AU2006254154A1 - Method for reducing the evaporation rate of liquids - Google Patents

Description

IN THE MATTER OF an Australian Application corresponding to PCT Application PCT/EP2006/062735 RWS Group Ltd, of Europa House, Marsham Way, Gerrards Cross, Buckinghamshire, England, hereby solemnly and sincerely declares that, to the best of its knowledge and belief, the following document, prepared by one of its translators competent in the art and conversant with the English and German languages, is a true and correct translation of the PCT Application filed under No. PCT/EP2006/062735. Date: 24 October 2007 C. E. SITCH Managing Director - UK Translation Division For and on behalf of RWS Group Ltd 1 METHOD FOR REDUCING THE EVAPORATION RATE OF LIQUIDS Description 5 The invention relates to a method of reducing the rate of evaporation of liquids, with the method using at least one hydrophobin as auxiliary agent. Service water is required in large quantities for certain mining techniques in diamond, gold or silver mining, for example, particularly for working up and separating the 10 products of value from the spoil. These mining areas frequently lie in hot, arid or semi arid regions in which water is scarce and frequently has to be transported into the mining areas at great cost. Service water is therefore as a rule used many times over and stored inbetween the individual occasions on which it is used. It is usually stored in open liquid reservoirs such as storage lakes or the like. 15 In order to reduce the losses of water by evaporation, it is known to apply barrier layers composed of high-boiling hydrocarbons, for example diesel oil, to the water surface, with these barrier layers being intended to reduce the evaporation of the water. However, this barrier layer is frequently not area-wide and homogeneous. "Eyes of fat" 20 are frequently formed instead of a homogeneous layer. The losses of liquid as a result of evaporation are therefore high despite the barrier layer. Hydrophobins are small proteins of about 100 to 150 amino acids which are characteristic of filamentous fungi, for example Schizophyllum commune. 25 Hydrophobins exhibit a pronounced affinity for interfaces and are therefore suitable for coating surfaces. Thus, Teflon, for example, can be coated with hydrophobins, resulting in a hydrophilic surface being obtained. 30 Hydrophobins can be isolated from natural sources. Our earlier application DE 102005007480.4 discloses a method for preparing hydrophobins. The prior art has proposed using hydrophobins for a variety of applications. 35 WO 96/41882 proposes using hydrophobins as emulsifiers, thickeners and surface active substances, for hydrophilizing hydrophobic surfaces, for improving the water resistance of hydrophilic substrates, or for preparing oil-in-water emulsions or water-in oil emulsions. The document also proposes pharmaceutical applications such as the production of ointments or creams and also cosmetic applications such as skin 40 protection or the production of hair shampoos or hair rinses.

