery of vaccines |
| AU2001294750C1 (en) | 2000-09-26 | 2008-09-18 | Idera Pharmaceuticals, Inc. | Modulation of immunostimulatory activity of immunostimulatory oligonucleotide analogs by positional chemical changes |
| US7189759B2 (en) | 2001-05-23 | 2007-03-13 | Medicis Pharmaceutical Corporation | Compositions for the treatment of pigmentation disorders and methods for their manufacture |
| WO2003018767A2 (en) | 2001-08-27 | 2003-03-06 | Advanced Cell Technology, Inc. | Trans-differentiation and re-differentiation of somatic cells and production of cells for cell therapies |
| EP1437403A4 (en) | 2001-09-21 | 2004-10-27 | Japan Science & Tech Corp | METHOD FOR PATTERNING REPROGRAMMING FACTOR, METHOD OF PATTERNED REPROGRAMMING FACTOR, METHOD FOR USE OF REPROGRAMMING FACTOR, METHOD FOR DIFFERENTIATING AND SIFE-INGENATING FAN |
| CA2463914A1 (en) | 2001-10-18 | 2003-04-24 | Ixion Biotechnology, Inc. | Conversion of liver stem and progenitor cells to pancreatic functional cells |
| US7276489B2 (en) | 2002-10-24 | 2007-10-02 | Idera Pharmaceuticals, Inc. | Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5′ ends |
| GB0202149D0 (en) | 2002-01-30 | 2002-03-20 | Univ Edinburgh | Pluripotency determining factors and uses thereof |
| US20030186249A1 (en) | 2002-04-01 | 2003-10-02 | Zairen Sun | Human TARPP genes and polypeptides |
| JP3785508B2 (ja) | 2002-04-15 | 2006-06-14 | 学校法人慶應義塾 | 遺伝子治療における免疫応答を解析できる実験モデルマウス |
| US7737182B2 (en) | 2002-08-09 | 2010-06-15 | Taisho Pharmaceutical Co., Ltd. | Pharmaceuticals for xerosis |
| JP4579911B2 (ja) | 2003-06-03 | 2010-11-10 | アイシス・ファーマシューティカルズ・インコーポレイテッド | スルビビン発現の調節 |
| US20070134796A1 (en) | 2005-07-26 | 2007-06-14 | Sangamo Biosciences, Inc. | Targeted integration and expression of exogenous nucleic acid sequences |
| JP2007512355A (ja) | 2003-11-21 | 2007-05-17 | アルザ コーポレイション | 開裂性のpegで表面修飾されたリポソーム−dna複合体で媒介される遺伝子送達 |
| US7682828B2 (en) | 2003-11-26 | 2010-03-23 | Whitehead Institute For Biomedical Research | Methods for reprogramming somatic cells |
| ATE549395T1 (de) | 2004-09-08 | 2012-03-15 | Wisconsin Alumni Res Found | Medium und kultur von embryonalen stammzellen |
| AU2005282414C1 (en) | 2004-09-08 | 2011-04-07 | Wisconsin Alumni Research Foundation | Culturing human embryonic stem cells |
| US20090202638A2 (en) | 2004-10-27 | 2009-08-13 | New York Society For The Ruptured And Crippled Maintaining The Hospital For Special Surgery | Bmp gene and fusion protein |
| BRPI0606934A2 (pt) | 2005-01-25 | 2017-07-11 | Cell Therapeutics Inc | Conjugado de proteína biologicamente ativa, composição, molécula de dna quimérica, vetor, célula, e, métodos para preparar conjugado de proteína biologicamente ativa, e para determinar se um dado conjugado de proteína exibe uma meia-vida de plasma modificada comparada com a meia-vida intrínseca do polipeptídeo biologicamente ativo não conjungado |
| CN101203222A (zh) * | 2005-03-30 | 2008-06-18 | 艾升制药公司 | 用于治疗湿疹的丙嗪或紧密相关的化合物 |
| WO2007006808A1 (en) | 2005-07-13 | 2007-01-18 | Novo Nordisk Health Care Ag | Host cell protein knock-out cells for production of therapeutic proteins |
| US8323666B2 (en) | 2005-08-01 | 2012-12-04 | Allergan, Inc. | Botulinum toxin compositions |
