WO2024053933A1 - Mrna의 세포내 안정성과 생합성을 향상시키는 utr 서열을 포함하는 구성물과 그 사용 - Google Patents

Mrna의 세포내 안정성과 생합성을 향상시키는 utr 서열을 포함하는 구성물과 그 사용 Download PDF

Info

Publication number
WO2024053933A1
WO2024053933A1 PCT/KR2023/012989 KR2023012989W WO2024053933A1 WO 2024053933 A1 WO2024053933 A1 WO 2024053933A1 KR 2023012989 W KR2023012989 W KR 2023012989W WO 2024053933 A1 WO2024053933 A1 WO 2024053933A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
sequence
nucleic acid
untranslated region
artificial nucleic
Prior art date
Application number
PCT/KR2023/012989
Other languages
English (en)
French (fr)
Inventor
황태순
백순명
김해숙
홍성의
김성광
허동혁
조은비
Original Assignee
주식회사 테라젠바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 테라젠바이오 filed Critical 주식회사 테라젠바이오
Publication of WO2024053933A1 publication Critical patent/WO2024053933A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • the present invention relates to sequences for stabilizing nucleic acids, specifically, untranslated region (UTR) sequences that improve the intracellular stability and biosynthesis of mRNA, and compositions for stabilizing nucleic acids containing the same.
  • UTR untranslated region
  • mRNA Unlike DNA, mRNA has the advantage of being able to temporarily express desired proteins directly in the cytoplasm without having to enter the nucleus, so it is attracting attention as a new treatment method in the health/medical field.
  • global biotech and pharmaceutical companies are actively attempting to use mRNA vaccines to treat and prevent diseases, but mRNA is structurally less stable than DNA, so there are limits to its industrial use. Therefore, in order to solve this problem, attempts have recently been made to increase the intracellular stability of mRNA and improve the efficiency of protein biosynthesis using UTR (Untranslational region).
  • UTR plays an auxiliary role in enabling the effective synthesis of peptides or proteins to be targeted for treatment, and is independent from the sequence of the gene to be synthesized, enabling the expression of various peptides or proteins.
  • UTR improves the stability of mRNA vaccines and allows antigens (neoantigens in the case of cancer vaccines) to be synthesized efficiently in vivo, making it highly effective in treating and preventing diseases even with a small amount of vaccine administered. Effects can be expected.
  • the present invention relates to a sequence for stabilizing nucleic acids, specifically, an untranslated region (UTR) sequence that improves the intracellular stability and biosynthesis of mRNA, and a composition for stabilizing nucleic acids containing the same.
  • UTR sequence of the present invention is expected to be widely used in the health/medical field because it has excellent nucleic acid stabilization and expression enhancement effects.
  • One object of the present invention is to provide a sequence for stabilizing nucleic acids, specifically, an untranslated region (UTR) sequence that improves the intracellular stability and biosynthesis of mRNA, and a method for selecting the same.
  • UTR untranslated region
  • Another object of the present invention is to provide an artificial nucleic acid containing a nucleic acid stabilizing sequence, specifically an untranslated region (UTR) sequence that improves the intracellular stability and biosynthesis of mRNA, and a method for producing the same.
  • a nucleic acid stabilizing sequence specifically an untranslated region (UTR) sequence that improves the intracellular stability and biosynthesis of mRNA
  • Another object of the present invention is to provide a vector containing the artificial nucleic acid and a method for producing the same.
  • Another object of the present invention is to provide a transformant transformed with a vector containing the artificial nucleic acid, and a method for producing the same.
  • Another object of the present invention is to provide a composition for stabilizing nucleic acids containing the artificial nucleic acid, and a method for producing the same.
  • Another object of the present invention is to provide a composition for enhancing immunity containing the artificial nucleic acid, and a method for producing the same.
  • Another object of the present invention is to provide a kit for detecting nucleic acid containing the artificial nucleic acid, and a method for producing the same.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating diseases containing the artificial nucleic acid, and a method for producing the same.
  • the term “untranslated region (UTR)” refers to a portion of a nucleic acid molecule that is not translated into protein.
  • the untranslated region located in the 5' direction of the nucleic acid is called 5'-UTR, and the untranslated region located in the 3' direction of the nucleic acid is called 3'-UTR.
  • a 5'-UTR is located 5' (i.e. "upstream") of the open reading frame and is typically understood to be a specific section of messenger RNA (mRNA) located 5' of the open reading frame of an mRNA.
  • the 5'-UTR is 10 to 100, 20 to 100, 20 to 80, 20 to 60, 20 to 50, 20 to 40, or 20 to 30 nucleotides (nt) in length.
  • the 5'-UTR may contain elements for regulating gene expression, so-called regulatory elements, and, but is not limited to, such regulatory elements may be ribosome binding sites.
  • the 5'-UTR can be modified post-transcriptionally through the addition of 5'-CAP.
  • the 5'-UTR of an mRNA is not translated into an amino acid sequence, and the 5'-UTR sequence is generally encoded by the gene that is transcribed into each mRNA during the gene expression process.
  • the genomic sequence may be transcribed, including optional introns, and then modified through processes such as 5'-capping or splicing.
  • the 5'-UTR is the nucleotide adjacent to the 5'-CAP of the modified mRNA, typically corresponding to the transcription start site.
  • “Corresponding” herein means that the 5'-UTR sequence may be an RNA sequence, such as an mRNA sequence, or a DNA sequence that corresponds to such an RNA sequence.
  • a 3'-UTR is located 3' (i.e. "downstream") of the open reading frame and is typically understood to be a specific section of messenger RNA (mRNA) located 3' of the open reading frame of an mRNA.
  • the 3'-UTR is 10 to 1000, 10 to 500, 20 to 500, 20 to 300, 20 to 200, 20 to 100, 20 to 80, 20 to 60, 20 to 50. , 20 to 40, or 20 to 30 nucleotides (nt) in length. It is located between the protein-coding region of the mRNA and the poly A sequence.
  • the 3'-UTR sequence is generally encoded by a gene that is transcribed into each mRNA during the gene expression process, and the genomic sequence is transcribed, including an optional intron, and then modified through processes such as splicing or 3'-polyadenylation. You can.
  • the 3'-UTR is the nucleotide adjacent to the poly A sequence of the modified mRNA and typically corresponds to the transcription termination site. “Corresponding” herein means that the 3'-UTR sequence may be an RNA sequence, such as an mRNA sequence, or a DNA sequence that corresponds to such an RNA sequence.
  • nucleic acid includes deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Used synonymously with the term “polynucleotide”. Preferably, it is a polymer composed of nucleotide monomers covalently linked to each other through phosphodiester bonds of the sugar/phosphate backbone. or base modified, sugar modified, or backbone modified DNA or RNA.
  • nucleic acid stabilization in the present invention is to prevent structural collapse or modification of DNA or RNA, more preferably RNA, even more preferably mRNA, SEQ ID NO: 1 to SEQ ID NO: 18, and sequence of the present invention
  • sequences represented by SEQ ID NOs: 20 to 37 were each evaluated as having excellent nucleic acid stabilizing effects.
  • sequence homology is a percentage indicating the degree to which two sequences being compared are identical. To determine the degree of homology, it is preferable that the sequences being compared are of the same length. However, if the sequence lengths are different, the calculation is based on the longer sequence among the compared sequences. For example, a 10 nt sequence has 80% homology with an 8 nt sequence, which is represented by the same sequence as part of it.
  • the artificial nucleic acid having an excellent nucleic acid stabilizing effect of the present invention is a sequence having at least 70% homology to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37. It may be an artificial nucleic acid containing. Alternatively, the artificial nucleic acid of the present invention may be an artificial nucleic acid containing a sequence having at least 80% homology to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37.
  • the artificial nucleic acid of the present invention may be an artificial nucleic acid containing a sequence having at least 90% homology to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37.
  • the artificial nucleic acid of the present invention may be an artificial nucleic acid containing a sequence having at least 95% homology to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37.
  • the artificial nucleic acid of the present invention may be an artificial nucleic acid containing a sequence having 100% homology to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37.
  • artificial nucleic acid can be understood as a non-natural nucleic acid molecule that does not exist in nature.
  • the artificial nucleic acid may be composed 100% of sequences that do not exist in nature, or may be composed of a mixture of some sequences that exist in nature (wild type) and some sequences that do not exist in nature. In the case where part of the sequence that exists in nature and part of sequence that does not exist in nature are mixed, the sequence that exists in nature may be a mixture of sequences derived from one or more species.
  • Artificial nucleic acids may be non-natural due to non-naturally occurring modifications of their individual sequences, for example, structural modifications of nucleotides that do not occur naturally. Artificial nucleic acids may also be DNA molecules, RNA molecules, or hybrid molecules containing DNA and RNA portions.
  • the term “vector” can be understood as a type of artificial nucleic acid.
  • the vector is an artificial nucleic acid selected for nucleic acid stabilization, specifically SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37. It is a concept that includes a sequence with .
  • These vectors may be storage vectors, expression vectors, cloning vectors, transport vectors, etc.
  • a storage vector is a vector that allows convenient storage of nucleic acid molecules, such as mRNA molecules.
  • Expression vectors can be used for the production of RNA, such as mRNA, or expression products such as peptides, polypeptides, or proteins.
  • Cloning vectors are typically vectors that contain cloning sites that can be used to incorporate nucleic acid sequences into the vector.
  • Cloning vectors may be, for example, plasmid vectors or bacteriophage vectors.
  • a transport vector is a vector suitable for transporting a nucleic acid molecule into a cell or organism, and may be, for example, a viral vector.
  • a vector in the context of the present invention may be, for example, an RNA vector or a DNA vector.
  • the vector is a DNA molecule.
  • the vector of the present invention is at least 70% identical to an artificial nucleic acid selected for nucleic acid stabilization, specifically, any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37. It includes a sequence having homology and a sequence of a target gene for expression control (sequence encoding the target protein). It is preferably a plasmid vector, but is not limited thereto.
  • the term “transfection” refers to introducing a nucleic acid molecule such as a DNA or RNA (e.g., mRNA) molecule into a cell, preferably into a eukaryotic cell, to change the original trait of the introduced subject.
  • the transformation can be performed by any method known to those skilled in the art for introducing nucleic acid molecules into cells, preferably into eukaryotic cells such as mammalian cells. These methods include, for example, electroporation, lipofection based on cationic lipids and/or liposomes, calcium phosphate precipitation, nanoparticle-based transfection, virus-based transfection, or DEAE-dextran or polyethyleneimine, etc. It involves transfection based on the same cationic polymer.
  • the transformation may be performed using a virus, for example, a lentivirus.
  • An introduced subject whose original characteristics are changed by being transformed in the manner described above is called a transformant.
  • the term “immunity-boosting” refers to the amplification of a desired immune response against a selected antigen, such as a characteristic component of a bacterial surface, viral particle, tumor antigen, etc.
  • the immune response can be induced to amplify naturally or artificially, and in the case of artificial amplification of the immune response, vaccine administration is the most common method.
  • a vaccine is typically understood as a prophylactic or therapeutic substance that provides at least one antigen, preferably an immunogen.
  • the antigen or immunogen may be derived from any material suitable for vaccination.
  • the antigen or immunogen may be derived from bacteria or viral particles, etc., or from a tumor or cancerous tissue. Antigens or immunogens stimulate the adaptive immune system in vivo.
  • mRNA has the advantage of being able to temporarily express desired proteins directly in the cytoplasm without having to enter the nucleus, so it is attracting attention as a new treatment method in the health/medical field.
  • mRNA has lower structural stability than DNA, which limits its industrial use. Therefore, in order to solve this problem, attempts have recently been made to increase the intracellular stability of mRNA and improve the efficiency of protein biosynthesis using UTR (Untranslational region).
  • any one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37 which is excellent in the nucleic acid stabilizing effect of the present invention, or having at least 70% homology thereto
  • the sequences can be administered as a vaccine together with nucleic acids from suitable antigens or immunogens for the desired immune enhancement.
  • any one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37 of the present invention, or a sequence having 70% or more homology thereto is used as an antigen in a nucleic acid vaccine.
  • the vaccine may additionally contain adjuvants to boost the desired effect.
  • Adjuvants are typically pharmaceutical and/or immunological agents that can modify or enhance the effect of another agent, such as a drug or vaccine.
  • an adjuvant can be recognized by the innate immune system and induce an innate immune response.
  • the use of the vaccine of the present invention can be infinitely expanded depending on the type of antigen or immunogen included. For example, if it contains nucleic acid from cancer tissue as an antigen or immunogen, the vaccine is a cancer vaccine.
  • the cancer vaccine may refer to an active immunotherapy method that attacks cancer cells and eliminates cancer by activating the immune system in vivo by administering cancer-specific antigens carried by cancer cells to cancer patients and activating the immune function in vivo.
  • the nucleic acid derived from the cancer tissue is preferably a neoantigen (a specific antigen produced only from cancer cells), but is not limited thereto.
  • the cancer may refer to a disease that forms a mass or tumor composed of undifferentiated cells that proliferate indefinitely, ignoring order within the tissue.
  • it may be a general term for a group of diseases that can take the life of an individual by infiltrating and destroying surrounding normal tissues or organs and metastasizing from the primary lesion to any organ of the individual, creating a new growth site.
  • cancers include oral cancer, liver cancer, stomach cancer, colon cancer, breast cancer, lung cancer, bone cancer, pancreatic cancer, skin cancer, head cancer, cervical cancer, skin cancer, melanoma, cervical cancer, ovarian cancer, colon cancer, small intestine cancer, rectal cancer, fallopian tube carcinoma, and anus.
  • Peripheral cancer endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, lymph node cancer, bladder cancer, gallbladder cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, From the group consisting of prostate cancer, chronic leukemia, acute leukemia, lymphocytic lymphoma, renal cancer, ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma, and pituitary adenoma. It may be any one selected, but is not limited thereto.
  • the term “markers” refers to indicators that can detect changes in the body using proteins, DNA, RNA, metabolites, etc.
  • tumor markers TMs
  • cancer cell markers refer to cancer cell markers. It is a substance that indicates the presence of a substance that is produced by cancer cells, or a substance that normal cells in the body produce by reacting with cancer cells. It means that examining the substance in blood, tissue, excrement, etc. is helpful as an indicator for cancer diagnosis or treatment. .
  • CEA Carcinoembryonic Antigen
  • a type of glycoprotein is a pan-tumor marker that is significantly increased in colon cancer, pancreatic cancer, stomach cancer, and breast cancer
  • AFP Alfa-Fetoprotein
  • CA 19 a marker for pancreatic and biliary tract cancer.
  • CA 125 a marker for ovarian cancer
  • PSA Prostate Specific Antigen
  • the artificial nucleic acid selected for stabilizing the nucleic acid of the present invention specifically, a sequence having at least 70% homology to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37.
  • the disease may be a cancer disease, and SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 20 of the present invention
  • An artificial nucleic acid containing a sequence having more than 70% homology to any one selected from the group consisting of number 37 is used as an antibody suitable for labeling cancer cells, or a composition for labeling cancer cells together with a nucleic acid sequence complementary to a nucleic acid derived from cancer cells. It can be.
