WO2006128877A1 - Procede de reduction de la vitesse d'evaporation de liquides - Google Patents

Procede de reduction de la vitesse d'evaporation de liquides Download PDF

Info

Publication number
WO2006128877A1
WO2006128877A1 PCT/EP2006/062735 EP2006062735W WO2006128877A1 WO 2006128877 A1 WO2006128877 A1 WO 2006128877A1 EP 2006062735 W EP2006062735 W EP 2006062735W WO 2006128877 A1 WO2006128877 A1 WO 2006128877A1
Authority
WO
WIPO (PCT)
Prior art keywords
liquid
hydrophobin
barrier
water
hydrophobins
Prior art date
Application number
PCT/EP2006/062735
Other languages
German (de)
English (en)
Inventor
Thorsten Montag
Ulrich Karl
Ulf Baus
Claus Bollschweiler
Thomas Subkowski
Hans-Georg Lemaire
Marvin Karos
Original Assignee
Basf Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Basf Aktiengesellschaft filed Critical Basf Aktiengesellschaft
Priority to AU2006254154A priority Critical patent/AU2006254154B2/en
Publication of WO2006128877A1 publication Critical patent/WO2006128877A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F1/00—Treatment of water, waste water, or sewage
    • C02F1/68—Treatment of water, waste water, or sewage by addition of specified substances, e.g. trace elements, for ameliorating potable water
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01J—CHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J19/00—Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J19/16—Preventing evaporation or oxidation of non-metallic liquids by applying a floating layer, e.g. of microballoons
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B65—CONVEYING; PACKING; STORING; HANDLING THIN OR FILAMENTARY MATERIAL
    • B65D—CONTAINERS FOR STORAGE OR TRANSPORT OF ARTICLES OR MATERIALS, e.g. BAGS, BARRELS, BOTTLES, BOXES, CANS, CARTONS, CRATES, DRUMS, JARS, TANKS, HOPPERS, FORWARDING CONTAINERS; ACCESSORIES, CLOSURES, OR FITTINGS THEREFOR; PACKAGING ELEMENTS; PACKAGES
    • B65D90/00—Component parts, details or accessories for large containers
    • B65D90/22—Safety features
    • B65D90/38—Means for reducing the vapour space or for reducing the formation of vapour within containers
    • B65D90/42—Means for reducing the vapour space or for reducing the formation of vapour within containers by use of particular materials for covering surface of liquids
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2103/00—Nature of the water, waste water, sewage or sludge to be treated
    • C02F2103/02—Non-contaminated water, e.g. for industrial water supply
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
    • Y02W90/00—Enabling technologies or technologies with a potential or indirect contribution to greenhouse gas [GHG] emissions mitigation
    • Y02W90/10—Bio-packaging, e.g. packing containers made from renewable resources or bio-plastics