| PL2578685T3 (pl) | 2005-08-23 | 2020-01-31 | The Trustees Of The University Of Pennsylvania | Rna zawierający zmodyfikowane nukleozydy i sposoby jego zastosowania |
| US9012219B2 (en) * | 2005-08-23 | 2015-04-21 | The Trustees Of The University Of Pennsylvania | RNA preparations comprising purified modified RNA for reprogramming cells |
| EP1962719A4 (en) | 2005-08-29 | 2011-05-04 | Technion Res And Dev Of Foundation Ltd | MEDIA FOR BREEDING STEM CELLS |
| TW200732347A (en) | 2005-10-06 | 2007-09-01 | Trophogen Inc | VEGF analogs and methods of use |
| US8048999B2 (en) | 2005-12-13 | 2011-11-01 | Kyoto University | Nuclear reprogramming factor |
| US8278104B2 (en) | 2005-12-13 | 2012-10-02 | Kyoto University | Induced pluripotent stem cells produced with Oct3/4, Klf4 and Sox2 |
| US8129187B2 (en) | 2005-12-13 | 2012-03-06 | Kyoto University | Somatic cell reprogramming by retroviral vectors encoding Oct3/4. Klf4, c-Myc and Sox2 |
| KR20080078010A (ko) | 2005-12-22 | 2008-08-26 | 체에스엘 베링 게엠베하 | 옥타노에이트-감소된 사람 알부민 |
| US7658728B2 (en) | 2006-01-10 | 2010-02-09 | Yuzhakov Vadim V | Microneedle array, patch, and applicator for transdermal drug delivery |
| DE102006051516A1 (de) | 2006-10-31 | 2008-05-08 | Curevac Gmbh | (Basen-)modifizierte RNA zur Expressionssteigerung eines Proteins |
| GB0623635D0 (en) | 2006-11-27 | 2007-01-03 | Stem Cell Sciences Uk Ltd | Pluripotent cell growth media |
| US7785301B2 (en) | 2006-11-28 | 2010-08-31 | Vadim V Yuzhakov | Tissue conforming microneedle array and patch for transdermal drug delivery or biological fluid collection |
| WO2008073856A2 (en) | 2006-12-08 | 2008-06-19 | Massachusetts Institute Of Technology | Delivery of nanoparticles and/or agents to cells |
| CN101200758A (zh) | 2006-12-15 | 2008-06-18 | 华中科技大学 | 一种检测col7a1基因突变的方法及其用途 |
| US10829733B2 (en) | 2007-01-04 | 2020-11-10 | Biolamina Ab | Composition and method for enabling proliferation of pluripotent human stem cells |
| WO2008086529A2 (en) | 2007-01-11 | 2008-07-17 | Yale University | Compositions and methods for targeted inactivation of hiv cell surface receptors |
| WO2008097926A2 (en) | 2007-02-02 | 2008-08-14 | Yale University | Transient transfection with rna |
| US9249423B2 (en) | 2007-02-02 | 2016-02-02 | Yale University | Method of de-differentiating and re-differentiating somatic cells using RNA |
| JP5813321B2 (ja) | 2007-03-23 | 2015-11-17 | ウィスコンシン アラムニ リサーチ ファンデーション | 体細胞の再プログラム化 |
| CN105861443A (zh) | 2007-04-07 | 2016-08-17 | 怀特黑德生物医学研究所 | 体细胞重编程 |
| JP2008307007A (ja) | 2007-06-15 | 2008-12-25 | Bayer Schering Pharma Ag | 出生後のヒト組織由来未分化幹細胞から誘導したヒト多能性幹細胞 |
| KR20100087298A (ko) * | 2007-09-28 | 2010-08-04 | 교와 핫꼬 기린 가부시키가이샤 | 피부 질환의 예방 및/또는 치료제 |
| JP5558097B2 (ja) | 2007-12-10 | 2014-07-23 | 国立大学法人京都大学 | 効率的な核初期化方法 |
| WO2009077509A1 (en) | 2007-12-14 | 2009-06-25 | Dsm Ip Assets B.V. | Sol-gel process with a protected catalyst |
| EP2072618A1 (en) | 2007-12-14 | 2009-06-24 | Johannes Gutenberg-Universität Mainz | Use of RNA for reprogramming somatic cells |
| JP5529754B2 (ja) | 2007-12-21 | 2014-06-25 | ストライカー コーポレイション | Nogginに対する感受性が低下したBMP変異体 |
