WO2007042487A2 - Utilisation de proteines en tant que composante antimousse dans des carburants - Google Patents

Utilisation de proteines en tant que composante antimousse dans des carburants Download PDF

Info

Publication number
WO2007042487A2
WO2007042487A2 PCT/EP2006/067169 EP2006067169W WO2007042487A2 WO 2007042487 A2 WO2007042487 A2 WO 2007042487A2 EP 2006067169 W EP2006067169 W EP 2006067169W WO 2007042487 A2 WO2007042487 A2 WO 2007042487A2
Authority
WO
WIPO (PCT)
Prior art keywords
fuel
hydrophobin
proteins
additive
hydrophobins
Prior art date
Application number
PCT/EP2006/067169
Other languages
German (de)
English (en)
Other versions
WO2007042487A3 (fr
Inventor
Thomas Subkowski
Hans-Georg Lemaire
Marvin Karos
Susan Hammer
Jörn KARL
Dietmar Posselt
Original Assignee
Basf Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Basf Aktiengesellschaft filed Critical Basf Aktiengesellschaft
Priority to EP06793992A priority Critical patent/EP1941009A2/fr
Priority to JP2008535007A priority patent/JP2009511689A/ja
Priority to CA2625134A priority patent/CA2625134C/fr
Priority to AU2006301257A priority patent/AU2006301257B2/en
Priority to BRPI0617287-3A priority patent/BRPI0617287A2/pt
Priority to US12/083,404 priority patent/US8038740B2/en
Priority to CN2006800460916A priority patent/CN101326271B/zh
Publication of WO2007042487A2 publication Critical patent/WO2007042487A2/fr
Publication of WO2007042487A3 publication Critical patent/WO2007042487A3/fr
Priority to NO20081618A priority patent/NO20081618L/no
Priority to KR1020087011264A priority patent/KR101265375B1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L10/00—Use of additives to fuels or fires for particular purposes
    • C10L10/18—Use of additives to fuels or fires for particular purposes use of detergents or dispersants for purposes not provided for in groups C10L10/02 - C10L10/16
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L1/00—Liquid carbonaceous fuels
    • C10L1/10—Liquid carbonaceous fuels containing additives
    • C10L1/14—Organic compounds
    • C10L1/24—Organic compounds containing sulfur, selenium and/or tellurium
    • C10L1/2462—Organic compounds containing sulfur, selenium and/or tellurium macromolecular compounds
    • C10L1/2475—Organic compounds containing sulfur, selenium and/or tellurium macromolecular compounds obtained otherwise than by reactions only involving unsaturated carbon to carbon bonds
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L1/00—Liquid carbonaceous fuels
    • C10L1/10—Liquid carbonaceous fuels containing additives
    • C10L1/14—Organic compounds
    • C10L1/22—Organic compounds containing nitrogen
    • C10L1/234—Macromolecular compounds
    • C10L1/238—Macromolecular compounds obtained otherwise than by reactions involving only carbon-to-carbon unsaturated bonds
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L2230/00—Function and purpose of a components of a fuel or the composition as a whole
    • C10L2230/14—Function and purpose of a components of a fuel or the composition as a whole for improving storage or transport of the fuel
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L2270/00—Specifically adapted fuels
    • C10L2270/02—Specifically adapted fuels for internal combustion engines
    • C10L2270/026—Specifically adapted fuels for internal combustion engines for diesel engines, e.g. automobiles, stationary, marine
    • C—CHEMISTRY; METALLURGY
    • C10—PETROLEUM, GAS OR COKE INDUSTRIES; TECHNICAL GASES CONTAINING CARBON MONOXIDE; FUELS; LUBRICANTS; PEAT
    • C10L—FUELS NOT OTHERWISE PROVIDED FOR; NATURAL GAS; SYNTHETIC NATURAL GAS OBTAINED BY PROCESSES NOT COVERED BY SUBCLASSES C10G, C10K; LIQUEFIED PETROLEUM GAS; ADDING MATERIALS TO FUELS OR FIRES TO REDUCE SMOKE OR UNDESIRABLE DEPOSITS OR TO FACILITATE SOOT REMOVAL; FIRELIGHTERS
    • C10L2300/00—Mixture of two or more additives covered by the same group of C10L1/00 - C10L1/308
    • C10L2300/20—Mixture of two components

