WO2015161276A2 - Crispr-cas-related methods, compositions and components for cancer immunotherapy - Google Patents

Crispr-cas-related methods, compositions and components for cancer immunotherapy Download PDF

Info

Publication number
WO2015161276A2
WO2015161276A2 PCT/US2015/026504 US2015026504W WO2015161276A2 WO 2015161276 A2 WO2015161276 A2 WO 2015161276A2 US 2015026504 W US2015026504 W US 2015026504W WO 2015161276 A2 WO2015161276 A2 WO 2015161276A2
Authority
WO
WIPO (PCT)
Prior art keywords
tables
domain
nucleotides
nucleic acid
molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/026504
Other languages
English (en)
French (fr)
Other versions
WO2015161276A3 (en
Inventor
G. Grant Welstead
Ari E. FRIEDLAND
Morgan L. Maeder
David A. Bumcrot
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Editas Medicine Inc
Original Assignee
Editas Medicine Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201580031806.XA priority Critical patent/CN108138183A/zh
Priority to US15/303,722 priority patent/US20170175128A1/en
Priority to KR1020237036403A priority patent/KR102827558B1/ko
Priority to CA2945335A priority patent/CA2945335A1/en
Priority to IL292512A priority patent/IL292512B2/en
Priority to KR1020257021203A priority patent/KR20250102123A/ko
Priority to KR1020167032071A priority patent/KR102595473B1/ko
Priority to AU2015247323A priority patent/AU2015247323B2/en
Priority to EP20190783.9A priority patent/EP3800248A3/en
Priority to JP2016562958A priority patent/JP2017513485A/ja
Priority to SG11201608701QA priority patent/SG11201608701QA/en
Application filed by Editas Medicine Inc filed Critical Editas Medicine Inc
Priority to EP15721400.8A priority patent/EP3132030B1/en
Publication of WO2015161276A2 publication Critical patent/WO2015161276A2/en
Publication of WO2015161276A3 publication Critical patent/WO2015161276A3/en
Priority to IL248284A priority patent/IL248284A0/en
Anticipated expiration legal-status Critical
Priority to IL279230A priority patent/IL279230B/en
Priority to US17/412,608 priority patent/US20220106600A1/en
Priority to IL286103A priority patent/IL286103B/en
Priority to AU2021236446A priority patent/AU2021236446B2/en
Priority to AU2024259841A priority patent/AU2024259841A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1135Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2310/531Stem-loop; Hairpin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/55Vector systems having a special element relevant for transcription from bacteria

