WO2012033272A1 - 인간 유래 세포 투과성 펩타이드와 생리활성 펩타이드 결합체 및 그 용도 - Google Patents

인간 유래 세포 투과성 펩타이드와 생리활성 펩타이드 결합체 및 그 용도 Download PDF

Info

Publication number
WO2012033272A1
WO2012033272A1 PCT/KR2011/002990 KR2011002990W WO2012033272A1 WO 2012033272 A1 WO2012033272 A1 WO 2012033272A1 KR 2011002990 W KR2011002990 W KR 2011002990W WO 2012033272 A1 WO2012033272 A1 WO 2012033272A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
peptide
seq
bone
conjugate
Prior art date
Application number
PCT/KR2011/002990
Other languages
English (en)
French (fr)
Inventor
정종평
박윤정
이주연
서진숙
Original Assignee
서울대학교산학협력단
주식회사 나이벡
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단, 주식회사 나이벡 filed Critical 서울대학교산학협력단
Priority to US13/821,790 priority Critical patent/US9023987B2/en
Priority to EP11823705.6A priority patent/EP2615105B1/en
Publication of WO2012033272A1 publication Critical patent/WO2012033272A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/51—Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a novel human-derived cell-penetrating peptide-physiologically active peptide conjugate and its use, and more specifically, to a physiological selected from the group consisting of cell-penetrating peptides, bone differentiation inducing sequence, bone regeneration inducing sequence and anti-inflammatory functional sequence.
  • Cell-penetrating peptide-physiological activity induced by chemically binding the activity inducing sequence to penetrate target cells by directly introducing important domains of physiologically active non-permeable intracellular proteins into cells.
  • Bone-forming cells are derived from mesenchymal stem cells and can be partially collected from normal bone, fat, and blood, but the bone marrow is expected to collect minimal invasion and maximum cell yield. In addition to blood-related cells, the bone marrow contains a large amount of bone marrow stromal cells, also called mesenchymal stem cells.
  • the technology used for bone regeneration using bone marrow matrix cells is largely 1) using the bone marrow itself, 2) separating and using only bone marrow-derived nucleated cells, 3) proliferating bone marrow matrix cells and using them as cell therapy, 4) using bone marrow matrix cells. Proliferation and differentiation into osteoblasts used as cell therapy, and some have already been developed and some are currently under development.
  • rhBMPs Human Recombinant Bone Morphogenetic proteins
  • TGF- ⁇ superfamily TGF- ⁇ superfamily, which are known to form new and new cartilage when transplanted
  • rhBMP-2, -4, -5, -6, -7 Kim CS et al.
  • the protein has a portion capable of binding to two WW domains of the osteoinductive region, which is called Smurf (Smad ubiquitin regulatory factor1) 1, which degrades Smad1 and Smad5, the main proteins of bone differentiation signaling system. Combine with your WW domain.
  • Smurf Smad ubiquitin regulatory factor1
  • Smad5 the main proteins of bone differentiation signaling system. Combine with your WW domain.
  • a study reported in 2006 showed that the affinity of Smurf1-LMP1 was stronger than that of Smurf1-Smad1 or Smad5 when comparing the competitive avidity of LMP1, Smad1, and Smad5 to Smurf1.
  • the shortest sequence that can induce differentiation and bone formation in the furnace was identified (GAPPPADSAP, Boden SD et al., JBC 2006; 281: 17212-17219).
  • PTD Protein Transduction Domain
  • the mechanism by which PTD penetrates the cell membrane is not yet known, but it is considered to be receptor-independent and independent of endocytosis or phagocytosis.
  • the cell membrane permeation of these peptides shows that the rapid increase of half-life in vivo can increase drug value by increasing the migration of therapeutic proteins and macromolecule genes, which are difficult to use as drugs.
  • TAT protein a transcription factor of human immunodeficiency virus-1 (HIV-1).
  • the protein is more effective in transcribing the cell membrane if it is composed of a portion of the 47th to 57th amino acid sequence (YGRKKRRQRRR), in which the positively charged amino acids are concentrated, rather than the complete form of 86 amino acids.
  • YGRKKRRQRRR 47th to 57th amino acid sequence
  • TAT PTD can cross cell membranes alone or attach to other proteins, and can transport proteins from 10 to 120 kDa into cells independent of receptors
  • CPP cell penetrating peptide
  • the present inventors have intensively tried to produce cell-penetrating peptides showing high stability and good target specificity for treating diseases including bone diseases and inflammatory diseases, and thus, contain a large amount of cationic amino acids, such as arginine, as the cell permeable domain.
  • a new human Bone Morphogenic Protein4-derived Heparin Binding Domain (HBD; SSRKKNPNCRRH) was synthesized, and the cell-penetrating peptides can be used to effectively deliver the impermeable domains into cells.
  • HBD Human Bone Morphogenic Protein4-derived Heparin Binding Domain
  • An object of the present invention is to provide a human-derived cell-penetrating peptide which is a cell-penetrating novel peptide capable of carrying a cell impermeable substance into or into a cell.
  • Another object of the present invention is to provide the use of the cell-penetrating peptide for delivering a cell impermeable substance.
  • Still another object of the present invention is to provide a conjugate in which a bioactive peptide or protein is bound to the cell permeable peptide.
  • Still another object of the present invention is to provide a use of a conjugate in which a bioactive peptide is bound to the cell-penetrating peptide for the prevention or treatment of a bone disease or an autoimmune disease.
  • Still another object of the present invention is to provide a pharmaceutical composition
  • a pharmaceutical composition comprising a conjugate in which a bioactive peptide is bound to the cell permeable peptide, and a pharmaceutically acceptable carrier.
  • Still another object of the present invention is to provide a pharmaceutical composition for preventing or treating bone diseases or autoimmune diseases, including a conjugate in which a bioactive peptide is bound to the cell permeable peptide, and a pharmaceutically acceptable carrier.
  • Another object of the present invention comprises administering to a subject a pharmaceutical composition comprising a conjugate in which a bioactive peptide is bound to the cell permeable peptide and a pharmaceutically acceptable carrier, preventing bone disease or autoimmune disease Or to provide a method of treatment.
  • the present invention is a human-derived cell-penetrating peptide consisting of 5-15 amino acid sequences, characterized in that the content of at least one amino acid selected from the group consisting of arginine, lysine and histidine is 70-80% to provide.
  • the invention also provides the use of said cell permeable peptide for delivering cell impermeable substances.
  • the invention also provides a method of using the cell permeable peptide to deliver a cell impermeable substance.
  • the present invention also provides a conjugate in which a bioactive peptide or protein is bound to the cell permeable peptide.
  • the present invention also provides the use of a conjugate in which a bioactive peptide or protein is bound to the cell permeable peptide for the prevention or treatment of a disease.
  • the present invention also provides the use of a conjugate in which a bioactive peptide is bound to the cell-penetrating peptide for the prevention or treatment of a bone disease or an autoimmune disease.
  • the present invention also provides a pharmaceutical composition for preventing or treating bone diseases, including a conjugate in which a bioactive peptide of bone differentiation inducing sequence or bone regeneration inducing sequence is bound to the cell permeable peptide and a pharmaceutically acceptable carrier. do.
  • the present invention also provides a pharmaceutical composition for preventing or treating autoimmune diseases, including a conjugate in which an anti-inflammatory bioactive peptide is bound to the cell permeable peptide and a pharmaceutically acceptable carrier.
  • the present invention also provides a method for preventing or treating bone disease or autoimmune disease, comprising administering to a subject a pharmaceutical composition comprising a conjugate in which a bioactive peptide is bound to the cell permeable peptide and a pharmaceutically acceptable carrier. To provide a way.
  • Figure 1 schematically shows the origin and chemical structure of the cell permeable peptide-physiologically active peptide (osteoblast differentiation inducing sequence) conjugate and the comparative domains according to the present invention.
  • Figure 2 confirms the accuracy of synthesis of the cell-penetrating peptide-physiologically active peptide (osteoblast differentiation inducing sequence) conjugate and the comparative domain according to the present invention was observed the physiological activity (binding capacity) using chemical, molecular and biological methods.
  • A is BIACORE (Sensorgram) confirming the binding force with Smurf1
  • B is the result of confirming the biological activity of the treatment material for the intracellular degradation of Smad1 / 5/8 by immunoprecipitation method
  • C is the result of confirming the binding strength and concentration-specific binding strength of the treated material and Smurf1 by performing a slot blot.
  • Figure 3 is the result of measuring the intracellular permeability of the fluorescently labeled cell permeable peptide-bioactive peptide (osteoblast differentiation inducing sequence) conjugate and the comparative domain according to the present invention
  • (A) is a confocal scanning electron microscope (confocal scanning microscope) ) Is a photograph
  • (B) is a graph measured using a fluid cell measurement method.
  • (a), (d) and (g) are groups treated with PBS, and (b), (e) and (h) are groups treated with osteoinduction sequences and (c), (f), ( i) is a group treated with cell permeable peptide-osteoblast differentiation inducing sequence conjugate. Each was observed with an optical microscope and a confocal scanning microscope.
  • (B) is a graph of the values obtained through the quantitative real-time polymerase chain reaction, and is the result for bone tissue differentiation markers ALP, OCN, and RUNX2.
  • (C) is a photograph taken under UV after staining the reaction of (B) with EtBr using electrophoresis, and (D) separates the cytoplasm and nucleus and plays an important role in bone differentiation signaling system.
  • the protein was used to confirm the difference in cell differentiation ability of the cell-penetrating peptide-physiologically active peptide (osteoblast differentiation inducing sequence) conjugate and the comparative domain by Western blot assay.
  • Figure 5 is a graph of the effect on the cell proliferation of the cell-penetrating peptide-physiologically active peptide (osteoblast differentiation inducing sequence) conjugate according to the present invention and the comparative domain using MTT reagent over time.
  • Figure 6 is a graph of the effect of the cell permeable peptide-physiologically active peptide (osteoblast differentiation inducing sequence) conjugates and comparative domains on the cell proliferation ability according to the present invention over time by BrdU assay.
  • FIG. 7 is a photograph comparing the cell permeability of the fluorescently labeled cell permeable peptide according to the present invention with a well-known cell permeable peptide (TAT). Incubation time was 20 minutes and 80 minutes, TAT was used as a positive control, poly-glutamic acid (CGGGEEEEEEEEEEE) was used as a negative control, and a confocal scanning microscope was observed.
  • TAT cell permeable peptide
  • Figure 8 shows the effect of the cell-penetrating peptide-physiologically active peptide (bone differentiation inducing sequence) conjugate according to the present invention on bone differentiation signaling system generated when treated in human mesenchymal stem cells.
  • the present invention relates to an intracellular delivery technique for preparing a cell-penetrating peptide and allowing a non-permeable physiologically active substance such as a peptide or drug bound thereto to penetrate into the cell, and a non-permeable physiological activity such as a peptide or drug to be introduced.
  • a non-permeable physiologically active substance such as a peptide or drug bound thereto
  • a non-permeable physiological activity such as a peptide or drug to be introduced.
  • the present invention relates to a human-derived cell-penetrating peptide comprising 5-15 amino acid sequences, wherein the content of at least one amino acid selected from the group consisting of arginine, lysine and histidine is 70-80%.
  • the cell permeable peptide is H4S (SEQ ID NO: 1: SSRKKNPNCRRH), H4Q (SEQ ID NO: 2: QRARKKNKNCRRH), HBD-3P (SEQ ID NO: 3: CSTRGRKCCRRKK), H2 (SEQ ID NO: 4, HKREKRQAKHKQRKR), H3 ( SEQ ID NO: KSKNKKKQRKGPHRK), H3B (SEQ ID NO: 6: KPRPGRKDRRKK), H4-1 (SEQ ID NO: 7: RRRRAKRSPKHHS), H6 (SEQ ID NO: 8: SRRRQQSRNR), H8 (SEQ ID NO: 9: RAVRPLRRRQPKKS), H4C (SEQ ID NO: 10 : CSSRKKNPNCRRH), H5C (SEQ ID NO: 11: CSSRKKNKNCPRRH) and H6C (SEQ ID NO: 12: CSSRKKNPNCPRRH).
  • H4Q is a peptide derived from human BMP-4
  • HBD-3P is a peptide derived from human beta defensin
  • H2 is derived from human BMP-2
  • H3 and H3B are derived from human BMP-3
  • H4-1 is a modification of a peptide derived from human BMP-4
  • H6 is a human osteoblastic protein ( H8, derived from human BMP) -6
  • the present invention relates to a conjugate in which a bioactive peptide or protein is bound to the cell permeable peptide.
  • the cell permeable peptide and the biologically active peptide conjugate can be prepared using a peptide synthesis apparatus by chemical synthesis, the bone differentiation induction sequence or physiology at the C terminal of the protein transport domain (PTD) having intracellular permeability
  • the active domains are allowed to be chemically synthesized sequentially so that the sequence of 'N end-protein transport domain-osteoblast differentiation inducing sequence or bioactive domain-C terminus'or' N end-osteoblast differentiation inducing sequence or bioactive domain-protein transport domain- C-terminal sequence 'can be synthesized to prepare a cell-penetrating peptide-physiologically active peptide (osteoblast differentiation inducing sequence) conjugate.
  • the bioactive domain is a substance that modulates gene expression and physiological function in the cell ( In vitro ) or in vivo ( In vivo ) as well as bone differentiation-inducing action, due to the lack or excessive secretion of substances involved in the regulation of function in vivo It may be characterized in that it can play a role of correcting when showing an abnormal condition, in consideration of stability in the body can be L-type or D-type.
  • the physiologically active domain is used as a meaning including the bone differentiation induction sequence, bone regeneration induction sequence and anti-inflammatory functional sequence
  • the biological activity induction sequence is SEQ ID NO: 13 (GAPPPADSAP), And SEQ ID NO: 14 (PPGY), SEQ ID NO: 15 (PPAY), and an anti-inflammatory sequence SEQ ID NO: 16 (anticare peptide: TRGRKCCRRKK).
  • the physiological activity induction sequence may be a peptide having an anti-inflammatory or antimicrobial functional sequence, cell adhesion induction sequence.
  • the cell-penetrating peptide may include at least one amino acid selected from the group consisting of arginine, lysine and histidine in an amount of 70-80%, and the amino acids constituting the cell-penetrating peptide may be stable in the body. In consideration, it may be L-type or D-type.
  • the cell permeable peptide-physiologically active peptide conjugate according to the present invention is a protein transport domain (PTD) having intracellular permeability, and other cationic protein transport domains other than H4S (SEQ ID NO: 1: SSRKKNPNCRRH), a transport domain found by the present inventors.
  • PTD protein transport domain
  • SEQ ID NO: 1 SSRKKNPNCRRH
  • H4Q SEQ ID NO: 2: QRARKKNKNCRRH
  • HBD-3P SEQ ID NO: 3: CSTRGRKCCRRKK
  • H2 SEQ ID NO: 4 , HKREKRQAKHKQRKR
  • H3 SEQ ID NO 5: KSKNKKKQRKGPHRK
  • H3B SEQ ID NO: 6: KPRPGRKDRRKK
  • H4-1 SEQ ID NO: 7: RRRRAKRSPKHHS
  • H6 SEQ ID NO: 8: SRRRQQSRNR
  • H8 SEQ ID NO: RAVKS
  • H4C SEQ ID NO: 10: CSSRKKNPNCRRH
  • H5C SEQ ID NO: 11: CSSRKKNKNCPRRH
  • H6C SEQ ID NO: 12: CSSRKKNPNCPRRH
  • cell permeable peptide-physiologically active peptide conjugates according to the present invention can also be made using existing non-human derived cell-permeable domains such as TAT, arginine-derived peptides.
  • TAT non-human derived cell-permeable domains
  • arginine-derived peptides it is listed as human-derived peptides to impart biocompatibility, but this does not mean that they cannot be applied to existing viral and non-human-derived peptides.
  • the cell permeable peptide-physiologically active peptide (osteoblast differentiation inducing sequence) conjugate according to the present invention is covalently bonded with fluorescent dyes used in optical imaging or contrast agent nanoparticles used in magnetic resonance imaging, thereby promoting bone differentiation and regeneration in cells and in vivo.
  • fluorescent dyes or contrast nanoparticles may be covalently bonded to the N- or C-terminus of the cell-penetrating peptide-physiologically active peptide (bone differentiation-inducing sequence) conjugate.
  • Cysteine is additionally attached to the distal end of the protein transport domain (PTD) and used.
  • the complex of the cell-penetrating peptide-physiologically active peptide (osteoblast differentiation inducing sequence) conjugate and the fluorescent dye or contrast nanoparticles can be made by inducing a chemical bond using a crosslinking agent.
  • a crosslinking agent When chemical bonds are induced using a crosslinking agent, complexes formed by the crosslinking agent are easily formed because each of the free amino groups is provided at the N-terminus of the protein transport domain (PTD) peptide, that is, the protein transport domain (PTD).
  • the crosslinking agent that can be used in the present invention is 1,4-bis-maleimidobutane (BMB), 1,11-bis-maleimidotetraethyleneglycol (1,11-bis-maleimidotetraethyleneglycol, BM [PEO] 4), 1-ethyl-3- [3-dimethyl aminopropyl] carbodiimide hydrochloride (1-ethyl-3- [3-dimethyl aminopropyl] carbodiimide hydrochloride (EDC), succinimidyl-4- [ N-maleimidomethylcyclohexane-1-carboxy- [6-amidocaproate]] (succinimidyl-4- [N-maleimidomethylcyclohexane-1-carboxy- [6-amidocaproate]], SMCC) and its sulfonates -SMCC), succimidyl 6- [3- (2-pyridyldithio) -lopionamido
  • the present invention provides a bone disease comprising a conjugate and a pharmaceutically acceptable carrier to which the cell-penetrating peptide is bound to a physiologically active peptide selected from the group consisting of SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15.
  • a pharmaceutical composition for the prophylaxis or treatment of may be provided as a pharmaceutical composition for treatment of bone defects and bone metabolism diseases, the bone diseases in the group consisting of osteoporosis, osteoplasia, hypercalcemia, osteomalacia, Paget's disease, bone loss due to cancer and bone necrosis
  • the selected, the pharmaceutical composition may be characterized in that in the form of an injection.
  • the present invention also relates to a pharmaceutical composition for preventing or treating autoimmune disease, comprising a conjugate in which the physiologically active peptide of SEQ ID NO: 16 is bound to the cell-penetrating peptide, and a pharmaceutically acceptable carrier.
  • the autoimmune disease may be characterized as rheumatoid arthritis or psoriasis
  • the pharmaceutical composition may be characterized in the form of a skin permeable formulation such as ointment or patch.
  • the present invention also provides a method for preventing or treating bone disease or autoimmune disease, comprising administering to a subject a pharmaceutical composition comprising a conjugate in which a bioactive peptide is bound to the cell permeable peptide and a pharmaceutically acceptable carrier. To provide a way.
  • compositions according to the invention can be used in the form of oral dosage forms, external preparations, suppositories, and sterile injectable solutions, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., respectively, according to conventional methods.
  • sterile injectable solutions such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., respectively, according to conventional methods.