  • the composition for labeling cancer cells can be used as a composition for a vaccine, and may additionally contain an adjuvant (component) to boost the expected effect.
  • an adjuvant component
  • the term “kit” refers to a set containing all or part of a preparation for detecting a target substance.
  • the kit may be applied to a biological sample isolated from an individual.
  • the biological sample isolated from the subject may be one or more selected from the group consisting of blood, saliva, tissue, cells, sputum, bronchial cell lavage fluid, and urine.
  • the biological sample may be a dried liquid or tissue sample, or a sample contained in a liquid.
  • the purpose of the kit may be to confirm the presence or absence of a specific gene or nucleic acid from a biological sample, and the kit preferably includes SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 of the present invention.
  • the kit may contain a sequence having more than 70% homology to any one selected from the group consisting of SEQ ID NO: 37.
  • the kit in the case where the kit is for detecting the A gene or nucleic acid in a biological sample isolated from an individual and includes a B nucleic acid that binds complementary to the A gene or nucleic acid as a whole or part of the preparation, the kit includes a sequence having at least 70% homology with any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37 of the present invention for stabilization of the B nucleic acid. can do.
  • the term “pharmaceutical composition” refers to a composition administered for the prevention or treatment of a desired disease.
  • the above diseases may be selected without limitation as long as they require prevention or treatment, but for the purpose of the present invention, they may be prevented or treated by regulating gene expression.
  • the gene may be a gene that directly affects the prevention or treatment of a disease, such as a genetic disease, or may indirectly affect the prevention or treatment of a disease, for example, by enhancing immunity in vivo, such as stimulating immune cells. It may be something that can be expected.
  • the pharmaceutical composition contains at least 70% of any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37 of the present invention for regulation of desired gene expression. It may contain a sequence having homology.
  • a pharmaceutical composition for preventing or treating cancer a sequence having at least 70% homology to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37
  • It may be a pharmaceutical composition containing a nucleic acid for suppressing the expression of an oncogene.
  • It may be a pharmaceutical composition.
  • it may be a pharmaceutical composition comprising a sequence having at least 70% homology to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37, and a nucleic acid for stimulating immune cells. .
  • it may be a pharmaceutical composition comprising a sequence having at least 70% homology to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37, and a nucleic acid for labeling cancer cells.
  • it may be a pharmaceutical composition comprising a sequence having at least 70% homology to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37, and a patient-specific neoantigen.
  • a synthetic long peptide comprising a sequence having at least 70% homology to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37 and a plurality of patient-specific neoantigens
  • It may be a synthetic long peptide (SLP) pharmaceutical composition.
  • the pharmaceutical composition may be in the form of capsules, tablets, granules, injections, ointments, powders, or beverages, and may be intended for human subjects.
  • the pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, etc., topical preparations, suppositories, and injections according to conventional methods, but it is preferable to use suppositories or injections.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, colorants, flavorings, etc. for oral administration, and buffers, preservatives, and analgesics for injections.
  • Topics, solubilizers, isotonic agents, stabilizers, etc. can be mixed and used, and for topical administration, bases, excipients, lubricants, preservatives, etc. can be used.
  • the dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing it with a pharmaceutically acceptable carrier as described above.
  • a pharmaceutically acceptable carrier as described above.
  • for oral administration it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injections, it can be manufactured in the form of unit dosage ampoules or multiple dosage forms. there is.
  • it can be formulated as a solution, suspension, tablet, capsule, sustained-release preparation, etc.
  • examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil may be used.
  • fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, etc. may be additionally included.
  • the pharmaceutical composition according to the invention may be administered via oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal routes.
  • parenteral administration is preferred.
  • the parenteral administration includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition of the present invention can also be administered in the form of a suppository for rectal administration.
  • the pharmaceutical composition of the present invention may vary depending on several factors, including the activity of the specific compound used, age, body weight, general health, gender, diet, time of administration, route of administration, excretion rate, drug formulation, and severity of the specific disease to be prevented or treated.
  • the dosage of the pharmaceutical composition may vary depending on the patient's condition, body weight, degree of disease, drug form, administration route and period, but may be appropriately selected by a person skilled in the art. Administration may be administered once a day, or may be administered several times. The above dosage does not limit the scope of the present invention in any way.
  • an artificial nucleic acid comprising a sequence having at least 70% homology to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37, , wherein the sequence is an untranslated region sequence, and the sequence is any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37.
  • It provides an artificial nucleic acid that is a sequence having 90% or more homology, wherein the sequence is 95% or more identical to any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 18, and SEQ ID NO: 20 to SEQ ID NO: 37.
  • an artificial nucleic acid is provided, wherein the artificial nucleic acid is a sequence having at least 70% homology to any one selected from SEQ ID NO: 1 to SEQ ID NO: 18; and a sequence having at least 70% homology to any one selected from SEQ ID NO: 20 to SEQ ID NO: 37, wherein the artificial nucleic acid is any one selected from SEQ ID NO: 1 to SEQ ID NO: 18.
  • an artificial nucleic acid in which a sequence having at least 70% homology is positioned at the 5', and a sequence having at least 70% homology with any one selected from SEQ ID NO: 20 to SEQ ID NO: 37 is positioned at the 3'; ,
  • the artificial nucleic acid provides an artificial nucleic acid that further includes any one or more of an open reading frame sequence, a promoter sequence, a Kozak sequence, and a poly A tail sequence.
  • a vector containing the artificial nucleic acid is provided, and the vector is a plasmid vector or a viral vector.
  • a transformant transformed with the vector is provided, wherein the transformant is a virus, bacterium, plant cell, or animal cell. to provide.
  • composition for stabilizing nucleic acids containing the artificial nucleic acids is provided.
  • composition for enhancing immunity containing the artificial nucleic acid is provided, and the composition for enhancing immunity is provided as a composition for a vaccine.
  • composition for labeling cancer cells containing the artificial nucleic acid is provided, and the composition for labeling cancer cells is a vaccine composition.
  • a kit for detecting nucleic acids containing the artificial nucleic acids is provided.
  • a pharmaceutical composition for preventing or treating diseases containing the artificial nucleic acid is provided.
  • step (a) selecting genes with an expression level in the top 20% from a database (b) primary selection of the untranslated region sequence of the selected gene; And, (c) secondary selection of untranslated region sequences that do not have secondary structures among the selected untranslated region sequences.
  • a method of selecting untranslated region sequences lacking secondary structure in step (c) may be to calculate Minimum Free Energy (MFE) and select 5' UTR sequences whose value is greater than -10.
  • MFE Minimum Free Energy
  • the method of selecting the untranslated region sequence for nucleic acid stabilization is that, after step (b), if several isoforms of the same gene exist among the selected untranslated region sequences, the untranslated region sequence of the shortest sequence is divided into 2 tea sorting step; And/or clustering the miRNA using the binding energy between the selected UTR sequence and the miRNA, and then further selecting the untranslated region sequence based on the information.
  • preparing an artificial nucleic acid to include a sequence having 70% or more homology to the untranslated region sequence selected by any one or more of the methods for selecting untranslated region sequences for stabilizing nucleic acids.
  • a method for producing an artificial nucleic acid comprising;
  • the UTR sequence of the present invention is expected to be widely used in the health/medical field because it has excellent nucleic acid stabilization and expression enhancement effects.
  • Figure 1 is a diagram showing the structure of a plasmid DNA construct for IVT mRNA synthesis containing a selection gene UTR, according to an embodiment of the present invention.
  • FIG. 2 is a schematic diagram of a plasmid vector using a selection gene according to an embodiment of the present invention. This shows an example where the RGS5 gene is used as a representative example, but plasmid vectors for other genes also have the same structure with only the gene changed.
  • Figure 3 shows the results of confirming the linearization of candidate UTR plasmid DNA vectors before IVT (in vitro transcription) according to an embodiment of the present invention.
  • Figure 4 shows the results of d2eGFP fluorescence expression analysis according to the selected gene UTR sequence using fluorescence imaging, according to an embodiment of the present invention.
  • Figure 5 shows the results of d2eGFP fluorescence expression analysis according to the selected gene UTR sequence using flow cytometry, according to an embodiment of the present invention.
  • Figure 6 shows the results of confirming transfection and translation efficiency according to the selected gene UTR sequence using flow cytometry, according to an embodiment of the present invention.
  • genes with high in vivo expression levels are normalized using an in silico method under the assumption that they will contain UTRs that increase the stability of mRNA in vivo and have high translation efficiency.
  • GTEx Genotype-Tissue Expression
  • 1,689 genes with high expression levels were selected. The above 1,689 genes correspond to the top 10% of the 16,903 genes in the database.
  • candidate UTR sequences for nucleic acid stabilization were selected based on the 5' UTR and 3' UTR sequences of the selected genes.
  • 3' UTRs with a length of 20 nt to 300 nt are first selected, and if multiple isoforms of the same gene exist, the shortest 3' UTR among them is selected. was selected to initially select 1,077 3'UTR candidate sequences.
  • the binding energy between 1,077 candidate 3' UTR sequences and 2,657 types of miRNA was calculated (IntaRNA 2.0), and the types of binding miRNA and their energies were calculated. Clustering was performed using the cola R package.
  • UTR sequences classified into the same cluster as known UTR sequences through various prior literature in the art are secondarily selected, and then AU rich elements involved in mRNA degradation are identified by referring to the AU-Rich Element Database (ARED-Plus). Genes containing (ARE) in the 3' UTR were excluded. As a result, a total of 217 3' UTR candidate sequences were selected.
  • ARED-Plus AU-Rich Element Database
  • UTR sequences for which the Kozak sequence was optimized are shown in Table 1 (5' UTR) and Table 2 (3' UTR). As control UTRs for these, UTR sequences conventionally known in the art were used.
  • nucleic acid type order SEQ ID NO: 1 REG3A DNA AAACCATACCATATCCCACCAGAGAGTCGCAGCCACC SEQ ID NO: 2 REG3A RNA AAACCAUACCAUAUCCCACCAGAGAGUCGCAGCCACC SEQ ID NO: 3 HPX DNA GTCCTGTGGCTCTCTGCAGGCCACC SEQ ID NO: 4 HPX RNA GUCCUGUGGCCUCUGCAGGCCACC SEQ ID NO: 5 RGS5 DNA AGAAGGTCTGACAAAACAAAGAAACAAAACCTCAGGGCCACC SEQ ID NO: 6 RGS5 RNA AGAAGUGUCUGACAAAACAAAGAAACAAAACCUCAGGGCCACC SEQ ID NO: 7 CLPS DNA GTCTCCCGCCACCCACACCAGCTGTCCCAGCCACC SEQ ID NO: 8 CLPS RNA GUCUCCCGCCACCCACACCAGCUGUCCCAGCCACC SEQ ID NO: 9 APOC3 DNA CTGCTCAGTTCATCCCTAGAGGCAGCTGCTCCAGGAACAGAGCC
  • Example 3-1 Production of plasmid DNA for IVT mRNA synthesis containing UTR
  • IVT mRNA was produced through an RNA polymerase (T7 polymerase) reaction and then transfected into the K562 cell line to compare and analyze intracellular mRNA stability and protein expression ability.
  • IVT template DNA was produced.
  • plasmid DNA for IVT mRNA production was produced in which each UTR candidate sequence was inserted, and based on the pUC57-kan IVT plasmid vector backbone DNA, a vector for IVT mRNA production was designed and produced considering the linearization method and cap binding site. did.
  • DNA construct production was carried out using the in-fusion cloning technique, and when amplifying the insert fragment, the sequence was extended with a primer to share the 3' and 5' end sequences (15 bp) of the joining region.
  • the terminal region was ligated and cloned using a linearized plasmid vector and an in fusion cloning kit. Since the plasmid DNA from which the reaction was induced contained a kanamycin resistance gene, single colony selection was performed on an antibiotic medium supplemented with kanamycin, and d2EGFP with a short half-life was inserted into the CDS (coding sequence) region to compare protein expression between candidates. It is designed to be easy to use.
  • FIG. 1 shows a schematic diagram of a plasmid vector using the RGS5 gene as a representative example, but plasmid vectors for other genes also show the same structure with only the gene changed.
  • Plasmid DNA linearization was performed using restriction enzymes, and for this purpose, SmaI restriction enzyme (Enzynomics, cat# R015S) was used.
  • SmaI restriction enzyme Enzynomics, cat# R015S
  • the linearized plasmid DNA cut with the restriction enzyme SmaI was confirmed to change to a linearized form through agarose gel electrophoresis.
  • SmaI restriction enzyme As a result of the experiment, it was confirmed that all plasmid DNA containing the selection gene UTR sequence was changed from circular form to linear form by SmaI restriction enzyme. The results are shown in Figure 3.
  • Example 3-3 mRNA production and performance evaluation using linearized plasmid DNA
  • IVT mRNA synthesis was performed using eight types of linear plasmid DNA containing selected gene UTR sequences using the mMESSAGE mMACHINE® T7 Transcription Kit (Invitrogen, cat# AM1344). IVT was performed by RNA polymerase T7 polymerase to synthesize mRNA, and the T7 promoter sequence was embedded in eight types of linear plasmid DNA. Nucleoside triphosphate (NTPs) and Cap analog were added to the IVT process, and a 5' cap was attached to the 5' end of IVT mRNA using a co-transcriptional capping method. The concentration of the finally synthesized IVT mRNA was measured using a Nanodrop device, and purification was performed using the MEGAclearTM Transcription Clean-Up Kit (Invitrogen, cat# AM1908).
  • NTPs Nucleoside triphosphate
  • Cap analog were added to the IVT process, and a 5' cap was attached to the 5' end of IVT mRNA using a
  • the human myeloid leukemia cell line (K-562; human lymphoblast) was transfected with UTR candidate IVT mRNA encoding the d2EGFP sequence, a marker reporter gene, and translation efficiency was evaluated.
  • UTR candidate IVT mRNA transfection was performed using Lipofectamine MessengerMax (Invitrogen, cat# LMRNA015).
  • IVT mRNA synthesized from eight types of linear plasmid DNA containing control UTR and selected gene UTR sequences contains d2EGFP, a marker reporter gene (see Figure 1). After transfection into the human myeloid leukemia cell line, d2EGFP was confirmed to be expressed by IVT mRNA translation, and 2.5 ⁇ g of 8 types of d2EGFP-encoding IVT mRNA containing the selection gene UTR sequence was transferred to 5 Transfection was performed using MessengerMax. Since the translation efficiency of d2EGFP internal IVT mRNA varies depending on the selected gene UTR sequence, it is expected that there will be a difference in the amount of d2EGFP expression.
  • d2EGFP was analyzed by time at 4, 6, 8, 12, and 24 hours after transfection. Expression changes were analyzed by fluorescence imaging analysis and flow cytometry. The results are shown in Figures 4 and 5. In the case of fluorescence imaging analysis, d2EGFP expression was not found in the negative control group treated only with Lipofectamine MM at 12 hours after transfection in a previous study, so fluorescence microscopy conditions (Exposure time, Gain) were determined through background confirmation. .
  • d2EGFP expression was confirmed to be stably maintained until 24 hours later.
  • flow cytometry analysis only Live cells (%) were selected among all cells, and among them, only K-562 expressing d2EGFP was classified and the difference in d2EGFP expression according to the selected gene UTR sequence was compared and analyzed.
  • d2EGFP-encoding IVT mRNA transfection through lipofection maintained high cell viability for up to 24 hours in all UTR sequences.
  • d2EGFP expression was highest in the RGS5 UTR group, but all d2EGFP positive cells did not show significant differences over time. The results are shown in Figure 6.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

