EP1848734A2 - Procede pour enduire des surfaces avec des hydrophobines - Google Patents

Procede pour enduire des surfaces avec des hydrophobines

Info

Publication number
EP1848734A2
EP1848734A2 EP06708070A EP06708070A EP1848734A2 EP 1848734 A2 EP1848734 A2 EP 1848734A2 EP 06708070 A EP06708070 A EP 06708070A EP 06708070 A EP06708070 A EP 06708070A EP 1848734 A2 EP1848734 A2 EP 1848734A2
Authority
EP
European Patent Office
Prior art keywords
hydrophobin
fusion
coating
hydrophobins
formulation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06708070A
Other languages
German (de)
English (en)
Inventor
Thomas Subkowski
Marvin Karos
Claus Bollschweiler
Ulf Baus
Patrick RÜDIGER
Michael Lang
Thorsten Montag
Alexandra Brandt
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE200510005737 external-priority patent/DE102005005737A1/de
Priority claimed from DE200510007480 external-priority patent/DE102005007480A1/de
Priority claimed from DE200510051515 external-priority patent/DE102005051515A1/de
Application filed by BASF SE filed Critical BASF SE
Publication of EP1848734A2 publication Critical patent/EP1848734A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B05—SPRAYING OR ATOMISING IN GENERAL; APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D—PROCESSES FOR APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D5/00—Processes for applying liquids or other fluent materials to surfaces to obtain special surface effects, finishes or structures
    • B05D5/04—Processes for applying liquids or other fluent materials to surfaces to obtain special surface effects, finishes or structures to obtain a surface receptive to ink or other liquid
    • C—CHEMISTRY; METALLURGY
    • C03—GLASS; MINERAL OR SLAG WOOL
    • C03C—CHEMICAL COMPOSITION OF GLASSES, GLAZES OR VITREOUS ENAMELS; SURFACE TREATMENT OF GLASS; SURFACE TREATMENT OF FIBRES OR FILAMENTS MADE FROM GLASS, MINERALS OR SLAGS; JOINING GLASS TO GLASS OR OTHER MATERIALS
    • C03C17/00—Surface treatment of glass, not in the form of fibres or filaments, by coating
    • C03C17/28—Surface treatment of glass, not in the form of fibres or filaments, by coating with organic material
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K17/00—Carrier-bound or immobilised peptides; Preparation thereof
    • C—CHEMISTRY; METALLURGY
    • C14—SKINS; HIDES; PELTS; LEATHER
    • C14C—CHEMICAL TREATMENT OF HIDES, SKINS OR LEATHER, e.g. TANNING, IMPREGNATING, FINISHING; APPARATUS THEREFOR; COMPOSITIONS FOR TANNING
    • C14C13/00—Manufacture of special kinds or leather, e.g. vellum
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B05—SPRAYING OR ATOMISING IN GENERAL; APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D—PROCESSES FOR APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D2201/00—Polymeric substrate or laminate
    • B05D2201/02—Polymeric substrate
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B05—SPRAYING OR ATOMISING IN GENERAL; APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D—PROCESSES FOR APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D2202/00—Metallic substrate
    • B05D2202/20—Metallic substrate based on light metals
    • B05D2202/25—Metallic substrate based on light metals based on Al
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B05—SPRAYING OR ATOMISING IN GENERAL; APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D—PROCESSES FOR APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D2203/00—Other substrates
    • B05D2203/24—Leather
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B05—SPRAYING OR ATOMISING IN GENERAL; APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D—PROCESSES FOR APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D7/00—Processes, other than flocking, specially adapted for applying liquids or other fluent materials to particular surfaces or for applying particular liquids or other fluent materials
    • B05D7/12—Processes, other than flocking, specially adapted for applying liquids or other fluent materials to particular surfaces or for applying particular liquids or other fluent materials to leather
    • C—CHEMISTRY; METALLURGY
    • C03—GLASS; MINERAL OR SLAG WOOL
    • C03C—CHEMICAL COMPOSITION OF GLASSES, GLAZES OR VITREOUS ENAMELS; SURFACE TREATMENT OF GLASS; SURFACE TREATMENT OF FIBRES OR FILAMENTS MADE FROM GLASS, MINERALS OR SLAGS; JOINING GLASS TO GLASS OR OTHER MATERIALS
    • C03C2217/00—Coatings on glass
    • C03C2217/70—Properties of coatings
    • C03C2217/76—Hydrophobic and oleophobic coatings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a process for coating surfaces with fusion hydrophobins at a pH> 4 as well as surfaces having a coating comprising fusion hydrophobins.
  • Hydrophobins are small proteins of about 100 to 150 amino acids, which are characteristic of filamentous fungi, for example Schizophyllum commune. They usually have 8 cysteine units. Hydrophobins can be isolated, for example, from natural sources.
  • Hydrophobins have a marked affinity for interfaces and are therefore suitable for coating surfaces.
  • Teflon can be coated by means of hydrophobins to obtain a hydrophilic surface.
  • WO 96/41882 proposes the use of hydrophobins obtained from edible fungi as emulsifiers, thickeners, surface-active substances, for hydrophilizing hydrophobic surfaces, for improving the water resistance of hydrophilic substrates, for producing oil-in-water emulsions or for water-in Oil emulsions. Furthermore, pharmaceutical applications such as the production of ointments or creams and cosmetic applications such as skin protection or the production of hair shampoos or hair rinses are proposed.
  • EP-B 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for carrying out experiments or for storage, hulls, solid particles or frame or body of passenger cars with a solution containing hydrophobins at a temperature of 30 to 80 0 C.
  • a surface-active substance is additionally used as a coating aid.
  • a type SC3 hydrophobin obtained from fungi (Schizophyllumford) is used.
  • To prepare the solution for coating freeze-dried SC3 is used, dissolved with trifluoroacetic acid, the mixture dried in a stream of nitrogen and then dissolved in water or a buffer solution. This procedure is cumbersome.
  • the present application relates to the coating of surfaces with a novel class of non-naturally occurring hydrophobins.
  • These are fusion hydrophobins in which naturally occurring hydrophobins are linked to at least 20 amino acid long peptide sequences which are not naturally linked to a hydrophobin.
  • Such fusion hydrophobins are also suitable for coating surfaces.
  • fusion hydrophobins which have the following general structural formula (I),
  • X is any of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Me Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, Gly) can.
  • X may be the same or different.
  • the indices standing at X each represent the number of amino acids, C stands for cysteine, alanine, serine, glycine, methionine or threonine, wherein at least four of the radicals named C are cysteine.
  • indices n and m independently of one another represent natural numbers of 0 and 500, preferably of 15 to 300, with the proviso that at least one of the peptide sequences designated X n and X m represents a peptide sequence of at least 5, preferably at least 20 amino acids naturally not associated with a hydrophobin.
  • the polypetides according to formula (I) are further characterized by the property that at room temperature after coating a glass surface they increase the contact angle of a water droplet of at least 20 °, preferably at least 25 ° and particularly preferably 30 °, in each case compared with the contact angle of an equal drop of water with the uncoated glass surface.
