WO2022071771A1 - 단백질 수송 도메인, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물 - Google Patents

단백질 수송 도메인, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물 Download PDF

Info

Publication number
WO2022071771A1
WO2022071771A1 PCT/KR2021/013379 KR2021013379W WO2022071771A1 WO 2022071771 A1 WO2022071771 A1 WO 2022071771A1 KR 2021013379 W KR2021013379 W KR 2021013379W WO 2022071771 A1 WO2022071771 A1 WO 2022071771A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
fusion compound
transport domain
protein transport
cells
Prior art date
Application number
PCT/KR2021/013379
Other languages
English (en)
French (fr)
Inventor
최수영
박진서
한규형
이근욱
박종국
음원식
신민재
이성호
이승호
여현지
여은지
최연주
손은정
차현주
권현정
김대원
Original Assignee
주식회사 젠센
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 젠센 filed Critical 주식회사 젠센
Publication of WO2022071771A1 publication Critical patent/WO2022071771A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • A61P39/06—Free radical scavengers or antioxidants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/001—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a protein transport domain, and relates to a protein transport domain comprising a peptide consisting of 18 amino acids of YANDIREGRQELRKTVRS or a peptide in which some amino acids are deleted, substituted or added. Further, the present invention relates to a fusion compound in which the protein transport domain and a cargo molecule are bound, and a pharmaceutical composition comprising the fusion compound.
  • Protein delivery technology is a protein transduction domain (PTD) or cell penetrating peptide (CPP), usually composed of 5 to 30 amino acids, by fusing a peptide with a polymer such as a protein or gene in mammalian cells and tissues. It is a new concept delivery system that can be easily delivered into living bodies such as , blood, etc. Although the specific mechanism has not yet been precisely elucidated, protein delivery technology has been widely used to deliver therapeutic proteins in vitro or in vivo, specifically into cells or tissues, and a wide variety of protein transport domains are known.
  • Pep-1 peptide consists of 21 amino acids (KETWWETWWTEWSQPKKKRKV) and has three domains, namely, a hydrophobic domain, a spacer and a hydrophilic domain. So far, studies using Pep-1 peptides have revealed that when a foreign protein is covalently fused to a Pep-1 peptide and administered to a cell, the protein can be transported into the cell in its natural state.
  • oligolysine, oligoarginine, oligo (lysine + arginine), etc. are widely known as protein transport domains.
  • Another object of the present invention is to provide a fusion compound in which the novel protein transport domain and a cargo molecule for preventing or treating diseases are covalently linked.
  • Another object of the present invention is to provide a recombinant polynucleotide encoding the fusion compound.
  • Another object of the present invention is to provide a fusion compound expression vector comprising the recombinant polynucleotide.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating a disease comprising the fusion compound, the polynucleotide, the expression vector, or a mixture of one or more selected therefrom.
  • Another object of the present invention is to provide the use of a composition comprising the fusion compound, the polynucleotide, the expression vector, or a mixture of one or more selected therefrom for preventing or treating a disease.
  • Another object of the present invention is to provide the use of a composition comprising the fusion compound, the polynucleotide, the expression vector, or a mixture of one or more selected therefrom for preparing a medicament for preventing or treating a disease. .
  • Another object of the present invention is to provide a method for preventing or treating a disease comprising administering to an individual a composition comprising the fusion compound, the polynucleotide, the expression vector, or a mixture of one or more selected from them will do
  • Another object of the present invention is to provide a method for smoothly transporting useful polymers such as proteins or genes into cells or tissues.
  • YANDIREGRQELRKTVRS peptide consisting of 18 amino acids (hereinafter referred to as "GK3" in the present invention) or some amino acids among them are deleted, substituted or added It has been found that the peptide can smoothly penetrate macromolecules such as proteins into living bodies such as cells, tissues, and blood.
  • a "cargo molecule” is a molecule that is not a protein transport domain or fragment thereof that is not capable of entering a target cell intrinsically or at an intrinsically useful rate, the molecule itself or the protein transport domain- It refers to the target protein portion of the target protein complex.
  • the cargo molecule refers to one selected from proteins, peptides, amino acids, nucleic acids, carbohydrates, lipids, and mixtures of one or more thereof.
  • target protein is a molecule that is not a protein transport domain or fragment thereof that is not capable of entering a target cell intrinsically or at an intrinsically useful rate, and is not capable of being fused with a protein transport domain. It refers to the former molecule itself or the target protein portion of the protein transport domain-target protein complex.
  • Target proteins include polypeptides, proteins, and peptides.
  • Fusion compound refers to a binding of a protein transport domain to a cargo molecule.
  • a fusion compound includes a fusion protein, and the fusion protein includes a protein transport domain and one or more target protein portions, and refers to a complex formed by genetic fusion or chemical bonding of a protein transport domain and a target protein, which is a cargo molecule.
  • the "genetic fusion” refers to a linkage formed by a linear or covalent bond formed through the genetic expression of a nucleotide or cDNA sequence encoding a protein.
  • it includes a case in which an oligonucleotide sequence encoding a protein transport domain and a cDNA sequence encoding a cargo molecule for disease prevention or treatment are combined, and the protein transport domain and the cargo molecule are covalently linked to each other.
  • target cell refers to a cell to which a target protein is delivered by a protein transport domain, and the target cell refers to a cell inside or outside the body. That is, the target cell is meant to include a cell in the body, that is, a cell constituting an organ or tissue of a living animal or human, or a microorganism found in a living animal or human. In addition, the target cell is meant to include cells in vitro, that is, cultured animal cells, human cells, or microorganisms.
  • the "protein transport domain" in the present invention forms a covalent bond with a high molecular weight organic compound, such as an oligonucleotide, a peptide, a protein, an oligosaccharide, or a polysaccharide to introduce the organic compounds into a cell without requiring a separate receptor, carrier, or energy. say what you can
  • R 1 is Y or R
  • R 2 is A or R
  • R 3 is N or R
  • R 4 is T or R
  • R 5 is V or R
  • R 6 is S or R
  • R 7 is R, RR or RRR
  • R 8 is RKKRRQRRR, KETWWET or EWSQPKKKRKV
  • the present invention is characterized in that the protein transport domain is one selected from SEQ ID NO: 1 to SEQ ID NO: 22.
  • the protein transport domain of the present invention is not limited to SEQ ID NOs: 1 to 22, but it is clearly shown that representative peptides are exemplified in Table 1 for convenience of the experiment.
  • the protein transport domain according to the present invention has 18 amino acids among variants in which amino acid residues are conservatively substituted at specific amino acid residue positions, or fragments in which 1 to 3 amino acids are truncated at the N-terminus and/or C-terminus of the variant. It is interpreted to include more than one fragment.
  • “conservative substitution” means a modification of a protein transport domain comprising substituting one or more amino acids with an amino acid having similar biochemical properties that does not cause loss of biological or biochemical function of the protein transport domain.
  • a “conservative amino acid substitution” is a substitution in which an amino acid residue is replaced by an amino acid residue having a similar side chain.
  • Classes of amino acid residues having similar side chains have been defined in the art and are well known. These classes include amino acids with basic side chains (eg lysine, arginine, histidine), amino acids with acidic side chains (eg aspartic acid, glutamic acid), amino acids with uncharged polar side chains (eg glycine) , asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids with beta-branched side chains (eg, threonine, valine, isoleucine) and amino acids with aromatic side chains (eg, tyrosine, phenylalanine, trypto
  • protein transport domain or fragment thereof of the present invention may still retain activity even with conservative amino acid substitutions.
  • the protein transport domain variant according to the present invention has substantially the same function and/or effect as the protein transport domain according to the present invention, and is 80% or 85% or more, preferably 90% or more, more preferably 95% or more. It is interpreted to include protein transport domain variants or fragments thereof having the above amino acid sequence homology.
  • the present invention is characterized in that the cargo molecule is selected from proteins, peptides, amino acids, nucleic acids, carbohydrates, lipids, and mixtures of one or more thereof.
  • the present invention is characterized in that the cargo molecule is selected from nanoparticles, microparticles, liposomes and micelles.
  • the present invention is characterized in that the binding between the protein transport domain and the cargo molecule is a covalent bond.
  • the present invention is one selected from the above (A) to (C), consisting of 18 to 29 amino acids, and transporting cargo molecules into cells or tissues of mammals by binding with cargo molecules for disease prevention or treatment. It relates to a fusion compound in which a protein transport domain and a cargo molecule for preventing or treating diseases are covalently bound to facilitate penetration into cells or tissues.
  • (A) to (C) are the same as described above in the protein transport domain.
  • the present invention relates to a fusion compound that easily penetrates into cells or tissues, characterized in that the protein transport domain is one selected from SEQ ID NO: 1 to SEQ ID NO: 22.
  • the protein transport domain of the present invention is not limited to SEQ ID NOs: 1 to 22, but it is clearly shown that representative peptides are exemplified in Table 1 for convenience of the experiment.
  • the present invention relates to a fusion compound, characterized in that the cargo molecule is selected from proteins, peptides, amino acids, nucleic acids, carbohydrates, lipids, and mixtures of one or more thereof.
  • the present invention relates to a fusion compound, wherein the cargo molecule is selected from nanoparticles, microparticles, liposomes and micelles.
  • the present invention relates to a pharmaceutical composition for preventing or treating a disease comprising a fusion compound that easily penetrates into the cell or tissue.
  • the present invention relates to a cell in which an oligonucleotide sequence encoding the protein transport domain and a cDNA sequence encoding a cargo molecule for disease prevention or treatment are combined, so that the protein transport domain and a cargo molecule for disease prevention or treatment are covalently linked. It relates to a recombinant polynucleotide encoding a fusion compound that is easily permeable into the body or into a tissue.
  • the present invention relates to a recombinant polynucleotide encoding a fusion compound that can easily penetrate into cells or tissues, characterized in that the oligonucleotide sequence encoding the protein transport domain is one selected from SEQ ID NOs: 23 to 44. .
  • the oligonucleotide encoding the protein transport domain of the present invention is not limited to SEQ ID NOs: 23 to 44, but it is clearly indicated that representative oligonucleotides are exemplified in Table 2 for the convenience of the experiment.
  • the present invention relates to a pharmaceutical composition for preventing or treating a disease comprising a recombinant polynucleotide encoding a fusion compound that can easily penetrate into cells or tissues.
  • the present invention relates to a fusion compound expression vector comprising a recombinant polynucleotide encoding a fusion compound easily permeable into cells or tissues.
  • the present invention relates to a pharmaceutical composition for preventing or treating a disease comprising the expression vector of the fusion compound.