  • Carriers, excipients and diluents that may be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and the solid preparations may include at least one excipient such as starch, calcium carbonate, sucrose in the extract. ) Or lactose, gelatin and the like are mixed.
  • lubricants such as magnesium stearate and talc are also used.
  • Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • the non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate and the like can be used.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • compositions of the present invention vary depending on the condition and weight of the patient, the extent of the disease, the form of the drug, the route of administration and the duration, and may be appropriately selected by those skilled in the art.
  • the composition of the present invention is preferably administered at 0.0001 to 500 mg / kg, preferably at 0.001 to 250 mg / kg. Administration may be administered once a day or may be divided several times. The dosage does not limit the scope of the invention in any aspect.
  • 'protein transport domain (PTD)' refers to a permeable peptide that can permeate a drug or drug-containing particles into the cytoplasm or nucleus of a cell. This means that covalent bonds with oligonucleotides, peptides, proteins, oligosaccharides, polysaccharides, or nanoparticles can introduce these substances into cells without requiring additional receptors, carriers, or energy.
  • 'induced osteogenic differentiation' in the physiological activity function is used to induce calcification of extracellular matrix (ECM) using adult stem cells having the possibility of differentiation into osteoblasts and through differentiation of cells. Changes in shape and the production of bone nodule, or altering the character of the cell to determine the fate of osteoblasts and osteoblasts. Or a phenomena including a phenomenon of inducing bone regeneration by implanting a biocompatible support including a bone graft material or stem cells having differentiation potential into bone cells in a bone defect part in vivo, Collectively, any type of technology or substance that can be used to treat bone regeneration.
  • anti-inflammatory function of the physiological activity function refers to a technique for discovering substances and substances that can block proteins causing inflammation in the cell.
  • Cell-penetrating peptides such as F-moc were synthesized using a peptide synthesizer to contain GAPPPADSAP (SEQ ID NO: 7) and H4S (SSRKKNPNCRRH; SEQ ID NO: 1) as PTD-derived bone differentiation-derived sequence derived from the N-terminus. Synthesis was performed by the solid-phase chemical synthesis method (FIG. 1). In other words, it was synthesized using a Rink resin (0.075 mmol / g, 100 to 200 mesh, 1% DVB crosslinking) combined with Fmoc- (9-Fluorenylmethoxycarbonyl) as a blocking group, and 50 mg of Rink resin in the synthesizer.
  • the synthesized peptide sequence was cleaved from the resin, washed, lyophilized and separated and purified by liquid chromatography. The purified peptide was confirmed molecular weight using MALDI analysis.
  • the peptide was synthesized by F-moc solid-phase chemical synthesis using a peptide synthesizer.
  • the peptide was synthesized by F-moc solid-phase chemical synthesis using a peptide synthesizer.
  • the human-derived Smurf1 protein acting as a ligand in this experiment was Origene (Rockville, MD, USA). ).
  • the 100 mg / ml of the protein is bound to the gold-coated side of the CM5 chip (BIACORE AB, Sweden) where the amino group is bound to the surface using an EDC / NHS kit (BIACORE AB, Sweden).
  • a method called 'pH scouting' is performed to find one pH condition.
  • the experimental method of 'pH scouting' may be used in the BIACORE T100 (BIACORE AB, Sweden) software used by the researcher.
  • the analyte cell permeable functional peptide-osteoblast differentiation inducing sequence conjugate synthesized in Example 1, cell permeable peptide of Comparative Example 1 for use as a negative control and positive control
  • Bone differentiation induction sequence of Comparative Example 2 for use in each of the 10mM flows on the CM5 chip while measuring the binding force (the above test method is' Binding analysis embedded in the BIACORE T100 (BIACORE AB, Sweden) software used by the researcher) May be used).
  • Comparative Example 2 which is a part that binds to the WW domain in the Smurf1 protein sequence and has bone differentiation ability, has a binding force of 750 RU (Resonance Unit; binding unit) for Smurf1.
  • the cell penetrating functional peptide-osteoblast differentiation inducing sequence conjugate synthesized in Example 1 showed 600RU, and the cell penetrating peptide of Comparative Example 1 used as a negative control in this experiment showed 100RU.
  • the cell-penetrating functional peptide-osteoblast differentiation inducing sequence conjugate has a bone differentiation inducing sequence and no significant damage to the physiological activity sequence (parts that can be functionalized by binding to Smurf1 in vivo) during synthesis. It is a result that shows the sound.
  • hMSC basal medium MSCBM, LONZA, USA
  • HMSCs synthesized in Examples 1 and 2 were cell lysis buffer (1% triton X-100, 150 mM NaCl, 50 mM Tris-Cl, pH 7.5), 0.1% SDS, 1% NP-40, 1 mM Destroyed using PMSF). In order to obtain the supernatant of the protein in the cell lysate (cell lysate), it was centrifuged for 10 minutes at 4 °C at 12,000 rpm.
  • the cell lysate was reacted with Smad1 / 5/8 antibody (5 ⁇ g) for 20 hours at 4 ° C., and then protein A / G-agar Ross beads (protein A / G-agarose beads) were added and reacted at 4 ° C. for 4 hours.
  • the beads were washed three times with PBS containing 1 mM DTT and boiled for 5 minutes with 2X protein loading dye (25% SDS, 62.5mM Tris-HCl (pH 6.8), 25% Gylcerol, and 0.01% Bromophenol Blue). .
  • the samples were separated on electrophoresis using SDS-PAGE.
  • Binding proteins separated by SDS-PAGE are transferred to a nitrocellulose membrane (NC membrane) for Western blot.
  • NC membrane nitrocellulose membrane
  • the washed NC membrane is reacted with 1 ⁇ g of Ubiquitin antibody used as primary antibody for 4 hours at room temperature. Wash 3 times with TBST for 10 minutes and react with HRP (horse radish peroxidase) secondary antibody for 1 hour at room temperature.
  • HRP horseradish peroxidase
  • Tween20 is made into 1L solution).
  • a slot blot assay was used.
  • the protein is raised on the membrane, inhaled from the opposite side, and strongly adhered to the surface of the membrane. Then, the substance to be observed to interact with the protein attached to the membrane is directly raised and incubated for a predetermined time to induce binding.
  • Blotting (botting) technique is a molecular biological method that checks the interaction (binding force) between proteins and substances through the difference of each dot.
  • the Smurf1 protein and Comparative Example 2 domain used as a positive control through the above-described method was bound and detected as a dot in Fig. 2 (C) and the Smurf1 protein and cell-penetrating peptides- Dot was also identified at the site of inducing binding of the bone differentiation inducing sequence conjugate.
  • FIG. 2 (D) when the cell permeable peptide-osteoblast differentiation inducing sequence conjugate or the osteoblast differentiation inducing sequence was incubated with the Smurf1 protein, the dot size of the bone differentiation inducing sequence (Comparative Example 2) was charged from 0.1 mM to 100 mM.
  • the dot size of the cell-penetrating peptide-osteoblast differentiation-inducing sequence conjugate also increases with the concentration from 10 mM. This means that the binding between the two substances (the conjugate obtained in Example 1 and Comparative Example 2 and the Smurf1 protein) occurs outside the cell, and it shows that it can increase with concentration.
  • Example 3 Cell-permeable peptide-induced bone differentiation in vitro of the conjugate acid sequence (in vitro) cell permeability measurement
  • the fluorescent material was labeled. 10 equivalents of Fluorescein isothicyanate (FITC) was bound to the N-terminus of the synthesized domain using triethylamine (1 ml per 1 g of resin), and the synthesis was confirmed by measuring the molecular weight using MALDI-TOF.
  • FITC Fluorescein isothicyanate
  • the purification was carried out under the same conditions as the solvent and the detection wavelength using a 2.2 cm diameter column at a flow rate of 20 ml / min. Only pure peptides were aliquoted, the solvent was removed using a rotary evaporator, and lyophilized.
  • a sterile slide glass was placed in a 6-well, and 2 ⁇ 10 4 hMSCs (human mesenchymal stem cells) were dispensed. After 20 hours incubation (overnight incubation) in fetal bovine serum (FBS, Fetal Bovine Serum, GIBCO, USA) incubated for 20 hours (overnight starvation) in hMSC basal medium (MSCBM, LONZA, USA) medium containing 0.5%.
  • FBS Fetal Bovine Serum
  • GIBCO fetal bovine serum
  • the fluorescent dye (FITC, green) was prepared by treating the cell-penetrating peptide-osteoblast differentiation inducing sequence conjugate of Example 1 and the bone differentiation inducing sequence of Comparative Example 2
  • the cell permeable peptide-osteoblast differentiation inducing sequence conjugate of Example 1 containing the PTD sequence of Comparative Example 1 was observed in the cytoplasm 20 minutes after treatment. And 80 minutes after treatment, it was clearly observed in the cytoplasm and nucleus. This showed that the cell permeability increased in a time-dependent manner (but observed within 80 minutes) due to the PTD sequence contained in the cell-penetrating peptide-osteoblast differentiation inducing sequence conjugate.
  • hMSCs were dispensed in 6-well, and then 20 hours in a general medium. After incubation (overnight incubation), 20 hours of incubation (overnight starvation) in hMSC basal medium (MSCBM, LONZA, USA) medium containing 0.5% fetal bovine serum (FBS, Fetal Bovine Serum, GIBCO, USA).
  • MSCBM hMSC basal medium
  • FBS Fetal Bovine Serum
  • the cells were separated from the wells using 0.25% trypsin, washed with phosphate buffer (PBS), and centrifuged to remove the supernatant. Outer fluorescent dyes were removed. To this, 300 ml of phosphate buffer solution (PBS) was added, and the cells were suspended, and then observed at FL-1 (488 nm) using FACSCalibur (BD, USA).
  • PBS phosphate buffer solution
  • the fluorescent dye (FITC, green) was prepared by treating the cell-penetrating peptide-osteoblast differentiation-inducing sequence conjugate of Example 1 and the osteogenic differentiation sequence of Comparative Example 2
  • the cell permeable peptide-osteoblast differentiation inducing sequence conjugate of Example 1 which includes the PTD sequence of Comparative Example 1 shows a fluorescence sensitivity increased by 10 times or more.
  • the cell permeability of the cell permeable peptide-osteoblast differentiation inducing sequence conjugate was found.
  • Example 4 Cell-permeable peptide-induced bone differentiation in vitro of the conjugate acid sequence (in vitro) cell measurement multipotential
  • Example 1 In order to confirm the cell differentiation capacity of the cell-penetrating peptide-osteoblast differentiation inducing sequence conjugate as the amount of calcium phosphate produced, 1 ⁇ 10 3 human Mesenchymal Stem cells (hMSCs) were dispensed into 24-wells as Example 1 The synthesized cell permeable peptide-osteoblast differentiation inducing sequence conjugate and the concentration of Comparative Example 2 were treated with 10 mM and cultured in hard tissue forming medium for 14 days.
  • hMSCs human Mesenchymal Stem cells
  • the composition of the hard tissue forming medium was 15% fetal bovine serum (FBS), L-ascorbic acid 50 mg / ml, dexamethasone 10 -7 M, antibiotic-antimycotic solution 1%, beta-glycerol phosphate 10 mM in MSCBM medium. . After incubation, the medium was removed and washed twice with phosphate buffer (PBS). Cells were fixed with 90% Ethanol for 15 minutes at 4 ° C., washed twice with distilled water, and stained with 2% Alizarin red S Solution (pH 4.2; Alizarin red S powder, Junsei, JAPAN) for 5 minutes.
  • the cell permeable peptide-osteoblast differentiation inducing sequence conjugate (c) of Example 1 showed a relatively strong staining level of calcium phosphate, indicating the cell differentiation ability of the cell permeable peptide-osteoblast differentiation inducing sequence conjugate.
  • ALP Alkaline phosphatase
  • hMSC human Mesenchymal Stem cell
  • the composition of the hard tissue forming medium was 15% fetal bovine serum (FBS), L-ascorbic acid 50 mg / ml, dexamethasone 10 -7 M, antibiotic-antimycotic solution 1%, beta-glycerol phosphate 10 mM in MSCBM medium. . After incubation, the medium was removed and washed twice with phosphate buffer (PBS). Cells were fixed at 10% NBF for 20 minutes at room temperature, washed twice with phosphate buffer (PBS), and stained according to the experimental method recommended by the manufacturer using Alkaline phosphatase detection kit (Millipore, USA).
  • Bone differentiation inducing sequence (e) that does not significantly increase the differentiation into osteoblasts compared to the group (d) treated only with PBS after 14 days of culture, whereas the PTD sequence of Comparative Example 1
  • the cell permeable peptide-osteoblast differentiation inducing sequence conjugate (f) of Example 1 showed a relatively strong staining of Alkaline phosphatase, indicating the cell differentiation capacity of the cell permeable peptide-osteoblast differentiation inducing sequence conjugate.
  • hMSC human mesenchymal stem cells
  • the composition of the hard tissue forming medium was 15% fetal bovine serum (FBS), L-ascorbic acid 50 mg / ml, dexamethasone 10 -7 M, antibiotic-antimycotic solution 1%, beta-glycerol phosphate 10 mM in MSCBM medium. .
  • FBS fetal bovine serum
  • L-ascorbic acid 50 mg / ml L-ascorbic acid 50 mg / ml
  • dexamethasone 10 -7 M antibiotic-antimycotic solution 1%
  • beta-glycerol phosphate 10 mM in MSCBM medium .
  • the medium was removed and washed twice with phosphate buffer (PBS).
  • the cells washed with phosphate buffer were fixed with 10% neutral buffered formalin (NBF), stained with nucleus (Hoechst 33342, blue), and then the differentiation of cell-penetrating peptide-osteoblast differentiation-inducing sequence conjugates into osteoblasts
  • Bone differentiation induction sequence (h) that can not be compared to the group (g) treated only with PBS after 14 days of incubation period, the degree of calcium phosphate staining is similar, Example 1 containing the PTD sequence of Comparative Example 1
  • the cell permeable peptide-osteoblast differentiation inducing sequence conjugate of (i) showed a relatively strong staining of calcium phosphate staining in fluorescence wavelength was able to confirm the cell differentiation ability of the bone differentiation inducing sequence by the cell permeable peptide.
  • hMSC human Mesenchymal Stem cells
  • Trizol reagent Invitrogen life technologies, USA
  • cDNA complementary DNA
  • PCR complementary 2pmole primer
  • PCR was performed using Gene Amp PCR system 9700 (Applied Biosystems, USA) to determine the number of repetitions under conditions in which each PCR product was not saturated.
  • the synthesized PCR product was electrophoresed on a 1% agarose gel containing 10 ⁇ gml -1 EtBr (ethidium bromide), and subjected to GEL DOC 2000 densitometer and image analysis system (Bio-Rad, USA). Confirmed.
  • the expression levels of ALP, OCN, and RUNX2, which are known as bone differentiation marker genes showed almost similar values (B) and bands (C) compared to the group treated with PBS alone, whereas the PTD sequence of Comparative Example 1
  • the cell permeable peptide-osteoblast differentiation inducing sequence conjugate of Example 1 included showed a markedly increased band of marker expression (B) with a 2.5- to 60-fold increase in bone marrow induction sequence due to cell permeable peptides. The cell differentiation ability of was confirmed.
  • a human Mesenchymal Stem cell in a 10 cm dish. 1 ⁇ 10 6 aliquots were dispensed and then incubated for 20 hours in normal medium to stabilize the cells. After 20 hours of incubation, the concentration of the cell permeable peptide-osteoblast differentiation inducing sequence conjugate and Comparative Example 2 was treated with 10 ⁇ M for 1 hour 30 minutes.
  • the cells treated with the cell permeable peptide-osteoblast differentiation inducing sequence conjugate and Comparative Example 2 were tested by the manufacturer using NE-PER Nuclear and cytoplasmic extraction reagents (Pierce, USA).
  • NE-PER Nuclear and cytoplasmic extraction reagents Pieris, USA.
  • the hMSC lysate, separated into cytoplasm and nucleus was quantified by Bradford's assay and electrophoresed at 10 volt polyacrylamide gel at 120 volts for 4 hours, followed by transfer buffer. (12.5mM Tris, 0.1M glycine, pH 8.3) was used to transfer to nitrocellulose membrane at 310 milliamps for 2 hours.
  • a blocking solution 5% Nonfat dry milk, in TBS
  • the primary antibody solution Smurf1, phosphoSmad1 / 5/8; Cell to the blocking solution to a concentration of 1 ⁇ g / ml; Signaling, USA, RUNX2, LaminB, Actin; Santa Cluz, USA
  • the secondary antibody for each primary antibody is added to the blocking solution at 1: 2000 and reacted at room temperature for 1 hour.
  • ECL enhanced chemo-luminal
  • Example 5 Cell-permeable peptide-induced bone differentiation sequence in vitro (in vitro) effect on the cell proliferation measurement in combination
  • MTT (4,5-dimethylthiane) was used to determine whether there was an effect on cell proliferation due to latent toxicity.
  • the MTT assay is a method of measuring the cytotoxicity as a percentage of the control group by measuring the absorbance of formazan produced by the reduction of MTT by live and metabolically active intracellular mitochondrial dehydrogenase. And reflects the concentration of metabolically active cells.
  • 2,3,5-triphenyl tetrazolium chloride (TTC) is reduced to formazan in living cells, which shows insoluble purple color and can measure respiration rate to a degree of color.
  • TTC 2,3,5-triphenyl tetrazolium chloride
  • the absorbance of formazan is maximum at a wavelength of 540 nm, and the absorbance measured at this wavelength reflects the concentration of living and metabolically active cells. If the concentration of cells in the well to be measured is too low or too high, Since the linear relationship between concentration and absorbance was not established, the optimal cell concentration was determined.
  • hMSCs human mesenchymal stem cells
  • 0.1 mg (50 ⁇ l of 2 mg / ml) of MTT was added to each well of the plate, and again incubated for 4 hours at 37 ° C. and 5% carbon dioxide to allow MTT to be reduced.
  • all of the medium was removed using a pipette, leaving only about 30 ⁇ l of medium, taking care not to disturb the crystals formed in each well.
  • 150 ⁇ l of dimethyl sulfoxide (DMSO, dimethyl sulforoxide, Aldrich) was added and stirred for about 5 minutes to dissolve the formazan crystals. Absorbance was measured at 540 nm using a photometer for plate (ELISA reader, Bio-Tek, USA).
  • hMSCs human Mesenchymal Stem cells
  • BrdU colorimetry
  • Boehringermanheim, Germany The degree of intracellular influx, ie the proliferation of hMSCs, was measured.
  • concentrations of the cell-penetrating peptide-osteoblast differentiation-inducing sequence conjugate synthesized as Example 1 and Comparative Example 2 were treated with 10 mM to incubate for 24 hours, 48 hours, and 72 hours in hard tissue-forming medium.
  • the human bone morphogenic protein-4-derived cationic cell-penetrating peptides according to the present invention have no concern for toxicity and immunogenicity, and thus exhibit high stability compared to viral peptide transporters. And in vivo, and can significantly increase target gene expression. In addition, it can be applied to the clinical without going through several steps and can be mass-produced, which is useful for the development of drug delivery system and treatment technology using the same.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 신규한 인간 유래 세포 투과성 펩타이드-생리활성 펩타이드 결합체 및 그 용도에 관한 것으로, 보다 구체적으로, 세포 투과성 펩타이드와 골분화 유도서열, 골재생 유도서열 및 항염기능성 서열로 구성된 군에서 선택되는 생리활성 유도서열을 화학적으로 결합시켜, 생리활성을 지닌 비투과성 세포 내 단백질의 중요 도메인을 세포 내로 직접 도입시킴으로써 표적 세포에 투과할 수 있어 펩타이드 치료제의 역할을 할 수 있도록 유도한 세포 투과성 펩타이드-생리활성 펩타이드 결합체 및 이를 함유하는 치료용 약학조성물에 관한 것이다. 본 발명에 따른 인간 골형성단백질-4 유래 양이온성 세포 투과성 펩타이드는 독성 및 면역원성의 염려가 없어 바이러스성 펩타이드 수송체에 비하여 높은 안정성을 나타내고, 세포 불투과성 물질을 세포 및 물질의 손상 없이 세포 내 및 생체 내로 운반할 수 있고, 표적 유전자 발현을 현저히 증가시킬 수 있다. 또한, 여러 단계를 거치지 않고 임상에 적용할 수 있고 대량 생산이 가능하여 이를 이용한 약물 전달 시스템 및 치료기술의 발전에 유용하다.