  • the amino acids designated C 1 to C 8 are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C 1 to C 8 should consist of cysteines.
  • Cysteines can either be reduced in the proteins used according to the invention or form disulfide bridges with one another. Particularly preferred is the intramolecular formation of CC bridges, in particular those with at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.
  • cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions indicated by X, the numbering of the individual C-positions in the general formulas may change accordingly.
  • X, C and the indices standing at X and C are as defined above, however, the indices n and m are numbers between 0 and 300, and the proteins are further characterized by the above-mentioned contact angle change, with the proviso that at least one of the peptide sequences designated X n and X m is an at least 15, preferably at least 35 amino acid long peptide sequence which is not naturally linked to a hydrophobin.
  • the proteins are further characterized by the above-mentioned contact angle change, provided that at least one of the peptide sequences designated X n and X m is a peptide sequence which is at least 20 amino acids long, preferably at least 50 amino acids, which is not naturally linked to a hydrophobin, and at least 6 of the radicals named C are cysteine. Most preferably, all C radicals are cysteine.
  • the residues not naturally associated with a hydrophobin are also referred to below as fusion partners. This is to say that the proteins can consist of at least one hydrophobin part and one fusion partner, which do not occur together in nature in this form.
  • the fusion partner can be selected from a variety of proteins. It is also possible to link a plurality of fusion partners with a hydrophobin part, for example at the amino terminus (X n ) and at the carboxy terminus (X m ) of the hydrophobin part. However, it is also possible, for example, to link two fusion partner parts to one position (X n or X m ) of the hydrophobin.
  • fusion partner parts are proteins which occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis.
  • fusion partner parts are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NO: 17 and 18) and thioredoxin.
  • fragments or derivatives of these sequences which comprise only a part, for example 70 to 99%, preferably 5 to 50% and particularly preferably 10 to 40% of said sequences, or in which individual amino acids or nucleotides are opposite the said sequence are changed, wherein the percentages in each case refers to the number of amino acids.
  • the fusion hydrophobin in addition to the fusion partner, also has a so-called affinity domain (affinity tag / affinity tail) as a group X n or X m .
  • affinity domains include (His) k, (Arg) k , (Asp) k, (Phe) k or (Cys) k groups, wherein k is generally a natural number from 1 to 10. It may preferably be a (His) k group, where k is 4 to 6.
  • fusion hydrophobins used according to the invention may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical crosslinking, for example with glutaraldehyde.
  • An essential property of the fusion proteins used in the invention is the change of surface properties when the surfaces are coated with the fusion proteins.
  • the change in the surface properties can be determined experimentally by measuring the contact angle of a water drop before and after coating the surface with the protein and determining the difference between the two measurements.
  • the implementation of contact angle measurements is known in principle to the person skilled in the art. The measurements refer to room temperature and water drops of 5 ⁇ l and the use of glass slides as substrate. The exact experimental conditions for an exemplary method for measuring the contact angle are shown in the experimental part.
  • the fusion proteins used according to the invention have the property of increasing the contact angle by at least 20 °, preferably at least 25 °, particularly preferably at least 30 °, in each case compared with the contact angle of a water droplet of the same size with the uncoated glass surface.
  • Preferred fusion hydrophobins for carrying out the present invention are those having a hydrophobic moiety of the type dewA, rodA, hypA, hypB, sc3, basfi, basf2, which are structurally characterized in the sequence listing below. It may also be just parts or derivatives thereof. It is also possible to link together a plurality of hydrophobic parts, preferably 2 or 3, of the same or different structure.
  • fusion proteins with the polypeptide sequences shown in SEQ ID NO: 20, 22, 24 and the nucleic acid sequences coding therefor, in particular the sequences according to FIG.
  • proteins which, starting from the SEQ ID NO. 20, 22 or 24 shown by exchange, insertion or deletion of at least one, up to 10, preferably 5, more preferably 5% of all amino acids, and still have at least 50% of the biological property of the starting proteins particularly preferred embodiments.
  • the biological property of the proteins is hereby understood to be the already described enlargement of the contact angle by at least 20 °.
  • fusion hydrophobins used according to the invention can be prepared chemically by known methods of peptide synthesis, for example by Merrifield solid-phase synthesis.
  • the preparation of the fusion hydrophobins preferably takes place by genetic engineering processes in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined in such a way that in a host organism by gene expression of the combined nucleic acid sequence the desired fusion Hydrophobin is produced.
  • Suitable host organisms (production organisms) for said production process may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus. megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and others.
  • prokaryotes including archaea
  • eukaryotes especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus. megaterium, As
  • the invention furthermore relates to the use of expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide used according to the invention, as well as vectors comprising at least one of these expression constructs.
  • constructs employed include a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream, and optionally other common regulatory elements, each operably linked to the coding sequence.
  • “Operational linkage” is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended in the expression of the coding sequence.
  • operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like.
  • Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. As described in Goeddel, Gene Expression Technolgy: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • a preferred nucleic acid construct advantageously also contains one or more of the "enhancer" sequences already mentioned, functionally linked to the promoter, which allow increased expression of the nucleic acid sequence. Additional advantageous sequences can also be inserted at the 3 'end of the DNA sequences, such as further regulatory elements or terminators.
  • the nucleic acids may be contained in one or more copies in the construct.
  • the construct may also contain further markers such as antibiotic resistance or auxotrophic complementing genes, optionally for selection on the construct.
  • Advantageous regulatory sequences for the method are, for example, in promoters such as cos, tac, trp, tet, trp tet, lpp, lac, lpp-lac, Iaclq T7, T5, T3, gal , trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which are advantageously used in gram-negative bacteria.
  • promoters amy and SP02 in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.