Definitions

  • the present invention relates to the use of a hydrophobin or a derivative thereof as a defoamer in additive compositions or fuels, a process for defoaming fuels, additive and fuel composition containing a hydrophobin or derivative thereof and at least one further fuel additive, and a process for producing a fuel composition - tongue.
  • hydrocarbon mixtures used as diesel fuel which may also contain aromatics, gasoil and kerosene, have the unpleasant property of developing foam when filling in reservoirs, such as storage tanks and fuel tanks of motor vehicles, in conjunction with air. This leads to the delay of the filling process and insufficient filling of the container. It is therefore common to add defoamer to the diesel fuel. These defoamers should be effective in the lowest possible concentration and must not form harmful residues when the diesel fuel is burnt in the engine or adversely affect the combustion of the fuel. Correspondingly effective defoamers are described in the patent literature.
  • DE-A 103 14 853 discloses, for example, organofunctionally modified polysiloxanes and their use for defoaming liquid fuel, in particular diesel fuel.
  • GB-B-2 173 510 relates to a process for defoaming diesel fuel or jet fuel, wherein an antifoaming agent based on a silicone polyether copolymer is added to the fuel.
  • wet diesel fuel is meant a fuel that contains about 250 ppm of water. This water is either condensation that gets into the fuel in the storage tanks, or it is added to the fuel during transport in oil tankers, due to incomplete emptying of the tanks of water.
  • the silicon content of typical polysiloxane-polyoxyalkylene copolymers is 10 to 15% by weight or even 20 to 25% by weight. Since compounds with such high silicon content can result in undesirable silica deposits upon combustion in the engine, there is a desire for defoamers for diesel fuels with reduced silicon content or at least improved foam prevention and scumming to reduce the use concentration of these additives.
  • additive packages are meant mixtures of various additives, such as.
  • means for improving the combustion behavior means for reducing the formation of smoke, means for reducing the formation of harmful exhaust gases, inhibitors for reducing corrosion in the engine and its parts, surface-active substances, lubricants and the like.
  • Such additive packages are e.g. in JP-OS 05 132 682, GB-OS 2 248 068 and in the journal Mineralöltechnik, 37 (4), 20 described.
  • the additives of the additive package are dissolved in an organic solvent to a master concentrate, which is added to the raw diesel fuel.
  • Antifoam agents with polar groups often can not be uniformly incorporated or separated into these additive packages during storage.
  • Proteins are macromolecules made up of amino acids.
  • the length of these polypeptide chains ranges from below 50, for example 10, to over 1000 amino acids.
  • the protein structure can be described by the primary structure, the secondary structure, the tertiary structure and the quaternary structure.
  • the primary structure is the sequence of the individual amino acids within the polypeptide chain.
  • the spatial arrangement of the amino acids of a protein is called secondary structure.
  • the tertiary structure is one of the secondary structure superordinate spatial arrangement of the polypeptide chain. It is determined by the forces and bonds between the residues (ie the side chains) of the amino acids. If several molecules form a superordinate functional unit in a spatial arrangement, this is called the quaternary structure.
  • the globular proteins whose tertiary or quaternary structure looks approximately spherical or pear-shaped and which are usually well soluble in water or saline solutions
  • the fibrillar proteins which have a thread-like or fibrous structure, are mostly insoluble and to the support and builder substances.
  • Hydrophobins are small proteins of about 100 to 150 amino acids, which are characteristic of filamentous fungi, for example Schizophyllum ses. They usually have 8 cysteine units.
  • Hydrophobins have a marked affinity for interfaces and are therefore suitable for coating surfaces to alter the properties of the interfaces by forming amphipathic membranes.
  • Teflon can be coated by means of hydrophobins to give a hydrophilic surface.
  • Hydrophobins can be isolated from natural sources. Likewise known are preparation processes for hydrophobins and derivatives thereof. For example, DE 10 2005 007 480.4 discloses a preparation process for hydrophobins and derivatives thereof.
  • hydrophobins Due to the extraordinary properties of hydrophobins for coating surfaces, these proteins have great potential for numerous technical applications.
  • the use of hydrophobins for various applications has been proposed in the prior art.
  • WO 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active substances, for hydrophilicizing hydrophobic surfaces, for improving the water resistance of hydrophilic substrates, for producing oil-in-water emulsions or for water-in-oil emulsions. Furthermore, pharmaceutical applications such as the production of ointments or creams as well as cosmetic applications such as skin protection or the production of hair shampoos or hair rinses are proposed. WO 96/41882 moreover describes compositions, in particular compositions for pharmaceutical applications, containing hydrophobins.
  • EP-A 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for carrying out experiments or for storage, hull fuming, solid particles or frame or body of passenger cars with a solution containing hydrophobins at a temperature of 30 to 80 ° C.
  • WO 03/53383 discloses the use of hydrophobin for treating keratin materials in cosmetic applications.
  • hydrophobins have surface-active properties.
  • a hydrophobin coated sensor is disclosed, for example, a measuring electrode to which non-covalently further substances, e.g. electroactive substances, antibodies or enzymes are bound.
  • WO 2004/000880 likewise discloses the coating of surfaces with hydrophobin or hydrophobin-like substances. It is further disclosed that oil-in-water or water-in-oil emulsions can also be stabilized by adding hydrophobins.
  • WO 01/74864 which relates to hydrophobin-like proteins, discloses that these can be used to stabilize dispersions and emulsions.
  • EP 05 007 208.1 proposes the use of proteins, in particular of hydrophobins or derivatives thereof, as demulsifiers.
  • a further object of the present invention was to provide defoamers, which are inexpensive in addition to a good defoaming effect.
  • Another object of the present invention was to provide defoamers, which are inexpensive and environmentally friendly in addition to a good defoaming effect.
  • this object is achieved by the use of at least one hydrophobin or a derivative thereof as antifoams in additive compositions or fuels.
  • hydrophobins or derivatives thereof have the advantage that they are also naturally occurring substances that are biodegradable and thus do not lead to a burden on the environment. In addition, hardly any substances are formed during decomposition, which lead to deposits in the engine area. According to the invention, hydrophobins or derivatives thereof are used as defoamers, ie the foaming of a fuel or a fuel composition is reduced.
  • At least one hydrophobin or a derivative thereof alone to a fuel as defoamer.
  • at least one hydrophobin or derivative thereof in combination with at least one further compound which acts as defoamer.
  • various hydrophobins or derivatives thereof in combination.
  • a hydrophobin or a derivative thereof is understood to mean a hydrophobin or a modified hydrophobin.
  • the modified hydrophobin may, for example, be a hydrophobin infusion protein or a protein which has a polypeptide sequence which is at least 60%, for example at least 70%, in particular at least 80%, particularly preferably at least 90%, particularly preferably at least 95%.
  • the biological properties of a hydrophobin fulfills, in particular the property that the surface properties by coating with these proteins be changed so that the contact angle of a water drop before and after the coating of a glass surface with the protein has an increase of at least 20 °, preferably at least 25 °, in particular by at least 30 °.
  • hydrophobins or derivatives thereof give good results when used as defoamers.
  • hydrophobins For the definition of hydrophobins, the structural and not the sequence specificity of the hydrophobins is decisive.
  • the amino acid sequence of the mature hydrophobin is very diverse, but they all have a highly characteristic pattern of 8 conserved cysteine residues. These residues form four intramolecular disulfide bridges.
  • N- and C-terminus is variable over a larger range.
  • fusion partner proteins with a length of 10 to 500 amino acids can be added by means of molecular biological techniques known to those skilled in the art.
  • hydrophobins and derivatives thereof are understood as meaning proteins having a similar structure and functional equivalence.
  • hydrophobins is to be understood below to mean polypeptides of the general structural formula (I)
  • X is selected for each of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Me Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, GIy) can stand.
  • X may be the same or different.
  • the indices standing at X each represent the number of amino acids
  • C stands for cysteine, alanine, serine, glycine, methionine or threonine, wherein at least four of the radicals named C are cysteine, and the indices n and m are independent of each other for natural numbers between 0 and 500, preferably between 15 and 300.
  • the polypetides according to the formula (I) are further characterized by the property that at room temperature after coating a glass surface, they increase the contact angle of a water droplet of at least 20 °, preferably at least 25 ° and particularly preferably 30 °, in each case compared with the contact angle an equally large drop of water with the uncoated glass surface.
  • the amino acids designated C 1 to C 8 are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C 1 to C 8 should consist of cysteines. Cysteines can either be reduced in the proteins according to the invention or form disulfide bridges with one another. Particularly preferred is the intramolecular formation of CC bridges, in particular those having at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.
  • cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions indicated by X, the numbering of the individual C-positions in the general formulas may change accordingly.
  • indices n and m are numbers between 0 and 200, and the proteins continue to be distinguished by the abovementioned contact angle change.
  • radicals X n and X m may be peptide sequences that are naturally also linked to a hydrophobin. However, one or both residues may also be peptide sequences that are not naturally linked to a hydrophobin. Including such radicals X N and / or X are m to understand, in which a naturally occurring in a hydrophobin peptide sequence is extended tidsequenz by a non-naturally occurring in a hydrophobin.
  • X n and / or X m are naturally non-hydrophobin-linked peptide sequences, such sequences are generally at least 20, preferably at least 35, more preferably at least 50, and most preferably at least 100 amino acids in length.
  • Such a residue, which is not naturally linked to a hydrophobin will also be referred to below as a fusion partner.
  • the proteins may consist of at least one hydrophobin part and one fusion partner part which in nature do not coexist in this form.
  • the fusion partner portion can be selected from a variety of proteins. It is also possible to link a plurality of fusion partners with a hydrophobin part, for example at the amino terminus (X n ) and at the carboxy terminus (X m ) of the hydrophobin part. However, it is also possible, for example, to link two fusion partners with a position (X n or X m ) of the protein according to the invention.
  • fusion partners are proteins that occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis.
  • Fusion partners are the sequences yaad (SEQ ID NOs: 15 and 16), yaae (SEQ ID NOs: 17 and 18), and thioredoxin.