Definitions

  • the invention relates to CRISPR/CAS-related methods, compositions and components for editing a target nucleic acid sequence, or modulating expression of a target nucleic acid sequence, and applications thereof in connection with cancer immunotherapy comprising adoptive transfer of engineered T cells or T cell precursors.
  • Adoptive transfer of genetically engineered T cells has entered clinical testing as a cancer therapeutic modality.
  • the approach consists of the following steps: 1) obtaining leukocytes from the subject by apheresis; 2) selecting/enriching for T cells; 3) activating the T cells by cytokine treatment; 4) introducing cloned T cell receptor (TCR) genes or a chimeric antigen receptor (CAR) gene by retroviral transduction, lentiviral transduction or electroporation; 5) expanding the T cells by cytokine treatment; 6) conditioning the subject, usually by lymphodepletion; and 7) infusion of the engineered T cells into the subject.
  • TCR cloned T cell receptor
  • CAR chimeric antigen receptor
  • Sources of cloned TCR genes include rare T cell populations isolated from individuals with particular malignancies and T cell clones isolated from T cell receptor-humanized mice immunized with specific tumor antigens or tumor cells.
  • TCR-engineered T cells recognize their cognate antigen peptides presented by major histocompatibility complex (MHC) proteins on the tumor cell surface.
  • MHC major histocompatibility complex
  • Antigen engagement stimulates signal transduction pathways leading to T cell activation and proliferation.
  • Stimulated T cells then mount a cytotoxic anti-tumor cell response, typically involving a secreted complex comprising Granzyme B, perforin and granulysin, inducing tumor cell apoptosis.
  • Chimeric antigen receptor (CAR) genes encode artificial T cell receptors comprising an extracellular tumor antigen binding domain, typically derived from the single-chain antibody variable fragment (scFv) domain of a monoclonal antibody, fused via hinge and transmembrane domains to a cytoplasmic effector domain.
  • the effector domain is typically derived from the CD3-zeta chain of the T cell co- receptor complex, and can also include domains derived from CD28 and/or CD 137 receptor proteins.
  • the CAR extra-cellular domain binds the tumor antigen in an MHC-independent manner leading to T cell activation and proliferation, culminating in cytotoxic anti-tumor activity as described for TCR engineered T cells.
  • Methods and compositions discussed herein provide for the treatment of cancer using an immunotherapy approach comprising administration of genetically engineered T cells or T cell precursors to a subject.
  • An approach to treat a subject suffering from cancer is to isolate T cells from the subject, genetically modify them to target an antigen expressed by the cancer cells, then re-introduce them into the subject; a process referred to as adoptive cell transfer.
  • Methods to genetically modify T cells include introduction of T cell receptor (TCR) or chimeric antigen receptor (CAR) genes encoding transmembrane TCR or CAR proteins, respectively, which specifically recognize particular cancer antigens.
  • Adoptive cell transfer utilizing genetically modified T cells has entered clinical testing as a therapeutic for solid and hematologic malignancies. Results to date have been mixed. In hematologic malignancies (especially lymphoma, CLL and ALL), the majority of patients in several Phase 1 and 2 trials exhibited at least a partial response, with some exhibiting complete responses (Kochenderfer, J. N. et al., 2012 Blood 1 19, 2709-2720). However, in most tumor types (including melanoma, renal cell carcinoma and colorectal cancer), fewer responses have been observed (Johnson, L. A. et al., 2009 Blood 1 14, 535-546; Lamers, C. H. et al., 2013 Mol. Ther. 21, 904-912; Warren, R. S. et al., 1998 Cancer Gene Ther. 5, S 1-S2). Thus, there exists a need to improve the efficacy of adoptive transfer of modified T cells in cancer treatment.
  • T cell proliferation e.g., limited proliferation of T cells following adoptive transfer
  • T cell survival e.g., induction of T cell apoptosis by factors in the tumor environment
  • T cell function e.g., inhibition of cytotoxic T cell function by inhibitory factors secreted by host immune cells and cancer cells.
  • methods and compositions discussed herein can be used to affect T cell proliferation (e.g., by inactivating genes that inhibit T cell proliferation). In an embodiment, methods and compositions discussed herein can be used to affect T cell survival (e.g., by inactivating genes mediating T cell apoptosis). In an embodiment, methods and composition discussed herein can be used to affect T cell function (e.g., by inactivating genes encoding immunosuppressive and inhibitory (e.g., anergy- inducing) signaling factors).
  • T cell proliferation e.g., by inactivating genes that inhibit T cell proliferation
  • methods and compositions discussed herein can be used to affect T cell survival (e.g., by inactivating genes mediating T cell apoptosis).
  • methods and composition discussed herein can be used to affect T cell function (e.g., by inactivating genes encoding immunosuppressive and inhibitory (e.g., anergy- inducing) signaling factors).
  • compositions described above can be utilized individually or in combination to affect one or more of the factors limiting the efficacy of genetically modified T cells as cancer therapeutics, e.g., T cell proliferation, T cell survival, T cell function, or any combination thereof.
  • Methods and compositions discussed herein can be used to affect T cell proliferation, survival and/or function by altering one or more T-cell expressed genes, e.g., one or more of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and/or TRBC genes.
  • methods and compositions described herein can be used to affect T cell proliferation by altering one or more T-cell expressed genes, e.g., the CBLB and/or PTPN6 gene.
  • methods and compositions described herein can be used to affect T cell survival by altering one or more T-cell expressed genes, e.g., FAS and/or BID gene.
  • methods and compositions described herein can be used to affect T cell function by altering one or more T-cell expressed gene or genes, e.g., CTLA4 and/or PDCD1 and/or TRAC and/or TRBC gene.
  • one or more T-cell expressed genes are independently targeted as a targeted knockout or knockdown, e.g., to influence T cell proliferation, survival and/or function.
  • the approach comprises knocking out or knocking down one T-cell expressed gene (e.g., FAS, BID, CTLA4, PDCDI, CBLB, PTPN6, TRAC or TRBC gene).
  • the approach comprises independently knocking out or knocking down two T-cell expressed genes, e.g., two of FAS, BID, CTLA4, PDCDI, CBLB, PTPN6, TRAC or TRBC genes.
  • the approach comprises independently knocking out or knocking down three T-cell expressed genes, e.g., three of FAS, BID, CTLA4, PDCDI, CBLB,
  • the approach comprises independently knocking out or knocking down four T-cell expressed genes, e.g., four of FAS, BID, CTLA4, PDCDI, CBLB, PTPN6, TRAC or TRBC genes.
  • the approach comprises independently knocking out or knocking down five T-cell expressed genes, e.g., five of FAS, BID, CTLA4, PDCDI, CBLB, PTPN6, TRAC or TRBC genes.
  • the approach comprises independently knocking out or knocking down six T-cell expressed genes, e.g., six of FAS, BID, CTLA4, PDCDI, CBLB, PTPN6, TRAC or TRBC genes.
  • the approach comprises independently knocking out or knocking down seven T-cell expressed genes, e.g., seven of FAS, BID, CTLA4, PDCDI, CBLB, PTPN6, TRAC or TRBC genes.
  • the approach comprises independently knocking out or knocking down eight T-cell expressed genes, e.g., each of FAS, BID, CTLA4, PDCDI, CBLB, PTPN6, TRAC and TRBC genes.
  • T-cell expressed genes may be targeted to affect the efficacy of engineered T cells. These genes include, but are not limited to TGFBRI, TGFBRII and TGFBRIII (Kershaw et al. 2013 NatRevCancer 13, 525-541). It is contemplated herein that one or more of TGFBRI, TGFBRII or TGFBRIII gene can be altered either individually or in combination using the methods disclosed herein.
  • TGFBRI, TGFBRII or TGFBRIII gene can be altered either individually or in combination with any one or more of the eight genes described above (i.e., FAS, BID, CTLA4, PDCDI, CBLB, PTPN6, TRAC or TRBC gene) using the methods disclosed herein.
  • methods and compositions discussed herein may be used to alter one or more of the
  • FAS, BID, CTLA4, PDCDI, CBLB, PTPN6, TRAC and/or TRBC genes to affect T cell proliferation, survival and/or function by targeting the gene, e.g., the non-coding or coding regions, e.g., the promoter region, or a transcribed sequence, e.g., intronic or exonic sequence.
  • coding sequence e.g., a coding region, e.g., an early coding region, of the FAS, BID, CTLA4, PDCDI, CBLB, PTPN6, TRAC and/or TRBC gene, is targeted for alteration and knockout of expression.
  • the methods and compositions discussed herein may be used to alter the FAS, BID, CTLA4, PDCDI, CBLB, PTPN6, TRAC and/or TRBC gene to affect T cell proliferation, survival and/or function by targeting the coding sequence of the FAS, BID, CTLA4, PDCDI, CBLB, PTPN6, TRAC and/or TRBC gene.
  • the gene e.g., the coding sequence of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene
  • the method provides an alteration that comprises an insertion or deletion.
  • a targeted knockout approach is mediated by non-homologous end joining (NHEJ) using a CRISPR/Cas system comprising an enzymatically active Cas9 (eaCas9).
  • TRAC and/or TRBC gene is targeted to knockout one or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene, respectively.
  • targeting affects one or two alleles of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • a targeted knockout approach reduces or eliminates expression of functional FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene product.
  • the method provides an alteration that comprises an insertion or deletion.
  • the methods and compositions discussed herein may be used to alter the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene to affect T cell function by targeting non-coding sequence of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene, e.g., promoter, an enhancer, an intron, 3'UTR, and/or polyadenylation signal.
  • the gene e.g., the non-coding sequence of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene
  • is targeted to knockout the gene e.g., to eliminate expression of the gene, e.g., to knockout one or two alleles of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene, e.g., by induction of an alteration comprising a deletion or mutation in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • the method provides an alteration that comprises an insertion or deletion.
  • T cell target FAS knockout position refers to a position in the FAS gene, which if altered by NHEJ-mediated alteration, results in a reduction or elimination of expression of functional FAS gene product (e.g., knockout of expression of functional FAS gene product).
  • the position is in the FAS gene coding region, e.g., an early coding region.
  • T cell target BID knockout position refers to a position in the BID gene, which if altered by NHEJ-mediated alteration, results in a reduction or elimination of expression of functional BID gene product (e.g., knockout of expression of functional BID gene product).
  • the position is in the BID gene coding region, e.g., an early coding region.
  • T cell target CTLA4 knockout position refers to a position in the CTLA4 gene, which if altered by NHEJ-mediated alteration, results in a reduction or elimination of expression of functional CTLA4 gene product (e.g., knockout of expression of functional CTLA4 gene product).
  • the position is in the CTLA4 gene coding region, e.g., an early coding region.
  • T cell target PDCD 1 knockout position refers to a position in the PDCDl gene, which if altered by NHEJ-mediated alteration, results in a reduction or elimination of expression of functional PDCDl gene product (e.g., knockout of expression of functional PDCDl gene product).
  • the position is in the PDCDl gene coding region, e.g., an early coding region.
  • T cell target CBLB knockout position refers to a position in the CBLB gene, which if altered by NHEJ-mediated alteration, results in a reduction or elimination of expression of functional CBLB gene product (e.g., knockout of expression of functional CBLB gene product).
  • the position is in the CBLB gene coding region, e.g., an early coding region.
  • T cell target PTPN6 knockout position refers to a position in the PTPN6 gene, which if altered by NHEJ-mediated alteration, results in a reduction or elimination of expression of functional PTPN6 gene product (e.g., knockout of expression of functional PTPN6 gene product).
  • the position is in the PTPN6 gene coding region, e.g., an early coding region.
  • T cell target TRAC knockout position refers to a position in the TRAC gene, which if altered by NHEJ-mediated alteration, results in a reduction or elimination of expression of functional TRAC gene product (e.g., knockout of expression of functional TRAC gene product).
  • the position is in the TRAC gene coding region, e.g., an early coding region.
  • T cell target TRBC knockout position refers to a position in the TRBC gene, which if altered by NHEJ-mediated alteration, results in a reduction or elimination of expression of functional TRBC gene product (e.g., knockout of expression of functional TRBC gene product).
  • the position is in the TRBC gene coding region, e.g., an early coding region.
  • methods and compositions discussed herein may be used to alter the expression of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, or PTPN6 genes, to affect T cell function by targeting a promoter region of the FAS, BID, CTLA4, PDCDl, CBLB, or PTPN6 gene.
  • the promoter region of the FAS, BID, CTLA4, PDCDl, CBLB, or PTPN6 gene is targeted to knockdown expression of the FAS, BID, CTLA4, PDCDl, CBLB, or PTPN6 gene.
  • a targeted knockdown approach reduces or eliminates expression of the functional FAS, BID, CTLA4,
  • a targeted knockdown is mediated by targeting an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fused to a transcription repressor domain or chromatin modifying protein to alter transcription, e.g., to block, reduce, or decrease transcription, of the FAS, BID, CTLA4, PDCDl, CBLB and/or PTPN6 genes.
  • eiCas9 enzymatically inactive Cas9
  • a transcription repressor domain or chromatin modifying protein to alter transcription, e.g., to block, reduce, or decrease transcription, of the FAS, BID, CTLA4, PDCDl, CBLB and/or PTPN6 genes.
  • T cell target FAS knockdown position refers to a position, e.g., in the FAS gene, which if targeted by an eiCas9 or an eiCas9 fusion protein described herein, results in reduction or elimination of expression of functional FAS gene product. In an embodiment, transcription is reduced or eliminated. In an embodiment, the position is in the FAS promoter sequence. In an embodiment, a position in the promoter sequence of the FAS gene is targeted by an enzymatically inactive Cas9 (eiCas9) or an eiCas9-fusion protein, as described herein.
  • eiCas9 enzymatically inactive Cas9
  • T cell target BID knockdown position refers to a position, e.g., in the BID gene, which if targeted by an eiCas9 or an eiCas9 fusion protein described herein, results in reduction or elimination of expression of functional BID gene product. In an embodiment, transcription is reduced or eliminated. In an embodiment, the position is in the BID promoter sequence. In an embodiment, a position in the promoter sequence of the BID gene is targeted by an enzymatically inactive Cas9 (eiCas9) or an eiCas9-fusion protein, as described herein.
  • eiCas9 enzymatically inactive Cas9
  • T cell target CTLA4 knockdown position refers to a position, e.g., in the CTLA4 gene, which if targeted by an eiCas9 or an eiCas9 fusion protein described herein, results in reduction or elimination of expression of functional CTLA4 gene product. In an embodiment, transcription is reduced or eliminated. In an embodiment, the position is in the CTLA4 promoter sequence. In an embodiment, a position in the promoter sequence of the CTLA4 gene is targeted by an enzymatically inactive Cas9 (eiCas9) or an eiCas9-fusion protein, as described herein.
  • eiCas9 enzymatically inactive Cas9
  • T cell target PDCDl knockdown position refers to a position, e.g., in the PDCDl gene, which if targeted by an eiCas9 or an eiCas9 fusion protein described herein, results in reduction or elimination of expression of functional PDCDl gene product. In an embodiment, transcription is reduced or eliminated. In an embodiment, the position is in the PDCDl promoter sequence. In an embodiment, a position in the promoter sequence of the PDCDl gene is targeted by an enzymatically inactive Cas9 (eiCas9) or an eiCas9-fusion protein, as described herein.
  • eiCas9 enzymatically inactive Cas9
  • T cell target CBLB knockdown position refers to a position, e.g., in the CBLB gene, which if targeted by an eiCas9 or an eiCas9 fusion protein described herein, results in reduction or elimination of expression of functional CBLB gene product. In an embodiment, transcription is reduced or eliminated. In an embodiment, the position is in the CBLB promoter sequence. In an embodiment, a position in the promoter sequence of the CBLB gene is targeted by an enzymatically inactive Cas9 (eiCas9) or an eiCas9-fusion protein, as described herein.
  • eiCas9 enzymatically inactive Cas9
  • T cell target PTPN6 knockdown position refers to a position, e.g., in the PTPN6 gene, which if targeted by an eiCas9 or an eiCas9 fusion protein described herein, results in reduction or elimination of expression of functional PTPN6 gene product. In an embodiment, transcription is reduced or eliminated. In an embodiment, the position is in the PTPN6 promoter sequence. In an embodiment, a position in the promoter sequence of the PTPN6 gene is targeted by an enzymatically inactive Cas9 (eiCas9) or an eiCas9-fusion protein, as described herein.
  • eiCas9 enzymatically inactive Cas9
  • T cell target FAS position refers to any of the T cell target FAS knockout position and/or T cell target FAS knockdown position, as described herein.
  • T cell target BID position refers to any of the T cell target BID knockout position and/or T cell target BID knockdown position, as described herein.
  • T cell target CTLA4 position refers to any of the T cell target CTLA4 knockout position and/or T cell target CTLA4 knockdown position, as described herein.
  • T cell target PDCDl position refers to any of the T cell target PDCDl knockout position and/or T cell target PDCDl knockdown position, as described herein.
  • T cell target CBLB position refers to any of the T cell target CBLB knockout position and/or T cell target CBLB knockdown position, as described herein.
  • T cell target PTPN6 position refers to any of the T cell target PTPN6 knockout position and/or T cell target PTPN6 knockdown position, as described herein.
  • T cell target TRAC position refers to any of the T cell target TRAC knockout position, as described herein.
  • T cell target TRBC position refers to any of the T cell target TRBC knockout position, as described herein.
  • T cell target knockout position refers to any of the T cell target FAS knockout position, T cell target BID knockout position, T cell target CTLA4 knockout position, T cell target
  • T cell target CBLB knockout position T cell target PTPN6 knockout position
  • T cell target TRAC knockout position T cell target TRBC knockout position
  • T cell target knockdown position refers to any of the T cell target FAS knockdown position, T cell target BID knockdown position, T cell target CTLA4 knockdown position, T cell target PDCD 1 knockdown position, T cell target CBLB knockdown position, or T cell target PTPN6 knockdown position, as described herein.
  • T cell target position refers to any of a T cell target knockout position or T cell target knockdown position, as described herein.
  • a gRNA molecule e.g., an isolated or non-naturally occurring gRNA molecule, comprising a targeting domain which is complementary with a target domain from the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene.
  • the targeting domain of the gRNA molecule is configured to provide a cleavage event, e.g., a double strand break or a single strand break, sufficiently close to a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene to allow alteration, e.g., alteration associated with NHEJ, of a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene.
  • a cleavage event e.g., a double strand break or a single strand break
  • the targeting domain is configured such that a cleavage event, e.g., a double strand or single strand break, is positioned within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides es of a T cell target position.
  • the break e.g., a double strand or single strand break, can be positioned upstream or downstream of a T cell target position in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene.
  • a second gR A molecule comprising a second targeting domain is configured to provide a cleavage event, e.g., a double strand break or a single strand break, sufficiently close to the T cell target position in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, to allow alteration, e.g., alteration associated with NHEJ, of the T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene, either alone or in combination with the break positioned by the first gRNA molecule.
  • a cleavage event e.g., a double strand break or a single strand break
  • the targeting domains of the first and second gRNA molecules are configured such that a cleavage event, e.g., a double strand or single strand break, is positioned, independently for each of the gRNA molecules, within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target position.
  • the breaks e.g., double strand or single strand breaks, are positioned on both sides of a nucleotide of a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene.
  • the breaks e.g., double strand or single strand breaks
  • the breaks are positioned on one side, e.g., upstream or downstream, of a nucleotide of a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene.
  • a single strand break is accompanied by an additional single strand break, positioned by a second gRNA molecule, as discussed below.
  • the targeting domains are configured such that a cleavage event, e.g., the two single strand breaks, are positioned within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of a T cell target position.
  • the first and second gRNA molecules are configured such that, when guiding a Cas9 nickase, a single strand break will be accompanied by an additional single strand break, positioned by a second gRNA, sufficiently close to one another to result in alteration of a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene.
  • the first and second gRNA molecules are configured such that a single strand break positioned by the second gRNA is within 10, 20, 30, 40, or 50 nucleotides of the break positioned by the first gRNA molecule, e.g., when the Cas9 is a nickase.
  • the two gRNA molecules are configured to position cuts at the same position, or within a few nucleotides of one another, on different strands, e.g., essentially mimicking a double strand break.
  • a double strand break can be accompanied by an additional double strand break, positioned by a second gRNA molecule, as is discussed below.
  • the targeting domain of a first gRNA molecule is configured such that a double strand break is positioned upstream of a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene, e.g., within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target position; and the targeting domain of a second gRNA molecule is configured such that a double strand break is positioned downstream of a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene, e.g., within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target position;
  • a double strand break can be accompanied by two additional single strand breaks, positioned by a second gRNA molecule and a third gRNA molecule.
  • the targeting domain of a first gRNA molecule is configured such that a double strand break is positioned upstream of a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene, e.g., within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target position; and the targeting domains of a second and third gRNA molecule are configured such that two single strand breaks are positioned downstream of a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene, e.g., within 1, 2, 3, 4, 5, 10, 15, 20,
  • a first and second single strand break can be accompanied by two additional single strand breaks positioned by a third gRNA molecule and a fourth gRNA molecule.
  • the targeting domain of a first and second gRNA molecule are configured such that two single strand breaks are positioned upstream of a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB,
  • PTPN6, TRAC or TRBC gene e.g., within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target position; and the targeting domains of a third and fourth gRNA molecule are configured such that two single strand breaks are positioned downstream of a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene, e.g., within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target position.
  • two double stranded breaks e.g., flanking a position (e.g., to remove a piece of DNA, e.g., to create a deletion mutation) or to create more than one indel in the gene, e.g., in a coding region, e.g., an early coding region, (3) one double stranded break and two paired nicks flanking a position (e.g., to remove a piece of DNA, e.g., to insert a deletion) or (4) four single stranded breaks, two on each side of a position, that they are targeting the same T cell target position. It is further,
  • multiple gRNAs may be used to target more than one position in the same gene.
  • the two or more cleavage events may be made by the same or different Cas9 proteins.
  • a single Cas9 nuclease may be used to create both double stranded breaks.
  • a single Cas9 nickase may be used to create the two or more nicks.
  • two Cas9 proteins may be used, e.g., one Cas9 nuclease and one Cas9 nickase. It is contemplated that when two or more Cas9 proteins are used that the two or more Cas9 proteins may be delivered sequentially to control specificity of a double stranded versus a single stranded break at the desired position in the target nucleic acid. In another embodiment, when two or more Cas9 proteins are used, the Cas9 proteins may be from different species.
  • the Cas9 nuclease generating the double stranded break may be from one bacterial species and the Cas9 nickase generating the single stranded break may be from a different bacterial species.
  • the targeted nucleic acids may be altered, e.g., cleaved, by one or more Cas9 proteins.
  • the same or a different Cas9 protein may be used to target each gene.
  • both genes or each gene targeted in a cell
  • both genes or each gene targeted in a cell
  • one or more genes in a cell may be altered by cleavage with a Cas9 nuclease and one or more genes in the same cell may be altered by cleavage with a Cas9 nickase.
  • the Cas9 proteins may be from different bacterial species.
  • one or more genes in a cell may be altered by cleavage with a Cas9 protein from one bacterial species, and one or more genes in the same cell may be altered by cleavage with a Cas9 protein from a different bacterial species.
  • the targeting domain of the first gRNA molecule and the targeting domain of the second gRNA molecules are complementary to opposite strands of the target nucleic acid molecule.
  • the gRNA molecule and the second gRNA molecule are configured such that the PAMs are oriented outward.
  • the targeting domain of a gRNA molecule is configured to avoid unwanted target chromosome elements, such as repeat elements, e.g., Alu repeats, in the target domain.
  • the gRNA molecule may be a first, second, third and/or fourth gRNA molecule.
  • the targeting domain of a gRNA molecule is configured to position a cleavage event sufficiently far from a preselected nucleotide, e.g., the nucleotide of a coding region, such that the nucleotide is not be altered.
  • the targeting domain of a gRNA molecule is configured to position an intronic cleavage event sufficiently far from an intron/exon border, or naturally occurring splice signal, to avoid alteration of the exonic sequence or unwanted splicing events.
  • the gRNA molecule may be a first, second, third and/or fourth gRNA molecule, as described herein.
  • a position in the coding region, e.g., the early coding region, of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene is targeted, e.g., for knockout.
  • the targeting domain comprises a sequence that is the same as, or differs by no more than 1 , 2, 3, 4, or 5 nucleotides from, a targeting domain sequence from any one of Tables 1A-I, Tables 3A-H, Tables 5A-I, Tables 7A-H, Tables 9A-I, Tables 11A-I, Tables 13A-K, Tables 15A-F, Tables 17A-K, Tables 19A-J, Tables 21A-K, Tables 23A-J, Tables 25A-G, Tables 26A-G, Table 27, Table 29, Table 31, or Table 32.
  • the targeting domain is selected from those in Tables 1A-I. In other embodiments, the targeting domain is:
  • GGCUCACCAGAGGUAGG (SEQ ID NO:8647);
  • the targeting domain is selected from those in Tables 3A-H. In other embodiments, the targeting domain is:
  • GACCGUAGCAUCCCUCC (SEQ ID NO: 10764);
  • GCUCGGUGGGCAGCGAG (SEQ ID NO: 10769);
  • GGCCCGGAGGGAUGCUA (SEQ ID NO: 10772);
  • GGUCCAUGCUGUCCCCGACC (SEQ ID NO: 10776);
  • GGUUCACAGUGUCCCAG (SEQ ID NO: 10777);
  • GUGUCCCAGUGGCGACC SEQ ID NO: 10783.
  • the targeting domain is selected from those in Tables 5A-I. In other embodiments, the targeting domain is:
  • the targeting domain is selected from those in Tables 7A-H. In other embodiments, the targeting domain is:
  • GUCACCACGAGCAGGGC SEQ ID NO:573.
  • the targeting domain is selected from those in Tables 9A-I. In other embodiments, the targeting domain is:
  • GATTTCCTCCTCGACCACCA (SEQ ID NO:6123);
  • GCGGCAGCTTGCTTAGG (SEQ ID NO:6126).
  • the targeting domain is selected from those in Tables 11A-I. In other embodiments, the targeting domain is:
  • each guide RNA is independently selected from one of Tables 1 A-F or Tables 13A-K.
  • each guide RNA is independently selected from one of Tables 3 A-H or Tables 15A-F.
  • each guide RNA is independently selected from one of Tables 5A-I or Tables 17A-K.
  • each guide RNA is independently selected from one of Tables 7A-H, Tables 19A-J, Table 31 or Table 32.
  • the targeting domain is:
  • GAUCUGCGCCUUGGGGGCCA (SEQ ID NO:526); GGGCCCUGACCACGCUCAUG (SEQ ID NO:527);
  • GAAGCUCUCCGAUGUGUGU (SEQ ID NO:536); GUUGUGUGACACGGAAG (SEQ ID NO:537);
  • GGCACUUCUGCCCUUCUCUC (SEQ ID NO:546); GGGCGGCCUGCUGGGCAGCC (SEQ ID NO:547);
  • each guide RNA is independently selected from one of Tables 7A-H, Tables 19A-J, Table 31 or Table 32 so that the break is generated with over 10% efficiency.
  • the targeting domain is:
  • GACGUUACCUCGUGCGGCCC (SEQ ID NO:540); GGUGCUGCUAGUCUGGGUCC (SEQ ID NO:544);
  • each guide RNA is independently selected from one of Tables 9A-I or Tables 21A-K.
  • each guide RNA is independently selected from one of Tables 11A-I or Tables 23 A- J.
  • each guide RNA is independently selected from one of Tables 25A-G or Table 29.
  • the targeting domain is:
  • AAAGUCAGAUUUGUUGCUCC SEQ ID NO:463
  • ACAAAACUGUGCUAGACAUG SEQ ID NO:464
  • the T cell target knockout position is the TRAC coding region, e.g., an early coding region
  • more than one gRNA is used to position breaks, e.g., two single stranded breaks or two double stranded breaks, or a combination of single strand and double strand breaks, e.g., to create one or more indels, in the target nucleic acid sequence
  • each guide RNA is independently selected from one of Tables 25A-G or Table 29 so that the break is generated with over 10% efficiency.
  • the targeting domain is:
  • GGCAGACAGACUUGUCACUGGAUU (SEQ ID NO :471 );
  • GAGAAUCAAAAUCGGUGAAU SEQ ID NO:452
  • GCUAGACAUGAGGUCUA SEQ ID NO:456
  • each guide RNA is independently selected from one of Tables 26A-G or Table 27.
  • the targeting domain is:
  • GGCUCAAACACAGCGACCUC (SEQ ID NO:406); UGAGGGUCUCGGCCACCUUC (SEQ ID NO:407);
  • AGGCUUCUACCCCGACCACG (SEQ ID NO:408);
  • GGCUGCUCCUUGAGGGGCU SEQ ID NO:440
  • GCUGCUCCUUGAGGGGCU SEQ ID NO:441
  • each guide RNA is independently selected from one of Tables 26A-G or Table 27 so that the break is generated with over 10% efficiency.
  • the targeting domain is:
  • AGGCUUCUACCCCGACCACG (SEQ ID NO:408);
  • the targeting domain of the gRNA molecule is configured to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein (e.g., an eiCas9 fused to a transcription repressor domain), sufficiently close to a T cell knockdown target position to reduce, decrease or repress expression of the FAS, BID, CTLA4, PDCDl, CBLB, or PTPN6 gene.
  • the targeting domain is configured to target the promoter region of the FAS, BID, CTLA4, PDCDl, CBLB, or PTPN6 gene to block transcription initation, binding of one or more transcription enhancers or activators, and/or RNA polymerase.
  • One or more gRNA may be used to target an eiCas9 to the promoter region of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene.
  • the targeting domain when the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 promoter region is targeted, e.g., for knockdown, can comprise a sequence that is the same as, or differs by no more than 1, 2, 3, 4, or 5 nucleotides from, a targeting domain sequence from any one of Tables 2A-I, Tables 4A-I, Tables 6A-I, Tables 8A-H, Tables 10A-I, Tables 12A-I, Tables 14A-K, Table 16A-K, Tables 18A-K, Tables 20A-J, Tables 22A-K, or Tables 24A-K.
  • the targeting domain is selected from those in Tables 2A-I.
  • the targeting domain is:
  • GCUUACCCCGUCUUAGUCCC (SEQ ID NO:9243);
  • GAGCUCACGAAAAGCCCCGG (SEQ ID NO:9250);
  • GCGCCAUAGGGCUCUGAAAA (SEQ ID NO:9260); GCUGGGGCUAUGCGAUU (SEQ ID NO:9261);
  • GGUGGACCCGCUCAGUA SEQ ID NO: 9265
  • GGCGCACGCGGGCACCU (SEQ ID NO :9270);
  • the targeting domain is selected from those in Tables 4A-I. In other embodiments, the targeting domain is:
  • GAGGAGAAAACCCGCGGGCC SEQ ID NO: 11445
  • GCUGAGGGUCGGGUCCGCCU (SEQ ID NO: 1 1452); GGAUUCCGAUCCGCCGGCAA (SEQ ID NO: 1 1453); GGCCACCCUUGCCGGCGGAU (SEQ ID NO: 1 1454); GGCUCGGCGCGUACCCCGGG (SEQ ID NO: 1 1455); GGGAUUCCGAUCCGCCGGCA (SEQ ID NO: 1 1456); GGGCGCCAUAAGGAGGAAGC (SEQ ID NO: 1 1457); GGGCGGGGAUUCCGAUCCGC (SEQ ID NO: 1 1458); GGUCAGAGCGGCCGCUUACU (SEQ ID NO: 1 1459); GGUCGGGUCCGCCUCGGAGG (SEQ ID NO: 1 1460); GUCAGAGCGGCCGCUUACUG (SEQ ID NO: l 1461); GUCGACCGUGUCCGCGCGCC (SEQ ID NO: 1 1462); GUCGGGUCCGCCUCGGAGGC (SEQ ID NO: 1 1463); G
  • GCUCAGAACAGAGCGCC (SEQ ID NO: 13746);
  • GAGCGCCAGGUAUUUAGUAG (SEQ ID NO: 13747);
  • GCGCCAGGUAUUUAGUA (SEQ ID NO: 13748);
  • GCGGUGUUCAGGUCUUC SEQ ID NO: 13751
  • the targeting domain is selected from those in Tables 8A-H. In other embodiments, the targeting domain is:
  • the targeting domain is selected from those in Tables 10A-I. In other embodiments, the targeting domain is:
  • GGATTTCCTCCTCGACCACC (SEQ ID NO:7642);
  • GATTTCCTCCTCGACCACCA (SEQ ID NO:7643);
  • GCGGCAGCTTGCTTAGG (SEQ ID NO: 7650); or
  • GGTCCTATCATACATTT (SEQ ID NO:7651).
  • the targeting domain is selected from those in Tables 12A-I. In other embodiments, the targeting domain is:
  • GGUUUCCGCCUACGGAG SEQ ID NO:471 1
  • each guide RNA is independently selected from one of Tables 2A-I or Tables 14A-K.
  • each guide RNA is independently selected from one of Tables 4A-I or Tables 16A-K.
  • each guide RNA is independently selected from one of Tables 6A-I or Tables 18A-K.
  • each guide RNA is independently selected from one of Tables 8A-H or Tables 20A- J.
  • each guide RNA is independently selected from one of Tables 10A-I or Tables 22A-K.
  • each guide RNA is independently selected from one of Tables 12A-I or Tables 24A-K.
  • the gRNA e.g., a gRNA comprising a targeting domain, which is complementary with the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene
  • the gRNA is a modular gRNA.
  • the gRNA is a unimolecular or chimeric gRNA.
  • the targeting domain which is complementary with the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene comprises 16 or more nucleotides in length.
  • the targeting domain which is complementary with a target domain from the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene is 16 nucleotides or more in length.
  • the targeting domain is 16 nucleotides in length.
  • the targeting domain is 17 nucleotides in length.
  • the targeting domain is 18 nucleotides in length.
  • the targeting domain is 19 nucleotides in length.
  • the targeting domain is 20 nucleotides in length.
  • the targeting domain is 21 nucleotides in length. In an embodiment, the targeting domain is 22 nucleotides in length. In an embodiment, the targeting domain is 23 nucleotides in length. In an embodiment, the targeting domain is 24 nucleotides in length. In an embodiment, the targeting domain is 25 nucleotides in length. In an embodiment, the targeting domain is 26 nucleotides in length.
  • a gRNA as described herein may comprise from 5' to 3': a targeting domain (comprising a "core domain", and optionally a "secondary domain”); a first complementarity domain; a linking domain; a second complementarity domain; a proximal domain; and a tail domain. In some embodiments, the proximal domain and tail domain are taken together as a single domain.
  • the targeting domain comprises 16 nucleotides.
  • the targeting domain comprises 17 nucleotides.
  • the targeting domain comprises 18 nucleotides.
  • the targeting domain comprises 19 nucleotides. In an embodiment, the targeting domain comprises 20 nucleotides.
  • the targeting domain comprises 21 nucleotides.
  • the targeting domain comprises 22 nucleotides.
  • the targeting domain comprises 23 nucleotides.
  • the targeting domain comprises 24 nucleotides.
  • the targeting domain comprises 25 nucleotides.
  • the targeting domain comprises 26 nucleotides.
  • a gRNA as described herein may comprise from 5' to 3' : a targeting domain (comprising a "core domain", and optionally a "secondary domain”); a first complementarity domain; a linking domain; a second complementarity domain; a proximal domain; and a tail domain.
  • a targeting domain comprising a "core domain”, and optionally a "secondary domain”
  • a first complementarity domain comprising a "core domain”, and optionally a "secondary domain”
  • a first complementarity domain comprising a "core domain", and optionally a "secondary domain”
  • a first complementarity domain comprising a linking domain; a second complementarity domain; a proximal domain; and a tail domain.
  • the proximal domain and tail domain are taken together as a single domain.
  • a gRNA comprises a linking domain of no more than 25 nucleotides in length; a proximal and tail domain, that taken together, are at least 20 nucleotides in length; and a targeting domain of equal to or greater than 16,17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • a gRNA comprises a linking domain of no more than 25 nucleotides in length; a proximal and tail domain, that taken together, are at least 30 nucleotides in length; and a targeting domain of equal to or greater than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • a gRNA comprises a linking domain of no more than 25 nucleotides in length; a proximal and tail domain, that taken together, are at least 35 nucleotides in length; and a targeting domain of equal to or greater than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • a gRNA comprises a linking domain of no more than 25 nucleotides in length; a proximal and tail domain, that taken together, are at least 40 nucleotides in length; and a targeting domain of equal to or greater than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • a cleavage event e.g., a double strand or single strand break
  • the Cas9 molecule may be an enzymatically active Cas9 (eaCas9) molecule, e.g., an eaCas9 molecule that forms a double strand break in a target nucleic acid or an eaCas9 molecule forms a single strand break in a target nucleic acid (e.g., a nickase molecule).
  • eaCas9 enzymatically active Cas9
  • the Cas9 molecule may be an enzymatically inactive Cas9 (eiCas9) molecule or a modified eiCas9 molecule, e.g., the eiCas9 molecule is fused to Kriippel-associated box (KRAB) to generate an eiCas9-KRAB fusion protein molecule.
  • eiCas9 enzymatically inactive Cas9
  • KRAB Kriippel-associated box
  • the eaCas9 molecule catalyzes a double strand break.
  • the eaCas9 molecule comprises HNH-like domain cleavage activity but has no, or no significant, N-terminal RuvC-like domain cleavage activity.
  • the eaCas9 molecule is an HNH-like domain nickase, e.g., the eaCas9 molecule comprises a mutation at D10, e.g., D 1 OA.
  • the eaCas9 molecule comprises N-terminal RuvC-like domain cleavage activity but has no, or no significant, HNH-like domain cleavage activity.
  • the eaCas9 molecule is an N-terminal RuvC-like domain nickase, e.g., the eaCas9 molecule comprises a mutation at H840, e.g., H840A.
  • the eaCas9 molecule is an N-terminal RuvC-like domain nickase, e.g., the eaCas9 molecule comprises a mutation at N863, e.g., N863A.
  • a single strand break is formed in the strand of the target nucleic acid to which the targeting domain of the gRNA is complementary. In another embodiment, a single strand break is formed in the strand of the target nucleic acid other than the strand to which the targeting domain of the gRNA is complementary.
  • nucleic acid e.g., an isolated or non-naturally occurring nucleic acid, e.g., DNA
  • a nucleic acid that comprises (a) a sequence that encodes a gRNA molecule comprising a targeting domain that is complementary with a target domain, e.g., with a T cell target position, in FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, as disclosed herein.
  • the nucleic acid encodes a gRNA molecule, e.g., a first gRNA molecule, comprising a targeting domain configured to provide a cleavage event, e.g., a double strand break or a single strand break, sufficiently close to a T cell target position in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene to allow alteration, e.g., alteration associated with NHEJ, of the a T cell target position in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, respectively.
  • a cleavage event e.g., a double strand break or a single strand break
  • the nucleic acid encodes a gRNA molecule, e.g., a first gRNA molecule, comprising a targeting domain configured to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein (e.g., an eiCas9 fused to a transcription repressor domain), sufficiently close to a T cell knockdown target position to reduce, decrease or repress expression of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 g e.
  • a targeting domain configured to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein (e.g., an eiCas9 fused to a transcription repressor domain)
  • eiCas9 fusion protein e.g., an eiCas9 fused to a transcription repressor domain
  • the nucleic acid encodes a gRNA molecule, e.g., the first gRNA molecule, comprising a targeting domain comprising a sequence that is the same as, or differs by no more than 1 , 2, 3, 4, or 5 nucleotides from, a targeting domain sequence from any one of Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I, Tables 5A-I, Tables 6A-I, Tables 7A-H, Tables 8A-H, Tables 9A-I,
  • the nucleic acid encodes a gRNA molecule comprising a targeting domain selected from those in Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I, Tables 5A-I, Tables 6A-I, Tables 7A- H, Tables 8A-H, Tables 9A-I, Tables 10A-I, Tables 11A-I, Tables 12A-I, Tables 13A-K, Tables 14A- K, Tables 15A-F, Tables 16A-K, Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23A-J, Tables 24A-K, Tables 25A-G, Tables 26A-G, Table 27, Table 29, Table 31, or Table 32.
  • a targeting domain selected from those in Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I,
  • the nucleic acid encodes a modular gRNA, e.g., one or more nucleic acids encode a modular gRNA. In other embodiments, the nucleic acid encodes a chimeric gRNA.
  • the nucleic acid may encode a gRNA, e.g., the first gRNA molecule, comprising a targeting domain comprising 16 nucleotides or more in length.
  • the nucleic acid may encode a gRNA, e.g., the first gRNA molecule, comprising a targeting domain comprising 16 nucleotides or more in length.
  • the nucleic acid encodes a gRNA, e.g., the first gRNA molecule, comprising a targeting domain that is 17 nucleotides in length. In other embodiments, the nucleic acid encodes a gRNA, e.g., the first gRNA molecule, comprising a targeting domain that is 18 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, e.g., the first gRNA molecule, comprising a targeting domain that is 19 nucleotides in length.
  • the nucleic acid encodes a gRNA, e.g., the first gRNA molecule, comprising a targeting domain that is 20 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, e.g., the first gRNA molecule, comprising a targeting domain that is 21 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, e.g., the first gRNA molecule, comprising a targeting domain that is 22 nucleotides in length.
  • the nucleic acid encodes a gRNA, e.g., the first gRNA molecule, comprising a targeting domain that is 23 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, e.g., the first gRNA molecule, comprising a targeting domain that is 24 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, e.g., the first gRNA molecule, comprising a targeting domain that is 25 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, e.g., the first gRNA molecule, comprising a targeting domain that is 26 nucleotides in length.
  • a nucleic acid encodes a gRNA comprising from 5' to 3': a targeting domain (comprising a "core domain", and optionally a "secondary domain”); a first complementarity domain; a linking domain; a second complementarity domain; a proximal domain; and a tail domain.
  • a targeting domain comprising a "core domain”, and optionally a "secondary domain”
  • a first complementarity domain comprising from 5' to 3'
  • a targeting domain comprising from 5' to 3': a targeting domain (comprising a "core domain", and optionally a "secondary domain”); a first complementarity domain; a linking domain; a second complementarity domain; a proximal domain; and a tail domain.
  • the proximal domain and tail domain are taken together as a single domain.
  • a nucleic acid encodes a gRNA e.g., the first gRNA molecule, comprising a linking domain of no more than 25 nucleotides in length; a proximal and tail domain, that taken together, are at least 20 nucleotides in length; and a targeting domain equal to or greater than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • a nucleic acid encodes a gRNA e.g., the first gRNA molecule, comprising a linking domain of no more than 25 nucleotides in length; a proximal and tail domain, that taken together, are at least 30 nucleotides in length; and a targeting domain equal to or greater than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • a nucleic acid encodes a gRNA e.g., the first gRNA molecule, comprising a linking domain of no more than 25 nucleotides in length; a proximal and tail domain, that taken together, are at least 35 nucleotides in length; and a targeting domain equal to or greater than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • a nucleic acid encodes a gRNA comprising e.g., the first gRNA molecule, a linking domain of no more than 25 nucleotides in length; a proximal and tail domain, that taken together, are at least 40 nucleotides in length; and a targeting domain equal to or greater than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • a nucleic acid comprises (a) a sequence that encodes a gRNA molecule, e.g., the first gRNA molecule, comprising a targeting domain that is complementary with a target domain in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, as disclosed herein, and further comprising (b) a sequence that encodes a Cas9 molecule.
  • the nucleic acid further comprises a sequence encoding a governing gRNA molecule.
  • the Cas9 molecule may be an enzymatically active Cas9 (eaCas9) molecule, e.g., an eaCas9 molecule that forms a double strand break in a target nucleic acid or an eaCas9 molecule forms a single strand break in a target nucleic acid (e.g., a nickase molecule).
  • eaCas9 enzymatically active Cas9
  • the Cas9 molecule may be an enzymatically inactive Cas9 (eiCas9) molecule or a modified eiCas9 molecule, e.g., the eiCas9 molecule is fused to Kriippel-associated box (KRAB) to generate an eiCas9-KRAB fusion protein molecule.
  • eiCas9 enzymatically inactive Cas9
  • KRAB Kriippel-associated box
  • a nucleic acid disclosed herein may comprise (a) a sequence that encodes a gRNA molecule comprising a targeting domain that is complementary with a target domain in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, as disclosed herein; (b) a sequence that encodes a Cas9 molecule; and further comprises (c) (i) a sequence that encodes a second gRNA molecule described herein having a targeting domain that is complementary to a second target domain of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, and optionally, (ii) a sequence that encodes a third gRNA molecule described herein having a targeting domain that is complementary to a third target domain of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene; and optionally, (iii) a sequence that encodes a fourth gRNA molecule
  • a nucleic acid encodes a second gR A molecule comprising a targeting domain configured to provide a cleavage event, e.g., a double strand break or a single strand break, sufficiently close to a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene, to allow alteration, e.g., alteration associated with NHEJ, of the a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene, either alone or in combination with the break positioned by the first gRNA molecule.
  • a cleavage event e.g., a double strand break or a single strand break
  • the nucleic acid encodes a second gRNA molecule comprising a targeting domain configured to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein (e.g., an eiCas9 fused to a transcription repressor domain), sufficiently close to a T cell knockdown target position to reduce, decrease or repress expression of the FAS, BID, CTLA4, PDCDl, CBLB, or PTPN6 gene.
  • eiCas9 enzymatically inactive Cas9
  • an eiCas9 fusion protein e.g., an eiCas9 fused to a transcription repressor domain
  • a nucleic acid encodes a third gRNA molecule comprising a targeting domain configured to provide a cleavage event, e.g., a double strand break or a single strand break, sufficiently close to a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene to allow alteration, e.g., alteration associated with NHEJ, of a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene, either alone or in combination with the break positioned by the first and/or second gRNA molecule.
  • a cleavage event e.g., a double strand break or a single strand break
  • the nucleic acid encodes a third gRNA molecule comprising a targeting domain configured to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein (e.g., an eiCas9 fused to a transcription repressor domain), sufficiently close to a T cell knockdown target position to reduce, decrease or repress expression of the FAS, BID, CTLA4, PDCDl, CBLB, or PTPN6 gene.
  • eiCas9 enzymatically inactive Cas9
  • an eiCas9 fusion protein e.g., an eiCas9 fused to a transcription repressor domain
  • a nucleic acid encodes a fourth gRNA molecule comprising a targeting domain configured to provide a cleavage event, e.g., a double strand break or a single strand break, sufficiently close to a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene to allow alteration, e.g., alteration associated with NHEJ, of a T cell target position in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene, either alone or in combination with the break positioned by the first gRNA molecule, the second gRNA molecule and the third gRNA molecule.
  • a cleavage event e.g., a double strand break or a single strand break
  • the nucleic acid encodes a fourth gRNA molecule comprising a targeting domain configured to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein (e.g., an eiCas9 fused to a transcription repressor domain), sufficiently close to a T cell knockdown target position to reduce, decrease or repress expression of the FAS, BID, CTLA4, PDCDl, CBLB, or PTPN6 gene.
  • eiCas9 enzymatically inactive Cas9
  • an eiCas9 fusion protein e.g., an eiCas9 fused to a transcription repressor domain
  • the nucleic acid encodes a second gRNA molecule.
  • the second gRNA is selected to target the same T cell target position as the first gRNA molecule.
  • the nucleic acid may encode a third gRNA, and further optionally, the nucleic acid may encode a fourth gRNA molecule.