2 EP 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, receptacles for carrying out experiments or for storage, ship holds, solid particles or frames, or the bodywork of private cars at a temperature of from 30 to 800C with a solution which comprises hydrophobins. 5 WO 03/53383 discloses the use of hydrophobin for treating keratin materials in cosmetic applications. WO 03/10331 discloses a hydrophobin-coated sensor, for example a measuring 10 electrode, to which other substances, e.g. electroactive substances, antibodies or enzymes, are bound noncovalently. There has been no previous disclosure of the use of hydrophobins for reducing the rate of evaporation of liquids in open liquid reservoirs. 15 It is an object of the invention to provide an improved method of reducing the rate of evaporation of liquids, in particular liquids in open liquid reservoirs. We have found that this object is achieved by a method of reducing the rate of 20 evaporation of liquids (L), in which method the surface of the liquid (L) is covered with a barrier fluid (B) which is not miscible with this liquid and which has a higher boiling point and a lower density than the liquid, with at least one hydrophobin being added, as auxiliary agent, to the liquid (L) and/or the barrier fluid (B). The liquid (L) is preferably water. The liquid is preferably in an open liquid reservoir. 25 A second aspect of the invention involved finding open liquid reservoirs which comprise at least one liquid (L) and also a barrier fluid (B) which has a higher boiling point and a lower density than the liquid (L), which is not miscible with this liquid and which covers the surface of the liquid (L), with the liquid reservoir additionally comprising at least one 30 hydrophobin. A third aspect of the invention involved finding the use of hydrophobins as auxiliary agents for liquid barrier layers. 35 It has been found, surprisingly, that the rate of evaporation of the liquid (L) can be drastically decreased by using hydrophobins. In a typical embodiment of the invention, more than 60% of the liquid which was originally present in an open liquid reservoir had evaporated after 20 days when hydrophobins were not being used. Only about 13% by weight of the liquid which was originally present evaporated over the same period when 40 hydrophobins were being used as an additive. The following is to be stated with regard to the details of the invention: 3 The liquid (L) which is to be protected from evaporation can in principle be any aqueous or organic liquid. The liquid can naturally also be a mixture of different substances. However, the liquid is preferably water, for example drinking water, processed water, service water or seawater. As a rule, the water is effluent water or 5 processed water from industrial and technical processes which is to be reused. The term "water" is not intended to be restricted to chemically pure water; instead, the water can also comprise other constituents which are dissolved, dispersed or suspended in it. For example, the water can comprise dissolved salts or sludges, for example composed of spoil or components of spoil, or else comprise water-miscible organic 10 solvents. The liquid can be in any desired arrangement. For example, the liquid may comprise water in lakes or seas or else liquids filled into any desired devices. Preferably, the liquid is in an open liquid reservoir. 15 Within the meaning of this invention, the term "open liquid reservoir" means a liquid reservoir which is not completely closed off from the environment but is still in contact with the environment such that the liquid can in principle evaporate and pass into the environment. In this connection, the open liquid reservoir can, for example, be a tank 20 which has an aperture which is not closed. However, as a rule, the open liquid reservoir is a reservoir in which the entire surface of the liquid is uncovered. The reservoirs can be natural or artificially installed liquid reservoirs. Examples of open liquid reservoirs of this nature comprise storage lakes, dammed reservoirs, cisterns, open storage tanks or what are termed lagoons. 25 According to the invention, the surface of the liquid (L) is covered with a barrier fluid (B) which is not miscible with this liquid. The barrier fluid can naturally also be a mixture of different substances. The term "not miscible" means that no significant quantities of the barrier fluid are to dissolve in the liquid. This naturally does not exclude the possibility 30 of traces or insignificant quantities being able to be dissolved. By its nature, the barrier fluid has a lower density than the liquid whose evaporation is to be retarded. In addition, the barrier fluid has a higher boiling point or boiling range than does the liquid whose evaporation is to be retarded. 35 The skilled person will make a suitable selection from the barrier fluids (B) which are in principle possible. Liquids which are nonpolar or essentially nonpolar have proved to be of value as the barrier fluid for the preferred case where the liquid (L) is water or an aqueous liquid 40 mixture. Examples comprise, in particular, hydrocarbons or mixtures of hydrocarbons. The skilled person will select the boiling point of hydrocarbons which are employed. A boiling point of at least 1500C has proved to be useful. In the case of mixtures, this 4 value relates to the lower limit of the boiling range with no account having been taken of any possible contamination with readily volatile compounds. For example, it is possible to employ hydrocarbon mixtures having a boiling range of from 150 to 250 0 C, preferably of from 200 to 3000C and particularly preferably of from 220 to 350*C. 5 Examples of these mixtures comprise high-boiling paraffinic, naphthenic and aromatic mineral oils. These mineral oils are obtained from crude oils by vacuum distillation. Preference is given to high-boiling mineral oils which are essentially paraffinic and/or naphthenic. These mineral oils are also termed white oils, with the skilled person 10 differentiating between industrial white oils, which are still able to comprise a small content of aromatic compounds, and medical white oils, which are essentially free of aromatic compounds. Other examples comprise petroleum benzine or diesel oil. However, it is also possible to use natural, in particular vegetable, oils which can be readily degraded biologically. Examples comprise soybean oil, wood oil, tall oil, thistle 15 oil, castor oil, rapeseed oil or linseed oil. It is furthermore also possible to use derivatives of these oils. Examples comprise esters such as rapeseed oil methyl ester or tall oil fatty acid ester. In order to carry out the method according to the invention, the liquid surface is covered 20 with the barrier fluid (B). The quantity of the barrier fluid is determined by the skilled person such that while, on the one hand, the liquid surface is covered as completely as possible, too great a quantity of barrier fluid is on the other hand avoided. As a rule, the thickness of the barrier layer should be not more than 2 mm, preferably not more than 1 mm, without this thereby in principle excluding greater thicknesses. In particular, 25 layer thicknesses of from 0.1 to 1 mm, preferably of from 0.2 to 0.9 mm, and particularly preferably of from 0.3 to 0.8 mm, have proved to be of value. According to the invention, at least one hydrophobin is added to the liquid (L) and/or the barrier layer as auxiliary agent. It is naturally also possible to use mixtures of 30 different hydrophobins. Within the meaning of this invention, the term "hydrophobins" is to be understood below as referring to proteins of the general structural formula (1) 35 Xn-C 1

-X

1 .o-C 2 -Xo.