mRNA는 DNA와 다르게 핵 내로 들어갈 필요없이 세포질에서 바로 일시적으로 원하는 단백질이 발현될 수 있다는 장점이 있으므로 mRNA 백신을 이용하려는 시도가 활발하게 진행되고 있으나, mRNA는 DNA에 비해 구조적으로 안정도가 낮아 산업적으로 이용하기에 한계가 있는 실정이다. 따라서 본 발명은 mRNA의 세포 내 안정성과 생합성을 향상시키는 UTR 서열, 및 이를 포함하는 핵산 안정화용 조성물에 관한 것이다. 본 발명의 UTR서열은 핵산 안정화 및 타겟 단백질의 발현 증진 효과가 우수하므로, 보건/의료 분야에서 크게 이용될 것으로 기대된다.

Description

MRNA의 세포내 안정성과 생합성을 향상시키는 UTR 서열을 포함하는 구성물과 그 사용
본 발명은 핵산 안정화용 서열, 구체적으로는 mRNA의 세포 내 안정성과 생합성을 향상시키는 UTR(Untranslated region) 서열, 및 이를 포함하는 핵산 안정화용 조성물에 관한 것이다.
mRNA는 DNA와 다르게 핵 내로 들어갈 필요없이 세포질에서 바로 일시적으로 원하는 단백질이 발현될 수 있다는 장점이 있으므로, 보건/의료 분야에서 새로운 치료 방법으로 주목받고 있다. 특히 글로벌 바이오텍 및 제약사를 중심으로 질병 치료 및 예방을 위해 mRNA 백신을 이용하려는 시도가 활발하게 진행되고 있으나, mRNA는 DNA에 비해 구조적으로 안정도가 낮아 산업적으로 이용하기에 한계가 있는 실정이다. 따라서 최근 이러한 문제의 해결을 위해, UTR(Untranslational region)을 이용하여 mRNA의 세포내 안정성을 높이고, 단백질의 생합성 효율을 향상시키고자 하는 시도가 이루어지고 있다. UTR은 치료 타겟이 될 펩타이드 또는 단백질이 효과적으로 합성될 수 있도록 보조 역할을 하면서, 합성하고자 하는 유전자의 서열로부터 독립적이므로 다양한 펩타이드 또는 단백질의 발현을 가능하게 한다. 특히 mRNA 백신 분야에서, UTR은 mRNA 백신의 안정성을 향상시키고 생체 내에서 항원(암백신의 경우, 신항원)이 효율적으로 합성될 수 있도록 하므로, 적은 양의 백신 투여로도 질병 치료 및 예방에 높은 효과를 기대할 수 있다.
따라서 본 발명은 핵산 안정화용 서열, 구체적으로는 mRNA의 세포 내 안정성과 생합성을 향상시키는 UTR(Untranslated region) 서열, 및 이를 포함하는 핵산 안정화용 조성물에 관한 것이다. 본 발명의 UTR서열은 핵산 안정화 및 타겟 단백질의 발현 증진 효과가 우수하므로, 보건/의료 분야에서 크게 이용될 것으로 기대된다.
본 발명의 일 목적은 핵산 안정화용 서열, 구체적으로는 mRNA의 세포 내 안정성과 생합성을 향상시키는 UTR(Untranslated region) 서열, 및 이의 선별 방법을 제공하는 것이다.
본 발명의 다른 목적은, 핵산 안정화용 서열, 구체적으로는 mRNA의 세포 내 안정성과 생합성을 향상시키는 UTR(Untranslated region) 서열을 포함하는 인공 핵산, 및 이의 제조 방법을 제공하는 것이다.
*본 발명의 또 다른 목적은, 상기 인공 핵산을 포함하는 벡터, 및 이의 제조 방법을 제공하는 것이다.
본 발명의 또 다른 목적은, 상기 인공 핵산을 포함하는 벡터로 형질전환된 형질전환체, 및 이의 제조 방법을 제공하는 것이다.
본 발명의 또 다른 목적은, 상기 인공 핵산을 포함하는 핵산 안정화용 조성물, 및 이의 제조 방법을 제공하는 것이다.
본 발명의 또 다른 목적은, 상기 인공 핵산을 포함하는 면역 증강용 조성물, 및 이의 제조 방법을 제공하는 것이다.
본 발명의 또 다른 목적은, 상기 인공 핵산을 포함하는 핵산 검출용 키트, 및 이의 제조 방법을 제공하는 것이다.
본 발명의 또 다른 목적은, 상기 인공 핵산을 포함하는 질환의 예방 또는 치료용 약학적 조성물, 및 이의 제조 방법을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
이하, 본원에 기재된 다양한 구현예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세사항, 예컨대, 특이적 형태, 조성물 및 공정 등이 기재되어 있다. 그러나, 특정의 구현예는 이들 특이적 상세 사항 중 하나 이상, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. “한 가지 구현예” 또는 “구현예”에 대한 본 명세서 전체를 통한 참조는 구현예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구현예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현된 “한 가지 구현예” 또는 “구현예”의 상황은 반드시 본 발명의 동일한 구현예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구현예에서 어떠한 적합한 방법으로 조합될 수 있다.
명세서 내에 특별한 정의가 없으면 본 명세서에 사용된 모든 과학적 및 기술적인 용어는 본 발명이 속하는 기술분야에서 당업자에 의하여 통상적으로 이해되는 것과 동일한 의미를 가진다.
본 발명에서 용어 “비번역 부위(untranslated region; UTR)”는 단백질로 번역되지 않는 핵산 분자의 일부를 의미한다. 핵산의 5’ 방향에 위치한 비번역 부위를 5'-UTR, 핵산의 3’ 방향에 위치한 비번역 부위를 3'-UTR이라 한다. 자세하게, 5'-UTR은 오픈 리딩 프레임의 5'(즉 "업스트림")에 위치하며, 전형적으로 mRNA의 오픈 리딩 프레임의 5'에 위치한 messenger RNA(mRNA)의 특정한 구획(section)으로 이해된다. 바람직하게 5'-UTR은 10 내지 100개, 20 내지 100개, 20 내지 80개, 20 내지 60개, 20 내지 50개, 20 내지 40개, 또는 20 내지 30개의 뉴클레오티드(nt) 길이를 갖는다. 5'-UTR은 유전자 발현을 조절하기 위한 요소, 소위 조절 요소를 포함할 수 있고, 이에 제한되는 것은 아니나 이러한 조절 요소는 리보좀 결합 부위일 수 있다. 5'-UTR은 5'-CAP의 첨가를 통해 전사 후 변형될 수 있다. mRNA의 5'-UTR은 아미노산 서열로 번역되지 않으며, 5'-UTR 서열은 일반적으로 유전자 발현 과정 중 각각의 mRNA로 전사되는 유전자에 의해 코딩된다. 유전체 서열은 선택적 인트론을 포함하여 전사된 후, 5'-capping, 또는 splicing 등의 과정에 따라 변형될 수 있다. 5'-UTR은 변형된 mRNA의 5'-CAP에 근접한 뉴클레오티드로, 전형적으로 전사 시작 부위에 상응한다. 여기서의 "상응"은 5'-UTR 서열이 mRNA 서열과 같은 RNA 서열, 또는 이러한 RNA 서열에 상응하는 DNA 서열일 수 있음을 의미한다. 3'-UTR은 오픈 리딩 프레임의 3'(즉 "다운스트림")에 위치하며, 전형적으로 mRNA의 오픈 리딩 프레임의 3'에 위치한 messenger RNA(mRNA)의 특정한 구획(section)으로 이해된다. 바람직하게 3'-UTR은 10 내지 1000개, 10 내지 500개, 20 내지 500개, 20 내지 300개, 20 내지 200개, 20 내지 100개, 20 내지 80개, 20 내지 60개, 20 내지 50개, 20 내지 40개, 또는 20 내지 30개의 뉴클레오티드(nt) 길이를 갖는다. mRNA의 단백질을 코딩하는 영역과 폴리 A 서열 사이에 위치한다. 3’-UTR 서열은 일반적으로 유전자 발현 과정 중 각각의 mRNA로 전사되는 유전자에 의해 코딩되고, 유전체 서열은 선택적 인트론을 포함하여 전사된 후, splicing, 또는 3'-polyadenylation 등의 과정에 따라 변형될 수 있다. 3'-UTR은 변형된 mRNA의 폴리 A 서열에 근접한 뉴클레오티드로, 전형적으로 전사 종결 부위에 상응한다. 여기서의 "상응"은 3'-UTR 서열이 mRNA 서열과 같은 RNA 서열, 또는 이러한 RNA 서열에 상응하는 DNA 서열일 수 있음을 의미한다.
본 발명에서 용어 “핵산(nucleic acid)”은 DNA(deoxyribonucleic acid), 및 RNA(ribonucleic acid)를 포함하는 개념이다. 용어 “폴리뉴클레오티드”와 동의어로 사용된다. 바람직하게는 당/인산 백본의 포스포디에스터(phosphodiester) 결합에 의해 서로 공유결합된 뉴클레이티드 모노머를 포함하여 이루어진 폴리머이다. 또는 염기 변형된, 당 변형된, 또는 백본 변형된 DNA 또는 RNA를 포함한다.
본 발명에서 용어 “핵산 안정화(stabilizing nucleic acid)”란 세포 내, 또는 세포 외에서의 핵산 구조의 붕괴, 또는 변형을 방지하여 핵산 구조를 안정화시키는 개념이다. 일반적으로 RNA는 단일가닥(single strand)로 이루어지고 DNA에 비하여 활성도가 높으므로, 구조적 안정성이 낮다. 따라서 본 발명에서의 핵산 안정화는, DNA, 또는 RNA, 보다 바람직하게는 RNA, 더욱 보다 바람직하게는 mRNA의 구조적 붕괴 또는 변형을 방지하기 위한 것이며, 본 발명의 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 표시되는 서열은 각각이 핵산 안정화 효과가 우수한 것으로 평가되었다.
본 발명에서 용어 서열 상동성(sequence homology)이란 비교되는 두 서열이 동일한 정도를 나타내는 백분율이다. 상동성의 정도를 결정하기 위해 비교되는 서열은 동일한 길이인 것이 바람직하나, 서열 길이가 상이할 경우 비교되는 서열 중 길이가 긴 서열을 기준으로 산정한다. 예를 들어 10 nt의 서열은 그 중 일부로서 동일한 서열로 표시되는 8 nt 서열과 80%의 상동성을 가지는 것이다.
본 발명에 있어서, 본 발명의 핵산 안정화 효과가 우수한 인공 핵산은 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열을 포함하는 인공 핵산일 수 있다. 또는 본 발명의 인공 핵산은 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 80% 이상의 상동성을 가지는 서열을 포함하는 인공 핵산일 수 있다. 또는 본 발명의 인공 핵산은 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 90% 이상의 상동성을 가지는 서열을 포함하는 인공 핵산일 수 있다. 또는 본 발명의 인공 핵산은 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 95% 이상의 상동성을 가지는 서열을 포함하는 인공 핵산일 수 있다. 또는 본 발명의 인공 핵산은 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 100%의 상동성을 가지는 서열을 포함하는 인공 핵산일 수 있다.
본 발명에서 용어 “인공 핵산(artificial nucleic acid)”은 본디 자연계에 존재하지 않는 비천연 핵산 분자로 이해될 수 있다. 상기 인공 핵산은 자연계에 존재하지 않는 서열로 100% 구성되거나, 또는 자연계에 존재하는(야생형) 서열 일부와 자연계에 존재하지 않는 서열 일부가 혼합되어 구성될 수 있다. 자연계에 존재하는 서열 일부와 자연계에 존재하지 않는 서열 일부가 혼합되어 구성되는 경우에, 자연계에 존재하는 서열은 1종 이상의 종(species)로부터 유래한 서열의 혼합일 수 있다. 인공 핵산은 이의 개별 서열의 자연적으로 발생하지 않는 변형, 예를 들어 자연적으로 발생하지 않는 뉴클레오타이드의 구조적 변형 때문에 비-천연적일 수 있다. 또한 인공 핵산은 DNA 분자, RNA 분자, 또는 DNA 및 RNA 부분을 포함하는 하이브리드 분자일 수 있다.
본 발명에서 용어 “벡터(vector)”는 상기 인공 핵산의 일종으로 이해될 수 있다. 본 발명의 맥락에서 벡터는 핵산 안정화를 위해 선별된 인공 핵산, 구체적으로는 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열을 포함하는 개념이다. 이러한 벡터는 저장 벡터, 발현 벡터, 클로닝 벡터, 수송 벡터 등일 수 있다. 저장 벡터는 핵산 분자, 예를 들어 mRNA 분자의 간편한 저장을 허용하는 벡터이다. 발현 벡터는 RNA, 예를 들어 mRNA, 또는 펩타이드, 폴리펩타이드 또는 단백질과 같은 발현 생산물의 생산에 사용될 수 있다. 클로닝 벡터는 전형적으로 벡터 내로 핵산 서열을 합체하는데 사용될 수 있는 클로닝 부위를 포함하는 벡터이다. 클로닝 벡터는 예를 들어 플라스미드 벡터 또는 박테리오파지 벡터일 수 있다. 수송 벡터는 세포 또는 유기체 내로 핵산 분자를 수송하는데 적합한 벡터로서, 예를 들어 바이러스 벡터일 수 있다. 본 발명의 맥락에서 벡터는 예를 들어 RNA 벡터 또는 DNA 벡터일 수 있다. 바람직하게는 벡터는 DNA 분자이다. 바람직하게는 본 발명의 벡터는 핵산 안정화를 위해 선별된 인공 핵산, 구체적으로는 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열과 발현 조절을 목적하는 타겟 유전자의 서열(타겟 단백질을 코딩하는 서열)을 포함한다. 이는 플라스미드 벡터인 것이 바람직하나, 이에 제한되는 것은 아니다.
본 발명에서 용어 “형질전환(transfection)”은 DNA 또는 RNA(예를 들어 mRNA) 분자와 같은 핵산 분자를 세포 내, 바람직하게는 진핵 세포 내에 도입하여, 도입 대상체의 본래 형질을 변화시키는 것을 의미한다. 상기 형질전환은 세포 내로, 바람직하게는 포유동물 세포 등의 진핵 세포 내로 핵산 분자를 도입하기 위한 통상의 기술자에게 알려진 어느 방법으로 수행될 수 있다. 이러한 방법은 예를 들어 전기천공, 양이온성 지질 및/또는 리포좀에 기초한 리포펙션(lipofection), 칼슘 포스페이트 침전, 나노입자 기초의 형질주입, 바이러스 기초의 형질주입, 또는 DEAE-덱스트란 또는 폴리에틸렌이민 등과 같은 양이온성 폴리머 기초의 형질주입을 포함한다. 또는 상기 형질전환은 바이러스, 예를 들면 렌티바이러스를 이용하여 수행될 수 있다. 상기와 같은 방법으로 형질전환되어 본래의 형질이 변화된 도입 대상체를 형질전환체라 명명한다.