Definitions

  • the invention relates to a method for reducing the evaporation rate of liquids in which at least one hydrophobin is used as auxiliary.
  • Industrial water is required for certain mining techniques, for example in the diamond, gold or silver mining in large quantities, in particular for processing and separation of recyclables from overburden.
  • Such mining areas are often in hot, arid or semi-arid areas where water is scarce and often has to be transported to the mining areas with great effort.
  • Industrial water is therefore usually used multiple times and stored between individual applications. As a rule, storage takes place in open liquid reservoirs such as reservoirs or the like.
  • Hydrophobins are small proteins of about 100 to 150 amino acids, which are characteristic of filamentous fungi, for example Schizophyllum commune.
  • Hydrophobins have a marked affinity for interfaces and are therefore suitable for coating surfaces.
  • Teflon can be coated by means of hydrophobins to obtain a hydrophilic surface.
  • Hydrophobins can be isolated from natural sources.
  • Our earlier application DE 102005007480.4 discloses a production process for hydrophobins.
  • WO 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active substances, for hydrophilicizing hydrophobic surfaces, for improving the water resistance of hydrophilic substrates, for producing oil-in-water emulsions or for water-in-oil emulsions.
  • pharmaceutical applications such as the production of ointments or creams as well cosmetic applications such as skin protection or the production of hair shampoos or hair rinses.
  • EP 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for carrying out experiments or for storage, hull fumes, solid particles or frame or body of passenger cars with a solution containing hydrophobins at a temperature of 30 to 80 0 C. ,
  • WO 03/53383 discloses the use of hydrophobin for treating keratin materials in cosmetic applications.
  • WO 03/10331 discloses a hydrophobin-coated sensor, for example a measuring electrode, to which non-covalently further substances, e.g. electroactive substances, antibodies or enzymes are bound.
  • the object of the invention was to provide an improved method for reducing the evaporation rate of liquids, in particular liquids in open liquid reservoirs.
  • a method for reducing the evaporation rate of liquids (F) has been found by covering the surface of the liquid (F) with a barrier liquid (S) which is immiscible with the latter and which has a higher boiling point and a lower density than the liquid. wherein the liquid (F) and / or the barrier liquid (S) is added as auxiliary at least one hydrophobin.
  • the liquid (F) is water. It is preferably a liquid in an open liquid reservoir.
  • liquid reservoirs which have at least one liquid (F) and a barrier liquid (S) which has a higher boiling point and a lower density than the liquid (F) and is immiscible with the surface Cover liquid (F) covered, wherein the liquid reservoir further comprises at least one hydrophobin.
  • the use of hydrophobins has been found as a fluid barrier agent adjunct. Surprisingly, it has been found that the evaporation rate of the liquid (F) can be drastically reduced by the use of hydrophobins. In a typical embodiment of the invention, more than 60% of the original liquid was evaporated in an open liquid reservoir without the use of hydrophobins after 20 days. When using hydrophobins as additive vaporized in the same time only about 13 wt.% Of the originally existing liquid.
  • the liquid (F) to be protected from evaporation can be any desired aqueous or organic liquid. Of course, it can also be a mixture of different substances. However, it is preferably water, for example drinking water, process water, industrial water or seawater. As a rule, these are effluents or industrial waters that are to be reused from industrial, technical processes.
  • water should not be restricted to chemically pure water, but the water may also contain other components dissolved, dispersed or suspended, for example, the water may be dissolved salts or sludges, for example from Abraum or components of overburden or else containing water-miscible organic solvents.
  • the liquid can be arranged arbitrarily.
  • it may be water in seas or lakes or liquids filled in any devices.
  • the liquid is in an open liquid reservoir.
  • open liquid reservoir in the sense of this invention means a liquid reservoir which is not completely sealed off from the environment, but is still in contact with the environment, so that the liquid can in principle evaporate and get into the environment
  • it may be a tank that has an unclosed orifice, but it is usually a reservoir that does not cover the entire surface of the fluid, either natural or artificially created fluid reservoirs
  • Such open liquid reservoirs include storage lakes, reservoirs, cisterns, open storage tanks or so-called lagoons.
  • the surface of the liquid (F) is covered with a barrier liquid (S) immiscible therewith.
  • the barrier liquid may of course also be a mixture of different substances.
  • the term "immiscible" means that no significant quantities of the barrier liquid should dissolve in the liquid, and of course does not exclude traces or insignificant amounts could be solved.
  • the barrier liquid naturally has a lower density than the liquid whose evaporation is to be delayed.
  • the barrier liquid also has a higher boiling point or boiling range, as the liquid whose evaporation is to be delayed.
  • nonpolar or substantially nonpolar liquids have proven to be a barrier liquid.
  • examples include in particular hydrocarbons or mixtures of hydrocarbons.
  • the boiling point of hydrocarbons used is chosen by the person skilled in the art. Proven a boiling point of at least 150 0 C. In the case of mixtures having this figure refers to the UN teralia the boiling range, where possible contaminants are not considered with volatile compounds.
  • Such mixtures include high boiling paraffinic, naphthenic and aromatic mineral oils.
  • mineral oils are obtained by vacuum distillation from petroleum. Preference is given to high-boiling, essentially paraffinic and / or naphthenic mineral oils.
  • Such mineral oils are also referred to as white oils, with the person skilled in the art distinguishing between technical white oils which may still have a low aromatics content and medicinal white oils which are substantially free of aromatics.
  • Other examples include petroleum benzine or diesel oil.
  • oils examples include soybean oil, wood oil, tall oil, safflower oil, ricineal oil, rapeseed oil or linseed oil.
  • derivatives of such oils can also be used. Examples include esters such as rapeseed oil methyl ester or tall oil fatty acid esters.
  • the liquid surface is covered with the barrier liquid (S).
  • the quantity of barrier liquid is dimensioned by a person skilled in the art in such a way that, on the one hand, complete coverage of the liquid surface is ensured, but on the other hand an excessive amount of barrier liquid is avoided.