5

-C

3

-X

1

.

100 C4-X 1 .1oo0C5-X1.

50

C

6 -Xo.SC7-X 1 .50C 8 Xm (I) where X can be any of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, Gin, Arg, Ile Met, Thr, Asn, Lys, Val, Ala, Asp, Glu, Gly). In this connection, X can in each case be identical or different. In the formula, the indices at X 40 in each case represent the number of the amino acids, C is cysteine, analine, serine, glycine, methionine or threonine, with at least four of the C amino acids being cysteine, 5 and the indices n and m are, independently of each other, natural numbers from 0 to 500, preferably from 15 to 300. The polypeptides according to formula (1) are further characterized in that, after coating 5 a glass surface, they bring about an increase in the contact angle of a water drop of at least 200, preferably at least 250, and particularly preferably 300, in each case compared with the contact angle of a water drop of the same size with the uncoated glass surface. 10 The amino acids designated by C' to C8 are preferably cysteines; however, they can also be replaced with other amino acids of similar space-filling, preferably with alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, particularly preferably at least 6 and in particular at least 7, of the C' to C8 positions should consist of cysteines. In the proteins which are used in accordance with the 15 invention, cysteines can either be present in the reduced state or form disulfide bridges with each other. Particular preference is given to the intramolecular formation of C-C bridges, particularly that involving the formation of at least one, preferably 2, particularly preferably 3, and very particularly preferably 4, intramolecular disulfide bridges. In the case of the above-described replacement of cysteines with amino acids 20 of similar space-filling, those C positions which can form intramolecular disulfide bridges with each other are advantageously replaced in pairs. If cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions designated by X, the numbering of the individual C positions in the general 25 formulae can change correspondingly. Preference is given to using hydrophobins of the general formula (II) Xn-C'-X 3

.

25 -C2-Xo.

2 -C 3X 5

.

5 o-C4-X 2

.

3 s-C5-X 2 -1 5 -C6-Xo.

2 -C7-X 3

.

35 -C8-Xm (11) 30 for carrying out the present invention, where X, C and the indices at X and C have the above meaning but the indices n and m are numbers of from 0 to 300 and the proteins are still characterized by the abovementioned contact angle change. 35 Particular preference is given to using hydrophobins of the general formula (Ill) Xn-C'-X 5

.

9

-C

2 -C3-X 11

.

39

C

4

-X

2

-

23

-C

5

-X

5 .9-C 6

-C

7 -X6.

18 -C-Xm (Ill) where X, C and the indices at X and C have the above meaning, the indices n and m 40 are numbers of from 0 to 200, the proteins are still characterized by the abovementioned contact angle change and at least 6 of the C amino acids are still cysteine. Particular preference is given to all the C amino acids being cysteine.

6 The residues X, and Xm can be peptide sequences which are naturally linked to a hydrophobin. However, one or both of the residues can also be peptide sequences which are not naturally linked to a hydrophobin. This is also to be understood as including those Xn and/or Xm residues where a peptide sequence which naturally 5 occurs in a hydrophobin is extended by a peptide sequence which does not occur naturally in a hydrophobin. If Xn and/or Xm is/are (a) peptide sequence(s) which is/are not naturally linked to hydrophobins, these sequences are as a rule at least 20, preferably at least 35, 10 particularly preferably at least 50, and very particularly preferably at least 100, amino acids in length. Such a residue, which is not naturally linked to a hydrophobin, will also be termed a fusion partner in that which follows. This is intended to express the fact that the proteins can be composed of at least one hydrophobin moiety and one fusion partner which are not found together in nature in this form. 15 The fusion partner can be selected from a large number of proteins. It is also possible for several fusion partners to be linked to one hydrophobin moiety, for example at the amino terminus (Xn) and at the carboxy terminus (Xm) of the hydrophobin moiety. However, it is also possible for two fusion partner moieties, for example, to be linked to 20 one position (Xn or Xm) of the protein according to the invention. Proteins which naturally occur in microorganisms, in particular in E. coli or Bacillus subtilis, are particularly suitable fusion partner moieties. Examples of such fusion partner moieties are the sequences yaad (SEQ ID NOs:15 and 16), yaae (SEQ ID 25 NOs:1 7 and 18) and thioredoxin. Fragments or derivatives of these said sequences which only comprise a part, preferably 70 to 99%, particularly preferably 80 to 98%, of said sequences, or in which individual amino acids or nucleotides are altered as compared with said sequence, with the percentage values in each case relating to the number of amino acids, are also very suitable. 30 In a further preferred embodiment, the fusion hydrophobin, as well as the fusion partner, further comprises as group Xn or Xm an affinity tag/ tail. This affinity domain comprises, in a basically known manner, core groups capable of interacting with certain complementary groups and useful for facilitating workup and purification of the 35 proteins. Examples of such affinity domains comprise (His)k, (Arg)k, (Asp)k, (Phe)k or (Cys)k groups, where k is generally a natural number from 1 to 10. The affinity domain may preferably be a (His)k group where k is from 4 to 6. The proteins which are used in accordance with the invention can also be modified in 40 their polypeptide sequence as well, for example by means of glycosylation or acetylation or else by means of chemical crosslinking, for example using glutaraldehyde.