| MX2010010165A (es) | 2008-03-17 | 2010-11-25 | Scripps Research Inst | Procedimientos quimicos y geneticos combinados para generacion de celulas madre pluripotentes inducidas. |
| US20110045001A1 (en) | 2008-03-28 | 2011-02-24 | Biontex Laboratories Gmbh | Transfection results of non-viral gene delivery systems by influencing of the innate immune system |
| WO2009127230A1 (en) | 2008-04-16 | 2009-10-22 | Curevac Gmbh | MODIFIED (m)RNA FOR SUPPRESSING OR AVOIDING AN IMMUNOSTIMULATORY RESPONSE AND IMMUNOSUPPRESSIVE COMPOSITION |
| JP2011160661A (ja) | 2008-06-02 | 2011-08-25 | Kyowa Hakko Kirin Co Ltd | 血球細胞の初期化法 |
| EP3279314A1 (en) | 2008-06-04 | 2018-02-07 | Cellular Dynamics International, Inc. | Methods for the production of ips cells using non-viral approach |
| GB2460552B (en) | 2008-06-05 | 2011-09-07 | Iti Scotland Ltd | Stem cell culture media and methods |
| US8669048B2 (en) | 2008-06-24 | 2014-03-11 | Parkinson's Institute | Pluripotent cell lines and methods of use thereof |
| US20100184033A1 (en) | 2008-07-16 | 2010-07-22 | West Michael D | Methods to accelerate the isolation of novel cell strains from pluripotent stem cells and cells obtained thereby |
| EP2151248A1 (en) | 2008-07-30 | 2010-02-10 | Johann Bauer | Improved pre-mRNA trans-splicing molecule (RTM) molecules and their uses |
| WO2010022194A2 (en) | 2008-08-20 | 2010-02-25 | Virxsys Corporation | Compositions and methods for generation of pluripotent stem cells |
| US20100076057A1 (en) | 2008-09-23 | 2010-03-25 | Northwestern University | TARGET DNA INTERFERENCE WITH crRNA |
| DK2356221T3 (en) | 2008-10-24 | 2019-02-18 | Wisconsin Alumni Res Found | Pluripotent stem cells obtained by non-viral reprogramming |
| EP2881461A1 (en) | 2008-11-21 | 2015-06-10 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Reprogramming cells toward a pluripotent state |
| EP2206723A1 (en) | 2009-01-12 | 2010-07-14 | Bonas, Ulla | Modular DNA-binding domains |
| US20110239315A1 (en) | 2009-01-12 | 2011-09-29 | Ulla Bonas | Modular dna-binding domains and methods of use |
| EP2412800A1 (en) | 2010-07-29 | 2012-02-01 | Koninklijke Nederlandse Akademie van Wetenschappen | Liver organoid, uses thereof and culture method for obtaining them |
| US20100209404A1 (en) | 2009-02-10 | 2010-08-19 | University Of Dayton | Enhanced method for producing stem-like cells from somatic cells |
| US10894944B2 (en) | 2009-04-10 | 2021-01-19 | Monash University | Cell culture media |
| WO2010123501A1 (en) | 2009-04-22 | 2010-10-28 | Massachusetts Institute Of Technology | Innate immune suppression enables repeated delivery of long rna molecules |
| US10837020B2 (en) | 2009-04-22 | 2020-11-17 | Massachusetts Institute Of Technology | Innate immune suppression enables repeated delivery of long RNA molecules |
| EP2421957B1 (en) | 2009-04-22 | 2020-11-18 | Viacyte, Inc. | Cell compositions derived from dedifferentiated reprogrammed cells |
| EP2251437B1 (en) | 2009-05-13 | 2013-12-04 | Hannelore Breitenbach-Koller | Method for identifying compounds that control the translational activity of ribosomal proteins in differential mRNA expression |