  • the thickness of the barrier layer should not be more than 2 mm, preferably not more than 1 mm, without higher thicknesses in principle being excluded therefrom.
  • layer thicknesses of from 0.1 to 1 mm, preferably from 0.2 to 0.9 mm and particularly preferably from 0.3 to 0.8 mm have proven useful.
  • at least one hydrophobin is added as auxiliary to the liquid (F) and / or the barrier layer. Of course, mixtures of different hydrophobins can be used.
  • hydrophobins in the context of this invention is intended below to mean proteins of the general structural formula (I)
  • X is selected for each of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, He Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, GIy) can stand.
  • X may be the same or different.
  • the indices standing at X each represent the number of amino acids
  • C stands for cysteine, alanine, serine, glycine, methionine or threonine, wherein at least four of the amino acids C are cysteine
  • the indices n and m are independently natural Numbers from 0 to 500, preferably from 15 to 300.
  • the polypetides according to formula (I) are further characterized by the property that at room temperature, after coating a glass surface, they increase the contact angle of a water droplet by at least 20 °, preferably at least 25 ° and particularly preferably 30 °, respectively Contact angle of an equal drop of water with the uncoated glass surface.
  • the amino acids designated C 1 to C 8 are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C 1 to C 8 should consist of cysteines. Cysteines can either be reduced in the proteins used according to the invention or form disulfide bridges with one another. Particularly preferred is the intramolecular formation of CC bridges, in particular those with at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.
  • cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions indicated by X, the numbering of the individual C-positions in the general formulas may change accordingly. Preference is given to hydrophobins of the general formula (II)
  • X, C and the indices standing at X and C are as defined above, however, the indices n and m are numbers from 0 to 300, and the proteins are further characterized by the above-mentioned contact angle change.
  • X, C and the indices standing at X and C have the above meaning
  • the indices n and m are numbers from 0 to 200
  • the proteins continue to be distinguished by the above-mentioned contact angle change, and further at least 6 of amino acids C is cysteine. Most preferably, all amino acids C are cysteine.
  • radicals X n and X m may be peptide sequences that are naturally linked to a hydrophobin. However, one or both residues may also be peptide sequences that are not naturally linked to a hydrophobin. Including such radicals X N and / or X are m to understand, in which a naturally occurring in a hydrophobin peptide sequence is extended tidsequenz by a non-naturally occurring in a hydrophobin.
  • X n and / or X m are naturally non-hydrophobin-linked peptide sequences, such sequences are generally at least 20, preferably at least 35, more preferably at least 50, and most preferably at least 100 amino acids in length.
  • Such a residue, which is not naturally linked to a hydrophobin will also be referred to below as a fusion partner.
  • the proteins can consist of at least one hydrophobin part and one fusion partner, which do not occur together in nature in this form.
  • the fusion partner can be selected from a variety of proteins. It is also possible to link a plurality of fusion partners with a hydrophobin part, for example at the amino terminus (X n ) and at the carboxy terminus (X m ) of the hydrophobin part. However, it is also possible, for example, to link two fusion partner parts with a position (X n or X m ) of the protein according to the invention. Particularly suitable fusion partner parts are proteins which occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis. Examples of such fusion partner parts are the sequences yaad (SEQ ID NO: 15 and 16), ya ae (SEQ ID NO: 17 and 18), and thioredoxin.
  • fragments or derivatives of said sequences which comprise only a part, preferably 70 to 99%, particularly preferably 80 to 98% of said sequences, or in which individual amino acids or nucleotides are changed with respect to said sequence, wherein the percentages in each case refers to the number of amino acids.
  • the fusion hydrophobin in addition to the fusion partner, also has a so-called affinity domain (affinity tag / affinity tail) as a group X n or X m .
  • affinity domains include (His) k, (Arg) k, (Asp) k,
  • (Phe) k or (Cys) k groups where k is generally a natural number from 1 to 10. It may preferably be a (His) k group, where k is 4 to 6.
  • proteins used according to the invention may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical crosslinking, for example with glutaraldehyde.
  • One property of the proteins used in the invention is the change in surface properties when the surfaces are coated with the proteins.
  • the change in the surface properties can be determined experimentally by measuring the contact angle of a water drop before and after the coating of the surface with the protein and determining the difference between the two measurements.
  • contact angle measurements is known in principle to the person skilled in the art.
  • the measurements refer to room temperature and water drops of 5 tf I.
  • the exact experimental conditions for an exemplary method for measuring the contact angle are shown in the experimental part.
  • the proteins used according to the invention have the property of increasing the contact angle by at least 20 °, preferably at least 25 °, particularly preferably at least 30 °, in each case compared with the contact angle of a water droplet of the same size with the uncoated glass surface.
  • the assembled membranes of class I hydrophobins are highly insoluble (even against 1% Na dodecyl sulfate (SDS) at elevated temperature) and can only be dissociated by concentrated trifluoroacetic acid (TFA) or formic acid.
  • the assembled forms of class II hydrophobins are less stable. They can already be redissolved by 60% ethanol or 1% SDS (at room temperature).
  • a comparison of the amino acid sequences shows that the length of the region between cysteine C 3 and C 4 in class II hydrophobins is significantly shorter than in class I hydrophobins.
  • Class II hydrophobins also have more charged amino acids than class I.
  • hydrophobins for carrying out the present invention are the hydrophobins of the type dewA, rodA, hypA, hypB, sc3, basF, basf2, which are structurally characterized in the sequence listing below. It may also be just parts or derivatives thereof. Also, several hydrophobin moieties, preferably 2 or 3, of the same or different structure can be linked together and linked to a corresponding suitable polypeptide sequence that is not naturally linked to a hydrophobin.