  • the fusion compound of the present invention an oligonucleotide encoding the same, or a pharmaceutical composition containing a vector comprising the oligonucleotide as an active ingredient is formulated with a carrier commonly acceptable in the pharmaceutical field, It can be formulated in various forms such as oral, spray, patch or injection.
  • oral compositions include tablets and gelatin capsules, which, in addition to the active ingredient, contain diluents (eg lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine), glidants (eg silica, talc).
  • stearic acid and its magnesium or calcium salts and/or polyethylene glycol also contain binders (eg magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone) ), preferably containing a disintegrant (eg, starch, agar, alginic acid or sodium salt thereof) or a boiling mixture and/or absorbent, colorant, flavoring agent and sweetening agent as the case may be.
  • binders eg magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone
  • a disintegrant eg, starch, agar, alginic acid or sodium salt thereof
  • absorbent, colorant, flavoring agent and sweetening agent as the case may be.
  • compositions for injection are preferably isotonic aqueous solutions or suspensions, the compositions mentioned are sterile and/or contain adjuvants (eg, preservatives, stabilizers, wetting or emulsifying agents, solution promoters, salts/or buffers for regulating the osmotic pressure). In addition, they may contain other therapeutically useful substances.
  • adjuvants eg, preservatives, stabilizers, wetting or emulsifying agents, solution promoters, salts/or buffers for regulating the osmotic pressure.
  • adjuvants eg, preservatives, stabilizers, wetting or emulsifying agents, solution promoters, salts/or buffers for regulating the osmotic pressure.
  • adjuvants eg, preservatives, stabilizers, wetting or emulsifying agents, solution promoters, salts/or buffers for regulating the osmotic pressure.
  • they may contain other therapeutically
  • the pharmaceutical preparation thus prepared can be administered orally, as desired, or parenterally, i.e., intravenous, intramuscular, intradermal, subcutaneous, intraperitoneal, intraarterial, intraventricular, intralesional, intrathecal, topical and these It may be performed by any one route selected from the group consisting of a combination of
  • the dose may be administered in one to several divided doses of 0.0001 to 100 mg/kg, 0.001 to 90 mg/kg, 0.01 to 80 mg/kg, 0.1 to 70 mg/kg, and 1 to 60 mg/kg per day.
  • the dosage level for a specific patient may vary depending on the patient's weight, age, sex, health status, administration time, administration method, excretion rate, severity of disease, and the like.
  • FKBP-12 Tecrolimus-binding protein; FK506-binding protein
  • HSP70 Hea-Shock Protein 70
  • the present invention also relates to the use of a composition comprising said fusion compound, said polynucleotide, said expression vector, or a mixture of one or more selected from these for preventing or treating a disease.
  • the present invention relates to the use of a composition comprising the fusion compound, the polynucleotide, the expression vector, or a mixture of one or more selected therefrom for preparing a medicament for preventing or treating a disease.
  • the present invention relates to a method for preventing or treating a disease, comprising administering to a subject a composition comprising the fusion compound, the polynucleotide, the expression vector, or a mixture of one or more selected therefrom.
  • the fusion compound, the polynucleotide, or the expression vector is the same as described above in the pharmaceutical composition.
  • novel protein transport domain of the present invention can be easily penetrated into cells or tissues by binding to cargo molecules such as proteins to form a fusion compound.
  • the fusion compound in which the novel protein transport domain and cargo molecule of the present invention are bound exhibits activity in cells or tissues
  • the fusion compound, an oligonucleotide encoding the same, or a vector comprising the oligonucleotide can be used as a pharmaceutical for preventing or treating diseases. It can be used as a composition.
  • cargo molecules such as proteins can be easily permeated into cells or tissues.
  • FIG. 1A and 1B show the construction of a GK3 expression vector on a pET-15b vector.
  • Synthetic GK3 oligomers were cloned at the Nde I site, and human HSP70 (Fig. 1a) or FKBP12 (Fig. 1b) cDNA was cloned at the Xho I and BamHI sites of pET-15b.
  • FIG. 2A shows the results of Western blot analysis of the protein levels introduced into cells after cells were treated with PEP-1-HSP70 fusion protein, TAT-HSP70 fusion protein, and GK3-HSP70 fusion protein for 1 hour.
  • FIG. 2B shows Western blotting of cells treated with GK3-HSP70 fusion protein or GK3-FKBP12 fusion protein.
  • Figure 3a is a cell-introduced control PEP-1-HSP70 fusion protein, TAT-HSP70 fusion protein or GK3-HSP70 fusion protein
  • Figure 3b is a cell-introduced control GK3-HSP70 fusion protein or GK3-FKBP12 fusion protein in the cell location and Levels were taken with a confocal fluorescence microscope.
  • FIG. 4 is a graph showing the protective effect of each protein against oxidative stress.
  • Cells were pretreated with 5 ⁇ M each of GK3-HSP70 fusion protein and GK3-FKBP12 protein, control HSP70 protein and FKBP12 protein for 1 hour, and then treated with 100 ⁇ M H 2 O 2 for 1 hour. Cell viability was then evaluated by MTT assay.
  • the middle number of the fusion protein is the protein transport domain number shown in Table 1.
  • the middle number of the fusion protein is the protein transport domain number shown in Table 1.
  • NSC34 cells a mouse motor neuron-like hybrid cell line, were purchased from Hallym University College of Natural Sciences and cultured.
  • the cell culture medium was prepared by adding 10% fetal bovine serum (FBS) and an antibiotic solution (100 units/ml penicillin, 100 ⁇ g/ml streptomycin) to DMEM medium.
  • FBS fetal bovine serum
  • antibiotic solution 100 units/ml penicillin, 100 ⁇ g/ml streptomycin
  • oligonucleotides were annealed at 37°C for 2 hours.
  • Sense oligonucleotide (SEQ ID NO: 45):
  • Antisense oligonucleotide SEQ ID NO: 46:
  • the Nde I site of the pET-15b vector was cut, and the GK3 encoding oligonucleotide pair prepared above was ligated.
  • the recombinant GK3 was transformed into Escherichia coli strain Top10 in Escherichia coli. DNA isolated from the transformed cells was amplified by PCR using the following primers.
  • the BamHI and Xho I sites of the GK3 vector were cut to link HSP70 or FKBP12 genes.
  • the recombinant GK3 plasmid was transformed into Escherichia coli strain BL21.
  • Transformed cells were incubated in 100 ml LB medium containing 100 ⁇ g/ml ampicillin at 37° C. and 180 rpm for 6 hours, and then 0.5 mM IPTG (isopropyl- ⁇ -D-thiogalactoside) was added to 30° C. , incubated at 120 rpm for 16 hours.
  • IPTG isopropyl- ⁇ -D-thiogalactoside
  • the recovered cells were sonicated and centrifuged to separate only the supernatant, and purified using Ni 2+ -nitrilotriacetic acid sepharose affinity chromatography column. Protein concentrations were normalized to bovine serum albumin (BSA) and quantified using a protein quantitation kit.
  • BSA bovine serum albumin
  • NSC34 cells were aliquoted on a 60mm plate and cultured at 37°C, 95% humidity, 5% CO 2 conditions.
  • PEP-1-HSP70 fusion protein, TAT-HSP70 fusion protein, and GK3-HSP70 fusion protein at the same concentration (5 ⁇ M) were each treated for 20 minutes.
  • another protein, FKBP12 protein at the same concentration was treated for 20 minutes.
  • the cultured cells were rinsed with PBS (phosphate buffer saline), RIPA lysis buffer was added to extract the protein, and the protein was quantified in the supernatant by centrifugation (4°C, 12,000 rpm, 10 min).
  • HRP horse radish peroxidase
  • Each of the glass coverslips was placed in a 24-well plate, and cells were dispensed thereon and incubated for 24 hours. After transducing 5 ⁇ M of Pep-1-HPS70 fusion protein, TAT-HPS70 fusion protein, GK3-HPS70 fusion protein or GK3-FKBP12 fusion protein into NSC34 cells for 2 hours, remove the culture medium and rinse 3 times with PBS. gave out After putting 4% paraformaldehyde in each well and fixing the cells for 5 minutes, PBS was added and washed three times briefly.
  • PBS-BT PBS-BT
  • His-probe primary antibody was diluted 1:2,000 and incubated for 1 hour at room temperature.
  • the secondary antibody Alexa Fluor 488, was diluted 1:10,000, darkened, reacted for 1 hour, and washed 3 times for 5 minutes with PBS-BT. Remove the glass coverslip from the well to remove moisture from the edges and lift. It was observed with a fluorescence microscope and fluorescence was confirmed using an image analyzer.
  • a GK3 oligonucleotide (gctgcgaatgatcttgcggaaggtctggcg gaactcgcggatacggtaggcgta; SEQ ID NO: 23) was cloned into the pET-15b plasmid Nde I site.
  • GK3 HSP70 Phosphoglycerate mutase 1
  • FKBP12 Boiliverdin Reductase A
  • HSP70 protein or FKBP12 protein was cloned into pET-15b plasmid. After expression of the fusion protein, Ni 2+ -nitrilotriacetic acid sepharose affinity chromatography column was used for purification, and this was confirmed by SDS-PAGE [ FIGS. 1A and 1B ].
  • NSC34 cells were treated with the same concentrations (5 ⁇ M) of PEP-1-HSP70 fusion protein, Tat-HSP70 fusion protein, and GK3-HSP70 fusion protein for 1 hour. Cell permeation levels were then analyzed by Western blotting. The level of intracellular fusion protein was highest in GK3-HSP70 fusion protein, whereas TAT-HSP70 fusion protein showed a cell permeation level of about 85% and PEP-1-HSP70 fusion protein about 5% [Fig. 2A] . The control HSP70 protein did not penetrate into the cells.
  • the GK3-HSP70 fusion protein and the GK3-FKBP12 fusion protein prepared by fusing the cell penetrating domain GK3 to the two types of proteins HSP70 and FKBP12 and the GK3-FKBP12 fusion protein are identical Concentration (5 ⁇ M) cells were treated for 1 hour. Although there was a difference in cell permeation efficiency depending on the type of protein, the two types of protein were smoothly permeated into the NSC34 cells [FIG. 2B].
  • the cells permeated with each fusion protein were immunostained with DAPI and Alexa Fluor 488-binding secondary antibody. did Control HSP70 protein was not observed in NSC34 cells.
  • the PEP-1-HSP70 fusion protein, the GTAT-HSP70 fusion protein and the GK3-HSP70 fusion protein were detected mainly in the cytoplasm by fluorescence microscopy and also in the nucleus [ FIG. 3A ].
  • the GK3-HSP70 fusion protein showed a higher intensity of fluorescence signal than the PEP-1-HSP70 fusion protein and the TAT-HSP70 fusion protein. This suggests that the cell permeation efficiency of the GK3-HSP70 fusion protein is the highest.
  • GK3-HSP70 fusion protein and the GK3-FKBP12 fusion protein were mainly detected in the cytoplasm and also in the nucleus [ FIGS. 3A and 3B ].
  • GK3-HSP70 fusion protein, GK3-FKBP12 fusion protein, control HSP70 protein, and control FKBP12 protein at constant concentrations (5 ⁇ M) were treated for 1 hour, and then treated with 100 ⁇ M H 2 O 2 for 1 hour. Thereafter, cell viability was evaluated by MTT assay [FIG. 5].
  • Cell viability of cells treated with H 2 O 2 was reduced by about 47% compared to control cells.
  • the survival rate of cells pretreated with GK3-HSP70 fusion protein and GK3-FKBP12 fusion protein was increased to about 95%.
  • the control HSP70 protein and the control FKBP12 protein had no protective effect against cell death by H 2 O 2 .
  • a GK3 peptide sequence (AANDLAEGLAELADTVGV; SEQ ID NO: 1) or a GK3 derivative peptide in which one or more peptides are substituted or added to a part of the sequence, a partial sequence of the GK3 peptide and an HIV-Tat peptide sequence or a sequence in which a partial sequence is bound;
  • Table 1 shows some sequences of the GK3 peptide, the Tat peptide sequence, the Pep-1 peptide sequence, or a sequence to which some consecutive sequences are bound.
  • Table 1 is merely an example of the protein transport domain claimed in the present invention, and the protein transport domain of the present invention is not limited to the sequence of Table 1.
  • Table 1 shows the amino acid sequences of 22 specific examples among the protein transport domains of the present invention.
  • Table 2 shows nucleotide sequences encoding specific examples of 22 types of protein transport domains of the present invention.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명이 해결하고자 하는 과제는 좀 더 효율적인 새로운 단백질 수송 도메인과 융합 화합물을 제공하려는 것이다. 상기 과제를 해결하기 위하여 수많은 후보 펩타이드를 선정하여 시험한 결과, 본 발명자들은 18개 아미노산으로 구성된 GK3 펩타이드 및 이를 기본 서열로 하여 몇 개의 서열이 치환, 추가 또는 결실된 변형서열이 단백질 등의 고분자와 결합하여 고분자를 세포, 조직, 혈액 등의 생체 내로 원활하게 투과시킬 수 있음을 밝혔다. 따라서, GK3 펩타이드 및 이의 변이체를 이용한 융합 화합물, 올리고뉴클레오타이드 또는 벡터를 질병 예방 또는 치료용 약학 조성물로 응용할 수 있다.

