WO2022146124A1 - 조직 특이적 발현을 위한 융합 프로모터 및 이의 용도 - Google Patents

조직 특이적 발현을 위한 융합 프로모터 및 이의 용도 Download PDF

Info

Publication number
WO2022146124A1
WO2022146124A1 PCT/KR2022/000048 KR2022000048W WO2022146124A1 WO 2022146124 A1 WO2022146124 A1 WO 2022146124A1 KR 2022000048 W KR2022000048 W KR 2022000048W WO 2022146124 A1 WO2022146124 A1 WO 2022146124A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
liver
present
seq
fusion promoter
Prior art date
Application number
PCT/KR2022/000048
Other languages
English (en)
French (fr)
Inventor
하기태
배성진
박혜린
Original Assignee
부산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 부산대학교 산학협력단 filed Critical 부산대학교 산학협력단
Publication of WO2022146124A1 publication Critical patent/WO2022146124A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Definitions

  • the present invention relates to fusion promoters and their use for enhancing tissue-specific, in particular liver and liver cell-specific expression.
  • Gene therapy offers an opportunity to correct mutated genes in vivo.
  • an expression vector and a gene delivery technology for transporting the structural gene into the cell and expressing it are required.
  • the expression vector is a vector capable of expressing the DNA fragment inserted into the vector, and generally includes an expression control sequence such as a promoter sequence capable of expressing a gene in a host.
  • the type of host cell, expression time, expression level, etc. are the main basis for selecting an expression vector, and various expression vectors are being developed to satisfy these points depending on the purpose.
  • CMV cytomegalovirus promoter
  • EF1 ⁇ mammalian elongation factor 1 ⁇
  • tissue-specific promoters are very important in vector design for gene therapy strategies.
  • the liver plays an important role in metabolic processes and is an important organ in various metabolic diseases, so it could be an attractive target organ for gene therapy.
  • the thyroxine-binding globulin (TBG) promoter has been developed and applied in recent years to regulate the expression of various therapeutic genes specifically in liver cells. However, according to the results of previous studies, it was confirmed that the expression of exogenous genes driven by the TBG promoter works specifically in liver cells, but has lower transcriptional activity than the ubiquitous promoters CMV and EF1 ⁇ .
  • a promoter system that is specific to hepatocytes and has higher transcriptional activity is required.
  • the present inventors developed a fusion promoter that has excellently improved the disadvantages of the existing thyroxine-binding globulin (TBG) promoter while researching a promoter that is specific to liver cells and has higher gene transcription activity and protein expression efficiency Thus, the present invention was completed.
  • TBG thyroxine-binding globulin
  • Another object of the present invention is to provide a recombinant vector.
  • Another object of the present invention is to provide a composition for inducing liver cell-specific target gene expression.
  • Another object of the present invention is to provide a transformed host cell.
  • Another object of the present invention is to provide a method for expressing a target protein in a host cell.
  • Another object of the present invention is to provide a method for producing a target protein.
  • the present invention provides a cytomegalovirus (CMV) enhancer represented by SEQ ID NO: 1 or a partial sequence thereof; and a thyroxine-binding globulin (TBG) promoter represented by SEQ ID NO: 2 or a partial sequence thereof; provides an operably linked fusion promoter.
  • CMV cytomegalovirus
  • TSG thyroxine-binding globulin
  • the present invention provides a recombinant vector comprising a fusion promoter according to the present invention.
  • the present invention provides a composition for inducing liver cell-specific target gene expression, including the fusion promoter according to the present invention.
  • the present invention provides a host cell transformed with the recombinant vector according to the present invention.
  • the present invention provides a method for expressing a target protein in a host cell by transforming the recombinant vector according to the present invention into a host cell.
  • the present invention comprises the steps of culturing a host cell according to the present invention; and obtaining the expressed target protein from the cultured host cell or host cell culture medium; provides a method for producing a target protein comprising a.
  • the fusion promoter in which the TBG promoter and CMV enhancer are combined according to the present invention is specifically expressed in liver cells, and it was confirmed that gene transcription efficiency and protein expression were significantly increased compared to when the conventional TBG promoter alone acted. Since the fusion promoter is a promoter that has improved the disadvantages of the existing TBG promoter, it can be usefully used for liver disease gene therapy.
  • FIG. 1 is a diagram illustrating a recombinant vector to which a GFP gene is bound for evaluation of a fusion promoter and a comparison group (CMV enhancer+CMV promoter or TBG promoter alone) according to the present invention.
  • FIG. 2 is a view confirming the liver cell-specific expression of the fusion promoter according to the present invention.
  • FIG. 3 is a result of confirming the expression of GFP protein and mRNA transcription efficiency in liver-derived normal cells of the fusion promoter according to the present invention.
  • the fluorescence expression level was confirmed.
  • the fusion protein, CMV enhancer or TBG promoter according to the present invention was applied to the liver-derived cell line (Hapa1-6). It is the result of confirming the degree of fluorescence expression after transfection.
  • FIG. 4 is a diagram illustrating the intensity of GFP protein expression in liver-derived normal cells of the fusion promoter according to the present invention using a fluorescence activated cell sorter (FACS).
  • FACS fluorescence activated cell sorter
  • A is a schematic diagram showing a recombinant vector including a fusion promoter combining the CMV enhancer with another promoter known to exhibit tissue-specific expression other than the TBG promoter
  • B in FIG. 5 is a fusion promoter according to the present invention or CMV enhancer and TBG Fluorescence expression was confirmed after transfection of fibroblasts with a fusion promoter combined with another promoter known to exhibit tissue-specific expression other than the promoter. This is the result of confirming the expression of genes after transfection into fibroblasts with a fusion promoter combined with another promoter known to show exogenous tissue-specific expression.
  • the present invention relates to the whole or a partial sequence of a cytomegalovirus (CMV) enhancer represented by SEQ ID NO: 1; and a thyroxine-binding globulin (TBG) promoter represented by SEQ ID NO: 2 or a partial sequence thereof; provides an operably linked fusion promoter.
  • CMV cytomegalovirus
  • TSG thyroxine-binding globulin
  • the “promoter” is a gene region located upstream of a coding region including a point for initiating transcription in general, and is a TATA box, a CAAT box region, which often regulates gene expression, to external stimuli. It consists of an enhancer that promotes the expression of almost all genes regardless of the region and the location and direction that affect gene expression in response.
  • the "enhancer” is a sequence that binds to other proteins of the transcription initiation complex and promotes transcription initiation proceeding by its associated promoter.
  • the present invention is a fusion promoter produced by combining the CMV enhancer and the TBG promoter. It has excellently improved the disadvantages of the TBG promoter, which is known to have lower transcriptional activity than the ubiquitous promoters CMV and EF1 ⁇ , although it works specifically for liver cells. There is this.
  • the fusion promoter in which the CMV enhancer and the TBG promoter according to the present invention are combined showed excellent gene transcription efficiency and protein expression only in liver-derived normal cells or cancer cells, which is higher than the efficiency of the TBG promoter alone. Excellent.
  • the CMV enhancer when the CMV enhancer is combined with a promoter having a tissue-specific expression characteristic other than TBG, it was confirmed that the existing tissue-specific expression characteristic is lost. It was confirmed that the binding of CMV enhancer and TBG promoter was a significant binding capable of maintaining the existing tissue-specific expression characteristics.
  • the fusion promoter according to the present invention is characterized in that it is a promoter capable of specifically expressing a gene in liver or liver-derived cells without inducing expression of the gene in other tissues.
  • the liver-derived cells may include normal cells and cancer cells.
  • the CMV enhancer represented by SEQ ID NO: 1 or the TBG promoter represented by SEQ ID NO: 2 are each 70% or more, more preferably 80% or more, even more preferably 90% or more, most Preferably, it may include a nucleotide sequence having 95% or more sequence homology.
  • the "% of sequence homology" for a nucleotide sequence is determined by comparing two optimally aligned sequences with a comparison region, and a portion of the nucleotide sequence in the comparison region is determined as a reference sequence (addition or deletion is performed) for the optimal alignment of the two sequences. may include additions or deletions (ie, gaps) compared to not including).
  • CMV Cytomegalovirus
  • TSG thyroxine-binding globulin
  • the fusion promoter according to the present invention is characterized in that it is represented by SEQ ID NO: 4, and as a modified sequence in which some bases of the nucleotide sequence of SEQ ID NO: 4 as well as the nucleotide sequence of SEQ ID NO: 4 are substituted, deleted or added, liver or liver It contains a nucleotide sequence that specifically exhibits promoter activity in the derived cell.
  • nucleotide sequence variant of SEQ ID NO: 4 may be included within the scope of the present invention.
  • each of the nucleotide sequences of SEQ ID NO: 4 and 70% or more, more preferably 80% or more, even more preferably 90% or more, most preferably 95% or more may include a nucleotide sequence having sequence homology.
  • the "% of sequence homology" for a nucleotide sequence is determined by comparing two optimally aligned sequences with a comparison region, and a portion of the nucleotide sequence in the comparison region is determined as a reference sequence (addition or deletion is performed) for the optimal alignment of the two sequences. may include additions or deletions (ie, gaps) compared to not including).
  • operably linked refers to a nucleic acid expression control sequence in which a nucleic acid expression control sequence and a nucleic acid sequence encoding a target protein are functionally linked to perform a general function.
  • a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the coding sequence.
  • the operative linkage with the recombinant vector can be prepared using a genetic recombination technique well known in the art, and site-specific DNA cleavage and ligation are performed using enzymes generally known in the art.
  • the present invention also provides a recombinant vector comprising the fusion promoter according to the present invention.
  • the "vector” refers to a gene load containing a nucleotide sequence of a gene operably linked to a suitable regulatory sequence so as to express a target gene in a suitable host, wherein the regulatory sequence initiates transcription. It may include a promoter capable of activating such transcription, any operator sequence to regulate such transcription, and sequences to control the termination of transcription and translation.
  • the recombinant vector according to the present invention inserts a fusion promoter in which the CMV enhancer of the present invention and the TBG promoter are combined using an existing vector used for protein expression as a basic backbone, and encodes the target protein toward the downstream side of the promoter. It can be prepared by inserting a target gene, which is a nucleotide sequence. In addition, it may be a form in which a transcription termination sequence is introduced.
  • the vector of the present invention is not particularly limited as long as it can replicate within an individual or cell, and any vector known in the art may be used. It may be any one or more selected. More preferably, it may be a viral vector, adeno-associated virus (AAV), retrovirus (Retrovirus), adenovirus (Adenovirus), herpes simplex virus (Herpes simplex virus) and lentivirus (Lentivirus) It may be any one or more selected from the group consisting of, but is not limited thereto.
  • pAAV vector is used.
  • pAAV eTBG:GFP containing the fusion promoter (eTBG) of the present invention was prepared.
  • downstream refers to a nucleotide sequence located on the 3' side of the reference nucleotide sequence.
  • the downstream nucleotide sequence is generally related to the sequence following the initiation point of transcription.
  • the translation initiation codon of a gene is located downstream of the initiation site of transcription.
  • the "gene of interest” may be defined as a nucleic acid sequence of a certain length encoding a desired product.
  • the desired product is itself a biologically active protein.
  • the gene of interest will generally be present in the vector in the sense direction, but may also be present in the antisense direction to inactivate a specific gene. If the target gene is a gene encoding a biologically active protein, the gene will usually include a coding sequence, and a 5' untranslated leader sequence (5'UTR), 3' untranslated sequence (3'UTR) and an intron ( Intron) may be included.
  • 5'UTR 5' untranslated leader sequence
  • 3'UTR 3' untranslated sequence
  • Intron intron
  • the gene of interest may be a sequence encoding a truncated protein, a fused protein, or a tagged protein, cDNA or genomic DNA, a sequence encoding a natural product, or a desired mutant form It may be a sequence encoding the product.
  • a target gene may be any as long as the target product is directly or indirectly useful to humans.
  • the gene of interest may originate from any one, for example, from a plant, bacterium, animal, virus, or the like.
  • the "expression of the target gene” may mean producing a protein encoded by the target gene by expressing the target gene.
  • the method of expressing the target gene in the present invention may be a method of expressing a protein encoded by the target gene by culturing a transformant (host cell) transformed with a vector containing the target gene, through which the protein It is possible to prepare the end product of the biosynthetic pathway involved.