  • the nucleic acid construct, for expression in a host organism is advantageously inserted into a vector, such as a plasmid or a phage, which allows for optimal expression of the genes in the host.
  • a vector such as a plasmid or a phage
  • all other vectors known to the person skilled in the art ie, z.
  • viruses such as SV40, CMV, baculovirus and adenovirus, Transposons.lS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system to understand.
  • vectors can be replicated autonomously in the host organism or replicated chromosomally. These vectors represent a further embodiment of the invention.
  • Suitable plasmids are described, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, plN-III "3-B1, tgt11 or pBdCI, in Streptomycespl J101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium for pSA77 or pAJ667, in fungi pALS1, pIL12 or pBB116, in yeasts 2alpha, pAG-1,
  • nucleic acid construct for expression of the further genes contained additionally 3'- and / or 5'-terminal regulatory sequences to increase the expression, which are selected depending on the selected host organism and gene or genes for optimal expression.
  • regulatory sequences are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
  • the regulatory sequences or factors can thereby preferably influence the gene expression of the introduced genes positively and thereby increase.
  • enhancement of the regulatory elements can advantageously be achieved at the transcriptional level by using strong transcription signals such as promoters and / or enhancers.
  • an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
  • the vector containing the nucleic acid construct or the nucleic acid can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination.
  • This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.
  • an expression cassette is carried out by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator or polyadenylation signal.
  • common recombination and cloning techniques are used, as described, for example, in T. Maniatis, EFFritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Coed Spring Harbor Laboratory, ColD Spring Harbor, NY (1989) and in TJ Silhavy , ML Berman and LW Enquist, Experiments with Gene Fusions, CoId Spring Harbor Laboratory, ColD Spring Harbor, NY (1984) and in Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
  • the recombinant nucleic acid construct or gene construct is inserted for expression in a suitable host organism, advantageously into a host-specific vector which enables optimal expression of the genes in the host.
  • Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985).
  • recombinant microorganisms can be produced, which are transformed, for example, with at least one vector and can be used to produce the proteins used in the invention.
  • the recombinant constructs described above are introduced into a suitable host system and expressed.
  • Homologously recombined microorganisms can also be produced.
  • a vector is produced which contains at least a portion of a gene or a coding sequence to be used according to the invention, in which optionally at least one amino acid deletion, addition or substitution has been introduced in order to modify the sequence, e.g. B. functionally disrupted ("knockout" - vector).
  • the introduced sequence can, for. Also be a homologue from a related microorganism or be derived from a mammalian, yeast or insect source.
  • the vector used for homologous recombination may be designed such that the endogenous gene is mutated or otherwise altered upon homologous recombination but still encodes the functional protein (eg, the upstream regulatory region may be altered such that expression the endogenous protein is changed).
  • the altered portion of the gene used according to the invention is in the homologous recombination vector.
  • suitable vectors for homologous recombination is e.g. As described in Thomas, K.R. and Capecchi, M.R. (1987) Cell 51: 503.
  • prokaryotic or eukaryotic organisms are suitable as recombinant host organisms for the nucleic acid or nucleic acid construct used according to the invention.
  • microorganisms such as bacteria, fungi or yeast are used as host organisms.
  • Gram-positive or Gram-negative bacteria preferably bacteria of the families Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, more preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus are used.
  • the organisms used in the production process for fusion hydrophobins are attracted or cultivated, depending on the host organism, in a manner known to the person skilled in the art.
  • Microorganisms are usually in a liquid medium containing a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts and optionally vitamins, at temperatures between 0 and 100 0 C, preferably between 10 to 60 0 C attracted under oxygen fumigation.
  • the pH of the nutrient fluid can be kept at a fixed value, that is, regulated during the cultivation or not.
  • the cultivation can be "batch”, “semi-batch” or continuous respectively.
  • Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously.
  • the enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction.
  • Fusion proteins or functional, biologically active fragments thereof used according to the invention can be produced by means of a recombinant process in which a protein-producing microorganism is cultivated, if appropriate, the expression of the proteins is induced and these are isolated from the culture.
  • the proteins can thus also be produced on an industrial scale, if desired.
  • the recombinant microorganism can be cultured and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 0 C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Colard Spring Harbor Laboratory, ColD Spring Harbor, NY (1989).
  • the cells are disrupted and the product is recovered from the lysate by known protein isolation methods.
  • the cells can optionally by high-frequency ultrasound, by high pressure, such as. B. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by combining several of the listed methods are digested.
  • Purification of the fusion proteins used according to the invention can be achieved by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, and by other conventional methods, such as ultrafiltration, crystallization, salting out, Dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, F.G., Biochemische Harvey Méen, Verlag Water de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
  • fusion hydrophobins with special anchor groups to facilitate isolation and purification, which can bind to corresponding complementary groups on solid supports, in particular suitable polymers.
  • Such solid carriers can be used, for example, as a filling for chromatography columns, and in this way the efficiency of the separation can generally be significantly increased.
  • separation methods are also known as affinity chromatography.
  • vector systems or oligonucleotides can be used in the production of the proteins, which extend the cDNA by certain nucleotide sequences and thus encode altered proteins or fusion proteins. Proteins modified for ease of purification include so-called "tags" acting as anchors, such as the modification known as hexa-histidine anchors.
  • fusion-hydrophobins modified with histidine anchors can be chromatographically purified using columnar-packed nickel-Sepharose.
  • the fusion hydrophobin can then be eluted from the column by suitable means for elution, such as an imidazole solution.
  • refurbishment methods can also be combined with each other. For example, it is possible first to separate by means of chromatography, and then to purify the solution obtained by means of dialysis of substances used for elution.