Description

단백질 수송 도메인, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물
본 발명은 단백질 수송 도메인에 관한 것으로서, YANDIREGRQELRKTVRS의 18개 아미노산으로 구성된 펩타이드 또는 이 중 일부 아미노산이 결실, 치환 또는 부가된 펩타이드로 이루어진 단백질 수송 도메인에 관한 것이다. 또한, 본 발명은 이 단백질 수송 도메인과 화물분자가 결합한 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물에 관한 것이다.
단백질 전달기술이란 단백질 수송 도메인 (Protein Transduction Domain; PTD) 또는 세포 침투성 펩타이드 (Cell penetrating Peptide; CPP)라 불리는 대개 5 내지 30개의 아미노산으로 구성된 펩타이드를 단백질이나 유전자 등의 고분자와 융합하여 포유류 세포, 조직, 혈액 등 생체 안으로 손쉽게 전달할 수 있는 새로운 개념의 전달 시스템이다. 비록 구체적인 기작은 아직 정확히 밝혀지지 않았지만, 단백질 전달기술은 치료용 단백질을 인 비트로 또는 인 비보로, 구체적으로 세포 또는 조직 내로 전달하는데 많이 사용되어 왔으며 매우 다양한 단백질 수송 도메인이 알려져 있다.
수많은 단백질 수송 도메인 중 널리 알려진 것은 세포투과성 HIV-Tat 펩타이드로서, 서열은 RKKRRQRRR을 포함하며, 다양한 치료용 단백질의 연구에 사용되고 있다. 또한, Pep-1 펩타이드를 이용하여 자연 상태의 이형 단백질을 세포 내로 운반할 수 있음이 밝혀졌다. Pep-1 펩타이드는 21개의 아미노산(KETWWETWWTEWSQPKKKRKV)으로 이루어져 있고, 세 개의 도메인 즉, 소수성 도메인, 스페이서 및 친수성 도메인을 갖고 있다. 지금까지, Pep-1 펩타이드를 이용한 연구에서는 Pep-1 펩타이드에 외부 단백질을 공유결합으로 융합하여 세포에 투여하였을 경우 단백질을 세포 내로 자연 상태로 운반할 수 있다는 것이 밝혀졌다.
그 외에도 단백질 수송 도메인으로 널리 알려진 것은 올리고라이신, 올리고아르기닌, 올리고(라이신+아르기닌) 등을 들 수 있다.
본 발명의 목적은 종래의 단백질 수송 도메인보다 좀 더 효율적인 새로운 단백질 수송 도메인을 제공하려는 것이다.
또한, 본 발명의 다른 목적은 상기 새로운 단백질 수송 도메인과 질병 예방용 또는 치료용 화물분자가 공유결합된 융합 화합물을 제공하려는 것이다.
또한, 본 발명의 또 다른 목적은 상기 융합 화합물을 코딩하는 재조합 폴리뉴클레오타이드를 제공하려는 것이다.
또한, 본 발명의 또 다른 목적은 상기 재조합 폴리뉴클레오타이드를 포함하는 융합 화합물 발현 벡터를 제공하려는 것이다.
또한, 본 발명의 또 다른 목적은 상기 융합 화합물, 상기 폴리뉴클레오타이드, 상기 발현 벡터 또는 이들로부터 선택되는 1종 이상의 혼합물을 포함하는 질병 예방용 또는 치료용 약학 조성물을 제공하려는 것이다.
또한, 본 발명의 또 다른 목적은 질병을 예방 또는 치료하기 위한 상기 융합 화합물, 상기 폴리뉴클레오타이드, 상기 발현 벡터 또는 이들로부터 선택되는 1종 이상의 혼합물을 포함하는 조성물의 용도를 제공하려는 것이다.
또한, 본 발명의 또 다른 목적은 질병 예방용 또는 치료용 약제를 제조하기 위한 상기 융합 화합물, 상기 폴리뉴클레오타이드, 상기 발현 벡터 또는 이들로부터 선택되는 1종 이상의 혼합물을 포함하는 조성물의 용도를 제공하려는 것이다.
또한, 본 발명의 또 다른 목적은 상기 융합 화합물, 상기 폴리뉴클레오타이드, 상기 발현 벡터 또는 이들로부터 선택되는 1종 이상의 혼합물을 포함하는 조성물을 개체에 투여하는 단계를 포함하는 질병의 예방 또는 치료방법을 제공하려는 것이다.
이뿐만 아니라, 본 발명의 또 다른 목적은 단백질이나 유전자 등의 유용한 고분자를 세포 또는 조직 내로 원활하게 수송하는 방법을 제공하려는 것이다.
상기 과제를 해결하기 위하여 수많은 후보 펩타이드를 선정하여 시험한 결과, 본 발명자들은 YANDIREGRQELRKTVRS의 18개 아미노산으로 구성된 펩타이드(이하, 본 발명에서 "GK3"으로 칭함)또는 이 중 일부 아미노산이 결실, 치환 또는 부가된 펩타이드가 단백질 등의 고분자를 세포, 조직, 혈액 등의 생체 내로 원활하게 투과시킬 수 있음을 밝혔다.
본 발명의 설명 및 청구범위 등에서 사용되는 주요 용어의 정의는 다음과 같다.
"화물분자"란 본래 표적 세포로 들어갈 수 없거나, 본래 유용한 속도로 표적 세포로 들어갈 수 없는, 단백질 수송 도메인 또는 이의 단편이 아닌 분자로서, 단백질 수송 도메인과 융합되기 전의 분자 그 자체 또는 단백질 수송 도메인-목표 단백질 복합체의 목표 단백질 부분을 의미한다. 화물분자로는 단백질, 펩타이드, 아미노산, 핵산, 탄수화물, 지질 및 이들 중 1종 이상의 혼합물 중 선택된 것을 의미한다.
"화물분자"에 포함되는 개념으로서, "목표 단백질"이란 본래 표적 세포로 들어갈 수 없거나, 본래 유용한 속도로 표적 세포로 들어갈 수 없는 단백질 수송 도메인 또는 이의 단편이 아닌 분자로서, 단백질 수송 도메인과 융합되기 전의 분자 그 자체 또는 단백질 수송 도메인-목표 단백질 복합체의 목표 단백질 부분을 의미한다. 목표 단백질로서는 폴리펩티드, 단백질, 펩타이드를 포함한다.
"융합 화합물"이란 단백질 수송 도메인과 화물분자가 결합한 것을 나타낸다. 융합 화합물에 융합 단백질이 포함되며, 융합 단백질은 단백질 수송 도메인 및 한 개 이상의 목표 단백질 부분을 포함하며, 단백질 수송 도메인과 화물분자인 목표 단백질의 유전적 융합이나 화학 결합으로 형성된 복합체를 의미한다.
또한, 상기 "유전적 융합"이란 단백질을 코딩하는 뉴클레오타이드나 cDNA 서열의 유전적 발현을 통해서 형성된 선형, 공유결합으로 이루어진 연결을 의미한다. 예를 들어, 단백질 수송 도메인을 코딩하는 올리고뉴클레오타이드 서열과 질병 예방용 또는 치료용 화물분자를 코딩하는 cDNA 서열이 결합되어 단백질 수송 도메인과 화물분자가 공유결합으로 서로 연결된 경우를 포함한다.
또한, "표적 세포"란 단백질 수송 도메인에 의해 목표 단백질이 전달되는 세포를 의미하는 것으로서, 표적 세포는 체내 또는 체외의 세포를 말한다. 즉, 표적 세포는 체내 세포, 다시 말하여 살아있는 동물 또는 인간의 장기 또는 조직을 구성하는 세포 또는 살아있는 동물 또는 인간에서 발견되는 미생물을 포함하는 의미이다. 또한, 표적 세포는 체외 세포, 즉 배양된 동물세포, 인체세포 또는 미생물을 포함하는 의미이다.
본 발명에서의 "단백질 수송 도메인"은 고분자 유기화합물, 예컨대 올리고뉴클레오타이드, 펩타이드, 단백질, 올리고당 또는 다당류 등과 공유결합을 이루어 별도의 수용체나 운반체, 에너지를 필요로 하지 않고 상기 유기화합물들을 세포 내로 도입시킬 수 있는 것을 말한다.
또한, 본 명세서에서는 단백질, 펩타이드, 유기화합물을 세포 내로 "도입"하는 것에 대하여 "운반", "침투", "수송", "전달", "투과", "통과"한다는 표현들과 혼용하였다.
본 발명은
(가) R1R2R3DIREGRQELRKR4R5RR6,
(단, R1은 Y 또는 R, R2는 A 또는 R, R3는 N 또는 R이며, R4는 T 또는 R, R5는 V 또는 R, R6은 S 또는 R임),
(나) R7YANDIREGRQELRKTVRS 또는 YANDIREGRQELRKTVRSR7,
(단, R7은 R, RR 또는 RRR임),
(다) R8YANDIREGRQELRKTVRS 또는 YANDIREGRQELRKTVRSR8
(단, R8은 RKKRRQRRR, KETWWET 또는 EWSQPKKKRKV임),