7 An essential property of the proteins which are used in accordance with the invention is the change in surface properties when the surfaces are coated with the proteins. The change in the surface properties can be determined experimentally by measuring the contact angle of a water drop before and after coating the surface with the protein and 5 determining the difference in the two measurements. The skilled person knows in principle how to carry out contact angle measurements. The measurements relate to room temperature and to 5 I water drops. The precise experimental conditions for an example of a suitable method for measuring the contact 10 angle are described in the experimental section. Under the conditions given in the experimental section, the proteins which are used in accordance with the invention possess the property of increasing the contact angle by at least 200, preferably at least 250, particularly preferably at least 30', in each case compared with the contact angle of a water drop of the same size with the uncoated glass surface. 15 The positions of the polar and nonpolar amino acids in the hydrophobin moiety of the previously known hydrophobins are conserved, with this being manifested in a characteristic hydrophobicity plot. Differences in biophysical properties and hydrophobicity have led to the previously known hydrophobins being divided into two 20 classes, i.e. I and II (Wessels et al. 1994, Ann. Rev. Phytopathol., 32, 413-437). The membranes which are assembled from class I hydrophobins are extremely insoluble (even towards 1% Na dodecyl sulfate (SDS) at elevated temperature) and can only be dissociated once again using concentrated trifluoroacetic acid (TFA) or 25 formic acid. By contrast, the assembled forms of class II hydrophobins are less stable. They can already be redissolved using 60% ethanol or 1% SDS (at room temperature). A comparison of the amino acid sequences shows that the length of the region between cysteine C3 and C4 is markedly shorter in class il hydrophobins than it is in 30 class I hydrophobins. Class II hydrophobins also possess more charged amino acids than do class I hydrophobins. Hydrophobins which are particularly preferred for carrying out the present invention are the hydrophobins of the dewA, rodA, hypA, hypB, sc3, basf1 and basf2 type, which are 35 characterized structurally in the sequence listing which follows. However, the hydrophobins can also be only moieties or derivatives of these hydrophobins. It is also possible to link several hydrophobin moieties, preferably 2 or 3, of the same or different structure, together and to link them to a corresponding suitable polypeptide sequence which is not naturally connected to a hydrophobin. 40 The fusion proteins yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basfl-his (SEQ ID NO: 24) having the polypeptide sequences 8 given in brackets, and also the encoding nucleic acid sequences, in particular the sequences as depicted in SEQ ID NOs: 19, 21, 23 are particularly also suitable according to the invention. Proteins which are formed from the polypeptide sequences depicted in SEQ ID NOs: 20, 22 or 24 by the substitution, insertion or deletion of at 5 least one and up to 10, preferably 5, particularly preferably 5%, of all the amino acids and which still possess at least 50% of the biological property of the starting proteins are also particularly preferred embodiments. In this connection, the biological property of the proteins is understood as being the change in the contact angle by at least 200 as has already been described. 10 Derivatives particularly suitable for carrying out the invention are residues derived from yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf1-his (SEQ ID NO: 24) by shortening the yaad fusion partner. Instead of the complete yaad fusion partner (SEQ ID NO: 16) of 294 amino acids it is 15 advantageously possible to use a shortened yaad residue. However, the shortened residue should comprise at least 20 and preferably at least 35 amino acids. For example, it is possible to use a shortened residue of 20 to 293, preferably 25 to 250 and more preferably 35 to 150 and for example 35 to 100 amino acids. 20 The proteins which are used in accordance with the invention can be prepared chemically using known methods of peptide synthesis, for example by means of Merrifield's solid-phase synthesis. Suitable methods can be used to isolate naturaIlly occurring hydrophobins from natural 25 sources. The reader is referred, by way of example, to W6sten et. al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882. Fusion proteins can preferably be prepared using recombinant methods in which a nucleic acid sequence, in particular DNA sequence, encoding the fusion partner and 30 one encoding the hydrophobin moiety are combined such that the desired protein is produced in a host organism by the genetic expression of the combined nucleic acid sequence. A preparation method of this nature is disclosed in our prior application DE 102005007480.4. 35 In this connection, host organisms (production organisms) which are suitable for said preparation method can be prokaryotes (including the Archaea) or eukaryotes, particularly bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, particularly preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia 40 pastoris, Pseudomonas spec., lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and others.