  • the cells are first separated by means of a suitable method from the Fermetationsbrühe, for example by microfiltration or by centrifugation. Subsequently, the cells can be disrupted by suitable methods, for example by means of the methods already mentioned above, and the cell debris can be separated from the inclusion bodies. The latter can be done advantageously by centrifuging. Finally, the inclusion bodies can be disrupted in a manner known in principle in order to liberate the fusion hydrophobins. This can be done for example by acids, bases and / or detergents.
  • the inclusion bodies with the fusion hydrophobins used according to the invention can generally be completely dissolved within about 1 h already using 0.1 M NaOH.
  • the purity of the fusion hydrophobins obtained by this simplified process is generally from 60 to 80% by weight with respect to the amount of all proteins.
  • the solutions obtained by the described, simplified purification process can be used without further purification for coating surfaces. As a rule, the secondary components do not disturb and at most have a negligible effect on the coating result.
  • the resulting hydrophobin solutions usually have a concentration of 0.1 mg / ml to 50 mg / ml of fusion hydrophobins.
  • the fusion hydrophobins can also be isolated from the solutions as a solid. This can be done, for example, in a manner known in principle by freeze-drying or spray-drying. In a preferred embodiment of the invention, the isolation can be carried out by means of spray drying.
  • the spray drying can be carried out with the solution purified by chromatography, but it is also possible with preference to use the solutions obtained by the purification process of the inclusion bodies (inclusion bodies).
  • the solutions can optionally be neutralized.
  • a pH range of 7 to 9 has been found to be particularly advantageous.
  • the solution can be spray-dried in a manner known in principle. Suitable apparatuses for spray drying are commercially available. The optimum spray drying conditions vary with device type and desired throughput. Input temperatures of 130 to 180 0 C and outlet temperatures of 50 to 80 ° C have been found in hydrophobin solutions to be favorable.
  • spray-drying auxiliaries such as, for example, sugar, manganese, dextran or maltodextrin can be used. An amount of from 0 to 30% by weight, preferably from 5 to 20% by weight, of such auxiliaries with respect to the hydrophobin has proven useful.
  • a formulation (F) which comprises at least water or aqueous solvent mixture and a fusion hydrophobin.
  • Suitable aqueous solvent mixtures include water and one or more water-miscible solvents.
  • the selection of such components is limited only insofar as the fusion hydrophobins and the other components must be sufficiently soluble in the mixture.
  • such mixtures comprise at least 50% by weight, preferably at least 65% by weight and more preferably at least 80% by weight, of water. Most preferably, only water is used.
  • the person skilled in the art will make a suitable choice among the water-miscible solvents, depending on the desired properties of the formulation F.
  • water-miscible solvents examples include monoalcohols, such as methanol, ethanol or propanol, higher alcohols, such as ethylene glycol or polyetherpolyols, and also ether alcohols, such as butylglycol or methoxypropanol.
  • monoalcohols such as methanol, ethanol or propanol
  • higher alcohols such as ethylene glycol or polyetherpolyols
  • ether alcohols such as butylglycol or methoxypropanol.
  • the formulation used for the treatment has a pH of> 4, preferably> 6 and particularly preferably> 7.
  • the pH may be 4, 5, 6, 7, 8, 9, 10, 11.
  • the pH is in the range of 4 to 11, preferably 6 to 10, particularly preferably 7 to 9.5 and very particularly preferably 7.5 to 9.
  • the pH may be 7.5 to 8.5 or 8.5 to 9.
  • the formulation preferably comprises a suitable buffer.
  • a suitable buffer depending on the pH range intended for the coating. Examples include potassium dihydrogen phosphate buffer, tris (hydroxymethyl) aminomethane buffer (Tris buffer), borax buffer, sodium bicarbonate buffer or sodium hydrogen phosphate buffer. Preferred is Tris buffer.
  • the concentration of the buffer in the solution will be determined by the skilled person depending on the desired properties of the formulation. The skilled person will usually pay attention to a sufficient buffer capacity to achieve the most constant coating conditions. A concentration of 0.001 mol / l to 1 mol / l, preferably 0.005 mol / l to 0.1 mol / l and particularly preferably 0.01 mol / l to 0.05 mol / l, has proven useful.
  • the formulation comprises at least one fusion hydrophobin.
  • Fusion hydrophobins and preferred fusion hydrophobins have already been mentioned at the outset.
  • mixtures of different fusion hydrophobins can be used.
  • Particularly suitable for carrying out the present invention is the fusion hydrophobin yaad-Xa-dewA-his (SEQ ID NO: 20), or derived therefrom, in which the fusion partner yaad is shortened.
  • concentration of the fusion hydrophobins in the solution will be selected by one skilled in the art according to the desired properties of the coating. With higher concentrations, a faster coating can usually be achieved.
  • formulation F may optionally comprise further components or additives.
  • Suitable surfactants are, for example, nonionic surfactants which comprise polyalkoxy groups, in particular polyethylene oxide groups. Examples include polyoxyethylene stearates, alkoxylated phenols and the like. Further examples of suitable surfactants include polyethyl neglycol (20) sorbitan monolaurate (Tween® 20), polyethylene glycol (20) sorbitan monopalmitate (Tween® 40), polyethylene glycol (20) sorbitan monostearate (Tween® 60), poly (ethylene glycol) (20) sorbitan monooleate ( Tween® 80), cyclohexylmethyl-.beta.-D-maltoside, cyclohexyl-ethyl-.beta.-D-maltoside, cyclohexyl-n-hexyl-.beta.-D-maltoside, n-undecyl-.beta.-D-maltoside si
  • surfactants are disclosed, for example, in WO 2005/68087 page 9, line 10 to page 10, line 2.
  • concentration of surfactants is generally 0.001% by weight to 0.5% by weight, preferably 0.01% by weight to 0.25% by weight and particularly preferably 0.1% by weight to 0.2% by weight. %, in each case based on the amount of all components of the formulation.
  • metal ions in particular divalent metal ions
  • Metal ions can contribute to a more uniform coating.
  • suitable divalent metal ions include, for example
  • Alkaline earth metal ions such as Ca 2+ ions.
  • Such metal ions may preferably be added as formulation-soluble salts, for example in the form of chlorides, nitrates or carbonate, acetate, citrate, gluconate, hydroxide, lactate, sulfate, succinate, tartrate.
  • CaCb or MgCb can be added.
  • the solubility can optionally also be increased by suitable auxiliaries, for example complexing agents. If present, the concentration of such metal ions is generally 0.01 mmol / l to 10 mmol / l, preferably 0.1 mmol / l to 5 mmol / l and particularly preferably 0.5 mmol / l to 2 mmol / l.
  • Additional components may also be naturally occurring hydrophobins which are used in admixture with the fusion hydrophobins.
  • formulations F it is possible in principle to use those solutions which are obtained in the preparation or processing of the hydrophobins. It may be both chromatographically purified fusion hydrophobins, or to the solutions which are obtained by completing the inclusion bodies. Such solutions may contain, in addition to the fusion hydrophobin, further components from the workup, for example buffers, residues of the auxiliaries used for the elution or auxiliaries from the spray drying. Unless such components interfere with the coating process, they need not be removed.