  • the third gRNA molecule and the fourth gRNA molecule are selected to target the same T cell target position as the first and second gRNA molecules.
  • the nucleic acid encodes a second gRNA molecule comprising a targeting domain comprising a sequence that is the same as, or differs by no more than 1 , 2, 3, 4, or 5 nucleotides from, a targeting domain sequence from one of Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I, Tables 5A-I, Tables 6A-I, Tables 7A-H, Tables 8A-H, Tables 9A-I, Tables 10A-I, Tables 11A-I, Tables 12A-I, Tables 13A-K, Tables 14A-K, Tables 15A-F, Tables 16A-K, Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23A-J, Tables 24A-K, Tables 25A-G, or Tables 26A-G Tables 26A-G,
  • the nucleic acid encodes a second gRNA molecule comprising a targeting domain selected from those in Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I, Tables 5A-I, Tables 6A-I, Tables 7A-H, Tables 8A-H, Tables 9A-I, Tables 10A-I, Tables 11A-I, Tables 12A-I, Tables 13A-K, Tables 14A-K, Tables 15A-F, Tables 16A-K, Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21 A-K, Tables 22A-K, Tables 23 A- J, Tables 24A-K, Tables 25A-G, or Tables 26A-G, Table 27, Table 29, Table 31, or Table 32.
  • a targeting domain selected from those in Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-
  • the third and fourth gRNA molecules may comprise a targeting domain comprising a sequence that is the same as, or differs by no more than 1 , 2, 3, 4, or 5 nucleotides from, a targeting domain sequence independently selected from one of Tables 1 A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I, Tables 5A-I, Tables 6A-I, Tables 7A-H, Tables 8A-H, Tables 9A-I, Tables 10 A-I, Tables 11 A-I, Tables 12A-I, Tables 13A-K, Tables 14A-K, Tables 15A-F, Tables 16A-K, Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23A-J, Tables 24A-K, Tables 25A-G, Tables 26A-
  • the third and fourth gRNA molecules may comprise a targeting domain independently selected from those in Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I, Tables 5A-I, Tables 6A-I, Tables 7A-H, Tables 8A-H, Tables 9A-I, Tables 10 A-I, Tables 11A- I, Tables 12A-I, Tables 13A-K, Tables 14A-K, Tables 15A-F, Tables 16A-K, Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23A-J, Tables 24A-K, Tables 25A-G, Tables 26A-G, Table 27, Table 29, Table 31, or Table 32.
  • the nucleic acid encodes a second gRNA which is a modular gRNA, e.g., wherein one or more nucleic acid molecules encode a modular gRNA.
  • the nucleic acid encoding a second gRNA is a chimeric gRNA.
  • the third and fourth gRNA may be a modular gRNA or a chimeric gRNA. When multiple gRNAs are used, any combination of modular or chimeric gRNAs may be used.
  • a nucleic acid may encode a second, a third, and/or a fourth gRNA comprising a targeting domain comprising 16 nucleotides or more in length.
  • the nucleic acid encodes a second gRNA comprising a targeting domain that is 16 nucleotides in length.
  • the nucleic acid encodes a second gRNA comprising a targeting domain that is 17 nucleotides in length.
  • the nucleic acid encodes a second gRNA comprising a targeting domain that is 18 nucleotides in length.
  • the nucleic acid encodes a second gRNA comprising a targeting domain that is 19 nucleotides in length.
  • the nucleic acid encodes a second gRNA comprising a targeting domain that is 20 nucleotides in length. In still other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain that is 21 nucleotides in length. In still other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain that is 22 nucleotides in length. In still other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain that is 23 nucleotides in length. In still other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain that is 24 nucleotides in length.
  • the nucleic acid encodes a second gRNA comprising a targeting domain that is 25 nucleotides in length. In still other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain that is 26 nucleotides in length.
  • the targeting domain comprises 16 nucleotides.
  • the targeting domain comprises 17 nucleotides.
  • the targeting domain comprises 18 nucleotides.
  • the targeting domain comprises 19 nucleotides.
  • the targeting domain comprises 20 nucleotides.
  • the targeting domain comprises 21 nucleotides.
  • the targeting domain comprises 22 nucleotides.
  • the targeting domain comprises 23 nucleotides.
  • the targeting domain comprises 24 nucleotides.
  • the targeting domain comprises 25 nucleotides.
  • the targeting domain comprises 26 nucleotides.
  • a nucleic acid encodes a second, a third, and/or a fourth gRNA comprising from 5' to 3' : a targeting domain (comprising a "core domain", and optionally a "secondary domain”); a first complementarity domain; a linking domain; a second complementarity domain; a proximal domain; and a tail domain.
  • a targeting domain comprising a "core domain”, and optionally a "secondary domain”
  • a first complementarity domain comprising from 5' to 3' : a targeting domain (comprising a "core domain", and optionally a "secondary domain”); a first complementarity domain; a linking domain; a second complementarity domain; a proximal domain; and a tail domain.
  • the proximal domain and tail domain are taken together as a single domain.
  • a nucleic acid encodes a second, a third, and/or a fourth gR A comprising a linking domain of no more than 25 nucleotides in length; a proximal and tail domain, that taken together, are at least 20 nucleotides in length; and a targeting domain of equal to or greater than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • a nucleic acid encodes a second, a third, and/or a fourth gRNA comprising a linking domain of no more than 25 nucleotides in length; a proximal and tail domain, that taken together, are at least 30 nucleotides in length; and a targeting domain of equal to or greater than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • a nucleic acid encodes a second, a third, and/or a fourth gRNA comprising a linking domain of no more than 25 nucleotides in length; a proximal and tail domain, that taken together, are at least 35 nucleotides in length; and a targeting domain of equal to or greater than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • a nucleic acid encodes a second, a third, and/or a fourth gRNA comprising a linking domain of no more than 25 nucleotides in length; a proximal and tail domain, that taken together, are at least 40 nucleotides in length; and a targeting domain of equal to or greater than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • a nucleic acid may comprise (a) a sequence encoding a gRNA molecule comprising a targeting domain that is complementary with a target domain in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, and (b) a sequence encoding a Cas9 molecule.
  • (a) and (b) are present on the same nucleic acid molecule, e.g., the same vector, e.g., the same viral vector, e.g., the same adeno-associated virus (AAV) vector.
  • the nucleic acid molecule is an AAV vector.
  • Exemplary AAV vectors that may be used in any of the described compositions and methods include an AAV1 vector, a modified AAV1 vector, an AAV2 vector, a modified AAV2 vector, an AAV3 vector, an AAV4 vector, a modified AAV4 vector, an AAV5 vector, a modified AAV5 vector, a modified AAV3 vector, an AAV6 vector, a modified AAV6 vector, an AAV7 vector, a modified AAV7 vector, an AAV8 vector,an AAV9 vector an AAV.rhlO vector, a modified AAV.rhlO vector, an AAV.rh32/33 vector, a modified AAV.rh32/33 vector, an AAV.rh43 vector, a modified AAV.rh43 vector, an AAV.rh64Rl vector, and a modified AAV.rh64Rl vector.
  • first nucleic acid molecule e.g. a first vector, e.g., a first viral vector, e.g., a first AAV vector
  • second nucleic acid molecule e.g., a second vector, e.g., a second vector, e.g., a second AAV vector.
  • the first and second nucleic acid molecules may be AAV vectors.
  • the nucleic acid may further comprise (c) (i) a sequence that encodes a second gRNA molecule as described herein.
  • the nucleic acid comprises (a), (b) and (c)(i).
  • Each of (a) and (c)(i) may be present on the same nucleic acid molecule, e.g., the same vector, e.g., the same viral vector, e.g., the same adeno-associated virus (AAV) vector.
  • the nucleic acid molecule is an AAV vector.
  • (a) and (c)(i) are on different vectors.
  • a first nucleic acid molecule e.g. a first vector, e.g., a first viral vector, e.g., a first AAV vector
  • a second nucleic acid molecule e.g., a second vector, e.g., a second vector, e.g., a second AAV vector.
  • the first and second nucleic acid molecules are AAV vectors.
  • each of (a), (b), and (c)(i) are present on the same nucleic acid molecule, e.g., the same vector, e.g., the same viral vector, e.g., an AAV vector.
  • the nucleic acid molecule is an AAV vector.
  • one of (a), (b), and (c)(i) is encoded on a first nucleic acid molecule, e.g., a first vector, e.g., a first viral vector, e.g., a first AAV vector; and a second and third of (a), (b), and (c)(i) is encoded on a second nucleic acid molecule, e.g., a second vector, e.g., a second vector, e.g., a second AAV vector.
  • the first and second nucleic acid molecule may be AAV vectors.
  • first nucleic acid molecule e.g., a first vector, e.g., a first viral vector, a first AAV vector
  • second nucleic acid molecule e.g., a second vector, e.g., a second vector, e.g., a second AAV vector.
  • the first and second nucleic acid molecule may be AAV vectors.
  • first nucleic acid molecule e.g., a first vector, e.g., a first viral vector, e.g., a first AAV vector
  • second nucleic acid molecule e.g., a second vector, e.g., a second vector, e.g., a second AAV vector.
  • the first and second nucleic acid molecule may be AAV vectors.
  • (c)(i) is present on a first nucleic acid molecule, e.g., a first vector, e.g., a first viral vector, e.g., a first AAV vector; and (b) and (a) are present on a second nucleic acid molecule, e.g., a second vector, e.g., a second vector, e.g., a second AAV vector.
  • the first and second nucleic acid molecule may be AAV vectors.
  • each of (a), (b) and (c)(i) are present on different nucleic acid molecules, e.g., different vectors, e.g., different viral vectors, e.g., different AAV vector.
  • vectors e.g., different viral vectors, e.g., different AAV vector.
  • (a) may be on a first nucleic acid molecule
  • (c)(i) on a third nucleic acid molecule may be AAV vectors.
  • each of (a), (b), (c)(i), (c) (ii) and (c)(iii) may be present on the same nucleic acid molecule, e.g., the same vector, e.g., the same viral vector, e.g., an AAV vector.
  • the nucleic acid molecule is an AAV vector.
  • each of (a), (b), (c)(i), (c) (ii) and (c)(iii) may be present on the different nucleic acid molecules, e.g., different vectors, e.g., the different viral vectors, e.g., different AAV vectors.
  • each of (a), (b), (c)(i), (c) (ii) and (c)(iii) may be present on more than one nucleic acid molecule, but fewer than five nucleic acid molecules, e.g., AAV vectors.
  • the nucleic acids described herein may comprise a promoter operably linked to the sequence that encodes the gRNA molecule of (a), e.g., a promoter described herein.
  • the nucleic acid may further comprise a second promoter operably linked to the sequence that encodes the second, third and/or fourth gRNA molecule of (c), e.g., a promoter described herein.
  • the promoter and second promoter differ from one another. In some embodiments, the promoter and second promoter are the same.
  • nucleic acids described herein may further comprise a promoter operably linked to the sequence that encodes the Cas9 molecule of (b), e.g., a promoter described herein.
  • compositions comprising (a) a gRNA molecule comprising a targeting domain that is complementary with a target domain in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, as described herein.
  • the composition of (a) may further comprise (b) a Cas9 molecule, e.g., a Cas9 molecule as described herein.
  • a composition of (a) and (b) may further comprise (c) a second, third and/or fourth gRNA molecule, e.g., a second, third and/or fourth gRNA molecule described herein.
  • a composition may comprise at least two gRNA molecules to target two or more of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and TRBC genes.
  • the composition further comprises a governing gRNA molecule, or a nucleic acid that encodes a governing gRNA molecule.
  • a method of altering a cell comprising contacting the cell with: (a) a gRNA that targets the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, e.g., a gRNA as described herein; (b) a Cas9 molecule, e.g., a Cas9 molecule as described herein; and optionally, (c) a second, third and/or fourth gRNA that targets FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, e.g., a gRNA, as described herein.
  • the method further comprises, introducing into the cell, a governing gRNA molecule, or a nucleic acid that encodes a governing gRNA molecule
  • the method comprises contacting the cell with (a) and (b).
  • the method comprises contacting the cell with (a), (b), and (c).
  • the gRNA of (a) and optionally (c) may be independently selected from any of Tables 1A-I,
  • the method of altering a cell e.g., altering the structure, e.g., altering the sequence, of a target nucleic acid of a cell, comprising altering two or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the cell is contacted with: (a) gRNAs that target two or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes, e.g., two or more of the gRNA as described herein; (b) a Cas9 molecule, e.g., a Cas9 molecule as described herein; and optionally, (c) second, third and/or fourth gRNAs that respectively targets the two or more genes selected in (a), e.g., a gRNA, as described herein.
  • the method further comprises, introducing into the cell, a governing gRNA molecule, or a nucleic acid that encodes a governing gRNA molecule, into the cell.
  • the method of altering a cell comprises altering two or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method of altering a cell comprises altering three or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method of altering a cell comprises altering four or more of FAS, BID,
  • CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes are included in CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method of altering a cell comprises altering five or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method of altering a cell comprises altering six or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method of altering a cell comprises altering seven or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method of altering a cell comprises altering each of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method comprises contacting a cell from a subject suffering from cancer.
  • the cell may be from a subject that would benefit from having a mutation at a T cell target position.
  • the cell being contacted in the disclosed method is a T cell.
  • the contacting may be performed ex vivo and the contacted cell may be returned to the subject's body after the contacting step.
  • the T cell may be an engineered T cell, e.g., an engineered CAR (chimeric antigen receptor) T cell or an engineered TCR (T-cell receptor) T cell.
  • a T cell may engineered to express a TCR or a CAR prior to, after, or at the same time as introducing a T cell target position mutation in one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene.
  • the method of altering a cell as described herein comprises acquiring knowledge of the sequence of a T cell target position in the cell, prior to the contacting step.
  • Acquiring knowledge of the sequence of a T cell target position in the cell may be by sequencing the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, or a portion of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene.
  • the contacting step of the method comprises contacting the cell with a nucleic acid, e.g., a vector, e.g., an AAV vector, e.g., an AAV vector described herein, that expresses at least one of (a), (b), and (c).
  • the contacting step of the method comprises contacting the cell with a nucleic acid, e.g., a vector, e.g., an AAV vector, that expresses each of (a), (b), and (c).
  • the contacting step of the method comprises delivering to the cell a Cas9 molecule of (b) and a nucleic acid which encodes a gRNA (a) and optionally, a second gRNA (c)(i) (and further optionally, a third gRNA (c)(iv) and/or fourth gRNA (c)(iii).
  • the contacting step of the method comprises contacting the cell with a nucleic acid, e.g., a vector, e.g., an AAV vector, that expresses at least one of (a), (b), and (c). In some embodiments, the contacting step of the method comprises contacting the cell with a nucleic acid, e.g., a vector, e.g., an AAV vector, that expresses each of (a), (b), and (c).
  • a nucleic acid e.g., a vector, e.g., an AAV vector
  • contacting comprises contacting the cell with a nucleic acid, e.g., a vector, e.g., an AAV vector an AAVl vector, a modified AAVl vector, an AAV2 vector, a modified AAV2 vector, an AAV3 vector, a modified AAV3 vector, an AAV4 vector, a modified AAV4 vector, an AAV5 vector, a modified AAV5 vector, an AAV6 vector, a modified AAV6 vector, an AAV7 vector, a modified AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV.rhlO vector, a modified AAV.rhlO vector, an AAV.rh32/33 vector, a modified
  • a nucleic acid e.g., a vector, e.g., an AAV vector an AAVl vector, a modified AAVl vector, an AAV2 vector, a modified AAV2 vector, an AAV3 vector, a modified AAV3 vector, an AAV
  • AAV.rh32/33 vector an AAV.rh43vector, a modified AAV.rh43vector, an AAV.rh64Rl vector, and a modified AAV.rh64Rlvector.
  • contacting comprises delivering to the cell a Cas9 molecule of (b), as a protein or an mRNA, and a nucleic acid which encodes (a) and optionally (c).
  • contacting comprises delivering to the cell a Cas9 molecule of (b), as a protein or an mRNA, the gRNA of (a), as an RNA, and optionally the second gRNA of (c), as an RNA.
  • contacting comprises delivering to the cell a gRNA of (a) as an RNA, optionally the second gRNA of (c) as an RNA, and a nucleic acid that encodes the Cas9 molecule of (b).
  • a method of treating a subject suffering from cancer e.g., altering the structure, e.g., sequence, of a target nucleic acid of the subject, comprising contacting the subject (or a cell from the subject) with:
  • a gRNA that targets the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene e.g., a gRNA disclosed herein;
  • a Cas9 molecule e.g., a Cas9 molecule disclosed herein;
  • a second gRNA that targets the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene e.g., a second gRNA disclosed herein, and
  • the method further comprises, introducing into the subject, or a cell of the subject, a governing gRNA molecule, or a nucleic acid that encodes a governing gRNA molecule.
  • contacting comprises contacting with (a) and (b).
  • contacting comprises contacting with (a), (b), and (c)(i).
  • contacting comprises contacting with (a), (b), (c)(i) and (c)(ii).
  • contacting comprises contacting with (a), (b), (c)(i), (c)(ii) and (c)(iii).
  • the gRNA of (a) or (c) may be independently selected from any of Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I, Tables 5A-I, Tables 6A-I, Tables 7A-H, Tables 8A-H, Tables 9A-I, Tables 10A-I, Tables 11A-I, Tables 12A-I, Tables 13A-K, Tables 14A-K, Tables 15A-F, Tables 16A-K, Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23A-J, Tables 24A-K, Tables 25A-G, Tables 26A-G, Table 27, Table 29, Table 31, or Table 32, or a gRNA that differs by no more than 1, 2, 3,
  • the method of treating a subject suffering from cancer comprises altering two or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes, e.g., altering the structure, e.g., sequence, of two or more target nucleic acids of the subject (e.g., two or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes).
  • the subject When two or more genes are altered in a subject (or a cell from the subject), the subject (or a cell from the subject) is contacted with: (a) gRNAs that target two or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes, e.g., two or more of the gRNA as described herein; (b) a Cas9 molecule, e.g., a Cas9 molecule as described herein; and optionally, (c) second, third and/or fourth gRNAs that respectively targets the two or more genes selected in (a), e.g., a gRNA, as described herein.
  • the method further comprises, introducing into the subject, or a cell of the subject, a governing gRNA molecule, or a nucleic acid that encodes a governing gRNA molecule.
  • the method of treating a subject suffering from cancer comprises altering two or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method of treating a subject suffering from cancer comprises altering three or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method of treating a subject suffering from cancer comprises altering four or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method of treating a subject suffering from cancer comprises altering five or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method of treating a subject suffering from cancer comprises altering six or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method of treating a subject suffering from cancer comprises altering seven or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method of treating a subject suffering from cancer comprises altering each of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the method comprises acquiring knowledge of the sequence at a T cell target position in the subject.
  • the method comprises acquiring knowledge of the sequence at a T cell target position in the subject by sequencing one or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene or a portion of one or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene.
  • the method comprises inducing a mutation at a T cell target position in the
  • the method comprises inducing a mutation at a T cell target position in one or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and TRBC genes.
  • the method comprises inducing a mutation at a T cell target position in two or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and TRBC genes.
  • the method comprises inducing a mutation at a T cell target position in three or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and TRBC genes.
  • the method comprises inducing a mutation at a T cell target position in four or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and TRBC genes. In an embodiment, the method comprises inducing a mutation at a T cell target position in five or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and TRBC genes.
  • the method comprises inducing a mutation at a T cell target position in six or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and TRBC genes.
  • the method comprises inducing a mutation at a T cell target position in seven or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and TRBC genes.
  • the method comprises inducing a mutation at a T cell target position in each of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and TRBC genes.
  • the method comprises inducing a mutation at a T cell target position in one or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene by NHEJ.
  • a cell of the subject is contacted ex vivo with (a), (b), and optionally (c).
  • the cell is returned to the subject's body.
  • the cell of the subject being contacted ex vivo is a T cell.
  • the T cell may be an engineered T cell, e.g., an engineered CAR (chimeric antigen receptor) T cell or an engineered TCR (T-cell receptor) T cell.
  • a T cell may engineered to express a TCR or a CAR prior to, after, or at the same time as introducing a T cell target position mutation in one or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene.
  • the method comprises (1) inducing a mutation at a T cell target position by NHEJ or (2) knocking down expression of the FAS, BID, CTLA4, PDCDl, CBLB, or PTPN6 gene, e.g., by targeting the promoter region, a Cas9 of (b) and at least one guide RNA, e.g., a guide RNA of (a) are included in the contacting step.
  • reaction mixture comprising a, gRNA, a nucleic acid, or a composition described herein, and a cell, e.g., a cell from a subject having cancer, or a subject which would benefit from a mutation at a T cell target position.
  • kits comprising, (a) gRNA molecule described herein, or nucleic acid that encodes the gRNA, and one or more of the following:
  • a Cas9 molecule e.g., a Cas9 molecule described herein, or a nucleic acid or mRNA that encodes the Cas9;
  • a second gRNA molecule e.g., a second gRNA molecule described herein or a nucleic acid that encodes (c)(i);
  • a third gRNA molecule e.g., a second gRNA molecule described herein or a nucleic acid that encodes (c)(ii);
  • kits comprises nucleic acid, e.g., an AAV vector, e.g., an AAV vector described herein, that encodes one or more of (a), (b), (c)(i), (c)(ii), and (c)(iii).
  • the kit further comprises a governing gRNA molecule, or a nucleic acid that encodes a governing gRNA molecule.
  • the disclosure features a gRNA molecule, referred to herein as a governing gRNA molecule, comprising a targeting domain which is complementary to a target domain on a nucleic acid that encodes a component of the CRISPR/Cas system introduced into a cell or subject.
  • a gRNA molecule referred to herein as a governing gRNA molecule, comprising a targeting domain which is complementary to a target domain on a nucleic acid that encodes a component of the CRISPR/Cas system introduced into a cell or subject.
  • the governing gRNA molecule targets a nucleic acid that encodes a Cas9 molecule or a nucleic acid that encodes a target gene gRNA molecule.
  • the governing gRNA comprises a targeting domain that is complementary to a target domain in a sequence that encodes a Cas9 component, e.g., a Cas9 molecule or target gene gRNA molecule.
  • the target domain is designed with, or has, minimal homology to other nucleic acid sequences in the cell, e.g., to minimize off- target cleavage.
  • the targeting domain on the governing gRNA can be selected to reduce or minimize off-target effects.
  • a target domain for a governing gRNA can be disposed in the control or coding region of a Cas9 molecule or disposed between a control region and a transcribed region. In an embodiment, a target domain for a governing gRNA can be disposed in the control or coding region of a target gene gRNA molecule or disposed between a control region and a transcribed region for a target gene gRNA.
  • altering, e.g., inactivating, a nucleic acid that encodes a Cas9 molecule or a nucleic acid that encodes a target gene gRNA molecule can be effected by cleavage of the targeted nucleic acid sequence or by binding of a Cas9 molecule/governing gRNA molecule complex to the targeted nucleic acid sequence.
  • compositions, reaction mixtures and kits, as disclosed herein, can also include a governing gRNA molecule, e.g., a governing gRNA molecule disclosed herein.
  • a governing gRNA molecule e.g., a governing gRNA molecule disclosed herein.
  • Figs. 1A-1G are representations of several exemplary gRNAs.
  • Fig. 1A depicts a modular gRNA molecule derived in part (or modeled on a sequence in part) from Streptococcus pyogenes (S. pyogenes) as a duplexed structure (SEQ ID NO:42 and 43, respectively, in order of appearance);
  • Fig. IB depicts a unimolecular (or chimeric) gRNA molecule derived in part from S. pyogenes as a duplexed structure (SEQ ID NO:44);
  • Fig. 1C depicts a unimolecular gRNA molecule derived in part from S. pyogenes as a duplexed structure (SEQ ID NO:45);
  • Fig. ID depicts a unimolecular gRNA molecule derived in part from S. pyogenes as a duplexed structure (SEQ ID NO:46);
  • Fig. IE depicts a unimolecular gRNA molecule derived in part from S. pyogenes as a duplexed structure (SEQ ID NO:47);
  • Fig. IF depicts a modular gRNA molecule derived in part from Streptococcus thermophilus (S. thermophilus) as a duplexed structure (SEQ ID NO:48 and 49, respectively, in order of appearance);
  • Fig. 1G depicts an alignment of modular gRNA molecules of S. pyogenes and S. thermophilus
  • Figs. 2A-2G depict an alignment of Cas9 sequences from Chylinski et al. (RNA Biol. 2013; 10(5): 726-737).
  • the N-terminal RuvC-like domain is boxed and indicated with a "y”.
  • the other two RuvC-like domains are boxed and indicated with a "b”.
  • the HNH-like domain is boxed and indicated by a "g”.
  • Sm S. mutans (SEQ ID NO: 1); Sp: S. pyogenes (SEQ ID NO:2); St: S. thermophilus (SEQ ID NO:3); Li: L. innocua (SEQ ID NO:4).
  • Motif this is a motif based on the four sequences: residues conserved in all four sequences are indicated by single letter amino acid abbreviation; "*" indicates any amino acid found in the corresponding position of any of the four sequences; and "-” indicates any amino acid, e.g., any of the 20 naturally occurring amino acids.
  • Figs. 3A-3B show an alignment of the N-terminal RuvC-like domain from the Cas9 molecules disclosed in Chylinski et al (SEQ ID NO:54-103, respectively, in order of appearance).
  • the last line of Fig. 3B identifies 4 highly conserved residues.
  • Figs. 4A-4B show an alignment of the N-terminal RuvC-like domain from the Cas9 molecules disclosed in Chylinski et al. with sequence outliers removed (SEQ ID NO: 104-177, respectively, in order of appearance).
  • the last line of Fig. 4B identifies 3 highly conserved residues.
  • Figs. 5A-5C show an alignment of the HNH-like domain from the Cas9 molecules disclosed in Chylinski et al (SEQ ID NO: 178-252, respectively, in order of appearance). The last line of Fig. 5C identifies conserved residues.
  • Figs. 6A-6B show an alignment of the HNH-like domain from the Cas9 molecules disclosed in Chylinski et al. with sequence outliers removed (SEQ ID NO:253-302, respectively, in order of appearance).
  • the last line of Fig. 6B identifies 3 highly conserved residues.
  • Figs. 7A-7B depict an alignment of Cas9 sequences from S. pyogenes and Neisseria meningitidis
  • N. meningitidis The N-terminal RuvC-like domain is boxed and indicated with a "Y”. The other two RuvC-like domains are boxed and indicated with a "B”. The HNH-like domain is boxed and indicated with a "G”.
  • Sp S. pyogenes
  • Nm N. meningitidis.
  • Motif this is a motif based on the two sequences: residues conserved in both sequences are indicated by a single amino acid designation; "*" indicates any amino acid found in the corresponding position of any of the two sequences; "-" indicates any amino acid, e.g., any of the 20 naturally occurring amino acids, and "-” indicates any amino acid, e.g., any of the 20 naturally occurring amino acids, or absent.
  • Fig. 8 shows a nucleic acid sequence encoding Cas9 of N. meningitidis (SEQ ID NO:303).
  • Sequence indicated by an "R” is an SV40 NLS; sequence indicated as “G” is an HA tag; and sequence indicated by an “O” is a synthetic NLS sequence; the remaining (unmarked) sequence is the open reading frame (ORF).
  • Fig. 9A shows schematic representations of the domain organization of S. pyogenes Cas 9 and the organization of the Cas9 domains, including amino acid positions, in reference to the two lobes of Cas9 (recognition (REC) and nuclease (NUC) lobes).
  • REC recognition
  • NUC nuclease
  • Fig. 9B shows schematic representations of the domain organization of S. pyogenes Cas 9 and the percent homology of each domain across 83 Cas9 orthologs.
  • Fig. 10A shows an exemplary structure of a unimolecular gRNA molecule derived in part from S. pyogenes as a duplexed structure (SEQ ID NO:40).
  • Fig. 10B shows an exemplary structure of a unimolecular gRNA molecule derived in part from S. aureus as a duplexed structure (SEQ ID NO:41).
  • Fig. 11 shows results from an experiment assesssing the activity of gRNAs directed against TRBC gene in 293 cells using S. aureus Cas9. 293s were transfected with two plasmids - one encoding S. aureus Cas9 and the other encoding the listed gRNA. The graph summarizes the average %NHEJ observed at the TRBC2 locus for each gRNA, which was calculated from a T7E1 assay performed on genomic DNA isolated from duplicate samples.
  • Fig. 12 shows results from an experiment assesssing the activity of gRNAs directed against TRBC gene in 293 cells using S. pyrogenes Cas9. 293 cells were transfected with two plasmids - one encoding S. pyogenes Cas9 and the other encoding the listed gRNA. The graph shows the average
  • %NHEJ observed at both the TRBCl and TRBC2 loci for each gRNA, which was calculated from a T7E1 assay performed on genomic DNA isolated from duplicate samples.
  • Fig. 13 shows results from an experiment assesssing the activity of gRNAs directed against TRAC gene in 293 cells using S. aureus Cas9. 293 cells were transfected with two plasmids - one encoding S. aureus Cas9 and the other encoding the listed gRNA. The graph shows the average %NHEJ observed at the TRAC locus for each gRNA, which was calculated from a T7E1 assay performed on genomic DNA isolated from duplicate samples.
  • Fig. 14 shows results from an experiment assesssing the activity of gRNAs directed against TRAC gene in 293 cells using S. pyogenes Cas9. 293 cells were transfected with two plasmids - one encoding S. pyogenes Cas9 and the other encoding the listed gRNA. The graph shows the average
  • %NHEJ observed at the TRAC locus for each gRNA, which was calculated from a T7E1 assay performed on genomic DNA isolated from duplicate samples.
  • Fig. 15 shows results from an experiment assesssing the activity of gRNAs directed against PDCD1 gene in 293 cells using S. aureus Cas9. 293 cells were transfected with two plasmids - one encoding S. aureus Cas9 and the other encoding the listed gRNA. The graph shows the average %NHEJ observed at the PDCD1 locus for each gRNA, which was calculated from a T7E1 assay performed on genomic DNA isolated from duplicate samples.
  • Fig. 16 shows results from an experiment assesssing the activity of gRNAs directed against PDCD1 gene in 293 cells using S. pyogenes Cas9. 293 cells were transfected with two plasmids - one encoding S. pyogenes Cas9 and the other encoding the listed gRNA. The graph shows the average %NHEJ observed at the PDCD1 locus for each gRNA, which was calculated from a T7E1 assay performed on genomic DNA isolated from duplicate samples.
  • Figs. 17A-C depict results showing a loss of CD3 expression in CD4+ T cells due to delivery of S. pyogenes Cas9 mRNA and TRBC and TRAC gene specific gRNAs
  • Fig. 17A shows CD4+ T cells electroporated with S. pyogenes Cas9 mRNA and the gRNA indicated (TRBC-210 (GCGCUGACGAUCUGGGUGAC) (SEQ ID NO:413), TRAC-4
  • GCUGGUACACGGCAGGGUCA (SEQ ID NO:453) or AAVS1 (GUCCCCUCCACCCCACAGUG) (SEQ ID NO:51201)
  • APC-CD3 antibody stained with an APC-CD3 antibody and analyzed by FACS.
  • the cells were analyzed on day 2 and day 3 after the electroporation.
  • Fig. 17B shows quantification of the CD3 negative population from the plots in (A).
  • Fig. 17C shows %NHEJ results from the T7E1 assay performed on TRBC2 and TRAC loci.
  • Figs. 18A-C depict results showing a loss of CD3 expression in Jurkat T cells due to delivery of S. aureus Cas9/gRNA RNP targeting TRAC gene
  • Fig. 18A shows Jurkat T cells electroporated with S. aureus Cas9/gRNA TRAC-233
  • Fig. 18B shows quantification of the CD3 negative population from the plots in (A).
  • Fig. 18C shows % NHEJ results from the T7E1 assay performed on the TRAC locus
  • Fig. 19 shows the structure of the 5' ARCA cap.
  • Fig. 20 depicts results from the quantification of live Jurkat T cells post electroporation with Cas9 mRNA and AAVS1 gRNAs.
  • Jurkat T cells were electroporated with S. pyogenes Cas9 mRNA and the respective modified gRNA.
  • 24 hours after electroporation 1 x 10 5 cells were stained with FITC- conjugated Annexin-V specific antibody for 15 minutes at room temperature followed by staining with propidium iodide immediately before analysis by flow cytometry. The percentage of cells that did not stain for either Annexin-V or PI is presented in the bar graph.
  • Figs. 21A-C depict loss of CD3 expression in Naive CD3+ T cells due to delivery of S. aureus Cas9/gRNA RNP targeting TRAC.
  • Fig. 21A depicts na ' ive CD3+ T cells electroporated with S. aureus Cas9/gRNA (with targeting domain GUGAAUAGGCAGACAGACUUGUCA (SEQ ID NO:474) RNPs targeting TRAC were stained with an APC-CD3 antibody and analyzed by FACS. The cells were analyzed on day 4 after the electroporation. The negative control are cells with the gRNA with the targeting domain
  • Fig. 21B depicts quantification of the CD3 negative population from the plots in Fig. 21 A.
  • Fig. 21C depicts % NHEJ results from the T7E1 assay performed on the TRAC locus.
  • Fig. 22 depicts genomic editing at the PDCD 1 locus in Jurkat T cells after delivery of S. pyogenes Cas9 mRNA and PDCDl gRNA (with a targeting domain GUCUGGGCGGUGCUACAACU (SEQ ID NO:508)) or S. pyogenes Cas9/gRNA (with a targeting domain GUCUGGGCGGUGCUACAACU (SEQ ID NO:508)) RNP targeting PDCDl .
  • Quantification of %NHEJ results from the T7E1 assay performed on the PDCDl locus at 24, 48, and 72 hours. Higher levels of %NHEJ were detected with RNP vs mRNA delivery.
  • Domain is used to describe segments of a protein or nucleic acid. Unless otherwise indicated, a domain is not required to have any specific functional property.
  • Calculations of homology or sequence identity between two sequences are performed as follows.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes).
  • the optimal alignment is determined as the best score using the GAP program in the GCG software package with a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frame shift gap penalty of 5.
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
  • Governing gRNA molecule refers to a gRNA molecule that comprises a targeting domain that is complementary to a target domain on a nucleic acid that comprises a sequence that encodes a component of the CRISPR/Cas system that is introduced into a cell or subject. A governing gRNA does not target an endogenous cell or subject sequence.
  • a governing gRNA molecule comprises a targeting domain that is complementary with a target sequence on: (a) a nucleic acid that encodes a Cas9 molecule; (b) a nucleic acid that encodes a gRNA which comprises a targeting domain that targets FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene (a target gene gRNA); or on more than one nucleic acid that encodes a CRISPR/Cas component, e.g., both (a) and (b).
  • a nucleic acid molecule that encodes a CRISPR Cas component comprises more than one target domain that is complementary with a governing gRNA targeting domain. While not wishing to be bound by theory, it is believed that a governing gRNA molecule complexes with a Cas9 molecule and results in Cas9 mediated inactivation of the targeted nucleic acid, e.g., by cleavage or by binding to the nucleic acid, and results in cessation or reduction of the production of a CRISPR/Cas system component.
  • the Cas9 molecule forms two complexes: a complex comprising a Cas9 molecule with a target gene gRNA, which complex will alter the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene; and a complex comprising a Cas9 molecule with a governing gRNA molecule, which complex will act to prevent further production of a CRISPR/Cas system component, e.g., a Cas9 molecule or a target gene gRNA molecule.
  • a CRISPR/Cas system component e.g., a Cas9 molecule or a target gene gRNA molecule.
  • a governing gRNA molecule/Cas9 molecule complex binds to or promotes cleavage of a control region sequence, e.g., a promoter, operably linked to a sequence that encodes a Cas9 molecule, a sequence that encodes a transcribed region, an exon, or an intron, for the Cas9 molecule.
  • a governing gRNA molecule/Cas9 molecule complex binds to or promotes cleavage of a control region sequence, e.g., a promoter, operably linked to a gRNA molecule, or a sequence that encodes the gRNA molecule.
  • the governing gRNA limits the effect of the Cas9 molecule/target gene gRNA molecule complex-mediated gene targeting.
  • a governing gRNA places temporal, level of expression, or other limits, on activity of the Cas9 molecule/target gene gRNA molecule complex.
  • a governing gRNA reduces off- target or other unwanted activity.
  • a governing gRNA molecule inhibits, e.g., entirely or substantially entirely inhibits, the production of a component of the Cas9 system and thereby limits, or governs, its activity.
  • Modulator refers to an entity, e.g., a drug, which can alter the activity (e.g., enzymatic activity, transcriptional activity, or translational activity), amount, distribution, or structure of a subject molecule or genetic sequence.
  • modulation comprises cleavage, e.g., breaking of a covalent or non-covalent bond, or the forming of a covalent or non-covalent bond, e.g., the attachment of a moiety, to the subject molecule.
  • a modulator alters the, three dimensional, secondary, tertiary, or quaternary structure, of a subject molecule.
  • a modulator can increase, decrease, initiate, or eliminate a subject activity.
  • Large molecule refers to a molecule having a molecular weight of at least 2, 3, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 kD. Large molecules include proteins, polypeptides, nucleic acids, biologies, and carbohydrates.
  • Polypeptide refers to a polymer of amino acids having less than 100 amino acid residues. In an embodiment, it has less than 50, 20, or 10 amino acid residues.
  • Non- homologous end joining refers to ligation mediated repair and/or non-template mediated repair including, e.g., canonical NHEJ (cNHEJ), alternative
  • NHEJ NHEJ
  • MMEJ microhomology-mediated end joining
  • SSA single-strand annealing
  • SD-MMEJ synthesis-dependent microhomology-mediated end joining
  • Reference molecule e.g., a reference Cas9 molecule or reference gRNA, as used herein, refers to a molecule to which a subject molecule, e.g., a subject Cas9 molecule of subject gRNA molecule, e.g., a modified or candidate Cas9 molecule is compared.
  • a Cas9 molecule can be characterized as having no more than 10% of the nuclease activity of a reference Cas9 molecule.
  • reference Cas9 molecules include naturally occurring unmodified Cas9 molecules, e.g., a naturally occurring Cas9 molecule such as a Cas9 molecule of S. pyogenes, S. aureus, or S. thermophilus .
  • the reference Cas9 molecule is the naturally occurring Cas9 molecule having the closest sequence identity or homology with the Cas9 molecule to which it is being compared.
  • the reference Cas9 molecule is a sequence, e.g., a naturally occurring or known sequence, which is the parental form on which a change, e.g., a mutation has been made.
  • Small molecule refers to a compound having a molecular weight less than about 2 kD, e.g., less than about 2 kD, less than about 1.5 kD, less than about 1 kD, or less than about 0.75 kD.
  • Subject may mean either a human or non-human animal.
  • the term includes, but is not limited to, mammals (e.g., humans, other primates, pigs, rodents (e.g., mice and rats or hamsters), rabbits, guinea pigs, cows, horses, cats, dogs, sheep, and goats).
  • the subject is a human.
  • the subject is poultry.
  • Treatment mean the treatment of a disease in a mammal, e.g., in a human, including (a) inhibiting the disease, i.e., arresting or preventing its development; (b) relieving the disease, i.e., causing regression of the disease state; and (c) curing the disease.
  • X as used herein in the context of an amino acid sequence, refers to any amino acid (e.g., any of the twenty natural amino acids) unless otherwise specified.
  • compositions and methods described herein can be used to affect proliferation of engineered T cells by altering one ore more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • T cell-expressed genes e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • compositions and methods described herein can be used to affect proliferation of engineered T cells by altering the CBLB gene. While not wishing to be bound by theory, it is considered that reduced or absent expression of Casitas B-lineage lymphoma b protein (encoded by CBLB) reduces the requirement for exogenous interleukin signaling to promote proliferation of engineered T cells following transfer to the subject (Stromnes, I. M. et al., 2010 J. Clin. Invest. 120, 3722-3734).
  • compositions and methods described herein can be used to affect proliferation of engineered T cells by altering the PTPN6 gene. While not wishing to be bound by theory, it is considered that reduced or absent expression of Src homology region 2 domain-containing phosphatase- 1 protein (encoded by PTPN6) leads to increased short-term accumulation of transferred T cells with subsequently improved anti-tumor activity (Stromnes, I. M. et al., 2012 J. Immunol. 189, 1812-1825).
  • compositions and methods described herein can be used to affect proliferation of engineered T cells by altering the FAS gene. While not wishing to be bound by theory, it is considered that reduced or absent expression of the Fas protein will inhibit induction of T cell apoptosis by Fas- ligand; a factor expressed by many cancer types (Dotti, G. et al., 2005 Blood 105, 4677-4684).
  • compositions and methods described herein can be used to affect proliferation of engineered T cells by altering the BID gene. While not wishing to be bound by theory, it is considered that reduced or absent expression of the Bid protein prevents the induction of T cell apoptosis following activation of the Fas pathway (Lei, X. Y. et al., 2009 Immunol. Lett. 122, 30-36).
  • compositions and methods described herein can be used to decrease the effect of immune suppressive factors on engineered T cells by altering the CTLA4 gene. While not wishing to be bound by theory, it is considered that reduced or absent expression of cytotoxic T-lymphocyte- associated antigen 4 (encoded by CTLA4) abrogates the induction of a non-responsive state ("anergy") following binding of CD80 or CD86 expressed by antigen presenting cells in the tumor environment (Shrikant, P. et al, 1999 Immunity 1 1, 483-493).
  • compositions and methods described herein can be used to decrease the effect of immune suppressive factors on engineered T cells by altering the PDCD1 gene. While not wishing to be bound by theory, it is considered that reduced or absent expression of the Programmed Cell Death Protein 1 (encoded by PDCD1) prevents induction of T cell apoptosis by engagement of PD1 Ligand expressed by tumor cells or cells in the tumor environment (Topalian, S. L. et al., 2012 N. Engl. J. Med. 366, 2443-2454).
  • compositions and methods described herein can be used to improve T cell specificity and safety by altering the TRAC and/or TRBC gene. While not wishing to be bound by theory, it is considered that reduced or absent expression of T-cell receptors (encoded by TRAC and TRBC) prevents graft vs. host disease by eliminating T cell receptor recognition of and response to host tissues. This approach, therefore, could be used to generate "off the shelf T cells (Torikai et al., 2012 Blood 1 19, 5697-5705).
  • TRAC and/or TRBC gene will reduce or eliminate mis-pairing of endogenous T cell receptors with exogenously introduced engineered T cell receptors, thus improving therapeutic efficacy (Provasi et al., 2012, Nature Medicine 18, 807-815).
  • compositions and methods described herein can be used to decrease one or more of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and TRBC genes to improve treatment of cancer immunotherapy using engineered T cells.
  • one or more of the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and TRBC genes are targeted as a targeted knockout or knockdown, e.g., to affect T cell proliferation, survival and/or function.
  • said approach comprises knocking out or knocking down one T-cell expressed gene (e.g., FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene).
  • the approach comprises knocking out or knocking down two T-cell expressed genes, e.g., two of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the approach comprises knocking out or knocking down three T-cell expressed genes, e.g., three of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the approach comprises knocking out or knocking down four T-cell expressed genes, e.g., four of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the approach comprises knocking out or knocking down five T-cell expressed genes, e.g., five of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the approach comprises knocking out or knocking down six T-cell expressed genes, e.g., six of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the approach comprises knocking out or knocking down seven T-cell expressed genes, e.g., seven of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC genes.
  • the approach comprises knocking out or knocking down eight T-cell expressed genes, e.g., each of FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and TRBC genes.
  • the methods comprise initiating treatment of a subject after disease onset. In an embodiment, the method comprises initiating treatment of a subject well after disease onset, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 24, or 36 months after onset of cancer.
  • the method comprises initiating treatment of a subject in an advanced stage of disease.
  • cancers that may be treated using the compositions and methods disclosed herein include cancers of the blood and solid tumors.
  • cancers that may be treated using the compositions and methods disclosed herein include, but are not limited to, lymphoma, chronic lymphocytic leukemia (CLL), B cell acute lymphocytic leukemia (B-ALL), acute lymphoblastic leukemia, acute myeloid leukemia, non-Hodgkin's lymphoma (NHL), diffuse large cell lymphoma (DELL), multiple myeloma, renal cell carcinoma (RCC), neuroblastoma, colorectal cancer, breast cancer, ovarian cancer, melanoma, sarcoma, prostate cancer, lung cancer, esophageal cancer, hepatocellular carcinoma, pancreatic cancer, astrocytoma, mesothelioma, head and neck cancer, and medulloblastoma.
  • CLL chronic lymphocytic leukemia
  • B-ALL B cell acute
  • Methods of altering one or more T cell-expressed genes e.g.. the FAS. BID. CTLA4. PDCDl. CBLB.
  • one or more T cell-expressed genes e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene can be targeted (e.g., altered) by gene editing, e.g., using the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene
  • the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene can be targeted (e.g., altered) by gene editing, e.g., using
  • Methods and compositions discussed herein provide for targeting (e.g., altering) a T cell target position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6,
  • a T cell target position can be targeted (e.g., altered) by gene editing, e.g., using CRISPR-Cas9 mediated methods to target (e.g. alter) in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • CRISPR-Cas9 mediated methods to target (e.g. alter) in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • T cell target position in one or more T cell- expressed genes, e.g., the FAS, BID, CTLA4, PDCD l, CBLB, PTPN6, TRAC and/or TRBC gene.
  • T cell- expressed genes e.g., the FAS, BID, CTLA4, PDCD l, CBLB, PTPN6, TRAC and/or TRBC gene.
  • Targeting e.g., altering a T cell target position is achieved, e.g., by:
  • T cell-expressed genes e.g., the FAS, BID, CTLA4, PDCDl,
  • insertion or deletion e.g., NHEJ-mediated insertion or deletion
  • one or more T cell-expressed genes e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene, or
  • deletion e.g., NHEJ-mediated deletion
  • a genomic sequence including at least a portion of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene, or
  • T cell-expressed genes e.g., the FAS, BID, CTLA4, PDCDl, CBLB, and/or PTPN6 gene mediated by enzymatically inactive Cas9 (eiCas9) molecule or an eiCas9- fusion protein by targeting non-coding region, e.g., a promoter region, of the gene.
  • T cell-expressed genes e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • methods described herein introduce one or more breaks near the coding region in at least one allele of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • methods described herein introduce two or more breaks to flank at least a portion of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • the two or more breaks remove (e.g., delete) a genomic sequence including at least a portion of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCD 1 , CBLB, PTPN6, TRAC and/or TRBC gene.
  • methods described herein comprise knocking down one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, and/or PTPN6 gene mediated by enzymatically inactive Cas9 (eiCas9) molecule or an eiCas9-fusion protein by targeting the promoter region of T cell target knockdown position.
  • T cell- expressed genes e.g., the FAS, BID, CTLA4, PDCD l, CBLB, PTPN6, TRAC and/or TRBC gene.
  • T cell-expressed genes e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene
  • the targeting (e.g., alteration) of one or more T cell-expressed genes can be mediated by any mechanism.