Description

인간 유래 세포 투과성 펩타이드와 생리활성 펩타이드 결합체 및 그 용도
본 발명은 신규한 인간 유래 세포 투과성 펩타이드-생리활성 펩타이드 결합체 및 그 용도에 관한 것으로, 보다 구체적으로, 세포 투과성 펩타이드와 골분화 유도서열, 골재생 유도서열 및 항염기능성 서열로 구성된 군에서 선택되는 생리활성 유도서열을 화학적으로 결합시켜, 생리활성을 지닌 비투과성 세포 내 단백질의 중요 도메인을 세포 내로 직접 도입시킴으로써 표적 세포에 투과할 수 있어 펩타이드 치료제의 역할을 할 수 있도록 유도한 세포 투과성 펩타이드-생리활성 펩타이드 결합체 및 이를 함유하는 치료용 약학조성물에 관한 것이다. 본 발명자들은 이를 표적에 지향적인 투과기능성을 지니는 펩타이드 치료제의 발굴 ( T arget O riented P eptide therapeutics Di scovery , TOPscovery)로 명명하였다.
골절 등의 가벼운 뼈 손상은 가벼운 외과적 처치 에 의해서 치유가 가능하지만 불유합, 지연유합, 골손실 혹은 골괴사 등과 같은 근원적으로 골생성 세포의 접근이 곤란하거나 세포수나 활성이 부족하여 자가골이식외에는 대안을 찾기 어려운 골질환들이 존재한다. 체외배양 뼈형성세포를 사용한 치료 방법은 이러한 난점을 해소하기 위한 새로운 대안으로 인식되고 있다. 뼈형성세포는 간엽줄기세포가 기원이며 정상 뼈나 지방, 혈액 등으로부터도 일부 채취가 가능하지만 최소한의 침습과 최대한의 세포 수율을 기대할 수 있는 채취부위는 골수이다. 골수에는 혈액관련 세포 외에 간엽줄기세포로도 불리는 골수기질세포가 다량 존재한다. 골수기질세포를 이용하여 뼈재생에 사용하는 기술은 크게 1) 골수 자체의 이용, 2) 골수유래 유핵 세포만을 분리 이용, 3) 골수기질세포를 증식시켜 세포치료제로 이용, 4) 골수기질세포를 골모세포로 증식 및 분화시켜 세포치료제로 이용하는 기술 등이 있으며 일부는 이미 개발되었고 일부는 현재 개발 중에 있다.
이와 같이 세포를 이용한 골재생을 유도하기 위해서는 골조직분화 신호전달체계를 자극, 촉진시킬 수 있는 성장인자가 요구된다. 또한 골관절염, 류마티스성 관절염에 있어서도 염증의 제어 뿐 아니라 손상된 연골, 골조직의 재생을 동시에 치유할 수 있는 생리활성 물질이 요구된다. 그 동안의 많은 연구들을 통하여 Human Recombinant Bone Morphogenetic proteins (rhBMPs)는 TGF-β superfamily로서, 이식되었을 때 신생골 및 신생연골을 형성한다고 알려져 있으며 (Wozney JM et al., Science 1988;242:1528-1534; Celeste AJ et al., Proc Natl Acad Sci U S A 1990;87:9843-9847), 현재 20가지 이상의 BMP가 발견되었고, 이중 rhBMP-2, -4, -5, -6, -7 (Kim CS et al., J Periodontol 2002;73:1126-1132; Wikesjo UM et al., J Clin Periodontol 1999;26:392-400; Kingsley DM et al., Cell 1992;71:399-410) 등이 골유도성이 우수하여 골 조직 공학 분야에 사용되고 있다. 그럼에도 불구하고 골재생 치료를 원하는 환자들에게 BMP를 적용할 시에는 상당히 높은 농도(1.5mg/ml)가 사용되어야 하며 가격이 비싸서 실제로 임상에서 적용하기는 어렵다. 그러나 1998년에 BMP를 대체할 만한 획기적인 단백질이 밝혀졌고 그것은 세포 내에서 작용하는 LMP(LIM Mineralization Protein)1 이라 하여 직접적으로 골모세포 분화에 관여하는 것으로 보고되었다 (Boden SD et al., Endocrinology 1998;139:5125-34). 이 단백질은 골형성유도영역 (osteoinductive region) 중 2개의 WW 도메인과 결합할 수 있는 부분을 가지고 있는데 이것이 골분화 신호전달체계의 주 단백질인 Smad1, Smad5를 분해시키는 Smurf(Smad ubiquitin regulatory factor1)1이 가진 WW 도메인과 결합한다. 2006년에 보고한 연구결과에서는 Smurf1에 대한 LMP1과 Smad1, Smad5의 경쟁적 결합력을 비교하였을 때 Smurf1-LMP1의 친화도가 Smurf1-Smad1 또는 Smad5 보다 강한 것을 확인하였고 LMP1이 가진 WW 도메인 결합부분 중 골모세포로의 분화 및 골형성을 유도할 수 있는 최단 서열을 밝혀 냈다 (GAPPPADSAP, Boden SD et al., JBC 2006;281:17212-17219).
그러나 소수성이 강한 상기 도메인을 외부에서 합성하여 골재생 유도하기 위해서는 smurf1이 존재하는 세포 내로 투과시켜야 활성을 가지게 된다. 이러한 문제점을 해결하기 위한 연구의 결과로서 제시된 것으로 단백질 전달체 (Protein Transduction Domain, PTD)가 있다. 최근, 세포막 투과가 어려운 단백질을 효과적으로 세포 내부로 전달할 수 있는 단백질 전달 영역 (Protein transduction domain, PTD)에 대한 연구가 활발히 이루어지고 있다. 이러한 단백질 전달체 (Protein Transduction Domain, PTD)는 양전하를 띄는 짧은 길이의 펩타이드로서 세포막을 통과할 수 있다고 알려져 있으며, PTD는 단백질뿐 아니라 DNA, RNA, 지방, 탄수화물, 화합물 또는 바이러스를 효율적으로 세포 내로 전달할 수 있는 것으로 알려져 있다. PTD가 세포막을 투과하는 원리는 아직 밝혀지지 않았으나, 수용체 비의존적이고, 엔도사이토시스 (endocytosis)나 파고사이토시스 (phagocytosis)에 비의존적이라고 생각되고 있다. 이러한 펩타이드의 세포막 투과 현상은 빠른 생체 내 반감기로 인하여 약물로 사용하기 어려웠던 치료용 단백질 및 거대분자인 유전자들의 이동을 높여 약물적인 가치를 높일 수 있음을 보여준다.
이 중 가장 많은 연구가 진행된 것은 인간 면역 결핍 바이러스-1(human immunodeficiency virus-1, HIV-1)의 전사인자인 TAT 단백질이다. 상기 단백질은 세포막을 통과함에 있어, 86개의 아미노산으로 구성된 완전한 형태일 때보다 양전하를 갖는 아미노산들이 집중적으로 분포되어 있는 47번째부터 57번째 아미노산 서열(YGRKKRRQRRR)의 일부분으로 구성된 형태일 경우, 더욱 효과적이라는 것이 밝혀졌다 (Fawell, S. et al., Proc. Natl. Acad. Sci. USA, 91:664, 1994). TAT PTD는 단독으로 또는 다른 단백질에 붙어서도 세포막을 통과할 수 있으며, 10에서 120kDa에 이르는 단백질을 수용체와 상관없이 세포 내로 운반할 수 있음이 보고되었다 (Schwarze SR. et al., Trends Pharmacol Sci 2000;21:45-48; Fawell S et al., Proc Natl Acad Sci USA 1994;91:664-668).
세포 투과성 펩타이드(cell penetrating peptide, CPP)로서의 효과가 확인된 다른 예로는 HSV-1(herpes simplex virus type 1)의 VP22 단백질의 267번째부터 300번째까지의 아미노산 서열을 가지는 펩타이드 (Elliott, G. et al., Cell, 88:223, 1997), HSV-2의 UL-56 단백질의 84번째부터 92번째까지의 아미노산 서열을 가지는 펩타이드(GeneBank code:D1047[gi:221784]) 및 드로소필라 속(Drosophila sp.)의 안테나페디아(antennapedia, ANTP) 단백질의 339번째부터 355번째까지의 아미노산 서열을 가지는 펩타이드 (Schwarze, S.R. et al., Trends. Pharmacol. Sci., 21:45, 2000) 등이 있으며, 전기적으로 양성인 아미노산들을 나열한 인위적인 펩타이드의 경우도 그 효과가 확인되었다 (Laus, R. et al., Nature. Biotechnol., 18:1269, 2000).
종래 CPP를 다른 펩타이드 또는 단백질과 연결시켰을 경우 융합 단백질을 효율적으로 세포 내로 수송하는 것이 밝혀진 이후, CPP를 이용한 다양한 응용이 시도되었으나 (대한민국 특허등록 제10-0568457호), 투과기능성 펩타이드가 바이러스에서 유래하기 때문에 안전성 측면에서 문제점을 가진다.
따라서, 기존의 바이러스 유래 펩타이드 수송체에서 탈피하여 높은 안전성을 보이고, 최적의 표적 지향화를 통한 골재생이나 염증질환을 포함한 질환치료에 대한 기술개발이 시급하나, 아직까지 그 연구성과가 미흡한 실정이다.
이에 본 발명자들은 골질환, 염증질환을 포함한 질환들을 치료할 수 있는 높은 안정성을 나타내며 표적 특이성이 좋은 세포 투과성 펩타이드를 제작하고자 예의 노력한 결과, 세포투과성 도메인으로서 아르기닌(arginine) 등의 양이온성 아미노산을 다량 함유하는 인간 골형성단백질-4 유래 헤파린 결합도메인 (human Bone Morphogenic Protein4 derived Heparin Binding Domain, HBD; SSRKKNPNCRRH)을 새로이 합성하였고, 이 세포 투과성 펩타이드를 이용하여 불투과성 도메인들을 세포 내로 효과적으로 전달할 수 있다는 사실을 규명하고 이 펩타이드를 세포 내 활성 도메인 전달용 펩타이드로 사용함으로써 목적 활성 도메인의 세포 내 전달 및 표적 유전자 발현을 현저히 증가시킬 수 있음을 확인하고 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 세포 불투과성 물질을 세포 내 또는 생체 내로 운반할 수 있는 세포 투과성 신규 펩타이드인 인간 유래 세포 투과성 펩타이드를 제공하는 데 있다.
본 발명의 또 다른 목적은 세포 불투과성 물질을 전달하기 위한 상기 세포 투과성 펩타이드의 용도를 제공하는데 있다.
본 발명의 또 다른 목적은 세포 불투과성 물질을 전달하기 위해 상기 세포 투과성 펩타이드를 이용하는 방법을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 세포 투과성 펩타이드에 생리활성 펩타이드 또는 단백질이 결합되어 있는 결합체를 제공하는 데 있다.
본 발명의 또 다른 목적은 골 질환 또는 자가면역질환의 예방 또는 치료를 위한, 상기 세포 투과성 펩타이드에 생리활성 펩타이드가 결합되어 있는 결합체의 용도를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 세포 투과성 펩타이드에 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는, 약학조성물을 제공하는 데 있다.
본 발명의 또 다른 목적은 상기 세포 투과성 펩타이드에 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는, 골 질환 또는 자가면역질환의 예방 또는 치료용 약학조성물을 제공하는 데 있다.
본 발명의 또 다른 목적은 상기 세포 투과성 펩타이드에 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는 약학 조성물을 개체에게 투여하는 단계를 포함하는, 골 질환 또는 자가면역질환의 예방 또는 치료 방법을 제공하는 데 있다.
상기 목적을 달성하기 위하여, 본 발명은 5-15개의 아미노산 서열로 구성되고, 아르기닌, 라이신 및 히스티딘으로 구성된 군에서 선택된 하나 이상의 아미노산 함량이 70~80% 인 것을 특징으로 하는 인간 유래 세포 투과성 펩타이드를 제공한다.
본 발명은 또한, 세포 불투과성 물질을 전달하기 위한 상기 세포 투과성 펩타이드의 용도를 제공한다.
본 발명은 또한, 세포 불투과성 물질을 전달하기 위해 상기 세포 투과성 펩타이드를 이용하는 방법을 제공한다.
본 발명은 또한, 상기 세포 투과성 펩타이드에 생리활성 펩타이드 또는 단백질이 결합되어 있는 결합체를 제공한다.
본 발명은 또한, 질환의 예방 또는 치료를 위한, 상기 세포 투과성 펩타이드에 생리활성 펩타이드 또는 단백질이 결합되어 있는 결합체의 용도를 제공한다.
본 발명은 또한, 골 질환 또는 자가면역질환의 예방 또는 치료를 위한, 상기 세포 투과성 펩타이드에 생리활성 펩타이드가 결합되어 있는 결합체의 용도를 제공한다.
본 발명은 또한, 상기 세포 투과성 펩타이드에 골분화 유도서열 또는 골재생 유도서열의 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는, 골 질환의 예방 또는 치료용 약학조성물을 제공한다.
본 발명은 또한, 상기 세포 투과성 펩타이드에 항염기능성 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는, 자가면역질환의 예방 또는 치료용 약학조성물을 제공한다.
본 발명은 또한, 상기 세포 투과성 펩타이드에 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는 약학 조성물을 개체에게 투여하는 단계를 포함하는, 골 질환 또는 자가면역질환의 예방 또는 치료 방법을 제공하는 데 있다.
도 1은 본 발명에 따른 세포 투과성 펩타이드-생리활성 펩타이드(골분화 유도서열) 결합체 및 비교 도메인들의 유래와 화학적 구조를 개략적으로 나타낸 것이다.
도 2는 본 발명에 따른 세포 투과성 펩타이드-생리활성 펩타이드(골분화 유도서열) 결합체 및 비교 도메인의 합성의 정확성을 확인한 것으로 화학적, 분자 생물학적 방법을 사용하여 생리활성(결합력)을 관찰하였다. (A)는 BIACORE로 Smurf1과의 결합력을 확인한 센서그램(sensorgram)이며 (B)는 면역침강법을 이용하여 Smad1/5/8의 세포 내 분해작용에 대한 처리물질의 생리활성을 확인한 결과이고 (C) 및 (D)는 슬랏블랏(Slot blot)을 하여 처리물질과 Smurf1의 결합력 및 농도별 결합력을 확인한 결과이다.
도 3은 본 발명에 따른 형광표지 세포 투과성 펩타이드-생리활성 펩타이드(골분화 유도서열) 결합체 및 비교 도메인의 세포내 투과능을 측정한 결과로서, (A)는 공초점 주사전자 현미경(confocal scanning microscope) 사진이며, (B)는 유체세포 측정법을 이용하여 측정한 그래프이다.
도 4는 본 발명에 따른 세포 투과성 펩타이드-생리활성 펩타이드(골분화 유도서열) 결합체 및 비교 도메인의 세포내 분화능을 관찰한 결과이다. (A)의 (a), (b), (c)는 Alizarin red S 염색을 한 것이며, (d), (e), (f)는 Alkaline phosphatase 염색을 한 것이고, (g), (h), (i)는 Calcein으로 염색을 한 것이다. 또한, (a), (d), (g)는 PBS를 처리한 군이고 (b), (e), (h)는 골분화 유도 서열을 처리한 군이며 (c), (f), (i)는 세포 투과성 펩타이드-골분화 유도 서열 결합체를 처리한 군이다. 각각은 광학 현미경(Optical microscope) 및 공초점 주사형광 현미경(confocal scanning microscope)으로 관찰되었다. (B)는 정량 실시간 중합효소 연쇄반응을 통해 얻은 수치를 그래프화 한 것으로 골조직 분화마커인 ALP, OCN, RUNX2에 대한 결과이다. (C)는 (B)의 반응물을 전기 영동을 이용하여 EtBr로 염색한 후, UV아래에서 촬영한 사진이며, (D)는 세포질과 핵을 분리하여 골분화 신호전달체계에서 중요한 역할을 담당하는 단백질을 이용하여 웨스턴 블랏법(Western blot assay)으로 세포 투과성 펩타이드-생리활성 펩타이드(골분화 유도서열) 결합체 및 비교 도메인의 세포 분화능의 차이를 확인하였다.
도 5는 본 발명에 따른 세포 투과성 펩타이드-생리활성 펩타이드(골분화 유도 서열) 결합체 및 비교 도메인의 세포 증식능에 대한 영향을 시간에 따라 MTT 시약을 사용하여 측정한 그래프이다.
도 6은 본 발명에 따른 세포 투과성 펩타이드-생리활성 펩타이드(골분화 유도서열) 결합체 및 비교 도메인들의 세포 증식능에 대한 영향을 시간에 따라 BrdU 분석법으로 측정한 그래프이다.
도 7은 본 발명에 따른 형광표지 세포 투과성 펩타이드의 단독 세포 투과능을 기존에 잘 알려진 세포 투과성 펩타이드(TAT)와 비교한 사진이다. 배양시간은 20분과 80분으로, 양성대조군으로 TAT을, 음성대조군으로 PGA(poly-Glutamic acid, CGGGEEEEEEEEEEE)를 사용하였고 공초점 주사형광 현미경(confocal scanning microscope)으로 관찰되었다.
도 8은 본 발명에 따른 세포 투과성 펩타이드-생리활성 펩타이드(골분화 유도서열) 결합체가 인간 중간엽 줄기세포에 처리되었을 때 발생되는 골분화 신호전달체계에 미치는 영향을 나타낸 것이다.
발명의 상세한 설명 및 구체적인 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명은 세포 투과성 펩타이드를 제조하여 이와 결합된 펩타이드나 약물 등 비투과성 생리활성물질을 세포 내로만 투과할 수 있도록 하는 세포 내 전달기법에 대한 것으로, 도입시키고자 하는 펩타이드나 약물 등 비투과성 생리활성물질을 화학적으로 결합시킨 후 수용액 상태로 생체 내(in vivo) 및 생체 외(in vitro)에 처리하여 세포 내로 빠르고 안전한 투과기능을 발휘하도록 한다. 즉, 기존 세포 내 흡수방법인 엔도사이토시스(endocytosis) 과정 없이 직접 세포 내로 도입하는 것이다.
본 발명은 일 관점에서, 5-15개의 아미노산 서열로 구성되고, 아르기닌, 라이신 및 히스티딘으로 구성된 군에서 선택된 하나 이상의 아미노산 함량이 70~80% 인 것을 특징으로 하는 인간 유래 세포 투과성 펩타이드에 관한 것이다.