본 발명에서 용어 “면역 증강(immunity-boosting)”은 박테리아 표면, 바이러스 입자, 종양 항원 등의 특징적인 성분과 같은 선택된 항원에 대해 원하는 면역 반응이 증폭되는 것을 의미한다. 자연적으로, 또는 인위적으로 면역 반응이 증폭되도록 유도할 수 있으며, 인위적인 면역 반응 증폭의 경우 백신 투여가 가장 일반적인 방법이다. 백신(vaccine)은 전형적으로 적어도 하나의 항원, 바람직하게는 면역원을 제공하는 예방 또는 치료적 물질로 이해된다. 항원 또는 면역원은 백신 접종에 적합한 어느 물질로부터 유래(derived)될 수 있다. 예를 들어, 항원 또는 면역원은 박테리아 또는 바이러스 입자 등으로부터, 또는 종양 또는 암 조직으로부터 유래될 수 있다. 항원 또는 면역원은 생체 내 적응 면역 시스템을 자극한다. 종래에는 항원 또는 면역원 유래의 단백질, 또는 펩타이드를 생체 내 적응 면역 시스템의 자극원으로 이용하는 백신이 주를 이루었으나, 최근 핵산을 자극원으로 이용하고자 하는 시도가 지속되고 있다. 특히 mRNA는 DNA와 다르게 핵 내로 들어갈 필요없이 세포질에서 바로 일시적으로 원하는 단백질이 발현될 수 있다는 장점이 있으므로, 보건/의료 분야에서 새로운 치료 방법으로 주목받고 있다. 그러나 mRNA는 DNA에 비해 구조적으로 안정도가 낮아 산업적으로 이용하기에 한계가 있는 실정이다. 따라서 최근 이러한 문제의 해결을 위해, UTR(Untranslational region)을 이용하여 mRNA의 세포내 안정성을 높이고, 단백질의 생합성 효율을 향상시키고자 하는 시도가 이루어지고 있다. 이와 같은 맥락에서, 본 발명의 핵산 안정화 효과가 우수한 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나의 서열, 또는 이와 70% 이상의 상동성을 가지는 서열은 목적하는 면역 증강을 위해 적합한 항원 또는 면역원 유래의 핵산과 함께 백신으로서 투여될 수 있다. 이러한 경우에, 본 발명의 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나의 서열, 또는 이와 70% 이상의 상동성을 가지는 서열은 핵산 백신에서 항원 유전 정보의 앞/뒤에 위치하는 것이 바람직하고, 핵산 백신이 생체내에서 분해효소로부터 보호받고, 항원으로서 핵산 서열이 효과적으로 번역되도록 부스팅하는 효과를 기대할 수 있다. 더하여, 핵산 백신의 안정성을 향상시키고, 생체 내에서 항원이 효율적으로 합성될 수 있도록 하므로, 적은 양의 백신 투여로도 질병 치료 및 예방에 높은 효과를 기대할 수 있다. 또한 기대하는 치료 효과를 충족하기 위해 투여되는 백신의 용량이 적어지므로 백신 생산가를 낮추는 효과를 기대할 수 있다. 상기 백신은 기대하는 효과의 부스팅을 위해 추가로 어쥬번트(component)를 포함할 수 있다. 어쥬번트는 전형적으로 약물 또는 백신과 같은, 다른 제제의 효과를 변형하거나 강화할 수 있는 약학적 및/또는 면역학적 제제이다. 이는 넓은 의미로 해석되고 물질의 넓은 범위를 나타낸다. 전형적으로, 이들 물질은 항원의 면역성을 증가시킬 수 있다. 예를 들어, 어쥬번트는 선천적 면역 시스템에 의해 인식될 수 있으며, 선천적 면역 반응을 유도할 수 있다. 이러한 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열, 및 목적하는 면역 증강을 위해 적합한 항원 또는 면역원 유래의 핵산을 포함하는 본 발명의 백신은 포함되는 항원 또는 면역원의 종류에 따라 그 용도가 무한히 확장될 수 있다. 예를 들어, 항원 또는 면역원으로 암 조직 유래의 핵산을 포함시키는 경우에, 상기 백신은 암 백신이다. 여기서의 암 백신이란 암세포가 지니는 암 특이적 항원을 암환자에게 투여하여 면역시스템을 활성화시킴으로써 생체내 면역기능을 활성화시켜, 암세포를 공격하여 암을 제거하는 능동적 면역치료법을 의미할 수 있다. 본 발명의 백신(또는 백신용 조성물)이 암 백신으로 이용되는 경우에, 상기 암 조직 유래의 핵산은 신항원(암세포에서만 나오는 특이 항원, neoantigen) 핵산인 것이 바람직하나, 이에 제한되는 것은 아니다. 상기 암은 조직 내에서 질서를 무시하고 무제한 증식하는 미분화 세포로 구성된 종괴, 또는 종양을 형성하는 질환을 의미할 수 있다. 사멸해야 할 비정상 세포들이 과다 증식하게 되며, 경우에 따라 주위 조직 및 장기에 침입하여 종괴를 형성하고 기존의 구조를 파괴하거나 변형시키는 것을 의미할 수 있다. 궁극적으로는 주위의 정상조직이나 기관을 침윤하여 파괴시키고 원발병소에서 개체의 어떤 기관이든 전이하여 새로운 성장 장소를 만들 수 있어 개체의 생명을 빼앗아 갈 수 있는 질환군을 총칭하는 것일 수 있다. 또한 상기 암은 구강암, 간암, 위암, 결장암, 유방암, 폐암, 골암, 췌장암, 피부암, 두부암, 경부암, 피부암, 흑색종, 자궁경부암, 난소암, 대장암, 소장암, 직장암, 나팔관암종, 항문부근암, 자궁내막암종, 질암종, 음문암종, 호지킨병(Hodgkin's disease), 식도암, 임파선암, 방광암, 담낭암, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직 육종, 요도암, 음경암, 전립선암, 만성 백혈병, 급성 백혈병, 림프구 림프종, 신장암, 수뇨관암, 신장세포암종, 신장골반암종, 중추신경계 종양, 1차 중추신경계 림프종, 척수 종양, 뇌간 신경교종, 및 뇌하수체 선종으로 이루어진 군으로부터 선택된 어느 하나인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 용어 “표지(markers)”는 단백질이나 DNA, RNA, 대사물질 등을 이용해 몸 안의 변화를 알아낼 수 있는 지표의 의미로, 구체적으로 암 표지(tumor markers; TMs), 또는 암세포 표지란 암세포가 있는 것을 나타내는 물질로서, 암세포가 만드는 물질, 또는 체내의 정상세포가 암세포와 반응해서 만드는 물질 중에서 혈액이나 조직, 배설물 등에서 그 물질을 검사하는 것이 암 진단이나 치료의 지표로서 도움이 되는 것을 의미한다. 일례로 당단백의 일종으로 대장암, 췌장암, 위암, 유방암 등에서 유의하게 증가되는 범종양 표지로서 CEA(Carcinoembryonic Antigen), 원발성 간암의 표지인 AFP(Alfa- Fetoprotein), 췌장암 및 담도암의 표지인 CA 19-9, 난소암의 표지인 CA 125, 전립선암의 표지인 PSA(Prostate Specific Antigen) 등이 있다. 본 발명의 핵산 안정화를 위해 선별된 인공 핵산, 구체적으로는 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열이 특정 질환의 진단 또는 치료를 위한 표지용 조성물로 이용되는 경우에, 이에 제한되는 것은 아니나, 상기 질환은 암 질환일 수 있고, 상기 본 발명의 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열을 포함하는 인공 핵산은 암세포 표지에 적합한 항체, 또는 암세포 유래의 핵산에 상보적인 핵산 서열과 함께 암세포 표지용 조성물로서 이용될 수 있다. 이러한 경우에, 상기 암세포 표지용 조성물은 백신용 조성물로 이용될 수 있는 것이며, 기대하는 효과의 부스팅을 위해 추가로 어쥬번트(component)를 포함할 수 있다. 상기의 암, 백신, 또는 어쥬번트에 관한 구체적인 제한사항은 상기 "면역 증강”에서 기재한 바와 중복되어, 이하 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.
본 발명에서 용어 “키트(kit)”는 목적하는 물질을 검출하기 위한 제제의 일체, 또는 일부를 포함하는 세트의 개념이다. 상기 키트는 개체로부터 분리된 생체 시료를 대상으로 적용되는 것일 수 있다. 상기 개체로부터 분리된 생체 시료는 혈액, 타액, 조직, 세포, 객담, 기관지 세포세척액 및 소변으로 이루어진 군으로부터 선택된 하나 혹은 그 이상의 것일 수 있다. 상기 생체 시료는, 건조된 형태의 액상 또는 조직시료, 또는 액체에 담겨 있는 시료가 이용될 수 있다. 본 발명에 있어서, 상기 키트의 목적은 생물학적 시료로부터 특정 유전자, 또는 핵산의 존재 여부를 확인하기 위한 것일 수 있고, 상기 키트는 바람직하게는 본 발명의 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열을 포함하는 것일 수 있다. 예를 들어, 개체로부터 분리된 생물학적 시료 내 A 유전자 또는 핵산을 검출하기 위한 키트로서, A 유전자 또는 핵산에 상보적으로 결합하는 B 핵산을 제제의 일체, 또는 일부로 포함하는 키트일 경우에, 상기 키트는 B 핵산의 안정화를 위해 본 발명의 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열을 B 핵산과 함께 포함할 수 있다.
본 발명에서 용어 “약학적 조성물(pharmaceutical composition)”은 목적하는 질환의 예방 또는 치료를 위해 투여되는 조성물의 개념이다. 상기의 질환은 예방 또는 치료가 필요한 것이라면 제한없이 선택될 수 있으나, 본 발명의 목적상 유전자 발현의 조절로 예방 또는 치료되는 것일 수 있다. 여기서의 유전자는, 예를 들면 유전병과 같이 질환의 예방 또는 치료에 직접적으로 영향을 미치는 유전자일 수 있고, 또는 예를 들면 면역세포 자극과 같이 생체 내 면역 증진을 통해 간접적으로 질환의 예방 또는 치료 효과를 기대할 수 있는 것일 수 있다. 본 발명에 있어서, 상기 약학적 조성물은 목적하는 유전자 발현의 조절을 위해 본 발명의 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열을 포함하는 것일 수 있다. 예를 들어, 암의 예방 또는 치료용 약학적 조성물일 경우, 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열과 종양유전자(oncogene)의 발현 억제용 핵산을 포함하는 약학적 조성물일 수 있다. 또는 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열과 항종양유전자(antioncogene)의 발현 증진용 핵산을 포함하는 약학적 조성물일 수 있다. 또는 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열과 면역 세포 자극용 핵산을 포함하는 약학적 조성물일 수 있다. 또는 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열과 암세포 표지용 핵산을 포함하는 약학적 조성물일 수 있다. 또는 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열과 환자 특이적 신항원을 포함하는 약학적 조성물일 수 있다. 또는 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열과 복수의 환자 특이적 신항원을 포함하는 합성 긴 펩타이드 (synthetic long peptide; SLP) 약학적 조성물일 수 있다. 상기 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 인간을 대상으로 하는 것을 특징으로 할 수 있다. 본 발명의 약학적 조성물은 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 주사제의 형태로 제형화하여 사용될 수 있으나, 좌제 또는 주사제인 것이 바람직하다. 또한 본 발명의 약학적 조성물은 약제적으로 허용 가능한 담체를 포함할 수 있다. 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 약학적 조성물의 제형은 상술한 바와 같은 약학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다. 한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다. 본 발명에 따른 약학적 조성물은 구강, 정맥 내, 근육 내, 동맥 내, 골수 내, 경막 내, 심장 내, 경피, 피하, 복강 내, 비강 내, 장관, 국소, 설하 또는 직장 경로를 통해 투여될 수 있으나, 상기 기술한 바와 같이 비경구 투하가 바람직하다. 상기 비경구 투여란, 피하, 피내, 정맥 내, 근육 내, 관절 내, 활액낭 내, 흉골 내, 경막 내, 병소 내 및 두개골 내 주사 또는 주입기술을 포함한다. 본 발명의 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다. 본 발명의 약학적 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여 시간, 투여 경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학적 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 해석으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 일 구체예에서, 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열을 포함하는 인공 핵산을 제공하고, 상기 서열은 비번역 부위(untranslated region) 서열인 것인 인공 핵산을 제공하며, 상기 서열은 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 90% 이상의 상동성을 가지는 서열인 것인 인공 핵산을 제공하며, 상기 서열은 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 95% 이상의 상동성을 가지는 서열인 것인 인공 핵산을 제공하며, 상기 인공 핵산은 서열번호 1 내지 서열번호 18로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열; 및 서열번호 20 내지 서열번호 37로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열;을 포함하는 것인 인공 핵산을 제공하며, 상기 인공 핵산은 서열번호 1 내지 서열번호 18로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열을 5’에 위치시키고, 서열번호 20 내지 서열번호 37로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열을 3’에 위치시키는 것인 인공 핵산을 제공하며, 또한 상기 인공 핵산은 오픈 리딩 프레임(open reading frame) 서열, 프로모터(promotor) 서열, Kozak 서열, 및 poly A tail 서열 중 어느 하나 이상을 추가로 포함하는 것인 인공 핵산을 제공한다.