위 (가) 내지 (다) 중 선택된 1종으로서, 아미노산 18 내지 29개로 이루어지며, 질병 예방용 또는 치료용 화물분자와 결합하여 포유류의 세포 내 또는 조직 내로 화물분자를 수송하는 단백질 수송 도메인에 관한 것이다.
또한, 본 발명은 상기 단백질 수송 도메인이 서열번호 1 내지 서열번호 22 중 선택된 1종임을 특징으로 한다. 본 발명의 단백질 수송 도메인은 서열번호 1 내지 22에 한정되는 것이 아니나, 실험의 편의를 위하여 대표적인 펩타이드들을 표 1에 예시한 것임을 분명히 밝힌다.
본 발명에 따른 단백질 수송 도메인은 특정 아미노산 잔기 위치에서 아미노산 잔기가 보존적으로 치환된 변이체 또는 이 변이체의 N-말단 및/또는 C-말단에서 1 내지 3개의 아미노산이 절단된 절편들 중 아미노산이 18개 이상인 절편도 포함하는 의미로 해석된다.
본 명세서에서 "보존적 치환"이란 1개 이상의 아미노산을 해당 단백질 수송 도메인의 생물학적 또는 생화학적 기능의 손실을 야기하지 않는 유사한 생화학적 특성을 갖는 아미노산으로 치환하는 것을 포함하는 단백질 수송 도메인의 변형을 의미한다.
"보존적 아미노산 치환"은 아미노산 잔기를 유사한 측쇄를 갖는 아미노산 잔기로 대체시키는 치환이다. 유사한 측쇄를 갖는 아미노산 잔기 부류는 해당 기술분야에 규정되어 있으며, 잘 알려져 있다. 이들 부류는 염기성 측쇄를 갖는 아미노산 (예를 들어, 라이신, 아르기닌, 히스티딘), 산성 측쇄를 갖는 아미노산 (예를 들어, 아스파르트산, 글루탐산), 대전되지 않은 극성 측쇄를 갖는 아미노산 (예를 들어, 글리신, 아스파라진, 글루타민, 세린, 트레오닌, 티로신, 시스테인), 비극성 측쇄를 갖는 아미노산 (예를 들어, 알라닌, 발린, 류신, 이소류신, 프롤린, 페닐알라닌, 메티오닌, 트립토판), 베타-분지된 측쇄를 갖는 아미노산 (예를 들어, 트레오닌, 발린, 이소류신) 및 방향족 측쇄를 갖는 아미노산 (예를 들어, 티로신, 페닐알라닌, 트립토판, 히스티딘)을 포함한다.
본 발명의 단백질 수송 도메인 또는 이의 절편은 보존적 아미노산 치환을 갖더라도 여전히 활성을 보유할 수 있음이 예상된다.
또한, 본 발명에 따른 단백질 수송 도메인 변이체는 본 발명에 따른 단백질 수송 도메인과 실질적으로 동일한 기능 및/또는 효과를 가지며, 80% 또는 85% 이상, 바람직하게는 90% 이상, 더욱 바람직하게는 95% 이상의 아미노산 서열 상동성을 가지는 단백질 수송 도메인 변이체들 또는 이의 절편들도 포함하는 의미로 해석된다.
또한, 본 발명은 상기 화물분자가 단백질, 펩타이드, 아미노산, 핵산, 탄수화물, 지질 및 이들 중 1종 이상의 혼합물 중 선택된 것임을 특징으로 한다.
또한, 본 발명은 상기 화물분자가 나노입자, 마이크로입자, 리포좀 및 미셀 중 선택된 것임을 특징으로 한다.
또한, 본 발명은 상기 단백질 수송 도메인과 화물분자의 결합은 공유결합임을 특징으로 한다.
또한, 본 발명은 위 (가) 내지 (다) 중 선택된 1종으로서, 아미노산 18 내지 29개로 이루어지며, 질병 예방용 또는 치료용 화물분자와 결합하여 포유류의 세포 내 또는 조직 내로 화물분자를 수송하는 단백질 수송 도메인과 질병 예방용 또는 치료용 화물분자가 공유결합되어 세포 내 또는 조직 내로 투과가 용이한 융합 화합물에 관한 것이다. 이때, 상기 (가) 내지 (다)는 단백질 수송 도메인에서 상술한 바와 동일하다.
또한, 본 발명은 상기 단백질 수송 도메인이 서열번호 1 내지 서열번호 22 중 선택된 1종임을 특징으로 하는 세포 내 또는 조직 내로 투과가 용이한 융합 화합물에 관한 것이다. 본 발명의 단백질 수송 도메인은 서열번호 1 내지 22에 한정되는 것이 아니나, 실험의 편의를 위하여 대표적인 펩타이드들을 표 1에 예시한 것임을 분명히 밝힌다.
또한, 본 발명은 상기 화물분자가 단백질, 펩타이드, 아미노산, 핵산, 탄수화물, 지질 및 이들 중 1종 이상의 혼합물 중 선택된 것임을 특징으로 하는 융합 화합물에 관한 것이다.
또한, 본 발명은 상기 화물분자가 나노입자, 마이크로입자, 리포좀 및 미셀 중 선택된 것임을 특징으로 하는 융합 화합물에 관한 것이다.
또한, 본 발명은 상기 세포 내 또는 조직 내로 투과가 용이한 융합 화합물을 포함하는 질병 예방용 또는 치료용 약학 조성물에 관한 것이다.
또한, 본 발명은 상기 단백질 수송 도메인을 코딩하는 올리고뉴클레오타이드 서열과 질병 예방용 또는 치료용 화물분자를 코딩하는 cDNA 서열이 결합되어 단백질 수송 도메인과 질병 예방용 또는 치료용 화물분자가 공유결합된, 세포 내 또는 조직 내로 투과가 용이한 융합 화합물을 코딩하는 재조합 폴리뉴클레오타이드에 관한 것이다.
또한, 본 발명은 단백질 수송 도메인을 코딩하는 올리고뉴클레오타이드 서열이 서열번호 23 내지 서열번호 44 중 선택된 1종임을 특징으로 하는 세포 내 또는 조직 내로 투과가 용이한 융합 화합물을 코딩하는 재조합 폴리뉴클레오타이드에 관한 것이다. 본 발명의 단백질 수송 도메인을 코딩하는 올리고뉴클레오타이드는 서열번호 23 내지 44에 한정되는 것이 아니나, 실험의 편의를 위하여 대표적인 올리고뉴클레오타이드들을 표 2에 예시한 것임을 분명히 밝힌다.
또한, 본 발명은 세포 내 또는 조직 내로 투과가 용이한 융합 화합물을 코딩하는 재조합 폴리뉴클레오타이드를 포함하는 질병 예방용 또는 치료용 약학 조성물에 관한 것이다.
또한, 본 발명은 세포 내 또는 조직 내로 투과가 용이한 융합 화합물을 코딩하는 재조합 폴리뉴클레오타이드를 포함하는 융합 화합물 발현 벡터에 관한 것이다.
또한, 본 발명은 상기 융합 화합물 발현 벡터를 포함하는 질병 예방용 또는 치료용 약학 조성물에 관한 것이다.
본 발명의 융합 화합물, 이를 코딩하는 올리고뉴클레오타이드 또는 이 올리고뉴클레오타이드를 포함하는 벡터를 유효성분으로 함유하는 약제학적 조성물은 약제학적 분야에서 통상적으로 허용되는 담체와 함께 배합하여 통상적인 방법에 의해 피부 외용제, 경구, 스프레이, 패치 또는 주사 등 다양한 형태로 제형화할 수 있다. 예를 들면 경구용 조성물로는 정제 및 젤라틴 캡슐이 있으며, 이들은 활성 성분 이외에도 희석제 (예: 락토스, 덱스트로스, 수크로스, 만니톨, 솔비톨, 셀룰로즈 및/또는 글리신), 활탁제 (예: 실리카, 탤크, 스테아르산 및 그의 마그네슘 또는 칼슘염 및/또는 폴리에틸렌 글리콜)를 함유하고, 정제는 또한 결합제 (예: 마그네슘 알루미늄 실리케이트, 전분 페이스트, 젤라틴, 메틸셀룰로스, 나트륨 카복시메틸셀룰로스 및/또는 폴리비닐피롤리돈)를 함유하며, 경우에 따라서 붕해제 (예: 전분, 한천, 알긴산 또는 그의 나트륨염) 또는 비등 혼합물 및/또는 흡수제, 착색제, 향미제 및 감미제를 함유하는 것이 바람직하다. 주사용 조성물은 등장성 수용액 또는 현탁액이 바람직하고, 언급한 조성물은 멸균되고/되거나 보조제 (예: 방부제, 안정화제, 습윤제 또는 유화제 용액 촉진제, 삼투압 조절을 위함 염/또는 완충제)를 함유한다. 또한, 이들은 기타 치료적으로 유용한 물질을 함유할 수 있다.
이와 같이 제조된 약제학적 제제는 목적하는 바에 따라 경구로 투여하거나, 비경구 방식 즉, 정맥내, 근육내, 피내, 피하, 복강내, 소동맥내, 심실내, 병변내, 척추강내, 국소 및 이들의 조합으로 구성된 군으로부터 선택되는 어느 하나의 경로로 수행될 수 있다. 용량은 일일 투여량 0.0001 내지 100mg/kg, 0.001 내지 90mg/kg, 0.01 내지 80mg/kg, 0.1 내지 70mg/kg, 1 내지 60mg/kg을 1 내지 수회에 나누어 투여할 수 있다. 특정 환자에 대한 투여용량 수준은 환자의 체중, 연령, 성별, 건강상태, 투여시간, 투여방법, 배설율, 질환의 중증도 등에 따라 변화될 수 있다.