본 발명에 있어서, 상기 세포 투과성 펩타이드는 H4S (서열번호 1:SSRKKNPNCRRH), H4Q (서열번호 2:QRARKKNKNCRRH), HBD-3P (서열번호 3: CSTRGRKCCRRKK), H2 (서열번호 4, HKREKRQAKHKQRKR), H3 (서열번호 5: KSKNKKKQRKGPHRK), H3B (서열번호 6: KPRPGRKDRRKK), H4-1 (서열번호 7: RRRRAKRSPKHHS), H6 (서열번호 8: SRRRQQSRNR), H8 (서열번호 9: RAVRPLRRRQPKKS), H4C (서열번호 10: CSSRKKNPNCRRH), H5C (서열번호 11: CSSRKKNKNCPRRH) 및 H6C (서열번호 12: CSSRKKNPNCPRRH)로 구성된 군에서 선택되는 것을 특징으로 할 수 있다.
H4Q는 인간 골형성단백질(human BMP)-4 유래의 펩타이드이고, HBD-3P는 인간 유래 베타 디펜신 (Human beta defensin)에서 유래한 펩타이드이며, H2는 인간 골형성단백질(human BMP)-2 유래, H3 및H3B는 인간 골형성단백질(human BMP)-3 유래, H4-1은 인간 골형성단백질(human BMP)-4 유래의 펩타이드를 일부 변형(modify)한 것이고, H6는 인간 골형성단백질(human BMP)-6 유래, H8은 인간 골형성단백질(human BMP)-8 유래의 펩타이드이다.
본 발명은 다른 관점에서, 상기 세포 투과성 펩타이드에 생리활성 펩타이드 또는 단백질이 결합되어 있는 결합체에 관한 것이다.
본 발명에 있어서, 세포 투과성 펩타이드 및 생리활성 펩타이드 결합체는 화학적 합성으로 펩타이드 합성장치를 이용하여 제조할 수 있으며, 세포 내 투과기능성을 가지는 단백질 수송 도메인(PTD)의 C 말단부에 골분화 유도서열 또는 생리활성 도메인을 순차적으로 화학합성되도록 하여, ’N 말단-단백질 수송 도메인-골분화 유도 서열 또는 생리활성 도메인-C 말단'의 순서 또는 ’N 말단-골분화 유도 서열 또는 생리활성 도메인-단백질 수송도메인-C말단의 순서'로 합성하여 세포 투과성 펩타이드-생리활성 펩타이드(골분화 유도서열) 결합체를 제조할 수 있다. 생리활성 도메인은 골분화유도 작용뿐만 아니라 세포 내 (In vitro) 혹은 생체 내 (In vivo)에서 유전표현과 생리기능을 조정하는 물질로서 생체 내에서 기능 조절에 관여하는 물질의 결핍이나 과도한 분비에 의해 비정상적인 병태를 보일 때 바로잡아 주는 역할을 할 수 있는 것을 특징으로 할 수 있고, 체내에서의 안정성을 고려하여 L-형 또는 D-형으로 할 수 있다. 본 발명에 있어서, 생리활성 도메인은 골분화 유도서열, 골재생 유도서열 및 항염기능성 서열을 포함하는 의미로 사용되며, 생리활성 유도서열은 골분화, 골재생 유도서열인 서열번호 13 (GAPPPADSAP), 서열번호 14 (PPGY), 서열번호 15 (PPAY) 및 항염기능성 서열인 서열번호 16(anticare peptide: TRGRKCCRRKK)으로 구성된 군에서 선택되는 것을 특징으로 할 수 있다. 또한, 생리활성 유도서열은 항염증 또는 항미생물 기능성 서열, 세포부착 유도서열을 가지고 있는 펩타이드일 수 있다.
본 발명에 있어서, 상기 세포 투과성 펩타이드는 아르기닌, 라이신 및 히스티딘으로 구성된 군에서 선택된 하나 이상의 아미노산을 70~80%의 함량으로 포함할 수 있고, 상기 세포 투과성 펩타이드를 구성하는 아미노산은 체내에서의 안정성을 고려하여 L-형 또는 D-형으로 할 수 있다.
본 발명에 따른 세포 투과성 펩타이드-생리활성 펩타이드 결합체는 세포 내 투과기능성을 가지는 단백질 수송 도메인(PTD)으로 본 발명자에 의해 발견된 수송 도메인인 H4S (서열번호 1:SSRKKNPNCRRH)이외의 다른 양이온 단백질 수송 도메인 펩타이드, 즉 아르기닌, 라이신 또는 히스티딘이 70~80% 이상 포함된 펩타이드가 사용될 수 있는데, 바람직하게는 H4Q (서열번호 2:QRARKKNKNCRRH), HBD-3P(서열번호 3: CSTRGRKCCRRKK), H2 (서열번호 4, HKREKRQAKHKQRKR), H3 (서열번호 5: KSKNKKKQRKGPHRK), H3B (서열번호 6: KPRPGRKDRRKK), H4-1(서열번호 7: RRRRAKRSPKHHS), H6 (서열번호 8: SRRRQQSRNR), H8 (서열번호 9: RAVRPLRRRQPKKS), H4C (서열번호 10: CSSRKKNPNCRRH), H5C (서열번호 11: CSSRKKNKNCPRRH) 및 H6C (서열번호 12: CSSRKKNPNCPRRH) 등이 사용될 수 있으며, 세포막을 투과할 수 있다면 전술한 펩타이드 이외의 다른 펩타이드 또는 펩타이드 유사체도 사용할 수 있다. 또한 이와 유사하게 기존의 비인간 유래 세포투과기능성 도메인, 예를 들어 TAT, 아르기닌 유래 펩타이드를 사용하여서도 본 발명에 따른 세포 투과성 펩타이드-생리활성 펩타이드 결합체를 만들 수 있다. 다만 본 발명에서는 생체친화성을 부여하기 위해 인간유래의 펩타이드로 나열한 것이지 이것이 기존의 바이러스성, 비인간유래 펩타이드에는 적용될 수 없음을 의미하는 것은 아니다.
본 발명에 따른 세포 투과성 펩타이드-생리활성 펩타이드(골분화 유도서열) 결합체는 광학영상에 사용되는 형광 염료나 자기공명영상에 사용되는 조영제 나노입자와 공유 결합함으로써, 세포 및 생체 내 골분화 및 재생을 위한 진단과 치료에 적용할 수 있는데, 이 때, 세포 투과성 펩타이드-생리활성 펩타이드(골분화 유도서열) 결합체의 N 말단 또는 C 말단부 등에 형광 염료 또는 조영제 나노입자가 공유결합될 수 있으며, 바람직하게는 단백질 수송 도메인(PTD)의 말단부에 시스테인을 부가적으로 부착하여 사용한다.
또한, 상기 세포투과성 펩타이드-생리활성 펩타이드(골분화 유도서열) 결합체와 형광염료 또는 조영제 나노입자의 복합체는 가교제를 이용하여 화학적 결합을 유도시켜 만들 수 있다. 가교제를 이용하여 화학적 결합을 유도시킬 경우, 단백질 수송도메인(PTD) 펩타이드, 즉 단백질 수송 도메인(PTD)의 N말단에 각각의 자유 아미노기를 지니고 있어 가교제에 의한 복합체 형성이 용이하다. 본 발명에서 사용할 수 있는 가교제는 1,4-비스-말레이미도부탄(1,4-bis-maleimidobutane, BMB), 1,11-비스-말레이미도테트라에틸렌글리콜(1,11-bis-maleimidotetraethyleneglycol, BM[PEO]4), 1-에틸-3-[3-디메틸 아미노프로필] 카보디이미드 하이드로클로라이드(1-ethyl-3-[3-dimethyl aminopropyl] carbodiimide hydrochloride, EDC), 숙시니미딜-4-[N-말레이미도메틸시클로헥산-1-카복시-[6-아미도카프로에이트]](succinimidyl-4-[N-maleimidomethylcyclohexane-1-carboxy-[6-amidocaproate]], SMCC) 및 그의 설폰화염(sulfo-SMCC), 숙시미딜 6-[3-(2-피리딜디티오)-로피오나미도] 헥사노에이트](succimidyl 6-[3-(2-pyridyldithio)-ropionamido] hexanoate, SPDP) 및 그의 설폰화염(sulfo-SPDP), m-말레이미도벤조일-N-하이드로시숙시니미드 에스터(m-maleimidobenzoyl-N-hydroxysuccinimide ester, MBS) 및 그의 설폰화염(sulfo-MBS), 숙시미딜[4-(p-말레이미도페닐) 부틸레이트](succimidyl[4-(p-maleimidophenyl) butyrate], SMPB) 및 그의 설폰화염(sulfo-SMPB) 등이 있으나, 이에 국한되는 것은 아니다.
본 발명은 다른 관점에서, 상기 세포 투과성 펩타이드에 서열번호 13, 서열번호 14 및 서열번호 15로 구성된 군에서 선택되는 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는, 골 질환의 예방 또는 치료용 약학조성물에 관한 것이다. 즉, 골결손 및 골대사 질환 등의 치료용 약학적 조성물로 제공할 수 있고, 상기 골 질환은 골다공증, 골형성 부전증, 고칼슘혈증, 골연화증, 파젯병, 암에 의한 골 소실 및 골 괴사증으로 구성된 군에서 선택되는 것을 특징으로 할 수 있으며, 상기 약학조성물은 주사제 형태인 것을 특징으로 할 수 있다.
또한, 본 발명은 상기 세포 투과성 펩타이드에 서열번호 16의 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는, 자가면역질환 질환의 예방 또는 치료용 약학조성물에 관한 것으로, 상기 자가면역 질환은 류마티스 관절염 또는 건선인 것을 특징으로 할 수 있고, 상기 약학조성물은 연고나 패취제와 같은 피부투과형 제형의 형태인 것을 특징으로 할 수 있다.
본 발명은 또한, 상기 세포 투과성 펩타이드에 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는 약학 조성물을 개체에게 투여하는 단계를 포함하는, 골 질환 또는 자가면역질환의 예방 또는 치료 방법을 제공하는 데 있다.
본 발명에 따른 약학 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.　
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명의 조성물은 1일 0.0001 내지 500mg/kg으로, 바람직하게는 0.001 내지 250mg/kg으로 투여하는 것이 좋다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명에 있어서, '단백질 수송 도메인(PTD)'은 약물 또는 약물함유입자를 세포의 세포질이나 핵 안으로 투과시킬 수 있는 투과기능성 펩타이드 등을 말한다. 이는 올리고뉴클레오타이드, 펩타이드, 단백질, 올리고당, 다당류 또는 나노입자 등과 공유결합을 이루어 별도의 수용체나 운반체, 에너지를 필요로 하지 않고, 이들 물질을 세포 내로 도입시킬 수 있는 것을 말한다.
본 발명에 있어서, 생리활성 기능 중에서 '골분화 유도'란 골모세포로 분화될 수 있는 가능성을 가진 성체 줄기 세포를 사용하여 세포 외 기질 (Extracellular Matrix, ECM)의 석회화를 유발하고 세포의 분화를 통해 모양의 변화 및 뼈 결절 (Bone nodule)을 생성하는 것, 세포의 성격을 변화시켜 골아 세포 나아가 골모 세포로의 운명을 결정지어 주는 것을 뜻한다. 또는 생체 내 골 결손부에 골이식재나 골세포 또는 골세포로의 분화가능성을 가진 줄기세포를 포함하는 생체 적합성 지지체를 이식하여 생체 골재생을 유도하는 현상을 포함하는 의미이나 이것만을 한정하지 않고, 골재생 치료 목적으로 쓰일 수 있는 모든 종류의 기술 혹은 물질을 통칭한다.
본 발명에 있어서, 생리활성 기능 중' 항염기능'은 세포 내에서 염증을 유발하는 단백질을 차단할 수 있는 물질 및 물질을 발굴하는 기술을 의미한다.
실시예
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1
N 말단으로부터 순서대로 LMP1에서 유래된 골분화 유도서열로서 GAPPPADSAP(서열번호 7), PTD로서 H4S(SSRKKNPNCRRH; 서열번호 1)를 함유하도록 펩타이드 합성장치를 이용하여 하기와 같은 세포 투과성 펩타이드를 F-moc 고상 화학합성 방법으로 합성하였다 (도 1). 즉, 블로킹 그룹(Blocking group)으로 Fmoc-(9-Fluorenylmethoxycarbonyl)이 결합된 Rink resin (0.075mmol/g, 100 ~ 200 mesh, 1% DVB crosslinking)을 사용하여 합성하였으며, 합성기에 50㎎의 Rink resin을 넣은 뒤 DMF로 resin을 스웰링(swelling) 시킨 후 Fmoc-group의 제거를 위해 20% piperidine/DMF 용액을 사용하였다. C말단부터 서열대로 0.5M amino acid 용액(용매: DMF), 1.0M DIPEA(용매: DMF＆NMP), 0.5M HBTU (용매: DMF)를 각각 5, 10, 5 당량씩 넣어 질소 기류하에서 1~2시간 동안 반응시켰다. 상기 디프로텍션(deprotection)과 커플링(coupling) 단계가 끝날 때마다 DMF와 NMP로 두 번씩 세척하는 과정을 거쳤다. 마지막 아미노산을 커플링(coupling) 시킨 후에도 디프로텍션(deprotection)을 해주어 Fmoc-group을 제거하였다.
합성의 확인은 닌하이드린 테스트(ninhydrin test) 방법을 이용하였고, 테스트를 거치고 합성이 완료된 resin은 THF나 DCM으로 건조시킨 후 TFA cleavage cocktail을 resin 1g당 20ml의 비율로 넣어 3시간 shaking 시킨 후 필터링을 통해 resin 과 펩타이드가 녹아 있는 cocktail을 분리하였다. 필터로 걸러진 용액을 진공증발농축기(rotary evaporator)를 이용하여 제거한 후 콜드 에테르(cold ether)를 넣어주거나 펩타이드가 녹아있는 TFA cocktail용액에 직접 콜드 에테르를 과량 넣어주어 펩타이드를 고체상으로 결정화시키고 이를 원심분리하여 분리해내었다. 이때 에테르로 여러 번 세척과 원심분리 과정을 거쳐 TFA cocktail을 완전히 제거하였다. 이렇게 해서 얻어진 펩타이드는 증류수에 녹여 동결건조하였다.
NH2-GAPPPADSAP-SSRKKNPNCRRH-C-COONH2 (서열번호 17)
합성된 펩타이드 서열은 레진으로부터 절단시켜 세척과정을 거쳐 동결건조 후 액체크로마토그래피에 의해 분리, 정제되었다. 정제된 펩타이드는 MALDI분석을 이용하여 분자량을 확인하였다.
비교예 1: PTD로서 H4S (SSRKKNPNCRRH; 서열번호 1)
펩타이드 합성장치를 이용하여 상기 펩타이드를 F-moc 고상 화학합성 방법으로 합성하였다.
비교예 2: LMP1으로 부터 유래된 골분화 유도서열 (GAPPPADSAP; 서열번호 13)
펩타이드 합성장치를 이용하여 상기 펩타이드를 F-moc 고상 화학합성 방법으로 합성하였다.
실시예 2 : 세포 투과성 펩타이드-골분화 유도서열 결합체와 Smurf1의 결합력 확인
2-1: 생체 물질간 상호 반응 분석법 (Surface plasmon resonanace detection assay)을 이용한 세포 투과 기능성 펩타이드-골분화 유도 서열 결합체와 Smurf1의 결합력 확인
실시예 1의 방법으로 합성된 세포 투과성 펩타이드-골분화 유도 서열 결합체와 Smurf1의 결합력을 화학적인 방법으로 확인하기 위해, 본 실험에서 리간드로 작용하는 인간유래 Smurf1 단백질을 Origene사(Rockville, MD, USA)에서 구매하였다. 상기 단백질 100mg/ml을 EDC/NHS kit(BIACORE AB, Sweden)를 이용하여 아미노기가 표면에 결합되어 있는 CM5 chip(BIACORE AB, Sweden)의 금으로 코팅된 면에 결합시킨다 (상기 실험 방법은 본 연구자가 사용한 BIACORE T100(BIACORE AB, Sweden) 소프트웨어에 내장되어 있는 'Immobilization'을 사용해도 무관하다). 이 때, 단백질이 CM5 chip의 아미노기와 결합할 수 있는 적합한 pH조건을 찾기 위해 'pH scouting' 이라 불리는 방법을 실시하여 하나의 pH 조건을 찾는다. 'pH scouting'의 실험 방법은 본 연구자가 사용한 BIACORE T100(BIACORE AB, Sweden) 소프트웨어에 내장되어 있는 것을 사용해도 무관하다. 이와 같은 방법으로 도출된 pH 조건에서 리간드를 결합시킨 후에 분석물질(실시예 1에서 합성된 세포 투과 기능성 펩타이드-골분화 유도 서열 결합체, 음성 대조군으로 사용하기 위한 비교예 1의 세포 투과성 펩타이드 및 양성 대조군으로 사용하기 위한 비교예 2의 골분화 유도 서열) 각각 10mM 씩 CM5 chip 위로 흘려주면서 결합력을 측정한다 (상기 실험 방법은 본 연구자가 사용한 BIACORE T100(BIACORE AB, Sweden) 소프트웨어에 내장되어 있는 'Binding analysis'을 사용해도 무관하다).
그 결과, 도 2(A)에 나타난 바와 같이, Smurf1 단백질 서열 내 WW 도메인과 결합하는 부분이며 골분화능을 가진 비교예 2(GAPPPADSAP)는 Smurf1에 대한 결합력이 750RU(Resonance Unit; 결합력 측정 단위)를 나타내었고 실시예 1에서 합성된 세포 투과 기능성 펩타이드-골분화 유도 서열 결합체는 600RU, 본 실험에서 음성대조군으로 사용된 비교예 1의 세포 투과성 펩타이드는 100RU을 나타내었다. 이는 세포 투과 기능성 펩타이드-골분화 유도 서열 결합체가 골분화 유도 서열을 가지고 있으며 합성되어지는 과정에서 생리활성서열 (생체 내에서 Smurf1과 결합하여 기능성을 나타낼 수 있는 부분)에 유의적인 손상이 가해지지 않았음을 보여주는 결과라 할 수 있겠다.
2-2: 면역침강법 (Immuno-precipitation)을 이용한 세포 투과 기능성 펩타이드-골분화 유도 서열 결합체와 Smurf1의 결합력 확인
실시예 1의 방법으로 합성된 세포 투과성 펩타이드-골분화 유도 서열 결합체가 Smurf1과 결합하기 위한 활성부분의 존재유무를 측정하기 위해, 면역침강 및 웨스턴 블랏법(Western blot assay)을 사용하였다. 본 실험방법은 Smurf1이 ubiquitin ligation을 담당하는 E3 ligase 중 하나로써 Smad1/5/8을 분해시키는 생리학적 활성을 실시예 1의 방법으로 합성된 세포 투과성 펩타이드-골분화 유도 서열 결합체가 억제할 수 있는지 확인하는 기법으로 적용되어졌다.
본 실험에서 모델 세포로 사용한 인간 성체 간엽줄기세포 (human mesenchymal stem cell, hMSC)를 1×106개씩 분주한 다음, 일반 배지에서 20시간 배양(overnight incubation) 한 후에, 우태혈청(FBS, Fetal Bovine Serum, GIBCO, USA)이 0.5% 포함된 hMSC basal medium(MSCBM, LONZA, USA) 배지에서 20시간 배양(overnight starvation)한다. 0.5% MSCBM에서 20시간 배양 후에, 동일 성상의 배지에 프로테아좀 억제제인 MG132 (MG132; proteasome inhibitor, Merck, USA) 10mM을 첨가하여 세포에 2시간 전처리한다. 이 후, 실시예 1에서 제조된 세포 투과성 펩타이드-골분화 유도 서열 결합체와 비교예 1 및 비교예 2의 농도를 10mM로 하여 각 디쉬(dish)에 주입시키고 1시간 30분을 배양한다.