  • fragments or derivatives of these sequences which comprise only a part, preferably from 70 to 99%, particularly preferably from 80 to 98%, of said sequences, or in which individual amino acids or nucleotides are modified relative to said sequence , wherein the percentages in each case refers to the number of amino acids.
  • proteins used according to the invention as hydrophobins or derivatives thereof may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical cross-linking, for example with glutaraldehyde.
  • One property of the hydrophobins or derivatives thereof used in the present invention is the change in surface properties when the surfaces are coated with the proteins.
  • the change in the surface properties can be experimentally determined, for example, by measuring the contact angle of a water drop before and after coating the surface with the protein and determining the difference between the two measurements.
  • contact angle measurements is known in principle to the person skilled in the art.
  • the measurements refer to room temperature and water drops of 5 ⁇ l.
  • the exact experimental conditions for an exemplary method for measuring the contact angle are shown in the experimental part.
  • the proteins used according to the invention have the property of increasing the contact angle by at least 20 °, preferably at least 25 °, particularly preferably at least 30 °, in each case compared with the contact angle of a water droplet of the same size with the uncoated glass surface.
  • the assembled membranes of class I hydrophobins are highly insoluble (even against 1% Na dodecyl sulfate (SDS) at elevated temperature) and can only be dissociated by concentrated trifluoroacetic acid (TFA) or formic acid.
  • the assembled forms of class II hydrophobins are less stable. They can already be redissolved by 60% ethanol or 1% SDS (at room temperature).
  • a comparison of the amino acid sequences shows that the length of the region between cysteine C 3 and C 4 in class II hydrophobins is significantly shorter than in class I hydrophobins.
  • Class II hydrophobins furthermore have more charged amino acids than class I.
  • hydrophobins for carrying out the present invention are the hydrophobins of the type dewA, rodA, hypA, hypB, sc3, basF, basf2, which are structurally characterized in the sequence listing below. It may also be just parts or derivatives thereof. It is also possible to link together a plurality of hydrophobin moieties, preferably 2 or 3, of the same or different structure and to link them to a corresponding suitable polypeptide sequence which is not naturally associated with a hydrophobin.
  • fusion proteins having the polypeptide sequences shown in SEQ ID NO: 20, 22, 24 and the nucleic acid sequences coding therefor, in particular the sequences according to SEQ ID NO: 19, 21, 23.
  • the biological property of the proteins is hereby understood as the change in the contact angle already described by at least 20 °.
  • Suitable fusion partners are proteins which result in the fusion protein thus generated being capable of coating surfaces while being resistant to detergent treatment.
  • Examples of fusion partners are, for example, in E. coli yaad, yaae, thioredoxin.
  • fusion proteins produced in this way are already functionally active and not, as described in the literature, by dissociation of the hydrophobins by trifluoroacetic acid or formic acid treatment and therefore have to be activated. Solutions containing these fusion proteins or, after cleavage of the fusion protein, only the hydrophobin are suitable directly for coating surfaces.
  • a C- or N-terminal fusion with an affinity tag proves to be favorable for a fast and efficient cleaning.
  • an affinity tag eg, His 6 , HA, calmodulin-BD, GST, MBD, chitin-BD, streptavidin-BD-AviTag, Flag-Tag, T7, etc.
  • a cleavage site between the hydrophobin and the fusion partner or the fusion partners can be used to release the pure hydrophobin in underivatized form (for example, by BrCN cleavage on methionine, factor Xa, enterokinase, thrombin, TEV cleavage, etc.).
  • fusion proteins from one fusion partner, for example yaad or yaae, and several hydrophobins, also of different sequence, for example DewA-RodA or Sc3-DewA, Sc3-RodA, in succession.
  • hydrophobin fragments for example N- or C-terminal truncations
  • muteins having up to 70% homology can be used. The selection of the optimal constructs is made with respect to the particular use, i. the fuel to be defoamed.
  • polypeptides used according to the invention or contained in the compositions according to the invention can be prepared chemically by known methods of peptide synthesis, for example by solid-phase synthesis according to Merrifield.
  • Naturally occurring hydrophobins can be isolated from natural sources by suitable methods. For example, see Wösten et al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882.
  • fusion proteins can preferably be carried out by genetic engineering methods in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence.
  • a production method is disclosed, for example, in DE 102005007480.4.
  • Suitable host organisms (production organisms) for said production process may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and others.
  • prokaryotes including archaea
  • eukaryotes especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Asperg
  • expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide used according to the invention and vectors comprising at least one of these expression constructs are used.
  • constructs employed include a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream, and optionally other common regulatory elements, each operably linked to the coding sequence.
  • an "operative linkage" is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements such that each of the regulatory elements can fulfill its function in the expression of the coding sequence as intended.
  • operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like.
  • Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. In Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically altered so that the natural regulation has been eliminated and the expression of the genes has been increased.
  • a preferred nucleic acid construct advantageously also contains one or more so-called “enhancer” sequences, functionally linked to the promoter, which allow increased expression of the nucleic acid sequence. Additional advantageous sequences can also be inserted at the 3 'end of the DNA sequences, such as further regulatory elements or terminators.
  • the nucleic acids may be contained in one or more copies in the construct.
  • the construct may also contain further markers, such as antibiotic resistances or genes that complement xanthropy, optionally for selection on the construct.
  • Advantageous regulatory sequences for the preparation are, for example, in promoters such as cos, tac, trp, tet, trp tet, Ipp, lac, Ipp-lac, Iaclq-T7, T5, T3, gal , trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which are advantageously used in gram-negative bacteria.
  • Further advantageous regulatory sequences are contained, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH. It is also possible to use artificial promoters for regulation.
  • the nucleic acid construct is advantageously inserted into a host organism for expression in a vector, such as a plasmid or a phage, which allows optimal expression of the genes in the host.
  • a vector such as a plasmid or a phage
  • all other vectors known to the person skilled in the art ie, z.
  • viruses such as SV40, CMV, baculovirus and adenovirus, Transposons.lS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system to understand.
  • vectors can be autonomously replicated in the host organism or replicated chromosomally.
  • Suitable plasmids are described, for example, in E.coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, pNIII "3-B1, tgtl 1 or pBdCI, in Streptomyces plJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALS1, pIL1 or pBB1 16, in yeasts 2alpha, pAG-1, YEp6, YEp13 or pEMB
  • nucleic acid construct for expression of the further genes contained additionally 3'- and / or 5'-terminal regulatory sequences to increase the expression, which are selected depending on the selected host organism and gene or genes for optimal expression.
  • genes and protein expression are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
  • the regulatory sequences or factors may preferably have a positive effect on the gene expression of the introduced genes and thereby increase it.
  • enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers.
  • an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
  • the vector containing the nucleic acid construct or the nucleic acid can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination.
  • This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.
  • An expression cassette is produced by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator or polyadenylation signal.
  • Common recombination and cloning techniques are used, for example, as described in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989) and TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Colard Spring Harbor Laboratory, ColD Spring Harbor, NY (1984), and Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
  • the recombinant nucleic acid construct or gene construct is inserted for expression in a suitable host organism, advantageously into a host-specific vector which enables optimal expression of the genes in the host.
  • Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985).
  • recombinant microorganisms can be produced, which are transformed, for example, with at least one vector and can be used to produce the hydrophobins or derivatives thereof used according to the invention.
  • the recombinant constructs described above are introduced into a suitable host system and expressed.
  • a vector is prepared which contains at least a portion of a gene or a coding sequence to be used, wherein optionally at least one amino acid deletion, addition or substitution has been introduced in order to alter the sequence, eg to functionally disrupt it (Knockout "- vector).
  • the introduced sequence may also be a homologue from a related microorganism or derived from a mammalian, yeast or insect source.
  • the vector used for homologous recombination may be such that the endogenous gene is mutated or otherwise altered upon homologous recombination, but still encodes the functional protein (eg, the upstream regulatory region may be altered such that expression of the endogenous protein is changed).
  • the altered portion of the gene used according to the invention is in the homologous recombination vector.
  • suitable vectors for homologous recombination is described, for example, in Thomas, KR and Capecchi, MR (1987) Cell 51: 503.
  • microorganisms such as bacteria, fungi or yeast are used as host organisms.
  • Gram-positive or Gram-negative bacteria preferably bacteria of the families Enterobacteriaceae, Pseudomonodaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus, are advantageously used.
  • Microorganisms are usually in a liquid medium containing a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts and optionally vitamins, at temperatures between 0 and 100 ° C, preferably between 10 and 60 ° C attracted under oxygen fumigation.
  • a carbon source usually in the form of sugars
  • a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate
  • trace elements such as iron, manganese and magnesium salts
  • optionally vitamins at temperatures between 0 and 100 ° C, preferably between 10 and 60 ° C attracted under oxygen fumigation.
  • the pH of the nutrient fluid can be kept at a fixed value, that is, regulated during the cultivation or not.
  • the cultivation can take place "batchwise", “semi-batch” - wise or continuously. Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously.
  • the enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction.
  • the proteins or functional, biologically active fragments thereof used according to the invention can be prepared by means of a process for recombinant production in which a polypeptide-producing microorganism is cultivated, optionally the expression of the proteins is induced and these are isolated from the culture. The proteins can thus also be produced on an industrial scale, if desired.