본 발명의 다른 구체예에서, 상기 인공 핵산을 포함하는 벡터를 제공하고, 상기 벡터는 플라스미드 벡터 또는 바이러스 벡터인 것인 상기 인공 핵산을 포함하는 벡터를 제공한다.
본 발명의 또 다른 구체예에서, 상기 벡터로 형질전환된 형질전환체를 제공하고, 상기 형질전환체는 바이러스, 박테리아, 식물 세포, 또는 동물 세포인 것인 상기 벡터로 형질전환된 형질전환체를 제공한다.
본 발명의 또 다른 구체예에서, 상기 인공 핵산을 포함하는 핵산 안정화용 조성물을 제공한다.
본 발명의 또 다른 구체예에서, 상기 인공 핵산을 포함하는 면역 증강용 조성물을 제공하고, 상기 면역 증강용 조성물은 백신용 조성물인 것인 상기 인공 핵산을 포함하는 면역 증강용 조성물을 제공한다.
본 발명의 또 다른 구체예에서, 상기 인공 핵산을 포함하는 암세포 표지용 조성물을 제공하고, 상기 암세포 표지용 조성물은 백신용 조성물인 것인 상기 인공 핵산을 포함하는 암세포 표지용 조성물을 제공한다.
본 발명의 또 다른 구체예에서, 상기 인공 핵산을 포함하는 핵산 검출용 키트를 제공한다.
본 발명의 또 다른 구체예에서, 상기 인공 핵산을 포함하는 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 또 다른 구체예에서, (a) 유전자는 데이터베이스로부터 발현 정도가 상위 20%인 유전자를 선별하는 단계; (b) 선별된 유전자의 비번역 부위(Untranslated Region) 서열을 1차 선별하는 단계; 및, (c) 선별된 비번역 부위 서열 중 2차 구조(Secondary Structure)가 부존재하는 비번역 부위 서열을 2차 선별하는 단계;를 포함하는 핵산 안정화용 비번역 부위 서열의 선별 방법을 제공한다. 상기 (c)단계에서 2차 구조가 부존재하는 비번역 부위 서열을 선별하는 방법은 Minimum Free Energy(MFE)를 산출하여 그 값이 -10보다 큰 5’ UTR 서열을 선별하는 것일 수 있다.
본 발명의 또 다른 구체예에서, (a) 유전자는 데이터베이스로부터 발현 정도가 상위 20%인 유전자를 선별하는 단계; (b) 선별된 유전자의 비번역 부위(Untranslated Region) 서열을 1차 선별하는 단계; 및, (c) 선별된 비번역 부위 서열 중 ARE(AU rich element)가 부존재하는 비번역 부위 서열을 2차 선별하는 단계;를 포함하는 핵산 안정화용 비번역 부위 서열의 선별 방법을 제공한다. 상기 상기 핵산 안정화용 비번역 부위 서열의 선별 방법은 상기 (b) 단계 이후에, 선별된 비번역 부위 서열 중 동일한 유전자의 여러 아형(isoform)이 존재할 경우, 가장 짧은 서열의 비번역 부위 서열을 2차 선별하는 단계; 및/또는 선별된 UTR 서열과 miRNA간 결합 에너지를 이용하여 miRNA를 클러스터링(clustering)한 뒤, 해당 정보를 기반으로 비번역 부위 서열을 추가 선별하는 단계;를 추가로 포함할 수 있다.
본 발명의 또 다른 구체예에서, 상기 핵산 안정화용 비번역 부위 서열의 선별 방법 중 어느 하나 이상의 방법으로 선별된 비번역 부위 서열과 70% 이상의 상동성을 가지는 서열이 포함되도록 인공 핵산을 제조하는 단계;를 포함하는 인공 핵산의 제조 방법을 제공한다.
이하 상기 본 발명을 실시예에 입각하여 상세히 설명한다.
본 발명의 UTR서열은 핵산 안정화 및 타겟 단백질의 발현 증진 효과가 우수하므로, 보건/의료 분야에서 크게 이용될 것으로 기대된다.
도 1은 본 발명의 일 실시예에 따른, 선별 유전자 UTR이 내제된 IVT mRNA 합성용 plasmid DNA construct 구조를 나타낸 도이다.
도 2는 본 발명의 일 실시예에 따른, 선별 유전자를 이용한 plasmid vector의 모식도이다. 대표로 RGS5 유전자가 이용된 예를 나타낸 것이나, 다른 유전자의 plasmid vector 또한 유전자만 변경될 뿐 동일한 구조를 가진다.
도 3은 본 발명의 일 실시예에 따른, IVT(in vitro transcription) 전 UTR 후보군 plasmid DNA vector 선형화를 확인한 결과를 나타낸 것이다.
도 4는 본 발명의 일 실시예에 따른, Fluorescence imaging을 이용한 선별 유전자 UTR 서열에 따른 d2eGFP 형광 발현 분석 결과를 나타낸 것이다.
도 5는 본 발명의 일 실시예에 따른, Flow cytometry를 이용한 선별 유전자 UTR 서열에 따른 d2eGFP 형광 발현 분석 결과를 나타낸 것이다.
도 6은 본 발명의 일 실시예에 따른, Flow cytometry를 이용한 선별 유전자 UTR 서열에 따른 transfection 및 translation 효율을 확인한 결과를 나타낸 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당 업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1. UTR 후보 서열 설계 및 선별
mRNA 백신의 세포내 안정성과 translation 효율을 높이는 UTR 서열을 선별하기 위해, 생체내 발현 정도가 높은 유전자는 생체내 mRNA의 안정성을 높이고 translation 효율이 높은 UTR을 포함하고 있을 것이라는 가정하에 in silico 방법으로 정상 조직에서의 유전자 발현 정보 데이터베이스인 Genotype-Tissue Expression (GTEx)를 기반으로 발현 정도가 높은 1,689개의 유전자를 선별하였다. 상기 1,689개의 유전자는 데이터베이스의 16,903 유전자 중 상위 10%에 해당하는 수치이다. 이후, 선별된 유전자가 갖는 5’ UTR 및 3’ UTR 서열을 대상으로 핵산 안정화용 후보 UTR 서열을 선별하였다.
구체적으로, 5’ UTR의 경우, 20nt ~ 60nt의 상대적으로 짧은 서열을 선별하였다. 5’ UTR의 길이가 길 경우 백신 합성의 어려움이 발생할 수 있고, 원하지 않는 구조적 생물학적 반응이 발생할 수 있다. 선별된 서열에 Upstream AUG가 존재할 경우에는 설계와는 다른 항원이 합성될 수 있으므로, upstream AUG가 존재하는 경우는 제외하였다. 또한 translation을 저해하는 구조적 특성(5’ UTR 내 secondary structure의 형성)을 갖는 5’ UTR을 추가로 제거하기 위해, Minimum Free Energy(MFE)를 산출하여 그 값이 -10보다 큰 5’ UTR 서열을 선별하였다. 그 결과, 총 360개의 5’ UTR 후보 서열이 선별되었다. 3’ UTR의 경우에는, 효율적인 IVT(in vitro transcription)를 위하여 길이가 20nt ~ 300nt를 만족하는 3’ UTR을 먼저 선별하고, 동일한 유전자의 여러 아형(isoform)이 존재한다면 그 중 가장 짧은 3’ UTR을 선택하여 일차적으로 1,077개의 3’ UTR 후보 서열을 선별하였다. 이를 대상으로 mRNA의 안정성에 영향을 미치는 miRNA와의 결합 양태를 파악하기 위해, 1,077종의 후보 3’ UTR 서열과 2,657종의 miRNA간 결합 에너지를 산출하였고(IntaRNA 2.0), 결합 miRNA 종류와 그 에너지를 이용하여 클러스터링(clustering)을 cola R package를 사용하여 진행하였다. 여기서 당 업계에서 다양한 선행문헌을 통해 공지된 UTR 서열과 같은 클러스터로 분류되는 UTR 서열을 이차적으로 선별하고, 이후 AU-Rich Element Database(ARED-Plus)를 참고하여 mRNA의 분해에 관여하는 AU rich element(ARE)를 3’ UTR에 포함하고 있는 유전자를 제외하였다. 그 결과, 총 217개의 3’ UTR 후보 서열이 선별되었다.
실시예 2. 선별된 UTR 후보의 최적화
상기 실시예 1에서 선별된 360 종의 5’ UTR, 및 217 종의 3’ UTR 서열 중 동일한 유전자에서 유래한 40종의 5’ UTR과 3’ UTR을 선별하였다. 그 중, 유전자의 발현량을 고려하여 각 9종의 5’ UTR 및 3’ UTR을 재선정하고, 강한 Kozak 서열을 갖도록 서열 최적화를 진행하였다. 그 결과, 선별된 유전자는 CLPS(Colipase), APOC3(Apolipoprotein C-III), REG3A(Regenerating Family Member 3 Alpha), TNNC1(Troponin C type 1), HPX(Hemopexin), RGS5(Regulator Of G Protein Signaling 5), IFI30(IFI30 Lysosomal Thiol Reductase), CYP11A1(Cytochrome P450 Family 11 Subfamily A Member 1), 및 CYC1(Cytochrome C1)이였다. 상기 유전자의 UTR 중 Kozak 서열이 최적화된 UTR 서열을 하기 표 1(5’ UTR)과 표 2(3’ UTR)에 나타내었다. 이들에 대한 대조군 UTR로는 당 업계에서 종래 공지된 UTR 서열을 이용하였다.
서열 번호 유전자 핵산 종류 서열
서열번호 1 REG3A DNA AAACCATACCATATCCCACCAGAGAGTCGCAGCCACC
서열번호 2 REG3A RNA AAACCAUACCAUAUCCCACCAGAGAGUCGCAGCCACC
서열번호 3 HPX DNA GTCCTGTGGCCTCTGCAGGCCACC
서열번호 4 HPX RNA GUCCUGUGGCCUCUGCAGGCCACC
서열번호 5 RGS5 DNA AGAAGTGTCTGACAAAACAAAGAAACAAAACCTCAGGCCACC
서열번호 6 RGS5 RNA AGAAGUGUCUGACAAAACAAAGAAACAAAACCUCAGGCCACC
서열번호 7 CLPS DNA GTCTCCCGCCACCCACACCAGCTGTCCCAGCCACC
서열번호 8 CLPS RNA GUCUCCCGCCACCCACACCAGCUGUCCCAGCCACC
서열번호 9 APOC3 DNA CTGCTCAGTTCATCCCTAGAGGCAGCTGCTCCAGGAACAGAGCCACC
서열번호 10 APOC3 RNA CUGCUCAGUUCAUCCCUAGAGGCAGCUGCUCCAGGAACAGAGCCACC
서열번호 11 TNNC1 DNA AGCAAGCTGTCCTGTGAGCCGCCACC
서열번호 12 TNNC1 RNA AGCAAGCUGUCCUGUGAGCCGCCACC
서열번호 13 IFI30 DNA GCAGTCGCCACACCTTTGCCCCTGCCACC
서열번호 14 IFI30 RNA GCAGUCGCCACACCUUUGCCCCUGCCACC
서열번호 15 CYP11A1 DNA CCGCTGAAGTGGAGCAGGTACAGTCACAGCTGTGGGGCCACC
서열번호 16 CYP11A1 RNA CCGCUGAAGUGGAGCAGGUACAGUCACAGCUGUGGGGCCACC
서열번호 17 CYC1 DNA GGCGGCCGCGCGGAGGAGGCCACC
서열번호 18 CYC1 RNA GGCGGCCGCGCGGAGGAGGCCACC
서열번호 19 Positive control DNA GAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC
서열 번호 유전자 핵산 종류 서열
서열번호 20 REG3A DNA TGCAGGAGGGAAGTCAGCAGCCTGTGTTTGGTGTGCAACTCATCATGGGCATGAGACCAGTGTGAGGACTCACCCTGGAAGAGAATATTCGCTTAATTCCCCCAACCTGACCACCTCATTCTTATCTTTCTTCTGTTTCTTCCTCCCCGCTGTCATTTCAGTCTCTTCATTTTGTCATACGGCCTAAGGCTTTAAAGAGCAATAAAATTTTTAGTCTGC
서열번호 21 REG3A RNA UGCAGGAGGGAAGUCAGCAGCCUGUGUUUGGUGUGCAACUCAUCAUGGGCAUGAGACCAGUGUGAGGACUCACCCUGGAAGAGAAUAUUCGCUUAAUUCCCCCAACCUGACCACCUCAUUCUUAUCUUUCUUCUGUUUCUUCCUCCCCGCUGUCAUUUCAGUCUCUUCAUUUUGUCAUACGGCCUAAGGCUUUAAAGAGCAAUAAAAUUUUUAGUCUGC
서열번호 22 HPX DNA GGGGCCTTCTGACATGAGTCTGGCCTGGCCCCACCTCCTAGTTCCTCATAATAAAGACAGATTGCTTCTTCGCTTCTCACTGAGGGGCCTTCTGACATGAGTCTGGCCTGGCCCCACCTCCCCAGTTTCTCATAATAAAGACAGATTGCTTCTTCACTTGAA
서열번호 23 HPX RNA GGGGCCUUCUGACAUGAGUCUGGCCUGGCCCCACCUCCUAGUUCCUCAUAAUAAAGACAGAUUGCUUCUUCGCUUCUCACUGAGGGGCCUUCUGACAUGAGUCUGGCCUGGCCCCACCUCCCCAGUUUCUCAUAAUAAAGACAGAUUGCUUCUUCACUUGAA
서열번호 24 RGS5 DNA TAATTTAGCCAGGCTATGAAATCATCCTGTGAGTTATTTCCTCCATAATAACCCTGCATTTCCCATTAATCTACATATCTTCCCACAGCAGCTTTGCTCAGTGATACCCACATGGGAAAAATCCCAGGGGATGTTGCTTACTCTTTTTGCCCACACTGCTTTGGATACTTATCTACTGTCCGAAGGCCTTCTTTCCCCACTCAATTCTTCCTGCCCTGTTATTAA