실시예 1 및 비교예 2에서 합성된 hMSC들은 세포 용해 버퍼(Cell lysis buffer: 1% triton X-100, 150mM NaCl, 50mM Tris-Cl(pH 7.5), 0.1% SDS, 1% NP-40, 1mM PMSF)을 이용하여 파괴시켰다. 세포 용해액(cell lysate)에서 단백질의 상층액을 얻어내기 위하여, 12,000 rpm으로 4℃에서 10분간 원심분리 하였다. 이의 상층액을 새로운 튜브로 옮기고 면역침강 분석을 수행하기 위해서, 세포 용해액을 Smad1/5/8 항체(5㎍)를 처리하여 4℃에서 20시간 동안 반응시켰고, 그 후 단백질 A/G-아가로스 비드(protein A/G-agarose beads)를 첨가하여 4℃ 조건에서 4시간 동안 반응시켰다. 상기 비드를 1 mM DTT가 함유된 PBS로 3회 세척하고, 2X protein loading dye(25 % SDS, 62.5mM Tris-HCl (pH 6.8), 25% Gylcerol, and 0.01% Bromophenol Blue)와 함께 5분간 끓였다. 상기 샘플들을 SDS-PAGE를 이용하여 전기 영동상에서 분리하였다.
SDS-PAGE로 분리된 결합 단백질들을 웨스턴 블랏을 진행하기 위해 니트로셀룰로오스 막(nitrocellulose membrane; NC membrane)으로 옮긴다. 단백질이 옮겨진 NC membrane을 5% skim-milk에서 1시간동안 실온에서 블로킹(Blocking)을 진행한다. NC membrane을 TBST 용액을 사용하여 10분씩 3번 세척한다. 세척한 NC membrane을 1차 항체(primary antibodies)로 사용한 Ubiquitin 항체 1㎍과 실온에서 4시간동안 반응시켜준다. TBST로 10분간 3번 세척하고 HRP(horse radish peroxidase)가 붙어있는 2차 항체(secondary antibodies)와 실온에서 1시간동안 반응시킨다. TBST로 10분간 3번 세척하고 ECL(enhanced chemo-luminal)을 사용하여 암실에서 X-ray film으로 감광시킨다 (TBST: 8.8g of NaCl, 0.2g of KCl, 3g of Tris base, pH 7.4, 0.05% Tween20 을 1L 용액으로 제작해 사용한다).
그 결과, 도2(B)에서 나타난 바와 같이, 프로테아좀 억제제를 통해 단백질(본 실험에서는 Smad1/5/8을 말한다)에 결합되어 있는 ubiquitin을 분해하지 않는 현상으로 인해 MG132만을 처리한 군에서는 ubiquitin 항체가 레인(lane)에서 끌림 현상을 보이며 전반적으로 검출되는 것을 볼 수 있다. 이와 같은 현상은 비교예 2로 합성된 골분화 유도서열 처리군에서도 동일하게 나타났으나 세포 투과성 펩타이드-골분화 유도 서열 결합체를 처리한 군에서는 Smad1/5/8의 ubiquitination이 억제되는 것을 가장 우측 레인(lane)에서 확인하였다. 이는 상기 결합체가 배양 시간동안 세포 내로 투과하여 Smurf1의 WW 도메인과 결합함으로서 Smad1/5/8의 분해를 방해하여 골조직 분화 및 골재생을 촉진할 수 있는 가능성을 내포하는 결과를 보여 주었으며 상기 결합체 및 골분화 유도 서열 (비교예 2)의 합성과정의 정확도를 판단할 수 있었다.
2-3: 슬랏블랏법 (Slot-Blot assay)을 이용한 세포 투과 기능성 펩타이드-골분화 유도 서열 결합체와 Smurf1의 결합력 확인
실시예 1의 방법으로 합성된 세포 투과성 펩타이드-골분화 유도 서열 결합체가 Smurf1과 결합하기 위한 활성부분의 존재유무 및 농도에 따른 결합정도를 확인하기 위해, 슬랏 블랏법(Slot blot assay)을 사용하였다. 본 실험 기법은 막 위에 단백질을 올리고 반대편에서 흡입하여 막 표면에 강하게 부착시킨 후에 막에 부착된 단백질과 상호작용을 보고자 하는 물질을 직접적으로 올리고 일정시간 배양하여 결합을 유도한 후, 항체를 이용하여 블랏팅(botting)기법으로 각 Dot의 차이를 통해 단백질과 물질간의 상호작용(결합력)을 확인하는 분자생물학적 방법이다.
인간유래 Smurf1 단백질 1㎍을 슬랏 블랏장치(Hoefer, Pharmacia Biotech, USA)를 이용하여 20ml/웰씩 넣고 진공상태에서 2㎛ Nitrocellulose 막(Pall, USA)의 일정위치로 각각 블랏팅 하였다. 블랏팅 후 니트로셀룰로오스 막을 0.5% Tween20 함유 인산염완충액으로 실온에서 30분 블록킹(Blocking)한 후 완전히 건조시켜 사용하였다. 상기 실시예1 및 비교예 1과 2에서 합성된 도메인을 EZ-Link Sulfo-NHS-Biotin (Pierce Biotechnology, USA)를 사용하여 제조사의 실험법에 따라 바이오틴화(Biotinylation) 하여 압력차를 추진력으로 하는 막분리법인 한외여과(Ultrafiltration)를 통해 결합되지 않은 부산물을 제거한 후, 동결건조를 실시하였다. 동결건조 후 얻어진 상기 도메인을 각각 증류수에 녹여 0.1, 1, 10, 100mM의 농도로 배양트레이의 각 웰에 200ml/웰씩 충전하여 4℃에서 20시간 동안 반응시켰다. 20시간 반응 후, 0.5% Tween20 함유 인산염완충액으로 실온에서 30분 블록킹(Blocking) 과정을 거쳐 Extravidin(SIGMA, USA)으로 실온에서 1시간동안 반응시킨다. TBST로 10분간 3번 세척하고 ECL(enhanced chemo-luminal)을 사용하여 암실에서 X-ray film으로 감광시킨다.
그 결과, 도 2(C, D)에서 나타낸 바와 같이 상기 실험법을 통해 Smurf1 단백질과 양성 대조군으로 사용된 비교예 2 도메인은 도 2(C)에서 결합되어 dot으로 검출되었으며 Smurf1 단백질과 세포 투과성 펩타이드-골분화 유도 서열 결합체의 결합을 유도한 부위에서도 dot을 확인할 수 있었다. 도 2(D)에서 세포 투과성 펩타이드-골분화 유도 서열 결합체 또는 골분화 유도 서열 농도별로 Smurf1 단백질과 배양 하였을 때, 골분화 유도 서열 (비교예 2)의 dot의 크기는 0.1mM로부터 100mM의 충전된 농도별로 증가하며 세포 투과성 펩타이드-골분화 유도 서열 결합체의 dot의 크기도 10mM부터 농도에 따라 증가됨을 확인하였다. 이는 두 물질간의 (실시예 1 및 비교예 2에서 얻은 결합체와 Smurf1 단백질) 결합이 세포 외에서도 일어나며 그것은 농도별로 증가할 수 있음을 보여 주고 있음을 의미한다.
실시예 3: 세포 투과성 펩타이드-골분화 유도서열 결합체의 생체 외(in vitro) 세포 투과능 측정
3-1: 세포 투과성 펩타이드-골분화 유도 서열 결합체의 형광물질 표지 합성
합성된 실시예 1 및 비교예 1, 2 도메인의 세포 투과 능력을 알아보기 위하여 형광 물질을 표지하였다. 합성된 도메인의 N 말단에 10당량의 FITC(Fluorescein isothicyanate) 를 triethylamine (resin 1g당 1ml) 을 이용하여 결합시켰으며 이를 MALDI-TOF를 이용하여 분자량을 측정함으로써 그 합성을 확인하였다.
분석용 역상 고성능 액체 크로마토그래피 (reverse phase liquid chromatography)를 이용하여 분석, 정제 하였다. 분석에는 직경 4.6mm의 C18 컬럼을 이용하여 유속 1ml/min 의 속도로 0.1% TFA/H2O 와 0.092% TFA/아세토 나이트릴 (acetonitrile)를 0~60%의 변화를 주면서 30분간 흘려주었다. 이때 자외선 검출기의 파장은 220nm로 하였으며 형광 물질이 표지된 펩타이드의 경우에 형광 검출기의 파장은 Ex: 493.5nm, Em: 460nm로 자외선 검출기의 파장은 220nm로 하였다.
정제에는 직경 2.2cm의 컬럼을 이용하여 유속 20ml/min의 속도로 용매와 검출파장을 같은 조건으로 실시하였다. 순수한 펩타이드만을 분취하여 진공 증발 농축기(rotary evaporator)를 이용하여 용매를 제거 한 후 동결 건조하였다.
3-2: 세포 투과성 펩타이드-골분화 유도 서열 결합체의 형광영상학적 세포 투과능 측정
세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포투과 정도를 측정하기 위하여, 6-웰(well)에 멸균된 slide glass를 넣고 hMSC(human Mesenchymal Stem cell)을 2×104개씩 분주한 다음, 일반 배지에서 20시간 배양(overnight incubation) 한 후에, 우태혈청(FBS, Fetal Bovine Serum, GIBCO, USA)이 0.5% 포함된 hMSC basal medium(MSCBM, LONZA, USA) 배지에서 20시간 배양(overnight starvation)한다. 실시예 1의 제조방법을 통해 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 N-term 부위에 형광염료(FITC; SIGMA, USA)를 아미노 결합하여 합성, 분리, 정제를 실시하여 얻은 형광표지 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 형광표지 골분화 유도서열의 각각 100mM을 각 웰(well)에 주입시키고, 주입 20분, 80분 후에 인산 완충용액(PBS)으로 2회 세척한 후, 공초점 주사전자 현미경(confocal scanning microscope, IX 70, Olympus Co., Tokyo, Japan)로 관찰하였다.
그 결과, 도 3(A)에 나타난 바와 같이, 형광염료(FITC, 녹색)가 결합되어 제조된 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 골분화 유도 서열을 처리해 주었을 때, 골분화 유도 서열은 세포 내 투과를 하지 못하는 반면, 비교예 1의 PTD 서열이 포함된 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체는 처리 20분후에 형광의 입자가 세포질 내에서 관찰되었고 처리 80분 후에는 세포질 및 핵 내에서 뚜렷하게 관찰되었다. 이는 세포 투과성 펩타이드-골분화 유도 서열 결합체 내 포함되어 있는 PTD 서열로 인하여 시간 의존적(단, 80분 이내로 관찰하였다)으로 세포 투과능이 증가함을 알 수 있었다.
또한, 도 7에서와 같이, TAT(기존에 강력한 세포 투과성 펩타이드로 알려진 바이러스 유래 양이온성 물질)과 본 발명의 PTD인 비교예 1의 H4S와 비교해 보았을 때, 20분에 두 군 모두에서 세포질 내에 고르게 존재하는 형광물질이 관찰되었고 80분에는 두 군 모두에서 핵 내까지 밀도 있게 존재하는 형광물질을 확인하였다. 이는 본 발명의 주 된 물질인 H4S의 세포 투과속도 및 축적 양상이 hMSC에서 TAT과 유사함을 발견하였다.
3-3: 유체 세포 측정법(flow cytometry)을 이용한 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 투과능 측정
상기 세포투과성와 형광표지 자성나노입자의 복합체의 세포투과 정도를 정량적으로 확인하기 위하여, 6-웰(well)에 hMSC(human Mesenchymal Stem cell)을 1×105개씩 분주한 다음, 일반 배지에서 20시간 배양(overnight incubation) 한 후에, 우태혈청(FBS, Fetal Bovine Serum, GIBCO, USA)이 0.5% 포함된 hMSC basal medium(MSCBM, LONZA, USA) 배지에서 20시간 배양(overnight starvation)한다. 실시예 1의 제조방법을 통해 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 N-term 부위에 형광염료(FITC; SIGMA, USA)를 아미노 결합하여 합성, 분리, 정제를 실시하여 얻은 형광표지 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 형광표지 골분화 유도서열의 각각 100mM을 각 웰(well)에 주입시키고, 주입 20분, 40분, 60분, 80분 후에 인산 완충용액(PBS)으로 2회 세척한 후, 0.25% 트립신(trypsin)을 사용하여 세포를 웰(well)로부터 분리하고, 인산완충용액(PBS)으로 세척 다음, 원심 분리하여 상층액을 제거하는 과정을 2회 반복하여 세포 밖의 형광염료를 제거하였다. 여기에, 300ml의 인산완충용액(PBS)를 첨가하여, 세포를 부유시킨 다음, FACSCalibur(BD, USA)를 사용하여 FL-1(488nm)에서 관찰하였다.
그 결과, 도 3(B)에서 나타난 바와 같이, 형광염료(FITC, 녹색)가 결합되어 제조된 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 골분화 유도 서열을 처리해 주었을 때, 골분화 유도 서열은 세포 내 투과를 하지 못하는 반면, 비교예 1의 PTD 서열이 포함된 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체는 상대적으로 10배 이상 증가된 형광감도를 보여줌으로서 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포투과 능력을 알 수 있었다.
실시예 4 :세포 투과성 펩타이드-골분화 유도 서열 결합체의 생체 외(in vitro) 세포 분화능 측정
4-1: Alizarin red S 염색법을 이용한 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 분화능 측정
상기 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 분화능을 인산화 칼슘 생성량으로 확인하기 위하여, 24-웰(well)에 hMSC(human Mesenchymal Stem cell)을 1×103개씩 분주한 다음, 실시예 1로서 합성된 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 농도를 10mM로 처리하여 경조직 형성 배지에서 14일 동안 배양하였다. 상기 경조직 형성 배지의 조성은 MSCBM 배지에 우태혈청(FBS, Fetal Bovine Serum) 15%, L-ascorbic acid 50㎎/㎖, dexamethasone 10-7M, antibiotic-antimycotic solution 1%, beta-glycerol phosphate 10mM 이다. 배양완료 후에 상기 배지를 걷어낸 다음, 인산 완충용액(PBS)으로 2회 세척하였다. 90% Ethanol로 세포를 4℃에서 15분간 고정하고 증류수로 2회 세척한 후, 2% Alizarin red S Solution (pH 4.2; Alizarin red S powder, Junsei, JAPAN)으로 5분간 염색하였다.
그 결과, 도 4(A: a, b, c)에서 나타난 바와 같이, 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 골분화 유도 서열을 처리해 주었을 때, 세포 내 투과를 하지 못하는 골분화 유도 서열(b)은 14일의 배양기간이 지난 후에도 PBS만을 처리한 군(a)에 비해 골아세포로의 분화를 확연하게 증가시키지 않는 반면, 비교예 1의 PTD 서열이 포함된 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체(c)는 상대적으로 강한 인산화 칼슘의 염색정도를 보여줌으로서 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포분화 능력을 알 수 있었다.
4-2: ALP(Alkaline phosphatase) 염색법을 이용한 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 분화능 측정
상기 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 분화능을 골분화 초기에 나타나는 표지물질인 ALP(Alkaline phosphatase)를 검출하기 위하여, 24-웰(well)에 hMSC(human Mesenchymal Stem cell)을 1×103개씩 분주한 다음, 실시예 1로서 합성된 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 농도를 10mM로 처리하여 경조직 형성 배지에서 14일 동안 배양하였다. 상기 경조직 형성 배지의 조성은 MSCBM 배지에 우태혈청(FBS, Fetal Bovine Serum) 15%, L-ascorbic acid 50㎎/㎖, dexamethasone 10-7M, antibiotic-antimycotic solution 1%, beta-glycerol phosphate 10mM 이다. 배양완료 후에 상기 배지를 걷어낸 다음, 인산 완충용액(PBS)으로 2회 세척하였다. 10% NBF로 세포를 상온에서 20분간 고정하고 인산 완충용액(PBS)으로 2회 세척한 후, Alkaline phosphatase detection kit (Millipore, USA)를 사용하여 제조사에서 권유하는 실험방법에 따라 염색을 실시하였다.
그 결과, 도 4(A: d, e, f)에서 나타난 바와 같이, 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 골분화 유도 서열을 처리해 주었을 때, 세포 내 투과를 하지 못하는 골분화 유도 서열(e)은 14일의 배양기간이 지난 후에도 PBS만을 처리한 군(d)에 비해 골아세포로의 분화를 확연하게 증가시키지 않는 반면, 비교예 1의 PTD 서열이 포함된 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체(f)는 상대적으로 강한 Alkaline phosphatase의 염색정도를 보여줌으로서 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포분화 능력을 알 수 있었다.