  • the workup solutions generally have a significantly higher hydrophobin concentration than required for coating. They can be diluted to the desired concentration by adding water, further water-miscible solvents or buffer solutions.
  • solid fusion hydrophobins are used to prepare the formulation F, preferably the abovementioned fusion hydrophobins prepared by spray-drying.
  • the spray-dried fusion hydrophobin can be particularly advantageously used in water or in water Dissolve the solvent mixture slightly. This is a distinct advantage over solid, naturally occurring hydrophobins which must be solved in the art using trifluoroacetic acid (TFA) or formic acid.
  • TFA / formic acid is undesirable for the coating of a number of substrates, so that TFA or formic acid must again be removed in a costly manner after dissolving the hydrophobin.
  • ком ⁇ онент can be dissolved in the formulation, for example by simply stirring. Of course, it is also possible to trigger additional components and then combine the solutions.
  • Various spray-dried materials can be mixed before dissolving.
  • the spray-dried fusion hydrophobin can also be provided with additional components in a further step, e.g. by spraying other compounds and then drying. Conversely, it is also possible to apply fusion hydrophobin to existing particles of auxiliaries. A modification of the spray-dried hydrophobin e.g. in the form of granulation is also possible.
  • the surface to be coated is treated with the formulation for coating.
  • surfaces are not limited here. It can be either smooth surfaces or surfaces with a pronounced surface structure. It may, for example, the surfaces of moldings such as plates, films or the like.
  • the surfaces may, for example, be made of plastics such as Teflon, polyethylene, polypropylene, polystyrene, polymethyl methacrylate or other polymeric materials, of metals such as steel, aluminum, zinc, tin, copper or metal alloys such as brass, natural or modified natural materials such as leather, Textiles (eg cotton), paper, as well as surfaces relevant to cosmetics (eg skin, hair, teeth, mucous membranes), made of glass or of ceramic materials.
  • Articles to be coated may also have surfaces of different materials, for example combinations of glass, metal and plastics.
  • the surfaces to be coated may, for example, also be the surfaces of finely divided inorganic or organic substances, in particular inorganic or organic pigments or, for example, also latex particles.
  • examples include typical dye or effect pigments or typical fillers.
  • the method of treating the surface is chosen by the skilled person depending on the type of surface.
  • the article to be coated may be dipped in the formulation, or the formulation may be sprayed on the surface will be applied.
  • This type of surface treatment is suitable for both flat and irregular shaped surfaces.
  • Flat shaped articles such as, for example, sheets or films can furthermore advantageously be treated by coating or rolling.
  • Excess formulation can be removed again by means of suitable methods, for example by doctoring or squeezing.
  • the coating can be carried out by means of spraying. Suitable spray apparatuses are known to the person skilled in the art.
  • Finely divided pigments and / or fillers can advantageously be coated by first dispersing the pigments in a suitable solvent and then adding the fusion hydrophobins and, optionally, further auxiliaries for coating this dispersion.
  • pigment dispersions it is also possible with advantage to use dispersions which are obtained in the wet-chemical preparation of pigments without the pigments being previously separated, provided that further substances present in the dispersion do not disturb the coating process.
  • a certain exposure time is required to deposit the fusion hydrophobins on the surface.
  • the person skilled in the art will choose a suitable exposure time depending on the desired result. Examples of typical exposure times are from 0.1 to 12 h, without the invention being restricted thereto.
  • the reaction time depends on the temperature as well as on the concentration of the fusion hydrophobin in the solution.
  • the temperature in the course of the coating process may be at room temperature or it may be elevated temperatures.
  • temperatures may be 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or 120 ° C.
  • Preference is given to temperatures of 15 to 120 0 C, more preferably 20 to 100 ° C, and for example 40 to 100 ° C or 70 to 9O 0 C.
  • the temperature can for example by heating the bath, in which the object to be coated immersed, are introduced. But you can also heat a submerged object later, for example using IR emitters. For pigment dispersions, the dispersion can be heated.
  • solvent still present in the coating is removed from the coating. This can be done for example by simple evaporation in air. However, the removal of the solvent can also be facilitated by raising the temperature and / or with suitable gas streams and / or applying a vacuum. The evaporation can be facilitated by, for example, heated objects in a drying oven or blown with a heated gas stream. The methods can also be combined, for example by it is dried in a convection oven or a drying tunnel. Furthermore, the coating for removing the solvent can also be heated by means of radiation, in particular IR radiation. For this purpose, all types of broadband IR emitters, for example. NIR, MIR or NIR steel can be used. However, it is also possible, for example, to use IR lasers. Such radiation sources are commercially available in various radiation geometries. Pigment dispersions can also be dried by means of spray drying, for example.
  • the temperature and the drying time in the course of drying is determined by the person skilled in the art. Has proven to have a drying temperature of 30 to 130 ° C, preferably 50 to 12O 0 C, more preferably 70 to 110 0 C, most preferably 75 to 105 ° C and for example 85 to 100 ° C. This refers to the temperature of the coating itself.
  • the temperature in a dryer can of course also be higher. Of course, the drying time is shorter, the higher the drying temperature is.
  • the temperature treatment in the course of coating and drying can advantageously be combined with one another.
  • a surface can first be treated with the formulation F at room temperature and then dried and tempered at elevated temperatures.
  • elevated temperature is applied at least in one of the two steps "treatment” or “drying".
  • higher temperature than room temperature is used in both steps.
  • the fusion hydrophobin layer may be further chemically modified before or after removal of the solvent.
  • suitable crosslinkers include glutardialdehyde, formaldehyde, and other homo and heterobifunctional protein crosslinkers known in protein chemistry.
  • the stability of the layer can be increased.
  • proteinaceous substrates such as leather
  • certain In addition, the connection to the substrate can be additionally improved for textiles, as well as for surfaces relevant to cosmetics.
  • the crosslinking can be carried out, for example, by treating the layer with the fusion hydrophobin after coating with a second solution with the crosslinker and then drying.
  • pretreat protein-containing but also other substrates such that protein-reactive functional groups are formed on the surface of the substrate.
  • This can be used, for example, the above-mentioned crosslinkers, but other chemicals such as ozone, peroxides or aldehydes.
  • Another possibility is to link or strengthen the coupling via metal ions.