  • Exemplary mechanisms that can be associated with the alteration of one or more T cell-expressed genes include, but are not limited to, non-homologous end joining (e.g., classical or alternative), microhomology -mediated end joining (MMEJ), homology-directed repair (e.g., endogenous donor template mediated), SDSA (synthesis dependent strand annealing), single strand annealing or single strand invasion.
  • non-homologous end joining e.g., classical or alternative
  • MMEJ microhomology -mediated end joining
  • homology-directed repair e.g., endogenous donor template mediated
  • SDSA synthesis dependent strand annealing
  • single strand annealing single strand invasion.
  • T cell-expressed genes e.g.. the FAS. BID. CTLA4.
  • TRAC and/or TRBC gene by introducing an indel or a deletion in one or more T cell-expressed genes, e.g.. the FAS. BID. CTLA4.
  • TRAC and/or TRBC gene by introducing an indel or a deletion in one or more T cell-expressed genes, e.g.. the FAS. BID. CTLA4.
  • TRAC and/or TRBC gene e.g. the FAS. BID. CTLA4.
  • the method comprises introducing an insertion or deletion of one more nucleotides in close proximity to the T cell target knockout position (e.g., the early coding region) of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene genes.
  • T cell target knockout position e.g., the early coding region
  • T cell-expressed genes e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene genes.
  • the method comprises the introduction of one or more breaks (e.g., single strand breaks or double strand breaks) to the T cell target knockout position, e.g., the coding region (e.g., the early coding region, e.g., within 500bp from the start codon or the remaining coding sequence, e.g., downstream of the first 500bp from the start codon) of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • the coding region e.g., the early coding region, e.g., within 500bp from the start codon or the remaining coding sequence, e.g., downstream of the first 500bp from the start codon
  • T cell-expressed genes e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • a single strand break is introduced (e.g., positioned by one gRNA molecule) at or in close proximity to a T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCD l, CBLB, PTPN6, TRAC and/or TRBC gene.
  • T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCD l, CBLB, PTPN6, TRAC and/or TRBC gene.
  • a single gRNA molecule (e.g., with a Cas9 nickase) is used to create a single strand break at or in close proximity to the T cell target knockout position, e.g., the coding region (e.g., the early coding region, e.g., within 500bp from the start codon or the remaining coding sequence, e.g., downstream of the first 500bp from the start codon).
  • the break is positioned to avoid unwanted target chromosome elements, such as repeat elements, e.g., an Alu repeat.
  • a double strand break is introduced (e.g., positioned by one gRNA molecule) at or in close proximity to a T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • a single gRNA molecule (e.g., with a Cas9 nuclease other than a Cas9 nickase) is used to create a double strand break at or in close proximity to the T cell target knockout position, e.g., the coding region (e.g., the early coding region, e.g., within 500bp from the start codon or the remaining coding sequence, e.g., downstream of the first 500bp from the start codon).
  • the break is positioned to avoid unwanted target chromosome elements, such as repeat elements, e.g., an Alu repeat.
  • two single strand breaks are introduced (e.g., positioned by two gRNA molecules) at or in close proximity to a T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCD l, CBLB, PTPN6, TRAC and/or TRBC gene.
  • T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCD l, CBLB, PTPN6, TRAC and/or TRBC gene.
  • two gRNA molecules are used to create two single strand breaks at or in close proximity to the T cell target knockout position, e.g., the coding region (e.g., the early coding region, e.g., within 500bp from the start codon or the remaining coding sequence, e.g., downstream of the first 500bp from the start codon).
  • the gRNAs molecules are configured such that both single strand breaks are positioned upstream or downstream of the T cell target knockout position.
  • two gRNA molecules are used to create two single strand breaks at or in close proximity to the T cell target knockout position, e.g., the gRNAs molecules are configured such that one single strand break is positioned upstream and a second single strand break is positioned downstream of the T cell target knockout position.
  • the breaks are positioned to avoid unwanted target chromosome elements, such as repeat elements, e.g., an Alu repeat.
  • two sets of breaks are introduced (e.g., positioned by two gRNA molecules) at or in close proximity to a T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • two gRNA molecules are used to create two double strand breaks to flank a T cell target knockout position, e.g., the coding region (e.g., the early coding region, e.g., within 500bp from the start codon or the remaining coding sequence, e.g., downstream of the first 500bp from the start codon).
  • the gRNAs molecules are configured such that both sets of breaks are positioned upstream or downstream of the T cell target knockout position.
  • the gRNA molecules are configured such that ene-set-ef bfeak-4sone set of breakfs) are positioned upstream and a-seeead-set-of-break isa second set of breakfs) are positioned downstream of the T cell target knockout position.
  • the breaks are positioned to avoid unwanted target chromosome elements, such as repeat elements, e.g., an Alu repeat.
  • two sets of breaks are introduced (e.g., positioned by three gRNA molecules) at or in close proximity to a T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and/or TRBC gene.
  • T cell target knockout position e.g., the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and/or TRBC gene.
  • three gRNA molecules are used to create two sets of breaks to flank a T cell target knockout position, e.g., the coding region (e.g., the early coding region, e.g., within 500bp from the start codon or the remaining coding sequence, e.g., downstream of the first 500bp from the start codon).
  • the gRNAs molecules are configured such that both sets of breaks are positioned upstream or downstream of the T cell target knockout position.
  • the gRNA molecules are configured such that ea -set-ef1 ⁇ 2eak-isone set of breakfs) are positioned upstream and a-see-en-d--se-t-e-f break isa second set of breakfs) are positioned downstream of the T cell target knockout position.
  • the breaks are positioned to avoid unwanted target chromosome elements, such as repeat elements, e.g., an Alu repeat.
  • two sets of breaks are introduced (e.g., positioned by four gRNA molecules) at or in close proximity to a T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and/or TRBC gene.
  • T cell target knockout position e.g., the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and/or TRBC gene.
  • gRNA molecules e.g., with one or more Cas9 nickases
  • the gRNAs molecules are configured such that both sets of breaks are positioned upstream or downstream of the T cell target knockout position.
  • the gRNA molecules are configured
  • the breaks are positioned to avoid unwanted target chromosome elements, such as repeat elements, e.g., an Alu repeat.
  • two or more (e.g., three or four) gRNA molecules are used with one Cas9 molecule.
  • at least one Cas9 molecule is from a different species than the other Cas9 molecule(s).
  • one Cas9 molecule can be from one species and the other Cas9 molecule can be from a different species. Both Cas9 species are used to generate a single or double-strand break, as desired.
  • the targeted nucleic acids may be altered, e.g., cleaved, by one or more Cas9 proteins.
  • the same or a different Cas9 protein may be used to target each gene.
  • both genes or each gene targeted in a cell
  • both genes or each gene targeted in a cell
  • one or more genes in a cell may be altered by cleavage with a Cas9 nuclease and one or more genes in the same cell may be altered by cleavage with a Cas9 nickase.
  • the Cas9 proteins may be from different bacterial species.
  • one or more genes in a cell may be altered by cleavage with a Cas9 protein from one bacterial species, and one or more genes in the same cell may be altered by cleavage with a Cas9 protein from a different bacterial species. It is contemplated that when two or more Cas9 proteins from different species are used that they may be delivered at the same time or delivered sequentially to control specificity of cleavage in the desired gene at the desired position in the target nucleic acid.
  • the targeting domain of the first gRNA molecule and the targeting domain of the second gRNA molecules are complementary to opposite strands of the target nucleic acid molecule.
  • the gRNA molecule and the second gRNA molecule are configured such that the PAMs are oriented outward.
  • T cell-expressed genes e.g.. the FAS. BID. CTLA4.
  • TRAC and/or TRBC gene by deleting (e.g.. NHEJ-mediated deletion) a genomic sequence including at least a portion of one or more T cell-expressed genes, e.g.. the FAS. BID. CTLA4.
  • the method comprises introducing a deletion of a genomic sequence comprising at least a portion of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and/or TRBC gene genes.
  • the method comprises the introduction of two double stand breaks - one 5' and the other 3' to (i.e., flanking) T cell target knockout position.
  • two gRNAs e.g., unimolecular (or chimeric) or modular gRNA molecules
  • the two sets of breaks e.g., two double strand breaks, one double strand break and a pair of single strand breaks or two pairs of single strand breaks
  • the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • the method comprises deleting (e.g., NHEJ-mediated deletion) a genomic sequence including at least a portion of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene genes.
  • a genomic sequence including at least a portion of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene genes.
  • the method comprises the introduction two sets of breaks (e.g., a pair of double strand breaks, one double strand break or a pair of single strand breaks, or two pairs of single strand breaks) to flank a region in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene genes (e.g., a coding region, e.g., an early coding region, or a non-coding region, e.g., a non- coding sequence of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene genes, e.g., a promoter, an enhancer, an intron, a 3'UTR, and/or a polyadenylation signal).
  • NHEJ-mediated repair of the break(s) allows for alteration of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene genes as described herein, which reduces or eliminates expression of the gene, e.g., to knock out one or both alleles of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCD l, CBLB, PTPN6, TRAC and/or TRBC gene genes.
  • two sets of breaks are introduced (e.g., positioned by two gRNA molecules) at or in close proximity to a T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • two gRNA molecules are used to create two sets of breaks to flank a T cell target knockout position, e.g., the gRNA molecules are configured such that one set of break isone set of break(s) are positioned upstream and a seeend-set-of-break isa second set of break(s) are positioned downstream of the T cell target knockout position.
  • the breaks are positioned to avoid unwanted target chromosome elements, such as repeat elements, e.g., an Alu repeat.
  • two sets of breaks are introduced (e.g., positioned by three gRNA molecules) at or in close proximity to a T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC and/or TRBC gene.
  • three gRNA molecules e.g., with a Cas9 nuclease and one or two Cas9 nickases
  • are used to create two sets of breaks to flank a T cell target knockout position e.g., the gRNA molecules are configured
  • break(s) are positioned upstream and a-se-eend-s-e-t-ef-br-eak-isa second set of break; s) are positioned downstream of the T cell target knockout position.
  • the breaks are positioned to avoid unwanted target chromosome elements, such as repeat elements, e.g., an Alu repeat.
  • two sets of breaks are introduced (e.g., positioned by four gRNA molecules) at or in close proximity to a T cell target knockout position in one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and/or TRBC gene.
  • T cell target knockout position e.g., the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and/or TRBC gene.
  • four gRNA molecules are used to create two sets of breaks to flank a T cell target knockout position, e.g., the gRNA molecules are configured such that ene--set--e-f-br-ea-k-1 ⁇ 2one set of break(s) are positioned upstream and a seeeftd-set-e£1 ⁇ 2eak4sa second set of break; s) are positioned downstream of the T cell target knockout position.
  • the breaks are positioned to avoid unwanted target chromosome elements, such as repeat elements, e.g., an Alu repeat.
  • two or more (e.g., three or four) gRNA molecules are used with one Cas9 molecule.
  • at least one Cas9 molecule is from a different species than the other Cas9 molecule(s).
  • one Cas9 molecule can be from one species and the other Cas9 molecule can be from a different species. Both Cas9 species are used to generate a single or double-strand break, as desired.
  • the targeted nucleic acids may be altered, e.g., cleaved, by one or more Cas9 proteins.
  • the same or a different Cas9 protein may be used to target each gene.
  • both genes or each gene targeted in a cell
  • both genes or each gene targeted in a cell
  • one or more genes in a cell may be altered by cleavage with a Cas9 nuclease and one or more genes in the same cell may be altered by cleavage with a Cas9 nickase.
  • the Cas9 proteins may be from different bacterial species.
  • one or more genes in a cell may be altered by cleavage with a Cas9 protein from one bacterial species, and one or more genes in the same cell may be altered by cleavage with a Cas9 protein from a different bacterial species. It is contemplated that when two or more Cas9 proteins from different species are used that they may be delivered at the same time or delivered sequentially to control specificity of cleavage in the desired gene at the desired position in the target nucleic acid.
  • the targeting domain of the first gRNA molecule and the targeting domain of the second gRNA molecules are complementary to opposite strands of the target nucleic acid molecule.
  • the gRNA molecule and the second gRNA molecule are configured such that the PAMs are oriented outward. Knocking down one or more T cell-expressed genes, e.g.. the FAS. BID. CTLA4. PDCDl. CBLB. and/or PTPN6 gene mediated by an enzymatically inactive Cas9 (eiCas9) molecule
  • a targeted knockdown approach reduces or eliminates expression of functional FAS, BID, CTLA4, PDCDl, CBLB, and/or PTPN6 gene product.
  • a targeted knockdown is mediated by targeting an enzymatically inactive Cas9 (eiCas9) molecule or an eiCas9 fused to a transcription repressor domain or chromatin modifying protein to alter transcription, e.g., to block, reduce, or decrease transcription, of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, and/or PTPN6 gene.
  • eiCas9 enzymatically inactive Cas9
  • a transcription repressor domain or chromatin modifying protein to alter transcription, e.g., to block, reduce, or decrease transcription, of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB
  • Methods and compositions discussed herein may be used to alter the expression of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, and/or PTPN6 gene to treat or prevent HIV infection or AIDS by targeting a promoter region of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, and/or PTPN6 gene.
  • the promoter region is targeted to knock down expression of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCDl, CBLB, and/or PTPN6 gene.
  • a targeted knockdown approach reduces or eliminates expression of functional FAS, BID, CTLA4, PDCDl, CBLB, and/or PTPN6 gene product.
  • a targeted knockdown is mediated by targeting an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein (e.g., an eiCas9 fused to a transcription repressor domain or chromatin modifying protein) to alter transcription, e.g., to block, reduce, or decrease transcription, of one or more T cell-expressed genes, e.g., the FAS, BID, CTLA4, PDCD 1 , CBLB, P and/or PTPN6 gene.
  • an enzymatically inactive Cas9 eiCas9
  • an eiCas9 fusion protein e.g., an eiCas9 fused to a transcription repressor domain or chromatin modifying protein
  • one or more eiCas9s may be used to block binding of one or more endogenous transcription factors.
  • an eiCas9 can be fused to a chromatin modifying protein. Altering chromatin status can result in decreased expression of the target gene.
  • One or more eiCas9s fused to one or more chromatin modifying proteins may be used to alter chromatin status.
  • the targeted nucleic acids may be altered, e.g., by one or more eiCas9 proteins or eiCas9 fusion proteins.
  • the eiCas9 proteins or eiCas9 fusion proteins may be from different bacterial species.
  • one or more genes in a cell may be altered with an eiCas9 protein or eiCas9 fusion protein from one bacterial species, and one or more genes in the same cell may be altered with an eiCas9 protein or eiCas9 fusion protein from a different bacterial species.
  • eiCas9 proteins or eiCas9 fusion proteins from different species may be delivered at the same time or delivered sequentially to control specificity of cleavage in the desired gene at the desired position in the target nucleic acid.
  • adoptive transfer of genetically engineered T cells may provide a potential treatment for cancer.
  • Genes encoding cell surface receptors are inserted into the T cells.
  • the genetically engineered T cells are able to detect tumor associated antigens, which can be used to discriminate tumor cells from most normal tissues.
  • Knockout or knockdown of one or two alleles of the target gene e.g., FAS, BID, CTLA4,
  • PDCDl, CBLB, PTPN6, TRAC or TRBC gene may be performed after disease onset, but preferably early in the disease course.
  • a gRNA molecule refers to a nucleic acid that promotes the specific targeting or homing of a gRNA molecule/Cas9 molecule complex to a target nucleic acid.
  • gRNA molecules can be unimolecular (having a single RNA molecule), sometimes referred to herein as "chimeric" gRNAs, or modular (comprising more than one, and typically two, separate RNA molecules).
  • a gRNA molecule comprises a number of domains. The gRNA molecule domains are described in more detail below.
  • gRNA structures with domains indicated thereon, are provided in Fig. 1. While not wishing to be bound by theory, with regard to the three dimensional form, or intra- or inter- strand interactions of an active form of a gRNA, regions of high complementarity are sometimes shown as duplexes in Fig. 1 and other depictions provided herein.
  • a unimolecular, or chimeric, gRNA comprises, preferably from 5' to 3' : a targeting domain (which is complementary to a target nucleic acid in the FAS, BID, CTLA4, PDCDl, CBLB, PTPN6, TRAC or TRBC gene, e.g., a targeting domain from any of Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I, Tables 5A-I, Tables 6A-I, Tables 7A-H, Tables 8A-H, Tables 9A-I, Tables 10A-I, Tables 11A-I, Tables 12A-I, Tables 13A-K, Tables 14A-K, Tables 15A-F, Tables 16A- K, Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23A-J, Tables
  • a modular gRNA comprises a first strand comprising, preferably from 5' to 3';
  • a targeting domain (which is complementary to a target nucleic acid in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, e.g., a targeting domain from Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I, Tables 5A-I, Tables 6A-I, Tables 7A-H, Tables 8A-H, Tables 9A-I, Tables 10A-I, Tables 11A-I, Tables 12A-I, Tables 13A-K, Tables 14A-K, Tables 15A-F, Tables 16A-K, Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23 A- J, Tables 24A-K, Tables 25A-G, Tables 26A-G, Table 27, Table 29, Table 31, or Table 32; and
  • a second strand comprising, preferably from 5' to 3' :
  • a tail domain optionally, a tail domain.
  • Fig. 1 provides examples of the placement of targeting domains.
  • the targeting domain comprises a nucleotide sequence that is complementary, e.g., at least 80, 85, 90, 95, 98 or 99% complementary, e.g., fully complementary, to the target sequence on the target nucleic acid.
  • the targeting domain is part of an R A molecule and will therefore comprise the base uracil (U), while any DNA encoding the gR A molecule will comprise the base thymine (T). While not wishing to be bound by theory, in an embodiment, it is believed that the complementarity of the targeting domain with the target sequence contributes to specificity of the interaction of the gRNA molecule/Cas9 molecule complex with a target nucleic acid.
  • the uracil bases in the targeting domain will pair with the adenine bases in the target sequence.
  • the target domain itself comprises in the 5' to 3' direction, an optional secondary domain, and a core domain.
  • the core domain is fully complementary with the target sequence.
  • the targeting domain is 5 to 50 nucleotides in length.
  • the strand of the target nucleic acid with which the targeting domain is complementary is referred to herein as the complementary strand.
  • Some or all of the nucleotides of the domain can have a modification, e.g., modification found in Section VIII herein.
  • the targeting domain is 16 nucleotides in length.
  • the tar ⁇ feting domain is 17 nucleotides in length.
  • the tar ⁇ feting domain is 18 nucleotides in length.
  • the tar ⁇ feting domain is 19 nucleotides in length.
  • the tar ⁇ feting domain is 20 nucleotides in length.
  • the tar ⁇ feting domain is 21 nucleotides in length.
  • the tar ⁇ feting domain is 22 nucleotides in length.
  • the tar ⁇ feting domain is 23 nucleotides in length.
  • the tar ⁇ feting domain is 24 nucleotides in length.
  • the tar ⁇ feting domain is 25 nucleotides in length.
  • the tar ⁇ feting domain is 26 nucleotides in length.
  • the tar ⁇ feting domain comprises 16 nucleotides.
  • the tar ⁇ feting domain comprises 17 nucleotides.
  • the tar ⁇ feting domain comprises 18 nucleotides.
  • the tar ⁇ feting domain comprises 19 nucleotides.
  • the tar ⁇ feting domain comprises 20 nucleotides.
  • the tar ⁇ feting domain comprises 21 nucleotides.
  • the tar ⁇ feting domain comprises 22 nucleotides.
  • the tar ⁇ feting domain comprises 23 nucleotides.
  • the tar ⁇ feting domain comprises 24 nucleotides.
  • the tar ⁇ feting domain comprises 25 nucleotides.
  • the tar ⁇ feting domain comprises 26 nucleotides.
  • Figs. 1A-1G provide examples of first complementarity domains.
  • the first complementarity domain is complementary with the second complementarity domain, and in an embodiment, has sufficient complementarity to the second complementarity domain to form a duplexed region under at least some physiological conditions.
  • the first complementarity domain is complementary with the second complementarity domain, and in an embodiment, has sufficient complementarity to the second complementarity domain to form a duplexed region under at least some physiological conditions.
  • complementarity domain is 5 to 30 nucleotides in length. In an embodiment, the first complementarity domain is 5 to 25 nucleotides in length. In an embodiment, the first complementary domain is 7 to 25 nucleotides in length. In an embodiment, the first complementary domain is 7 to 22 nucleotides in length. In an embodiment, the first complementary domain is 7 to 18 nucleotides in length. In an embodiment, the first complementary domain is 7 to 15 nucleotides in length. In an embodiment, the first complementary domain is 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.
  • the first complementarity domain comprises 3 subdomains, which, in the 5' to 3' direction are: a 5' subdomain, a central subdomain, and a 3' subdomain.
  • the 5' subdomain is 4-9, e.g., 4, 5, 6, 7, 8 or 9 nucleotides in length.
  • the central subdomain is 1, 2, or 3, e.g., 1, nucleotide in length.
  • the 3' subdomain is 3 to 25, e.g., 4-22, 4-18, or 4 to 10, or 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25, nucleotides in length.
  • the first complementarity domain can share homology with, or be derived from, a naturally occurring first complementarity domain. In an embodiment, it has at least 50% homology with a first complementarity domain disclosed herein, e.g., an S. pyogenes, S. aureus, N. meningtidis, or S.
  • thermophilus first complementarity domain.
  • nucleotides of the first complementarity domain can have a modification, e.g., a modification found in Section VIII herein.
  • Figs. 1A-1G provide examples of linking domains.
  • a linking domain serves to link the first complementarity domain with the second
  • the linking domain can link the first and second complementarity domains covalently or non-covalently. In an embodiment, the linkage is covalent. In an embodiment, the linking domain covalently couples the first and second complementarity domains, see, e.g., Figs. IB-IE. In an embodiment, the linking domain is, or comprises, a covalent bond interposed between the first complementarity domain and the second complementarity domain. Typically the linking domain comprises one or more, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.
  • Fig. 1A In modular gRNA molecules the two molecules are associated by virtue of the hybridization of the complementarity domains see e.g., Fig. 1A.
  • linking domains are suitable for use in unimolecular gRNA molecules.
  • Linking domains can consist of a covalent bond, or be as short as one or a few nucleotides, e.g., 1, 2, 3, 4, or 5 nucleotides in length.
  • a linking domain is 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or more nucleotides in length.
  • a linking domain is 2 to 50, 2 to 40, 2 to 30, 2 to 20, 2 to 10, or 2 to 5 nucleotides in length.
  • a linking domain shares homology with, or is derived from, a naturally occurring sequence, e.g., the sequence of a tracrRNA that is 5' to the second complementarity domain.
  • the linking domain has at least 50% homology with a linking domain disclosed herein.
  • nucleotides of the linking domain can have a modification, e.g., a modification found in Section VIII herein.
  • a modular gR A can comprise additional sequence, 5' to the second complementarity domain, referred to herein as the 5' extension domain, see, e.g., Fig. 1A.
  • the 5' extension domain is, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, or 2-4 nucleotides in length.
  • the 5' extension domain is 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides in length.
  • Figs. 1A-1G provide examples of second complementarity domains.
  • the second complementarity domain is complementary with the first complementarity domain, and in an embodiment, has sufficient complementarity to the second complementarity domain to form a duplexed region under at least some physiological conditions.
  • the second complementarity domain can include sequence that lacks complementarity with the first complementarity domain, e.g., sequence that loops out from the duplexed region.
  • the second complementarity domain is 5 to 27 nucleotides in length. In an embodiment, it is longer than the first complementarity region. In an embodiment the second complementary domain is 7 to 27 nucleotides in length. In an embodiment, the second complementary domain is 7 to 25 nucleotides in length. In an embodiment, the second complementary domain is 7 to 20 nucleotides in length. In an embodiment, the second complementary domain is 7 to 17 nucleotides in length. In an embodiment, the complementary domain is 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.
  • the second complementarity domain comprises 3 subdomains, which, in the 5' to 3' direction are: a 5' subdomain, a central subdomain, and a 3' subdomain.
  • the 5' subdomain is 3 to 25, e.g., 4 to 22, 4 tol8, or 4 to 10, or 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.
  • the central subdomain is 1, 2, 3, 4 or 5, e.g., 3, nucleotides in length.
  • the 3' subdomain is 4 to 9, e.g., 4, 5, 6, 7, 8 or 9 nucleotides in length.
  • the 5' subdomain and the 3' subdomain of the first complementarity domain are respectively, complementary, e.g., fully complementary, with the 3' subdomain and the 5' subdomain of the second complementarity domain.
  • the second complementarity domain can share homology with or be derived from a naturally occurring second complementarity domain. In an embodiment, it has at least 50% homology with a second complementarity domain disclosed herein, e.g., an S. pyogenes, S. aureus, N. meningtidis, or S. thermophilus, first complementarity domain.
  • a second complementarity domain disclosed herein, e.g., an S. pyogenes, S. aureus, N. meningtidis, or S. thermophilus, first complementarity domain.
  • nucleotides of the second complementarity domain can have a modification, e.g., a modification found in Section VIII herein.
  • Figs. 1A-1G provide examples of proximal domains.
  • the proximal domain is 5 to 20 nucleotides in length. In an embodiment, the proximal domain can share homology with or be derived from a naturally occurring proximal domain. In an embodiment, it has at least 50% homology with a proximal domain disclosed herein, e.g., an S.
  • nucleotides of the proximal domain can have a modification, e.g., a modification found in Section VIII herein.
  • Figs. 1A-1G provide examples of tail domains.
  • the tail domain is 0 (absent), 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length.
  • the tail domain nucleotides are from or share homology with sequence from the 5' end of a naturally occurring tail domain, see e.g., Fig. ID or IE.
  • the tail domain includes sequences that are complementary to each other and which, under at least some physiological conditions, form a duplexed region.
  • the tail domain is absent or is 1 to 50 nucleotides in length. In an embodiment, the tail domain is absent or is 1 to 50 nucleotides in length. In an
  • the tail domain can share homology with or be derived from a naturally occurring proximal tail domain. In an embodiment, it has at least 50% homology with a tail domain disclosed herein, e.g., an S. pyogenes, S. aureus, N. meningtidis, or S. thermophilus, tail domain.
  • the tail domain includes nucleotides at the 3 ' end that are related to the method of in vitro or in vivo transcription.
  • these nucleotides may be any nucleotides present before the 3 ' end of the DNA template.
  • these nucleotides may be the sequence UIJIJUUU.
  • these nucleotides may be various numbers or uracil bases or may include alternate bases.
  • the domains of gRNA molecules are described in more detail below.
  • the Targeting Domain is described in more detail below.
  • the "targeting domain" of the gRNA is complementary to the "target domain” on the target nucleic acid.
  • the strand of the target nucleic acid comprising the core domain target is referred to herein as the "complementary strand" of the target nucleic acid.
  • Guidance on the selection of targeting domains can be found, e.g., in Fu Y et al, Nat Biotechnol 2014 (doi: 10.1038/nbt.2808) and Sternberg SH et al, Nature 2014 (doi: 10.1038/naturel301 1).
  • the targeting domain is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides in length.
  • the tar ⁇ feting domain is 16 nucleotides in length.
  • the tar ⁇ feting domain is 17 nucleotides in length.
  • the tar ⁇ feting domain is 18 nucleotides in length.
  • the tar ⁇ feting domain is 19 nucleotides in length.
  • the tar ⁇ feting domain is 20 nucleotides in length.
  • the tar ⁇ feting domain is 21 nucleotides in length.
  • the tar ⁇ feting domain is 22 nucleotides in length.
  • the tar ⁇ feting domain is 23 nucleotides in length.
  • the tar ⁇ feting domain is 24 nucleotides in length.
  • the tar ⁇ feting domain is 25 nucleotides in length.
  • the tar ⁇ feting domain is 26 nucleotides in length.
  • the tar ⁇ feting domain comprises 16 nucleotides.
  • the tar ⁇ feting domain comprises 17 nucleotides.
  • the tar ⁇ feting domain comprises 18 nucleotides.
  • the tar ⁇ feting domain comprises 19 nucleotides.
  • the tar ⁇ feting domain comprises 20 nucleotides.
  • the tar ⁇ feting domain comprises 21 nucleotides.
  • the tar ⁇ feting domain comprises 22 nucleotides.
  • the tar ⁇ feting domain comprises 23 nucleotides.
  • the tar ⁇ feting domain comprises 24 nucleotides. In an embodiment, the targeting domain comprises 25 nucleotides.
  • the targeting domain comprises 26 nucleotides. In an embodiment, the targeting domain is 10 +1-5, 20+/-5, 30+/-5, 40+/-5, 50+/-5, 60+/-5, 70+/-5, 80+/-5, 90+/-5, or 100+/-5 nucleotides, in length.
  • the targeting domain is 20+/-5 nucleotides in length.
  • the targeting domain is 20+/- 10, 30+/- 10, 40+/- 10, 50+/- 10, 60+/- 10, 70+/- 10, 80+/- 10, 90+/- 10, or 100+/- 10 nucleotides, in length.
  • the targeting domain is 30+/- 10 nucleotides in length.
  • the targeting domain is 10 to 100, 10 to 90, 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, 10 to 20 or 10 to 15 nucleotides in length.
  • the targeting domain is 20 to 100, 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, or 20 to 25 nucleotides in length.
  • the targeting domain has full complementarity with the target sequence.
  • the targeting domain has or includes 1 , 2, 3, 4, 5, 6, 7 or 8 nucleotides that are not complementary with the corresponding nucleotide of the targeting domain.
  • the target domain includes 1 , 2, 3, 4 or 5 nucleotides that are complementary with the corresponding nucleotide of the targeting domain within 5 nucleotides of its 5' end. In an embodiment, the target domain includes 1 , 2, 3, 4 or 5 nucleotides that are complementary with the corresponding nucleotide of the targeting domain within 5 nucleotides of its 3 ' end.
  • the target domain includes 1 , 2, 3, or 4 nucleotides that are not complementary with the corresponding nucleotide of the targeting domain within 5 nucleotides of its 5' end. In an embodiment, the target domain includes 1 , 2, 3, or 4 nucleotides that are not complementary with the corresponding nucleotide of the targeting domain within 5 nucleotides of its 3 ' end.
  • the degree of complementarity, together with other properties of the gRNA, is sufficient to allow targeting of a Cas9 molecule to the target nucleic acid.
  • the targeting domain comprises two consecutive nucleotides that are not complementary to the target domain ("non-complementary nucleotides”), e.g., two consecutive noncomplementary nucleotides that are within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or more than 5 nucleotides away from one or both ends of the targeting domain.
  • non-complementary nucleotides two consecutive nucleotides that are within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or more than 5 nucleotides away from one or both ends of the targeting domain.
  • no two consecutive nucleotides within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3 ' end of the targeting domain, or within a region that is more than 5 nucleotides away from one or both ends of the targeting domain are not complementary to the targeting domain.
  • the targeting domain nucleotides do not comprise modifications, e.g., modifications of the type provided in Section VIII.
  • the targeting domain comprises one or more modifications, e.g., modifications that render it less susceptible to degradation or more bio-compatible, e.g., less immunogenic.
  • the backbone of the targeting domain can be modified with a phosphorothioate, or other modification(s) from Section VIII.
  • a nucleotide of the targeting domain can comprise a 2' modification, e.g., a 2-acetylation, e.g., a 2' methylation, or other modification(s) from Section VIII.
  • the targeting domain includes 1, 2, 3, 4, 5, 6, 7 or 8 or more modifications. In an embodiment, the targeting domain includes 1, 2, 3, or 4 modifications within 5 nucleotides of its 5' end. In an embodiment, the targeting domain comprises as many as 1, 2, 3, or 4 modifications within 5 nucleotides of its 3 ' end.
  • the targeting domain comprises modifications at two consecutive nucleotides, e.g., two consecutive nucleotides that are within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3 ' end of the targeting domain, or more than 5 nucleotides away from one or both ends of the targeting domain.
  • no two consecutive nucleotides are modified within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or within a region that is more than 5 nucleotides away from one or both ends of the targeting domain.
  • no nucleotide is modified within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3 ' end of the targeting domain, or within a region that is more than 5 nucleotides away from one or both ends of the targeting domain.
  • Modifications in the targeting domain can be selected to not interfere with targeting efficacy, which can be evaluated by testing a candidate modification in the system described in Section IV.
  • gR As having a candidate targeting domain having a selected length, sequence, degree of
  • the candidate targeting domain can be placed, either alone, or with one or more other candidate changes in a gRNA molecule/Cas9 molecule system known to be functional with a selected target and evaluated.
  • the modified nucleotides are complementary to and capable of hybridizing to corresponding nucleotides present in the target domain. In other embodiments, 1, 2, 3, 4, 5, 6, 7 or 8 or more modified nucleotides are not complementary to or capable of hybridizing to corresponding nucleotides present in the target domain.
  • the targeting domain comprises, preferably in the 5' ⁇ 3' direction: a secondary domain and a core domain. These domains are discussed in more detail below.
  • the “core domain” of the targeting domain is complementary to the “core domain target” on the target nucleic acid.
  • the core domain comprises about 8 to about 13 nucleotides from the 3' end of the targeting domain (e.g., the most 3' 8 to 13 nucleotides of the targeting domain).
  • the secondary domain is absent or optional.
  • the core domain and targeting domain are independently 6 +1-2, 1+1-2, 8+/-2, 9+1-2, 10+/-2, 1 1+/-2, 12+/-2, 13+/-2, 14+/-2, 15+/-2, or 16+-2 nucleotides in length.
  • the core domain and targeting domain are independently 10+/-2 nucleotides in length.
  • the core domain and targeting domain are independently 10+/-4 nucleotides in length.
  • the core domain and targeting domain are independently 6, 7, 8, 9, 10, 1 1, 12,
  • the core and targeting domain are independently 3 to 20, 4 to 20, 5 to 20, 6 to 20, 7 to 20, 8 to 20, 9 to 20 10 to 20 or 15 to 20 nucleotides in length.
  • the core and targeting domain are independently 3 to 15, e.g., 6 to 15, 7 to 14, 7 to 13, 6 to 12, 7 to 12, 7 to 1 1, 7 to 10, 8 to 14, 8 to 13, 8 to 12, 8 to 1 1, 8 to 10 or 8 to 9 nucleotides in length.
  • the core domain is complementary with the core domain target.
  • the core domain has exact complementarity with the core domain target.
  • the core domain can have 1 , 2, 3, 4 or 5 nucleotides that are not complementary with the corresponding nucleotide of the core domain.
  • the degree of complementarity, together with other properties of the gRNA, is sufficient to allow targeting of a Cas9 molecule to the target nucleic acid.
  • the "secondary domain" of the targeting domain of the gRNA is complementary to the
  • the secondary domain is positioned 5' to the core domain.
  • the secondary domain is absent or optional.
  • the secondary domain is 12 to 17 nucleotides in length. In an embodiment, if the targeting domain is 25 nucleotides in length and the core domain (counted from the 3 ' end of the targeting domain) is 8 to 13 nucleotides in length, the secondary domain is 12 to 17 nucleotides in length. In an embodiment, if the targeting domain is 25 nucleotides in length and the core domain (counted from the 3 ' end of the targeting domain) is 8 to 13 nucleotides in length, the secondary domain is 12 to 17 nucleotides in length.
  • the targeting domain is 24 nucleotides in length and the core domain (counted from the 3 ' end of the targeting domain) is 8 to 13 nucleotides in length
  • the secondary domain is 1 1 to 16 nucleotides in length.
  • the targeting domain is 23 nucleotides in length and the core domain (counted from the 3 ' end of the targeting domain) is 8 to 13 nucleotides in length
  • the secondary domain is 10 to 15 nucleotides in length.
  • the targeting domain is 22 nucleotides in length and the core domain
  • the secondary domain (counted from the 3 ' end of the targeting domain) is 8 to 13 nucleotides in length, the secondary domain is 9 to 14 nucleotides in length.
  • the targeting domain is 21 nucleotides in length and the core domain (counted from the 3 ' end of the targeting domain) is 8 to 13 nucleotides in length
  • the secondary domain is 8 to 13 nucleotides in length.
  • the targeting domain is 20 nucleotides in length and the core domain (counted from the 3 ' end of the targeting domain) is 8 to 13 nucleotides in length
  • the secondary domain is 7 to 12 nucleotides in length.
  • the targeting domain is 19 nucleotides in length and the core domain (counted from the 3 ' end of the targeting domain) is 8 to 13 nucleotides in length
  • the secondary domain is 6 to 1 1 nucleotides in length.
  • the targeting domain is 18 nucleotides in length and the core domain (counted from the 3 ' end of the targeting domain) is 8 to 13 nucleotides in length
  • the secondary domain is 5 to 10 nucleotides in length.
  • the targeting domain is 17 nucleotides in length and the core domain
  • the secondary domain (counted from the 3 ' end of the targeting domain) is 8 to 13 nucleotides in length, the secondary domain is 4 to 9 nucleotides in length.
  • the targeting domain is 16 nucleotides in length and the core domain (counted from the 3 ' end of the targeting domain) is 8 to 13 nucleotides in length
  • the secondary domain is 3 to 8 nucleotides in length.
  • the secondary domain is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14 or 15 nucleotides in length.
  • the secondary domain is complementary with the secondary domain target.
  • the secondary domain has exact complementarity with the secondary domain target.
  • the secondary domain can have 1, 2, 3, 4 or 5 nucleotides that are not complementary with the corresponding nucleotide of the secondary domain.
  • the degree of complementarity, together with other properties of the gR A, is sufficient to allow targeting of a Cas9 molecule to the target nucleic acid.
  • the core domain nucleotides do not comprise modifications, e.g.,
  • the core domain comprises one or more modifications, e.g., modifications that render it less susceptible to degradation or more bio-compatible, e.g., less immunogenic.
  • the backbone of the core domain can be modified with a phosphorothioate, or other modification(s) from Section VIII.
  • a nucleotide of the core domain can comprise a 2' modification (e.g., a modification at the 2' position on ribose), e.g., a 2-acetylation, e.g., a 2' methylation, or other modification(s) from Section VIII.
  • a core domain will contain no more than 1, 2, or 3 modifications.
  • Modifications in the core domain can be selected to not interfere with targeting efficacy, which can be evaluated by testing a candidate modification in the system described in Section IV.
  • gRNAs having a candidate core domain having a selected length, sequence, degree of complementarity, or degree of modification can be evaluated in the system described at Section IV.
  • the candidate core domain can be placed, either alone, or with one or more other candidate changes in a gRNA molecule/Cas9 molecule system known to be functional with a selected target and evaluated.
  • the secondary domain nucleotides do not comprise modifications, e.g., modifications of the type provided in Section VIII.
  • the secondary domain comprises one or more modifications, e.g., modifications that render it less susceptible to degradation or more bio-compatible, e.g., less immunogenic.
  • the backbone of the secondary domain can be modified with a phosphorothioate, or other modification(s) from Section VIII.
  • a nucleotide of the secondary domain can comprise a 2' modification, e.g., a 2-acetylation, e.g., a 2' methylation, or other modification(s) from Section VIII.
  • a secondary domain will contain no more than 1, 2, or 3 modifications.
  • Modifications in the secondary domain can be selected to not interfere with targeting efficacy, which can be evaluated by testing a candidate modification in the system described in Section IV.
  • the candidate secondary domain can be placed, either alone, or with one or more other candidate changes in a gRNA molecule/Cas9 molecule system known to be functional with a selected target and evaluated.
  • (1) the degree of complementarity between the core domain and its target, and (2) the degree of complementarity between the secondary domain and its target may differ. In an embodiment, (1) may be greater than (2). In an embodiment, (1) may be less than (2). In an embodiment, (1) and (2) are the same, e.g., each may be completely complementary with its target.
  • (1) the number of modifications (e.g., modifications from Section VIII) of the nucleotides of the core domain and (2) the number of modification (e.g., modifications from Section VIII) of the nucleotides of the secondary domain may differ. In an embodiment, (1) may be less than (2). In an embodiment, (1) may be greater than (2). In an embodiment, (1) and (2) may be the same, e.g., each may be free of modifications.
  • the first complementarity domain is complementary with the second complementarity domain.
  • the first complementarity domain does not have exact complementarity with the second complementarity domain target.
  • the first complementarity domain can have 1 , 2, 3, 4 or 5 nucleotides that are not complementary with the corresponding nucleotide of the second complementarity domain.
  • 1 , 2, 3, 4, 5 or 6, e.g., 3 nucleotides will not pair in the duplex, and, e.g., form a non-duplexed or looped-out region.
  • an unpaired, or loop-out, region e.g., a loop-out of 3 nucleotides, is present on the second complementarity domain.
  • the unpaired region begins 1 , 2, 3, 4, 5, or 6, e.g., 4, nucleotides from the 5' end of the second complementarity domain.
  • the degree of complementarity, together with other properties of the gRNA, is sufficient to allow targeting of a Cas9 molecule to the target nucleic acid.
  • the first and second complementarity domains are:
  • the second complementarity domain is longer than the first complementarity domain, e.g., 2, 3, 4, 5, or 6, e.g., 6, nucleotides longer.
  • the first and second complementary domains independently, do not comprise modifications, e.g., modifications of the type provided in Section VIII.
  • the first and second complementary domains independently, comprise one or more modifications, e.g., modifications that the render the domain less susceptible to degradation or more bio-compatible, e.g., less immunogenic.
  • the backbone of the domain can be modified with a phosphorothioate, or other modification(s) from Section VIII.
  • a nucleotide of the domain can comprise a 2' modification, e.g., a 2-acetylation, e.g., a 2' methylation, or other modification(s) from Section VIII.
  • first and second complementary domains independently, include 1, 2, 3, 4, 5, 6, 7 or 8 or more modifications. In an embodiment, the first and second complementary domains, independently, include 1, 2, 3, or 4 modifications within 5 nucleotides of its 5' end. In an embodiment, the first and second complementary domains, independently, include as many as 1, 2, 3, or 4
  • the first and second complementary domains independently, include modifications at two consecutive nucleotides, e.g., two consecutive nucleotides that are within 5 nucleotides of the 5' end of the domain, within 5 nucleotides of the 3' end of the domain, or more than 5 nucleotides away from one or both ends of the domain.
  • the first and second complementary domains independently, include no two consecutive nucleotides that are modified, within 5 nucleotides of the 5' end of the domain, within 5 nucleotides of the 3' end of the domain, or within a region that is more than 5 nucleotides away from one or both ends of the domain.
  • the first and second complementary domains independently, include no nucleotide that is modified within 5 nucleotides of the 5' end of the domain, within 5 nucleotides of the 3' end of the domain, or within a region that is more than 5 nucleotides away from one or both ends of the domain.
  • Modifications in a complementarity domain can be selected to not interfere with targeting efficacy, which can be evaluated by testing a candidate modification in the system described in Section IV.
  • gR As having a candidate complementarity domain having a selected length, sequence, degree of complementarity, or degree of modification, can be evaluated in the system described in Section IV.
  • the candidate complementarity domain can be placed, either alone, or with one or more other candidate changes in a gRNA molecule/Cas9 molecule system known to be functional with a selected target and evaluated.
  • the first complementarity domain has at least 60, 70, 80, 85%, 90% or 95% homology with, or differs by no more than 1, 2, 3, 4, 5, or 6 nucleotides from, a reference first complementarity domain, e.g., a naturally occurring, e.g., an S. pyogenes, S. aureus, N. meningtidis, or S. thermophilus, first complementarity domain, or a first complementarity domain described herein, e.g., from Figs. 1A-1G.
  • a reference first complementarity domain e.g., a naturally occurring, e.g., an S. pyogenes, S. aureus, N. meningtidis, or S. thermophilus
  • first complementarity domain or a first complementarity domain described herein, e.g., from Figs. 1A-1G.
  • the second complementarity domain has at least 60, 70, 80, 85%, 90%, or 95% homology with, or differs by no more than 1, 2, 3, 4, 5, or 6 nucleotides from, a reference second complementarity domain, e.g., a naturally occurring, e.g., an S. pyogenes, S. aureus, N. meningtidis, or S. thermophilus, second complementarity domain, or a second complementarity domain described herein, e.g., from Figs. 1A-1G.
  • a reference second complementarity domain e.g., a naturally occurring, e.g., an S. pyogenes, S. aureus, N. meningtidis, or S. thermophilus
  • second complementarity domain or a second complementarity domain described herein, e.g., from Figs. 1A-1G.
  • the duplexed region formed by first and second complementarity domains is typically 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 base pairs in length (excluding any looped out or unpaired nucleotides).
  • the first and second complementarity domains when duplexed, comprise 1 1 paired nucleotides, for example, in the gRNA sequence (one paired strand underlined, one bolded): NNNNNNNNNNNNNNNNN ⁇
  • the first and second complementarity domains when duplexed, comprise
  • the first and second complementarity domains when duplexed, comprise 16 paired nucleotides, for example in the gRNA sequence (one paired strand underlined, one bolded): NNNNNNNNNNNNNNNNNNGUUU
  • the first and second complementarity domains when duplexed, comprise 21 paired nucleotides, for example in the gRNA sequence (one paired strand underlined, one bolded): NNNNNNNNNNNNNNNNNNGUUU
  • nucleotides are exchanged to remove poly-U tracts, for example in the gRNA sequences (exchanged nucleotides underlined):
  • a modular gR A can comprise additional sequence, 5' to the second complementarity domain.
  • the 5' extension domain is 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, or 2 to 4 nucleotides in length.
  • the 5' extension domain is 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides in length.
  • the 5' extension domain nucleotides do not comprise modifications, e.g., modifications of the type provided in Section VIII.
  • the 5' extension domain comprises one or more modifications, e.g., modifications that render it less susceptible to degradation or more bio-compatible, e.g., less immunogenic.
  • the backbone of the 5' extension domain can be modified with a phosphorothioate, or other modification(s) from Section VIII.
  • a nucleotide of the 5' extension domain can comprise a 2' modification, e.g., a 2- acetylation, e.g., a 2' methylation, or other modification(s) from Section VIII.
  • the 5' extension domain can comprise as many as 1, 2, 3, 4, 5, 6, 7 or 8 modifications. In an embodiment, the 5' extension domain comprises as many as 1, 2, 3, or 4 modifications within 5 nucleotides of its 5' end, e.g., in a modular gRNA molecule. In an embodiment, the 5' extension domain comprises as many as 1, 2, 3, or 4 modifications within 5 nucleotides of its 3' end, e.g., in a modular gRNA molecule.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Virology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Hematology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2015/026504 2014-04-18 2015-04-17 Crispr-cas-related methods, compositions and components for cancer immunotherapy Ceased WO2015161276A2 (en)