9 The invention also relates to the use of expression constructs which comprise, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence which encodes a polypeptide which is used in accordance with the invention and also to vectors which comprise at least one of these expression constructs. 5 Constructs which are employed preferably comprise a promoter 5'-upstream of the given coding sequence and a terminator sequence 3-downstream as well as, if appropriate, other customary regulatory elements, in each case operatively linked to the coding sequence. 10 "Operative linkage" is understood as meaning the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, other regulatory elements such that each of the regulatory elements is able to fulfill its function in accordance with its intended use in connection with expressing the coding sequence. 15 Examples of sequences which can be operatively linked are targeting sequences and also enhancers, polyadenylation signals and the like. Other regulatory elements comprise selectable markers, amplification signals, origins of replication and the like. Examples of suitable regulatory sequences are described in Goeddel, Gene 20 Expression Technology : Methods in Enzymology 185, Academic Press, San Diego, CA (1990). In addition to these regulatory sequences, the natural regulation of these sequences can still be present upstream of the actual structural genes and, if appropriate, have 25 been genetically altered such that the natural regulation has been switched off and the expression of the genes has been increased. A preferred nucleic acid construct advantageously also comprises one or more of the enhancer sequences which have already been mentioned, which sequences are 30 functionally linked to the promoter and enable the expression of the nucleic acid sequence to be increased. Additional advantageous sequences, such as further regulatory elements or terminators, can also be inserted at the 3' end of the DNA sequences. 35 The nucleic acids can be present in the construct in one or more copies. The construct can comprise yet other markers, such as antibiotic resistances or genes which complement auxotrophies, for selecting for the construct, if appropriate. Regulatory sequences which are advantageous for the method are present, for 40 example, in promoters such as the cos, tac, trp, tet, trp-tet, Ipp, lac,lpp-lac, laclq-T7, T5, T3, gal, trc, ara, rhaP(rhaPBAD) SP6, lambda-PR or imlambda-P promoter, which promoters are advantageously used in Gram-negative bacteria. Other advantageous 10 regulatory sequences are present, for example, in the Gram-positive promoters amy and SPO2, or in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYCI, GAPDH, TEF, rp28 and ADH. 5 Artificial promoters can also be used for the regulation. For being expressed in a host organism, the nucleic acid construct is advantageously inserted into a vector, such as a plasmid or a phage, which enables the genes to be expressed optimally in the host. Apart from plasmids and phages, vectors are also to 10 be understood as being any other vectors which are known to the skilled person, that is, for example, viruses, such as SV40, CMV, baculovirus and adenovirus, transposons, IS elements, phasmids, cosmids and linear or circular DNA and also the Agrobacterium system. 15 These vectors can either replicate autonomously in the host organism or be replicated chromosomally. These vectors constitute another embodiment of the invention. Examples of suitable plasmids are pLG338, pACYC1 84, pBR322, pUC1 8, pUC1 9, pKC30, pRep4, pHS1, pKK223-3, pDHE1 9.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, plN-Ill"3-B1, tgtl 1 or pBdCI, in E. coli, pIJ101, plJ364, plJ702 or plJ361, in 20 Streptomyces, pUB1 10, pC194 or pBD214 in Bacillus, pSA77 or pAJ667, in Corynebacterium, pALS1, plL2 or pBB1 16 in fungi, 2alpha, pAG-1, YEp6, YEp1 3 or pEMBLYe23, in yeasts, or pLGV23, pGHlac+, pBIN19, pAK2004 or pDH51, in plants. Said plasmids constitute a small selection of the possible plasmids. Other plasmids are known to the skilled person and can be found, for example, in the book Cloning Vectors 25 (Eds. Pouwels P. H. et al. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). Advantageously, the nucleic acid construct additionally comprises, for the purpose of expressing the other genes which are present, 3'- and/or 5-terminal regulatory 30 sequences which are intended for increasing expression and which are selected for optimal expression in dependence on the host organism and gene or genes which are chosen. These regulatory sequences are intended to enable the genes to be expressed 35 selectively and to enable the proteins to be expressed. Depending on the host organism, this can mean, for example, that the gene is only expressed or overexpressed following induction or that it is immediately expressed and/or overexpressed. 