  • the recombinant microorganism can be cultured and fermented by known methods.
  • Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, ColD Spring Harbor Laboratory, ColD Spring Harbor, NY (1989).
  • the cells are disrupted and the product is recovered from the lysate by known protein isolation procedures.
  • the cells may optionally be treated by high frequency ultrasound, high pressure, e.g. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by combining several of the listed methods.
  • Purification of the proteins can be achieved by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, as well as by other conventional methods, such as ultrafiltration, crystallization, salting out , Dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, F.G., Biochemische Harvey Methoden, Verlag Walter de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
  • vector systems or oligonucleotides for the isolation of the recombinant protein, which extend the cDNA by certain nucleotide sequences and thus code for altered polypeptides or fusion proteins which serve, for example, a simpler purification.
  • suitable modifications include so-called "tags" as anchors, such as the modification known as hexa-histidine anchors, or epitopes that can be recognized as antigens of antibodies (described, for example, in Harlow, E. and Lane, D., 1988 , Antibodies: A Laboratory Manual, CoId Spring Harbor (NY) Press).
  • Suitable tags include HA, calmodulin BD, GST, MBD; Chitin-BD, streptavidin-BD-avi-tag, flag-tag, T7, etc.
  • anchors may serve to attach the proteins to a solid support, such as a polymer matrix, for example, in a chromosome. or can be used on a microtiter plate or on another carrier.
  • the corresponding purification protocols are available from the commercial affinity tag providers.
  • the proteins prepared as described can be used both directly as fusion proteins and after cleavage and separation of the fusion partner as "pure" hydrophobins.
  • a potential cleavage site (specific recognition site for proteases) in the fusion protein between the hydrophobin part and the fusion partner part.
  • Suitable cleavage sites are, in particular, those peptide sequences which otherwise do not occur in the hydrophobin part or in the fusion partner part, which can be easily determined with bioinformatic tools.
  • Particularly suitable are, for example, BrCN cleavage on methionine, or protease-mediated cleavage with factor Xa, enterokinase, thrombin, TEV cleavage (Tobacca etch virus protease).
  • fuels are understood as meaning both fuels in the narrower sense, which serve for the operation of internal combustion engines, and also fuels in general.
  • Suitable fuels are middle distillates and gasoline. Preferably, however, middle distillates are used.
  • Suitable middle distillates are those which boil in a range of about 120 to 500 ° C and are selected, for example, from diesel fuels, kerosene and fuel oil. Preferred middle distillates are diesel fuels.
  • the diesel fuels are, for example, petroleum raffinates, which usually have a boiling range of 100 to 400 ° C. These are mostly distillates with a 95% point up to 36O 0 C or even beyond. However, these may also be so-called “ultra low sulfur diesel” or "city diesel", characterized by a 95% point of, for example, a maximum of 345 0 C and a maximum sulfur content of 0.005 wt .-% or by a 95% point, for example 285 ° C and a maximum sulfur content of 0.001 wt .-%.
  • those obtainable by coal gasification or gas liquefaction (“gas to liquid” (GTL) fuels) are suitable.
  • GTL gas to liquid
  • mixtures of the abovementioned diesel fuels with regenerative fuels such as biodiesel or bioethanol.
  • the diesel fuels are particularly preferably those with a low sulfur content, ie with a sulfur content of less than 0.05% by weight. %, preferably less than 0.02% by weight, in particular less than 0.005% by weight and especially less than 0.001% by weight of sulfur.
  • the fuel oils are also particularly preferably those with a low sulfur content, for example with a sulfur content of at most 0.1% by weight, preferably of at most 0.05% by weight, particularly preferably of at most 0.005% by weight. , And in particular of at most 0.001 wt .-%.
  • hydrophobins or derivatives thereof are preferably used as defoamers in diesel fuels.
  • the present invention therefore relates to a use as described above of at least one hydrophobin or a derivative thereof as defoamer, wherein the fuel is a diesel fuel.
  • the at least one hydrophobin or derivative thereof is used according to the invention preferably in an amount of 0.1 to 100 ppm, based on the fuel, preferably from 0.15 to 50 ppm, more preferably from 0.2 to 30 ppm or 0.3 to 10 ppm.
  • the present invention therefore relates to a use as described above of at least one hydrophobin or a derivative thereof as defoamer, wherein the at least one hydrophobin or derivative thereof is used in an amount of 0.1 to 100 ppm, based on the fuel ,
  • a fuel in particular a diesel fuel, can be defoamed by adding at least one hydrophobin or a derivative thereof.
  • the present invention also relates to a method of defoaming fuel comprising adding at least one hydrophobin or derivative thereof to a fuel.
  • the present invention relates to a method for defoaming fuel as described above, wherein a diesel fuel is used as fuel.
  • the present invention relates to a method for defoaming fuel as described above, wherein the at least one hydrophobin or derivative thereof is used in an amount of 0.1 to 100 ppm based on the fuel.
  • the at least one hydrophobin or derivative thereof is added directly to a fuel or a fuel composition or in the form of an additive composition.
  • the present invention furthermore relates to additive compositions which contain, in addition to at least one further fuel additive, at least one hydrophobin or a derivative thereof.
  • the present invention relates to fuel compositions containing at least one hydrophobin or a derivative thereof and at least one further fuel additive.
  • the present invention relates to an additive composition
  • an additive composition comprising at least one hydrophobin or derivative thereof and at least one further fuel additive.
  • the present invention relates to a fuel composition
  • a fuel composition comprising, in addition to at least one fuel as the main constituent, at least one hydrophobin or derivative thereof and at least one further fuel additive.
  • the additive composition or the fuel contain, in addition to the at least one hydrophobin or derivative thereof, at least one further fuel additive, in particular at least one detergent and / or one demulsifier. Suitable detergent additives and demulsifiers are listed below.
  • the additive compositions and fuels may also instead or additionally contain various fuel additives such as carrier oils, corrosion inhibitors, antioxidants, antistatic agents, colorants and the like.
  • the additive composition or the fuel preferably contains at least one detergent and / or one demulsifier and optionally further, different fuel additives.
  • the present invention relates to an additive composition or fuel composition as described above, wherein the composition comprises at least one detergent. Likewise, according to a further preferred embodiment, the present invention relates to an additive composition or fuel composition as described above, wherein the composition comprises at least one demulsifier
  • detergent additives are amphiphilic substances having at least one hydrophobic hydrocarbon radical having a number average molecular weight (Mn) of from 85 to 20,000 and at least one polar moiety selected from:
  • the hydrophobic hydrocarbon radical in the above detergent additives which provides sufficient solubility in the fuel, has a number average molecular weight (Mn) of from 85 to 20,000, especially from 113 to 10,000, especially from 300 to 5,000.
  • Mn number average molecular weight
  • amines for example ammonia, monoamines or polyamines, such as dimethylaminopropylamine, ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine, can be used here.
  • amines for example ammonia, monoamines or polyamines, such as dimethylaminopropylamine, ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine, can be used here.
  • Corresponding additives based on polypropene are described in particular in WO 94/24231.
  • monoamino groups (a) containing additives are the polyisobutene epoxides by reaction with amines and subsequent dehydration and reduction of the amino alcohols obtainable compounds, as described in particular in DE-A 196 20 262.
  • These reaction products typically are mixtures of pure nitropolyisobutenes (e.g., ⁇ , ⁇ -dinitropolyisobutene) and mixed hydroxynitripropylisobutenes (e.g., ⁇ -nitro- ⁇ -hydroxy polyisobutene).
  • Carboxyl groups or their alkali metal or alkaline earth metal salts (d) containing additives are preferably copolymers of C 2 -C 40 olefins with maleic anhydride having a total molecular weight of 500 to 20 000, the carboxyl groups wholly or partially to the alkali metal or alkaline earth metal salts and a remaining Rest of the carboxyl groups are reacted with alcohols or amines.
  • Such additives are in particular known from EP-A 307 815.
  • Such additives are mainly used to prevent valve seat wear and, as described in WO 87/01126, can be advantageously used in combination with conventional fuel detergents such as poly (iso) butenamines or polyetheramines.
  • Sulphonic acid groups or their alkali metal or alkaline earth metal salts (e) containing additives are preferably alkali metal or alkaline earth metal salts of a sulfosuccinic acid alkyl ester, as described in particular in EP-A 639 632.
  • Such additives are mainly used to prevent valve seat wear and can be used to advantage in combination with conventional fuel detergents such as poly (iso) butenamines or polyetheramines.
  • Polyoxy-C 2 -C 4 -alkylene (f) additives are preferably polyethers or polyetheramines which are obtainable by reaction of kanolen C 2 -C 6O -AI, C 6 -C 30 - alkanediols, mono- or di-C 2 -C 30 alkylamines, CrC 30 -Alkylcyclohexanolen d- or C 30 alkyl phenols having 1 to 30 mol ethylene oxide and / or propylene oxide and / or butylene oxide per hydroxyl group or amino group and, in the case of the polyetheramines, by subsequent reductive amination with ammonia , Monoamines or polyamines are available.
  • Such products are described in particular in EP-A 310 875, EP-A 356 725, EP-A 700 985 and US 4,877,416.
  • polyethers such products also meet carrier oil properties. Typical examples of these are tridecanol or Isotridecanolbutoxylate, Isononylphenolbutoxylate and Polyisobutenolbu- toxylate and propoxylates and the corresponding reaction products with ammonia.
  • Carboxylic ester groups (g) containing additives are preferably esters of mono-, di- or tricarboxylic acids with long-chain alkanols or polyols, especially those having a minimum viscosity of 2 mm 2 / s at 100 ° C, as described in particular in DE-A 38 38 918 are.
  • Aliphatic or aromatic acids can be used as the mono-, di- or tricarboxylic acids, especially suitable as ester alcohols or polyols are long-chain representatives with, for example, 6 to 24 C atoms.
  • esters are adipates, phthalates, isophthalates, terephthalates and trimellitates of iso-octanol, iso-nonanol, iso-decanol and of isotridecanol. Such products also meet carrier oil properties.
  • derivatives with aliphatic poly- amines such as ethylenediamine, diethylenetriamine, triethylenetetramine or tetraethylenepentamine.
  • the groups having hydroxyl and / or amino and / or amido and / or imido groups are, for example, carboxylic acid groups, acid amides, acid amides of diamines or polyamines which, in addition to the amide function, still have free amine groups, succinic acid derivatives with a Acid and an amide, Carbon Textreimide with monoamines, Carbonklareimide with di- or polyamines, which still have free amine groups in addition to the imide function, and diimides, which are formed by the reaction of di- or polyamines with two succinic acid derivatives.
  • Such fuel additives are described in particular in US Pat. No. 4,849,572.
