Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
  • A61K38/46—Hydrolases (3)
  • A61K38/47—Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
  • A61K35/66—Microorganisms or materials therefrom
  • A61K35/76—Viruses; Subviral particles; Bacteriophages
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
  • A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/0012—Galenical forms characterised by the site of application
  • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
  • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
  • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
  • C12Y302/01076—L-Iduronidase (3.2.1.76)

Definitions

• the mucopolysaccharidoses are a group of inherited disorders caused by a lack of specific lysosomal enzymes involved in the degradation of glycosaminoglycans (GAG), also called mucopolysaccharides.
• GAG glycosaminoglycans
• the accumulation of partially-degraded GAG causes interference with cell, tissue, and organ function. Over time, the GAG accumulates within cells, blood, and connective tissue, resulting in increasing cellular and organ damage.
• the most serious of the mucopolysaccharidosis (MPS) disorders, MPS I is caused by a deficiency of the enzyme a-L-iduronidase (IDUA). This leads to three clinical syndromes which in order of severity are Hurler, Hurler-Scheie and Scheie syndromes. Each is inherited in an autosomal recessive manner with the extent of enzyme deficiency being directly related to the severity of the clinical phenotype.
• the IDUA gene has been reported to provide instructions for producing an enzyme called alpha-L-iduronidase, which is essential for the breakdown of large sugar molecules called glycosaminoglycans (GAGs).
• alpha-L-iduronidase is reported to remove sulfate from a molecule known as sulfated alpha-L-iduronic acid, which is present in two GAGs called heparan sulfate and dermatan sulfate.
• Alpha-L-iduronidase is located in lysosomes, compartments within cells that digest and recycle different types of molecules.
• HSCT hematopoietic stem cell transplantation
• BMT bone marrow transplantation
• UBT umbilical cord blood transplantations
• Organomegaly is significantly improved although aspects of the disease in the skeletal system, eye and heart are only partially improved. Patients may require surgery to stabilize the hip and knee and to treat carpal tunnel syndrome and finger contractions. Cardiac disease is treated medically although surgery may eventually be required.
• ERT for MPS I provides exogenous enzyme for uptake into lysosomes and increased catabolism of GAG. Although the lysosomal enzymes function internally, cell-surface mannose-6-phosphate receptors are capable of binding, internalizing, and delivering these enzymes to the lysosomes.
• Recombinant IDUA (Aldurazyme®, BioMarin) is approved by FDA for patients with Hurler and Hurler-Scheie forms of MPS I and for patients with the Scheie form who have moderate to severe symptoms and was shown to improve pulmonary function and walking capacity.
• ERT has also been observed to reduce hepatomegaly in MPS I patients, as well as the levels of urinary GAG. However, because intravenous enzyme does not easily cross into the brain, ERT does not currently address the neurological symptoms experienced by some MPS I
• ERT Complications of ERT revolve around immune response to the recombinant enzyme which can range from mild to full-blown anaphylaxis as well as complications of life-long peripheral access such as local and systemic infections. Up to 91% of patients receiving Aldurazyme develop antibodies to the enzyme, although it is not clear how much it affects efficacy. Furthermore, ERT requires weekly intravenous (i.v.) infusions, administered over a period of 3-8 hours in a hospital setting, which significantly impacts patient quality of life and, at a high expense, is a major strain on health care reimbursement systems.
• i.v. intravenous
• the invention provides an expression cassette comprising a human alpha-L-iduronidase (hIDUA) gene having the nucleotide sequence of SEQ ID NO: 1 or a sequence at least about 95% identical to SEQ ID NO: 1 which encodes a functional human alpha-L-iduronidase in human cells, wherein said expression cassette further comprises regulatory control sequences which direct expression of the human alpha-L-iduronidase in human cells, said regulatory control sequences comprising a liver-specific promoter.
• the invention provides a vector containing the expression cassette.
• the expression cassette is located on a cis plasmid.
• the expression cassette is located on pENN.TBG.hIDUA.nRBG.
• the invention provides a recombinant adeno-associated virus (rAAV) particle having an AAV capsid and having packaged therein a left inverted terminal repeat (IT ), a human alpha-L-iduronidase (hIDUA) gene under the control of regulatory sequences which control expression thereof, and an AAV right ITR, wherein said hIDUA gene has a sequence shown in SEQ ID NO: 1 (FIG 1) or a sequence at least about 95% identical thereto which encodes a functional human alpha-L-iduronidase.
• the functional hIDUA gene is expressed under the control of a liver-specific promoter.
• a promoter may be a thyroxin binding globulin (TBG) promoter.
• the invention provides the recombinant adeno-associated viral particle AAV2/8.TBG.hIDUA.co.
• the invention provides a composition useful for treating mucopolysaccharidosis type I (MPS I) comprising the rAAV comprising the expression cassette described herein and a pharmaceutically acceptable carrier.
• MPS I mucopolysaccharidosis type I
• the invention provides a method for treating type I mucopolysaccharidosis comprising delivering an effective amount of a composition comprising a pharmaceutically acceptable carrier and a rAAV as described herein.
• the invention provides a method for treating or ameliorating the symptoms of Hurler, Hurler-Scheie and/or Scheie syndromes.