Priority Applications (18)

Application Number Priority Date Filing Date Title
SG11201608701QA SG11201608701QA (en) 2014-04-18 2015-04-17 Crispr-cas-related methods, compositions and components for cancer immunotherapy
KR1020237036403A KR102827558B1 (ko) 2014-04-18 2015-04-17 암 면역요법을 위한 crispr-cas-관련 방법, 조성물 및 구성성분
CA2945335A CA2945335A1 (en) 2014-04-18 2015-04-17 Crispr-cas-related methods, compositions and components for cancer immunotherapy
IL292512A IL292512B2 (en) 2014-04-18 2015-04-17 CRISPR-CAS-related methods, compositions and components for cancer immunotherapy
KR1020257021203A KR20250102123A (ko) 2014-04-18 2015-04-17 암 면역요법을 위한 crispr-cas-관련 방법, 조성물 및 구성성분
KR1020167032071A KR102595473B1 (ko) 2014-04-18 2015-04-17 암 면역요법을 위한 crispr-cas-관련 방법, 조성물 및 구성성분
EP15721400.8A EP3132030B1 (en) 2014-04-18 2015-04-17 Crispr-cas-related methods, compositions and components for cancer immunotherapy
US15/303,722 US20170175128A1 (en) 2014-04-18 2015-04-17 Crispr-cas-related methods, compositions and components for cancer immunotherapy
JP2016562958A JP2017513485A (ja) 2014-04-18 2015-04-17 がん免疫療法のためのcrispr−cas関連方法、組成物および構成要素
CN201580031806.XA CN108138183A (zh) 2014-04-18 2015-04-17 用于癌症免疫疗法的crispr-cas相关方法、组合物和组分
EP20190783.9A EP3800248A3 (en) 2014-04-18 2015-04-17 Crispr-cas-related methods, compositions and components for cancer immunotherapy
AU2015247323A AU2015247323B2 (en) 2014-04-18 2015-04-17 CRISPR-Cas-related methods, compositions and components for cancer immunotherapy
IL248284A IL248284A0 (en) 2014-04-18 2016-10-10 Methods related to crispr–cas, compositions and components for cancer immunotherapy
IL279230A IL279230B (en) 2014-04-18 2020-12-06 Methods related to crispr–cas, compositions and components for cancer immunotherapy
US17/412,608 US20220106600A1 (en) 2014-04-18 2021-08-26 Crispr-cas-related methods, compositions and components for cancer immunotherapy
IL286103A IL286103B (en) 2014-04-18 2021-09-02 Crispr-cas-related methods, compositions and components for cancer immunotherapy
AU2021236446A AU2021236446B2 (en) 2014-04-18 2021-09-20 CRISPR-Cas-related methods, compositions and components for cancer immunotherapy
AU2024259841A AU2024259841A1 (en) 2014-04-18 2024-11-08 CRISPR-Cas-related methods, compositions and components for cancer immunotherapy