  • Mannich reaction of substituted phenols with aldehydes and mono- or polyamines generated groupings (i) containing additives are preferably reaction products of polyisobutene-substituted phenols with formaldehyde and mono- or polyamines such as ethylenediamine, diethylenetriamine, triethylenetetramine, tetraethylenepentamine or dimethylaminopropylamine.
  • Such "polyisobutene-Mannich bases" are described in particular in EP-A 831 141.
  • detergent additives from group (h) are in particular polyisobutenyl-substituted succinimides, especially the imides with aliphatic polyamines.
  • Examples of suitable demulsifiers according to the invention are the following.
  • Demulsifiers are substances which cause the separation of an emulsion. These may be both ionogenic and non-ionic substances which are effective at the phase boundary. Accordingly, basically all surface-active substances are suitable as demulsifiers.
  • Particularly suitable emulsifiers are selected from anionic active compounds, such as the alkali metal or alkaline earth metal salts of alkyl-substituted phenol and naphthalene sulfonates, and the alkali metal or alkaline earth metal salts of fatty acids, as well as neutral compounds, such as alcohol alkoxylates, for example alcohol ethoxylates, phenol alkoxylates, for example tert Butylphenolethoxylat or tert-Pentylphenolethoxylat, fatty acids, alkylphenols, condensation products of ethylene oxide (EO) and propylene oxide (PO), for example in the form of EO / PO block copolymers, polyethyleneimines or polysiloxa
  • suitable carrier oils are listed below.
  • Suitable mineral carrier oils are fractions obtained in petroleum processing, such as bright stock or base oils with viscosities such as from class SN 500-2000; but also aromatic hydrocarbons, paraffinic hydrocarbons and alkoxyalkanols. Also useful is a fraction known as "hydrocrack oil” and derived from the refining of mineral oil (vacuum distillate cut having a boiling range of about 360-500 ° C, available from high pressure, catalytically hydrogenated and isomerized and dewaxed natural mineral oil). Also suitable are mixtures of the abovementioned mineral carrier oils.
  • Examples of synthetic carrier oils which can be used according to the invention are selected from: polyolefins (polyalphaolefins or polyinternalolefins), (poly) esters, (poly) alkoxylates, polyethers, aliphatic polyetheramines, alkylphenol-initiated polyethers, alkylphenol-initiated polyetheramines and carboxylic esters of long-chain alkanols.
  • suitable polyethers or polyetheramines are preferably PoIyOXy-C 2 - C 4 -alkylene-containing compounds produced by reaction of C 2 - C oil 6O -AI kan, C 6 -C 30 alkanediols, mono- or di-C 2 - C 3 o-alkylamines, CrC 30 - alkylcyclohexanols or CrC 30 -alkylphenols with 1 to 30 moles of ethylene oxide and / or propylene oxide and / or butylene oxide per hydroxyl group or amino group and, in the case of polyetheramines, by subsequent reductive amination with ammonia, monoamines or polyamines are available.
  • Such products are described in particular in EP-A 310 875, EP-A 356 725, EP-A 700 985 and US 4,877,416.
  • polyetheramines poly-C 2 -C 6 alkylene oxide amines or functional derivatives thereof can be used. Typical examples of these are tridecanol or Isotridecanolbutoxylate, Isononylphenolbutoxylate and Polyisobutenolbutoxylate and propoxylates and the corresponding reaction products with ammonia.
  • carboxylic acid esters of long-chain alkanols are in particular esters of mono-, di- or tricarboxylic acids with long-chain alkanols or polyols, as described in particular in DE-A 38 38 918.
  • mono-, di- or tricarboxylic acids it is possible to use aliphatic or aromatic acids, especially suitable ester alcohols or polyols are long-chain representatives having, for example, 6 to 24 carbon atoms.
  • esters are adipates, phthalates, isophthalates, terephthalates and trimellitates of isooctanol, isononanol, isodecanol and of isotricanecanol, for example di (n- or isotridecyl) phthalate.
  • suitable synthetic carrier oils are alcohol-initiated polyethers having from about 5 to 35, such as about 5 to 30, C 3 -C 6 -alkylene oxide units, for example selected from propylene oxide, n-butylene oxide and i-butylene oxide units, or mixtures thereof.
  • suitable starter alcohols are long-chain alkanols or long-chain alkyl-substituted phenols, where the long-chain alkyl radical is in particular a straight-chain or branched C 6 -C 6 -alkyl radical.
  • Preferred examples are tridecanol and nonylphenol.
  • suitable synthetic carrier oils are alkoxylated alkylphenols, as described in DE-A 10 102 913.6.
  • compositions of the invention may optionally contain further co-additives.
  • Further customary additives are the cold properties of the fuel-improving additives, such as nucleators, flow improvers, paraffin dispersants and mixtures thereof, for example ethylene-vinyl acetate copolymers; Corrosion inhibitors, for example based on film-forming ammonium salts of organic carboxylic acids or of heterocyclic aromatics in the case of non-ferrous metal corrosion protection; dehazers; Anti-foaming agents, eg certain siloxane compounds; Cetane number improvers (ignitability improvers); combustion improvers; Antioxidants or stabilizers, for example based on amines such as p-phenylenediamine, dicyclohexylamine or derivatives thereof or of phenols such as 2,4-di-tert-butylphenol or 3,5-di-tert-butyl-4-hydroxyphenylpropionic acid; Antistatic agents; Metallocenes such as ferrocene; Methylcyclopentadienyl
  • amines are added to lower the pH of the fuel.
  • detergent additives for example those with the polar groupings (a) to (i), they are usually added to the fuel in an amount of 10 to 5000 ppm by weight, in particular 50 to 1000 ppm by weight, particularly preferably 25 added to 500 ppm by weight.
  • demulsifiers When demulsifiers are used, they are usually added to the fuel in an amount of 0.1 to 100 ppm by weight, especially 0.2 to 10 ppm by weight.
  • the additive composition according to the invention contains a detergent additive, it is preferably present in an amount of from 1 to 60% by weight, preferably from 1 to 50% by weight, particularly preferably from 1 to 40% by weight and in particular from 1 to 15 Wt .-%, based on the total weight of the composition, before.
  • the additive composition of the present invention contains a demulsifier, it is preferably contained in an amount of 0.01 to 5% by weight, more preferably 0.01 to 2.5% by weight, and more preferably 0.01 to 1% by weight. %, based on the total weight of the composition.
  • compositions according to the invention may optionally also contain a solvent or diluent
  • Suitable diluents and solvents are, for example, aromatic and aliphatic hydrocarbons, for example C 5 -C 10 -alkanes, such as pentane, hexane, heptane, octane, nonane, decane, their constitutional isomers and mixtures; Petroleum ethers, aromatics such as benzene, toluene, xylene and solvent naphtha; Alkanols having 3 to 8 carbon atoms, for example, propanol, isopropanol, n-butanol, sec-butanol, isobutanol and the like, in combination with hydrocarbon solvents; and alkoxyalkanoethylene.
  • aromatic and aliphatic hydrocarbons for example C 5 -C 10 -alkanes, such as pentane, hexane, heptane, octane, nonane, decane, their constitutional isomers and mixtures
  • Suitable diluents are, for example, fractions obtained in petroleum processing, such as kerosene, naphtha or bright stock.
  • middle distillates especially in diesel fuels and heating oils preferred diluent used are naphtha, kerosene, diesel fuels, aromatic hydrocarbons such as Solvent Naphtha heavy, Solvesso ® or Shellsol ®, as well as mixtures of these solvents and diluents.
  • the individual components may be added to the fuel or the conventional fuel composition singly or as a previously prepared concentrate (additive package; additive composition).
  • the present invention also relates to a process for producing at least one fuel composition, wherein a fuel or a fuel composition
  • Hydrophobins or derivatives thereof have good defoaming properties of fuels.
  • Oligonucleotides Hal570 and Hal571 were used to perform a polymerase chain reaction.
  • the PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site.
  • the PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII.
  • This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BglI.
  • the resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS 6 and YAAE :: HIS 6 , respectively.
  • Hal570 gcgcgcccatggctcaaacaggtactga
  • Hal571 gcagatctccagccgcgttcttgcatac
  • Hal572 ggccatgggattaacaataggtgtactagg
  • Hal573 gcagatcttacaagtgccttttgcttatattcc
  • vaad-Hvdrophobin DewA-Hiss Using the oligonucleotides KaM 416 and KaM 417, a polymerase chain reaction was carried out.
  • the template DNA used was genomic DNA of the mold Aspergillus nidulans.
  • the resulting PCR fragment contained the coding sequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase cleavage site.
  • the PCR fragment was purified and cut with the restriction endonuclease BamHI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD # 2 previously linearized with the restriction endonuclease BgIII.
  • the resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS6.
  • KaM416 GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
  • plasmid # 513 The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
  • KaM434 GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
  • plasmid # 507 The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • the template DNA used was an artificially synthesized DNA sequence-hydrophobin BASF1 (see Appendix, SEQ ID NOS 11 and 12).
  • plasmid # 506 The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • An artificially synthesized DNA sequence-hydrophobin BASF2- was used as template DNA (see Appendix, SEQ ID NOS: 13 and 14).
  • Plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.
  • Schyzophyllum commune cDNA was used as template DNA (see Appendix, SEQ ID NOS: 9 and 10).
  • KaM464 CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
  • KaM465 GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
  • 100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 mM sodium phosphate buffer, pH 7.5 and resuspended.
  • the suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then incubated for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) to break down the nucleic acids.
  • filter with a glass cartridge P1.
  • two homogenizer runs are carried out at 1500 bar (Microfluidizer M-1 10EH, Microfluidics Corp.).
  • the homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , Centrifugation and resuspension are repeated 3 times with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stir for one hour and perform a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g).
  • the hydrophobin is contained in the supernatant after the final centrifugation ( Figure 1).
  • the experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells.
  • 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) which has been equilibrated with 50 mM Tris-Cl pH 8.0 buffer.
  • the column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole.
  • the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.
  • FIG. 1 shows the purification of the hydrophobin prepared, wherein the tracks A to F are shown.
  • Lane A Nickel Sepharose column (1:10 dilution)
  • Lanes C - E OD 280 Maxima of elution fractions (WP1, WP2, WP3)
  • Lane F shows the applied marker
  • the hydrophobin of Figure 1 has a molecular weight of about 53 kD.
  • the smaller bands partially represent degradation products of hydrophobin.
  • the samples are air dried and the contact angle (in degrees) of a drop of 5 ⁇ l of water is determined.
  • the contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.
  • the defoaming improvement was carried out by means of a handshake foam test as follows:
  • the starting sample had a concentration of 6.1 mg / ml hydrophobin.
  • 2 mL of the starting sample were made up to 10OmL (Hyd.Lsgl) and 3 mL of the resulting solution was added to 97 mL of fuel (EN 590 fuel).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Mycology (AREA)
  • Combustion & Propulsion (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Solid Fuels And Fuel-Associated Substances (AREA)
  • Detergent Compositions (AREA)
  • Liquid Carbonaceous Fuels (AREA)