• FIGs.lA-lD provides the sequence of the pENN.AAV.TBG.PI.hIDUA.RGB plasmid [SEQ ID NO:3] described herein, which includes the nucleic acid sequence of the functional human IDUA gene.
• the gene of the functional IDUA located at position 1251-3213 of FIG 1 and its encoded enzyme sequence are also provided in SEQ ID NO: 1 and 2.
• the sequence is further annotated to identify the sequences of the alpha mic/bik enhancers, the intron 1, the rabbit globulin poly A, the ITRs, the origin of replication.
• FIG. 2 provides the circular map of pENN.AAV.TBG.PI.hIDUA.RGB. DETAILED DESCRIPTION OF THE INVENTION
• compositions described herein provide an expression cassette carrying a human IDUA gene which expresses a therapeutically effective amount of functional human alpha-L- iduronidase enzyme in a human subject.
• a “therapeutically effective amount” refers to the amount of the composition which delivers and expresses in the target cells an amount of enzyme sufficient to ameliorate or treat the symptoms of Hurler, Hurler-Scheie and/or Scheie syndromes, and or MPS I. "Treatment” may include preventing the worsening of the symptoms of one of the syndromes (or MPS I) and possibly reversal of one or more of the symptoms thereof.
• a “functional human alpha-L-iduronidase” refers to a human alpha-L- iduronidase enzyme which functions normally in humans without MPS1 or an associated syndrome such as Hurler, Hurler-Scheie and/or Scheie syndromes. Conversely, a human alpha-L-iduronidase enzyme variant which causes MPS1 or one of these syndromes is considered non-functional.
• a functional human alpha- 1-iduronidase has the amino acid sequence of a wild-type human alpha-L-iduronidase described by Bremer et al, Mol. Genet. Metab.
• a functional human alpha-L-iduronidase may include a synthetic amino acid sequence in which all or a portion of the first 26 amino acids of SEQ ID NO:2, which correspond to the leader (signal) peptide, are replaced with a heterologous leader peptide.
• This leader peptide which is responsible for transporting the enzyme out of the cell through its secretory pathway into the circulation, may be substituted with another suitable leader peptide, e.g., such as the leader peptides from interleukin-2 (IL-2) or oncostatin.
• IL-2 interleukin-2
• Suitable leader peptides are preferably, although not necessarily of human original.
• Suitable leader peptides may be chosen from http://proline.bic.nus.edu.sg/spdb/zhang270.htm , which is incorporated by reference herein, or may be determined using a variety of computational programs for determining the leader (signal) peptide in a selected protein. Although not limited, such sequences may be from about 15 to about 50 amino acids in length, or about 20 to about 28 amino acids in length, or may be larger or smaller as required. In addition, at least one in vitro assay has been described as being useful to assess the enzymatic activity of an IDUA enzyme [see, e.g., Kakkis et al, Mol Genet Metabol, 2001 Mar; 72(3): 199-208].
• composition and method described herein do not require long term, repeated weekly injections of a therapeutic dose.
• the method described herein is believed to be useful for correcting the central nervous system phenotype in addition to somatic symptoms associated with MPSI disorders.
• the expression cassette is composed of, at a minimum, a gene and its regulatory sequences. Where the cassette is designed to be expressed from a recombinant adeno- associated virus, the expression cassette further contains 5 ' and 3 ' AAV inverted terminal repeats (ITRs). These ITR's may be full-length, or one or both of the ITRs may be truncated. For example, a truncated 5' ITR containing a deletion of the D sequence and a terminal resolution site (trs) deletion may be used, e.g., for a self-complementary AAV.
• ITRs inverted terminal repeats
• the rAAV is pseudotyed, i.e., the AAV capsid is from a different source AAV than that the AAV which provides the IT s.
• the ITRs of AAV serotype 2 are used. However, ITRs from other suitable sources may be selected.
• patients suffering from one of the conditions described herein are delivered an expression cassette which carries a functional human alpha-L-iduronidase (hlDUA) gene under control of regulatory sequences which direct expression of a functional human alpha-L-iduronidase enzyme in the cells.
• hlDUA human alpha-L-iduronidase
• the expression cassette contains a hlDUA gene characterized by having the nucleotide sequence of SEQ ID NO: 1. This sequence, developed by the inventors, has an identity of about 83% with the published gene sequence of Genbank NP000194.2 encoding SEQ ID NO: 2.
• the expression cassette contains a hlDUA gene characterized by having the nucleotide sequence at least about 80% identical to SEQ ID NO: 1 and encodes a functional human alpha-L-iduronidase.
• the sequence is at least about 85% identity to SEQ ID NO: 1 or at least about 90% identical to SEQ ID NO:l and encodes a functional human alpha-L-iduronidase.
• the sequence is at least about 95% identical to SEQ ID NO:l, at least about 97% identical to SEQ ID NO:l, or at least about 99% identical to SEQ ID NO: 1 and encodes a functional human alpha-L-iduronidase. In one embodiment, this encompasses full-length hlDUA gene, including the leader peptide sequences of the human alpha-L-iduronidase ⁇ i.e., encoding about amino acid 26, or about amino acid 27, to about amino acid 653 of SEQ ID NO:2), corresponding to about 1 to about 78 of SEQ ID NO:l .
• the hlDUA gene encodes a functional synthetic human alpha-L-iduronidase enzyme which is synthetic peptide comprising a heterologous leader sequence fused to the secreted portion of a functional alpha-L-iduronidase enzyme, i.e., about amino acids 27 to about 653 of SEQ ID NO: 2 or one of the functional variants thereof which are identified herein.