  • fusion proteins yaad-XadewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basfl-he (SEQ ID NO: 24 ) with the polypeptide sequences given in parentheses and the nucleic acid sequences coding therefor, in particular the sequences according to SEQ ID NO: 19, 21, 23.
  • proteins which, starting from the sequences shown in SEQ ID NO. 20, 22 or 24 represented by exchange, insertion or deletion of at least one, up to 10, preferably 5, particularly preferably 5% of all
  • Amino acids give, and still possess the biological property of the starting proteins to at least 50%, are particularly preferred embodiments.
  • the biological property of the proteins is hereby understood as the change in the contact angle already described by at least 20 °.
  • Particularly suitable for carrying out the invention derivatives are from yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basfl-his (SEQ ID NO : 24) residues derived by truncation of the yaad fusion partner.
  • yaad fusion partner SEQ ID NO: 16
  • a shortened yaad residue can be used.
  • the truncated residue should comprise at least 20, preferably at least 35, amino acids.
  • can a truncated radical having 20 to 293, preferably 25 to 250, more preferably 35 to 150 and for example 35 to 100 amino acids are used.
  • the proteins used according to the invention can be prepared chemically by known methods of peptide synthesis, for example by solid-phase synthesis according to Merri- field.
  • Naturally occurring hydrophobins can be isolated from natural sources by suitable methods. As an example, let Wösten et. al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882.
  • fusion proteins can preferably be carried out by genetic engineering methods in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence.
  • a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence.
  • Suitable host organisms (production organisms) for said production process may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus. megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells), and the like.
  • prokaryotes including archaea
  • eukaryotes especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus. megaterium,
  • the invention furthermore relates to the use of expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide used according to the invention, as well as vectors comprising at least one of these expression constructs.
  • constructs employed include a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream, and optionally other common regulatory elements, each operably linked to the coding sequence.
  • Operaational linkage is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements in such a way that each of the regulatory elements can fulfill its function in the expression of the coding sequence as intended.
  • operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like.
  • Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. In Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • a preferred nucleic acid construct advantageously also contains one or more of the abovementioned "enhancer” sequences, functionally linked to the promoter, which allow increased expression of the nucleic acid sequence, and additional advantageous sequences may also be inserted at the 3 'end of the DNA sequences additional regulatory elements or terminators.
  • the nucleic acids may be contained in one or more copies in the construct.
  • the construct may also contain further markers, such as antibiotic resistances or genes that complement xanthropy, optionally for selection on the construct.
  • Advantageous regulatory sequences for the process are, for example, in promoters such as cos, tac, trp, tet, trp, tet, lpp, lac, lpp-lac, laclq-T7, T5, T3 , gal, trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which find utility in gram-negative bacteria.
  • Further advantageous regulatory sequences are contained, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.
  • the nucleic acid construct is advantageously inserted into a host organism for expression in a vector, such as a plasmid or a phage, which allows optimal expression of the genes in the host.
  • a vector such as a plasmid or a phage
  • all other vectors known to the person skilled in the art ie, z.
  • viruses such as SV40, CMV, baculovirus and adenovirus, Transposons.lS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system to understand.
  • These vectors can be autonomously replicated in the host organism or replicated chromosomally. These vectors represent a further embodiment of the invention.
  • Suitable plasmids are described, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, plN-III "3-B1, tgt11 or pBdCI, in Streptomycespl J101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium for pSA77 or pAJ667, in fungi pALS1, pIL12 or pBB116, in yeasts 2alpha, pAG-1, YEp6, YEp13 or pEMBLYe23 or in plants pLGV23, pGHIac +, p
  • nucleic acid construct for expression of the further genes contained additionally 3'- and / or 5'-terminal regulatory sequences to increase the expression, which are selected depending on the selected host organism and gene or genes for optimal expression.
  • genes and protein expression are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
  • the regulatory sequences or factors may preferably have a positive effect on the gene expression of the introduced genes and thereby increase it.
  • enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers.
  • an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
  • the vector containing the nucleic acid construct or the nucleic acid can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination.
  • This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.
  • nucleic acid sequences For optimal expression of heterologous genes in organisms, it is advantageous to modify the nucleic acid sequences according to the specific "codon usage" used in the organism.
  • the "codon usage” can be easily determined by computer evaluations of other known genes of the organism concerned.
  • the production of an expression cassette is carried out by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator or polyadenylation signal. Common recombinant and cloning techniques are used, as described, for example, in T. Maniatis, EFFritsch and J.
  • the recombinant nucleic acid construct or gene construct is inserted for expression in a suitable host organism, advantageously into a host-specific vector which enables optimal expression of the genes in the host.
  • Vectors are well known to those skilled in the art and may be taken, for example, from "Cloning Vectors" (Pouwels P.H. et al., Eds., Elsevier, Amsterdam-New York-Oxford, 1985).
  • recombinant microorganisms can be produced, which are transformed, for example, with at least one vector and can be used to produce the proteins used in the invention.