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201461981636P 2014-04-18 2014-04-18
US61/981,636 2014-04-18
US201562138246P 2015-03-25 2015-03-25
US62/138,246 2015-03-25

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/303,722 A-371-Of-International US20170175128A1 (en) 2014-04-18 2015-04-17 Crispr-cas-related methods, compositions and components for cancer immunotherapy
US17/412,608 Division US20220106600A1 (en) 2014-04-18 2021-08-26 Crispr-cas-related methods, compositions and components for cancer immunotherapy

Publications (2)

Publication Number Publication Date
WO2015161276A2 true WO2015161276A2 (en) 2015-10-22
WO2015161276A3 WO2015161276A3 (en) 2015-12-10

Family

ID=53059426

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/026504 Ceased WO2015161276A2 (en) 2014-04-18 2015-04-17 Crispr-cas-related methods, compositions and components for cancer immunotherapy

Country Status (10)

Country Link
US (2) US20170175128A1 (enExample)
EP (2) EP3132030B1 (enExample)
JP (5) JP2017513485A (enExample)
KR (3) KR102827558B1 (enExample)
CN (1) CN108138183A (enExample)
AU (3) AU2015247323B2 (enExample)
CA (1) CA2945335A1 (enExample)
IL (4) IL292512B2 (enExample)
SG (3) SG10201809157VA (enExample)
WO (1) WO2015161276A2 (enExample)

Cited By (200)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
WO2016094867A1 (en) 2014-12-12 2016-06-16 The Broad Institute Inc. Protected guide rnas (pgrnas)
WO2016094874A1 (en) 2014-12-12 2016-06-16 The Broad Institute Inc. Escorted and functionalized guides for crispr-cas systems
WO2016094880A1 (en) 2014-12-12 2016-06-16 The Broad Institute Inc. Delivery, use and therapeutic applications of crispr systems and compositions for genome editing as to hematopoietic stem cells (hscs)
WO2016106244A1 (en) 2014-12-24 2016-06-30 The Broad Institute Inc. Crispr having or associated with destabilization domains
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
WO2016154596A1 (en) * 2015-03-25 2016-09-29 Editas Medicine, Inc. Crispr/cas-related methods, compositions and components
WO2016182959A1 (en) * 2015-05-11 2016-11-17 Editas Medicine, Inc. Optimized crispr/cas9 systems and methods for gene editing in stem cells
WO2016183236A1 (en) * 2015-05-11 2016-11-17 Editas Medicine, Inc. Crispr/cas-related methods and compositions for treating hiv infection and aids
WO2016196388A1 (en) 2015-05-29 2016-12-08 Juno Therapeutics, Inc. Composition and methods for regulating inhibitory interactions in genetically engineered cells
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
WO2017093969A1 (en) * 2015-12-04 2017-06-08 Novartis Ag Compositions and methods for immunooncology
WO2017123663A1 (en) * 2016-01-12 2017-07-20 Sqz Biotechnologies Company Intracellular delivery of complexes
WO2017152015A1 (en) * 2016-03-04 2017-09-08 Editas Medicine, Inc. Crispr-cpf1-related methods, compositions and components for cancer immunotherapy
EP3219799A1 (en) 2016-03-17 2017-09-20 IMBA-Institut für Molekulare Biotechnologie GmbH Conditional crispr sgrna expression
CN107304434A (zh) * 2016-04-25 2017-10-31 上海宇玫博生物科技有限公司 一种免疫细胞治疗的双功能新型载体
WO2017193053A1 (en) * 2016-05-06 2017-11-09 Woolf Tod M Improved methods for genome editing with and without programmable nucleases
WO2017193107A2 (en) 2016-05-06 2017-11-09 Juno Therapeutics, Inc. Genetically engineered cells and methods of making the same
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
WO2018067618A1 (en) 2016-10-03 2018-04-12 Juno Therapeutics, Inc. Hpv-specific binding molecules
WO2018071873A2 (en) 2016-10-13 2018-04-19 Juno Therapeutics, Inc. Immunotherapy methods and compositions involving tryptophan metabolic pathway modulators
WO2018097296A1 (ja) * 2016-11-28 2018-05-31 ナパジェン ファーマ,インコーポレテッド 化学修飾siRNA
WO2018106732A1 (en) 2016-12-05 2018-06-14 Juno Therapeutics, Inc. Production of engineered cells for adoptive cell therapy
WO2018126074A1 (en) * 2016-12-30 2018-07-05 Celularity, Inc. Genetically modified natural killer cells
US10034925B2 (en) 2015-07-29 2018-07-31 Onkimmune Limited Modified natural killer cells and natural killer cell lines having increased cytotoxicity
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
WO2018191490A1 (en) * 2017-04-13 2018-10-18 The Trustees Of The University Of Pennsylvania Use of gene editing to generate universal tcr re-directed t cells for adoptive immunotherapy
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
WO2018227114A1 (en) 2017-06-09 2018-12-13 Editas Medicine, Inc. Engineered cas9 nucleases
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
WO2019003193A1 (en) * 2017-06-30 2019-01-03 Novartis Ag METHODS FOR TREATING DISEASES USING GENE EDITING SYSTEMS
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
WO2019060425A1 (en) 2017-09-19 2019-03-28 Massachusetts Institute Of Technology COMPOSITIONS FOR CHIMERIC ANTIGENIC RECEPTOR T CELL THERAPY AND USES THEREOF
WO2019070541A1 (en) 2017-10-03 2019-04-11 Juno Therapeutics, Inc. HPV-SPECIFIC BINDING MOLECULES
WO2019089982A1 (en) 2017-11-01 2019-05-09 Juno Therapeutics, Inc. Method of assessing activity of recombinant antigen receptors
WO2019090202A1 (en) 2017-11-06 2019-05-09 Editas Medicine, Inc. Methods, compositions and components for crispr-cas9 editing of cblb in t cells for immunotherapy
JP2019515914A (ja) * 2016-04-22 2019-06-13 インテリア セラピューティクス,インコーポレイテッド 転写因子4内のトリヌクレオチドリピートと関連する疾患の治療のための組成物および方法
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
WO2019178427A1 (en) 2018-03-14 2019-09-19 Arbor Biotechnologies, Inc. Novel crispr dna targeting enzymes and systems
WO2019195486A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. T cell receptors and engineered cells expressing same
WO2019195491A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. T cells expressing a recombinant receptor, related polynucleotides and methods
WO2019195492A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. Methods of producing cells expressing a recombinant receptor and related compositions
WO2019200306A1 (en) * 2018-04-13 2019-10-17 Sigma-Aldrich Co. Llc Modification of immune-related genomic loci using paired crispr nickase ribonucleoproteins
EP3433365A4 (en) * 2016-03-21 2019-11-13 Dana-Farber Cancer Institute, Inc. T cell depletion state specific gene expression regulators and uses thereof
WO2019215500A1 (en) * 2018-05-11 2019-11-14 Crispr Therapeutics Ag Methods and compositions for treating cancer
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10526573B2 (en) 2014-11-14 2020-01-07 Massachusetts Institute Of Technology Disruption and field enabled delivery of compounds and compositions into cells
CN110832075A (zh) * 2017-03-22 2020-02-21 诺华股份有限公司 用于免疫肿瘤学的组合物和方法
WO2020051283A1 (en) 2018-09-05 2020-03-12 The Regents Of The University Of California Generation of heritably gene-edited plants without tissue culture
WO2020068261A1 (en) 2018-09-28 2020-04-02 Massachusetts Institute Of Technology Collagen-localized immunomodulatory molecules and methods thereof
WO2020081613A1 (en) * 2018-10-16 2020-04-23 Intellia Therapeutics, Inc. Compositions and methods for immunotherapy
WO2020131862A1 (en) 2018-12-17 2020-06-25 The Broad Institute, Inc. Crispr-associated transposase systems and methods of use thereof
US10696944B2 (en) 2011-10-17 2020-06-30 Massachusetts Institute Of Technology Intracellular delivery
EP3532079A4 (en) * 2016-10-27 2020-07-08 Intima Bioscience, Inc. VIRAL T-LYMPHOCYTE THERAPY METHODS
US10729725B2 (en) 2017-05-12 2020-08-04 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US10738278B2 (en) 2014-07-15 2020-08-11 Juno Therapeutics, Inc. Engineered cells for adoptive cell therapy
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
WO2020168300A1 (en) 2019-02-15 2020-08-20 Editas Medicine, Inc. Modified natural killer (nk) cells for immunotherapy
US10786533B2 (en) 2015-07-15 2020-09-29 Juno Therapeutics, Inc. Engineered cells for adoptive cell therapy
WO2020210724A1 (en) 2019-04-10 2020-10-15 University Of Utah Research Foundation Htra1 modulation for treatment of amd
WO2020223571A1 (en) 2019-05-01 2020-11-05 Juno Therapeutics, Inc. Cells expressing a chimeric receptor from a modified cd247 locus, related polynucleotides and methods
WO2020223535A1 (en) 2019-05-01 2020-11-05 Juno Therapeutics, Inc. Cells expressing a recombinant receptor from a modified tgfbr2 locus, related polynucleotides and methods
WO2020236967A1 (en) 2019-05-20 2020-11-26 The Broad Institute, Inc. Random crispr-cas deletion mutant
US20200377883A1 (en) * 2017-06-27 2020-12-03 Agency For Science, Technology And Research Antisense oligonucleotides for modulating the function of a t cell
US10870112B2 (en) 2013-08-16 2020-12-22 Massachusetts Institute Of Technology Selective delivery of material to cells
WO2020263399A1 (en) 2019-06-26 2020-12-30 Massachusetts Institute Of Technology Immunomodulatory fusion protein-metal hydroxide complexes and methods thereof
US10906951B2 (en) 2015-07-29 2021-02-02 Onk Therapeutics Limited Modified natural killer cells and natural killer cell lines having increased cytotoxicity
WO2021041922A1 (en) 2019-08-30 2021-03-04 The Broad Institute, Inc. Crispr-associated mu transposase systems
EP3650545A4 (en) * 2017-06-20 2021-03-31 Jiangsu Hengrui Medicine Co., Ltd. METHOD OF TARGETING A TARGET CELL IN VITRO AND CRRNA USED IN THIS METHOD
WO2021061648A1 (en) 2019-09-23 2021-04-01 Massachusetts Institute Of Technology Methods and compositions for stimulation of endogenous t cell responses
US20210187018A1 (en) * 2017-12-07 2021-06-24 Flagship Pioneering Innovations V, Inc. Cytobiologics and therapeutic uses thereof
US11078483B1 (en) 2016-09-02 2021-08-03 KSQ Therapeutics, Inc. Methods for measuring and improving CRISPR reagent function
US11078481B1 (en) 2016-08-03 2021-08-03 KSQ Therapeutics, Inc. Methods for screening for cancer targets
US20210254005A1 (en) * 2020-01-23 2021-08-19 Kangstem Biotech Co., Ltd. Off-the-shelf stem cell and immune cell, and a pharmaceutical composition including the same
US11111472B2 (en) 2014-10-31 2021-09-07 Massachusetts Institute Of Technology Delivery of biomolecules to immune cells
WO2021183207A1 (en) 2020-03-10 2021-09-16 Massachusetts Institute Of Technology COMPOSITIONS AND METHODS FOR IMMUNOTHERAPY OF NPM1c-POSITIVE CANCER
US11125739B2 (en) 2015-01-12 2021-09-21 Massachusetts Institute Of Technology Gene editing through microfluidic delivery
US11147837B2 (en) 2015-07-31 2021-10-19 Regents Of The University Of Minnesota Modified cells and methods of therapy
WO2021216622A1 (en) 2020-04-21 2021-10-28 Aspen Neuroscience, Inc. Gene editing of gba1 in stem cells and method of use of cells differentiated therefrom
WO2021216623A1 (en) 2020-04-21 2021-10-28 Aspen Neuroscience, Inc. Gene editing of lrrk2 in stem cells and method of use of cells differentiated therefrom
WO2021221783A1 (en) 2020-05-01 2021-11-04 Massachusetts Institute Of Technology Methods for identifying chimeric antigen receptor-targeting ligands and uses thereof
WO2021221782A1 (en) 2020-05-01 2021-11-04 Massachusetts Institute Of Technology Chimeric antigen receptor-targeting ligands and uses thereof
US11166985B2 (en) 2017-05-12 2021-11-09 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
WO2021231661A2 (en) 2020-05-13 2021-11-18 Juno Therapeutics, Inc. Process for producing donor-batched cells expressing a recombinant receptor
US11180751B2 (en) 2015-06-18 2021-11-23 The Broad Institute, Inc. CRISPR enzymes and systems
US11203758B2 (en) 2014-10-31 2021-12-21 The Trustees Of The University Of Pennsylvania Altering gene expression in modified T cells and uses thereof
WO2021260186A1 (en) 2020-06-26 2021-12-30 Juno Therapeutics Gmbh Engineered t cells conditionally expressing a recombinant receptor, related polynucleotides and methods
US11234420B2 (en) 2016-06-28 2022-02-01 Biocytogen Pharmaceuticals (Beijing) Co., Ltd. Method for constructing PD-1 gene modified humanized animal model and use thereof
US11261428B2 (en) 2018-03-15 2022-03-01 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11272695B2 (en) 2017-10-13 2022-03-15 Biocytogen Pharmaceuticals (Beijing) Co., Ltd. Genetically modified non-human animal with human or chimeric PD-1
US11299698B2 (en) 2015-07-09 2022-04-12 Massachusetts Institute Of Technology Delivery of materials to anucleate cells
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
WO2022098787A1 (en) 2020-11-04 2022-05-12 Juno Therapeutics, Inc. Cells expressing a chimeric receptor from a modified invariant cd3 immunoglobulin superfamily chain locus and related polynucleotides and methods
US11332713B2 (en) 2016-11-16 2022-05-17 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
US11352647B2 (en) 2016-08-17 2022-06-07 The Broad Institute, Inc. Crispr enzymes and systems
US11389481B2 (en) 2019-04-30 2022-07-19 Crispr Therapeutics Ag Allogeneic cell therapy of B cell malignancies using genetically engineered T cells targeting CD19
WO2022162247A1 (en) * 2021-02-01 2022-08-04 Epsilen Bio S.R.L. Gene silencing
US11421228B2 (en) 2018-03-15 2022-08-23 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
WO2022187406A1 (en) 2021-03-03 2022-09-09 Juno Therapeutics, Inc. Combination of a t cell therapy and a dgk inhibitor
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
WO2022204071A1 (en) 2021-03-22 2022-09-29 Juno Therapeutics, Inc. Method to assess potency of viral vector particles
US11466271B2 (en) 2017-02-06 2022-10-11 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
WO2022232839A1 (en) 2021-04-30 2022-11-03 The Board Of Trustees Of The Leland Stanford Junior University Methods for improved production of primary cd34+ cells
AU2016343991B2 (en) * 2015-10-30 2022-12-01 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating herpes simplex virus
EP3917541A4 (en) * 2019-01-28 2022-12-07 Bar Ilan University Combinations, nanoparticles and methods for controlling natural killer cell activation and function
US11530253B2 (en) 2016-02-25 2022-12-20 The Children's Medical Center Corporation Customized class switch of immunoglobulin genes in lymphoma and hybridoma by CRISPR/CAS9 technology
WO2022266139A2 (en) 2021-06-14 2022-12-22 Graphite Bio, Inc. Methods to genetically engineer hematopoietic stem and progenitor cells for red cell specific expression of therapeutic proteins
WO2022272292A2 (en) 2021-06-23 2022-12-29 Editas Medicine, Inc. Engineered cells for therapy
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
WO2023278811A1 (en) 2021-07-01 2023-01-05 Indapta Therapeutics, Inc. Engineered natural killer (nk) cells and related methods
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
WO2023010135A1 (en) 2021-07-30 2023-02-02 Tune Therapeutics, Inc. Compositions and methods for modulating expression of methyl-cpg binding protein 2 (mecp2)
WO2023010133A2 (en) 2021-07-30 2023-02-02 Tune Therapeutics, Inc. Compositions and methods for modulating expression of frataxin (fxn)
US11613759B2 (en) 2015-09-04 2023-03-28 Sqz Biotechnologies Company Intracellular delivery of biomolecules to cells comprising a cell wall
WO2023077149A1 (en) 2021-11-01 2023-05-04 Sigma-Aldrich Co. Llc Electroporation enhancers for crispr-cas systems
WO2023081715A1 (en) 2021-11-03 2023-05-11 Viracta Therapeutics, Inc. Combination of car t-cell therapy with btk inhibitors and methods of use thereof
WO2023081900A1 (en) 2021-11-08 2023-05-11 Juno Therapeutics, Inc. Engineered t cells expressing a recombinant t cell receptor (tcr) and related systems and methods
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
WO2023115039A2 (en) 2021-12-17 2023-06-22 Sana Biotechnology, Inc. Modified paramyxoviridae fusion glycoproteins
WO2023115041A1 (en) 2021-12-17 2023-06-22 Sana Biotechnology, Inc. Modified paramyxoviridae attachment glycoproteins
WO2023133595A2 (en) 2022-01-10 2023-07-13 Sana Biotechnology, Inc. Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses
WO2023137471A1 (en) 2022-01-14 2023-07-20 Tune Therapeutics, Inc. Compositions, systems, and methods for programming t cell phenotypes through targeted gene activation
WO2023137472A2 (en) 2022-01-14 2023-07-20 Tune Therapeutics, Inc. Compositions, systems, and methods for programming t cell phenotypes through targeted gene repression
CN116539885A (zh) * 2023-07-06 2023-08-04 上海秤信生物科技有限公司 用于乳腺癌早期检测的肿瘤自身抗原/抗体组合及应用
WO2023150518A1 (en) 2022-02-01 2023-08-10 Sana Biotechnology, Inc. Cd3-targeted lentiviral vectors and uses thereof
WO2023150647A1 (en) 2022-02-02 2023-08-10 Sana Biotechnology, Inc. Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
WO2023201133A1 (en) 2022-04-14 2023-10-19 Board Of Regents Of The University Of Nebraska Cell therapy for alzheimer's disease
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
WO2023224715A1 (en) 2022-05-19 2023-11-23 Massachusetts Institute Of Technology Car cells targeting an inserted ligand
WO2023250511A2 (en) 2022-06-24 2023-12-28 Tune Therapeutics, Inc. Compositions, systems, and methods for reducing low-density lipoprotein through targeted gene repression
WO2024007020A1 (en) 2022-06-30 2024-01-04 Indapta Therapeutics, Inc. Combination of engineered natural killer (nk) cells and antibody therapy and related methods
WO2024015881A2 (en) 2022-07-12 2024-01-18 Tune Therapeutics, Inc. Compositions, systems, and methods for targeted transcriptional activation
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11904023B2 (en) 2016-08-17 2024-02-20 Factor Bioscience Inc. Nucleic acid products and methods of administration thereof
WO2024040254A2 (en) 2022-08-19 2024-02-22 Tune Therapeutics, Inc. Compositions, systems, and methods for regulation of hepatitis b virus through targeted gene repression
US11911415B2 (en) 2015-06-09 2024-02-27 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for improving transplantation
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
WO2024044655A1 (en) 2022-08-24 2024-02-29 Sana Biotechnology, Inc. Delivery of heterologous proteins
WO2024054944A1 (en) 2022-09-08 2024-03-14 Juno Therapeutics, Inc. Combination of a t cell therapy and continuous or intermittent dgk inhibitor dosing
WO2024064838A1 (en) 2022-09-21 2024-03-28 Sana Biotechnology, Inc. Lipid particles comprising variant paramyxovirus attachment glycoproteins and uses thereof
WO2024064642A2 (en) 2022-09-19 2024-03-28 Tune Therapeutics, Inc. Compositions, systems, and methods for modulating t cell function
WO2024081820A1 (en) 2022-10-13 2024-04-18 Sana Biotechnology, Inc. Viral particles targeting hematopoietic stem cells
US11970710B2 (en) 2015-10-13 2024-04-30 Duke University Genome engineering with Type I CRISPR systems in eukaryotic cells
US11976307B2 (en) 2012-04-27 2024-05-07 Duke University Genetic correction of mutated genes
WO2024100604A1 (en) 2022-11-09 2024-05-16 Juno Therapeutics Gmbh Methods for manufacturing engineered immune cells
WO2024119157A1 (en) 2022-12-02 2024-06-06 Sana Biotechnology, Inc. Lipid particles with cofusogens and methods of producing and using the same
WO2024163683A2 (en) 2023-02-01 2024-08-08 Tune Therapeutics, Inc. Systems, compositions, and methods for modulating expression of methyl-cpg binding protein 2 (mecp2) and x-inactive specific transcript (xist)
WO2024163678A2 (en) 2023-02-01 2024-08-08 Tune Therapeutics, Inc. Fusion proteins and systems for targeted activation of frataxin (fxn) and related methods
WO2024161021A1 (en) 2023-02-03 2024-08-08 Juno Therapeutics Gmbh Methods for non-viral manufacturing of engineered immune cells
WO2024220574A1 (en) 2023-04-18 2024-10-24 Sana Biotechnology, Inc. Universal protein g fusogens and adapter systems thereof and related lipid particles and uses
WO2024220598A2 (en) 2023-04-18 2024-10-24 Sana Biotechnology, Inc. Lentiviral vectors with two or more genomes
WO2024220560A1 (en) 2023-04-18 2024-10-24 Sana Biotechnology, Inc. Engineered protein g fusogens and related lipid particles and methods thereof
WO2024243340A1 (en) 2023-05-23 2024-11-28 Sana Biotechnology, Inc. Tandem fusogens and related lipid particles
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
WO2024249342A1 (en) 2023-05-26 2024-12-05 Editas Medicine, Inc. Crispr-related methods and compositions targeting ptpn2 expression
WO2024249348A2 (en) 2023-05-26 2024-12-05 Editas Medicine, Inc. Crispr-related methods and compositions targeting fl1-1 expression
WO2024249346A1 (en) 2023-05-26 2024-12-05 Editas Medicine, Inc. Crispr-related methods and compositions targeting cd70 expression
US12214056B2 (en) 2016-07-19 2025-02-04 Duke University Therapeutic applications of CPF1-based genome editing
US12215345B2 (en) 2013-03-19 2025-02-04 Duke University Compositions and methods for the induction and tuning of gene expression
US12215366B2 (en) 2015-02-09 2025-02-04 Duke University Compositions and methods for epigenome editing
US12214054B2 (en) 2015-11-30 2025-02-04 Duke University Therapeutic targets for the correction of the human dystrophin gene by gene editing and methods of use
WO2025029835A1 (en) 2023-07-31 2025-02-06 Tune Therapeutics, Inc. Compositions and methods for modulating il-2 gene expression
WO2025029840A1 (en) 2023-07-31 2025-02-06 Tune Therapeutics, Inc. Compositions and methods for multiplexed activation and repression of t cell gene expression
WO2025038494A1 (en) 2023-08-11 2025-02-20 Tune Therapeutics, Inc. Compositions, systems, and methods for lymphoid cell differentiation using targeted gene activation
WO2025054202A1 (en) 2023-09-05 2025-03-13 Sana Biotechnology, Inc. Method of screening a sample comprising a transgene with a unique barcode
WO2025059073A1 (en) 2023-09-11 2025-03-20 Tune Therapeutics, Inc. Epigenetic editing methods and systems for differentiating stem cells
WO2025059533A1 (en) 2023-09-13 2025-03-20 The Broad Institute, Inc. Crispr enzymes and systems
EP4438729A3 (en) * 2019-12-09 2025-03-26 Caribou Biosciences, Inc. Crispr abasic restricted nucleotides and crispr accuracy via analogs
US12264323B2 (en) 2018-12-17 2025-04-01 The Broad Institute, Inc. CRISPR CPF1 direct repeat variants
EP4259159A4 (en) * 2020-12-14 2025-04-09 Emendobio Inc. Biallelic knockout of trac
EP4467642A3 (en) * 2020-05-08 2025-04-16 Metagenomi, Inc. Enzymes with ruvc domains
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
WO2025096638A2 (en) 2023-10-30 2025-05-08 Turnstone Biologics Corp. Genetically modified tumor infilitrating lymphocytes and methods of producing and using the same
WO2025117544A1 (en) 2023-11-29 2025-06-05 The Broad Institute, Inc. Engineered omega guide molecule and iscb compositions, systems, and methods of use thereof
WO2025137646A1 (en) 2023-12-22 2025-06-26 Recode Therapeutics, Inc. Gene editing methods and compositions for treating cystic fibrosis
US12344850B2 (en) 2019-07-30 2025-07-01 Pairwise Plants Services, Inc. Morphogenic regulators and methods of using the same
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12359197B2 (en) 2014-12-12 2025-07-15 Etagen Pharma, Inc. Compositions and methods for editing nucleic acids in cells utilizing oligonucleotides
WO2025151838A1 (en) 2024-01-12 2025-07-17 Sana Biotechnology, Inc. Safety switches to control in vitro and in vivo proliferation of cell therapy products
US12378576B2 (en) 2018-04-27 2025-08-05 Spacecraft Seven, Llc Gene therapy for CNS degeneration
US12378578B2 (en) 2018-07-09 2025-08-05 Flagship Pioneering Innovations V, Inc. Fusosome compositions and uses thereof
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
WO2025184529A1 (en) 2024-03-01 2025-09-04 Sana Biotechnology, Inc. Viral particles with fusogen display and related compositions and methods
US12421507B2 (en) 2018-08-20 2025-09-23 The Broad Institute, Inc. Methods and compositions for optochemical control of CRISPR-CAS9
US12428631B2 (en) 2016-04-13 2025-09-30 Duke University CRISPR/Cas9-based repressors for silencing gene targets in vivo and methods of use
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12435323B2 (en) 2021-08-27 2025-10-07 Metagenomi, Inc. Enzymes with RUVC domains
WO2025213127A1 (en) 2024-04-05 2025-10-09 Indapta Therapeutics, Inc. Treatment of autoimmune diseases or conditions with natural killer cells
WO2025212519A1 (en) 2024-04-01 2025-10-09 Moonlight Bio, Inc. Dll3 binding proteins and uses thereof
WO2025235851A1 (en) 2024-05-10 2025-11-13 Juno Therapeutics, Inc. Genetically engineered t cells expressing a cd19 chimeric antigen receptor (car) and uses thereof for allogeneic cell therapy
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
WO2025245399A1 (en) 2024-05-23 2025-11-27 Indapta Therapeutics, Inc. Method of treating cancer with natural killer cells
US12496274B2 (en) 2018-11-14 2025-12-16 Flagship Pioneering Innovations V, Inc. Compositions and methods for compartment-specific cargo delivery
WO2025260068A1 (en) 2024-06-14 2025-12-18 Tune Therapeutics, Inc. Lipid nanoparticle formulation for delivery of nucleic acids to cells