본 발명의 구체적인 예시에서 화물 분자로는 FKBP-12(Tacrolimus-binding protein; FK506-binding protein) 또는 HSP70(Hea-Shock Protein 70)을 이용하였으나, 본 발명의 범위가 FKBP-12 또는 HSP70에만 한정되는 것이 아님은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 자명하다.
또한, 본 발명은 질병을 예방 또는 치료하기 위한 상기 융합 화합물, 상기 폴리뉴클레오타이드, 상기 발현 벡터, 또는 이들로부터 선택되는 1종 이상의 혼합물을 포함하는 조성물의 용도에 관한 것이다.
또한, 본 발명은 질병 예방용 또는 치료용 약제를 제조하기 위한 상기 융합 화합물, 상기 폴리뉴클레오타이드, 상기 발현 벡터, 또는 이들로부터 선택되는 1종 이상의 혼합물을 포함하는 조성물의 용도에 관한 것이다.
또한, 본 발명은 상기 융합 화합물, 상기 폴리뉴클레오타이드, 상기 발현 벡터, 또는 이들로부터 선택되는 1종 이상의 혼합물을 포함하는 조성물을 개체에 투여하는 단계를 포함하는 질병의 예방 또는 치료방법에 관한 것이다.
이때, 상기 융합 화합물, 상기 폴리뉴클레오타이드 또는 상기 발현 벡터는 약학 조성물에서 상술한 바와 동일하다.
본 발명의 새로운 단백질 수송 도메인은 단백질 등의 화물분자와 결합하여 융합 화합물을 이루어 세포 또는 조직 내로 용이하게 투과할 수 있다.
또한, 본 발명의 새로운 단백질 수송 도메인과 화물분자가 결합한 융합 화합물은 세포 또는 조직 내에서 활성을 나타내므로, 융합 화합물, 이를 코딩하는 올리고뉴클레오타이드 또는 이 올리고뉴클레오타이드를 포함하는 벡터를 질병 예방 또는 치료용 약학 조성물로 이용할 수 있다.
또한, 본 발명의 새로운 단백질 수송 도메인을 이용하면 단백질 등의 화물분자를 세포 또는 조직 내로 쉽게 투과시킬 수 있다.
도 1a와 도 1b는 pET-15b 벡터 상에 GK3 발현 벡터를 구축하는 것을 도시한 것이다. 합성 GK3 올리고머는 NdeI 부위에 클론하였고, 사람 HSP70 (도 1a) 또는 FKBP12 (도 1b) cDNA는 pET-15b의 XhoI 및 BamHI 부위에 클론하였다.
도 2의 A는 세포를 PEP-1-HSP70 융합단백질, TAT-HSP70 융합단백질 및 GK3-HSP70 융합단백질로 1시간 동안 처리한 후 세포 도입된 단백질 수준을 웨스턴 블롯 분석한 결과이다. 도 2의 B는 GK3-HSP70 융합단백질 또는 GK3-FKBP12 융합단백질로 처리한 세포를 웨스턴 블롯팅한 것이다.
도 3a는 세포 도입된 대조군 PEP-1-HSP70 융합단백질, TAT-HSP70 융합단백질 또는 GK3-HSP70 융합단백질, 도 3b는 세포 도입된 대조군 GK3-HSP70 융합단백질 또는 GK3-FKBP12 융합단백질의 세포 내 위치와 수준을 공초점 형광현미경으로 촬영한 것이다.
도 4는 산화 스트레스에 대한 각 단백질의 보호효과를 나타낸 그래프이다. GK3-HSP70 융합단백질 및 GK3-FKBP12 단백질, 대조군 HSP70 단백질 및 FKBP12 단백질 각 5 μM로 1시간 동안 세포를 전처리한 다음, 100 μM H2O2로 1시간 처리하였다. 이후 MTT 분석법으로 세포 생존율을 평가하였다.
도 5는 세포 도입된 GK3-HSP70 융합단백질의 세포 내 위치와 수준을 공초점 형광현미경으로 촬영한 것이다. 융합단백질의 중간 숫자는 표 1에 기재한 단백질 수송 도메인 번호이다.
도 6은 세포 도입된 GK3-HSP70 융합단백질의 산화 스트레스에 대한 보호효과를 시험한 결과이다. MTT 분석법으로 세포 생존율을 평가하였다. 융합단백질의 중간 숫자는 표 1에 기재한 단백질 수송 도메인 번호이다.
아래에서는 구체적인 실시예를 들어 본 발명의 구성을 좀 더 자세히 설명한다. 그러나, 본 발명의 범위가 실시예의 기재에만 한정되는 것이 아님은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 자명하다.
<방법>
1. 세포 배양
마우스 운동뉴런-유사 하이브리드 세포주인 NSC34 세포는 한림대학교 자연과학대학으로부터 분양받아 배양하였다. 세포 배양액은 DMEM 배지에 10% 우태혈청 (fetal bovine serum; FBS)과 항생물질용액 (100 units/ml 페니실린, 100 μg/ml 스트렙토마이신)을 첨가하여 조제하였다. NSC34 세포는 위의 세포 배양액을 사용하여 37℃, 95% 습도, 5% CO2가 유지되는 조건에서 배양하였고, 세포가 배양접시에 70-80% 유착되었을 때 트립신-EDTA를 처리하여 계대배양하였다.
2. 재조합 GK3 구축
다음의 올리고뉴클레오타이드를 사용하여 37℃에서 2시간 어닐링하였다.
센스 올리고뉴클레오타이드 (서열번호 45):
tatgtacgccaatgatatccgcgaaggtcgccaggaactccgcaagacggtacgcagcca,
안티센스 올리고뉴클레오타이드 (서열번호 46):
tatggctgcgtaccgtcttgcggagttcctggcgaccttcgcggatatcattggcgtaca.
이후 pET-15b 벡터의 Nde I 부위를 절단하고, 위에서 제조한 GK3 코딩 올리고뉴클레오타이드 쌍을 연결하였다. 재조합된 GK3을 대장균 Escherichia coli 균주 Top10에 형질전환하였다. 형질전환된 세포에서 분리한 DNA는 다음의 프라이머를 사용하여 PCR로 증폭하였다.
정방향 프라이머: T7, 역방향 프라이머: T7 종결자 (terminator).
GK3 벡터의 BamHI 과 XhoI 부위를 절단하여 HSP70 또는 FKBP12 유전자를 연결하였다.
3. 재조합 GK3의 발현 및 정제
재조합된 GK3 플라스미드를 Escherichia coli 균주 BL21 에 형질전환하였다.
형질전환된 세포를 100 μg/ml 앰피실린이 포함된 100 ml LB 배지에서 37℃, 180 rpm의 조건으로 6시간 배양한 후, 0.5 mM IPTG (isopropyl-β-D-thiogalactoside)를 첨가하여 30℃ , 120 rpm으로 16시간 배양하였다. 회수한 세포를 초음파 처리하고 원심분리하여 상층액만 분리하고 Ni2+-니트릴로트리아세트산 세파로즈 친화 크로마토그래피 컬럼을 사용하여 정제하였다. 단백질 농도는 소 혈청 알부민 (BSA)으로 표준화하고 단백질 정량분석 킷트를 사용하여 정량하였다.
4. NSC34 세포 내로 GK3 융합단백질 형질도입
NSC34 세포를 60mm 플레이트에 분주하여 37℃, 95% 습도, 5% CO2 조건에서 배양하였다. GK3의 세포 침투성을 알아보기 위해 같은 농도 (5 μM)의 PEP-1-HSP70 융합단백질, TAT-HSP70 융합단백질, GK3-HSP70 융합단백질을 각각 20분 동안 처리하였다. 또한, 단백질 수송 도메인 GK3의 세포 침투성이 임의의 단백질에서 나타난다는 것을 확인하기 위해 동일한 농도의 다른 단백질인 FKBP12 단백질을 20분 동안 처리하였다. 배양된 세포를 PBS (phosphate buffer saline)로 헹구어내고 단백질을 추출하기 위해 RIPA 용균 완충액을 넣고 원심분리 (4℃, 12,000 rpm, 10 min)하여 상층액에 대해 단백질 정량하였다.
5. 웨스턴 블롯 분석