  • the recombinant vector of the present invention may further include a regulatory nucleic acid sequence operably linked to the target gene.
  • a regulatory nucleic acid sequence refers to any nucleic acid sequence present upstream or downstream of a transcription initiation site capable of affecting the transcription/translation of a gene operably linked thereto.
  • the recombinant vector of the present invention preferably contains one or more selection marker genes to enable or facilitate the selection of a transformed host organism, or to qualitatively and quantitatively analyze the expression of a target gene to be expressed. It may include one or more reporter genes. As the selection marker gene or reporter gene, those known in the art may be used as described above.
  • the recombinant vector of the present invention is one or more antibiotic resistance genes selected from the group consisting of ampicillin, tetracyclin, kanamycin, chloramphenicol, streptomycin and neomycin. may further include.
  • the "antibiotic resistance gene” is a gene having resistance to an antibiotic, and the cells having it survive even in an environment treated with the antibiotic, so it is usefully used as a selection marker in the process of obtaining a plasmid in large quantities from E. coli. .
  • an antibiotic resistance gene generally used as a selection marker can be used without limitation.
  • the reporter gene refers to a base encoding an identifying factor that can be identified based on the effect of the gene, wherein the effect is to trace the inheritance of the base of interest or the base of interest It is used to identify a cell or organism that inherits and/or to measure gene expression induction or transcription.
  • reporter gene include: Green fluorescent protein , GFP), luminescent proteins such as Luciferase (Luc), chloroamphenicol acetyltransferase (CAT), beta-galactosidase ( ⁇ -galactosidase, LacZ), beta- glucuronidase ( ⁇ -glucuronidase, Gus) and the like.
  • the target gene is a gene for the treatment of a specific disease, it can be used for targeting the therapeutic gene based on the specific expression characteristics for the liver or liver-derived cells possessed by the fusion promoter of the present invention.
  • a therapeutic gene to be expressed is included in the recombinant vector into which the fusion promoter to which the CMV enhancer and the TBG promoter are combined according to the present invention is inserted.
  • the gene delivery system can be used without limitation as long as it is for gene therapy known in the art, and preferably plasmid, recombinant adenovirus, adeno-associated viruses (AAV), retrovirus, lentivirus, herpes simplex virus, vaccinia virus, poxvirus, polymer, liposome or niosome.
  • AAV adeno-associated viruses
  • retrovirus lentivirus
  • herpes simplex virus vaccinia virus
  • poxvirus poxvirus
  • polymer liposome or niosome.
  • the present invention provides a composition for inducing expression of a liver cell-specific target gene comprising the recombinant vector according to the present invention.
  • the liver cells are characterized in that at least one selected from the group consisting of normal liver cells, liver cancer cells, liver stem cells, and liver cells derived from induced pluripotent stem cells.
  • the present invention also provides a host cell transformed with the recombinant vector according to the present invention.
  • the "transformation” refers to the introduction of DNA into a cell.
  • the introduced DNA is usually in the form of a vector containing a fragment into which the DNA has been inserted.
  • the introduced DNA sequence may originate from the same species as the host cell, or from a species different from the host cell, or it may be a hybrid DNA sequence containing some DNA originating from the host species and some foreign DNA.
  • the recombinant vector comprising the fusion promoter of the present invention or the nucleotide sequence of the target gene operably linked to the fusion promoter can be introduced into a host cell using a method known in the art.
  • Methods for introducing the recombinant vector according to the present invention into a host cell are not limited thereto, calcium chloride (CaCl 2 ) and heat shock (heat shock) method, Agrobacterium (Agrobacterium sp.) - Method by mediation, Particle gun bombardment, silicon carbide whiskers, sonication, electroporation, and precipitation by PEG (polyethylenglycol) may be used.
  • the cells are preferably liver-derived cells, and the liver-derived cells include liver-derived normal cells and cancer cells.
  • the present invention also provides a method for expressing a target protein in a host cell by transforming the recombinant vector according to the present invention into a host cell.
  • the present invention comprises the steps of culturing the transformed host cell according to the present invention; And it provides a method for producing a target protein comprising the step of obtaining the expressed target protein from the cultured host cell or host cell culture medium.
  • the "cultivation” means growing cells in an artificially controlled environmental condition.
  • the cells can be grown in a conventional medium.
  • the medium contains nutrients required by the cells to be cultured, that is, to be cultured in order to culture specific cells, and may be mixed with additionally added materials for a specific purpose.
  • the medium is also referred to as an incubator or culture medium, and is a concept including all of natural medium, synthetic medium, or selective medium.
  • a linker (SEQ ID NO: 3) to construct a fusion promoter (denoted as eTBG) (represented by SEQ ID NO: 4).
  • the CMV enhancer uses plasmid #61591 acquired from Addgene as a template, sense 5'-CGG TCT CTG TAC TCG TTA CAT AAC TTA CGG TAA ATG G-3' (SEQ ID NO: 5) ), antisense 5'-CAT GCA AGC TTG CTA GCG GTA CCA TGG TAA TAG CGA TGA CTA ATA C-3' (SEQ ID NO: 6) Phusion DNA polymerization using an oligonucleotide as a primer PCR with enzyme (#F553S, purchased from ThermoFisher).
  • the TBG promoter uses plasmid #61593 acquired from Addgene as a template, and sense (sense) 5'-TAC CAT GGT ACC GCT AGC AAG CTT GCA TGT ATA ATT TCT ACA GAA CCT AT-3' (SEQ ID NO: 7 ), antisense (antisense) 5'-AAG GAT CCG TCG ACC GGT ATC TTT CCA TTT TTA TAG-3' (SEQ ID NO: 8) was used as a primer for PCR with fusion DNA polymerase.
  • each CMV (enhancer + A vector into which the promoter) was inserted (described as CMV:GFP), a vector into which the TBG promoter was inserted (described as TBG:GFP), and a vector into which the eTBG promoter of the present invention was inserted (described as eTBG:GFP) were prepared.
  • the pAAV-promoterless-SV40polyA (pAAV-promoterless-SV40polyA) vector was prepared using plasmid #61591 acquired from Addgen as a template, and sense (sense) 5'-GGA TCC GCG GCC GCA GAT CCG CGT GCA GGA ACC CCT AGT Using the oligonucleotide of GAT GGA GTT GGC CAC T-3' (SEQ ID NO: 11), antisense 5'-GGT ACC ACT AGA GGC CGC AGG AAC CCC TAG TGA TGG-3' (SEQ ID NO: 12) as a primer PCR was performed with Phusion DNA polymerase.
  • the linear DNA amplified by PCR was converted into a circular plasmid using T4 DNA ligase.
  • the plasmid was linearized with BamHI and NotI restriction enzymes (purchased from NEB), and then mixed with the complementary DNA fragments from MCS-SV40polyA-1 to -3 in Table 2 below and T4 DNA ligase (purchased from ThermoFisher) was used to bind to a circular plasmid (MCS-SV40 polyA-1: SEQ ID NO: 13 and SEQ ID NO: 14, MCS-SV40 polyA-2: SEQ ID NO: 15 and SEQ ID NO: 16, MCS-SV40 polyA-3 : SEQ ID NO: 17 and SEQ ID NO: 18).
  • the pAAV-CMV-SV40polyA vector was constructed as follows. First, using plasmid #61591 sold from Adden as a template, sense 5'-CGG TCT CTG TAC TCG TTA CAT AAC TTA CGG TAA ATG G-3' (SEQ ID NO: 19), antisense 5'- GAT GGA TCC GTC GAC CGG TAG TTA GCC AGA GAG CTC TGC TTA TAT Restriction enzymes of BsaI and BamHI to the CMV promoter prepared by PCR with Phusion DNA polymerase using the oligonucleotide of SEQ ID NO: 20 as a primer.
  • the pAAV-TBG-SV40polyA vector was treated with KpnI and BamHI restriction enzymes on the TBG promoter prepared by the above-described process, and then linearized with KpnI and BamHI restriction enzymes.
  • the T4 DN It was prepared by binding to a circular plasmid using a ligase.
  • the pAAV-eTBG-SV40polyA vector was treated with restriction enzymes of BsaI and BamHI to the eTBG fusion promoter prepared by the procedure described above, and then linearized with the restriction enzymes of KpnI and BamHI, followed by mixing with the pAAV-promoterless-SV40polyA vector, followed by T4 It was prepared by binding to a circular plasmid using DNA ligase.
  • GFP uses plasmid #11680 acquired from Adgen as a template, sense 5'-TTA GAT CTA CCA TGG TGA GCA AGG GCG AGG A-3' (SEQ ID NO: 21), antisense 5'- Using the oligonucleotide of TTG AAT TCC CGG ATC CCT TGT ACA GCT CGT CCA T-3' (SEQ ID NO: 22) as a primer, it was prepared by PCR with Phusion DNA polymerase.
  • each of the three vectors, pAAV-CMV-SV40polyA, pAAV-TBG-SV40polyA, and pAAV-eTBG-SV40polyA, prepared above was linearized with BamHI and EcoRI, and mixed with GFP treated with BglII and EcoRI restriction enzymes.
  • CMV:GFP, TBG:GFP and eTBG:GFP were prepared by binding to a circular plasmid using T4 DNA ligase.
  • tissue specificity of the eTBG promoter In order to evaluate the tissue specificity of the eTBG promoter according to the present invention, experiments were conducted using liver cells HepG2 and Hepa1c1c-7, fibroblasts NIH3T3, and human fetal kidney cells HEK293. Each cell line was transfected with 5 ⁇ g of eTBG:GFP, and after 48 hours, tissue specificity was evaluated by Western blotting using a GFP antibody (Santa Cruz, sc-9996).
  • L-PEI Linear-Polyethylenimine
  • eTBG:GFP 5 ⁇ g of eTBG:GFP
  • RIPA buffer Radioimmunoprecipitation assay buffer; purchased from ThermoFisher
  • BCA Boicinchoninic acid
  • a 10% acrylamide gel was made and electrophoresis was performed.
  • the isolated proteins present in the gel were transferred to a nitrocellulose membrane (purchased from ThermoFischer), and finally tissue specificity was compared by comparing the protein amount of GFP using a GFP antibody (purchased from Santa Cruz, sc-9996). was evaluated.
  • the expression of GFP by the eTBG promoter according to the present invention was shown only in HepG2, a human liver cancer cell and Hepa1c1c7, a mouse liver cancer cell, but was not expressed in HEK293, a human fetal kidney cell, and NIH3T3, a mouse fibroblast. It was confirmed that the transcriptional activity of eTBG was specific to liver cells.
  • Example 2 the three types of vectors (CMV:GFP, TBG:GFP or eTBG:GFP) prepared in Example 2 were transfected into liver-derived cells (HepG2, Hepa1c1c-7 or Hepa1-6). 5 ⁇ g of each vector was transfected, and expression intensity was evaluated 48 hours later by Western blotting and qRT-PCR.
  • TRIzol purchased from Invitrogen, 15596-018 was used to extract RNA from the transfected Hepa1-6 cells.
  • the extracted RNA was converted into cDNA by reacting it with Oligo dT, reverse transcriptase (purchased from Promega, M1701), and dNTP.
  • RealHelixTM qPCR kit purchased from Nanohelix, QP2-S500 was used for gene amplification using cDNA, and the primer sequences for each gene are as follows.
  • GFP primer (sense) 5'-CCCGACAACCACTACCTGAG-3' (SEQ ID NO: 23), antisense 5'-TTGTACAGCTCGTCCATGCC-3' (SEQ ID NO: 24) and mouse 18S ribosomal RNA (Mus Musculus 18S ribosomal RNA) primer (sense 5'-GCAATTATTCCCCATGAACGAGG-3' (SEQ ID NO: 25), antisense 5'-GGCCTCACTAAACCATCCAATC-3' (SEQ ID NO: 26).
  • Oligonucleotide primers used in all experiments were ordered and synthesized from Bionicss.
  • the expression level of GFP was evaluated at the protein level.
  • the eTBG promoter according to the present invention was transfected In one case, it was weaker than CMV, but it was confirmed that the strength was significantly increased when compared with the TBG-only experimental group.
  • the efficiency of the vector was evaluated using a fluorescence activated cell sorter (FACS). After transfection of each vector in hepatocytes Hepa1-6, analysis was performed 48 hours later. At this time, in order to derive a value for correcting the transfection efficiency of each vector, the pCS2B TaqBFP vector was also transfected and the ratio of BFP+GFP+/BFP was established as an evaluation standard.
  • FACS fluorescence activated cell sorter
  • the GFP expression ratio by each promoter was 77.99% for the CMV promoter, 55.10% for the eTBP promoter according to the present invention, and 1.22% for the TBG promoter, a pattern similar to that of Western blotting and qRT-PCR. got the result of
  • the eTBP promoter according to the present invention significantly increased gene transcription efficiency and protein expression in liver cells than the conventional TBG promoter alone.
  • a vector in which a CMV enhancer is added in front of the CD68, GFAP (glial fibrillary acidic protein) and TNT4 (Troponin T2 cardiac type, promoter 4) promoters which are known to act specifically on myeloid cells, astrocytes or cardiomyocytes, was prepared in the above example. It was prepared in the same manner as in Examples 1 and 2 (A in FIG. 5).
  • the vectors were added to the NIH3T3 cell line, a fibroblast cell line. After transfection, the expression of GFP was confirmed through a green fluorescence filter of an inverted fluorescence microscope (Nikon, Eclipse Ti-S), and images were taken at a magnification of 100 times. Thereafter, qRT-PCR was performed in the same manner as in Example 3.
  • the fusion promoter in which the CMV enhancer and the TBF promoter according to the present invention are combined not only significantly increased gene transcription efficiency and protein expression efficiency in the liver, but also did not impair the existing tissue specificity, resulting in excellent performance in liver or liver-derived cells. It was confirmed through the above examples that the promoter can show specific expression.
  • the fusion promoter combining the TBG promoter and the CMV enhancer according to the present invention showed liver cell-specific expression, and it was confirmed that gene transcription efficiency and protein expression were significantly increased compared to when the conventional TBG promoter acted alone.
  • the fusion promoter according to the present invention is a promoter that has excellently improved the disadvantages of the existing TBG promoter, so it can be usefully used for liver disease gene therapy.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 TBG 프로모터와 CMV 인핸서를 결합시킨 융합 프로모터에 대한 것으로, 본 발명에 따르면 상기 융합 프로모터는 간 세포에 특이적으로 발현하며 기존 TBG 프로모터 단독으로 작용할 때보다 유전자 전사효율과 단백질의 발현이 현저히 증가된 것을 확인한 바, 본 발명에 따른 융합 프로모터는 기존 TBG 프로모터가 가진 단점을 우수하게 개선한 프로모터이므로, 이를 간 질환 유전자 치료를 위하여 유용하게 활용할 수 있다.