Families Citing this family (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4269601A3 (en) * 2015-03-27 2024-01-10 President and Fellows of Harvard College Modified t cells and methods of making and using the same
AU2016261600B2 (en) 2015-05-08 2021-09-23 President And Fellows Of Harvard College Universal donor stem cells and related methods
EP3494132A4 (en) * 2016-08-03 2020-03-18 Washington University Gene editing of car-t cells for the treatment of t cell malignancies with chimeric antigen receptors
JP7181862B2 (ja) 2016-10-18 2022-12-01 リージェンツ オブ ザ ユニバーシティ オブ ミネソタ 腫瘍浸潤リンパ球および治療の方法
AU2017378153B2 (en) 2016-12-13 2024-03-28 Seattle Children's Hospital (dba Seattle Children's Research Institute) Methods of exogenous drug activation of chemical-induced signaling complexes expressed in engineered cells in vitro and in vivo
US20190381157A1 (en) * 2017-01-29 2019-12-19 Zequn Tang Methods of immune modulation against foreign and/or auto antigens
US10828330B2 (en) * 2017-02-22 2020-11-10 IO Bioscience, Inc. Nucleic acid constructs comprising gene editing multi-sites and uses thereof
CN110651046A (zh) 2017-02-22 2020-01-03 艾欧生物科学公司 包含基因编辑多位点的核酸构建体及其用途
AU2018273979B2 (en) 2017-05-25 2024-10-17 Regeneron Pharmaceuticals, Inc. CBLB endonuclease variants, compositions, and methods of use
MX2019015188A (es) 2017-06-15 2020-08-03 Univ California Inserciones de adn no virales orientadas.
JP2020530307A (ja) 2017-06-30 2020-10-22 インティマ・バイオサイエンス,インコーポレーテッド 遺伝子治療のためのアデノ随伴ウイルスベクター
AU2018355587B2 (en) 2017-10-27 2023-02-02 The Regents Of The University Of California Targeted replacement of endogenous T cell receptors
US11738047B2 (en) 2017-12-12 2023-08-29 The Trustees Of The University Of Pennsylvania Genetically modified immune cells targeting NY-ESO-1 and methods of use thereof
EP3724327A4 (en) * 2017-12-14 2022-01-12 EZY Biotech LLC SUBJECT-SPECIFIC TUMOR INHIBITION CELLS AND THEIR USE
EP3768327A4 (en) * 2018-03-23 2022-04-13 The Trustees of Columbia University in the City of New York GENE EDITING FOR AUTOSOMAL DOMINANT DISEASES
SG11202007874XA (en) 2018-04-27 2020-09-29 Seattle Childrens Hospital Dba Seattle Childrens Res Inst Rapamycin resistant cells
EP4365194A3 (en) 2018-06-14 2024-07-24 Regeneron Pharmaceuticals, Inc. Cd79a chimeric antigen receptors
CN108866004A (zh) * 2018-06-26 2018-11-23 奥妙生物技术(广州)有限公司 Shp-1敲除的t细胞及其构建方法
CN112823011A (zh) * 2018-07-09 2021-05-18 加利福尼亚大学董事会 基于t细胞的免疫疗法的基因靶标
KR20200011899A (ko) * 2018-07-25 2020-02-04 주식회사 툴젠 인위적인 유전자 조작을 통한 자가면역질환 치료
US20210317448A1 (en) * 2018-07-26 2021-10-14 Toolgen Incorporated Gene editing of anticoagulants
US20200080056A1 (en) * 2018-09-06 2020-03-12 The Trustees Of The University Of Pennsylvania CRISPR-Cas9 Knock-out of SHP-1/2 to Reduce T cell Exhaustion in Adoptive Cell Therapy
CN112654245B (zh) * 2018-09-11 2022-05-27 得克萨斯州大学系统董事会 自身免疫不良事件和免疫检查点阻断治疗的遗传小鼠模型
WO2020072059A1 (en) * 2018-10-04 2020-04-09 Bluebird Bio, Inc. Cblb endonuclease variants, compositions, and methods of use
US12331320B2 (en) 2018-10-10 2025-06-17 The Research Foundation For The State University Of New York Genome edited cancer cell vaccines
US20210395784A1 (en) * 2018-10-29 2021-12-23 China Agricultural University Crispr/cas12f enzyme and system
BR112021021979A2 (pt) 2019-05-03 2022-12-06 Specific Biologics Inc Polipeptídeo, nucleases quiméricas, formulações farmaceuticamente aceitáveis, métodos para editar dna genômico, para deletar comprimentos definidos de uma molécula de dna e para substituir sequências selecionadas de uma molécula de dna, processo, métodos de administração da formulação, de tratamento de uma doença relacionada ao pulmão e de tratamento de doenças monogenéticas e infecciosas, ligante e moléculas de dna doadoras modificadas
US12188045B2 (en) 2019-06-07 2025-01-07 KSQ Therapeutics, Inc. Guide RNA combinations and methods of use
BR112021025259A2 (pt) * 2019-06-14 2022-03-15 2Seventy Bio Inc Composições e métodos para tratar câncer
WO2021247924A1 (en) * 2020-06-03 2021-12-09 Mammoth Biosciences, Inc. Programmable nucleases and methods of use
US11332744B1 (en) 2020-10-26 2022-05-17 Arsenal Biosciences, Inc. Safe harbor loci
US11591381B2 (en) 2020-11-30 2023-02-28 Crispr Therapeutics Ag Gene-edited natural killer cells
US11473060B2 (en) 2020-12-30 2022-10-18 Crispr Therapeutics Ag Compositions and methods for differentiating stem cells into NK cells
US12171813B2 (en) 2021-02-05 2024-12-24 Christiana Care Gene Editing Institute, Inc. Methods of and compositions for reducing gene expression and/or activity
WO2022215982A1 (ko) * 2021-04-05 2022-10-13 주식회사 셀렌진 Trac 유전자에 상보적인 가이드 rna 및 이의 용도
US20230016422A1 (en) * 2021-06-23 2023-01-19 Crispr Therapeutics Ag Engineered cells with improved protection from natural killer cell killing
EP4416292A2 (en) 2021-10-14 2024-08-21 Arsenal Biosciences, Inc. Immune cells having co-expressed shrnas and logic gate systems
MX2024007790A (es) 2021-12-22 2024-09-06 Camp4 Therapeutics Corp Modulación de la transcripción génica utilizando oligonucleótidos antisentido dirigidos a arn reguladores.
IL319694A (en) * 2022-09-19 2025-05-01 Emendobio Inc Biallelic silencing of CTLA4
US12257304B2 (en) 2023-03-03 2025-03-25 Arsenal Biosciences, Inc. Systems targeting PSMA and CA9

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3362867B2 (ja) * 1991-04-26 2003-01-07 財団法人大阪バイオサイエンス研究所 ヒト細胞表面抗原をコードするdna
HUE064187T2 (hu) * 2012-05-25 2024-02-28 Cellectis Eljárás immunterápiára alkalmas allogén és immunszupresszív-rezisztens T-sejt módosítására
RS59199B1 (sr) * 2012-05-25 2019-10-31 Univ California Metode i jedinjenja za rnk-upravljanu ciljanu dnk modifikaciju i za rnk- upravljanu modulaciju transkripta
EP3763810A3 (en) * 2012-10-10 2021-07-14 Sangamo Therapeutics, Inc. T cell modifying compounds and uses thereof
US8697359B1 (en) * 2012-12-12 2014-04-15 The Broad Institute, Inc. CRISPR-Cas systems and methods for altering expression of gene products
EP2898075B1 (en) * 2012-12-12 2016-03-09 The Broad Institute, Inc. Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation
US9937207B2 (en) * 2013-03-21 2018-04-10 Sangamo Therapeutics, Inc. Targeted disruption of T cell receptor genes using talens
CN105378067A (zh) * 2013-05-13 2016-03-02 塞勒克提斯公司 工程化用于免疫治疗的高活性t细胞的方法
AU2014273490B2 (en) * 2013-05-29 2019-05-09 Cellectis Methods for engineering T cells for immunotherapy by using RNA-guided Cas nuclease system
BR112015031608A2 (pt) * 2013-06-17 2017-08-22 Massachusetts Inst Technology Aplicação e uso dos sistemas crispr-cas, vetores e composições para direcionamento e terapia hepáticos
EP3693384B1 (en) * 2014-03-11 2024-01-24 Cellectis Method for generating t-cells compatible for allogenic transplantation
WO2016154596A1 (en) * 2015-03-25 2016-09-29 Editas Medicine, Inc. Crispr/cas-related methods, compositions and components

Non-Patent Citations (44)

* Cited by examiner, † Cited by third party
Title
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL ET AL., NUC. ACIDS RES., vol. 25, 1977, pages 3389 - 3402
ANDERS ET AL., NATURE, 2014
BAE ET AL., BIOINFORMATICS, 2014
BAE ET AL., BIOINFORMATICS, vol. 30, no. 10, 2014, pages 1473 - 1475
BAE S; PARK J; KIM JS: "Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases", BIOINFORMATICS, 17 February 2014 (2014-02-17)
BRENT ET AL., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, 2003
CHYLINSKI ET AL., RNA BIOL., vol. 10, no. 5, 2013, pages 726 - 737
CHYLINSKI ET AL., RNA BIOLOGY, vol. 10, no. 5, 2013, pages 727 - 737
DEVEAU ET AL., JB, vol. 190, no. 4, 2008, pages 1390 - 1400
DOTTI, G. ET AL., BLOOD, vol. 105, 2005, pages 4677 - 4684
E. MEYERS; W. MILLER, COMPUT. APPL. BIOSCI., vol. 4, 1988, pages 11 - 17
ESVELT ET AL., NATURE, vol. 472, no. 7344, 2011, pages 499 - 503
FU ET AL., NAT BIOTECHNOL, 2014
FU ET AL.: "Improving CRISPR-Cas nuclease specificity using truncated guide RNAs", NAT BIOTECHNOL., 26 January 2014 (2014-01-26)
FU Y ET AL., NAT BIOTECHNOL, 2014
HEIGWER ET AL., N METHODS, vol. 11, no. 2, 2014, pages 122 - 3
HORVATH ET AL., SCIENCE, vol. 327, no. 5962, 2010, pages 167 - 170
HOU ET AL., PNAS EARLY EDITION, 2013, pages 1 - 6
HSU ET AL., N B, vol. 31, no. 9, pages 827 - 32
JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816
JINEK ET AL., SCIENCE, vol. 343, no. 6176, 2014, pages 1247997
JOHNSON, L. A. ET AL., BLOOD, vol. 114, 2009, pages 535 - 546
KERSHAW ET AL., NATREVCANCER, vol. 13, 2013, pages 525 - 541
KOCHENDERFER, J. N. ET AL., BLOOD, vol. 119, 2012, pages 2709 - 2720
LAMERS, C. H. ET AL., MOL. THER., vol. 21, 2013, pages 904 - 912
LEI, X. Y. ET AL., IMMUNOL. LETT., vol. 122, 2009, pages 30 - 36
MALI ET AL., SCIENCE, vol. 339, no. 6121, 2013, pages 823 - 826
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 444 - 453
NISHIMASU ET AL., CELL, vol. 156, 2014, pages 935 - 949
PEARSON; LIPMAN, PROC. NAT'L. ACAD. SCI. USA, vol. 85, 1988, pages 2444
PROVASI ET AL., NATURE MEDICINE, vol. 18, 2012, pages 807 - 815
SANDER ET AL., NAR, vol. 35, 2007, pages W599 - 605
SANDER ET AL., NAR, vol. 38, 2010, pages W462 - 8
SHRIKANT, P. ET AL., IMMUNITY, vol. 11, 1999, pages 483 - 493
SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1970, pages 482C
STERNBERG SH ET AL., NATURE, 2014
STROMNES, I. M. ET AL., J. CLIN. INVEST., vol. 120, 2010, pages 3722 - 3734
STROMNES, I. M. ET AL., J. IMMUNOL., vol. 189, 2012, pages 1812 - 1825
TOPALIAN, S. L. ET AL., N. ENGL. J. MED., vol. 366, 2012, pages 2443 - 2454
TORIKAI ET AL., BLOOD, vol. 119, 2012, pages 5697 - 5705
WARREN, R. S. ET AL., CANCER GENE THER, vol. 5, 1998, pages S 1 - S2
XIAO A ET AL., BIOINFORMATICS, 2014