  • the recombinant constructs described above are introduced into a suitable host system and expressed.
  • Suitable systems are described, for example, in Current Protocols in Molecular Biology, F.Ausubel et al., Ed., Wiley Interscience, New York 1997, or Sambrook et al. Molecular Cloning: A Laboratory Manual. 2nd ed., Colard Spring Harbor Laboratory, Col. Spring Harbor Laboratory Press, Col. Spring Harbor, NY, 1989.
  • Homologously recombined microorganisms can also be produced.
  • a vector is prepared which contains at least a portion of a gene or a coding sequence to be used according to the invention, wherein optionally at least one amino acid deletion, addition or substitution has been introduced to alter the sequence, e.g. B. functionally disrupted ("knockout" - vector).
  • the introduced sequence can, for. Also be a homologue from a related microorganism or be derived from a mammalian, yeast or insect source.
  • the vector used for homologous recombination may be designed such that the endogenous gene is mutated or otherwise altered upon homologous recombination but still encodes the functional protein (eg, the upstream regulatory region may be altered such that expression the endogenous protein is changed).
  • the modified section of the invented The gene used according to the invention is in the homologous recombination vector.
  • suitable vectors for homologous recombination is e.g. As described in Thomas, KR and Capecchi, MR (1987) Cell 51: 503.
  • prokaryotic or eukaryotic organisms are suitable as recombinant host organisms for the nucleic acid or nucleic acid construct used according to the invention.
  • microorganisms such as bacteria, fungi or yeast are used as host organisms.
  • Gram-positive or Gram-negative bacteria preferably bacteria of the families Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, more preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus are used.
  • Microorganisms are usually in a liquid medium containing a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts and optionally vitamins, at temperatures between 0 and 100 0 C, preferably between 10 to 60 0 C attracted under oxygen fumigation.
  • a carbon source usually in the form of sugars
  • a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate
  • trace elements such as iron, manganese and magnesium salts and optionally vitamins
  • the pH of the nutrient fluid can be kept at a fixed value, that is, regulated during the cultivation or not.
  • the cultivation can be done batchwise, semi-batchwise or continuously.
  • Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously.
  • the enzymes may be isolated from the organisms by the method described
  • Proteins or functional, biologically active fragments thereof used according to the invention can be produced by means of a recombinant process in which a protein-producing microorganism is cultivated, optionally the expression of the proteins is induced and these are isolated from the culture.
  • the proteins can thus also be produced on an industrial scale, if desired.
  • the recombinant microorganism can be cultured and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 0 C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Colard Spring Harbor Laboratory, ColD Spring Harbor, NY (1989).
  • the cells are disrupted and the product is known Protein isolation method recovered from the lysate.
  • the cells can optionally by high-frequency ultrasound, by high pressure, such as. B. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by combining several of the listed methods are digested.
  • Purification of the proteins used according to the invention can be achieved by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, and by other conventional methods, such as ultrafiltration, crystallization Salting out, dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, F.G., Biochemische Harvey Méen, Verlag Water de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
  • vector systems or oligonucleotides for the isolation of the recombinant protein, which extend the cDNA by certain nucleotide sequences and thus code for altered proteins or fusion proteins, which serve for example a simpler purification.
  • suitable modifications include so-called "tags" as anchors, such as the modification known as hexa-histidine anchors, or epitopes that can be recognized as antigens of antibodies (described, for example, in Harlow, E. and Lane, D., 1988 , Antibodies: A Laboratory Manual, CoId Spring Harbor (NY) Press).
  • tags are e.g.
  • HA calmodulin BD
  • GST GST
  • MBD Chitin-BD
  • Steptavidin-BD-Avi-Tag Flag-Tag
  • T7 T7 etc.
  • anchors can be used to attach the proteins to a solid support, such as.
  • a polymer matrix serve, which may be filled for example in a chromatography column, or may be used on a microtiter plate or other carrier.
  • the corresponding purification protocols are available from the commercial affinity tag providers.
  • the proteins prepared as described can be used both directly as fusion proteins and after cleavage and separation of the fusion partner as "pure" hydrophobins.
  • a potential cleavage site (specific recognition site for proteases) in the fusion protein between the hydrophobin part and the fusion partner part.
  • Suitable cleavage sites are, in particular, those peptide sequences which are otherwise found neither in the hydrophobin part nor in the fusion partner part, which can easily be determined with bioinformatic tools. Particularly suitable are, for example, BrCN cleavage on methionine, or protease-mediated cleavage with factor Xa, enterokinase, thrombin, TEV cleavage (Tobacco etch virus protease).
  • the choice of hydrophobins for carrying out the invention is not limited. The skilled person makes a suitable choice. Fusionproteins such as yaad-Xa-dewA-his (SEQ ID NO: 19) or yaad-Xa-rodA-his (SEQ ID NO: 21) have proven particularly useful.
  • the hydrophobins can advantageously be used to carry out the invention as aqueous formulations.
  • preference may be given to using the aqueous solutions obtained in the synthesis and / or isolation.
  • water-miscible organic solvents can also be added to the aqueous formulations.
  • solvents include water-miscible alcohols, such as, for example, ethanol, propanol or ethylene glycol.
  • hydrophobins can also initially be isolated as a substance, for example by freeze-drying, and used as such or else dissolved in a nonaqueous solvent or corresponding formulations based on nonaqueous solvents.
  • hydrophobin formulations used according to the invention may also comprise further auxiliaries and additives.
  • auxiliaries and additives include surfactants, buffers, solvents, preservatives such as protease inhibitors, stabilizers such as proteins, sugars or sugar derivatives, alcohols or water-soluble polymers.
  • concentration of hydrophobins in the formulation is chosen by the skilled person. Proven concentrations have been from 0.001 ppm to 10%.