| US8496941B2 (en) | 2009-06-03 | 2013-07-30 | National Institute Of Advanced Industrial Science And Technology | Vectors for generating pluripotent stem cells and methods of producing pluripotent stem cells using the same |
| WO2010148050A2 (en) | 2009-06-16 | 2010-12-23 | Curna, Inc. | Treatment of collagen gene related diseases by inhibition of natural antisense transcript to a collagen gene |
| CA2769670C (en) | 2009-07-31 | 2018-10-02 | Ethris Gmbh | Rna with a combination of unmodified and modified nucleotides for protein expression |
| US8586526B2 (en) | 2010-05-17 | 2013-11-19 | Sangamo Biosciences, Inc. | DNA-binding proteins and uses thereof |
| WO2011056971A2 (en) | 2009-11-04 | 2011-05-12 | Cellular Dynamics International, Inc. | Episomal reprogramming with chemicals |
| AU2010319555A1 (en) | 2009-11-11 | 2012-06-14 | Sanford-Burnham Medical Research Institute | Method for generation and regulation of iPS cells and compositions thereof |
| US8808982B2 (en) | 2009-12-07 | 2014-08-19 | Cellscript, Llc | Compositions and methods for reprogramming eukaryotic cells |
| US20130189741A1 (en) | 2009-12-07 | 2013-07-25 | Cellscript, Inc. | Compositions and methods for reprogramming mammalian cells |
| WO2011072246A2 (en) | 2009-12-10 | 2011-06-16 | Regents Of The University Of Minnesota | Tal effector-mediated dna modification |
| US8557972B2 (en) | 2009-12-21 | 2013-10-15 | University Of Washington Through Its Center For Commercialization | Compositions and methods for transfection of RNA and controlled stabilization of transfected RNA |
| CA2788635A1 (en) | 2010-02-01 | 2011-08-04 | The Board Of Trustees Of The Leland Stanford Junior University | Enhanced efficiency of induced pluripotent stem cell generation |
| US20140194482A1 (en) | 2010-02-02 | 2014-07-10 | Scioderm, Inc. | Compositions and methods of treatment of inflammatory skin conditions using allantoin |
| JPWO2011102532A1 (ja) | 2010-02-16 | 2013-06-17 | 国立大学法人九州大学 | 誘導肝細胞 |
| WO2011110886A1 (en) | 2010-03-09 | 2011-09-15 | Biolamina Ab | Composition and method for enabling proliferation of pluripotent human stem cells |
| US8802438B2 (en) | 2010-04-16 | 2014-08-12 | Children's Medical Center Corporation | Compositions, kits, and methods for making induced pluripotent stem cells using synthetic modified RNAs |
| CN102234627B (zh) | 2010-04-30 | 2015-06-03 | 中国科学院广州生物医药与健康研究院 | 一种培养基添加剂及其应用 |
| WO2011140397A2 (en) | 2010-05-05 | 2011-11-10 | The Regents Of The University Of California Office Of The President | Stem cell defined media for xeno-free and feeder free conditions and uses thereof |
| US8048675B1 (en) | 2010-05-12 | 2011-11-01 | Ipierian, Inc. | Integration-free human induced pluripotent stem cells from blood |
| CA2799095A1 (en) | 2010-05-12 | 2011-11-17 | Cellectis | Meganuclease variants cleaving a dna target sequence from the dystrophin gene and uses thereof |
| EP2392208B1 (en) | 2010-06-07 | 2016-05-04 | Helmholtz Zentrum München Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) | Fusion proteins comprising a DNA-binding domain of a Tal effector protein and a non-specific cleavage domain of a restriction nuclease and their use |