Description

조직 특이적 발현을 위한 융합 프로모터 및 이의 용도
본 발명은 조직 특이적, 특히 간 및 간 세포 특이적 발현을 증대시키기 위한 융합 프로모터 및 이의 용도에 대한 것이다.
유전자 치료는 생체 내에서 돌연변이 유전자를 교정할 수 있는 기회를 제공한다. 숙주 세포 내에서 원하는 유전자를 발현시키기 위해서는 세포 내로 구조 유전자를 수송하여 이를 발현시키는 발현벡터 및 유전자 전달기술이 필요하다. 이 때, 발현벡터는 벡터에 삽입된 DNA 단편을 발현시킬 수 있는 벡터로서, 일반적으로 숙주 내에서 유전자를 발현시킬 수 있는 프로모터 서열 등의 발현조절서열을 포함한다. 숙주 세포의 종류, 발현 시기, 발현량 등은 발현벡터를 선택함에 있어서 주요한 근거가 되며, 목적에 따라 이러한 점들을 충족시키기 위해 다양한 발현벡터가 개발되고 있다.
이에 있어 유전자의 높고 지속적인 발현의 목표를 달성하기 위하여, 거대 세포 바이러스 프로모터 (cytomegalovirus promoter, CMV) 및 포유류 신장 인자 1α (mammalian elongation factor 1α, EF1α) 프로모터와 같은 유비쿼터스 프로모터가 치료 유전자를 구동하는 데 사용되어 왔다.
그러나 이러한 시스템의 주요 단점 중 하나는 특정 세포집단이나 표적 기관에서 유전자 발현을 제한할 수 없다는 것이다. 따라서, 조직 특이적 프로모터는 유전자 치료 전략을 위한 벡터 디자인에서 매우 중요하다.
한편 간은 대사 과정에서 중요한 역할을 하고 다양한 대사질환에 중요한 기관이므로, 유전자 치료를 위한 매력적인 표적 기관이 될 수 있다.
티록신 결합 글로불린(thyroxine-binding globulin, TBG) 프로모터는 최근 몇 년 동안 간 세포 특이적으로 다양한 치료 유전자의 발현을 조절하기 위해 개발되고 적용되고 있다. 그러나 기존의 연구 결과에 의하면 TBG 프로모터에 의해 구동되는 외인성 유전자의 발현은 간 세포에 특이적으로 작동하지만, 유비쿼터스 프로모터인 CMV 및 EF1α보다 낮은 전사 활성을 가지는 것으로 확인되었다.
따라서, 간 질환의 유전자 치료를 위해서는 간세포 특이적이면서도 전사 활성이 더 높은 프로모터 시스템이 필요하다.
본 발명자들은 간 세포 특이적이면서도 유전자 전사 활성 및 단백질 발현 효율이 더 높은 프로모터에 대하여 연구하던 중, 기존 티록신 결합 글로불린(thyroxine-binding globulin, TBG) 프로모터가 갖던 단점을 우수하게 개선한 융합 프로모터를 개발하여 본 발명을 완성하였다.
따라서 본 발명의 목적은 융합 프로모터를 제공하는 것이다.
본 발명의 또 다른 목적은 재조합 벡터를 제공하는 것이다.
본 발명의 또 다른 목적은 간 세포 특이적 목적 유전자 발현 유도용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 형질전환된 숙주 세포를 제공하는 것이다.
본 발명의 또 다른 목적은 숙주 세포에서 목적 단백질을 발현시키는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 목적 단백질의 제조방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 1로 표시되는 거대 세포 바이러스(Cytomegalovirus, CMV) 인핸서의 전체 또는 이의 일부 서열; 및 서열번호 2로 표시되는 티록신 결합 글로불린(thyroxine-binding globulin, TBG) 프로모터의 전체 또는 이의 일부 서열;이 작동가능하게 연결된 융합 프로모터를 제공한다.
또한 상기 또 다른 목적을 달성하기 위하여, 본 발명은 본 발명에 따른 융합 프로모터를 포함하는 재조합 벡터를 제공한다.
또한 상기 또 다른 목적을 달성하기 위하여, 본 발명은 본 발명에 따른 융합 프로모터를 포함하는, 간 세포 특이적 목적 유전자 발현 유도용 조성물을 제공한다.
또한 상기 또 다른 목적을 달성하기 위하여, 본 발명은 본 발명에 따른 재조합 벡터로 형질전환된 숙주 세포를 제공한다.
또한 상기 또 다른 목적을 달성하기 위하여, 본 발명은 본 발명에 따른 재조합 벡터를 숙주 세포에 형질전환하여, 숙주 세포에서 목적 단백질을 발현시키는 방법을 제공한다.
또한 상기 또 다른 목적을 달성하기 위하여, 본 발명은 본 발명에 따른 숙주 세포를 배양하는 단계; 및 상기 배양된 숙주 세포 또는 숙주 세포 배양 배지로부터 발현된 목적 단백질을 수득하는 단계;를 포함하는 목적 단백질의 제조방법을 제공한다.
본 발명에 따른 TBG 프로모터와 CMV 인핸서를 결합시킨 융합 프로모터는 간 세포에 특이적으로 발현하며 기존 TBG 프로모터 단독으로 작용할 때보다 유전자 전사 효율과 단백질의 발현이 현저히 증가된 것을 확인한 바, 본 발명에 따른 융합 프로모터는 기존 TBG 프로모터가 가진 단점을 우수하게 개선한 프로모터이므로 이를 간 질환 유전자 치료를 위하여 유용하게 활용할 수 있다.
도 1은 본 발명에 따른 융합 프로모터 및 비교군(CMV 인핸서+CMV 프로모터 또는 TBG 프로모터 단독)의 평가를 위해 GFP 유전자가 결합된 재조합 벡터를 나타낸 도이다.
도 2는 본 발명에 따른 융합 프로모터의 간 세포 특이적 발현을 확인한 도이다.
도 3은 본 발명에 따른 융합 프로모터의 간 유래 정상세포에서의 GFP 단백질 발현 및 mRNA 전사 효율을 확인한 결과로, 도 3 중 A 및 B는 본 발명에 따른 융합 단백질, CMV 인핸서 또는 TBG 프로모터를 각각 간 유래 세포주(Hepa1c1c-7, HepG2)에 형질주입한 후, 형광 발현 정도를 확인한 결과이고, 도 3 중 C는 본 발명에 따른 융합 단백질, CMV 인핸서 또는 TBG 프로모터를 간 유래 세포주(Hapa1-6)에 형질주입한 후 형광 발현 정도를 확인한 결과이다.
도 4는 본 발명에 따른 융합 프로모터의 간 유래 정상세포에서의 GFP 단백질 발현 강도를 형광활성세포분류기(fluorescence activated cell sorter, FACS)를 이용하여 확인한 도이다.
도 5는 본 발명의 융합 프로모터와 비교군(조직 특이적 발현 특성의 다른 프로모터와 CMV 인핸서를 결합한 융합 프로모터)의 평가를 위해 GFP 유전자가 결합된 재조합 벡터의 조직 특이성을 평가한 결과로, 도 5 중 A는 CMV 인핸서와 TBG 프로모터 외 조직 특이적 발현을 보임이 공지된 다른 프로모터를 결합한 융합 프로모터를 포함하는 재조합 벡터를 나타내는 모식도이며, 도 5 중 B는 본 발명에 따른 융합 프로모터 또는 CMV 인핸서와 TBG 프로모터 외 조직 특이적 발현을 보임이 공지된 다른 프로모터를 결합한 융합 프로모터를 섬유모세포에 형질주입한 후, 형광 발현을 확인한 결과이며, 도 5 중 C는 본 발명에 따른 융합 프로모터 또는 CMV 인핸서와 TBG 프로모터 외 조직 특이적 발현을 보임이 공지된 다른 프로모터를 결합한 융합 프로모터를 섬유모세포에 형질주입한 후, 유전자 발현 여부를 확인한 결과이다.
이하, 본 발명에 대해 상세히 설명한다.
본 발명은 서열번호 1로 표시되는 거대 세포 바이러스(Cytomegalovirus, CMV) 인핸서의 전체 또는 이의 일부 서열; 및 서열번호 2로 표시되는 티록신 결합 글로불린(thyroxine-binding globulin, TBG) 프로모터의 전체 또는 이의 일부 서열;이 작동가능하게 연결된 융합 프로모터를 제공한다.
본 발명에 있어서, 상기 “프로모터(promoter)”는 일반적으로 전사를 개시하는 지점을 포함하는 암호화 부위의 상류 쪽에 위치하는 유전자 부위로, 흔히 유전자 발현을 조절하는 TATA 박스, CAAT 박스 부위, 외부 자극에 반응하여 유전자 발현에 영향을 주는 부위 및 위치와 방향에 상관없이 거의 모든 유전자의 발현을 촉진하는 인핸서 등으로 이루어져 있다.
본 발명에서, 상기 “인핸서(Enhancer)”란 전사 개시 복합체의 다른 단백질과 결합하여 그것의 관련 프로모터에 의해 진행되는 전사 개시를 촉진하는 서열이다.
본 발명은 특히 CMV 인핸서와 TBG 프로모터를 결합하여 제작한 융합 프로모터로서, 간 세포에 특이적으로 작동하지만 유비쿼터스 프로모터인 CMV 및 EF1α보다 낮은 전사 활성을 가지는 것으로 알려진 TBG 프로모터의 단점을 우수하게 개선한 특징이 있다.
본 발명의 일 실시예에 따르면, 본 발명에 따른 CMV 인핸서와 TBG 프로모터가 결합된 융합 프로모터는 간 유래 정상 세포 또는 암 세포에서만 우수한 유전자 전사 효율과 단백질의 발현을 보여주었고, 이는 TBG 프로모터 단독 효율보다 우수하였다.
특히 본 발명의 또 다른 일 실시예에 따르면, 상기 CMV 인핸서를 TBG 외 다른 조직 특이적 발현의 특성을 지닌 프로모터와 결합하는 경우, 기존 보유한 조직 특이적 발현의 특성이 소멸되는 것을 확인한 바, 본 발명의 CMV 인핸서와 TBG 프로모터 결합은 기존 보유한 조직 특이적 발현 특성을 유지할 수 있는 유의성있는 결합인 것을 확인하였다.
따라서 본 발명에 따른 융합 프로모터는 다른 조직에서는 유전자의 발현을 유도하지 않으면서 간 또는 간 유래 세포에서 특이적으로 유전자를 발현시킬 수 있는 프로모터인 것을 특징으로 한다. 상기 간 유래 세포는 정상세포 및 암 세포를 포함할 수 있다.
본 발명의 융합 프로모터에 있어서, 상기 서열번호 1로 표시되는 CMV 인핸서 또는 서열번호 2로 표시되는 TBG 프로모터는 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더욱 더 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기 서열을 포함할 수 있다. 염기 서열에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 염기 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
본 발명에 있어서, 상기 서열번호 1로 표시되는 거대 세포 바이러스(Cytomegalovirus, CMV) 인핸서의 전체 또는 이의 일부 서열과 상기 서열번호 2로 표시되는 티록신 결합 글로불린(thyroxine-binding globulin, TBG) 프로모터의 전체 또는 이의 일부 서열은 서열번호 3으로 표시되는 링커로 결합되는 것을 특징으로 한다.