Abstract

La présente invention concerne l'utilisation d'une hydrophobine ou d'un dérivé de celle-ci, en tant qu'agent antimousse dans des compositions d'addition ou des carburants, un procédé pour empêcher la formation de mousse dans des carburants, une composition d'addition et une composition de carburant contenant une hydrophobine ou un dérivé de celle-ci, et au moins un autre additif de carburant, ainsi qu'un procédé pour préparer une composition de carburant.
PCT/EP2006/067169 2005-10-12 2006-10-09 Utilisation de proteines en tant que composante antimousse dans des carburants WO2007042487A2 (fr)

Priority Applications (9)

Application Number Priority Date Filing Date Title
EP06793992A EP1941009A2 (fr) 2005-10-12 2006-10-09 Utilisation de proteines en tant que composante antimousse dans des carburants
JP2008535007A JP2009511689A (ja) 2005-10-12 2006-10-09 タンパク質の燃料の消泡剤成分としての利用
CA2625134A CA2625134C (fr) 2005-10-12 2006-10-09 Utilisation de proteines en tant que composante antimousse dans des carburants
AU2006301257A AU2006301257B2 (en) 2005-10-12 2006-10-09 Use of proteins as an antifoaming constituent in fuels
BRPI0617287-3A BRPI0617287A2 (pt) 2005-10-12 2006-10-09 uso de pelo menos uma hidrofobina ou de um derivado desta, processo para desespumar combustìvel, composição de aditivo, composição de combustìvel, e, processo para produzir pelo menos uma composição de combustìvel
US12/083,404 US8038740B2 (en) 2005-10-12 2006-10-09 Use of proteins as an antifoaming constituent in fuels
CN2006800460916A CN101326271B (zh) 2005-10-12 2006-10-09 蛋白质作为燃料中消泡剂成分的用途
NO20081618A NO20081618L (no) 2005-10-12 2008-04-02 Anvendelse av proteiner som en antiskumdannende komponent i drivstoff
KR1020087011264A KR101265375B1 (ko) 2005-10-12 2008-05-09 연료의 발포 방지 성분으로서의 단백질의 용도

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102005048720A DE102005048720A1 (de) 2005-10-12 2005-10-12 Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen
DE102005048720.3 2005-10-12

Publications (2)

Publication Number Publication Date
WO2007042487A2 true WO2007042487A2 (fr) 2007-04-19
WO2007042487A3 WO2007042487A3 (fr) 2007-05-31

Family

ID=37672197

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/067169 WO2007042487A2 (fr) 2005-10-12 2006-10-09 Utilisation de proteines en tant que composante antimousse dans des carburants

Country Status (12)

Country Link
US (1) US8038740B2 (fr)
EP (1) EP1941009A2 (fr)
JP (1) JP2009511689A (fr)
KR (1) KR101265375B1 (fr)
CN (1) CN101326271B (fr)
AU (1) AU2006301257B2 (fr)
BR (1) BRPI0617287A2 (fr)
CA (1) CA2625134C (fr)
DE (1) DE102005048720A1 (fr)
NO (1) NO20081618L (fr)
RU (1) RU2008118099A (fr)
WO (1) WO2007042487A2 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7799741B2 (en) 2005-04-01 2010-09-21 Basf Se Drilling mud containing hydrophobin
US7892788B2 (en) 2005-02-07 2011-02-22 Basf Se Hydrophobin fusion products, production and use thereof
US7910699B2 (en) 2005-06-10 2011-03-22 Basf Se Cysteine-depleted hydrophobin fusion proteins, their production and use thereof
US8038740B2 (en) 2005-10-12 2011-10-18 Basf Se Use of proteins as an antifoaming constituent in fuels
US8096484B2 (en) 2006-08-15 2012-01-17 Basf Se Method for the production of dry free-flowing hydrophobin preparations
JP2012505645A (ja) * 2008-10-16 2012-03-08 ユニリーバー・ナームローゼ・ベンノートシヤープ 消泡剤を含むハイドロフォビン溶液
US8535535B2 (en) 2005-04-01 2013-09-17 Basf Se Use of hydrophobin as a phase stabilizer
US8859106B2 (en) 2005-03-31 2014-10-14 Basf Se Use of polypeptides in the form of adhesive agents