• Identity or similarity with respect to a sequence is defined herein as the percentage of amino acid residues in the candidate sequence that are identical ⁇ i.e., same residue) or similar ⁇ i.e., amino acid residue from the same group based on common side-chain properties, see below) with the peptide and polypeptide regions provided herein, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity.
• Percent (%) identity is a measure of the relationship between two polynucleotides or two polypeptides, as determined by comparing their nucleotide or amino acid sequences, respectively. In general, the two sequences to be compared are aligned to give a maximum correlation between the sequences.
• the alignment of the two sequences is examined and the number of positions giving an exact amino acid or nucleotide correspondence between the two sequences determined, divided by the total length of the alignment and multiplied by 100 to give a % identity figure.
• This % identity figure may be determined over the whole length of the sequences to be compared, which is particularly suitable for sequences of the same or very similar length and which are highly homologous, or over shorter defined lengths, which is more suitable for sequences of unequal length or which have a lower level of homology.
• algorithms, and computer programs based thereon which are available to be used the literature and/or publically or commercially available for performing alignments and percent identity. The selection of the algorithm or program is not a limitation of the present invention.
• suitable alignment programs including, e.g., the software CLUSTALW under Unix and then be imported into the Bioedit program (Hall, T. A. 1999, BioEdit: a user- friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41 :95-98); the Wisconsin Sequence Analysis Package, version 9.1 (Devereux J. et al., Nucleic Acids Res., 12:387-395, 1984, available from Genetics
• the programs BESTFIT and GAP may be used to determine the % identity between two polynucleotides and the % identity between two polypeptide sequences.
• the expression cassette is designed for human liver-directed expression.
• a liver-specific promoter is particularly well suited for the expression cassette.
• thyroxin binding globulin promoter is selected.
• the TBG promoter has the sequence of nucleotides 442 to 901 of FIG. 1.
• liver-specific promoter may be selected.
• tissue-specific are well known for liver and other tissues (albumin, Miyatake et al, (1997) J. Virol, 71:5124-32; hepatitis B virus core promoter, Sandig et al, (1996) Gene Ther., 3:1002-9; alpha- fetoprotein (AFP), Arbuthnot et al, (1996) Hum. Gene Ther.,
• bone osteocalcin (Stein et al, (1997) Mol. Biol. Rep., 24:185-96); bone sialoprotein (Chen et al, (1996) J. Bone Miner. Res., 11:654-64), lymphocytes (CD2, Hansal et al, (1998) J. Immunol, 161: 1063-8; immunoglobulin heavy chain; T cell receptor chain), neuronal such as neuron-specific enolase (NSE) promoter (Andersen et al, (1993) Cell. Mol. Neurobiol, 13:503-15), neurofilament light-chain gene (Piccioli et al, (1991) Proc. Natl. Acad. Sci.
• NSE neuron-specific enolase
• vgf gene (Piccioli et al, (1995) Neuron, 15:373-84), among others.
• Other promoters may be selected, but expression cassettes containing same may not have all of the advantages of those with TBG or another liver-specific promoter.
• a regulatable promoter may be selected. See, e.g., WO 2011/126808B2, incorporated by reference herein.
• the expression cassette comprises one or more expression enhancers.
• the expression cassette contains two or more expression enhancers. These enhancers may be the same or may from one another different.
• an enhancer may include an Alpha mic/bik enhancer. This enhancer may be present in two copies which are located adjacent to one another. Alternatively, the dual copies of the enhancer may be separated by one or more sequences.
• the expression cassette further contains an intron, e.g, the Promega intron. Other suitable introns include those known in the art, e.g., such as are described in WO 2011/126808.
• an expression cassette of the invention is provided with a suitable polyadenylation signal.
• the polyA sequence is a rabbit globulin poly A.
• the polyA sequence is characterized by that of nt 3261-3387 of FIG. 1.
• another polyA e.g., a human growth hormone (hGH) polyadenylation sequence, an SV40 polyA, or a synthetic polyA.
• hGH human growth hormone
• Still other conventional regulatory elements may be additional or optionally included in an expression cassette.
• the expression cassette is engineered onto a suitable vector, e.g., a plasmid vector using techniques known to those of skill in the art.
• a composition of the invention may contain a first expression cassette comprising the modified human IDUA gene and a second expression cassette comprising a different gene.
• the functional human IDUA may be expressed from a more than one expression cassette, which may be located on a multiple vectors, e.g., as described in WO 2011/126808.
• the expression cassette is carried by the expression cassette
• pENN.TBG.hIDUA.nRBG which plasmid is used to generate a recombinant adeno- associated virus carrying the expression cassette.
• the invention provides a recombinant adeno-associated virus (rAAV) particle having an AAV capsid and having packaged therein a 5' inverted terminal repeat (ITR), a human alpha-L-iduronidase (hlDUA) gene under the control of regulatory sequences which control expression thereof, and an AAV 3 ' ITR, wherein said hlDUA gene has a sequence shown in SEQ ID NO: 1 (FIG 1) or a sequence at least about 95% identical thereto which encodes a functional human alpha-L-iduronidase.
• ITR 5' inverted terminal repeat
• hlDUA gene human alpha-L-iduronidase
• FIG 1 AAV2/8.TBG.hIDUA.co.
• AAV-based vectors Methods of preparing AAV-based vectors are known. See, e.g., US Published Patent Application No. 2007/0036760 (February 15, 2007), which is incorporated by reference herein.
• the use of AAV capsids of AAV8 are particularly well suited for the compositions and methods described herein.