본 발명에 따른 융합 프로모터는 서열번호 4로 표시되는 것을 특징으로 하며, 상기 서열번호 4의 염기서열 뿐만 아니라 상기 서열번호 4의 염기서열의 일부 염기가 치환, 결실 또는 부가된 변형서열로서 간 또는 간 유래 세포에 특이적으로 프로모터 활성을 나타내는 염기서열을 포함한다.
또한 상기 서열번호 4의 염기서열 변이체가 본 발명의 범위 내에 포함될 수 있다. 본 발명의 서열번호 4의 염기서열 및 이를 구성하는 핵산 분자의 작용성 등가물, 예를 들어, 서열번호 4의 일부 염기서열이 결실(deletion), 치환(substitution) 또는 삽입(insertion)에 의해 변형되었지만, 서열번호 4의 염기서열 및 이를 구성하는 핵산 분자와 기능적으로 동일한 작용을 할 수 있는 변이체(variants)를 포함하는 개념이다. 구체적으로, 서열번호 4의 염기 서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더욱 더 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기 서열을 포함할 수 있다. 염기 서열에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 염기 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
본 발명에서 상기 "작동가능하게 연결된(operably linked)"은 일반적 기능을 수행하도록 핵산 발현조절 서열과 목적하는 단백질을 코딩하는 핵산 서열이 기능적으로 연결되어 있는 것을 말한다. 예를 들어 프로모터와 단백질 또는 RNA를 코딩하는 핵산 서열이 작동가능하게 연결되어 코딩서열의 발현에 영향을 미칠 수 있다. 재조합 벡터와의 작동적 연결은 당해 기술분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등을 사용한다.
또한 본 발명은 본 발명에 따른 융합 프로모터를 포함하는 재조합 벡터를 제공한다.
본 발명에 있어서, 상기 "벡터"는 적합한 숙주 내에서 목적 유전자를 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 유전자의 염기서열을 함유하는 유전자 적재물을 의미하는 것으로, 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다.
본 발명에 따른 재조합 벡터는 단백질 발현에 사용되는 기존의 벡터를 기본 골격으로 하여 본 발명의 CMV 인핸서 및 TBG 프로모터가 결합된 융합 프로모터를 삽입하고 상기 프로모터의 다운스트림(downstream) 쪽으로 목적 단백질을 코딩하는 염기서열인 목적 유전자를 삽입함으로써 제조할 수 있다. 이에 추가적으로 전사 종결 서열이 도입된 형태일 수 있다.
본 발명의 벡터는 개체 또는 세포 내에서 복제 가능한 것이면 특별히 한정되지 않고 당업계에 알려진 임의의 벡터를 이용할 수 있으며 본 발명에 사용될 수 있는 벡터는 바이러스 벡터, 플라스미드 벡터 및 아그로박테리움 벡터로 이루어진 군에서 선택된 어느 하나 이상일 수 있다. 보다 바람직하게는 바이러스 벡터일 수 있으며, 아데노 부속 바이러스(Adeno-associated virus, AAV), 레트로바이러스(Retrovirus), 아데노바이러스(Adenovirus), 헤르페스 심플렉스 바이러스(Herpes simplex virus) 및 렌티바이러스(Lentivirus)로 이루어진 군에서 선택된 어느 하나 이상일 수 있으나 이에 제한되는 것은 아니다.
그러나 당업자라면 본 발명의 융합 프로모터 및 상기 융합 프로모터로 발현하고자 하는 목적 유전자의 염기 서열을 숙주 세포 내로 도입할 수 있는 벡터라면 어떠한 벡터라도 모두 사용할 수 있으며, 본 발명의 일 실시예에서는 pAAV 벡터를 이용하여 본 발명의 융합 프로모터(eTBG)를 포함하는 pAAV eTBG:GFP를 제조하였다.
본 발명에서, 상기 "다운스트림(downstream)"은 참고 뉴클레오티드 서열의 3' 쪽에 위치한 뉴클레오티드 서열을 말한다. 구체적으로, 다운스트림 뉴클레오티드 서열은 전사의 개시 포인트 뒤에 오는 서열과 일반적으로 관련된다. 예를 들면, 유전자의 번역 개시 코돈은 전사의 개시 부위의 다운스트림에 위치한다.
본 발명에서, 상기 "목적 유전자"는 목적하는 생성물을 암호화하는 일정 길이의 핵산 서열로서 정의될 수 있다. 목적하는 생성물은 그 자체가 생물학적으로 활성인 단백질이다. 이러한 목적 유전자는 일반적으로 센스 방향으로 벡터 내에 존재할 것이지만, 특정 유전자를 불활성화시키기 위하여 안티센스 방향으로 존재할 수도 있다. 목적 유전자가 생물학적으로 활성인 단백질을 암호화하는 유전자라면 그 유전자는 통상 코딩서열은 반드시 포함할 것이며, 5' 비번역리더서열(5'UTR), 3' 비번역서열(3'UTR) 및 인트론(Intron)을 포함할 수 있다. 또한 목적 유전자는 절단된 형태의 단백질, 융합된 형태의 단백질, 태그된 형태의 단백질을 암호화하는 서열일 수 있으며, cDNA 또는 게놈 DNA일 수 있고, 천연 형태의 생성물을 암호화하는 서열이거나 원하는 돌연변이 형태의 생성물을 암호화하는 서열일 수 있다. 이러한 목적 유전자는 그 목적 생성물이 인간에게 직·간접적으로 유용한 것이라면 임의의 것이라도 무방하다. 또한 이러한 목적 유전자는 임의의 것으로부터 기원할 수 있는데, 예컨대 식물, 세균, 동물, 바이러스 등으로부터 기원할 수 있다.
본 발명에서 상기 "목적 유전자의 발현"은 상기 목적 유전자를 발현시켜 목적 유전자가 코딩하는 단백질을 생산하는 것을 의미할 수 있다. 본 발명에서 목적 유전자를 발현하는 방법은 상기 목적 유전자를 포함하는 벡터로 형질전환된 형질전환체(숙주 세포)를 배양하여 상기 목적 유전자가 코딩하는 단백질을 발현시키는 방법일 수 있으며, 이를 통해 상기 단백질이 관여되는 생합성 경로의 최종산물을 제조할 수 있다.
본 발명의 재조합 벡터는 상기 목적 유전자에 작동가능하게 연결된 조절 핵산서열을 추가로 포함할 수 있다. 이러한 조절 핵산서열은 그것에 작동가능하게 연결된 유전자의 전사/번역에 영향을 줄 수 있는, 전사 개시 부위의 상류 또는 하류에 존재하는 임의의 핵산서열을 말한다. 예컨대 인핸서, 전사를 조절하기 위한 오퍼레이터 서열, 폴리아데닐화 시그널, 리보솜 결합 부위, 복제 개시점, 전사 종결 서열 등을 말한다.
본 발명의 재조합 벡터는 바람직하게는 형질전환된 숙주 유기체의 선별을 가능 또는 용이하게 하기 위하여 선택 마커 유전자를 하나 이상 포함하거나, 발현시키고자 하는 목적 유전자의 발현 여부를 정성적·정량적으로 분석하기 위하여 리포터 유전자를 하나 이상 포함할 수 있다. 이러한 선택 마커 유전자나 리포터 유전자는 전술한 바와 같이 당업계에 공지된 것을 사용할 수 있다.
따라서 본 발명의 재조합 벡터는 암피실린(ampicilin), 테트라사이클린(tetracyclin), 카나마이신(kanamycin), 클로람페니콜(chloroamphenicol), 스트렙토마이신 (streptomycin) 및 네오마이신(neomycin)으로 이루어진 군에서 선택되는 하나 이상의 항생제 저항성 유전자를 추가로 포함할 수 있다.
본 발명에서 상기 "항생제 저항성 유전자"는 항생제에 대하여 저항성을 가지는 유전자로서, 이것을 가지고 있는 세포는 해당 항생제를 처리한 환경에서도 생존하므로, 대장균에서 대량으로 플라스미드를 얻는 과정에 선별 마커로서 유용하게 사용된다. 본 발명에서 항생제 저항성 유전자는 본 발명의 핵심적 기술인 벡터의 최적의 조합에 따른 발현 효율에 크게 영향을 미치는 요소가 아니므로, 선별 마커로서 일반적으로 사용되는 항생제 저항성 유전자를 제한 없이 사용할 수 있다.
본 발명에서, 상기 “리포터 유전자(또는 검출용 유전자)"는 상기 유전자의 효과에 기초하여 동정될 수 있는 동정하는 인자를 코딩하는 염기를 말하며, 여기서 상기 효과는 관심 염기의 유전을 추적하거나 관심 염기를 물려 받은 세포나 유기체를 동정하기 위해, 및/또는 유전자 발현 유도 또는 전사를 측정하기 위해 사용된다. 공지되고 당해 기술에서 사용되는 리포터 유전자의 예는 하기를 포함한다: 녹색 형광 단백질(Green fluorescent protein, GFP)과 같은 형광 단백질, 루시퍼라제(Luciferase, Luc)와 같은 발광 단백질, 클로로암페니콜 아세틸전이효소(Chloramphenicol acetyltransferase, CAT), 베타-갈락토시다아제(β-galactosidase, LacZ), 베타-글루쿠로니다아제(β-glucuronidase, Gus) 등.
더불어 상기 목적 유전자가 특정 질환의 치료를 위한 유전자라면, 본 발명의 융합 프로모터가 갖는 간 또는 간 유래 세포에 대한 특이적 발현 특성을 기반으로 상기 치료 유전자의 표적화를 위하여 사용될 수 있다.
즉 본 발명에 따른 CMV 인핸서 및 TBG 프로모터가 결합된 융합 프로모터가 삽입된 재조합 벡터에, 발현시키고자 하는 치료 유전자가 포함된 형태의 유전자 전달체로 제공될 수 있다.
상기 유전자 전달체는 당 분야에 알려진 유전자 치료를 위한 것이라면 제한없이 사용 가능하며, 바람직하게는 플라스미드, 재조합 아데노바이러스, 아데노-관련 바이러스(Adenoassociated viruses: AAV), 레트로바이러스, 렌티바이러스, 헤르페스 심플렉스 바이러스, 백시니아 바이러스, 폭스바이러스, 폴리머, 리포좀 또는 니오좀일 수 있다.
따라서 본 발명은 본 발명에 따른 재조합 벡터를 포함하는 간 세포 특이적 목적 유전자 발현 유도용 조성물을 제공한다. 상기 간 세포는 정상 간 세포, 간암세포, 간 줄기세포 및 유도만능줄기세포 기원의 간 세포로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 한다.
또한 본 발명은 본 발명에 다른 재조합 벡터로 형질전환된 숙주 세포를 제공한다.