서열번호 25 RGS5 RNA UAAUUUAGCCAGGCUAUGAAAUCAUCCUGUGAGUUAUUUCCUCCAUAAUAACCCUGCAUUUCCCAUUAAUCUACAUAUCUUCCCACAGCAGCUUUGCUCAGUGAUACCCACAUGGGAAAAAUCCCAGGGGAUGUUGCUUACUCUUUUUGCCCACACUGCUUUGGAUACUUAUCUACUGUCCGAAGGCCUUCUUUCCCCACUCAAUUCUUCCUGCCCUGUUAUUAA
서열번호 26 CLPS DNA GACTGCCCACCCACTCCCACACCTAGCCCAGAATGCTGTAGGCCACTAGGCGCAGGGGCATCTCTCCCCTGCTCCAGCGCATCTCCCGGGCTGGCCACCTCCTTGACCAGCATATCTGTTTTCTGATTGCGCTCTTCACAATTAAAGGCCTCCTGCAAACCTTT
서열번호 27 CLPS RNA GACUGCCCACCCACUCCCACACCUAGCCCAGAAUGCUGUAGGCCACUAGGCGCAGGGGCAUCUCUCCCCUGCUCCAGCGCAUCUCCCGGGCUGGCCACCUCCUUGACCAGCAUAUCUGUUUUCUGAUUGCGCUCUUCACAAUUAAAGGCCUCCUGCAAACCUUU
서열번호 28 APOC3 DNA GACCTCAATACCCCAAGTCCACCTGCCTATCCATCCTGCGAGCTCCTTGGGTCCTGCAATCTCCAGGGCTGCCCCTGTAGGTTGCTTAAAAGGGACAGTATTCTCAGTGCTCTCCTACCCCACCTCATGCCTGGCCCCCCTCCAGGCATGCTGGCCTCCCAATAAAGCTGGACAAGAAGCTGCTATGA
서열번호 29 APOC3 RNA GACCUCAAUACCCCAAGUCCACCUGCCUAUCCAUCCUGCGAGCUCCUUGGGUCCUGCAAUCUCCAGGGCUGCCCCUGUAGGUUGCUUAAAAGGGACAGUAUUCUCAGUGCUCUCCUACCCCACCUCAUGCCUGGCCCCCCUCCAGGCAUGCUGGCCUCCCAAUAAAGCUGGACAAGAAGCUGCUAUGA
서열번호 30 TNNC1 DNA ATGCTGACCTTCACCCAGAGCTGCCTATGCCCAGCCTCCAACTCCAGCTGAGTCCTGGGGTTGGGGAGGGGGTCGGGGTCCCAGGACCTGAGCCTGGCCATGTCCTCAACCCCAAATCCCCCGACTCCCTCCCCAGATCTGTCCTGGGGGATGCAAATAAAGCCTGCTCTCCCAA
서열번호 31 TNNC1 RNA AUGCUGACCUUCACCCAGAGCUGCCUAUGCCCAGCCUCCAACUCCAGCUGAGUCCUGGGGUUGGGGAGGGGGUCGGGGUCCCAGGACCUGAGCCUGGCCAUGUCCUCAACCCCAAAUCCCCCGACUCCCUCCCCAGAUCUGUCCUGGGGGAUGCAAAUAAAGCCUGCUCUCCCAA
서열번호 32 IFI30 DNA TGGCCGGTGAGCTGCGGAGAGCTCATGGAAGGCGAGTGGGAACCCGGCTGCCTGCCTTTTTTTCTGATCCAGACCCTCGGCACCTGCTACTTACCAACTGGAAAATTTTATGCATCCCATGAAGCCCAGATACACAAAATTCCACCCCATGATCAAGAATCCTGCTCCACTAAGAATGGTGCTAAAGTAAAACTAGTTTAATAAGC
서열번호 33 IFI30 RNA UGGCCGGUGAGCUGCGGAGAGCUCAUGGAAGGCGAGUGGGAACCCGGCUGCCUGCCUUUUUUUCUGAUCCAGACCCUCGGCACCUGCUACUUACCAACUGGAAAAUUUUAUGCAUCCCAUGAAGCCCAGAUACACAAAAUUCCACCCCAUGAUCAAGAAUCCUGCUCCACUAAGAAUGGUGCUAAAGUAAAACUAGUUUAAUAAGC
서열번호 34 CYP11A1 DNA TCAGAGAGGATGGCCTGCAGCCACATGGGAGGAAGGCCCAGGGGTGGGGCCCATGGGGTCTCTGCATCTTCAGTCGTCTGTCCCAAGTCCTGCTCCTTTCTGCCCAGCCTGCTCAGCAGGTTGAATGGGTTCTCAGTGGTCACCTTCCTCAGCTCAGCTGGGCCACTCCTCTTCACCCACCCCATGGAGACAATAAACAGCTGAACCATG
서열번호 35 CYP11A1 RNA UCAGAGAGGAUGGCCUGCAGCCACAUGGGAGGAAGGCCCAGGGGUGGGGCCCAUGGGGUCUCUGCAUCUUCAGUCGUCUGUCCCAAGUCCUGCUCCUUUCUGCCCAGCCUGCUCAGCAGGUUGAAUGGGUUCUCAGUGGUCACCUUCCUCAGCUCAGCUGGGCCACUCCUCUUCACCCACCCCAUGGAGACAAUAAACAGCUGAACCAUG
서열번호 36 CYC1 DNA CCCTGTCCAGTGTCTGCTTGCCATCCTGCCAGAACAGGCCCTCAAGCCCAAGAGCCATCCCAGGCCTGTTCAGGCCTCAGCTAAGCCTCTCTTCATCTGGAAGAAGAGGCAAGGGGGCAGGAGACCAGGCTCTAGCTCTGGGCCCTCCTTCAGCCCCCATCATGGGAATAAATTAATTTTCTCAATGTA
서열번호 37 CYC1 RNA CCCUGUCCAGUGUCUGCUUGCCAUCCUGCCAGAACAGGCCCUCAAGCCCAAGAGCCAUCCCAGGCCUGUUCAGGCCUCAGCUAAGCCUCUCUUCAUCUGGAAGAAGAGGCAAGGGGGCAGGAGACCAGGCUCUAGCUCUGGGCCCUCCUUCAGCCCCCAUCAUGGGAAUAAAUUAAUUUUCUCAAUGUA
서열번호 38 Positive control DNA CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTCGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCAA
상기 표 1, 및 표 2에서, 서열이 RNA인 경우에, 서열 중의 U(우라실)은 서열목록 상에서 T로 표시될 수 있다.
실시예 3. 선별된 UTR 후보의 성능 평가
실시예 3-1. UTR이 내제된 IVT mRNA 합성용 plasmid DNA 제작
상기 실시예 2에서 선별된 UTR 최적화 후보 서열의 성능 평가를 위해, RNA 중합효소 (T7 polymerase) 반응을 통해 IVT mRNA를 생산 후 이를 K562 세포주에 transfection하여 세포 내 mRNA 안정성 및 단백질 발현능을 비교 분석하고자 IVT template DNA를 제작하였다. 구체적으로, 각 UTR 후보 서열이 삽입된 형태의 IVT mRNA 생산용 plasmid DNA를 제작하였고, pUC57-kan IVT plasmid vector backbone DNA를 토대로 IVT mRNA 생산용 vector를 Linearization 방법 및 Cap binding site를 고려하여 디자인 및 제작하였다. DNA construct 제작은 In-fusion cloning 기법을 이용하여 진행하였으며, insert 절편 증폭 시 연결부위의 3’ 과 5’ 말단 서열(15bp)을 공유하도록 해당 시퀀스가 연장된 형태의 primer로 진행하였다. PCR 증폭 후에는 선형화된 plasmid vector와 In fusion cloning kit를 사용하여 말단부위가 ligation되어 클로닝되도록 하였다. 반응 유도된 plasmid DNA에는 카나마이신(kanamycin) 저항 유전자가 포함되었으므로 카나마이신이 첨가된 항생제 배지에서 single colony selection을 통해 진행하였고, CDS(Coding sequence) region에 짧은 반감기를 가진 d2EGFP를 삽입하여 후보 간의 단백질 발현 비교가 용이하도록 설계하였다. 이후, 제작 완료된 IVT vector를 기반으로 각 선별된 유전자 형태를 삽입한 형태의 DNA를 제작하여 최종 버전인 IVT template 제작하였다. 제작 완료된 UTR 후보 construct는 UTR 서열을 제외하고 동일한 서열을 가진다. 상기 제작된 UTR이 내제된 IVT mRNA 합성용 plasmid DNA construct 구조를 도 1과 도 2에 나타내었다. 도 2는 대표로 RGS5 유전자를 이용한 plasmid vector의 모식도를 나타낸 것이나, 다른 유전자의 plasmid vector 또한 유전자만 변경될 뿐 동일한 구조를 나타낸다.
실시예 3-2. Plasmid DNA linearization 및 확인
Control plasmid DNA와 선별된 유전자 UTR 후보군이 내제되어 있는 8종의 plasmid DNA circular form을 linearization하였다. 제한효소를 사용하여 plasmid DNA linearization을 진행하였으며, 이를 위해 SmaⅠ 제한효소(Enzynomics, cat# R015S)를 사용하였다. 제한효소 SmaⅠ에 cutting된 linearized plasmid DNA는 아가로오스 겔 전기영동(Agarose gel electrophoresis) 통해 linearized form으로의 변화를 확인하였다. 실험 결과, 선별 유전자 UTR 서열이 포함된 plasmid DNA모두 SmaⅠ제한효소에 의해 circular form에서 linear form으로 변경되었음을 확인하였다. 상기 결과를 도 3에 나타내었다.
실시예 3-3. 선형화된 plasmid DNA를 이용한 mRNA 생산 및 성능 평가
(1) In vitro transcription
선별된 유전자 UTR 서열이 포함된 8종의 linear plasmid DNA로 mMESSAGE mMACHINE® T7 Transcription Kit (Invitrogen, cat# AM1344)를 사용하여 IVT mRNA 합성을 진행하였다. RNA 중합효소 T7 polymerase에 의해 IVT가 진행되어 mRNA가 합성되었고, 8종의 linear plasmid DNA에는 T7 promoter 서열을 내재하였다. IVT 과정에Nucleoside triphosphate(NTPs)와 Cap analog를 추가하여, co-transcriptional capping 방법으로 IVT mRNA 5’ end에 5’ cap을 장착시켰다. 최종적으로 합성된 IVT mRNA는 Nanodrop 기기를 사용하여 농도를 측정하였고, MEGAclear™ Transcription Clean-Up Kit(Invitrogen, cat# AM1908)로 purification 진행하였다.
(2) IVT mRNA transfection
인간 골수성 백혈병 세포주(K-562; human lymphoblast)에 Marker reporter gene인 d2EGFP 서열이 encoding된 UTR 후보군 IVT mRNA를 transfection하여, translation 효율을 평가하였다. UTR 후보군 IVT mRNA transfection은 Lipofectamine MessengerMax(Invitrogen, cat# LMRNA015)를 사용하여 진행하였다.
(3) d2EGFP-encoding IVT mRNA을 이용한 translational efficiency 확인
Control UTR과 선별된 유전자 UTR 서열이 포함된 8종의 linear plasmid DNA로부터 합성한 IVT mRNA에는 marker reporter gene인 d2EGFP가 내재되어 있다(도 1 참조). 인간 골수성 백혈병 세포주에 transfection 진행 후, IVT mRNA translation에 의해 d2EGFP가 발현됨을 확인하여, 선별 유전자 UTR 서열이 내제된 8종의 d2EGFP-encoding IVT mRNA 2.5㎍을 인간 골수성 백혈병 세포주 5 X 105 cells에 Lipofectamine MessengerMax를 사용하여 transfection 진행하였다. 선별된 유전자 UTR 서열에 따라 d2EGFP 내재 IVT mRNA의 translation 효율이 달라지므로 d2EGFP 발현양에도 차이가 있을 것으로 예상되어, transfection 후, 4, 6, 8, 12, 및 24 시간이 경과한 시점에서 시간 별로 d2EGFP 발현 변화를 Fluorescence imaging 분석, 및 Flow cytometry 분석하였다. 그 결과를 도 4와 도 5에 나타내었다. Fluorescence imaging 분석의 경우, 선행 연구에서 transfection 12시간 경과한 시점에서는 Lipofectamine MM만 처리한 negative control group에서는 d2EGFP 발현이 발견되지 않았으므로, 이러한 background 확인을 통해 형광 현미경 조건(Exposure time, Gain)을 결정하였다. 또한 선행 연구에서 확인된 Positive(V2 UTR(pTB0110)) control을 이용한 d2EGFP 발현 확인 결과 UTR sequence를 제거한 no UTR-control(pTB0112)에서는 d2EGFP 발현이 거의 나타나지 않았으므로, 실험이 잘 진행되었음을 알 수 있었다. 실험 결과, APOC3, REG3A, TNNC1, HPX, 및 RGS5유전자 UTR이 positive control인 V2 UTR(pTB0110)보다 d2EGFP 발현이 높게 나타났으며, 특히 REG3A, HPX, 및 RGS5 유전자의 UTR 발현이 매우 현저하였고, 상기 REG3A, HPX, 및 RGS5 유전자 UTR의 경우 24 시간 후까지 d2EGFP 발현이 안정적으로 유지되는 것을 확인할 수 있었다. Flow cytometry 분석의 경우에는, 전체 세포 중 Live cells(%)만 선별하고 그 중 d2EGFP를 발현하는 K-562만 분류하여 선별 유전자 UTR 서열에 따른 d2EGFP 발현 차이를 비교 분석하였다. 그 결과, Lipofection을 통한 d2EGFP-encoding IVT mRNA transfection은 모든 UTR 서열에서 24 시간까지 높은 세포 생존율(cell viability)를 유지함을 확인할 수 있었다. d2EGFP 발현은 RGS5 UTR그룹에서 가장 높게 나타났으나, 모든 d2EGFP positive cells은 시간 별로는 큰 차이가 나타나지 않았다. 상기 결과를 도 6에 나타내었다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (22)