• the sequences of AAV8 and methods of generating vectors based on the AAV8 capsid are described in US Patent 7,282,199 B2, US 7,790,449, and US 8,318,480, which are incorporated herein by reference.
• AAV9 capsids are also well suited for use in the invention.
• AAV9 and methods of generating vectors based on the AAV9 capsid are described in US Patent 7,906,111, which is incorporated by reference herein. However, other AAV capsids may be selected or generated for use in the invention.
• the sequences of a number of such AAV are provided in the above-cited US Patent 7,282,199 B2, US 7,790,449, US 8,318,480, and US Patent 7,906, 11 1 , and/or are available from GenBank.
• GenBank GenBank
• the sequences of any of the AAV capsids can be readily generated synthetically or using a variety of molecular biology and genetic engineering techniques. Suitable production techniques are well known to those of skill in the art. See, e.g.,
• oligonucleotides encoding peptides e.g., CDRs
• the peptides themselves can generated synthetically, e.g., by the well-known solid phase peptide synthesis methods (Merrifield, (1962) J. Am. Chem. Soc, 85:2149; Stewart and Young, Solid Phase Peptide Synthesis (Freeman, San Francisco, 1969) pp. 27-62).
• the recombinant adeno-associated virus (AAV) described herein may be generated using techniques which are known. Such a method involves culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid; a functional rep gene; a expression cassette composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a transgene; and sufficient helper functions to permit packaging of the expression cassette into the AAV capsid protein.
• ITRs AAV inverted terminal repeats
• the components required to be cultured in the host cell to package an AAV expression cassette in an AAV capsid may be provided to the host cell in trans.
• any one or more of the required components may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art.
• a stable host cell will contain the required component(s) under the control of an inducible promoter.
• the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion of regulatory elements suitable for use with the transgene.
• a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters.
• a stable host cell may be generated which is derived from 293 cells (which contain El helper functions under the control of a constitutive promoter), but which contains the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art.
• the expression cassette, rep sequences, cap sequences, and helper functions required for producing the rAAV of the invention may be delivered to the packaging host cell in the form of any genetic element which transfer the sequences carried thereon.
• the selected genetic element may be delivered by any suitable method, including those described herein.
• the methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g. , Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.
• methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g. , K. Fisher et al, (1993) J. Virol, 70:520-532 and US Patent No. 5,478,745.
• the AAV IT s, and other selected AAV components described herein may be readily selected from among any AAV.
• These ITRs or other AAV components may be readily isolated using techniques available to those of skill in the art from an AAV sequence.
• Such AAV may be isolated or obtained from academic, commercial, or public sources ⁇ e.g. , the American Type Culture Collection, Manassas, VA).
• the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank®, PubMed®, or the like.
• the expression cassette is as defined herein.
• the expression cassette and/or a vector as described herein may contain additional transgene regulatory sequences.
• the expression cassette that is packaged into a capsid protein and delivered to a selected host cell.
• the transgene may include the use of multiple transgenes. Suitable transgenes may be readily selected by one of skill in the art. The selection of the transgene is not considered to be a limitation of this invention.
• the vector also includes conventional control elements which are operably linked to the transgene in a manner which permits its transcription, translation and/or expression in a cell transfected with the plasmid vector or infected with the virus produced by the invention.
• "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
• Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency ⁇ i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
• RNA processing signals such as splicing and polyadenylation (polyA) signals
• sequences that stabilize cytoplasmic mRNA sequences that enhance translation efficiency ⁇ i.e., Kozak consensus sequence
• sequences that enhance protein stability e.g., telomereon sequences that enhance protein.
• a great number of expression control sequences including promoters which are native, constitutive, inducible and/or tissue-specific, are known in the art and may be utilized.
• constitutive promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, (1985) Cell, 41:521-530], the SV40 promoter, the dihydrofolate reductase promoter, the ⁇ -actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF 1 promoter
• RSV Rous sarcoma virus
• CMV cytomegalovirus
• PGK phosphoglycerol kinase
• Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only.
• Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art.
• inducible promoters regulated by exogenously supplied compounds include, the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system [International Patent Publication No. WO 98/10088]; the ecdysone insect promoter [No et al, (1996) Proc. Natl. Acad. Sci. USA, 93:3346-3351], the tetracycline-repressible system [Gossen et al, (1992) Proc. Natl. Acad. Sci.
• transgene includes a gene operably linked to a tissue-specific promoter.