본 발명에 있어서, 상기 "형질전환"은 DNA의 세포내로의 도입을 말한다. 도입된 DNA는 일반적으로 DNA가 삽입된 조각을 함유하는 벡터의 형태이다. 도입된 DNA 서열은 숙주 세포와 동일한 종, 또는 숙주 세포와는 상이한 종으로부터 기원할 수 있거나, 또는 이는 숙주 종으로부터 기원한 일부 DNA 및 일부 외부 DNA를 함유하는 하이브리드 DNA 서열일 수 있다.
본 발명의 융합 프로모터 또는 상기 융합 프로모터와 작동 가능하게 연결되어 있는 목적 유전자의 염기서열을 포함하는 것을 특징으로 하는 재조합 벡터는 당분야에 공지된 방법을 이용하여 숙주세포 내로 도입할 수 있다. 본 발명에 따른 재조합 벡터를 숙주세포내로 도입하는 방법으로는, 이에 한정되지는 않으나, 염화칼슘(CaCl2) 및 열 쇼크(heat shock) 방법, 아그로박테리움(Agrobacterium sp.)-매개에 의한 방법, 입자 총 충격법(particle gun bombardment), 실리콘 탄화물 위스커(silicon carbide whiskers), 초음파 처리(sonication), 전기천공법 (electroporation) 및 PEG(polyethylenglycol)에 의한 침전법 등을 사용할 수 있다.
본 발명의 융합 프로모터가 갖는 간 또는 간 유래 세포에 대한 특이적 발현 특성을 기반으로 상기 세포는 간 유래 세포인 것이 바람직하며, 상기 간 유래 세포는 간 유래 정상세포 및 암 세포를 포함한다.
또한 본 발명은 본 발명에 따른 재조합 벡터를 숙주 세포에 형질전환하여, 숙주 세포에서 목적 단백질을 발현시키는 방법을 제공한다.
더불어 본 발명은 본 발명에 따른 형질전환된 숙주 세포를 배양하는 단계; 및 상기 배양된 숙주 세포 또는 숙주 세포 배양 배지로부터 발현된 목적 단백질을 수득하는 단계를 포함하는 목적 단백질 제조방법을 제공한다.
본 발명에 있어서, 상기 "배양"은 세포를 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다. 상기 세포는 통상의 배지에서 생육 가능하다. 배지는 특정 세포를 배양하기 위하여 배양대상 즉 배양체가 되는 세포가 필요로 하는 영양물질을 포함하는 것으로 특수한 목적을 위한 물질이 추가로 첨가되어 혼합된 것일 수 있다. 상기 배지는 배양기 또는 배양액이라고도 하며, 천연배지, 합성배지 또는 선택배지를 모두 포함하는 개념이다.
상술한 본 발명의 내용은 상호 모순되지 않는 한, 서로 동일하게 적용되며, 당해 기술분야의 통상의 기술자가 적절한 변경을 가해 실시하는 것 또한 본 발명의 범주에 포함된다.
이하 본 발명을 실시예를 통해 상세하게 설명하나 본 발명의 범위가 하기 실시예로만 한정되는 것은 아니다.
실시예 1. 융합 프로모터 제조
간 세포 특이적이면서도 효능을 증가시킨 프로모터를 위하여, CMV 인핸서 영역(서열번호 1로 표시)을 기존 간세포 특이적 유전자 발현을 위하여 사용하던 TBG 프로모터 영역(서열번호 2로 표시)의 앞에 링커(서열번호 3으로 표시)로 결합하여 융합 프로모터(eTBG로 기재)를 제작하였다(서열번호 4로 표시).
구체적인 서열 정보는 하기 표 1과 같다.
명칭 염기서열(5'→3') 서열번호
CMV 인핸서 CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGTCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATG 1
TBG 프로모터 GCATGTATAATTTCTACAGAACCTATTAGAAAGGATCACCCAGCCTCTGCTTTTGTACAACTTTCCCTTAAAAAACTGCCAATTCCACTGCTGTTTGGCCCAATAGTGAGAACTTTTTCCTGCTGCCTCTTGGTGCTTTTGCCTATGGCCCCTATTCTGCCTGCTGAAGACACTCTTGCCAGCATGGACTTAAACCCCTCCAGCTCTGACAATCCTCTTTCTCTTTTGTTTTACATGAAGGGTCTGGCAGCCAAAGCAATCACTCAAAGTTCAAACCTTATCATTTTTTGCTTTGTTCCTCTTGGCCTTGGTTTTGTACATCAGCTTTGAAAATACCATCCCAGGGTTAATGCTGGGGTTAATTTATAACTAAGAGTGCTCTAGTTTTGCAATACAGGACATGCTATAA 2
링커 GTACCGCTAGCAAGCTT 3
eTBG 프로모터 CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGTCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTACCGCTAGCAAGCTTGCATGTATAATTTCTACAGAACCTATTAGAAAGGATCACCCAGCCTCTGCTTTTGTACAACTTTCCCTTAAAAAACTGCCAATTCCACTGCTGTTTGGCCCAATAGTGAGAACTTTTTCCTGCTGCCTCTTGGTGCTTTTGCCTATGGCCCCTATTCTGCCTGCTGAAGACACTCTTGCCAGCATGGACTTAAACCCCTCCAGCTCTGACAATCCTCTTTCTCTTTTGTTTTACATGAAGGGTCTGGCAGCCAAAGCAATCACTCAAAGTTCAAACCTTATCATTTTTTGCTTTGTTCCTCTTGGCCTTGGTTTTGTACATCAGCTTTGAAAATACCATCCCAGGGTTAATGCTGGGGTTAATTTATAACTAAGAGTGCTCTAGTTTTGCAATACAGGACATGCTATAA 4
보다 구체적으로, CMV 인핸서는 애드진(Addgene)으로부터 분양받은 플라스미드 #61591을 주형으로 하여, 센스(sense) 5'-CGG TCT CTG TAC TCG TTA CAT AAC TTA CGG TAA ATG G-3'(서열번호 5), 안티센스(antisense) 5'-CAT GCA AGC TTG CTA GCG GTA CCA TGG TAA TAG CGA TGA CTA ATA C-3'(서열번호 6)의 올리고뉴클레오티드(oligonucleotide)를 프라이머(primer)로 사용하여 Phusion DNA 중합효소(ThermoFisher에서 구매 #F553S)로 PCR하였다. TBG 프로모터는 애드진(Addgene)에서 분양받은 플라스미드 #61593을 주형으로 하여, 센스(sense) 5'-TAC CAT GGT ACC GCT AGC AAG CTT GCA TGT ATA ATT TCT ACA GAA CCT AT-3'(서열번호 7), 안티센스(antisense) 5'-AAG GAT CCG TCG ACC GGT ATC TTT CCA TTT TTA TAG-3'(서열번호 8)의 올리고뉴클레오티드를 프라이머로 사용하여 퓨전 DNA 중합효소로 PCR하였다. 더불어 상기 PCR로 증폭된 CMV 인핸서와 TBG 프로모터를 혼합한 후 센스(sense) 5'-CGG TCT CTG TAC TCG TTA CAT AAC TTA CGG TAA ATG G-3'(서열번호 9), 안티센스(antisense) 5'-AAG GAT CCG TCG ACC GGT ATC TTT CCA TTT TTA TAG-3'(서열번호 10)의 올리고뉴클레오티드를 프라이머로 사용하여 Phusion DNA 중합효소로 라이게이션 PCR(ligation PCR)하여 융합 프로모터 eTBG를 제작하였다.
실시예 2. 벡터의 제조
간 세포 특이성과 유전자 발현 강도를 평가하기 위하여, 도 1과 같이 GFP(Green fluorescent protein)를 발현할 수 있는 pAAV(Adeno-Associated Virus) 벡터의 GFP 염기서열의 앞에 위치한 프로모터 영역에 각각 CMV(인핸서+프로모터)가 삽입된 벡터(CMV:GFP로 기재), TBG 프로모터가 삽입된 벡터(TBG:GFP로 기재) 및 본 발명의 eTBG 프로모터가 삽입된 벡터(eTBG:GFP로 기재)를 제작하였다.
먼저, pAAV-프로모터제외-SV40polyA(pAAV-promoterless-SV40polyA) 벡터는 애드젠에서 분양받은 플라스미드 #61591을 주형으로 하여, 센스(sense) 5'-GGA TCC GCG GCC GCA GAT CCG CGT GCA GGA ACC CCT AGT GAT GGA GTT GGC CAC T-3'(서열번호 11), 안티센스(antisense) 5'-GGT ACC ACT AGA GGC CGC AGG AAC CCC TAG TGA TGG-3'(서열번호 12)의 올리고뉴클레오티드를 프라이머로 사용하여 Phusion DNA 중합효소로 PCR하였다. PCR로 증폭된 선형의 DNA는 T4 DNA 라이게이즈(ligase)를 이용하여 환형 플라스미드로 전환하였다. 다음에는 BamHⅠ과 NotⅠ의 제한효소(NEB에서 구매)로 플라스미드를 선형화한 후, 하기 표 2의 MCS-SV40polyA-1에서 -3까지의 상보적으로 결합된 DNA 조각들과 혼합하고 T4 DNA 라이게이즈(ThermoFisher에서 구매)를 이용하여 환형 플라스미드로 결합하였다(MCS-SV40 polyA-1: 서열번호 13 및 서열번호 14, MCS-SV40 polyA-2: 서열번호 15 및 서열번호 16, MCS-SV40 polyA-3: 서열번호 17 및 서열번호 18).
Figure PCTKR2022000048-appb-img-000001
pAAV-CMV-SV40polyA 벡터는 다음과 같이 제작되었다. 먼저 애드젠에서 분양받은 플라스미드 #61591을 주형으로 하여, 센스(sense) 5'-CGG TCT CTG TAC TCG TTA CAT AAC TTA CGG TAA ATG G-3'(서열번호 19), 안티센스(antisense) 5'-GAT GGA TCC GTC GAC CGG TAG TTA GCC AGA GAG CTC TGC TTA TAT AGA-3'(서열번호 20)의 올리고뉴클레오티드를 프라이머로 사용하여 Phusion DNA 중합효소로 PCR하여 제작된 CMV 프로모터에 BsaⅠ과 BamHⅠ의 제한효소(NEB에서 구매)를 처리한 후, KpnⅠ과 BamHⅠ의 제한효소(NEB에서 구매)로 선형화한 상기 pAAV-promoterless-SV40polyA 벡터와 혼합한 후 T4 DNA 라이게이즈를 이용하여 환형 플라스미드로 결합하여 제작하였다.