4-3: Calcein 염색법을 이용한 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 분화능 측정
상기 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 분화능을 확인하기 위하여, 챔버 슬라이드(4-well chamber slide)에 hMSC(human Mesenchymal Stem Cell)를 5×103개씩 분주한 다음, 세포의 안정화를 위해 일반 배지에서 20시간 동안 배양(overnight incubation)하였다. 실시예 1로서 합성된 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 농도를 10mM로 처리하여 calcein(칼세인; 칼슘염색, green)이 함유된 경조직 형성 배지에서 14일 동안 배양하였다. 상기 경조직 형성 배지의 조성은 MSCBM 배지에 우태혈청(FBS, Fetal Bovine Serum) 15%, L-ascorbic acid 50㎎/㎖, dexamethasone 10-7M, antibiotic-antimycotic solution 1%, beta-glycerol phosphate 10mM 이다. 배양완료 후에 상기 배지를 걷어낸 다음, 인산 완충용액(PBS)으로 2회 세척하였다. 인산 완충용액으로 세척된 상기 세포를 10% NBF(neutral buffered formalin)으로 고정시키고, 핵(Hoechst 33342, blue)을 염색한 다음, 세포 투과성 펩타이드-골분화 유도 서열 결합체의 골아세포로의 분화 여부를 공초점 주사형광 현미경(Confocal scanning microscope, IX 70, Olympus Co., Tokyo, Japan)으로 관찰하였다.
그 결과, 도 4(A: g, h, i)에서 나타난 바와 같이, 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 골분화 유도 서열을 처리해 주었을 때, 세포 내 투과를 하지 못하는 골분화 유도 서열(h)은 14일의 배양기간이 지난 후에도 PBS만을 처리한 군(g)에 비교하여 인산화 칼슘의 염색정도가 유사한 반면, 비교예 1의 PTD 서열이 포함된 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체(i)는 상대적으로 강한 인산화 칼슘의 염색정도를 형광파장에서 보여줌으로서 세포 투과성 펩타이드로 인한 골분화 유도 서열의 세포분화 능력을 확인할 수 있었다.
4-4: 정량 실시간 중합효소 연쇄반응 분석법(Quantitative Real time PCR) 및 전기영동법을 이용한 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 분화능 측정
상기 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 분화능을 골조직 분화 마커 유전자를 통해 확인하기 위하여, 6cm 디쉬(dish)에 hMSC(human Mesenchymal Stem cell)을 1×105개씩 분주한 다음, 세포의 안정화를 위해 일반 배지에서 20시간 동안 배양(overnight incubation)하였다. 20시간 배양 후, 상기 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 농도를 10μM로 72시간 동안 처리하였다.
이후, 상기 처리한 세포로부터 트리졸(trizol) 시약(Invitrogen life technologies, USA)을 사용하여 제조사의 방법대로 전체 RNA를 분리하였고, 각 전체 RNA 시료의 양과 순도는 분광광도계로 측정하였다. 세포에서 분리해낸 RNA 1㎍은 합성된 oligo dT 2㎕ 가하여 증류수로 총량을 11㎕로 채운 후, 65℃로 10분 동안 변성시킨 다음 빙상에서 급냉하였다. 이것에 SuperScriptII Reverse Transcriptase(Invitrogen, USA) 1㎕, 100mM DTT 2㎕, 2.5mM dNTPs(25mmol/ℓ dATP, 25mmol/ℓ dCTP, 25mmol/ℓ dGTP, 10mmol/ℓ dTTP) 2㎕, 5X strand buffer (반응 완충액) 4㎕를 가하여 42℃로 60분 동안 유지하였다. 상기 실험법으로 합성된 cDNA(complementary DNA) 50ng을 취하여 주형으로 삼고, 각 유전자와 상보적인 2pmole의 primer(표 1) 1㎕를 Taq-중합효소 혼합물(Taq-polymerase Mixture, Bioneer, Korea)에 첨가하여 중합연쇄반응(PCR)을 수행하였다. PCR은 Gene Amp PCR system 9700(Applied Biosystems, USA)를 이용하여 각 PCR 산물이 포화되지 않는 조건으로 반복횟수를 결정하였다. 합성된 PCR 산물을 10μg㎖-1 EtBr (ethidium bromide)이 포함된 1 % 아가로스 젤(agarose gel) 에서 전기영동 하여, GEL DOC 2000 농도계 (densitometer) 와 영상 분석 시스템(Bio-Rad, USA)으로 확인하였다.
정량 실시간 PCR (Quantitative Real-Time PCR)을 수행하기 위해, RT-PCR과 같이 주형이 될 cDNA와 프라이머를 섞어준 후, 10㎕의 SYBR Green Premix Ex Taq(TaKaRa, JAPAN)를 섞어 반응물을 제조한다. Applied Biosystems 7500 Real-time PCR(Applied Biosystems, USA)를 이용하여 상기 반응물을 95 ℃에서 10초간 변성시킨 후, 95 ℃에서 5초, 60 ℃에서 34초의 과정을 40회 반복하여 threshold cycle(CT)를 얻었다. 각 유전자의 CT값을 하우스키핑 유전자(Housekeeping gene)로 사용한 GAPDH의 CT값으로 나눈 후, 음성 대조군을 기준으로 계산한 값을 취하여 mRNA 발현 정도를 비교하였다(Shin et al., (2007) Plant J. 49, 981-994).
그 결과, 도 4에서 나타난 바와 같이, 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 골분화 유도 서열을 처리해 주었을 때, 세포 내 투과를 하지 못하는 골분화 유도 서열은 72시간의 배양기간이 지난 후에도 PBS만을 처리한 군과 비교하여 골분화 마커 유전자로 알려진 ALP, OCN, RUNX2의 발현량이 거의 유사한 수치(B) 및 밴드(C)를 보여주는 반면, 비교예 1의 PTD 서열이 포함된 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체는 상대적으로 2.5배에서 60배 증가된 마커 발현량(B)과 눈에 띄게 증가된 밴드를 보여줌으로서 세포 투과성 펩타이드로 인한 골분화 유도 서열의 세포분화 능력을 확인할 수 있었다.
표 1 PCR 분석에 사용한 프라이머
gene name direction sequence
alkaline phosphatase(ALP) FP GACCCTTGACCCCCACAAT
RP GCTCGTACTGCATGTCCCCCT
Osteocalcin(OCN) FP GAAGCCCAGCGGTGCA
RP CACTACCTCGCTGCCTCC
Runt-related transcription factor 2(RUNX2) FP CCGGCAAGATGAGCGAGGTCA
RP GTGGGTTGGAGAAGCGGCTCT
Glyceraldehyde-3-phosphate dehydrogenase(GAPDH) FP GAAGGTGAAGGTCGGAGT
RP GAAGATGGTGATGGGATTTC
4-5: 웨스턴 블랏법(Western blot assay)을 이용한 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 분화능 측정
상기 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 분화능을 세포질과 핵을 분리하여 골분화 신호전달체계에서 중요한 역할을 담당하는 단백질로 확인하기 위하여, 10cm 디쉬(dish)에 hMSC(human Mesenchymal Stem cell)을 1×106개씩 분주한 다음, 세포의 안정화를 위해 일반 배지에서 20시간 동안 배양(overnight incubation)하였다. 20시간 배양 후, 상기 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 농도를 10μM로 1시간 30분 동안 처리하였다.
이 후, 세포 내 단백질 발현정도를 비교하기 위하여, 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2가 처리 된 세포를 NE-PER Nuclear and cytoplasmic extraction reagents (Pierce, USA)를 사용하여 제조사의 실험방법을 따라 세포질과 핵을 분리한다. 세포질과 핵으로 분리된 hMSC 용해액은 브래드 포드 시약 분석법(Bradford's assay)으로 단백질 정량하여 10% 폴리아크릴아마이드 겔(polyacrylamide gel)에 4시간 동안 120 볼트(volt)로 전기영동 후 전이버퍼(transfer buffer)(12.5mM Tris, 0.1M glycine, pH 8.3)를 이용하여 310 밀리암페어(㎃)에서 2시간 동안 니트로셀룰로오스 막(nitrocellulose membrane)으로 전이시켰다. 불로킹 용액 (5% Nonfat dry milk, in TBS)으로 막을 블록(block)한 뒤, 상기 블로킹 용액에 1㎍/ml의 농도가 되도록 첨가된 1차 항체 용액 (Smurf1, phosphoSmad1/5/8; Cell Signaling, USA, RUNX2, LaminB, Actin; Santa Cluz, USA)을 하룻밤동안 4℃에서 반응을 시켰다. 다음 날 오전, 각 1차 항체에 대한 2차 항체를 블로킹 용액에 1:2000으로 첨가해 상온에서 1시간 반응시킨다. ECL(enhanced chemo-luminal)을 사용하여 암실에서 X-ray film으로 감광시킨다.
그 결과, 도 4(D)에서 나타난 바와 같이, 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 골분화 유도 서열을 처리해 주었을 때, 세포 내 투과를 하지 못하는 골분화 유도 서열은 1시간 30분의 배양기간이 지난 후에도 PBS만을 처리한 군과 비교하여 골아세포로의 분화신호를 전달하는 주 전달단백질 분자인 Smad1/5/8의 인산화, 핵 내에서 Smad1/5/8과 협동하여 골분화 유도 전사인자로 작용하는 RUNX2의 증가가 거의 일어나지 않은 반면, 비교예 1의 PTD 서열이 포함된 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체는 상대적으로 Smad1/5/8 인산화 및 RUNX2가 눈에 띄게 증가된 밴드를 보여줌으로서 세포 투과성 펩타이드로 인한 골분화 유도 서열의 세포분화 능력을 확인할 수 있었다. (Smurf1 단백질은 세포질과 핵 내에서 작용시기에 따라 모두 존재할 수 있다고 보고되어졌으며 본 발명의 실험결과에서도 동일하게 밝혀졌다. Lamin B는 핵막에 존재한다고 알려진 단백질로서 세포질과 핵질의 분리가 잘 되었는지를 확인하기 위한 마커로 사용되었으며 Actin은 전체 단백질의 로딩(loading) 양이 일정한지를 확인하기 위한 단백질로 사용되었다.)
실시예 5 : 세포 투과성 펩타이드-골분화 유도 서열 결합체의 생체 외(in vitro) 세포 증식능에 미치는 영향 측정
5-1: MTT 분석법을 통한 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 독성 측정
상기 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교 도메인이 hMSC와 함께 배양될 때, 잠재되어 있는 독성으로 인한 세포 증식에 영향이 있는지 여부를 확인하기 위해, MTT(3-(4,5-디메틸티아졸-2-일)-2,5-디페닐테트라졸리움 브로마이드 티아졸일 블루; SIGMA, USA) 시험법을 사용하였다.
MTT 시험법은 살아있고 대사적으로 왕성한 세포내 미토콘드리아 탈수소 효소가 MTT를 환원시켜 생성한 포마잔(formazan)의 흡광도를 측정하여 대조군에 대한 퍼센트로 세포 독성을 측정하는 방법으로서, 측정된 흡광도는 살아있고 대사적으로 왕성한 세포의 농도를 반영한다. 2,3,5-트리페닐 테트라졸리움 클로라이드(TTC)는 살아있는 세포에서 포마잔(formazan)으로 환원되며, 이 포마잔은 불용성의 자주색을 나타내는 것으로 색의 정도로 호흡률을 측정할 수 있다. 포마잔의 흡광도는 540nm의 파장에서 최대이며, 이 파장에서 측정된 흡광도는 살아있고 대사적으로 왕성한 세포의 농도를 반영하는데, 측정할 웰 내의 세포의 농도가 너무 낮거나 높은 범위에 있으면 살아있는 세포의 농도와 흡광도 사이의 직선적 관계가 성립되지 않게 되므로 최적의 세포 농도를 결정하는 과정을 거쳤다.
96-웰(well)에 hMSC(human Mesenchymal Stem cell)을 1×103개씩 분주한 다음, 실시예 1로서 합성된 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 농도를 10mM로 처리하여 경조직 형성 배지에서 24시간, 48시간, 72시간 동안 배양하였다.
각각의 배양 시간 후, 플레이트의 각 웰에 0.1mg (50㎕ of 2 mg/㎖)의 MTT를 가하고, 다시 37℃, 5% 이산화탄소하에서 4시간 더 배양하여 MTT가 환원되도록 하였다. 배양 종료 시, 각 웰에 형성된 결정이 흐트러지지 않도록 주의하면서 배지를 30㎕ 정도만 남기고 파이펫을 이용하여 모두 제거하였다. 배지가 제거된 각 웰에 생성된 포마잔 결정을 용해시키기 위하여, 디메틸술폭시드(DMSO, dimethyl sulforoxide, Aldrich사)를 150㎕씩 가하고 포마잔 결정이 녹을 수 있도록 약 5분간 교반한 후, 96 웰-플레이트용 광도계(ELISA reader, Bio-Tek, USA)를 사용하여 540nm에서 흡광도를 측정하였다.
그 결과, 도 5에서 나타난 바와 같이, 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 골분화 유도 서열을 각 배양시간을 달리하여 처리해 주었을 때, PBS만을 처리한 군과 유사한 세포 증식능을 보여 주었으며 군간의 차이는 유의적이지 않았으므로 본 발명의 결합체 및 비교 도메인(비교예 2)은 72시간 이내 세포 독성을 보여주지 않는 것을 알 수 있었다.
5-2: 정량적 BrdU 분석법을 통한 세포 투과성 펩타이드-골분화 유도 서열 결합체의 세포 독성 측정
상기 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교 도메인이 hMSC와 함께 배양될 때, 잠재되어 있는 독성으로 인한 세포 증식에 영향이 있는지 여부를 확인하기 위해, 세포의 증식 정도를 BrdU를 이용한 ELISA로 분석하였다. BrdU는 hMSC의 증식과정에서 DNA 복제시에 dTTP (deoxy thymidine triphosphate) 대신 염색체 내로 도입되므로 그 도입 정도는 hMSC의 증식 정도를 반영하게 된다.
먼저, 96-웰(well)에 hMSC(human Mesenchymal Stem cell)을 1×103개씩 분주한 다음, 세포 분화 ELISA 키트 (cell proliferation ELISA kit, BrdU (colorimetry); Boehringermanheim, 독일)를 이용하여 BrdU의 세포내 유입 정도, 즉 hMSC의 증식 정도를 측정하였다. 이를 간단히 살펴보면, 실시예 1로서 합성된 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 농도를 10mM로 처리하여 경조직 형성 배지에서 24시간, 48시간, 72시간 동안 배양하였다. 각 배양이 끝나는 24시간 전 시점에 각 군에 20μl의 BrdU (5-bromo-2’-deoxyuridine)를 첨가하여 24시간 더 배양하였다. 포름알데히드를 첨가하여 30분간 상온에서 고정시킨 후 플레이트에 100μl의 항 BrdU 용액을 넣고 실온에서 90분간 반응시켰다. 이후 상기 플레이트를 PBS로 세척한 후 발색 기질을 넣어 30분간 반응시켰다. 1N의 H2SO4 로 반응을 정지시킨 다음, 96 웰-플레이트용 광도계(ELISA reader, Bio-Tek, USA)를 이용하여 450 nm 파장에서의 흡광도를 측정하였다.
그 결과, 도 6에서 나타난 바와 같이, 실시예 1의 세포 투과성 펩타이드-골분화 유도 서열 결합체 및 비교예 2의 골분화 유도 서열을 각 배양시간을 달리하여 처리해 주었을 때, PBS만을 처리한 군과 유사한 DNA 합성능을 보여 주었으며 군간의 차이는 유의적이지 않았으므로 본 발명의 결합체 및 비교 도메인(비교예 2)은 72시간 이내 세포 증식에 영향을 미치지 않는다는 결과를 보여주었다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
본 발명에 따른 인간 골형성단백질-4 유래 양이온성 세포 투과성 펩타이드는 독성 및 면역원성의 염려가 없어 바이러스성 펩타이드 수송체에 비하여 높은 안정성을 나타내고, 세포 불투과성 물질을 세포 및 물질의 손상 없이 세포 내 및 생체 내로 운반할 수 있고, 표적 유전자 발현을 현저히 증가시킬 수 있다. 또한, 여러 단계를 거치지 않고 임상에 적용할 수 있고 대량 생산이 가능하여 이를 이용한 약물 전달 시스템 및 치료기술의 발전에 유용하다.
전자파일 첨부하였음.