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102005033002A1 (de) * 2005-07-14 2007-01-18 Basf Ag Wässrige Monomeremulsionen enthaltend Hydrophobin
ZA200800990B (en) * 2005-09-23 2009-08-26 Unilever Plc Process for producing a frozen aerated composition
WO2007039066A1 (fr) * 2005-09-23 2007-04-12 Unilever Plc Procédé de production d’une composition aérée congelée
EP1926389B8 (fr) * 2005-09-23 2009-03-04 Unilever PLC Produits aeres a faible ph
US8173716B2 (en) * 2007-03-06 2012-05-08 Basf Se Open-cell foam modified with hydrophobines
EP2042155A1 (fr) * 2007-09-28 2009-04-01 Basf Se Procédé de suppression de substances indissolubles dans l'eau de surfaces de substrat
KR20110137301A (ko) * 2009-03-09 2011-12-22 바스프 에스이 수성상 증점을 위한 수용성 중합체 및 하이드로포빈의 상승 혼합물의 용도
US8394444B2 (en) * 2009-05-29 2013-03-12 Conopco, Inc. Oil-in-water emulsion
US8357420B2 (en) * 2009-05-29 2013-01-22 Conopco, Inc. Oil-in-water emulsion
CA2704702C (fr) * 2009-06-02 2018-06-12 Unilever Plc Produits aeres cuits au four

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1010748A1 (fr) * 1998-12-15 2000-06-21 Ck Witco Corporation Composition antimousse de combustible diesel
WO2004000880A1 (fr) * 2002-06-21 2003-12-31 Applied Nanosystems B.V. Procede pour coller un compose sur une surface
WO2006103251A1 (fr) * 2005-04-01 2006-10-05 Basf Aktiengesellschaft Utilisation de proteines comme desemulsifants

Family Cites Families (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB195876A (en) 1922-04-25 1923-04-12 Sharples Specialty Co Process for resolving water-in-oil emulsions
US2399161A (en) 1942-06-30 1946-04-30 Claude R Wickard Process for producing glues and adhesives from keratin protein materials
GB1278924A (en) 1970-02-06 1972-06-21 Ici Ltd Improvements in synthetic film materials
DE2609104A1 (de) 1976-03-05 1977-09-15 Basf Ag Verfahren zur herstellung von styrol-suspensionspolymerisaten
DE2638839A1 (de) 1976-08-28 1978-03-02 Basf Ag Verfahren zur herstellung von styrol-suspensionspolymerisaten
JPS60206893A (ja) 1984-03-31 1985-10-18 Yoshinari Shimada 油中水滴型乳状燃料油の製造方法
US5049504A (en) 1986-11-24 1991-09-17 Genex Corporation Bioadhesive coding sequences
GB8508254D0 (en) 1985-03-29 1985-05-09 Dow Corning Ltd Foam control
JPS6323670A (ja) 1986-04-25 1988-01-30 バイオ−ポリマ−ズ　インコ−ポレ−テツド 接着・被覆組成物とその使用方法
IT209201Z2 (it) 1986-07-10 1988-09-20 Calzaturificio Tecnica Dispositivo di bloccaggio per scarpe e scarponi.
IT1196484B (it) 1986-07-11 1988-11-16 Sclavo Spa Vettore ad espressione e secrezione in lieviti,utile per la preparazione di proteine eterologhe
GB8918185D0 (en) 1989-08-09 1989-09-20 Secr Defence Ochrobactrum surfactant
DE4024871A1 (de) 1990-08-06 1992-02-13 Basf Ag Perlfoermige antistatische expandierbare styrolpolymerisate
GB2248068A (en) 1990-09-21 1992-03-25 Exxon Chemical Patents Inc Oil compositions and novel additives
JP3102934B2 (ja) 1991-11-13 2000-10-23 日石三菱株式会社 添加剤組成物およびその使用方法並びにディーゼル燃料
DE4220225A1 (de) 1992-06-20 1993-12-23 Basf Ag Verfahren zur Herstellung von perlförmigen expandierbaren Styrolpolymerisaten
AU2751092A (en) 1992-10-09 1994-05-09 Won Jae Yim A process for preparing emulsified fuel oil
FR2701490B1 (fr) 1993-02-16 1995-04-14 Inst Francais Du Petrole Procédé de production d'un mout de xanthane ayant une propriété améliorée, composition obtenue et application de la composition dans une boue de forage de puits.
JP3508157B2 (ja) 1993-05-19 2004-03-22 旭硝子株式会社 分裂酵母接合フェロモン前駆体遺伝子
DE69434368T2 (de) 1993-06-30 2005-10-20 General Electric Co. Leistungsfähige Dieselkraftstoffentschäumer mit einem geringen Silikongehalt
DE69426289T2 (de) 1993-12-10 2001-04-12 Korea Inst Sci & Tech Signalsequenzen für die Secretion heterologer Proteine von Hefe
JP3537487B2 (ja) 1994-04-27 2004-06-14 株式会社海洋バイオテクノロジー研究所 ムラサキイガイ接着蛋白質遺伝子
IL110938A (en) 1994-09-12 2001-01-28 Haber Meir Adhesive proteins isolated from mature macro and microalgae
EP0773296B1 (fr) 1995-02-03 2006-09-13 Asahi Glass Company Ltd. Gene de signal de secretion et vecteur d'expression comprenant ce signal
JPH08266281A (ja) 1995-03-31 1996-10-15 Kaiyo Bio Technol Kenkyusho:Kk イガイ接着蛋白質遺伝子
WO1996041882A1 (fr) 1995-06-12 1996-12-27 Proefstation Voor De Champignoncultuur Hydrophobines de champignons commestibles, genes, sequences nucleotidiques, fragments d'adn codant pour lesdites hydrophobines et leur expression
WO1999023223A1 (fr) 1997-10-31 1999-05-14 Asahi Glass Company Ltd. Gene promoteur d'induction et gene de signal de secretion utilisables dans le schizosaccharomyces pombe, vecteurs d'expression comportant ces genes et utilisation des ces derniers
US6572845B2 (en) 1998-10-16 2003-06-03 Burt D. Ensley Recombinant hair treatment compositions
US7060669B1 (en) 1999-03-25 2006-06-13 Valtion Teknillinen Tutkimuskeskus Process for partitioning of proteins
FI108863B (fi) 1999-08-20 2002-04-15 Valtion Teknillinen Parannettu biotekninen tuotantomenetelmä
DE19942539A1 (de) 1999-09-07 2001-03-08 Cognis Deutschland Gmbh Waschmittel
DE19956802A1 (de) 1999-11-25 2001-06-13 Cognis Deutschland Gmbh Waschmitteltabletten
GB0002663D0 (en) 2000-02-04 2000-03-29 Biomade B V Method of stabalizing a hydrophobin-containing solution and a method of coating a surface with a hydrophobin
GB0002660D0 (en) 2000-02-04 2000-03-29 Biomade B V Method of stabilizing a hydrophobin-containing solution and a method of coatinga surface with a hydrophobin
FR2805278B1 (fr) 2000-02-17 2006-09-29 Chalen Papier Europ Service Compositions utiles comme surfactants et leurs utilisations
GB0007770D0 (en) 2000-03-30 2000-05-17 Biomade B V Protein capable of self-assembly at a hydrophobic hydrophillic interface, method of coating a surface, method of stabilizing a dispersion, method of stabilizi
WO2002020651A2 (fr) 2000-09-06 2002-03-14 Zymogenetics, Inc. Polypeptide de phéromone humaine
DE10061280A1 (de) 2000-12-08 2002-06-13 Novaprot Gmbh Reinigungswirksame, grenzflächenaktive Kombination aus nachwachsenden Rohstoffen mit hoher Fettlösekraft
GB0030038D0 (en) 2000-12-08 2001-01-24 Univ Warwick Yeast-based assay
EP1279742A1 (fr) 2001-07-23 2003-01-29 Applied NanoSystems B.V. Procédé de fixation d' un produit sur la surface d' un détecteur à l' aide d' hydrophobin
EP1430090A4 (fr) 2001-08-31 2006-10-11 Keratec Ltd Production de materiaux biopolymeres sous forme de films, de fibres, de mousses ou d'adhesifs, a partir de derives de keratine s-sulfonee
AT410669B (de) 2001-10-11 2003-06-25 Bcd Rohstoffe F Bauchemie Hand Sprühgetrocknete dispersionen, verfahren zu ihrer herstellung und deren anwendung
FR2833490B1 (fr) * 2001-12-14 2004-12-10 Oreal Utilisition cosmetique d'au moins une hydrophobine pour le traitement des matieres keratiniques et compositions mises en oeuvre
US7186690B2 (en) 2002-03-26 2007-03-06 Biopolymer Products Of Sweden Ab Method for attaching two surfaces to each other using a bioadhesive polyphenolic protein and periodate ions
DE10314853A1 (de) 2003-04-02 2004-10-14 Goldschmidt Ag Organofunktionell modifizierte Polysiloxane und ihre Verwendung zum Entschäumen von flüssigen Kraftstoffen
DE10342794A1 (de) 2003-09-16 2005-04-21 Basf Ag Sekretion von Proteinen aus Hefen
CN1909979A (zh) 2004-01-16 2007-02-07 应用超微系统股份有限公司 在低温下用疏水蛋白涂覆物体的方法
NZ551366A (en) 2004-05-24 2009-01-31 Basf Ag Keratin-binding polypeptides
DE102004025805A1 (de) 2004-05-24 2005-12-29 Basf Ag Keratin-bindende Effektormoleküle
US7241734B2 (en) 2004-08-18 2007-07-10 E. I. Du Pont De Nemours And Company Thermophilic hydrophobin proteins and applications for surface modification
CA2596661C (fr) 2005-02-07 2013-12-10 Basf Aktiengesellschaft Nouvelles proteines de fusion d'hydrophobine, leur production et leur utilisation
KR101250105B1 (ko) 2005-03-30 2013-04-03 바스프 에스이 경화 광물 건축 재료, 천연석, 인조석 및 세라믹의 표면처리를 위한 하이드로포빈의 용도
ATE483009T1 (de) 2005-03-30 2010-10-15 Basf Se Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen
US8859106B2 (en) 2005-03-31 2014-10-14 Basf Se Use of polypeptides in the form of adhesive agents
EP1868700A2 (fr) * 2005-04-01 2007-12-26 Basf Aktiengesellschaft Utilisation d'hydrophobine comme stabilisateur de phases
DK1869138T3 (da) 2005-04-01 2010-03-01 Basf Se Borevæske indeholdende hydrophobin
DE102005027039A1 (de) 2005-06-10 2006-12-21 Basf Ag Hydrophobin als Beschichtungsmittel für expandierbare oder expandierte, thermoplastische Polymerpartikel
DE102005027139A1 (de) 2005-06-10 2006-12-28 Basf Ag Neue Cystein-verarmte Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005029704A1 (de) 2005-06-24 2007-01-11 Basf Ag Verwendung von Hydrophobin-Polypeptiden sowie Konjugaten aus Hydrophobin-Polypeptiden mit Wirk-oder Effektstoffen und ihre Herstellung sowie deren Einsatz in der Kosmetik
DE102005033002A1 (de) 2005-07-14 2007-01-18 Basf Ag Wässrige Monomeremulsionen enthaltend Hydrophobin
JP5105441B2 (ja) 2005-08-01 2012-12-26 ビーエーエスエフ ソシエタス・ヨーロピア 界面活性非酵素タンパク質の織布洗浄への利用
DE102005048720A1 (de) 2005-10-12 2007-04-19 Basf Ag Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1010748A1 (fr) * 1998-12-15 2000-06-21 Ck Witco Corporation Composition antimousse de combustible diesel
WO2004000880A1 (fr) * 2002-06-21 2003-12-31 Applied Nanosystems B.V. Procede pour coller un compose sur une surface
WO2006103251A1 (fr) * 2005-04-01 2006-10-05 Basf Aktiengesellschaft Utilisation de proteines comme desemulsifants