  • the hydrophobins can be added to the liquid (F) and / or the barrier layer. This can be done by simply mixing the hydrophobin or preferably a suitable hydrophobin formulation with the liquid and / or the barrier liquid.
  • the addition of hydrophobin can be done before covering the liquid surface with the barrier liquid, or only afterwards.
  • only the surface of the liquid can be treated with the hydrophobin. This can be done, for example, by spraying the surface, in particular a water surface, with a hydrophobin solution before covering it with the barrier liquid. It is also possible to spray a surface already covered with the barrier liquid with a hydrophobin formulation.
  • the hyrophobin is dissolved or suspended in the liquid before the barrier liquid is applied.
  • hydrophobins Even small amounts of hydrophobins are sufficient to effect evaporation delay according to the invention.
  • the amount of hydrophobins is from the Professional determined. Proven amounts of about 1 to 10 g / m 2 surface, preferably 3 to 8 g / m 2 have .
  • the invention is particularly suitable for protecting industrial water from evaporation, for example, water stored in reservoirs or the like for mining applications.
  • hydrophobins can preferably be used in biodegradable systems, for example by using a biologically readily degradable liquid, such as a naturally occurring, vegetable, animal or bacterial oil, as the barrier liquid.
  • a biologically readily degradable liquid such as a naturally occurring, vegetable, animal or bacterial oil
  • examples include rapeseed oil or so-called “bio-diesel”.
  • Part A Preparation and test of the hydrophobins used in the invention
  • Oligonucleotides Hal570 and Hal571 were used to perform a polymerase chain reaction.
  • the PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site.
  • the PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII.
  • This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BglI.
  • the resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HISe and YAAE :: HIS 6 , respectively.
  • Hal570 gcgcgcccatggctcaaacaggtactga
  • Hal571 gcagatctccagccgcgttcttgcatac
  • Hal572 ggccatgggattaacaataggtgtactagg
  • Hal573 gcagatcttacaagtgccttttgcttatattcc
  • the oligonucleotides KaM 416 and KaM 417 Using the oligonucleotides KaM 416 and KaM 417, a polymerase chain reaction was carried out.
  • the template DNA used was genomic DNA of the mold Aspergillus nidulans.
  • the resulting PCR fragment contained the coding sequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase cleavage site.
  • the PCR fragment was purified and cut with the restriction endonuclease BamHI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD # 2 previously linearized with the restriction endonuclease BgIII.
  • the resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS 6 .
  • KaM416 GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
  • plasmid # 513 The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
  • KaM434 GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
  • plasmid # 507 The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • Plasmid # 506 The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
  • Plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.
  • the template DNA used was Schyzophyllum commune cDNA (see Appendix).
  • KaM464 CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
  • KaM465 GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
  • 100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 mM sodium phosphate buffer, pH 7.5 and resuspended.
  • the suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then incubated for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) to break down the nucleic acids.
  • filter with a glass cartridge P1.
  • two homogenizer runs are carried out at 1500 bar (Microfluidizer M-110EH, Microfluidics Corp.).
  • the homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , Centrifugation and resuspension are repeated 3 times with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stir for one hour and perform a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g).
  • the hydrophobin is contained in the supernatant after the final centrifugation ( Figure 1).
  • the experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells.
  • 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) which has been equilibrated with 50 mM Tris-Cl pH 8.0 buffer.
  • the column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole.
  • the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.
  • Figure 1 shows the purification of the prepared hydrophobin
  • Lanes 3 - 5 OD 280 maxima of the elution fractions
  • the hydrophobin of Figure 1 has a molecular weight of about 53 kD.
  • the smaller bands partially represent degradation products of hydrophobin.
  • hydrophobin The purified according to Example 8 hydrophobin was used. Concentration of hydrophobin in the solution: 100 ug / ml, the solution further contained 50 mM Na-acetate buffer and 0.1% polyoxyethylene (20) sorbitan monolaurate (Tween ® 20), pH of the solution: 4
  • the samples are air dried and the contact angle (in degrees) of a drop of 5 ⁇ l of water with the coated glass surface determined at room temperature.
  • the contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.
  • hydrophobin solution In a beaker with a diameter of 10 cm, 6.56 g of the abovementioned hydrophobin solution were diluted with water to a total of 200 g (hydrophobin concentration 0.2 mg / ml, total amount 40 mg). The surface of the liquid (area: 78.5 cm 2 ) was covered with 3.5 g of diesel oil (density 0.83 g / ml) as a barrier liquid. The water surface was completely covered by this. The thickness of the barrier layer was about 0.54 mm.
  • Table 1 Total amount of liquid in the beaker as a function of the storage time
  • the examples and comparative examples demonstrate that the addition of hydrophobins significantly increases the evaporation-inhibiting effect of the barrier layer.
  • hydrophobin solution In a beaker with a diameter of 10 cm, 6.56 g of the abovementioned hydrophobin solution were diluted with water to a total of 200 g (hydrophobin concentration 0.2 mg / ml, total amount 40 mg). The surface of the liquid (area: 78.5 cm 2 ) was covered with 6.0 g of RME biodiesel as a barrier liquid. The water surface was completely covered by this. The thickness of the barrier layer was about 1, 0 mm.
  • Table 2 Total amount of liquid in the beaker as a function of the storage time
  • hydrophobin solution In a beaker with a diameter of 10 cm, 6.56 g of the abovementioned hydrophobin solution were diluted with water to a total of 200 g (hydrophobin concentration 0.2 mg / ml, total amount 40 mg). The surface of the liquid (area: 78.5 cm 2 ) was covered with 6.0 g rapeseed oil as a barrier liquid. The water surface was completely covered by this. The thickness of the barrier layer was about 1.0 mm.
  • Table 3 Total amount of liquid in the beaker as a function of the storage time