| AU2011265733B2 (en) | 2010-06-14 | 2014-04-17 | Iowa State University Research Foundation, Inc. | Nuclease activity of TAL effector and Foki fusion protein |
| US9279103B2 (en) | 2010-08-05 | 2016-03-08 | Wisconsin Alumni Research Foundation | Simplified basic media for human pluripotent cell culture |
| WO2012019168A2 (en) * | 2010-08-06 | 2012-02-09 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US20140127814A1 (en) | 2010-08-10 | 2014-05-08 | Srinivasan Chandrasegaran | Generation and use of pluripotent stem cells |
| EP2616540A4 (en) | 2010-09-14 | 2014-02-19 | Univ Kyoto | METHOD FOR EFFICIENT MANUFACTURE OF INDUCED PLURIPOTENTER STEM CELLS |
| EP2625189B1 (en) | 2010-10-01 | 2018-06-27 | ModernaTX, Inc. | Engineered nucleic acids and methods of use thereof |
| WO2012048213A1 (en) | 2010-10-08 | 2012-04-12 | Regents Of The University Of Minnesota | A method to increase gene targeting frequency |
| JP5888753B2 (ja) | 2010-11-04 | 2016-03-22 | 国立大学法人京都大学 | 効率的な人工多能性幹細胞の樹立方法 |
| WO2012094132A1 (en) | 2011-01-05 | 2012-07-12 | Sangamo Biosciences, Inc. | Methods and compositions for gene correction |
| CN103502436A (zh) | 2011-03-07 | 2014-01-08 | 麻省理工学院 | 用核酸转染细胞的方法 |
| AU2012236099A1 (en) | 2011-03-31 | 2013-10-03 | Moderna Therapeutics, Inc. | Delivery and formulation of engineered nucleic acids |
| WO2012131090A1 (en) | 2011-03-31 | 2012-10-04 | Galderma Research & Development | Method for treatment of xeroderma pigmentosum |
| EP3460064B8 (en) | 2011-04-03 | 2024-03-20 | The General Hospital Corporation d/b/a Massachusetts General Hospital | Efficient protein expression in vivo using modified rna (mod-rna) |
| CA3111953C (en) | 2011-04-05 | 2023-10-24 | Cellectis | Method for the generation of compact tale-nucleases and uses thereof |
| WO2012174224A2 (en) | 2011-06-17 | 2012-12-20 | Calando Pharmaceuticals, Inc. | Methods for administering nucleic acid-based therapeutics |
| WO2012176015A1 (en) | 2011-06-24 | 2012-12-27 | Leo Pharma A/S | Methods for treating uv-damaged skin and scc tumors and for removing tattoos with topical ingenol mebutate |
| WO2013003475A1 (en) | 2011-06-27 | 2013-01-03 | Cellscript, Inc. | Inhibition of innate immune response |
| JP2014520551A (ja) | 2011-07-11 | 2014-08-25 | セルラー ダイナミクス インターナショナル, インコーポレイテッド | 細胞のリプログラミング方法およびゲノムの改変方法 |
| EP2753704A4 (en) | 2011-08-03 | 2015-07-08 | Lotus Tissue Repair Inc | COLLAGEN 7 AND ASSOCIATED METHODS |
| DE19216461T1 (de) | 2011-10-03 | 2021-10-07 | Modernatx, Inc. | Modifizierte nukleoside, nukleotide und nukleinsäuren und verwendungen davon |
| ES2670495T3 (es) | 2011-10-11 | 2018-05-30 | Inserm - Institut National De La Santé Et De La Recherche Médicale | Tratamiento de salto de exones para epidermólisis ampollosa distrófica |
| US8497124B2 (en) | 2011-12-05 | 2013-07-30 | Factor Bioscience Inc. | Methods and products for reprogramming cells to a less differentiated state |
| WO2013090186A1 (en) * | 2011-12-14 | 2013-06-20 | modeRNA Therapeutics | Modified nucleic acids, and acute care uses thereof |
| CA3018046A1 (en) | 2011-12-16 | 2013-06-20 | Moderna Therapeutics, Inc. | Modified nucleoside, nucleotide, and nucleic acid compositions |
| CN104968354A (zh) | 2011-12-21 | 2015-10-07 | 现代治疗公司 | 增加器官或器官外植体的活力或寿命的方法 |