• a promoter active in muscle should be used. These include the promoters from genes encoding skeletal ⁇ -actin, myosin light chain 2A, dystrophin, desmin, MHC, muscle creatine kinase, as well as synthetic muscle promoters with activities higher than naturally-occurring promoters (see Li et al, (1999) Nat. Biotech., 17:241-245).
• promoters that are tissue-specific are known for CNS/neuronal include, e.g., neuron-specific enolase (NSE) promoter (Andersen et al., (1993) Cell. Mol. Neurobiol, 13:503-15), neurofilament light-chain gene (Piccioli et al, (1991) Proc. Natl. Acad. Sci. USA, 88:5611-5), and the neuron-specific vgf gene (Piccioli et al, (1995) Neuron, 15:373-84), among others.
• NSE neuron-specific enolase
• the native promoter for the transgene will be used. The native promoter may be preferred when it is desired that expression of the transgene should mimic the native expression.
• the native promoter may be used when expression of the transgene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to specific transcriptional stimuli.
• other native expression control elements such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression.
• the expression cassette can be carried on any suitable vector, e.g., a plasmid, which is delivered to a host cell.
• plasmids useful in this invention may be engineered such that they are suitable for replication and, optionally, integration in prokaryotic cells, mammalian cells, or both.
• These plasmids (or other vectors carrying the expression cassette) contain sequences permitting replication of the expression cassette in eukaryotes and/or prokaryotes and selection markers for these systems.
• Selectable markers or reporter genes may include sequences encoding kanamycin, geneticin, hygromicin or purimycin resistance, among others.
• the plasmids may also contain certain selectable reporters or marker genes that can be used to signal the presence of the vector in bacterial cells, such as ampicillin resistance.
• Other components of the plasmid may include an origin of replication and an amplicon, such as the amplicon system employing the Epstein Barr virus nuclear antigen. This amplicon system, or other similar amplicon components permit high copy episomal replication in the cells.
• the molecule carrying the expression cassette is transfected into the cell, where it may exist transiently.
• the expression cassette may be stably integrated into the genome of the host cell, either chromosomally or as an episome.
• the expression cassette may be present in multiple copies, optionally in head-to-head, head-to-tail, or tail-to-tail concatamers. Suitable transfection techniques are known and may readily be utilized to deliver the expression cassette to the host cell.
• the vector when delivering the vector comprising the expression cassette by transfection, the vector is delivered in an amount from about 5 ⁇ g to about 100 ⁇ g DNA, about 10 ⁇ g to about 50 ⁇ g DNA to about 1 x 10 4 cells to about 1 x 10 13 cells, or about 1 x 10 5 cells.
• the relative amounts of vector DNA to host cells may be adjusted, taking into consideration such factors as the selected vector, the delivery method and the host cells selected.
• the host cell contains the sequences which drive expression of an AAV capsid protein of the invention in the host cell and rep sequences of the same source as the source of the AAV ITRs found in the expression cassette, or a cross-complementing source.
• the packaging host cell also requires helper functions in order to package the rAAV of the invention. Such helper functions are well known in the art and will not be duplicated herein.
• methods for producing suitable vectors having AAV capsids are known. [See, e.g., US Published Patent Application No. US 2007/0036760].
• the construct of a rAAV encoding an expression cassette described herein same can be suspended in a physiologically compatible carrier, may be administered to a subject.
• the carrier is sterile saline alone or, optionally, with any of a number of buffering solutions (e.g., phosphate buffered saline).
• buffering solutions e.g., phosphate buffered saline.
• Other exemplary carriers include lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, sesame oil, and water.
• the selection of the carrier is not a limitation of the present invention.
• compositions of the invention may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers.
• delivery is via intravenous delivery.
• routes of administration may be selected.
• routes of administration may be combined, if desired.
• the invention includes a lyophilized composition which contains an rAAV as described herein, or a mixture of rAAV, in lyophilized form.
• a lyophilized composition is reconstituted with a suitable diluent, e.g., sterile saline or a buffered saline.
• a suitable diluent e.g., sterile saline or a buffered saline.
• a therapeutically effective dosage of the viral vector is generally in the range of from about 0.1 mL to about 100 mL, or about 0.1 mL to about 10 mL, or about 0.1 mL to about 5 mL, or about 0.5 mL to about 1 mL, of solution containing concentrations of from about 3 x 10 9 to 3 x 10 13 genomes viral vector (particles)/mL aqueous suspending agent.
• Another exemplary dosage is about 3 x 10 9 to 3 x 10 13 AAV genomes per 1 kg.
• One suitable volume is about 1 mL.
• a therapeutically effective dose of the rAAV construct is in the range of about 0.001 ng to about 1000 mg/70 kg animal, which may be delivered in a single dosage or over a series of two or more doses. Other suitable dosages may be determined. The dosage will be adjusted to balance the therapeutic benefit against any side effects and such dosages may vary depending upon the therapeutic application for which the recombinant vector is employed.
• compositions of the present invention avoid complications of enzyme replacement therapy related to immune response to the recombinant enzyme which can range from mild to full-blown anaphylaxis as well as complications of life-long peripheral access such as local and systemic infections. Further, in contrast to E T, the composition of the invention does not require long term, repeated weekly injections.