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Hydrology & Water Resources (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Environmental & Geological Engineering (AREA)
  • Water Supply & Treatment (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Vaporization, Distillation, Condensation, Sublimation, And Cold Traps (AREA)
  • Fats And Perfumes (AREA)
  • Application Of Or Painting With Fluid Materials (AREA)
  • Lubricants (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un procédé de réduction de la vitesse d'évaporation de liquides dans des réservoirs à liquides ouverts, faisant intervenir au moins une hydrophobine en tant qu'agent auxiliaire.
PCT/EP2006/062735 2005-06-03 2006-05-30 Procede de reduction de la vitesse d'evaporation de liquides WO2006128877A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2006254154A AU2006254154B2 (en) 2005-06-03 2006-05-30 Method for reducing the evaporation rate of liquids

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DE102005025969.3 2005-06-03
DE200510025969 DE102005025969A1 (de) 2005-06-03 2005-06-03 Verfahren zur Verringerung der Verdunstungsgeschwindigkeit von Flüssigkeiten
DE102005031463.5 2005-07-04
DE200510031463 DE102005031463A1 (de) 2005-06-03 2005-07-04 Verfahren zur Verringerung der Verdunstungsgeschwindigkeit von Flüssigkeiten

Publications (1)

Publication Number Publication Date
WO2006128877A1 true WO2006128877A1 (fr) 2006-12-07

Family

ID=36940382

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/062735 WO2006128877A1 (fr) 2005-06-03 2006-05-30 Procede de reduction de la vitesse d'evaporation de liquides

Country Status (5)

Country Link
AU (1) AU2006254154B2 (fr)
DE (2) DE102005025969A1 (fr)
EC (1) ECSP078035A (fr)
PE (1) PE20070059A1 (fr)
WO (1) WO2006128877A1 (fr)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008142111A1 (fr) * 2007-05-24 2008-11-27 Basf Se Utilisation d'hydrophobines comme auxiliaires lors de la cristallisation de solides
EP2042155A1 (fr) 2007-09-28 2009-04-01 Basf Se Procédé de suppression de substances indissolubles dans l'eau de surfaces de substrat
WO2010072665A1 (fr) 2008-12-23 2010-07-01 Basf Se Modification de nanofibres ou de mésofibres ou de produits textiles plats produits par électrofilage à l'aide de protéines amphiphiles
WO2010102934A1 (fr) 2009-03-09 2010-09-16 Basf Se Utilisation d'un mélange de polymères solubles dans l'eau et d'hydrophobines pour épaissir des phases aqueuses
WO2011015530A2 (fr) 2009-08-03 2011-02-10 Basf Se Procédé pour le dépôt de couches minces d’oxydes métalliques
WO2011121009A1 (fr) 2010-03-31 2011-10-06 Basf Se Stents revêtus et procédé de revêtement par une protéine
US8096484B2 (en) 2006-08-15 2012-01-17 Basf Se Method for the production of dry free-flowing hydrophobin preparations
US8173716B2 (en) 2007-03-06 2012-05-08 Basf Se Open-cell foam modified with hydrophobines
EP2676680A1 (fr) 2007-09-13 2013-12-25 Basf Se Utilisation de polypeptides d'hydrophobine en tant qu'activateurs de pénétration

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3431064A (en) * 1964-12-23 1969-03-04 Chevron Res Antievaporant process and composition
US3431062A (en) * 1964-10-26 1969-03-04 Chevron Res Antievaporant process and composition
US3458274A (en) * 1967-04-21 1969-07-29 Exxon Research Engineering Co Retarding water evaporation from storage reservoirs
US3459492A (en) * 1965-07-02 1969-08-05 Eastman Kodak Co Retarding evaporation of water
US3549313A (en) * 1969-06-04 1970-12-22 Texaco Inc Composition and method for retarding evaporation of water
RU2102560C1 (ru) * 1990-04-18 1998-01-20 Владимир Федорович Раковский Способ предотвращения испарения воды с поверхности водоемов и водотоков
WO2004000880A1 (fr) * 2002-06-21 2003-12-31 Applied Nanosystems B.V. Procede pour coller un compose sur une surface