| EP3144389B1 (en) | 2011-12-30 | 2018-05-09 | Cellscript, Llc | Making and using in vitro-synthesized ssrna for introducing into mammalian cells to induce a biological or biochemical effect |
| WO2013151665A2 (en) * | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of proteins associated with human disease |
| WO2013152220A2 (en) | 2012-04-04 | 2013-10-10 | Life Technologies Corporation | Tal-effector assembly platform, customized services, kits and assays |
| US20150211004A1 (en) * | 2012-04-20 | 2015-07-30 | Agency For Science, Technology And Research | Rnai-based therapies for cardiomyopathies, muscular dystrophies and laminopathies |
| SG11201407768QA (en) | 2012-04-24 | 2015-01-29 | Brigham & Womens Hospital | Generating pluripotent cells de novo |
| US10119150B2 (en) | 2012-05-13 | 2018-11-06 | Allele Biotechnology & Pharmaceuticals, Inc. | Feeder-free Derivation of human-induced pluripotent stem cells with synthetic messenger RNA |
| US10155929B2 (en) | 2012-05-13 | 2018-12-18 | Allele Biotechnology & Pharmaceuticals, Inc. | Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger RNA |
| EP3561054B1 (en) | 2012-05-13 | 2023-07-05 | Allele Biotechnology And Pharmaceuticals, Inc. | Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger rna |
| US20140031295A1 (en) | 2012-07-19 | 2014-01-30 | Lotus Tissue Repair, Inc. | Recombinant C7 and Methods of Use |
| KR102121086B1 (ko) | 2012-11-01 | 2020-06-09 | 팩터 바이오사이언스 인크. | 세포에서 단백질을 발현시키는 방법들과 생성물들 |
| AU2014218667A1 (en) | 2013-02-22 | 2015-10-08 | The Board Of Trustees Of The Leland Stanford Junior University | Compounds, compositions, methods, and kits relating to telomere extension |
| CN105229144A (zh) | 2013-02-22 | 2016-01-06 | 细胞动力学国际有限公司 | 通过组合的遗传工程和化学工程经由正向编程产生肝细胞 |
| WO2014134412A1 (en) | 2013-03-01 | 2014-09-04 | Regents Of The University Of Minnesota | Talen-based gene correction |
| WO2015038075A1 (en) | 2013-09-16 | 2015-03-19 | Agency For Science, Technology And Research | Method |
| BR112016013516A8 (pt) | 2013-12-12 | 2020-05-19 | Life Technologies Corp | complexo de transfecção e seu uso para aumentar transporte de molécula de carga em células e para o tratamento de câncer e terapia gênica, bem como método in vitro para fornecer um poliânion a uma célula |
| EP3053585A1 (en) * | 2013-12-13 | 2016-08-10 | Moderna Therapeutics, Inc. | Alternative nucleic acid molecules and uses thereof |
| RU2021118125A (ru) | 2014-12-29 | 2022-04-06 | Новартис Аг | Способы получения экспрессирующих химерный антигенный рецептор клеток |
-
2016
- 2016-02-16 CA CA2976376A patent/CA2976376A1/en active Pending
- 2016-02-16 EP EP24172111.7A patent/EP4406585A3/en not_active Withdrawn
- 2016-02-16 AU AU2016218977A patent/AU2016218977C1/en active Active
- 2016-02-16 JP JP2017542098A patent/JP7199809B2/ja active Active
- 2016-02-16 WO PCT/US2016/018065 patent/WO2016131052A1/en not_active Ceased
- 2016-02-16 EP EP19162770.2A patent/EP3543339A1/en not_active Ceased
- 2016-02-16 EP EP16750065.1A patent/EP3256585A4/en not_active Withdrawn
- 2016-02-16 CN CN201680021235.6A patent/CN109477102A/zh active Pending
- 2016-02-16 US US15/550,280 patent/US11241505B2/en active Active