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
HEKTOR ET AL: "Hydrophobins: proteins with potential" CURRENT OPINION IN BIOTECHNOLOGY, LONDON, GB, Bd. 16, Nr. 4, August 2005 (2005-08), Seiten 434-439, XP005006169 ISSN: 0958-1669 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7892788B2 (en) 2005-02-07 2011-02-22 Basf Se Hydrophobin fusion products, production and use thereof
US8859106B2 (en) 2005-03-31 2014-10-14 Basf Se Use of polypeptides in the form of adhesive agents
US7799741B2 (en) 2005-04-01 2010-09-21 Basf Se Drilling mud containing hydrophobin
US8535535B2 (en) 2005-04-01 2013-09-17 Basf Se Use of hydrophobin as a phase stabilizer
US7910699B2 (en) 2005-06-10 2011-03-22 Basf Se Cysteine-depleted hydrophobin fusion proteins, their production and use thereof
US8038740B2 (en) 2005-10-12 2011-10-18 Basf Se Use of proteins as an antifoaming constituent in fuels
US8096484B2 (en) 2006-08-15 2012-01-17 Basf Se Method for the production of dry free-flowing hydrophobin preparations
JP2012505645A (ja) * 2008-10-16 2012-03-08 ユニリーバー・ナームローゼ・ベンノートシヤープ 消泡剤を含むハイドロフォビン溶液

Also Published As

Publication number Publication date
BRPI0617287A2 (pt) 2013-01-01
DE102005048720A1 (de) 2007-04-19
AU2006301257A1 (en) 2007-04-19
RU2008118099A (ru) 2009-11-20
US20090241413A1 (en) 2009-10-01
CA2625134C (fr) 2013-02-05
CN101326271A (zh) 2008-12-17
AU2006301257B2 (en) 2011-12-01
JP2009511689A (ja) 2009-03-19
CA2625134A1 (fr) 2007-04-19
CN101326271B (zh) 2012-06-13
EP1941009A2 (fr) 2008-07-09
KR101265375B1 (ko) 2013-05-22
NO20081618L (no) 2008-07-08
WO2007042487A3 (fr) 2007-05-31
US8038740B2 (en) 2011-10-18
KR20080059439A (ko) 2008-06-27

Similar Documents

Publication Publication Date Title
WO2007042487A2 (fr) Utilisation de proteines en tant que composante antimousse dans des carburants
EP1868698A1 (fr) Utilisation de proteines comme desemulsifants
EP1869138B1 (fr) Lavage de forage au moyen d'hydrophobine
EP1868700A2 (fr) Utilisation d'hydrophobine comme stabilisateur de phases
EP1848733B1 (fr) Nouvelles proteines de fusion d'hydrophobine, leur production et leur utilisation
EP1866401A1 (fr) Utilisation d'hydrophobines pour le traitement antisalissant de surfaces dures
MX2007011134A (es) Sistema de elevador.
EP1848734A2 (fr) Procede pour enduire des surfaces avec des hydrophobines
WO2006128877A1 (fr) Procede de reduction de la vitesse d'evaporation de liquides
MX2008004720A (es) Uso de proteinas como un constituyente antiespumante en combustibles

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200680046091.6

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2625134

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 12083404

Country of ref document: US

Ref document number: MX/a/2008/004720

Country of ref document: MX

Ref document number: 2006301257

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2008535007

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2006793992

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2006301257

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 1020087011264

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2008118099

Country of ref document: RU

WWP Wipo information: published in national office

Ref document number: 2006793992

Country of ref document: EP

ENP Entry into the national phase

Ref document number: PI0617287

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20080411