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3431062A (en) * 1964-10-26 1969-03-04 Chevron Res Antievaporant process and composition
US3431064A (en) * 1964-12-23 1969-03-04 Chevron Res Antievaporant process and composition
US3459492A (en) * 1965-07-02 1969-08-05 Eastman Kodak Co Retarding evaporation of water
US3458274A (en) * 1967-04-21 1969-07-29 Exxon Research Engineering Co Retarding water evaporation from storage reservoirs
US3549313A (en) * 1969-06-04 1970-12-22 Texaco Inc Composition and method for retarding evaporation of water
RU2102560C1 (ru) * 1990-04-18 1998-01-20 Владимир Федорович Раковский Способ предотвращения испарения воды с поверхности водоемов и водотоков
WO2004000880A1 (fr) * 2002-06-21 2003-12-31 Applied Nanosystems B.V. Procede pour coller un compose sur une surface

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE WPI Section PQ Week 199836, Derwent World Patents Index; Class Q42, AN 1998-426189, XP002398160 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8096484B2 (en) 2006-08-15 2012-01-17 Basf Se Method for the production of dry free-flowing hydrophobin preparations
US8173716B2 (en) 2007-03-06 2012-05-08 Basf Se Open-cell foam modified with hydrophobines
WO2008142111A1 (fr) * 2007-05-24 2008-11-27 Basf Se Utilisation d'hydrophobines comme auxiliaires lors de la cristallisation de solides
EP2676680A1 (fr) 2007-09-13 2013-12-25 Basf Se Utilisation de polypeptides d'hydrophobine en tant qu'activateurs de pénétration
EP2042155A1 (fr) 2007-09-28 2009-04-01 Basf Se Procédé de suppression de substances indissolubles dans l'eau de surfaces de substrat
WO2010072665A1 (fr) 2008-12-23 2010-07-01 Basf Se Modification de nanofibres ou de mésofibres ou de produits textiles plats produits par électrofilage à l'aide de protéines amphiphiles
WO2010102934A1 (fr) 2009-03-09 2010-09-16 Basf Se Utilisation d'un mélange de polymères solubles dans l'eau et d'hydrophobines pour épaissir des phases aqueuses
WO2011015530A2 (fr) 2009-08-03 2011-02-10 Basf Se Procédé pour le dépôt de couches minces d’oxydes métalliques
WO2011121009A1 (fr) 2010-03-31 2011-10-06 Basf Se Stents revêtus et procédé de revêtement par une protéine

Also Published As

Publication number Publication date
DE102005025969A1 (de) 2006-12-28
AU2006254154A1 (en) 2006-12-07
DE102005031463A1 (de) 2007-01-11
PE20070059A1 (es) 2007-02-08
ECSP078035A (es) 2008-01-23
AU2006254154B2 (en) 2010-11-25

Similar Documents

Publication Publication Date Title
EP1869138B1 (fr) Lavage de forage au moyen d'hydrophobine
EP1848733B1 (fr) Nouvelles proteines de fusion d'hydrophobine, leur production et leur utilisation
WO2006128877A1 (fr) Procede de reduction de la vitesse d'evaporation de liquides
EP1868700A2 (fr) Utilisation d'hydrophobine comme stabilisateur de phases
EP1904534B1 (fr) Emulsions monomeres aqueuses contenant de l'hydrophobine
WO2006131564A2 (fr) Nouvelles proteines de fusion de type hydrophobines appauvries en cysteine, leur production, et leur utilisation
EP1866150B1 (fr) Substrats métalliques ayant des polypeptides comme agents adhesifs
WO2006103251A1 (fr) Utilisation de proteines comme desemulsifants
EP1848734A2 (fr) Procede pour enduire des surfaces avec des hydrophobines
EP1866401B1 (fr) Utilisation d'hydrophobines pour le traitement antisalissant de surfaces dures
EP1893675B1 (fr) Hydrophobine utilisee en tant que substance de revetement pour des particules polymeres thermoplastiques expansibles ou expansees
DE102005048720A1 (de) Verwendung von Proteinen als Antischaum-Komponente in Kraftstoffen
EP1866106B1 (fr) Utilisation d'hydrophobines pour traiter la surface de materiaux de construction mineraux durcis, de pierre naturelle, de pierre artificielle et de ceramiques
WO2007014897A1 (fr) Utilisation de proteines tensioactives non enzymatiques pour le linge
DE102005015043A1 (de) Verwendung von Polypeptiden als Haftvermittler
DE102005007480A1 (de) Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005005737A1 (de) Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005051515A1 (de) Verfahren zum Beschichten von Oberflächen mit Hydrophobinen
DE102005045770A1 (de) Verwendung von Polypeptiden als Haftvermittler
DE102005014843A1 (de) Verwendung von Hydrophobinen zur Oberflächenbehandlung von gehärteten mineralischen Baustoffen, Naturstein, Kunststein und Keramiken
DE102005036341A1 (de) Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006254154

Country of ref document: AU

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

ENP Entry into the national phase

Ref document number: 2006254154

Country of ref document: AU

Date of ref document: 20060530

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2006254154

Country of ref document: AU

122 Ep: pct application non-entry in european phase

Ref document number: 06763382

Country of ref document: EP

Kind code of ref document: A1