  1. 서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는
    그룹으로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열을 포함하는,
    인공 핵산.
  2. 제 1항에 있어서,
    상기 서열은 비번역 부위(untranslated region) 서열인 것인, 인공 핵산.
  3. 제 1항에 있어서,
    상기 서열은,
    서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 90% 이상의 상동성을 가지는 서열인 것인, 인공 핵산.
  4. 제 1항에 있어서,
    상기 서열은,
    서열번호 1 내지 서열번호 18, 및 서열번호 20 내지 서열번호 37로 구성되는 그룹으로부터 선택되는 어느 하나와 95% 이상의 상동성을 가지는 서열인 것인, 인공 핵산.
  5. 제 1항에 있어서,
    상기 인공 핵산은,
    서열번호 1 내지 서열번호 18로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열; 및,
    서열번호 20 내지 서열번호 37로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열;을 포함하는 것인, 인공 핵산.
  6. 제 5항에 있어서,
    상기 인공 핵산은,
    서열번호 1 내지 서열번호 18로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열을 5’에 위치시키고,
    서열번호 20 내지 서열번호 37로부터 선택되는 어느 하나와 70% 이상의 상동성을 가지는 서열을 3’에 위치시키는 것인, 인공 핵산.
  7. 제 1항에 있어서,
    상기 인공 핵산은 오픈 리딩 프레임(open reading frame) 서열, 프로모터(promotor) 서열, Kozak 서열, 및 poly A tail 서열 중 어느 하나 이상을 추가로 포함하는 것인, 인공 핵산.
  8. 제 1항의 인공 핵산을 포함하는 벡터.
  9. 제 8항에 있어서,
    상기 벡터는 플라스미드 벡터 또는 바이러스 벡터인 것인, 벡터.
  10. 제 8항의 벡터로 형질전환된 형질전환체.
  11. 제 10항에 있어서,
    상기 형질전환체는 바이러스, 박테리아, 식물 세포, 또는 동물 세포인 것인, 형질전환체.
  12. 제 1항의 인공 핵산을 포함하는, 핵산 안정화용 조성물.
  13. 제 1항의 인공 핵산을 포함하는, 면역 증강용 조성물.
  14. 제 13항에 있어서,
    상기 면역 증강용 조성물은 백신용 조성물인 것인, 면역 증강용 조성물.
  15. 제 1항의 인공 핵산을 포함하는, 암세포 표지용 조성물.
  16. 제 15항에 있어서,
    상기 암세포 표지용 조성물은 백신용 조성물인 것인, 암세포 표지용 조성물.
  17. 제 1항의 인공 핵산을 포함하는, 핵산 검출용 키트.
  18. 제 1항의 인공 핵산을 포함하는, 질환의 예방 또는 치료용 약학적 조성물.
  19. (a) 유전자는 데이터베이스로부터 발현 정도가 상위 20%인 유전자를 선별하는 단계;
    (b) 선별된 유전자의 비번역 부위(Untranslated Region) 서열을 1차 선별하는 단계; 및,
    (c) 선별된 비번역 부위 서열 중 2차 구조(Secondary Structure)가 부존재하는 비번역 부위 서열을 2차 선별하는 단계;를 포함하는, 핵산 안정화용 비번역 부위 서열의 선별 방법.
  20. (a) 유전자는 데이터베이스로부터 발현 정도가 상위 20%인 유전자를 선별하는 단계;
    (b) 선별된 유전자의 비번역 부위(Untranslated Region) 서열을 1차 선별하는 단계; 및,
    (c) 선별된 비번역 부위 서열 중 ARE(AU rich element)가 부존재하는 비번역부위 서열을 2차 선별하는 단계;를 포함하는, 핵산 안정화용 비번역 부위 서열의 선별 방법.
  21. (a) 제 19항의 방법으로 핵산 안정화용 비번역 부위 서열을 선별하는 단계;
    (b) 제 20항의 방법으로 핵산 안정화용 비번역 부위 서열을 선별하는 단계; 및,
    (c) 상기 (a) 또는 (b)에서 선별된 비번역 부위 서열과 70% 이상의 상동성을 가지는 서열이 포함되도록 인공 핵산을 제조하는 단계;를 포함하는, 인공 핵산의 제조 방법.
  22. (a) 제 19항의 방법으로 핵산 안정화용 비번역 부위 서열을 선별하는 단계;
    (b) 제 20항의 방법으로 핵산 안정화용 비번역 부위 서열을 선별하는 단계;및,
    (c) 상기 (a) 및 (b)에서 선별된 비번역 부위 서열과 70% 이상의 상동성을 가지는 서열이 포함되도록 인공 핵산을 제조하는 단계;를 포함하는, 인공 핵산의 제조 방법.
PCT/KR2023/012989 2022-09-08 2023-08-31 Mrna의 세포내 안정성과 생합성을 향상시키는 utr 서열을 포함하는 구성물과 그 사용 WO2024053933A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0114207 2022-09-08
KR1020220114207A KR102561516B1 (ko) 2022-09-08 2022-09-08 mRNA의 세포내 안정성과 생합성을 향상시키는 UTR 서열을 포함하는 구성물과 그 사용