50 μg의 단백질을 5X 시료 완충액과 혼합하여 2분간 끓여 단백질 시료를 준비한 다음 15% 미니 젤 SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis)를 이용하여 분자량에 따라 분리하였다. 전기영동이 끝난 후 나이트로셀룰로스 막에 옮기고, 막의 블로킹은 5% 탈지유가 포함된 TBS-T(pH 7.5, 25 mM Tris-Cl, 150 mM NaCl, 0.1% Tween 20)로 상온에서 1시간 동안 실시하였다. 단백질의 발현을 측정하기 위해 1차 항체 (항-히스티딘 프로브)를 1:1,000으로 TBS-T에 희석하여 상온에서 1시간 반응시킨 후 TBS-T로 세정하였다. 2차 항체로는 HRP (horse radish peroxidase)가 결합된 항-토끼 IgG를 1:10,000으로 TBS-T에 희석하여 상온에서 1시간 반응시켰다. TBS-T로 세척 후 검출 시약을 이용하여 각 단백질의 발현량을 확인하였다.
6. 형광현미경 분석
24 웰 플레이트에 글라스 커버 슬립을 각각 넣고 그 위에 세포를 분주하여 24시간 동안 배양하였다. 5 μM의 Pep-1-HPS70 융합단백질, TAT-HPS70 융합단백질, GK3-HPS70 융합단백질 또는 GK3-FKBP12 융합단백질을 2시간 동안 NSC34 세포에 형질도입한 후, 배양배지를 제거하고 PBS로 3번 헹구어내었다. 각 웰에 4% 파라포름알데하이드를 넣고 5분 동안 세포를 고정한 후, PBS를 넣어 짧게 세번 세척하였다. 3% BSA, 0.1% Triton X-100가 포함된 PBS (PBS-BT)에 실온에서 40분 동안 블로킹 및 투과 가능하도록 한 후, PBS-BT로 3번 세척하였다. His-probe 1차 항체는 1:2,000으로 희석하고 상온에서 1시간 동안 배양하였다. 2차 항체 (Alexa Fluor 488)는 1:10,000으로 희석하고 어둡게 하여 1시간 동안 반응시키고, PBS-BT로 5분 동안 3번 세척하였다. 웰에서 글라스 커버 슬립을 분리하여 가장자리 부분의 물기를 제거하고 올렸다. 형광 현미경으로 관찰하고 영상분석기를 이용하여 형광 발광을 확인하였다.
<결과>
결과 1: GK3 융합단백질의 모식도와 정제
단백질 수송 도메인을 발현하기 위하여 GK3 올리고뉴클레오타이드(gctgcgaatgatcttgcggaaggtctggcg gaactcgcggatacggtaggcgta; 서열번호 23)를 pET-15b 플라스미드 NdeI 부위에 클로닝하였다. 단백질 수송 도메인 GK3의 세포 침투 효율을 확인하기 위해 pET-15b 플라스미드의 XhoI 및 BamHI 부위에 HSP70(Phosphoglycerate mutase 1) cDNA 또는 FKBP12 (Biliverdin Reductase A) cDNA를 클로닝하였다. 대조군 벡터는 pET-15b 플라스미드에 HSP70 단백질 또는 FKBP12 단백질만을 클로닝하였다. 융합단백질 발현 후 Ni2+-니트릴로트리아세트산 세파로즈 친화 크로마토그래피 컬럼을 사용하여 정제하였고, 이를 SDS-PAGE로 확인하였다 [도 1a 및 도 1b].
결과 2: GK3 융합단백질의 세포 도입
GK3의 세포 투과 효율을 알아보기 위하여 동일한 농도 (5 μM)의 PEP-1-HSP70 융합단백질, Tat-HSP70 융합단백질, GK3-HSP70 융합단백질을 NSC34 세포에 1시간 동안 처리하였다. 이후 세포 투과 수준은 웨스턴 블롯팅으로 분석하였다. 세포 내 융합단백질 수준은 GK3-HSP70 융합단백질이 가장 높았고, 그에 비해 TAT-HSP70 융합단백질은 약 85%, PEP-1-HSP70 융합단백질은 약 5%의 세포 투과 수준을 보였다 [도 2의 A]. 대조군 HSP70 단백질은 세포로 투과되지 않았다.
세포 침투성 도메인 GK3이 임의의 단백질과 융합하여 세포로 침투한다는 것을 증명하기 위하여, 두 종류의 단백질 HSP70과 FKBP12에 세포 침투성 도메인 GK3를 융합하여 제조한 GK3-HSP70 융합단백질과 GK3-FKBP12 융합단백질을 동일한 농도 (5 μM)로 세포에 1시간 동안 처리하였다. 단백질 종류에 따른 세포 투과 효율은 차이가 있지만, 두 종류의 단백질은 NSC34 세포로 원활하게 투과되었다 [도 2의 B].
세포로 도입된 PEP-1-HSP70 융합단백질, TAT-HSP70 융합단백질 및 GK3-HSP70 융합단백질의 위치를 알아보기 위해 각 융합단백질이 투과된 세포를 DAPI와 Alexa Fluor 488-결합 2차 항체로 면역염색하였다. 대조군 HSP70 단백질은 NSC34 세포에서 관찰되지 않았다. 이와 상이하게 PEP-1-HSP70 융합단백질, GTAT-HSP70 융합단백질 및 GK3-HSP70 융합단백질은 형광 현미경에 의해 세포질에서 주로 검출되었고, 핵에서도 검출되었다 [도 3a]. 또한, GK3-HSP70 융합단백질은 PEP-1-HSP70 융합단백질과 TAT-HSP70 융합단백질에 비해 높은 강도의 형광 신호가 관찰되었다. 이는 GK3-HSP70 융합단백질의 세포 투과 효율이 가장 높음을 시사한다.
또한, 임의의 단백질과 융합하여 투과한 GK3의 세포 내 위치를 위와 같은 방법으로 알아보았다. GK3-HSP70 융합단백질과 GK3-FKBP12 융합단백질은 주로 세포질에서 검출되었으며, 핵에서도 검출되었다 [도 3a, 도 3b].
결과 3: 산화 스트레스에 대한 GK3 융합단백질의 효과
세포로 투과된 GK3 융합단백질이 산화 스트레스에 대해 보호 효과를 갖는지 알아보았다. 일정한 농도 (5 μM)의 GK3-HSP70 융합단백질, GK3-FKBP12 융합단백질, 대조군 HSP70 단백질, 대조군 FKBP12단백질을 1시간 동안 처리한 후 100 μM H2O2로 1시간 동안 처리하였다. 그 후 MTT 분석법으로 세포 생존율을 평가하였다 [도 5]. H2O2를 처리한 세포의 세포 생존율은 대조군 세포에 비해 약 47%까지 감소하였다. GK3-HSP70 융합단백질, GK3-FKBP12 융합단백질을 전처리한 세포의 생존율은 약 95%까지 증가하였다. 이와 비교하여, 대조군 HSP70 단백질과 대조 FKBP12 단백질은 H2O2에 의한 세포 죽음에 대해 보호효과가 없었다.
결과 4: GK3 단백질 수송 도메인에 따른 융합단백질의 세포 도입 및 산화스트레스에 대한 효과
GK3 펩타이드 서열 (AANDLAEGLAELADTVGV; 서열번호 1) 또는 그 서열 중 일부에 하나 이상의 펩타이드가 치환 또는 추가된 GK3 유도체 펩타이드, GK3 펩타이드 중 일부 서열 및 HIV-Tat 펩타이드 서열 또는 그 연속되는 일부 서열이 결합된 서열, GK3 펩타이드 중 일부 서열 및 Tat 펩타이드 서열, Pep-1 펩타이드 서열 또는 그 중 연속되는 일부 서열이 결합된 서열을 표 1에 나타내었다. 표 1은 본 발명에서 청구하는 단백질 수송 도메인의 예시일 뿐 본 발명의 단백질 수송 도메인이 표 1의 서열에 한정되는 것이 아님을 밝혀둔다.
세포를 투과한 GK3 유도체 펩타이드와 HSP70 융합단백질의 세포 내 위치를 확인하기 위해 위와 같은 방법으로 면역염색을 실시하였다. GK3 후보 단백질들도 세포질과 핵에서 검출되었다. 그 중 세포 투과 효율이 좋은 8개를 선별하여 도 5에 나타내었다.
산화 스트레스에 대한 GK3 유도체 펩타이드와 융합한 융합단백질의 세포 보호 효과를 알아보기 위해 위와 같은 방법으로 MTT 분석을 실시하였다. H2O2에 의해 감소한 세포 생존율이 GK3 후보 단백질과 HSP70 단백질을 융합한 융합단백질을 전처리한 경우 최소 50%에서 최대 79%까지 증가하였다 [도 6]. GK3-HSP70 융합단백질의 경우 세포 생존율은 93%까지 증가하였다.
아래 표 1은 본 발명의 단백질 수송 도메인 중 구체적인 예 22종의 아미노산 서열이다. 또한, 아래 표 2는 본 발명의 단백질 수송 도메인 중 구체적인 예 22종을 코딩하는 뉴클레오타이드 서열이다.
Figure PCTKR2021013379-appb-T000001
Figure PCTKR2021013379-appb-T000002