• the liver-directed therapeutic method described herein is believed to be useful for correcting the central nervous system phenotype associated with MPSI disorders by providing efficient, long-term gene transfer afforded by vectors with high transduction efficiency could provide continuous, elevated circulating IDUA levels, which provides therapeutic leverage across the blood brain barrier.
• AAV liver gene transfer may provide active tolerance and prevent antibody formation against the enzyme.
• a method for treating type I mucopolysaccharidosis comprising delivering a therapeutically effective amount of a modified hIDUA expression cassette as described herein is provided. Also provided is a method for treating and/or ameliorating the symptoms of Hurler, Hurler-Scheie and Scheie syndromes.
• the rAAV is delivered intravenously.
• the rAAV is delivered in an amount of about 3 x 10 9 to about 3 x 10 12 is delivered to the subject. While a single administration of the rAAV is anticipated to be effective, since the liver is a regenerative organ, administration by be repeated (e.g., quarterly, bi-annually, annually, or as otherwise needed.
• an initial dose of a therapeutically effective amount may be delivered over split infusion sessions, taking into consideration the age and ability of the subject to tolerate infusions. However, repeated weekly injections of a full therapeutic dose are not required, providing an advantage to the patient in terms of both comfort and therapeutic outcome.
• the following examples are illustrative only and are not a limitation on the invention described herein.
• a modified nucleotide sequence encoding a functional human alpha-L-iduronidase was synthesized.
• the resulting sequence is particularly well suited for human expression and has less than about 90% identical to the functional human IDUA gene (hIDUA;
• Genbank NP000194.2 The resultant transgene was then inserted into a plasmid containing cis elements necessary for packaging into an AAV vector available from UPenn Vector Core using engineered MM and Sail sites. Gene expression was driven by the human thyroid binding globulin (TBG, Hayashi Y, Mori Y, Janssen OE, et al. Human thyroxine-binding globulin gene: complete sequence and transcriptional regulation. Mol Endocrinol 1993; 7: 1049-1060].
• TBG human thyroid binding globulin
• pENN.AAV.TBG.PI.hIDUA.RGB contains the modified hIDUA gene under the control of expression control sequences including the liver-specific TBG promoter.
• the plasmid further contains the AAV2 5' ITR, tandem repeats of the alpha mic/bic enhancers, the TBG promoter, a Promega intron sequence, the modified human IDUA gene of SEQ ID NO: 1, a rabbit globulin poly A, and an AAV2 - 3' ITR.
• AAV2/8.TBG.hIDUA In certain locations, the recombinant AAV particles are referred to as AAV8.TBG.hIDUAco or AAV2/8.TBG.hIDUAco.
• the plasmid further contains the AAV2 5' ITR, tandem repeats of the alpha mic/bic enhancers, the TBG promoter, a Promega intron sequence, the modified human IDUA gene of SEQ ID NO: 1, a rabbit globulin poly A, and an AAV2 - 3' ITR.
• HEK 293 cells were maintained in growth medium containing Dulbecco's Modified Eagle Medium (DMEM; Gibco®, Life TechnologiesTM ) with 5% fetal bovine serum (FBS; XXX), 1% penicillin/streptomycin (p/s; Life TechnologiesTM ). Plasmid DNA transfections were carried out using LipofectamineTM 2000 (InvitrogenTM, Life
• Plasmid DNA and LipofectamineTM 2000 were diluted with Opti-MEM I ® Reduced Serum Medium (without serum) for a final ratio of 1 :2.5 (DNA: LipofectamineTM 2000).
• LipofectamineTM 2000 transfection solution was incubated for five minutes at 22°C before mixing with the DNA solution. This final transfection mixture containing the DNA:
• LipofectamineTM 2000 solution was incubated further for 20 minutes (22°C) before addition to the wells containing cells and media.
• Mock cells received no plasmid DNA and a plasmid encoding for eGFP was used as a transfection control.
• Three wells were transfected for each construct tested. Cells were incubated at 37° in 5%C0 2 ; media was replaced with growth media four hours later. Contents of each well were harvested 72 hours later and collected at 4000rpm for 15 minutes at 4°C. Cells were resuspended in ⁇ lysis buffer (0.2% Triton X-100, 0.9% NaCl, pH4.0) and freeze/thawed three times with vortexing.
• lysates were treated with Benzonase for 30 minutes at 37°C before the final freeze/thaw.
• Cell debris was pelleted at 10 OOOrpm (4°C) for 10 minutes and final clarified cell lysates were placed on ice and immediately assayed for enzyme activity.
• Frozen tissues were semi-thawed in a box on a bed of dry ice and small pieces of wet tissue were cut ( ⁇ 20mgs, ⁇ 10 mgs of spleen) up in a small petri dish.
• the pre- processed tissues were then submerged in a 2-ml eppendorph with 1ml lysis buffer (0.2% Triton X-100, 0.9% NaCl, pH4.0) and a 5mm steel bead. Samples were homogenized on a tissue-lyzer at 30Hz for 2 minutes. Homogenized samples were briefly spun at 6000 rpm for 30 seconds and the 5mm steel beads were removed.
• Tissue lysates were further disrupted by sonication using a 1-1/16" diameter microhorn and frozen overnight at -80°C. Processed samples were thawed the next day at 22°C and clarified by centrifugation (10 OOOrpm/10 minutes/4°C). Floating lipid layers from brain, or other fatty tissues, were aspirated before assay. Samples were then stored on wet ice and assayed immediately for enzyme activity.
• Total protein was estimated using the Coomassie based Bradford assay (Thermo Scientific) following the manufacturer's protocol. Briefly, a standard curve was set up using bovine serum albumin (BSA) to generate a working range from l-25 ⁇ g/ml and a blank accounting for the protein dilution buffer with no BSA. Samples were diluted twofold from 1/300 -1/1200 and mixed at a 1 :1 ratio of diluted protein: Bradford reagent in a 96-well flat-bottom dish. Samples were allowed to equilibrate at 22°C for 15 minutes and absorbance values were collected on a plate reader at the suggested wavelength of 595nm. Raw values were converted to ⁇ g/ml concentrations using the standard curve with blank correction. Microgram quantities were then converted and reported in milligrams.