더불어 pAAV-TBG-SV40polyA 벡터는 앞에서 설명한 과정으로 제작된 TBG 프로모터에 KpnⅠ과 BamHⅠ의 제한효소를 처리한 후, KpnⅠ과 BamHⅠ의 제한효소로 선형화한 상기 pAAV-promoterless-SV40polyA 벡터와 혼합한 후 T4 DN ligase를 이용하여 환형 플라스미드로 결합하여 제작하였다.
또한 pAAV-eTBG-SV40polyA 벡터는 앞에서 설명한 과정으로 제작된 eTBG 융합 프로모터에 BsaⅠ과 BamHⅠ의 제한효소를 처리한 후, KpnⅠ과 BamHⅠ의 제한효소로 선형화한 상기 pAAV-promoterless-SV40polyA 벡터와 혼합한 후 T4 DNA ligase를 이용하여 환형 플라스미드로 결합하여 제작하였다.
그리고 GFP는 애드젠으로부터 분양받은 플라스미드 #11680을 주형으로 하여, 센스(sense) 5'-TTA GAT CTA CCA TGG TGA GCA AGG GCG AGG A-3'(서열번호 21), 안티센스(antisense) 5'-TTG AAT TCC CGG ATC CCT TGT ACA GCT CGT CCA T-3'(서열번호 22)의 올리고뉴클레오티드(oligonucleotide)를 프라이머로 사용하여 Phusion DNA 중합효소로 PCR하여 제작하였다.
최종적으로 상기에서 제작한 pAAV-CMV-SV40polyA, pAAV-TBG-SV40polyA, pAAV-eTBG-SV40polyA의 세 가지 벡터 각각을 BamHⅠ과 EcoRⅠ으로 선형화한 후, BglⅡ와 EcoRⅠ의 제한효소를 처리한 GFP와 혼합하고 T4 DNA 라이게이즈를 이용하여 환형 플라스미드로 결합하여 CMV:GFP, TBG:GFP 및 eTBG:GFP를 제작하였다.
실시예 3. 조직 특이성 및 발현 강도 평가
3.1 간 유래 세포 및 타조직 유래 세포에서의 평가
프로모터에 의한 GFP 발현에 있어서, 조직 특이성과 발현 강도를 평가하기 위하여 세포실험을 진행하였다. 모든 세포는 온도 37℃와 CO2 농도가 5%로 일정하게 유지되는 세포 배양기에서 ATCC(American Type Culture Collection) 권장 배지에 배양하였다.
본 발명에 따른 eTBG 프로모터의 조직 특이성을 평가하기 위하여, 간 세포인 HepG2, Hepa1c1c-7와 섬유아세포 NIH3T3, 사람 태아 신장세포인 HEK293을 이용한 실험을 진행하였다. 각각의 세포주에 5 μg의 eTBG:GFP를 형질주입하였고, 48시간 후 GFP 항체(Santa Cruz, sc-9996)를 이용하여 웨스턴 블롯팅을 통해 조직 특이성을 평가하였다.
벡터의 형질주입을 위하여 500 μl의 Opti-MEM 배지(media)에 20 μg의 L-PEI(Linear-Polyethylenimine; Sigma-Aldrich에서 구매)와 5 μg의 eTBG:GFP를 넣고 잘 교반하여, 30분 반응시간을 거친 후 세포에 처리하였다. 48시간 후 웨스턴 블롯팅을 시행하기 위해 RIPA 버퍼(Radioimmunoprecipitation assay buffer; ThermoFisher에서 구매)를 처리함으로서 세포를 용해하여 단백질을 추출한 후, BCA(Bicinchoninic acid) 단백질 분석(Biorad에서 구매)을 통해 단백질 농도를 정량하였다. 이 후 세포 용해물 내에 존재하는 여러 단백질을 크기에 따라 분리하기 위하여 10% 아크릴아마이드(Acrylamide) 겔을 만들어 전기영동을 시행하였다. 겔에 존재하는 분리된 단백질들을 나이트로셀룰로오스 멤브레인(Nitrocellulose membrane; ThermoFischer에서 구매)으로 옮긴 후, 최종적으로 GFP 항체(Santa Cruz에서 구매, sc-9996)를 이용하여 GFP의 단백질양을 비교함으로써 조직 특이성을 평가하였다.
그 결과 도 2와 같이, 본 발명에 따른 eTBG 프로모터에 의한 GFP 발현은 인간 간암세포인 HepG2와 생쥐 간암세포인 Hepa1c1c7에서만 나타났으며, 인간태아 신장세포인 HEK293과 생쥐 섬유아세포인 NIH3T3에서는 발현되지 않아서 eTBG의 전사 활성은 간 세포 특이적인 것을 확인할 수 있었다.
3.2 간 유래 세포에서 eTBG의 발현 강도 평가
더불어 간 유래 세포(HepG2, Hepa1c1c-7 또는 Hepa1-6)에 상기 실시예 2에서 제조한 세 가지 종류의 벡터(CMV:GFP, TBG:GFP 또는 eTBG:GFP)를 형질주입하였다. 각각의 벡터를 5 μg씩 형질주입하여 48시간 뒤 웨스턴 블롯팅과 qRT-PCR을 통해 발현 강도를 평가하였다.
웨스턴 블롯팅은 상기 3.1에 기재된 방법과 동일하게 수행하였으며, qRT-PCR은 하기와 같이 수행하였다.
형질주입된 Hepa1-6 세포로부터 RNA를 추출하기 위하여 TRIzol (Invitrogen에서 구매, 15596-018)을 사용하였다. 추출된 RNA를 Oligo dT와 역전사효소(Promega에서 구매, M1701), dNTP와 함께 반응시켜 cDNA로 전환시켰다. 이 후 cDNA를 이용한 유전자 증폭을 위해 RealHelix™ qPCR kit (Nanohelix에서 구매, QP2-S500)를 사용하였으며, 각 유전자에 대한 primer 서열은 다음과 같다. GFP 프라이머(센스(sense) 5'-CCCGACAACCACTACCTGAG-3'(서열번호 23), 안티센스(antisense) 5'-TTGTACAGCTCGTCCATGCC-3'(서열번호 24)와 생쥐 18S 리보솜의 RNA(Mus Musculus 18S ribosomal RNA) 프라이머(센스(sense) 5'-GCAATTATTCCCCATGAACGAGG-3'(서열번호 25), 안티센스(antisense) 5'-GGCCTCACTAAACCATCCAATC-3'(서열번호 26).
모든 실험에 사용한 올리고뉴클레오티드 프라이머는 바이오닉스(Bionicss)에서 주문하여 합성하여 사용하였다.
간 유래 세포주인 Hepa1c1c-7, HepG2, Hepa1-6에 각각의 벡터를 형질주입한 후 GFP 발현 정도를 단백질 수준에서 평가한 결과 도 3 중 A 및 B와 같이, 본 발명에 따른 eTBG 프로모터를 형질주입한 경우 CMV보다는 약하지만, TBG 단독 실험군과 비교하였을 때 그 강도가 현저하게 증가되어 있는 것을 확인할 수 있었다.
더불어 간 세포 Hepa1-6에 각각의 벡터를 형질주입한 후 GFP 발현 정도를 RNA 수준에서 평가한 결과 도 3 중 C와 같이, 본 발명에 따른 eTBG 프로모터에 의한 GFP mRNA의 수준이 TBG 프로모터와 비교하였을 때 현저하게 증가되어 있는 것을 확인하였다.
추가적으로 형광활성세포분류기(fluorescence activated cell sorter, FACS)를 이용하여 벡터의 효율을 평가하였다. 간세포 Hepa1-6에서 각각의 벡터를 형질주입한 후, 48시간 뒤 분석을 진행하였다. 이때 각 벡터의 형질주입 효율을 보정하기 위한 값을 도출하기 위하여, pCS2B TaqBFP 벡터도 형질주입하였고 BFP+GFP+/BFP의 비율을 평가 기준으로 확립하였다.
그 결과 도 4에 나타낸 바와 같이, 각 프로모터에 의한 GFP 발현 비율은 CMV 프로모터는 77.99%, 본 발명에 따른 eTBP 프로모터는 55.10%, TBG 프로모터는 1.22%로 상기 웨스턴 블롯팅 및 qRT-PCR과 유사한 패턴의 결과를 얻었다.
따라서 본 발명에 따른 eTBP 프로모터는 간 세포에 있어서 기존 TBG 프로모터 단독보다 유전자 전사 효율과 단백질의 발현이 현저히 증가되었음을 확인하였다.
실시예 4. eTBG 프로모터 특이성 확인
CMV 인핸서와 TBG 프로모터를 결합한 융합 프로모터의 특이성을 확인하기 위하여, TBG 프로모터 외 조직 특이적 발현을 보임이 공지된 다른 프로모터와 상기 CMV 인핸서를 결합하여 효능을 확인하였다. 이를 위하여 골수계세포, 성상세포 또는 심근세포에서 특이적으로 작용한다고 알려진 CD68, GFAP(glial fibrillary acidic protein) 및 TNT4(Troponin T2 cardiac type, promoter 4) 프로모터 앞에 CMV 인핸서를 추가한 벡터를 상기 실시예 1 및 실시예 2와 동일한 방법으로 제작하였다(도 5 중 A).
본 발명의 융합 프로모터를 포함한 벡터(eTBG:GFP)와 비교군(CMV:GFP, eCD68:GFP, eGRAP:GFP, eTNT4:GFP)의 조직 특이성을 평가하기 위하여, 섬유모세포주인 NIH3T3 세포주에 상기 벡터들을 형질주입하고 GFP의 발현을 역상형광현미경(Nikon, Eclipse Ti-S)의 녹색 형광 필터를 통해 확인한 후, 100배의 배율로 이미지를 촬영하였다. 이 후 상기 실시예 3과 동일한 방식으로 qRT-PCR을 시행하였다.
그 결과 도 5 중 B 및 C와 같이, 본 발명에 따른 eTBG 프로모터의 경우 간세포가 아닌 섬유모세포에서는 발현이 거의 나타나지 않아서 조직 특이성이 단백질 및 mRNA 수준에서 유지되고 있음을 확인하였다. 그러나 eTBG를 제외한 다른 비교군 프로모터들은 발현되지 않아야 할 섬유모세포주인 NIH3T3 세포에서 발현이 확인되고 있으므로, 조직 특이성이 손실되었음을 알 수 있었다.
따라서, 인핸서와 조직 특이적 프로모터를 결합시킨 융합 프로모터에 있어서, 그 발현 강도가 강해졌다하더라도 기존 보유한 조직 특이성이 손실될 수도 있음을 확인하였다.
그러므로 본 발명에 따른 CMV 인핸서와 TBF 프로모터가 결합된 융합 프로모터는 간에서의 유전자 전사 효율 및 단백질 발현 효능이 매우 우수하게 증가되었을 뿐만 아니라 기존 보유한 조직 특이성이 손상되지 않아, 간 또는 간 유래 세포에서 우수한 특이적 발현을 보일 수 있는 프로모터임을 상기 실시예들을 통하여 확인하였다.
종합적으로 본 발명에 따른 TBG 프로모터와 CMV 인핸서를 결합시킨 융합 프로모터는 간 세포 특이적인 발현을 보이며 기존 TBG 프로모터 단독으로 작용할 때보다 유전자 전사 효율과 단백질의 발현이 현저히 증가된 것을 확인한 바, 본 발명에 따른 융합 프로모터는 기존 TBG 프로모터가 가진 단점을 우수하게 개선한 프로모터이므로 이를 간 질환 유전자 치료를 위하여 유용하게 활용할 수 있다.