  • Corresponding protein sequences with affinity for metal ions are known to the person skilled in the art (eg His ⁇ to Ni, Co, Fe, etc.) and can be attached to the hydrophobins by standard molecular biological techniques or protein-chemical coupling.
  • the metal ions may be coupled in advance to the surface to be coated or used simultaneously with the hydrophobin coupling.
  • Oligonucleotides Hal570 and Hal571 were used to perform a polymerase chain reaction.
  • the PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site.
  • the PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII.
  • This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BglI.
  • the thus obtained vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used for the expression of proteins consisting of, YAAD :: HIS6 or YAAE :: HIS6.
  • Hal570 gcgcgcccatggctcaaacaggtactga
  • Hal571 gcagatctccagccgcgttcttgcatac
  • Hal572 ggccatgggattaacaataggtgtactagg
  • Hal573 gcagatcttacaagtgccttttgcttatattcc
  • the oligonucleotides KaM 416 and KaM 417 Using the oligonucleotides KaM 416 and KaM 417, a polymerase chain reaction was carried out.
  • the template DNA used was genomic DNA of the mold Aspergillus nidulans.
  • the resulting PCR fragment contained the coding sequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase cleavage site.
  • the PCR fragment was purified and cut with the restriction endonuclease BamHI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD # 2 previously linearized with the restriction endonuclease BgIII.
  • the thus constructed vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS6.
  • KaM416 GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
  • plasmid # 513 The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
  • KaM434 GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
  • plasmid # 507 The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
  • Plasmid # 506 The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT-
  • Plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.
  • the template DNA used was Schyzophyllum commune cDNA (see Appendix).
  • KaM464 CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
  • KaM465 GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
  • 100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 mM sodium phosphate buffer, pH 7.5 and resuspended.
  • the suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then degraded for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) the nucleic acids are incubated.
  • filter with a glass cartridge P1.
  • two homogenizer runs are carried out at 1500 bar (Microfluidizer M-110EH, Microfluidics Corp.).
  • the homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , centrifugation and resuspending are repeated 3 times, with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stir for one hour and perform a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g).
  • the hydrophobin is contained in the supernatant after the final centrifugation ( Figure 1).
  • the experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells.
  • 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) which has been equilibrated with 50 mM Tris-Cl pH 8.0 buffer.
  • the column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin subsequently eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole.
  • the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.
  • Figure 1 shows the purification of the prepared fusion hydrophobin
  • Lanes 3 - 5 OD 280 maxima of the elution fractions
  • the fusion hydrophobin of Figure 1 has a molecular weight of about 53 kD.
  • the smaller bands partially represent degradation products of hydrophobin.
  • Example 10 The E. coli cell pellet obtained in Example 7 in water is forced through a nozzle at 1000 bar. The cells are completely disrupted. By means of centrifugation, the hydrophobin arising in inclusion bodies will be separated from the remaining cell debris. At a g-number of 5000, 2 phases separate after 30 minutes. The lower, fusion hydrophobin-containing phase is resuspended with water and centrifuged as above. The inclusion bodies are then incubated in 0.1 M NaOH for 60 minutes and dissolved completely. The pH is adjusted to 8 with phosphoric acid and the protein concentration is adjusted to 20 mg / ml. The purity (based on total protein) of the fusion hydrophobin thus produced is 70%.
  • Example 10 The purity (based on total protein) of the fusion hydrophobin thus produced is 70%.
  • Example 9 The hydrophobin solution obtained in Example 9 is further processed in a commercial spray dryer.
  • the spray drying is carried out with an addition of 10% w / w mannitol at an inlet temperature of 16O 0 C and outlet temperatures of 70 0 C. It was obtained a finely powdered product.
  • Spray-dried hydrophobin according to Example 10 in an aqueous buffer solution (5OmM Tris, pH 8 + 0.1 mM CaCl 2 (final concentration) + 0.1% polyvinyl lyoxyethylen (20) sorbitan monolaurate (Tween ® 20)) and added to aqueous buffer solution
  • the samples are dried in air and the contact angle (in degrees) of a drop of 5 ⁇ l of water at room temperature is determined.
  • the contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.
  • Example 8 a solution of yaad-Xa-dewA-his obtained according to Example 8 (SEQ ID NO: 20) was used.
  • the solution also contained sodium phosphate buffer at a concentration of 50 mM.
  • the concentration of the fusion hydrophobin in the solution was 11, 23 mg / ml, the pH of the solution 7.5.
  • the solutions were diluted approximately 100-fold to a concentration of 100 ⁇ g / ml of fusion hydrophobin.
  • the following solutions or solvents were used in each case:
  • the aluminum sheets were sprayed with the solution 10-1 (water only) and 10-2 (fusion hydrophobin in Tris buffer), dried and rinsed with deionized water.
  • the consumption of solution was 150 ml (100 ⁇ g / ml) for 1.2 m 2 plate, this corresponds to about 12.5 mg hydrophobin / m 2 .
  • Tab. 2 Coating of aluminum plates with fusion hydrophobins It can be seen a slight hydrophobization of the aluminum surface by means of contact angle measurement. With regard to the film formation of water on the aluminum surface, a clear modification can be seen.
  • Substrate leather (Wet Blue)
  • Spray-dried hydrophobin is taken up in water and adjusted to a concentration of 100 ⁇ g / ml - incubation of pieces of leather overnight (at room temperature) in 50 mM Tris pH 8 + 0.1 nriM CaCl 2 (final concentration) + 0.1% polyoxyethylene ( 20) sorbitan monolaurate (Tween® 20) then wash coating in distilled water
  • hydrophilization There is a significant hydrophilization of the leather, which gains additional mechanical stability through the crosslinking.
  • the hydrophilization can be determined in a known manner by means of water drop recording. While a drop of water on untreated leather took about 4 minutes to be drawn in, an equal drop of water absorbed the hydrophobin-treated leather in less than 1 minute.
  • Spray-dried hydrophobin according to Example 9 is taken up in 1 OmM Tris pH 8 and adjusted to a concentration of 50 ⁇ g / ml. Glass slides are wetted with the hydrophobin solution and dried by IR radiation (IR125R from Philips) within 10 minutes.
  • the contact angle (in degrees) of a drop of 5 ⁇ l of water is determined at room temperature.
  • the contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.
  • Untreated glass gave a contact angle of 30 ⁇ 5 °; the treated glass gave a contact angle of 75 ⁇ 15 °.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Geochemistry & Mineralogy (AREA)
  • Materials Engineering (AREA)
  • Manufacturing & Machinery (AREA)
  • Peptides Or Proteins (AREA)
  • Paints Or Removers (AREA)