• BSA bovine serum albumin
• IDUA enzyme activity was assayed using 4-Methylumbelliferyl alpha-L- Idopyranosiduronic Acid, Cyclohexylammonium Salt (4-MU-Ido; Toronto Research Chemicals, Inc.) as a substrate according to previously published methods [Kakkis et al, Mol Genet Metab, 2001 Mar; 72(3): 199-208].
• reaction buffer 0.1M sodium acetate pH3.5, 0.15M NaCl, 0.05% Triton X-100
• reaction buffer 0.1M sodium acetate pH3.5, 0.15M NaCl, 0.05% Triton X-100
• Taqman PC was used to determine the vector DNA load in diploid cells.
• total cellular DNA was extracted from tissues using a QIAamp DNA Mini Kit (Qiagen, Valencia, CA, USA).
• Primer and probe sets were designed to target the nRBG polyA region of the vector, using the following sequences; forward: GCCAAAAATTATGGGGACAT, reverse:
• ATGAAGCCCCTTGAGCATCTGACTTCT-TAMRA Standard curves for vector genome quantification were established with the cis plasmids used for the production of the corresponding vector.
• the PCR was performed with a TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA) with 200 ng total cellular DNA as template, 300 nM primers, and 200 nM probes each. Cycles were for 2 min at 50°C, 10 min at 95°C, 40 cycles of 15 s at 95°C, and 1 min at 60°C.
• Immunoblotting was performed according to standard methods. In brief, the NuPAGE gel system (Life Technologies), 4-12% bis-tris gels was used. Transfer was following 30 minutes at 20V to a PVDF membrane. The block was 10% NFDM in T-PBS (overnight). The primary MAb was mouse anti-human IDUA 1 :300 (1.5 hours); 1% NFDM in T-PBS. Secondary: HRP-linked rabbit anti-mouse 1 :3000 (lhr); 1% NFDM in T-PBS Detection was by SuperSignal West Dura Chemiluminescent Substrate (Thermo Scientific), 30 second exposure on x-ray film.
• IDUA deficiencies can be found in dogs, allowing for study of the disease and therapies in a large animal.
• MPS I dogs carry a recessive (null) mutation in the IDUA gene, in which a G>A mutation in the donor splice site of intron 1 creates a premature termination codon at the exon-intron junction [Menon, K.P., P.T. Tieu, and E.F. Neufeld, Architecture of the canine IDUA gene and mutation underlying canine mucopolysaccharidosis I. Genomics, 1992. 14(3): p. 763-8.].
• the course of disease in the dog is analogous to Hurler-Scheie syndrome; disease manifestations include significant skeletal disease, including chest deformity.
• Urine GAG analysis is a biochemical marker used to determine efficacy of treatments for MPS I in the clinical setting.
• GAGs glycosaminoglycans
• Hl Alcian Blue
• the accumulation of unprocessed GAG within cells are particularly well visualized on 1 ⁇ thin sections from plastic-embedded tissues stained with Toluidine Blue. Thin sections (1 ⁇ ) of epon-embedded tissues, stained with Toluidine Blue. This shows cells containing storage material ("foamy, sponge cells").
• Immunohistochemistry was performed with antibody against ganglioside GM3 in brain. Shows abnormal storage of GM3 in neurons.
• the cortex was evaluated in dogs and cortex and hypothalamus in mice. Expression of human IDUA in liver was evaluated by immunofluorescence.
• AAV8.TBG.modified hIDUA was prepared as described in Example 1. Mice (about 3 months) were injected intravenously at doses of about 1 xlO 11 GC, 3 x 10 10 GC, 3 x 10 9 GC, 1 xlO 9 GC and evaluated ⁇ 2 weeks post injection.
• AAV8.TBG.modified hIDUA was prepared as described in Example 1. Dogs (about 8 months age) were injected intravenously at a dose of 1 xlO 11 GC and evaluated after four months post injection (i.e. 1 year old). This study shows reversal of storage lesions. More particularly, virtually complete clearance of GAG storage in all major organs is seen by Alcian Blue stain. No storage lesions are observed in heart, kidney or liver thin sections. A reduction or complete clearance of GM3 accumulation is observed in neurons. Expression of IDUA in liver is observed by immunofluorescence in >95% of hepatocytes.
• AAV8-mediated gene transfer of IDUA will be evaluated in Hurler-Scheie patients.
• the subjects would receive a single infusion of vector into a peripheral vein which based on pre-clinical data should lead to stable production of the enzyme at levels that are close to what is obtained in normal subjects.
• the trial may involve different doses of vector for example, 3xl0 u GC/kg; lxlO 12 GC/kg; 3xl0 12 GC/kg and please add dose range.
• the most non-invasive assessment of efficacy is the level of urine GAG which are elevated in the disease and partially corrected following E T. Transgene engraftment and its level of expression will be determined by measuring serum IDUA. Urine GAG will also be measured before and after gene therapy.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Genetics & Genomics (AREA)
• General Health & Medical Sciences (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Organic Chemistry (AREA)
• Medicinal Chemistry (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Veterinary Medicine (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Pharmacology & Pharmacy (AREA)
• Biomedical Technology (AREA)
• Biotechnology (AREA)
• Biochemistry (AREA)
• Epidemiology (AREA)
• General Engineering & Computer Science (AREA)
• Microbiology (AREA)
• Molecular Biology (AREA)
• Virology (AREA)
• Immunology (AREA)
• Mycology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Gastroenterology & Hepatology (AREA)
• Dermatology (AREA)
• Biophysics (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Enzymes And Modification Thereof (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Saccharide Compounds (AREA)