Claims (12)

  1. 서열번호 1로 표시되는 거대 세포 바이러스(Cytomegalovirus, CMV) 인핸서의 전체 또는 이의 일부 서열; 및 서열번호 2로 표시되는 티록신 결합 글로불린(thyroxine-binding globulin, TBG) 프로모터의 전체 또는 이의 일부 서열;이 작동가능하게 연결된 융합 프로모터.
  2. 제 1항에 있어서,
    상기 융합 프로모터는 서열번호 4로 표시되는 것을 특징으로 하는, 융합 프로모터.
  3. 제 1항에 있어서,
    상기 서열번호 1로 표시되는 거대 세포 바이러스(Cytomegalovirus, CMV) 인핸서의 전체 또는 이의 일부 서열과 상기 서열번호 2로 표시되는 티록신 결합 글로불린(thyroxine-binding globulin, TBG) 프로모터의 전체 또는 이의 일부 서열은 서열번호 3으로 표시되는 링커로 결합되는 것을 특징으로 하는, 융합 프로모터.
  4. 제 1항에 있어서,
    상기 융합 프로모터는 간 또는 간 유래 세포에서 특이적으로 발현되는 것을 특징으로 하는, 융합 프로모터.
  5. 제 1항 내지 제 4항 중 어느 한 항에 따른 융합 프로모터를 포함하는 재조합 벡터.
  6. 제 5항에 있어서,
    상기 재조합 벡터는 암피실린(ampicilin), 테트라사이클린(tetracyclin), 카나마이신(kanamycin), 클로람페니콜(chloroamphenicol), 스트렙토마이신 (streptomycin) 및 네오마이신(neomycin)으로 이루어진 군에서 선택되는 하나 이상의 항생제 저항성 유전자를 포함하는 것을 특징으로 하는 재조합 벡터.
  7. 제 5항에 따른 재조합 벡터를 포함하는, 간 세포 특이적 목적 유전자 발현 유도용 조성물.
  8. 제 7항에 있어서,
    상기 간 세포는 정상 간 세포, 간암세포, 간 줄기세포 및 유도만능줄기세포 기원의 간 세포로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 하는, 조성물.
  9. 제 5항의 재조합 벡터로 형질전환된 숙주 세포.
  10. 제 9항에 있어서,
    상기 세포는 간 유래 세포인 것을 특징으로 하는 숙주 세포.
  11. 제 5항의 재조합 벡터를 숙주 세포에 형질전환하여, 숙주 세포에서 목적 단백질을 발현시키는 방법.
  12. 제 9항에 따른 숙주 세포를 배양하는 단계; 및
    상기 배양된 숙주 세포 또는 숙주 세포 배양 배지로부터 발현된 목적 단백질을 수득하는 단계;를 포함하는 목적 단백질 제조방법.
PCT/KR2022/000048 2021-01-04 2022-01-04 조직 특이적 발현을 위한 융합 프로모터 및 이의 용도 WO2022146124A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210000502A KR102590276B1 (ko) 2021-01-04 2021-01-04 조직 특이적 발현을 위한 융합 프로모터 및 이의 용도
KR10-2021-0000502 2021-01-04