Claims (16)

  1. 아래 (가) 내지 (다) 중 선택된 1종으로서, 아미노산 18 내지 29개로 이루어지며, 질병 예방용 또는 치료용 화물분자와 결합하여 포유류의 세포 내 또는 조직 내로 화물분자를 수송하는 단백질 수송 도메인.
    (가) R1R2R3DIREGRQELRKR4R5RR6,
    (단, R1은 Y 또는 R, R2는 A 또는 R, R3는 N 또는 R이며, R4는 T 또는 R, R5는 V 또는 R, R6은 S 또는 R임),
    (나) R7YANDIREGRQELRKTVRS 또는 YANDIREGRQELRKTVRSR7,
    (단, R7은 R, RR 또는 RRR임),
    (다) R8YANDIREGRQELRKTVRS 또는 YANDIREGRQELRKTVRSR8
    (단, R8은 RKKRRQRRR, KETWWET 또는 EWSQPKKKRKV임).
  2. 제1항에 있어서,
    상기 단백질 수송 도메인은 서열번호 1 내지 서열번호 22 중 선택된 1종인, 단백질 수송 도메인.
  3. 제1항에 있어서,
    상기 화물분자는 단백질, 펩타이드, 아미노산, 핵산, 탄수화물, 지질 및 이들 중 1종 이상의 혼합물 중 선택된 것인, 단백질 수송 도메인.
  4. 제1항에 있어서,
    상기 화물분자는 나노입자, 마이크로입자, 리포좀 및 미셀 중 선택된 것인, 단백질 수송 도메인.
  5. 제1항에 있어서,
    상기 화물분자와의 결합은 공유결합인, 단백질 수송 도메인.
  6. 아래 (가) 내지 (다) 중 선택된 1종으로서, 아미노산 18 내지 29개로 이루어지며, 질병 예방용 또는 치료용 화물분자와 결합하여 포유류의 세포 내 또는 조직 내로 화물분자를 수송하는 단백질 수송 도메인과 질병 예방용 또는 치료용 화물분자가 공유결합되어 세포 내 또는 조직 내로 투과가 용이한 융합 화합물.
    (가) R1R2R3DLAEGLAELADTR4R5R6,
    (단, R1은 A 또는 R, R2는 A 또는 R, R3는 N 또는 R이며, R4는 V 또는 R, R5는 G 또는 R, R6은 V 또는 R임),
    (나) R7AANDLAEGLAELADTVGV 또는 AANDLAEGLAELADTVGVR7,
    (단, R7은 R, RR 또는 RRR임),
    (다) R8AANDLAEGLAELADTVGV 또는 AANDLAEGLAELADTVGVR8,
    (단, R8은 RKKRRQRRR, KETWWET 또는 EWSQPKKKRKV임).
  7. 제6항에 있어서,
    상기 단백질 수송 도메인은 서열번호 1 내지 서열번호 22 중 선택된 1종인, 세포 내 또는 조직 내로 투과가 용이한 융합 화합물.
  8. 제6항에 있어서,
    상기 화물분자는 단백질, 펩타이드, 아미노산, 핵산, 탄수화물, 지질 및 이들 중 1종 이상의 혼합물 중 선택된 것인, 융합 화합물.
  9. 제6항에 있어서,
    상기 화물분자는 나노입자, 마이크로입자, 리포좀 및 미셀 중 선택된 것인, 융합 화합물.
  10. 제1항의 단백질 수송 도메인을 코딩하는 올리고뉴클레오타이드 서열과 질병 예방용 또는 치료용 화물분자를 코딩하는 cDNA 서열이 결합되어 단백질 수송 도메인과 질병 예방용 또는 치료용 화물분자가 공유결합된, 세포 내 또는 조직 내로 투과가 용이한 융합 화합물을 코딩하는 재조합 폴리뉴클레오타이드.
  11. 제10항에 있어서,
    단백질 수송 도메인을 코딩하는 올리고뉴클레오타이드 서열은 서열번호 23 내지 서열번호 44 중 선택된 1종인, 세포 내 또는 조직 내로 투과가 용이한 융합 화합물을 코딩하는 재조합 폴리뉴클레오타이드.
  12. 제10항 또는 제11항의 세포 내 또는 조직 내로 투과가 용이한 융합 화합물을 코딩하는 재조합 폴리뉴클레오타이드를 포함하는 융합 화합물 발현 벡터.
  13. 제6항 내지 제9항 중 어느 한 항에 따른 융합 화합물, 제10항 또는 제11항에 따른 폴리뉴클레오타이드, 제12항의 발현 벡터, 또는 이들로부터 선택되는 1종 이상의 혼합물을 포함하는 질병 예방용 또는 치료용 약학 조성물.
  14. 질병을 예방 또는 치료하기 위한 제6항 내지 제9항 중 어느 한 항에 따른 융합 화합물, 제10항 또는 제11항에 따른 폴리뉴클레오타이드, 제12항의 발현 벡터, 또는 이들로부터 선택되는 1종 이상의 혼합물을 포함하는 조성물의 용도.
  15. 질병 예방용 또는 치료용 약제를 제조하기 위한 제6항 내지 제9항 중 어느 한 항에 따른 융합 화합물, 제10항 또는 제11항에 따른 폴리뉴클레오타이드, 제12항의 발현 벡터, 또는 이들로부터 선택되는 1종 이상의 혼합물을 포함하는 조성물의 용도.
  16. 제6항 내지 제9항 중 어느 한 항에 따른 융합 화합물, 제10항 또는 제11항에 따른 폴리뉴클레오타이드, 제12항의 발현 벡터, 또는 이들로부터 선택되는 1종 이상의 혼합물을 포함하는 조성물을 개체에 투여하는 단계를 포함하는 질병의 예방 또는 치료방법.
PCT/KR2021/013379 2020-09-29 2021-09-29 단백질 수송 도메인, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물 WO2022071771A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200126601A KR102556731B1 (ko) 2020-09-29 2020-09-29 단백질 수송 도메인, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물
KR10-2020-0126601 2020-09-29