Claims (10)

  1. 5-15개의 아미노산 서열로 구성되고, 아르기닌, 라이신 및 히스티딘으로 구성된 군에서 선택된 하나 이상의 아미노산 함량이 70~80% 인 것을 특징으로 하는 인간 유래 세포 투과성 펩타이드.
  2. 제1항에 있어서, 상기 세포 투과성 펩타이드는 H4S (서열번호 1), H4Q (서열번호 2), HBD-3P (서열번호 3), H2 (서열번호 4), H3 (서열번호 5), H3B (서열번호 6), H4-1 (서열번호 7), H6 (서열번호 8), H8 (서열번호 9), H4C (서열번호 10), H5C (서열번호 11) 및 H6C (서열번호 12)로 구성된 군에서 선택되는 것을 특징으로 하는 세포 투과성 펩타이드.
  3. 제1항 또는 제2항의 세포 투과성 펩타이드에 생리활성 펩타이드 또는 단백질이 결합되어 있는 결합체.
  4. 제3항에 있어서, 상기 생리활성 펩타이드는 서열번호 13, 서열번호 14, 서열번호 15 및 서열번호 16으로 구성된 군에서 선택되는 것을 특징으로 하는 결합체.
  5. 제1항 또는 제2항의 세포 투과성 펩타이드에 서열번호 13, 서열번호 14 및 서열번호 15로 구성된 군에서 선택되는 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는, 골 질환의 예방 또는 치료용 약학조성물.
  6. 제5항에 있어서, 상기 골 질환은 골다공증, 골형성 부전증, 고칼슘혈증, 골연화증, 파젯병, 암에 의한 골 소실 및 골 괴사증으로 구성된 군에서 선택되는 것을 특징으로 하는 골 질환의 예방 또는 치료용 약학조성물.
  7. 제5항에 있어서, 상기 약학조성물은 주사제 형태인 것을 특징으로 하는 골 질환의 예방 또는 치료용 조성물.
  8. 제1항 또는 제2항의 세포 투과성 펩타이드에 서열번호 16의 생리활성 펩타이드가 결합되어 있는 결합체 및 약학적으로 허용가능한 담체를 포함하는, 자가면역질환의 예방 또는 치료용 약학조성물.
  9. 제8항에 있어서, 상기 자가면역질환은 류마티스 관절염 또는 건선인 것을 특징으로 하는 자가면역질환의 예방 또는 치료용 약학조성물.
  10. 제8항에 있어서, 상기 약학조성물은 피부투과형 제형 형태인 것을 특징으로 하는 자가면역질환의 예방 또는 치료용 약학조성물.
PCT/KR2011/002990 2010-09-09 2011-04-25 인간 유래 세포 투과성 펩타이드와 생리활성 펩타이드 결합체 및 그 용도 WO2012033272A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US13/821,790 US9023987B2 (en) 2010-09-09 2011-04-25 Cell-permeable peptide
EP11823705.6A EP2615105B1 (en) 2010-09-09 2011-04-25 Human-derived cell-permeable peptide bioactive peptide conjugate, and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2010-0088610 2010-09-09
KR1020100088610A KR101348284B1 (ko) 2010-09-09 2010-09-09 인간 유래 세포 투과성 펩타이드와 생리활성 펩타이드 결합체 및 그 용도

Publications (1)

Publication Number Publication Date
WO2012033272A1 true WO2012033272A1 (ko) 2012-03-15

Family

ID=45810844

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/002990 WO2012033272A1 (ko) 2010-09-09 2011-04-25 인간 유래 세포 투과성 펩타이드와 생리활성 펩타이드 결합체 및 그 용도

Country Status (4)