Publications (1)

Publication Number Publication Date
WO2022146124A1 true WO2022146124A1 (ko) 2022-07-07

Family

ID=82260897

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/000048 WO2022146124A1 (ko) 2021-01-04 2022-01-04 조직 특이적 발현을 위한 융합 프로모터 및 이의 용도

Country Status (2)

Country Link
KR (1) KR102590276B1 (ko)
WO (1) WO2022146124A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101038126B1 (ko) * 2010-11-30 2011-05-31 주식회사 엘지생명과학 새로운 융합 프로모터 및 이를 포함하는 재조합 벡터
WO2014151341A1 (en) * 2013-03-15 2014-09-25 The Trustees Of The University Of Pennsylvania Compositions and methods for treating mpsi
US20190345224A1 (en) * 2016-05-20 2019-11-14 President And Fellows Of Harvard College Gene Therapy Methods for Age-Related Diseases and Conditions

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101038126B1 (ko) * 2010-11-30 2011-05-31 주식회사 엘지생명과학 새로운 융합 프로모터 및 이를 포함하는 재조합 벡터
WO2014151341A1 (en) * 2013-03-15 2014-09-25 The Trustees Of The University Of Pennsylvania Compositions and methods for treating mpsi
US20190345224A1 (en) * 2016-05-20 2019-11-14 President And Fellows Of Harvard College Gene Therapy Methods for Age-Related Diseases and Conditions

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GenBank NCBI; . : "Cloning vector pAAV-LacZ, complete sequence", XP055949058, retrieved from NLM *
DATABASE GenBank NCBI; . : "Human thyroxine-binding globulin gene, complete cds", XP055949059, retrieved from NLM *

Also Published As

Publication number Publication date
KR102590276B1 (ko) 2023-10-16
KR20220098616A (ko) 2022-07-12

Similar Documents

Publication Publication Date Title
KR100522369B1 (ko) 조건성 복제기원을 지닌 환상 디엔에이분자, 이의 제조방법 및 유전자 요법에 있어서 이의 용도
KR101038126B1 (ko) 새로운 융합 프로모터 및 이를 포함하는 재조합 벡터
JP7189943B2 (ja) 細胞の遺伝子修飾のための非組込みｄｎａベクター
Guild et al. Development of retrovirus vectors useful for expressing genes in cultured murine embryonal cells and hematopoietic cells in vivo
KR20210056329A (ko) 신규 cas12b 효소 및 시스템
WO2019062522A1 (zh) 一种sgRNA、改造的Cas9蛋白及试剂盒
KR20010071227A (ko) 무세포 키메라플라스티 및 이형이중나선 돌연변이성벡터를 진핵세포에 이용
CA2232234A1 (en) Methods for production of recombinant plasmids
CN107109434A (zh) 新颖cho整合位点和其用途
US6653132B1 (en) IRES sequences with high translational efficiency and expression vectors containing the sequence
KR101323542B1 (ko) 조건성 복제 오리진을 보유하는 원형 ｄｎａ 분자, 이의제조방법 및 이를 유전자치료에 사용하는 방법
AU2002248173B2 (en) Compositions and methods for rapidly generating recombinant nucleic acid molecules
CN110551713A (zh) 用于修饰梭状芽孢杆菌属细菌的优化的遗传工具
TW202233844A (zh) Aav衣殼及含有其之組成物
JP2012515532A (ja) Ｍｉｒ−２１プロモーター駆動性標的がん治療
EP4284935A1 (en) Functional nucleic acid molecule and method
WO2024053933A1 (ko) Mrna의 세포내 안정성과 생합성을 향상시키는 utr 서열을 포함하는 구성물과 그 사용
CN111733184B (zh) 腺病毒包装方法
WO2022146124A1 (ko) 조직 특이적 발현을 위한 융합 프로모터 및 이의 용도
CN111518812B (zh) 一种编辑绵羊FGF5基因实现选择性剪接的sgRNA、成套核酸分子和应用
Wang et al. Cell compatibility of an eposimal vector mediated by the characteristic motifs of matrix attachment regions
CN111235183B (zh) 一种talen表达载体及其快速制备方法及靶基因和细胞双标记系统和应用
US20210292787A1 (en) Pseudotyped insect baculovirus gene transfer system and pseudotyped baculovirus for shrimps, construction method and use thereof
US20220380750A1 (en) Method for the production of raav and method for the in vitro generation of genetically engineered, linear, single-stranded nucleic acid fragments containing itr sequences flanking a gene of interest
KR20220049619A (ko) 유전자 발현 조절 시스템

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22734797

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22734797

Country of ref document: EP

Kind code of ref document: A1