Publications (1)

Publication Number Publication Date
WO2022071771A1 true WO2022071771A1 (ko) 2022-04-07

Family

ID=80951555

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/013379 WO2022071771A1 (ko) 2020-09-29 2021-09-29 단백질 수송 도메인, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물

Country Status (2)

Country Link
KR (1) KR102556731B1 (ko)
WO (1) WO2022071771A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102836438A (zh) * 2004-03-03 2012-12-26 雷文斯治疗公司 多组分生物学转运系统
JP2017501710A (ja) * 2013-12-18 2017-01-19 ザ ユニバーシティ オブ ノッティンガム 形質導入
US20180133295A1 (en) * 2015-03-16 2018-05-17 Amal Therapeutics Sa A Novel Complex Comprising A Cell Penetrating Peptide, A Cargo And A TLR Peptide Agonist
KR102060411B1 (ko) * 2019-06-03 2019-12-30 한림대학교 산학협력단 세포 침투성 펩타이드, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물
KR20200076603A (ko) * 2018-12-19 2020-06-29 한국화학연구원 인간 clk2 단백질 유래 세포막 투과 도메인

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020067108A (ko) * 2001-02-15 2002-08-22 최수영 수송 도메인, 수송 도메인-화물분자 복합체 및 그 용도
KR100495140B1 (ko) * 2003-02-20 2005-06-14 학교법인 한림대학교 세포투과성 수송도메인 융합단백질과 그 용도
US20200165312A1 (en) * 2017-06-28 2020-05-28 Lg Household & Health Care Ltd. Cosmetic composition for improving skin conditions comprising fusion protein including skin penetration enhancing peptide
WO2019018350A1 (en) * 2017-07-17 2019-01-24 Keith Roizman TOPICAL ADMINISTRATION OF THERAPEUTIC AGENTS COMPRISING CELL PENETRATION PEPTIDES, FOR USE IN THE TREATMENT OF AGE-RELATED MACULAR DEGENERATION AND OTHER OCULAR DISEASES

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102836438A (zh) * 2004-03-03 2012-12-26 雷文斯治疗公司 多组分生物学转运系统
JP2017501710A (ja) * 2013-12-18 2017-01-19 ザ ユニバーシティ オブ ノッティンガム 形質導入
US20180133295A1 (en) * 2015-03-16 2018-05-17 Amal Therapeutics Sa A Novel Complex Comprising A Cell Penetrating Peptide, A Cargo And A TLR Peptide Agonist
KR20200076603A (ko) * 2018-12-19 2020-06-29 한국화학연구원 인간 clk2 단백질 유래 세포막 투과 도메인
KR102060411B1 (ko) * 2019-06-03 2019-12-30 한림대학교 산학협력단 세포 침투성 펩타이드, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물

Also Published As

Publication number Publication date
KR20220043329A (ko) 2022-04-05
KR102556731B1 (ko) 2023-07-21

Similar Documents

Publication Publication Date Title
JP5043672B2 (ja) 新規細胞膜透過ペプチド
KR102060411B1 (ko) 세포 침투성 펩타이드, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물
JP5295785B2 (ja) 細胞膜透過性ペプチド
WO2016036060A1 (ko) 신규 세포막 투과 펩티드 및 생리활성 물질 전달체로서의 그의 용도
US6087486A (en) Nucleotide sequences encoding vpr receptor protein
EP3043811A1 (en) Compositions and methods for the delivery of molecules into live cells
AU2014318839A1 (en) Compositions and methods for the delivery of molecules into live cells
WO2022071771A1 (ko) 단백질 수송 도메인, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물
US7709606B2 (en) Interacting polypeptide comprising a heptapeptide pattern and a cellular penetration domain
WO2022255708A1 (ko) 화물분자 수송 도메인 rmmr1, 이의 변이체, 이를 포함하는 재조합 화물분자 및 이를 이용한 화물분자 수송 방법
JP2022549057A (ja) 分子の細胞内送達のための複合体
US20040235745A1 (en) Antimicrobial Peptides
KR102479847B1 (ko) 새로운 단백질 수송 도메인, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물
WO2018111051A1 (ko) 세포막 투과 펩티드 및 이를 포함하는 세포내 전달체
US20220288160A1 (en) Fusion proteins and uses thereof
KR102146392B1 (ko) 포스포글리세레이트 뮤테이즈 1 융합단백질 및 이를 포함하는 약학 조성물
KR20240006722A (ko) 화물분자 수송 도메인 sy1, 이를 포함하는 융합 화합물 및 이 융합 화합물을 포함하는 약학 조성물
CN113559239B (zh) 融合蛋白在制备预防和/或治疗呼吸道疾病的药物中的应用
WO2019169131A1 (en) Peptide compositions and method of treating human cytomegalovirus infection
KR20180021470A (ko) 세포투과성 Atox1 융합단백질을 포함하는 항염증 약학 조성물
US7754687B2 (en) Methods of inhibiting viral infection
WO2021194257A1 (ko) 세포 투과성 펩티드 이량체, 이의 제조방법 및 이를 이용한 카고 전달 시스템
US20220226489A1 (en) Therapeutics directed against coronavirus
WO2023224357A1 (ko) 혈뇌장벽을 통과하는 폴리펩타이드 및 이의 용도
KR100374050B1 (ko) 세포침투성 융합단백질, 이를 코딩하는 재조합폴리뉴클레오타이드 및 발현벡터

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21876046

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21876046

Country of ref document: EP

Kind code of ref document: A1