Country Link
US (1) US9023987B2 (ko)
EP (1) EP2615105B1 (ko)
KR (1) KR101348284B1 (ko)
WO (1) WO2012033272A1 (ko)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140046996A (ko) * 2012-10-09 2014-04-21 한양대학교 산학협력단 인간 ｎｌｂｐ 유래의 ｎｐ12 폴리펩티드 또는 ｎｐ21 폴리펩티드를 포함하는 세포 투과 펩티드 및 이를 이용한 카고 전달 시스템
KR20140046994A (ko) * 2012-10-09 2014-04-21 한양대학교 산학협력단 인간 ＮＬＢＰ 유래의 ＮＰ2 폴리펩티드 또는 ｄＮＰ2 폴리펩티드를 포함하는 세포 투과 펩티드 및 이를 이용한 카고 전달 시스템
WO2015137705A1 (ko) * 2014-03-10 2015-09-17 한양대학교 산학협력단 세포 투과성 펩티드 및 이를 이용한 생물학적 활성 물질의 전달방법
KR101564752B1 (ko) 2012-10-09 2015-11-03 한양대학교 산학협력단 인간 ｎｌｂｐ 단백질 유래의 ｎｐ1 폴리펩티드를 포함하는 세포 투과 펩티드 및 이를 이용한 카고 전달 시스템
EP2873678A4 (en) * 2012-07-11 2016-05-18 Gemvax & Kael Co Ltd PEPTIDE PENETRATING IN A CELL, CONJUGATED COMPRISING SAME, AND COMPOSITION COMPRISING SAME
TWI616530B (zh) * 2012-09-19 2018-03-01 傑姆維克斯＆凱爾有限公司 穿膜胜肽以及包含該胜肽之共軛物及組成物（一）
CN110225920A (zh) * 2016-12-27 2019-09-10 首尔大学校产学协力团 具有细胞渗透性和骨组织再生能力的双功能新颖肽及其用途

Families Citing this family (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104507489B (zh) 2012-05-11 2016-07-13 杰姆维克斯&凯尔有限公司 用于预防和治疗类风湿性关节炎的组合物
KR20150014483A (ko) 2012-05-11 2015-02-06 주식회사 카엘젬백스 항염증 활성을 갖는 펩티드 및 이를 포함하는 조성물
KR101456026B1 (ko) 2012-09-18 2014-11-04 서울대학교산학협력단 종양선택적 투과기능성을 가지는 펩타이드 및 그 용도
KR102201430B1 (ko) * 2012-09-19 2021-01-12 주식회사 젬백스앤카엘 세포 투과성 펩티드, 그를 포함한 컨쥬게이트 및 그를 포함한 조성물
CN107312759A (zh) 2012-09-19 2017-11-03 珍白斯凯尔有限公司 细胞穿透肽、包含该肽的缀合物、及包含该缀合物的组合物
ES2716870T3 (es) 2013-04-19 2019-06-17 Gemvax & Kael Co Ltd Composición para el tratamiento y prevención de lesión isquémica
KR101491016B1 (ko) * 2013-05-31 2015-02-10 건국대학교 산학협력단 배반포 및 생식기관 암 세포 특이적인 단백질 운반 방법 및 그 조성물
US10383926B2 (en) 2013-06-07 2019-08-20 Gemvax & Kael Co., Ltd. Biological markers useful in cancer immunotherapy
ES2808076T3 (es) 2013-06-21 2021-02-25 Gemvax & Kael Co Ltd Regulador de la secreción hormonal, composición que lo contiene y procedimiento para controlar la secreción hormonal mediante su uso
WO2015005723A1 (ko) * 2013-07-12 2015-01-15 주식회사 카엘젬백스 세포 투과성 펩티드 및 이를 포함하는 컨쥬게이트
KR101529634B1 (ko) * 2013-08-28 2015-06-30 서울대학교산학협력단 역분화 유도를 위한 세포투과성 융합 단백질 및 그 용도
CN110755599A (zh) 2013-10-23 2020-02-07 珍白斯凯尔有限公司 用于治疗和预防良性前列腺增生的组合物
EP3072519B1 (en) 2013-11-22 2020-08-19 Gemvax & Kael Co., Ltd. Peptide having angiogenesis inhibitory activity and composition containing same
EP3085380B1 (en) 2013-12-17 2020-06-17 Gemvax & Kael Co., Ltd. Composition for treating prostate cancer
US9937240B2 (en) 2014-04-11 2018-04-10 Gemvax & Kael Co., Ltd. Peptide having fibrosis inhibitory activity and composition containing same
JP6466971B2 (ja) 2014-04-30 2019-02-06 ジェムバックス アンド カエル カンパニー，リミティド 臓器、組織又は細胞移植用組成物、キット及び移植方法
KR102212415B1 (ko) * 2014-05-30 2021-02-05 주식회사 엘지생활건강 피부투과성 펩타이드 및 이를 포함하는 융합단백질
KR102413243B1 (ko) 2014-12-23 2022-06-27 주식회사 젬백스앤카엘 안질환 치료 펩티드 및 이를 포함하는 안질환 치료용 조성물
KR102636129B1 (ko) 2015-02-27 2024-02-14 주식회사 젬백스앤카엘 청력 손상 방어용 펩타이드 및 이를 포함하는 조성물
EP3305802B1 (en) 2015-05-26 2021-05-12 Gemvax & Kael Co., Ltd. Anti-inflammatory, anti-fibrotic and wound-healing octapeptides and compositions containing the same
KR102638286B1 (ko) 2015-07-02 2024-02-20 주식회사 젬백스앤카엘 항바이러스 활성 효능을 가지는 펩티드 및 이를 포함하는 조성물
PT3265443T (pt) * 2015-07-08 2020-02-14 Korea Res Inst Chemical Tech Derivados de pirrolidina carboxamido e métodos de preparação e utilização dos mesmos
KR101746787B1 (ko) 2015-11-12 2017-06-13 주식회사 펩트론 미백, 피부 탄력, 주름 개선 및 상처치유 활성을 갖는 다기능성 피부투과 펩타이드
WO2017082690A1 (ko) * 2015-11-12 2017-05-18 주식회사 펩트론 미백, 피부 탄력, 주름 개선 및 상처치유 활성을 갖는 다기능성 피부투과 펩타이드
KR101853923B1 (ko) * 2016-01-25 2018-05-02 연세대학교 산학협력단 Smad 단백질을 포함하는 자가 면역 질환 치료용 조성물, Smad 단백질을 포함하는 융합 단백질, 이를 제조하기 위한 벡터, 및 이의 제조 방법
KR20180123512A (ko) 2016-04-07 2018-11-16 주식회사 젬백스앤카엘 텔로머라제 활성 증가 및 텔로미어 연장 효능을 가지는 펩티드 및 이를 포함하는 조성물
TWI811767B (zh) 2018-02-28 2023-08-11 韓商畢利吉生物科技股份有限公司 脂化肽的水溶性鹽以及製備與使用其的方法
EP4332219A1 (en) * 2021-05-14 2024-03-06 Remedi Co., Ltd Cargo molecule tranduction domain rmad1, variant thereof, recombinant cargo molecule, and method for tranducing cargo molecule using same
WO2022255708A1 (ko) * 2021-06-03 2022-12-08 주식회사 레메디 화물분자 수송 도메인 rmmr1, 이의 변이체, 이를 포함하는 재조합 화물분자 및 이를 이용한 화물분자 수송 방법

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100568457B1 (ko) 2003-07-22 2006-04-07 학교법인 성균관대학 양이온성 올리고펩타이드를 이용한 식물체로의 ｒｎａ전달 기법
US7504347B2 (en) * 2004-03-17 2009-03-17 Dow Global Technologies Inc. Fibers made from copolymers of propylene/α-olefins
US20090234100A9 (en) * 2003-03-24 2009-09-17 Boden Scott D Osteogenic compositions comprising an amiono acid sequence which is capable of being phosphorylated by camk2

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7504374B2 (en) 2000-10-24 2009-03-17 Warsaw Orthopedic, Inc. Method for inducing deposition and maturation of bone comprising a co-therapeutic regimen of LMP-1 and BMP-2
US20050032173A1 (en) * 2003-08-05 2005-02-10 Mauricio Rojas Fusion proteins with a membrane translocating sequence and methods of using same to inhibit an immune response
US7807627B2 (en) * 2005-05-27 2010-10-05 Bbs-Bioactive Bone Substitutes Oy Bone morphogenetic protein 4 and osteogenic devices and pharmaceutical products containing thereof
KR100894265B1 (ko) * 2007-06-05 2009-04-21 재단법인서울대학교산학협력재단 골형성 촉진 펩타이드를 함유하는 주입형 골재생재

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090234100A9 (en) * 2003-03-24 2009-09-17 Boden Scott D Osteogenic compositions comprising an amiono acid sequence which is capable of being phosphorylated by camk2
KR100568457B1 (ko) 2003-07-22 2006-04-07 학교법인 성균관대학 양이온성 올리고펩타이드를 이용한 식물체로의 ｒｎａ전달 기법
US7504347B2 (en) * 2004-03-17 2009-03-17 Dow Global Technologies Inc. Fibers made from copolymers of propylene/α-olefins

Non-Patent Citations (17)

* Cited by examiner, † Cited by third party
Title
BODEN SD ET AL., ENDOCRINOLOGY, vol. 139, 1998, pages 5125 - 34
BODEN SD ET AL., JBC, vol. 281, 2006, pages 17212 - 17219
CELESTE AJ ET AL., PROC. NATL. ACAD. SCI. US, vol. 87, 1990, pages 9843 - 9847
ELLIOTT, G. ET AL., CELL, vol. 88, 1997, pages 223
FAWELL S ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 664 - 668
FAWELL, S ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 664
HERCE, H. D. ET AL.: "Arginine-Rich peptides destabilize the plasma membrane, consistent with a pore formation translocation mechanism of cell-penetrating peptides.", BIOPHYSICAL JOURNAL., vol. 97, October 2009 (2009-10-01), pages 1917 - 1925, XP008163525 *
KIM CS ET AL., J PERIODONTAL, vol. 73, 2002, pages 1126 - 1132
KINGSLEY DM ET AL., CELL, vol. 71, 1992, pages 399 - 410
LAUS, R. ET AL., NATURE BIOTECHNOL., vol. 18, 2000, pages 1269
SCHWARZE SR. ET AL., TRENDS PHARMACOL SCI, vol. 21, 2000, pages 45 - 48
SCHWARZE, S.R. ET AL., TRENDS. PHARMACOL. SCI., vol. 21, 2000, pages 45
SEBBAGE, V.: "Cell-penetrating peptides and their therapeutic applications.", BIOSCENCE HORIZONS., vol. 2, no. 1, March 2009 (2009-03-01), pages 64 - 72, XP008163524 *
See also references of EP2615105A4 *
SHIN ET AL., PLANT J., vol. 49, 2007, pages 981 - 994
WIKESJO UM ET AL., J CLIN PERIODONTAL, vol. 26, 1999, pages 392 - 400
WOZNEY JM ET AL., SCIENCE, vol. 242, 1988, pages 1528 - 1534

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2873678A4 (en) * 2012-07-11 2016-05-18 Gemvax & Kael Co Ltd PEPTIDE PENETRATING IN A CELL, CONJUGATED COMPRISING SAME, AND COMPOSITION COMPRISING SAME
TWI616530B (zh) * 2012-09-19 2018-03-01 傑姆維克斯＆凱爾有限公司 穿膜胜肽以及包含該胜肽之共軛物及組成物（一）
KR20140046996A (ko) * 2012-10-09 2014-04-21 한양대학교 산학협력단 인간 ｎｌｂｐ 유래의 ｎｐ12 폴리펩티드 또는 ｎｐ21 폴리펩티드를 포함하는 세포 투과 펩티드 및 이를 이용한 카고 전달 시스템
KR20140046994A (ko) * 2012-10-09 2014-04-21 한양대학교 산학협력단 인간 ＮＬＢＰ 유래의 ＮＰ2 폴리펩티드 또는 ｄＮＰ2 폴리펩티드를 포함하는 세포 투과 펩티드 및 이를 이용한 카고 전달 시스템
KR101564752B1 (ko) 2012-10-09 2015-11-03 한양대학교 산학협력단 인간 ｎｌｂｐ 단백질 유래의 ｎｐ1 폴리펩티드를 포함하는 세포 투과 펩티드 및 이를 이용한 카고 전달 시스템
KR101636542B1 (ko) 2012-10-09 2016-07-07 한양대학교 산학협력단 인간 ｎｌｂｐ 유래의 ｎｐ12 폴리펩티드 또는 ｎｐ21 폴리펩티드를 포함하는 세포 투과 펩티드 및 이를 이용한 카고 전달 시스템
KR101636538B1 (ko) 2012-10-09 2016-07-07 한양대학교 산학협력단 인간 ＮＬＢＰ 유래의 ＮＰ2 폴리펩티드 또는 ｄＮＰ2 폴리펩티드를 포함하는 세포 투과 펩티드 및 이를 이용한 카고 전달 시스템
WO2015137705A1 (ko) * 2014-03-10 2015-09-17 한양대학교 산학협력단 세포 투과성 펩티드 및 이를 이용한 생물학적 활성 물질의 전달방법
US9969774B2 (en) 2014-03-10 2018-05-15 Iucf-Hyu (Industry-University Cooperation Foundation Hanyang University) Cell penetrating peptide and method for delivering biologically active substance using same
CN110225920A (zh) * 2016-12-27 2019-09-10 首尔大学校产学协力团 具有细胞渗透性和骨组织再生能力的双功能新颖肽及其用途
CN110225920B (zh) * 2016-12-27 2023-05-26 首尔大学校产学协力团 具有细胞渗透性和骨组织再生能力的双功能新颖肽及其用途

Also Published As

Publication number Publication date
US9023987B2 (en) 2015-05-05
EP2615105A4 (en) 2013-11-13
EP2615105A1 (en) 2013-07-17
US20130237484A1 (en) 2013-09-12
KR101348284B1 (ko) 2014-01-03
KR20120026408A (ko) 2012-03-19
EP2615105B1 (en) 2017-02-22

Similar Documents

Publication Publication Date Title
WO2012033272A1 (ko) 인간 유래 세포 투과성 펩타이드와 생리활성 펩타이드 결합체 및 그 용도
WO2010095881A2 (ko) 표적 선택적 세포／조직 투과기능 활성을 가지는 펩타이드 및 그 용도
US8207293B2 (en) Peptides derived from maurocalcine used as vectors for intracellular addressing of molecules of interest
HUE025291T2 (en) Metastin derivatives and their use
WO2015156649A1 (ko) 섬유증 억제 활성을 가지는 펩티드 및 이를 포함하는 조성물
WO2015137705A1 (ko) 세포 투과성 펩티드 및 이를 이용한 생물학적 활성 물질의 전달방법
EA020018B1 (ru) Процессированные аналоги глюкозозависимого инсулинотропного полипептида
KR102060411B1 (ko) 세포 침투성 펩타이드, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물
US20110118172A1 (en) Metastin derivative and use thereof
EP2870174A1 (en) Cell penetrating peptides to target eif4e
WO2016098935A1 (ko) Bmp 유래 펩타이드 및 이의 용도
EP2314609B1 (en) Metastin derivative and use thereof
EP1888635A2 (en) Neural regeneration peptides and methods for their use
WO2018147624A1 (ko) 인슐린의 a 사슬로부터 유래된 펩타이드 단편 및 이를 포함하는 당뇨병 또는 당뇨병성 창상의 예방 또는 치료용 약학 조성물
EP4180446A1 (en) Cyclic peptide, peptide complex, and drug composition containing said cyclic peptide and/or said peptide complex
JP6643314B2 (ja) 骨分化促進能及び歯周靭帯線維母細胞活性促進能を有するペプチド及びその用途
KR102043992B1 (ko) Ncoa1/stat6 단백질-단백질 상호작용을 저해하는 신규 스테이플 펩타이드 및 이의 용도
WO2018111051A1 (ko) 세포막 투과 펩티드 및 이를 포함하는 세포내 전달체
CN113024635B (zh) 一类订书肽化合物及其药物组合物的用途
WO2016175532A1 (ko) 골아세포분화 및 혈관신생 촉진활성을 갖는 펩타이드 및 그의 용도
WO2022215946A1 (ko) 세포 투과성 펩타이드 변이체 및 이의 용도
WO2022071771A1 (ko) 단백질 수송 도메인, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물
CZ20032612A3 (cs) HeterokarpinŹ proteinŹ který váže lidský GHRH
KR102146392B1 (ko) 포스포글리세레이트 뮤테이즈 1 융합단백질 및 이를 포함하는 약학 조성물
EP4317190A1 (en) C-met protein-binding peptide complex

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11823705

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2011823705

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011823705

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13821790

Country of ref document: US

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112013005750

Country of ref document: BR

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112013005750

Country of ref document: BR

ENPW Started to enter national phase and was withdrawn or failed for other reasons

Ref document number: 112013005750

Country of ref document: BR