Publications (1)

Publication Number Publication Date
WO2024053933A1 true WO2024053933A1 (ko) 2024-03-14

Family

ID=87566505

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/012989 WO2024053933A1 (ko) 2022-09-08 2023-08-31 Mrna의 세포내 안정성과 생합성을 향상시키는 utr 서열을 포함하는 구성물과 그 사용

Country Status (2)

Country Link
KR (3) KR102561516B1 (ko)
WO (1) WO2024053933A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102561516B1 (ko) * 2022-09-08 2023-08-02 주식회사 테라젠바이오 mRNA의 세포내 안정성과 생합성을 향상시키는 UTR 서열을 포함하는 구성물과 그 사용

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102561516B1 (ko) * 2022-09-08 2023-08-02 주식회사 테라젠바이오 mRNA의 세포내 안정성과 생합성을 향상시키는 UTR 서열을 포함하는 구성물과 그 사용

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102561516B1 (ko) * 2022-09-08 2023-08-02 주식회사 테라젠바이오 mRNA의 세포내 안정성과 생합성을 향상시키는 UTR 서열을 포함하는 구성물과 그 사용

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ADIBZADEH SETARE, FARDAEI MAJID, TAKHSHID MOHAMMAD ALI, MIRI MOHAMMAD REZA, RAFIEI DEHBIDI GHOLAMREZA, FARHADI ALI, RANJBARAN REZA: "Enhancing Stability of Destabilized Green Fluorescent Protein Using Chimeric mRNA Containing Human Beta-Globin 5' and 3' Untranslated Regions", AVICENNA JOURNAL OF MEDICAL BIOTECHNOLOGY, AVICENNA RESEARCH INSTITUTE, IRAN, vol. 11, no. 1, 1 January 2019 (2019-01-01), Iran , pages 112 - 117, XP093147292, ISSN: 2008-2835 *
GILL S, JUNE C H: "Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies.", IMMUNOLOGICAL REVIEWS, WILEY-BLACKWELL PUBLISHING, INC., US, vol. 263, no. 1, 1 January 2015 (2015-01-01), US , pages 68 - 89, XP002760559, ISSN: 0105-2896, DOI: 10.1111/imr.12243 *
KIRTIKA H. ASRANI, JEREMIAH D. FARELLI, MARY R. STAHLEY, REBECCA L. MILLER, CHRISTOPHER J. CHENG, ROMESH R. SUBRAMANIAN & JEFFREY : "Optimization of mRNA untranslated regions for improved expression of therapeutic mRNA.", RNA BIOLOGY 2011 JAN-FEB, vol. 15, no. 6, 26 March 2018 (2018-03-26), pages 756 - 762, XP002793471, ISSN: 1555-8584, DOI: 10.1080/15476286.2018.1450054 *
LI JING, LIANG QIANG, SONG WENJIANG, MARCHISIO MARIO ANDREA: "Nucleotides upstream of the Kozak sequence strongly influence gene expression in the yeast S. cerevisiae", JOURNAL OF BIOLOGICAL ENGINEERING, BIOMED CENTRAL LTD, LO, vol. 11, no. 1, 1 December 2017 (2017-12-01), Lo , XP093147293, ISSN: 1754-1611, DOI: 10.1186/s13036-017-0068-1 *
WICKENHEISSER JESSICA K., BIEGLER JESSICA M., NELSON-DEGRAVE VELEN L., LEGRO RICHARD S., STRAUSS JEROME F., MCALLISTER JAN M.: "Cholesterol Side-Chain Cleavage Gene Expression in Theca Cells: Augmented Transcriptional Regulation and mRNA Stability in Polycystic Ovary Syndrome", PLOS ONE, PUBLIC LIBRARY OF SCIENCE, US, vol. 7, no. 11, 14 November 2012 (2012-11-14), US , pages e48963, XP093147291, ISSN: 1932-6203, DOI: 10.1371/journal.pone.0048963 *

Also Published As

Publication number Publication date
KR20240035692A (ko) 2024-03-18
KR102561516B1 (ko) 2023-08-02
KR20240035691A (ko) 2024-03-18

Similar Documents

Publication Publication Date Title
WO2024053933A1 (ko) Mrna의 세포내 안정성과 생합성을 향상시키는 utr 서열을 포함하는 구성물과 그 사용
US20140220676A1 (en) Method and Medicament for Inhibiting the Expression of a Given Gene
CN110337493A (zh) 用于治疗肌强直性营养不良的组合物和方法
JP2022536951A (ja) 環状ポリリボヌクレオチドを投与する方法
CN113201591B (zh) 一种长链非编码rna及其抑制剂在预防、治疗乳腺癌中的应用
JP2024504412A (ja) 機能性核酸分子および方法
CN1526012A (zh) 一种高效表达抗癌基因的肿瘤细胞内特异性增殖的病毒及其用途
WO2021194179A1 (ko) Stat3 및 mtor를 이중 특이적으로 표적하는 핵산서열을 포함한 항암 바이러스
CN113564252B (zh) 甲基化酶mettl3的新用途
CN116693626A (zh) 订书肽及其用途和在体外扩增干细胞的方法
WO2019052000A1 (zh) 一种靶向STAT3信号通路miRNA及其制备方法和应用
CN113930451B (zh) 一种用于筛选干扰素信号通路负调控因子的报告系统及其构建方法
WO2022146124A1 (ko) 조직 특이적 발현을 위한 융합 프로모터 및 이의 용도
WO2022055093A1 (ko) 종양미세환경 회피능을 갖는 면역세포치료제 조성물
CN110042121B (zh) 一种促进白血病细胞分化的方法及其应用
CN114306608B (zh) 一类适应低氧或缺氧微环境的肿瘤的治疗靶点及其应用
CA2446606A1 (en) Inhibitors of dna methyltransferase isoforms
JP4032013B2 (ja) ＳＭＧ−１特異的ｓｉＲＮＡ及びｍＲＮＡサーベイランス機構抑制剤
WO2011162558A2 (ko) 아데닐레이트 싸이클라제 활성화 폴리펩타이드 1 (뇌하수체)의 유전자를 함유하는 자궁경부암세포의 증식 억제용 재조합벡터 및 자궁경부암 치료용 약학 조성물
CN107058230B (zh) 一种沉默t细胞抗原受体的t淋巴细胞的制备方法
WO2024023530A1 (en) Functional nucleic acid molecule and method
WO2019227687A1 (zh) 一种HDAC4信号通路miRNA抑制剂及其过表达方法和应用
Ito et al. Metastatic phenotype in hybrid cells derived from B16 melanoma
KR20220035575A (ko) GDF11 유전자의 발현을 조절하는 PCBP2와 microRNA를 함유하는 조성물
CN115778976A (zh) 靶向linc02258基因的抑制剂在制备乳腺癌血管生成抑制药物中的应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23863409

Country of ref document: EP

Kind code of ref document: A1