Abstract

L'invention concerne un procédé pour enduire des surfaces au moyen d'hydrophobines de fusion à pH > 4, ainsi que des surfaces enduites d'une couche contenant au moins une hydrophobine de fusion.
EP06708070A 2005-02-07 2006-02-07 Procede pour enduire des surfaces avec des hydrophobines Withdrawn EP1848734A2 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DE200510005737 DE102005005737A1 (de) 2005-02-07 2005-02-07 Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE200510007480 DE102005007480A1 (de) 2005-02-17 2005-02-17 Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE200510051515 DE102005051515A1 (de) 2005-10-26 2005-10-26 Verfahren zum Beschichten von Oberflächen mit Hydrophobinen
PCT/EP2006/050723 WO2006082253A2 (fr) 2005-02-07 2006-02-07 Procede pour enduire des surfaces avec des hydrophobines

Publications (1)

Publication Number Publication Date
EP1848734A2 true EP1848734A2 (fr) 2007-10-31

Family

ID=36763579

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06708070A Withdrawn EP1848734A2 (fr) 2005-02-07 2006-02-07 Procede pour enduire des surfaces avec des hydrophobines

Country Status (4)

Country Link
US (1) US20080319168A1 (fr)
EP (1) EP1848734A2 (fr)
TW (1) TW200639179A (fr)
WO (1) WO2006082253A2 (fr)

Families Citing this family (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2596661C (fr) 2005-02-07 2013-12-10 Basf Aktiengesellschaft Nouvelles proteines de fusion d'hydrophobine, leur production et leur utilisation
MX2007012021A (es) * 2005-03-31 2008-03-14 Basf Ag El uso de polipeptidos como promotores de adhesion.
WO2006103253A2 (fr) 2005-04-01 2006-10-05 Basf Aktiengesellschaft Lavage de forage au moyen d'hydrophobine
EA014384B1 (ru) 2005-04-01 2010-10-29 Басф Акциенгезелльшафт Промывочный буровой раствор, содержащий гидрофобин
DE102005027139A1 (de) 2005-06-10 2006-12-28 Basf Ag Neue Cystein-verarmte Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005033002A1 (de) * 2005-07-14 2007-01-18 Basf Ag Wässrige Monomeremulsionen enthaltend Hydrophobin
WO2007014897A1 (fr) * 2005-08-01 2007-02-08 Basf Se Utilisation de proteines tensioactives non enzymatiques pour le linge
EP2054687B1 (fr) * 2006-08-15 2011-10-19 Basf Se Procédé de fabrication de préparations d'hydrophobine s'écoulant librement, sèches
PL2134775T3 (pl) 2007-03-06 2010-11-30 Basf Se Modyfikowane hydrofobinami tworzywa piankowe o otwartych komórkach
AU2008225890B2 (en) * 2007-03-12 2012-03-08 B.R.A.I.N. Biotechnology Research And Information Network Ag Method of treating cellulosic materials with hydrophobins
KR20100022482A (ko) * 2007-05-24 2010-03-02 바스프 에스이 고체의 결정화에서 보조제로서의 히드로포빈의 용도
WO2009037061A2 (fr) 2007-09-13 2009-03-26 Basf Se Utilisation de polypeptides de type hydrophobine comme renforçateurs de pénétration
EP2042155A1 (fr) * 2007-09-28 2009-04-01 Basf Se Procédé de suppression de substances indissolubles dans l'eau de surfaces de substrat
CN102015955A (zh) * 2008-02-14 2011-04-13 巴斯夫欧洲公司 疏水蛋白在防止表面结冰中的应用
WO2010072665A1 (fr) 2008-12-23 2010-07-01 Basf Se Modification de nanofibres ou de mésofibres ou de produits textiles plats produits par électrofilage à l'aide de protéines amphiphiles
US20110312497A1 (en) * 2009-02-10 2011-12-22 Basf Se Use of hydrophobin as a spreading agent
CN102341464A (zh) 2009-03-09 2012-02-01 巴斯夫欧洲公司 水溶性聚合物和疏水蛋白的混合物在增稠水相中的用途
WO2011015530A2 (fr) 2009-08-03 2011-02-10 Basf Se Procédé pour le dépôt de couches minces d’oxydes métalliques
US8993743B2 (en) 2010-02-18 2015-03-31 B.R.A.I.N. Biotechnology Research And Information Network Ag Chimeric surface active proteins
EP2371844A1 (fr) 2010-03-25 2011-10-05 B.R.A.I.N. Biotechnology Research and Information Network AG Protéines actives à surface chimérique
JP2013523232A (ja) 2010-03-31 2013-06-17 ビーエーエスエフ ソシエタス・ヨーロピア 被覆されたステントおよびタンパク質で被覆する方法
WO2012004255A1 (fr) 2010-07-07 2012-01-12 Basf Se Composition contenant une hydrophobine et procédé de nettoyage de surfaces hydrophobes
WO2012013508A1 (fr) 2010-07-30 2012-02-02 Basf Se Protéine amphiphile utilisée en électronique imprimée
WO2012049250A2 (fr) 2010-10-13 2012-04-19 Basf Se Procédé pour immobiliser des principes actifs cationiques sur des surfaces
RU2013149861A (ru) 2011-04-08 2015-05-20 ДАНИСКО ЮЭс, ИНК. Композиции
EP2909230B1 (fr) 2012-10-19 2019-05-22 Danisco US Inc. Stabilisation de membranes biométriques
DK3083936T3 (en) 2013-12-19 2018-10-22 Danisco Us Inc USE OF HYDROPHOBINES TO INCREASE GAS TRANSFER IN AEROBE FERMENTATION PROCESSES