-
2020
- 2020-02-13 US US16/789,831 patent/US20200261599A1/en not_active Abandoned
-
2021
- 2021-10-01 JP JP2021163064A patent/JP7638844B2/ja active Active
-
2022
- 2022-07-21 AU AU2022206783A patent/AU2022206783A1/en not_active Abandoned
-
2024
- 2024-10-03 JP JP2024174419A patent/JP2025013347A/ja active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050272634A1 (en) * | 2002-07-26 | 2005-12-08 | Bahlmann Ferdinand H | Use of erythropoietin |
| US20110213335A1 (en) * | 2008-11-18 | 2011-09-01 | Burton Scott A | Hollow microneedle array and method |
| WO2013078199A2 (en) * | 2011-11-23 | 2013-05-30 | Children's Medical Center Corporation | Methods for enhanced in vivo delivery of synthetic, modified rnas |
| US20140356906A1 (en) * | 2011-12-05 | 2014-12-04 | Factor Bioscience Inc. | Methods and products for transfecting cells |
| WO2015117021A1 (en) * | 2014-01-31 | 2015-08-06 | Factor Bioscience Inc. | Methods and products for nucleic acid production and delivery |
Non-Patent Citations (3)
| Title |
|---|
| "Guidance Notes for the Safe Storage and Handling of Cryogenic Materials", December 2002 (2002-12-01), pages 1 - 32, XP055474543, Retrieved from the Internet <URL:https://www.st-andrews.ac.uk/staff/policy/healthandsafety/publications/cryogenics-safestorageandhandling/#5-7> * |
| DATABASE UniProtKB [O] 21 July 1986 (1986-07-21), XP055473304, Database accession no. P60568 * |
| See also references of EP3256585A4 * |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10815463B2 (en) | 2014-11-02 | 2020-10-27 | Arcturus Therapeutics, Inc. | Messenger UNA molecules and uses thereof |
| US11542490B2 (en) | 2016-12-08 | 2023-01-03 | CureVac SE | RNAs for wound healing |
| WO2018104540A1 (en) * | 2016-12-08 | 2018-06-14 | Curevac Ag | Rnas for wound healing |
| WO2018154413A1 (en) * | 2017-02-22 | 2018-08-30 | Crispr Therapeutics Ag | Materials and methods for treatment of dystrophic epidermolysis bullosa (deb) and other collagen type vii alpha 1 chain (col7a1) gene related conditions or disorders |
| JP2020515644A (ja) * | 2017-03-31 | 2020-05-28 | アッカニス・バイオテック・エフ・アンド・イー・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツング・ウント・コムパニー・コマンディットゲゼルシャフトAccanis Biotech F&E GmbH & Co KG | 非メラノーマ皮膚癌(nmsc)の予防および治療 |
| WO2018178215A1 (en) | 2017-03-31 | 2018-10-04 | Accanis Biotech F&E Gmbh & Co Kg | Prevention and treatment of non-melanoma skin cancer (nmsc) |
| EP4019037A1 (en) | 2017-03-31 | 2022-06-29 | Accanis Biotech F&E GmbH & Co KG | Prevention and treatment of non-melanoma skin cancer (nmsc) |
| CN110636854A (zh) * | 2017-03-31 | 2019-12-31 | 阿卡尼斯生物技术F&E有限责任两合公司 | 非黑素瘤皮肤癌(nmsc)的预防和治疗 |
| JP7264867B2 (ja) | 2017-03-31 | 2023-04-25 | アッカニス・バイオテック・エフ・アンド・イー・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツング・ウント・コムパニー・コマンディットゲゼルシャフト | 非メラノーマ皮膚癌(nmsc)の予防および治療 |
| WO2019025431A1 (en) | 2017-07-31 | 2019-02-07 | Accanis Biotech F&E Gmbh & Co Kg | TREATMENT OF LOCAL SKIN HYPOTROPHIC CONDITIONS |
| EP3437650A1 (en) | 2017-07-31 | 2019-02-06 | Accanis Biotech F&E GmbH & Co KG | Treatment of local skin hypotrophy conditions |
| US11707510B2 (en) | 2018-02-16 | 2023-07-25 | Preclinics Discovery Gmbh | Nucleic acid-based botulinum neurotoxin for therapeutic use |