Cited By (347)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10696944B2 (en) 2011-10-17 2020-06-30 Massachusetts Institute Of Technology Intracellular delivery
US11976307B2 (en) 2012-04-27 2024-05-07 Duke University Genetic correction of mutated genes
US12215345B2 (en) 2013-03-19 2025-02-04 Duke University Compositions and methods for the induction and tuning of gene expression
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11806714B2 (en) 2013-08-16 2023-11-07 Massachusetts Institute Of Technology Selective delivery of material to cells
US10870112B2 (en) 2013-08-16 2020-12-22 Massachusetts Institute Of Technology Selective delivery of material to cells
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US9340800B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College Extended DNA-sensing GRNAS
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10640788B2 (en) 2013-11-07 2020-05-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAs
US11390887B2 (en) 2013-11-07 2022-07-19 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10190137B2 (en) 2013-11-07 2019-01-29 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US10738278B2 (en) 2014-07-15 2020-08-11 Juno Therapeutics, Inc. Engineered cells for adoptive cell therapy
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11203758B2 (en) 2014-10-31 2021-12-21 The Trustees Of The University Of Pennsylvania Altering gene expression in modified T cells and uses thereof
US20220145306A1 (en) * 2014-10-31 2022-05-12 The Trustees Of The University Of Pennsylvania Altering Gene Expression in Modified T Cells and Uses Thereof
US11208661B2 (en) 2014-10-31 2021-12-28 The Trustees Of The University Of Pennsylvania Altering gene expression in modified T cells and uses thereof
US11111472B2 (en) 2014-10-31 2021-09-07 Massachusetts Institute Of Technology Delivery of biomolecules to immune cells
EP3215166B1 (en) 2014-10-31 2024-04-24 The Trustees of the University of Pennsylvania Altering gene expression in car-t cells and uses thereof
US12344843B2 (en) 2014-10-31 2025-07-01 The Trustees Of The University Of Pennsylvania Altering gene expression in cart cells and uses thereof
US12410392B2 (en) 2014-10-31 2025-09-09 Massachusetts Institute Of Technology Delivery of biomolecules to immune cells
US10526573B2 (en) 2014-11-14 2020-01-07 Massachusetts Institute Of Technology Disruption and field enabled delivery of compounds and compositions into cells
US12359197B2 (en) 2014-12-12 2025-07-15 Etagen Pharma, Inc. Compositions and methods for editing nucleic acids in cells utilizing oligonucleotides
WO2016094874A1 (en) 2014-12-12 2016-06-16 The Broad Institute Inc. Escorted and functionalized guides for crispr-cas systems
EP3985115A1 (en) 2014-12-12 2022-04-20 The Broad Institute, Inc. Protected guide rnas (pgrnas)
EP3889260A1 (en) 2014-12-12 2021-10-06 The Broad Institute, Inc. Protected guide rnas (pgrnas)
WO2016094867A1 (en) 2014-12-12 2016-06-16 The Broad Institute Inc. Protected guide rnas (pgrnas)
WO2016094880A1 (en) 2014-12-12 2016-06-16 The Broad Institute Inc. Delivery, use and therapeutic applications of crispr systems and compositions for genome editing as to hematopoietic stem cells (hscs)
EP3702456A1 (en) 2014-12-24 2020-09-02 The Broad Institute, Inc. Crispr having or associated with destabilization domains
WO2016106244A1 (en) 2014-12-24 2016-06-30 The Broad Institute Inc. Crispr having or associated with destabilization domains
US12130281B2 (en) 2015-01-12 2024-10-29 Massachusetts Institute Of Technology Gene editing through microfluidic delivery
US11125739B2 (en) 2015-01-12 2021-09-21 Massachusetts Institute Of Technology Gene editing through microfluidic delivery
US12215366B2 (en) 2015-02-09 2025-02-04 Duke University Compositions and methods for epigenome editing
EP4019635A1 (en) * 2015-03-25 2022-06-29 Editas Medicine, Inc. Crispr/cas-related methods, compositions and components
WO2016154596A1 (en) * 2015-03-25 2016-09-29 Editas Medicine, Inc. Crispr/cas-related methods, compositions and components
JP7030522B2 (ja) 2015-05-11 2022-03-07 エディタス・メディシン、インコーポレイテッド 幹細胞における遺伝子編集のための最適化crispr/cas9システムおよび方法
WO2016182959A1 (en) * 2015-05-11 2016-11-17 Editas Medicine, Inc. Optimized crispr/cas9 systems and methods for gene editing in stem cells
JP2022084601A (ja) * 2015-05-11 2022-06-07 エディタス・メディシン、インコーポレイテッド 幹細胞における遺伝子編集のための最適化crispr/cas9システムおよび方法
JP2018519801A (ja) * 2015-05-11 2018-07-26 エディタス・メディシン、インコーポレイテッド 幹細胞における遺伝子編集のための最適化crispr/cas9システムおよび方法
AU2016261358B2 (en) * 2015-05-11 2021-09-16 Editas Medicine, Inc. Optimized CRISPR/Cas9 systems and methods for gene editing in stem cells
US11390884B2 (en) 2015-05-11 2022-07-19 Editas Medicine, Inc. Optimized CRISPR/cas9 systems and methods for gene editing in stem cells
WO2016183236A1 (en) * 2015-05-11 2016-11-17 Editas Medicine, Inc. Crispr/cas-related methods and compositions for treating hiv infection and aids
WO2016196388A1 (en) 2015-05-29 2016-12-08 Juno Therapeutics, Inc. Composition and methods for regulating inhibitory interactions in genetically engineered cells
US11911415B2 (en) 2015-06-09 2024-02-27 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for improving transplantation
US11180751B2 (en) 2015-06-18 2021-11-23 The Broad Institute, Inc. CRISPR enzymes and systems
US12441969B2 (en) 2015-07-09 2025-10-14 Massachusetts Institute Of Technology Delivery of materials to anucleate cells
US11299698B2 (en) 2015-07-09 2022-04-12 Massachusetts Institute Of Technology Delivery of materials to anucleate cells
US10786533B2 (en) 2015-07-15 2020-09-29 Juno Therapeutics, Inc. Engineered cells for adoptive cell therapy
US10034925B2 (en) 2015-07-29 2018-07-31 Onkimmune Limited Modified natural killer cells and natural killer cell lines having increased cytotoxicity
US10960064B2 (en) 2015-07-29 2021-03-30 Onk Therapeutics Limited Modified natural killer cells and natural killer cell lines having increased cytotoxicity
US10906951B2 (en) 2015-07-29 2021-02-02 Onk Therapeutics Limited Modified natural killer cells and natural killer cell lines having increased cytotoxicity
US11925664B2 (en) 2015-07-31 2024-03-12 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US11147837B2 (en) 2015-07-31 2021-10-19 Regents Of The University Of Minnesota Modified cells and methods of therapy
US11903966B2 (en) 2015-07-31 2024-02-20 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US11266692B2 (en) 2015-07-31 2022-03-08 Regents Of The University Of Minnesota Intracellular genomic transplant and methods of therapy
US11642375B2 (en) 2015-07-31 2023-05-09 Intima Bioscience, Inc. Intracellular genomic transplant and methods of therapy
US11583556B2 (en) 2015-07-31 2023-02-21 Regents Of The University Of Minnesota Modified cells and methods of therapy
US11613759B2 (en) 2015-09-04 2023-03-28 Sqz Biotechnologies Company Intracellular delivery of biomolecules to cells comprising a cell wall
US11970710B2 (en) 2015-10-13 2024-04-30 Duke University Genome engineering with Type I CRISPR systems in eukaryotic cells
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11834649B2 (en) 2015-10-30 2023-12-05 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating herpes simplex virus
AU2016343991B2 (en) * 2015-10-30 2022-12-01 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating herpes simplex virus
US12214054B2 (en) 2015-11-30 2025-02-04 Duke University Therapeutic targets for the correction of the human dystrophin gene by gene editing and methods of use
CN108699557A (zh) * 2015-12-04 2018-10-23 诺华股份有限公司 用于免疫肿瘤学的组合物和方法
US12037583B2 (en) 2015-12-04 2024-07-16 Novartis Ag Compositions and methods for immunooncology
WO2017093969A1 (en) * 2015-12-04 2017-06-08 Novartis Ag Compositions and methods for immunooncology
IL259576B (en) * 2015-12-04 2022-09-01 Novartis Ag grna molecule containing tracr and crrna, pharmaceutical composition containing it and method for preparing cells for immunotherapy
CN116218916A (zh) * 2016-01-12 2023-06-06 Sqz生物技术公司 复合物的细胞内递送
JP2022023163A (ja) * 2016-01-12 2022-02-07 スクイーズ バイオテクノロジーズ カンパニー 複合体の細胞内送達
EP4495222A3 (en) * 2016-01-12 2025-04-23 SQZ Biotechnologies Company Intracellular delivery of complexes
JP7033535B2 (ja) 2016-01-12 2022-03-10 スクイーズ バイオテクノロジーズ カンパニー 複合体の細胞内送達
JP2019500886A (ja) * 2016-01-12 2019-01-17 スクイーズ バイオテクノロジーズ カンパニー 複合体の細胞内送達
JP2024029242A (ja) * 2016-01-12 2024-03-05 スクイーズ バイオテクノロジーズ カンパニー 複合体の細胞内送達
CN108779475A (zh) * 2016-01-12 2018-11-09 Sqz生物技术公司 复合物的细胞内递送
WO2017123663A1 (en) * 2016-01-12 2017-07-20 Sqz Biotechnologies Company Intracellular delivery of complexes
US11530253B2 (en) 2016-02-25 2022-12-20 The Children's Medical Center Corporation Customized class switch of immunoglobulin genes in lymphoma and hybridoma by CRISPR/CAS9 technology
KR20220124278A (ko) * 2016-03-04 2022-09-13 에디타스 메디신, 인코포레이티드 암 면역요법을 위한 crispr-cpf1-관련 방법, 조성물 및 구성성분
IL261163B (en) * 2016-03-04 2022-10-01 Editas Medicine Inc Crispr-cpf1-related methods, compositions and components for cancer immunotherapy
AU2017226172B2 (en) * 2016-03-04 2023-08-17 Editas Medicine, Inc. CRISPR/Cpf1-related methods, compositions and components for cancer immunotherapy
AU2017226172B9 (en) * 2016-03-04 2023-08-24 Editas Medicine, Inc. CRISPR/Cpf1-related methods, compositions and components for cancer immunotherapy
JP2019507599A (ja) * 2016-03-04 2019-03-22 エディタス・メディシン、インコーポレイテッド がん免疫療法のためのcrispr−cpf1関連方法、組成物および構成要素
KR102587132B1 (ko) * 2016-03-04 2023-10-11 에디타스 메디신, 인코포레이티드 암 면역요법을 위한 crispr-cpf1-관련 방법, 조성물 및 구성성분
KR20230146127A (ko) * 2016-03-04 2023-10-18 에디타스 메디신, 인코포레이티드 암 면역요법을 위한 crispr-cpf1-관련 방법, 조성물 및 구성성분
CN109312340A (zh) * 2016-03-04 2019-02-05 爱迪塔斯医药公司 用于癌症免疫疗法的crispr-cpf1相关方法、组合物和组分
JP7251980B2 (ja) 2016-03-04 2023-04-04 エディタス・メディシン、インコーポレイテッド がん免疫療法のためのcrispr-cpf1関連方法、組成物および構成要素
KR102438360B1 (ko) * 2016-03-04 2022-08-31 에디타스 메디신, 인코포레이티드 암 면역요법을 위한 crispr-cpf1-관련 방법, 조성물 및 구성성분
US12325854B2 (en) 2016-03-04 2025-06-10 Editas Medicine, Inc. Crispr-CPF1-related methods, compositions and components for cancer immunotherapy
IL261163B2 (en) * 2016-03-04 2023-02-01 Editas Medicine Inc Crispr-cpf1-related methods, compositions and components for cancer immunotherapy
KR20180118204A (ko) * 2016-03-04 2018-10-30 에디타스 메디신, 인코포레이티드 암 면역요법을 위한 crispr-cpf1-관련 방법, 조성물 및 구성성분
KR102738283B1 (ko) * 2016-03-04 2024-12-09 에디타스 메디신, 인코포레이티드 암 면역요법을 위한 crispr-cpf1-관련 방법, 조성물 및 구성성분
IL291971B2 (en) * 2016-03-04 2025-04-01 Editas Medicine Inc CRISPR–CPF1 related methods, compositions and components for cancer immunotherapy
WO2017152015A1 (en) * 2016-03-04 2017-09-08 Editas Medicine, Inc. Crispr-cpf1-related methods, compositions and components for cancer immunotherapy
EP3219799A1 (en) 2016-03-17 2017-09-20 IMBA-Institut für Molekulare Biotechnologie GmbH Conditional crispr sgrna expression
WO2017158153A1 (en) 2016-03-17 2017-09-21 Imba - Institut Für Molekulare Biotechnologie Gmbh Conditional crispr sgrna expression
AU2017238054B2 (en) * 2016-03-21 2023-10-19 Dana-Farber Cancer Institute, Inc. T-cell exhaustion state-specific gene expression regulators and uses thereof
EP3433365A4 (en) * 2016-03-21 2019-11-13 Dana-Farber Cancer Institute, Inc. T cell depletion state specific gene expression regulators and uses thereof
US12428631B2 (en) 2016-04-13 2025-09-30 Duke University CRISPR/Cas9-based repressors for silencing gene targets in vivo and methods of use
JP2019515914A (ja) * 2016-04-22 2019-06-13 インテリア セラピューティクス,インコーポレイテッド 転写因子4内のトリヌクレオチドリピートと関連する疾患の治療のための組成物および方法
CN107304434A (zh) * 2016-04-25 2017-10-31 上海宇玫博生物科技有限公司 一种免疫细胞治疗的双功能新型载体
WO2017193107A3 (en) * 2016-05-06 2018-01-04 Juno Therapeutics, Inc. Genetically engineered cells and methods of making the same
JP2023061884A (ja) * 2016-05-06 2023-05-02 ジュノー セラピューティクス インコーポレイテッド 遺伝子操作された細胞および同細胞を作製する方法
CN109843915A (zh) * 2016-05-06 2019-06-04 朱诺治疗学股份有限公司 基因工程化细胞及其制备方法
WO2017193053A1 (en) * 2016-05-06 2017-11-09 Woolf Tod M Improved methods for genome editing with and without programmable nucleases
WO2017193107A2 (en) 2016-05-06 2017-11-09 Juno Therapeutics, Inc. Genetically engineered cells and methods of making the same
JP2019517788A (ja) * 2016-05-06 2019-06-27 ジュノー セラピューティクス インコーポレイテッド 遺伝子操作された細胞および同細胞を作製する方法
US11234420B2 (en) 2016-06-28 2022-02-01 Biocytogen Pharmaceuticals (Beijing) Co., Ltd. Method for constructing PD-1 gene modified humanized animal model and use thereof
US12214056B2 (en) 2016-07-19 2025-02-04 Duke University Therapeutic applications of CPF1-based genome editing
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11078481B1 (en) 2016-08-03 2021-08-03 KSQ Therapeutics, Inc. Methods for screening for cancer targets
US11912987B2 (en) 2016-08-03 2024-02-27 KSQ Therapeutics, Inc. Methods for screening for cancer targets
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11352647B2 (en) 2016-08-17 2022-06-07 The Broad Institute, Inc. Crispr enzymes and systems
IL264439B1 (en) * 2016-08-17 2024-04-01 Factor Bioscience Inc A suitable viral preparation containing a synthetic messenger RNA encoding a gene editing protein for use in cancer treatment and a synthetic messenger RNA encoding a gene editing protein for use in therapy
US11904023B2 (en) 2016-08-17 2024-02-20 Factor Bioscience Inc. Nucleic acid products and methods of administration thereof
IL264439B2 (en) * 2016-08-17 2024-08-01 Factor Bioscience Inc A suitable viral preparation containing a synthetic messenger RNA encoding a gene editing protein for use in cancer treatment and a synthetic messenger RNA encoding a gene editing protein for use in therapy
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11078483B1 (en) 2016-09-02 2021-08-03 KSQ Therapeutics, Inc. Methods for measuring and improving CRISPR reagent function
US11946163B2 (en) 2016-09-02 2024-04-02 KSQ Therapeutics, Inc. Methods for measuring and improving CRISPR reagent function
WO2018067618A1 (en) 2016-10-03 2018-04-12 Juno Therapeutics, Inc. Hpv-specific binding molecules
US11072660B2 (en) 2016-10-03 2021-07-27 Juno Therapeutics, Inc. HPV-specific binding molecules
EP4190335A1 (en) 2016-10-13 2023-06-07 Juno Therapeutics, Inc. Immunotherapy methods and compositions involving tryptophan metabolic pathway modulators
US11896615B2 (en) 2016-10-13 2024-02-13 Juno Therapeutics, Inc. Immunotherapy methods and compositions involving tryptophan metabolic pathway modulators
WO2018071873A2 (en) 2016-10-13 2018-04-19 Juno Therapeutics, Inc. Immunotherapy methods and compositions involving tryptophan metabolic pathway modulators
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
EP3532075A4 (en) * 2016-10-27 2020-07-08 Intima Bioscience, Inc. VIRAL METHODS OF MANUFACTURING GENETICALLY MODIFIED CELLS
EP3532079A4 (en) * 2016-10-27 2020-07-08 Intima Bioscience, Inc. VIRAL T-LYMPHOCYTE THERAPY METHODS
US11332713B2 (en) 2016-11-16 2022-05-17 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
WO2018097296A1 (ja) * 2016-11-28 2018-05-31 ナパジェン ファーマ,インコーポレテッド 化学修飾siRNA
US11203755B2 (en) 2016-11-28 2021-12-21 Napajen Pharma, Inc. Chemically-modified siRNA
JPWO2018097296A1 (ja) * 2016-11-28 2018-11-29 ナパジェン ファーマ, インコーポレテッドNapaJen Pharma, Inc. 化学修飾siRNA
WO2018106732A1 (en) 2016-12-05 2018-06-14 Juno Therapeutics, Inc. Production of engineered cells for adoptive cell therapy
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
WO2018126074A1 (en) * 2016-12-30 2018-07-05 Celularity, Inc. Genetically modified natural killer cells
US11466271B2 (en) 2017-02-06 2022-10-11 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11851659B2 (en) 2017-03-22 2023-12-26 Novartis Ag Compositions and methods for immunooncology
CN110832075A (zh) * 2017-03-22 2020-02-21 诺华股份有限公司 用于免疫肿瘤学的组合物和方法
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
WO2018191490A1 (en) * 2017-04-13 2018-10-18 The Trustees Of The University Of Pennsylvania Use of gene editing to generate universal tcr re-directed t cells for adoptive immunotherapy
US12227555B2 (en) 2017-04-13 2025-02-18 The Trustees Of The University Of Pennsylvania Use of gene editing to generate universal TCR re-directed t cells for adoptive immunotherapy
US10934336B2 (en) 2017-04-13 2021-03-02 The Trustees Of The University Of Pennsylvania Use of gene editing to generate universal TCR re-directed T cells for adoptive immunotherapy
US11135247B2 (en) 2017-05-12 2021-10-05 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US11207351B2 (en) 2017-05-12 2021-12-28 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US11013767B2 (en) 2017-05-12 2021-05-25 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US11071755B1 (en) 2017-05-12 2021-07-27 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US11202802B2 (en) 2017-05-12 2021-12-21 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US10729725B2 (en) 2017-05-12 2020-08-04 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US11191783B2 (en) 2017-05-12 2021-12-07 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US10736919B2 (en) 2017-05-12 2020-08-11 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US11471491B1 (en) 2017-05-12 2022-10-18 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US11622977B2 (en) 2017-05-12 2023-04-11 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US10881689B2 (en) 2017-05-12 2021-01-05 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US10857184B2 (en) 2017-05-12 2020-12-08 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US11166985B2 (en) 2017-05-12 2021-11-09 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US11298378B2 (en) 2017-05-12 2022-04-12 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
US10428319B2 (en) 2017-06-09 2019-10-01 Editas Medicine, Inc. Engineered Cas9 nucleases
US12297466B2 (en) 2017-06-09 2025-05-13 Editas Medicine, Inc. Engineered Cas9 nucleases
WO2018227114A1 (en) 2017-06-09 2018-12-13 Editas Medicine, Inc. Engineered cas9 nucleases
US11098297B2 (en) 2017-06-09 2021-08-24 Editas Medicine, Inc. Engineered Cas9 nucleases
EP3650545A4 (en) * 2017-06-20 2021-03-31 Jiangsu Hengrui Medicine Co., Ltd. METHOD OF TARGETING A TARGET CELL IN VITRO AND CRRNA USED IN THIS METHOD
US20200377883A1 (en) * 2017-06-27 2020-12-03 Agency For Science, Technology And Research Antisense oligonucleotides for modulating the function of a t cell
EP3645724A4 (en) * 2017-06-27 2021-07-21 Agency for Science, Technology and Research OLIGONUCLEOTIDES ANTISENS TO MODULATE THE FUNCTION OF A T LYMPHOCYTE
AU2018291556B2 (en) * 2017-06-27 2021-12-09 Agency For Science, Technology And Research Antisense oligonucleotides for modulating the function of a T cell
US12188016B2 (en) 2017-06-27 2025-01-07 Agency For Science, Technology And Research Antisense oligonucleotides for modulating the function of a T cell
WO2019003193A1 (en) * 2017-06-30 2019-01-03 Novartis Ag METHODS FOR TREATING DISEASES USING GENE EDITING SYSTEMS
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
WO2019060425A1 (en) 2017-09-19 2019-03-28 Massachusetts Institute Of Technology COMPOSITIONS FOR CHIMERIC ANTIGENIC RECEPTOR T CELL THERAPY AND USES THEREOF
US11952408B2 (en) 2017-10-03 2024-04-09 Juno Therapeutics, Inc. HPV-specific binding molecules
WO2019070541A1 (en) 2017-10-03 2019-04-11 Juno Therapeutics, Inc. HPV-SPECIFIC BINDING MOLECULES
EP4215543A2 (en) 2017-10-03 2023-07-26 Juno Therapeutics, Inc. Hpv-specific binding molecules
US11272695B2 (en) 2017-10-13 2022-03-15 Biocytogen Pharmaceuticals (Beijing) Co., Ltd. Genetically modified non-human animal with human or chimeric PD-1
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
WO2019089982A1 (en) 2017-11-01 2019-05-09 Juno Therapeutics, Inc. Method of assessing activity of recombinant antigen receptors
US20230137729A1 (en) * 2017-11-06 2023-05-04 Editas Medicine, Inc. Methods, compositions and components for crispr-cas9 editing of cblb in t cells for immunotherapy
WO2019090202A1 (en) 2017-11-06 2019-05-09 Editas Medicine, Inc. Methods, compositions and components for crispr-cas9 editing of cblb in t cells for immunotherapy
US20210187018A1 (en) * 2017-12-07 2021-06-24 Flagship Pioneering Innovations V, Inc. Cytobiologics and therapeutic uses thereof
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
WO2019178427A1 (en) 2018-03-14 2019-09-19 Arbor Biotechnologies, Inc. Novel crispr dna targeting enzymes and systems
EP4257696A2 (en) 2018-03-14 2023-10-11 Arbor Biotechnologies, Inc. Novel crispr dna targeting enzymes and systems
US11459544B2 (en) 2018-03-15 2022-10-04 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
US11608500B2 (en) 2018-03-15 2023-03-21 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
US12123021B2 (en) 2018-03-15 2024-10-22 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
US12084682B2 (en) 2018-03-15 2024-09-10 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
US11261428B2 (en) 2018-03-15 2022-03-01 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
US11421228B2 (en) 2018-03-15 2022-08-23 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
US12280111B2 (en) 2018-03-15 2025-04-22 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
WO2019195492A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. Methods of producing cells expressing a recombinant receptor and related compositions
US11471489B2 (en) 2018-04-05 2022-10-18 Juno Therapeutics, Inc. T cell receptors and engineered cells expressing same
WO2019195486A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. T cell receptors and engineered cells expressing same
WO2019195491A1 (en) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. T cells expressing a recombinant receptor, related polynucleotides and methods
CN112384621A (zh) * 2018-04-13 2021-02-19 西格马-奥尔德里奇有限责任公司 使用成对的crispr切口酶核糖核蛋白修饰免疫相关基因组基因座
WO2019200306A1 (en) * 2018-04-13 2019-10-17 Sigma-Aldrich Co. Llc Modification of immune-related genomic loci using paired crispr nickase ribonucleoproteins
US12378576B2 (en) 2018-04-27 2025-08-05 Spacecraft Seven, Llc Gene therapy for CNS degeneration
US11254912B2 (en) 2018-05-11 2022-02-22 Crispr Therapeutics Ag Methods and compositions for treating cancer
US11649438B2 (en) 2018-05-11 2023-05-16 Crispr Therapeutics Ag Methods and compositions for treating cancer
WO2019215500A1 (en) * 2018-05-11 2019-11-14 Crispr Therapeutics Ag Methods and compositions for treating cancer
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12378578B2 (en) 2018-07-09 2025-08-05 Flagship Pioneering Innovations V, Inc. Fusosome compositions and uses thereof
US12421507B2 (en) 2018-08-20 2025-09-23 The Broad Institute, Inc. Methods and compositions for optochemical control of CRISPR-CAS9
WO2020051283A1 (en) 2018-09-05 2020-03-12 The Regents Of The University Of California Generation of heritably gene-edited plants without tissue culture
WO2020068261A1 (en) 2018-09-28 2020-04-02 Massachusetts Institute Of Technology Collagen-localized immunomodulatory molecules and methods thereof
WO2020081613A1 (en) * 2018-10-16 2020-04-23 Intellia Therapeutics, Inc. Compositions and methods for immunotherapy
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12496274B2 (en) 2018-11-14 2025-12-16 Flagship Pioneering Innovations V, Inc. Compositions and methods for compartment-specific cargo delivery
WO2020131862A1 (en) 2018-12-17 2020-06-25 The Broad Institute, Inc. Crispr-associated transposase systems and methods of use thereof
US12264323B2 (en) 2018-12-17 2025-04-01 The Broad Institute, Inc. CRISPR CPF1 direct repeat variants
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
EP3917541A4 (en) * 2019-01-28 2022-12-07 Bar Ilan University Combinations, nanoparticles and methods for controlling natural killer cell activation and function
WO2020168300A1 (en) 2019-02-15 2020-08-20 Editas Medicine, Inc. Modified natural killer (nk) cells for immunotherapy
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
WO2020210724A1 (en) 2019-04-10 2020-10-15 University Of Utah Research Foundation Htra1 modulation for treatment of amd
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US11389481B2 (en) 2019-04-30 2022-07-19 Crispr Therapeutics Ag Allogeneic cell therapy of B cell malignancies using genetically engineered T cells targeting CD19
WO2020223571A1 (en) 2019-05-01 2020-11-05 Juno Therapeutics, Inc. Cells expressing a chimeric receptor from a modified cd247 locus, related polynucleotides and methods
WO2020223535A1 (en) 2019-05-01 2020-11-05 Juno Therapeutics, Inc. Cells expressing a recombinant receptor from a modified tgfbr2 locus, related polynucleotides and methods
US12435120B2 (en) 2019-05-01 2025-10-07 Juno Therapeutics, Inc. Cells expressing a chimeric receptor from a modified CD247 locus, related polynucleotides and methods
WO2020236967A1 (en) 2019-05-20 2020-11-26 The Broad Institute, Inc. Random crispr-cas deletion mutant
WO2020263399A1 (en) 2019-06-26 2020-12-30 Massachusetts Institute Of Technology Immunomodulatory fusion protein-metal hydroxide complexes and methods thereof
US12344850B2 (en) 2019-07-30 2025-07-01 Pairwise Plants Services, Inc. Morphogenic regulators and methods of using the same
WO2021041922A1 (en) 2019-08-30 2021-03-04 The Broad Institute, Inc. Crispr-associated mu transposase systems
WO2021061648A1 (en) 2019-09-23 2021-04-01 Massachusetts Institute Of Technology Methods and compositions for stimulation of endogenous t cell responses
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
EP4438729A3 (en) * 2019-12-09 2025-03-26 Caribou Biosciences, Inc. Crispr abasic restricted nucleotides and crispr accuracy via analogs
US20210254005A1 (en) * 2020-01-23 2021-08-19 Kangstem Biotech Co., Ltd. Off-the-shelf stem cell and immune cell, and a pharmaceutical composition including the same
WO2021183207A1 (en) 2020-03-10 2021-09-16 Massachusetts Institute Of Technology COMPOSITIONS AND METHODS FOR IMMUNOTHERAPY OF NPM1c-POSITIVE CANCER
WO2021216622A1 (en) 2020-04-21 2021-10-28 Aspen Neuroscience, Inc. Gene editing of gba1 in stem cells and method of use of cells differentiated therefrom
WO2021216623A1 (en) 2020-04-21 2021-10-28 Aspen Neuroscience, Inc. Gene editing of lrrk2 in stem cells and method of use of cells differentiated therefrom
WO2021221782A1 (en) 2020-05-01 2021-11-04 Massachusetts Institute Of Technology Chimeric antigen receptor-targeting ligands and uses thereof
WO2021221783A1 (en) 2020-05-01 2021-11-04 Massachusetts Institute Of Technology Methods for identifying chimeric antigen receptor-targeting ligands and uses thereof
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
EP4467642A3 (en) * 2020-05-08 2025-04-16 Metagenomi, Inc. Enzymes with ruvc domains
WO2021231661A2 (en) 2020-05-13 2021-11-18 Juno Therapeutics, Inc. Process for producing donor-batched cells expressing a recombinant receptor
WO2021260186A1 (en) 2020-06-26 2021-12-30 Juno Therapeutics Gmbh Engineered t cells conditionally expressing a recombinant receptor, related polynucleotides and methods
WO2022098787A1 (en) 2020-11-04 2022-05-12 Juno Therapeutics, Inc. Cells expressing a chimeric receptor from a modified invariant cd3 immunoglobulin superfamily chain locus and related polynucleotides and methods
EP4259159A4 (en) * 2020-12-14 2025-04-09 Emendobio Inc. Biallelic knockout of trac
GB2617799A (en) * 2021-02-01 2023-10-18 Epsilen Bio S R L Gene silencing
WO2022162247A1 (en) * 2021-02-01 2022-08-04 Epsilen Bio S.R.L. Gene silencing
WO2022187406A1 (en) 2021-03-03 2022-09-09 Juno Therapeutics, Inc. Combination of a t cell therapy and a dgk inhibitor
WO2022204071A1 (en) 2021-03-22 2022-09-29 Juno Therapeutics, Inc. Method to assess potency of viral vector particles
WO2022232839A1 (en) 2021-04-30 2022-11-03 The Board Of Trustees Of The Leland Stanford Junior University Methods for improved production of primary cd34+ cells
WO2022266139A2 (en) 2021-06-14 2022-12-22 Graphite Bio, Inc. Methods to genetically engineer hematopoietic stem and progenitor cells for red cell specific expression of therapeutic proteins
WO2022272292A2 (en) 2021-06-23 2022-12-29 Editas Medicine, Inc. Engineered cells for therapy
WO2023278811A1 (en) 2021-07-01 2023-01-05 Indapta Therapeutics, Inc. Engineered natural killer (nk) cells and related methods
WO2023010135A1 (en) 2021-07-30 2023-02-02 Tune Therapeutics, Inc. Compositions and methods for modulating expression of methyl-cpg binding protein 2 (mecp2)
WO2023010133A2 (en) 2021-07-30 2023-02-02 Tune Therapeutics, Inc. Compositions and methods for modulating expression of frataxin (fxn)
US12435323B2 (en) 2021-08-27 2025-10-07 Metagenomi, Inc. Enzymes with RUVC domains
WO2023077149A1 (en) 2021-11-01 2023-05-04 Sigma-Aldrich Co. Llc Electroporation enhancers for crispr-cas systems
WO2023081715A1 (en) 2021-11-03 2023-05-11 Viracta Therapeutics, Inc. Combination of car t-cell therapy with btk inhibitors and methods of use thereof
WO2023081900A1 (en) 2021-11-08 2023-05-11 Juno Therapeutics, Inc. Engineered t cells expressing a recombinant t cell receptor (tcr) and related systems and methods
WO2023115041A1 (en) 2021-12-17 2023-06-22 Sana Biotechnology, Inc. Modified paramyxoviridae attachment glycoproteins
WO2023115039A2 (en) 2021-12-17 2023-06-22 Sana Biotechnology, Inc. Modified paramyxoviridae fusion glycoproteins
WO2023133595A2 (en) 2022-01-10 2023-07-13 Sana Biotechnology, Inc. Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses
WO2023137472A2 (en) 2022-01-14 2023-07-20 Tune Therapeutics, Inc. Compositions, systems, and methods for programming t cell phenotypes through targeted gene repression
WO2023137471A1 (en) 2022-01-14 2023-07-20 Tune Therapeutics, Inc. Compositions, systems, and methods for programming t cell phenotypes through targeted gene activation
WO2023150518A1 (en) 2022-02-01 2023-08-10 Sana Biotechnology, Inc. Cd3-targeted lentiviral vectors and uses thereof
WO2023150647A1 (en) 2022-02-02 2023-08-10 Sana Biotechnology, Inc. Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses
WO2023201133A1 (en) 2022-04-14 2023-10-19 Board Of Regents Of The University Of Nebraska Cell therapy for alzheimer's disease
WO2023224715A1 (en) 2022-05-19 2023-11-23 Massachusetts Institute Of Technology Car cells targeting an inserted ligand
US12098399B2 (en) 2022-06-24 2024-09-24 Tune Therapeutics, Inc. Compositions, systems, and methods for epigenetic regulation of proprotein convertase subtilisin/kexin type 9 (PCSK9) gene expression
WO2023250511A2 (en) 2022-06-24 2023-12-28 Tune Therapeutics, Inc. Compositions, systems, and methods for reducing low-density lipoprotein through targeted gene repression
WO2024007020A1 (en) 2022-06-30 2024-01-04 Indapta Therapeutics, Inc. Combination of engineered natural killer (nk) cells and antibody therapy and related methods
WO2024015881A2 (en) 2022-07-12 2024-01-18 Tune Therapeutics, Inc. Compositions, systems, and methods for targeted transcriptional activation
US12221608B2 (en) 2022-08-19 2025-02-11 Tune Therapeutics, Inc. Compositions, systems, and methods for regulation of hepatitis b virus through targeted gene repression
US12398394B2 (en) 2022-08-19 2025-08-26 Tune Therapeutics, Inc. Compositions, systems, and methods for regulation of Hepatitis B virus through targeted gene repression
US12252692B2 (en) 2022-08-19 2025-03-18 Tune Therapeutics, Inc. Compositions, systems, and methods for regulation of hepatitis B virus through targeted gene repression
WO2024040254A2 (en) 2022-08-19 2024-02-22 Tune Therapeutics, Inc. Compositions, systems, and methods for regulation of hepatitis b virus through targeted gene repression
US12325858B1 (en) 2022-08-19 2025-06-10 Tune Therapeutics, Inc. Compositions, systems, and methods for regulation of Hepatitis B virus through targeted gene repression
US12325857B2 (en) 2022-08-19 2025-06-10 Tune Therapeutics, Inc. Compositions, systems, and methods for regulation of Hepatitis b virus through targeted gene repression
WO2024044655A1 (en) 2022-08-24 2024-02-29 Sana Biotechnology, Inc. Delivery of heterologous proteins
WO2024054944A1 (en) 2022-09-08 2024-03-14 Juno Therapeutics, Inc. Combination of a t cell therapy and continuous or intermittent dgk inhibitor dosing
WO2024064642A2 (en) 2022-09-19 2024-03-28 Tune Therapeutics, Inc. Compositions, systems, and methods for modulating t cell function
WO2024064642A3 (en) * 2022-09-19 2024-05-02 Tune Therapeutics, Inc. Compositions, systems, and methods for modulating t cell function
WO2024064838A1 (en) 2022-09-21 2024-03-28 Sana Biotechnology, Inc. Lipid particles comprising variant paramyxovirus attachment glycoproteins and uses thereof
WO2024081820A1 (en) 2022-10-13 2024-04-18 Sana Biotechnology, Inc. Viral particles targeting hematopoietic stem cells
WO2024100604A1 (en) 2022-11-09 2024-05-16 Juno Therapeutics Gmbh Methods for manufacturing engineered immune cells
WO2024119157A1 (en) 2022-12-02 2024-06-06 Sana Biotechnology, Inc. Lipid particles with cofusogens and methods of producing and using the same
WO2024163683A2 (en) 2023-02-01 2024-08-08 Tune Therapeutics, Inc. Systems, compositions, and methods for modulating expression of methyl-cpg binding protein 2 (mecp2) and x-inactive specific transcript (xist)
WO2024163678A2 (en) 2023-02-01 2024-08-08 Tune Therapeutics, Inc. Fusion proteins and systems for targeted activation of frataxin (fxn) and related methods
WO2024161021A1 (en) 2023-02-03 2024-08-08 Juno Therapeutics Gmbh Methods for non-viral manufacturing of engineered immune cells
WO2024220574A1 (en) 2023-04-18 2024-10-24 Sana Biotechnology, Inc. Universal protein g fusogens and adapter systems thereof and related lipid particles and uses
WO2024220598A2 (en) 2023-04-18 2024-10-24 Sana Biotechnology, Inc. Lentiviral vectors with two or more genomes
WO2024220560A1 (en) 2023-04-18 2024-10-24 Sana Biotechnology, Inc. Engineered protein g fusogens and related lipid particles and methods thereof
WO2024243340A1 (en) 2023-05-23 2024-11-28 Sana Biotechnology, Inc. Tandem fusogens and related lipid particles
WO2024249342A1 (en) 2023-05-26 2024-12-05 Editas Medicine, Inc. Crispr-related methods and compositions targeting ptpn2 expression
WO2024249348A2 (en) 2023-05-26 2024-12-05 Editas Medicine, Inc. Crispr-related methods and compositions targeting fl1-1 expression
WO2024249346A1 (en) 2023-05-26 2024-12-05 Editas Medicine, Inc. Crispr-related methods and compositions targeting cd70 expression
CN116539885A (zh) * 2023-07-06 2023-08-04 上海秤信生物科技有限公司 用于乳腺癌早期检测的肿瘤自身抗原/抗体组合及应用
CN116539885B (zh) * 2023-07-06 2023-09-29 上海秤信生物科技有限公司 用于乳腺癌早期检测的肿瘤自身抗原/抗体组合及应用
WO2025029835A1 (en) 2023-07-31 2025-02-06 Tune Therapeutics, Inc. Compositions and methods for modulating il-2 gene expression
WO2025029840A1 (en) 2023-07-31 2025-02-06 Tune Therapeutics, Inc. Compositions and methods for multiplexed activation and repression of t cell gene expression
WO2025038494A1 (en) 2023-08-11 2025-02-20 Tune Therapeutics, Inc. Compositions, systems, and methods for lymphoid cell differentiation using targeted gene activation
WO2025054202A1 (en) 2023-09-05 2025-03-13 Sana Biotechnology, Inc. Method of screening a sample comprising a transgene with a unique barcode
WO2025059073A1 (en) 2023-09-11 2025-03-20 Tune Therapeutics, Inc. Epigenetic editing methods and systems for differentiating stem cells
WO2025059533A1 (en) 2023-09-13 2025-03-20 The Broad Institute, Inc. Crispr enzymes and systems
WO2025096638A2 (en) 2023-10-30 2025-05-08 Turnstone Biologics Corp. Genetically modified tumor infilitrating lymphocytes and methods of producing and using the same
WO2025117544A1 (en) 2023-11-29 2025-06-05 The Broad Institute, Inc. Engineered omega guide molecule and iscb compositions, systems, and methods of use thereof
WO2025137646A1 (en) 2023-12-22 2025-06-26 Recode Therapeutics, Inc. Gene editing methods and compositions for treating cystic fibrosis
WO2025151838A1 (en) 2024-01-12 2025-07-17 Sana Biotechnology, Inc. Safety switches to control in vitro and in vivo proliferation of cell therapy products
WO2025184529A1 (en) 2024-03-01 2025-09-04 Sana Biotechnology, Inc. Viral particles with fusogen display and related compositions and methods
WO2025212519A1 (en) 2024-04-01 2025-10-09 Moonlight Bio, Inc. Dll3 binding proteins and uses thereof
WO2025213127A1 (en) 2024-04-05 2025-10-09 Indapta Therapeutics, Inc. Treatment of autoimmune diseases or conditions with natural killer cells
WO2025235851A1 (en) 2024-05-10 2025-11-13 Juno Therapeutics, Inc. Genetically engineered t cells expressing a cd19 chimeric antigen receptor (car) and uses thereof for allogeneic cell therapy
WO2025245399A1 (en) 2024-05-23 2025-11-27 Indapta Therapeutics, Inc. Method of treating cancer with natural killer cells
WO2025260068A1 (en) 2024-06-14 2025-12-18 Tune Therapeutics, Inc. Lipid nanoparticle formulation for delivery of nucleic acids to cells

Also Published As

Publication number Publication date
IL292512B2 (en) 2024-07-01
JP7681753B2 (ja) 2025-05-22
KR20230152175A (ko) 2023-11-02
SG11201608701QA (en) 2016-11-29
US20220106600A1 (en) 2022-04-07
IL286103A (en) 2021-10-31
JP2022081522A (ja) 2022-05-31
CA2945335A1 (en) 2015-10-22
SG10201912171PA (en) 2020-02-27
EP3800248A2 (en) 2021-04-07
IL292512A (en) 2022-06-01
EP3132030B1 (en) 2020-08-26
IL248284A0 (en) 2016-11-30
CN108138183A (zh) 2018-06-08
KR102595473B1 (ko) 2023-10-30
JP2024073596A (ja) 2024-05-29
IL286103B (en) 2022-06-01
AU2015247323B2 (en) 2021-07-01
KR20170009865A (ko) 2017-01-25
JP2017513485A (ja) 2017-06-01
EP3132030A2 (en) 2017-02-22
IL279230B (en) 2021-09-30
IL279230A (en) 2021-01-31
AU2015247323A1 (en) 2016-11-10
IL292512B1 (en) 2024-03-01
KR102827558B1 (ko) 2025-07-11
AU2021236446B2 (en) 2024-08-08
US20170175128A1 (en) 2017-06-22
SG10201809157VA (en) 2018-11-29
JP2020062029A (ja) 2020-04-23
JP2025128109A (ja) 2025-09-02
JP7525531B2 (ja) 2024-07-30
WO2015161276A3 (en) 2015-12-10
AU2024259841A1 (en) 2025-01-02
KR20250102123A (ko) 2025-07-04
EP3800248A3 (en) 2021-08-04

Similar Documents

Publication Publication Date Title
JP7681753B2 (ja) がん免疫療法のためのcrispr-cas関連方法、組成物および構成要素
US20230002760A1 (en) Crispr/cas-related methods, compositions and components
US20250320491A1 (en) Crispr-cpf1-related methods, compositions and components for cancer immunotherapy
US20230026726A1 (en) Crispr/cas-related methods and compositions for treating sickle cell disease
US20170007679A1 (en) Crispr/cas-related methods and compositions for treating hiv infection and aids
US20160281111A1 (en) Crispr/cas-mediated gene conversion
AU2016261358A1 (en) Optimized CRISPR/Cas9 systems and methods for gene editing in stem cells
HK40050007A (en) Crispr-cas-related methods, compositions and components for cancer immunotherapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15721400

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2945335

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 248284

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 15303722

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2016562958

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2015247323

Country of ref document: AU

Date of ref document: 20150417

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2015721400

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2015721400

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20167032071

Country of ref document: KR

Kind code of ref document: A

WWD Wipo information: divisional of initial pct application

Ref document number: 1020257021203

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 1020257021203

Country of ref document: KR