Priority Applications (24)

Applications Claiming Priority (2)

Related Child Applications (2)

Publications (1)

Family

ID=51580934

Family Applications (1)

Country Status (21)

Cited By (26)

Families Citing this family (15)

Citations (3)

Family Cites Families (40)

• 2014
  • 2014-03-13 EP EP20170476.4A patent/EP3747998B1/en active Active
  • 2014-03-13 AU AU2014235096A patent/AU2014235096B2/en active Active
  • 2014-03-13 SI SI201431605T patent/SI2984166T1/sl unknown
  • 2014-03-13 ES ES14770186T patent/ES2805355T3/es active Active
  • 2014-03-13 BR BR112015021036A patent/BR112015021036A2/pt not_active Application Discontinuation
  • 2014-03-13 US US14/769,596 patent/US10137176B2/en active Active
  • 2014-03-13 KR KR1020157022504A patent/KR102346455B1/ko active Active
  • 2014-03-13 DK DK14770186.6T patent/DK2984166T3/da active
  • 2014-03-13 ES ES20170476T patent/ES2991471T3/es active Active
  • 2014-03-13 WO PCT/US2014/025509 patent/WO2014151341A1/en not_active Ceased
  • 2014-03-13 CN CN201480010987.3A patent/CN105026554B/zh active Active
  • 2014-03-13 RU RU2015144234A patent/RU2708318C2/ru active
  • 2014-03-13 PL PL14770186T patent/PL2984166T3/pl unknown
  • 2014-03-13 HU HUE14770186A patent/HUE051373T2/hu unknown
  • 2014-03-13 JP JP2016501864A patent/JP6591956B2/ja active Active
  • 2014-03-13 HR HRP20201063TT patent/HRP20201063T1/hr unknown
  • 2014-03-13 SG SG10201707319UA patent/SG10201707319UA/en unknown
  • 2014-03-13 EP EP14770186.6A patent/EP2984166B1/en active Active
  • 2014-03-13 CA CA2901328A patent/CA2901328C/en active Active
  • 2014-03-13 KR KR1020217043023A patent/KR102581652B1/ko active Active
  • 2014-03-13 PT PT147701866T patent/PT2984166T/pt unknown
  • 2014-03-13 LT LTEP14770186.6T patent/LT2984166T/lt unknown
  • 2014-03-13 MX MX2015012739A patent/MX386059B/es unknown
  • 2014-03-13 SG SG11201507507PA patent/SG11201507507PA/en unknown
• 2015
  • 2015-09-14 MX MX2021010918A patent/MX2021010918A/es unknown
• 2018
  • 2018-10-22 US US16/166,346 patent/US10792343B2/en active Active
• 2019
  • 2019-04-19 JP JP2019079881A patent/JP2019134717A/ja active Pending
• 2020
  • 2020-06-10 AU AU2020203826A patent/AU2020203826B2/en active Active
  • 2020-07-07 CY CY20201100628T patent/CY1123169T1/el unknown
  • 2020-09-03 JP JP2020148103A patent/JP7168621B2/ja active Active
  • 2020-09-10 US US17/017,150 patent/US20200397872A1/en not_active Abandoned
• 2022
  • 2022-10-27 JP JP2022172314A patent/JP7553527B2/ja active Active

Patent Citations (3)

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events