| WO2019158745A1 (de) * | 2018-02-16 | 2019-08-22 | Bontana Therapies Gmbh | Nukleinsäure-basiertes botulinum neurotoxin zur therapeutischen anwendung |
| WO2020146700A1 (en) * | 2019-01-10 | 2020-07-16 | Massachusetts Institute Of Technology | Lipid nanoparticles |
| US11026894B2 (en) | 2019-01-10 | 2021-06-08 | Massachusetts Institute Of Technology | Lipid nanoparticles and use thereof to deliver RNA polynucleotides |
| US12344572B2 (en) | 2019-07-03 | 2025-07-01 | Factor Bioscience Inc. | Cationic lipids and transfection methods |
| US10501404B1 (en) | 2019-07-30 | 2019-12-10 | Factor Bioscience Inc. | Cationic lipids and transfection methods |
| US11242311B2 (en) | 2019-07-30 | 2022-02-08 | Factor Bioscience Inc. | Cationic lipids and transfection methods |
| US10752576B1 (en) | 2019-07-30 | 2020-08-25 | Factor Bioscience Inc. | Cationic lipids and transfection methods |
| US10611722B1 (en) | 2019-07-30 | 2020-04-07 | Factor Bioscience Inc. | Cationic lipids and transfection methods |
| US11814333B2 (en) | 2019-07-30 | 2023-11-14 | Factor Bioscience Inc. | Cationic lipids and transfection methods |
| US10556855B1 (en) | 2019-07-30 | 2020-02-11 | Factor Bioscience Inc. | Cationic lipids and transfection methods |
| US12384740B2 (en) | 2019-07-30 | 2025-08-12 | Factor Bioscience Inc. | Cationic lipids and transfection methods |
| US20240398983A1 (en) * | 2021-03-22 | 2024-12-05 | Recode Therapeutics, Inc. | Polynucleotide compositions, related formulations, and methods of use thereof |
| CN116675780A (zh) * | 2023-06-02 | 2023-09-01 | 东北农业大学 | 犬成纤维细胞生长因子21融合蛋白制备及其在治疗特应性皮炎中的用途 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4406585A3 (en) | 2024-10-23 |
| EP3543339A1 (en) | 2019-09-25 |
| EP4406585A2 (en) | 2024-07-31 |
| CA2976376A1 (en) | 2016-08-18 |
| JP2022000470A (ja) | 2022-01-04 |
| JP7199809B2 (ja) | 2023-01-06 |
| JP2018506542A (ja) | 2018-03-08 |
| EP3256585A1 (en) | 2017-12-20 |
| US20200261599A1 (en) | 2020-08-20 |
| AU2016218977B2 (en) | 2022-07-21 |
| AU2016218977C1 (en) | 2023-03-23 |
| EP3256585A4 (en) | 2018-08-15 |
| JP7638844B2 (ja) | 2025-03-04 |
| JP2025013347A (ja) | 2025-01-24 |
| CN109477102A (zh) | 2019-03-15 |
| US11241505B2 (en) | 2022-02-08 |
| AU2022206783A1 (en) | 2022-08-25 |
| US20180256748A1 (en) | 2018-09-13 |
| AU2016218977A1 (en) | 2017-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230015146A1 (en) | Nucleic acid products and methods of administration thereof | |
| JP7638844B2 (ja) | 核酸製品及びその投与方法 | |
| HK40013876A (en) | Nucleic acid products and methods of administration thereof | |
| NZ791466A (en) | Nucleic Acid Products And Methods Of Administration Thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16750065 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2976376 Country of ref document: CA Ref document number: 2017542098 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15550280 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2016218977 Country of ref document: AU Date of ref document: 20160216 Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2016750065 Country of ref document: EP |