Family Cites Families (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2399161A (en) * 1942-06-30 1946-04-30 Claude R Wickard Process for producing glues and adhesives from keratin protein materials
GB1278924A (en) * 1970-02-06 1972-06-21 Ici Ltd Improvements in synthetic film materials
DE2609104A1 (de) * 1976-03-05 1977-09-15 Basf Ag Verfahren zur herstellung von styrol-suspensionspolymerisaten
DE2638839A1 (de) * 1976-08-28 1978-03-02 Basf Ag Verfahren zur herstellung von styrol-suspensionspolymerisaten
US5049504A (en) * 1986-11-24 1991-09-17 Genex Corporation Bioadhesive coding sequences
JPH03203838A (ja) * 1989-12-29 1991-09-05 Matsushita Electric Ind Co Ltd 回転体に対する処理装置
DE4024871A1 (de) * 1990-08-06 1992-02-13 Basf Ag Perlfoermige antistatische expandierbare styrolpolymerisate
DE4220225A1 (de) * 1992-06-20 1993-12-23 Basf Ag Verfahren zur Herstellung von perlförmigen expandierbaren Styrolpolymerisaten
IL110938A (en) * 1994-09-12 2001-01-28 Haber Meir Adhesive proteins isolated from mature macro and microalgae
WO1996041882A1 (fr) * 1995-06-12 1996-12-27 Proefstation Voor De Champignoncultuur Hydrophobines de champignons commestibles, genes, sequences nucleotidiques, fragments d'adn codant pour lesdites hydrophobines et leur expression
DE19956802A1 (de) * 1999-11-25 2001-06-13 Cognis Deutschland Gmbh Waschmitteltabletten
GB0002660D0 (en) * 2000-02-04 2000-03-29 Biomade B V Method of stabilizing a hydrophobin-containing solution and a method of coatinga surface with a hydrophobin
GB0002663D0 (en) * 2000-02-04 2000-03-29 Biomade B V Method of stabalizing a hydrophobin-containing solution and a method of coating a surface with a hydrophobin
WO2002020651A2 (fr) * 2000-09-06 2002-03-14 Zymogenetics, Inc. Polypeptide de phéromone humaine
FR2833490B1 (fr) * 2001-12-14 2004-12-10 Oreal Utilisition cosmetique d'au moins une hydrophobine pour le traitement des matieres keratiniques et compositions mises en oeuvre
DE10342794A1 (de) * 2003-09-16 2005-04-21 Basf Ag Sekretion von Proteinen aus Hefen
US7241734B2 (en) * 2004-08-18 2007-07-10 E. I. Du Pont De Nemours And Company Thermophilic hydrophobin proteins and applications for surface modification
CA2596661C (fr) * 2005-02-07 2013-12-10 Basf Aktiengesellschaft Nouvelles proteines de fusion d'hydrophobine, leur production et leur utilisation
CA2610785A1 (fr) * 2005-06-06 2006-12-14 Basf Aktiengesellschaft Procede d'enduction de surfaces de substrats fibreux
DE102005027139A1 (de) * 2005-06-10 2006-12-28 Basf Ag Neue Cystein-verarmte Hydrophobinfusionsproteine, deren Herstellung und Verwendung

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2006082253A3 *

Also Published As

Publication number Publication date
US20080319168A1 (en) 2008-12-25
WO2006082253A3 (fr) 2006-12-28
TW200639179A (en) 2006-11-16
WO2006082253A2 (fr) 2006-08-10

Similar Documents

Publication Publication Date Title
EP1848734A2 (fr) Procede pour enduire des surfaces avec des hydrophobines
EP1866150B1 (fr) Substrats métalliques ayant des polypeptides comme agents adhesifs
EP1848733B1 (fr) Nouvelles proteines de fusion d'hydrophobine, leur production et leur utilisation
EP1866401B1 (fr) Utilisation d'hydrophobines pour le traitement antisalissant de surfaces dures
EP1904534B1 (fr) Emulsions monomeres aqueuses contenant de l'hydrophobine
EP1913123B1 (fr) Utilisation de proteines tensioactives non enzymatiques pour le linge
EP1866106B1 (fr) Utilisation d'hydrophobines pour traiter la surface de materiaux de construction mineraux durcis, de pierre naturelle, de pierre artificielle et de ceramiques
EP1893675B9 (fr) Hydrophobine utilisee en tant que substance de revetement pour des particules polymeres thermoplastiques expansibles ou expansees
EP1893639A2 (fr) Nouvelles proteines de fusion de type hydrophobines appauvries en cysteine, leur production, et leur utilisation
WO2006103251A1 (fr) Utilisation de proteines comme desemulsifants
WO2006103252A2 (fr) Utilisation d'hydrophobine comme stabilisateur de phases
WO2006131478A2 (fr) Procede d'enduction de surfaces de substrats fibreux
EP1941009A2 (fr) Utilisation de proteines en tant que composante antimousse dans des carburants
EP1869138A2 (fr) Lavage de forage au moyen d'hydrophobine
WO2006128877A1 (fr) Procede de reduction de la vitesse d'evaporation de liquides
DE102005015043A1 (de) Verwendung von Polypeptiden als Haftvermittler
DE102005051515A1 (de) Verfahren zum Beschichten von Oberflächen mit Hydrophobinen
DE102005007480A1 (de) Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005005737A1 (de) Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005045770A1 (de) Verwendung von Polypeptiden als Haftvermittler
DE102005030786A1 (de) Verfahren zur Beschichtung von Oberflächen von faserigen Substraten
DE102005026143A1 (de) Verfahren zur Beschichtung von Oberflächen von faserigen Substraten
DE102005036341A1 (de) Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20070907

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BASF SE

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20100219

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20100702