40 In this connection, the regulatory sequences or factors can preferably influence positively, and thereby increase, the gene expression of the inserted genes. Thus, the regulatory elements can advantageously be augmented at the transcriptional level by 11 using strong transcription signals such as promoters and/or enhancers. However, in addition to that, it is also possible to augment the translation by, for example, improving the stability of the mRNA. 5 In another embodiment of the vector, the vector comprising the nucleic acid construct or the nucleic acid can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism by way of heterologous or homologous recombination. This linear DNA can consist of a linearized vector, such as a plasmid, or only of the nucleic acid construct or the nucleic 10 acid. In order to achieve optimal expression of heterologous genes in organisms, it is advantageous to alter the nucleic acid sequences in accordance with the specific codon usage which is employed in the organism. The codon usage can be readily 15 ascertained with the aid of computer analyses of other known genes of the organism concerned. An expression cassette is prepared by fusing a suitable promoter with a suitable coding nucleotide sequence and a terminator signal or polyadenylation signal. To do this, use 20 is made of customary recombination and cloning techniques as are described, for example, in T. Maniatis, E. F.Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and also in T. J. Silhavy, M. L. Berman and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F. M. et al., 25 Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987). For expression in a suitable host organism, the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector which enables the 30 genes to be expressed optimally in the host. Vectors are well known to the skilled person and can be found, for example, in "Cloning Vectors" (Pouwels P. H. et al., Eds., Elsevier, Amsterdam-New York-Oxford, 1985). The vectors can be used to prepare recombinant microorganisms which are 35 transformed, for example, with at least one vector and can be used for producing the proteins which are used in accordance with the invention. Advantageously, the above described recombinant constructs are introduced into a suitable host system and expressed in this system. In this connection, customary cloning and transfection methods which are known to the skilled person, such as coprecipitation, protoplast 40 fusion, electroporation, retroviral transfection and the like, are preferably used in order to express said nucleic acids in the given expression system. Suitable systems are described, for example, in Current Protocols in Molecular Biology, F. Ausubel et al., 12 Eds., Wiley Interscience, New York 1997, or Sambrook et al. Molecular Cloning: A Laboratory Manual, 2 nd edtn., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. 5 It is also possible to prepare homologously recombined microorganisms. A vector which comprises at least one segment of a gene or a coding sequence which is to be used in accordance with the invention in which, if appropriate, at least one amino acid deletion, addition or substitution has been introduced in order to alter, e.g. functionally disrupt, the sequence (thereby forming a knockout vector) is prepared for this purpose. 10 The sequence which is introduced can, for example, also be a homolog from a related microorganism or be derived from a mammalian, yeast or insect source. The vector which is used for the homologous recombination can alternatively be constituted such that while the endogenous gene mutates, or is in some other way altered, in connection with homologous recombination, it still encodes the functional protein (e.g. the 15 upstream regulatory region can be altered such that this alters the expression of the endogenous protein). The altered segment of the gene which is used in accordance with the invention is in the homologous recombination vector. The construction of vectors which are suitable for homologous recombination is described, for example, in Thomas, K. R. and Capecchi, M. R. (1987) Cell 51 : 503. 20 Any prokaryotic or eukaryotic organisms are in principle suitable for being used as recombinant host organisms for the nucleic acid or the nucleic acid construct which is used in accordance with the invention. Microorganisms such as bacteria, fungi or yeasts are advantageously used as host organisms. Gram-positive or Gram-negative 25 bacteria, preferably bacteria of the families Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus, are advantageously used. 30 The organisms which are used in the method for preparing fusion proteins are grown or cultured in dependence on the host organism and in a manner known to the skilled person. Microorganisms are as a rule grown, at temperatures of between 0 and 1 00*C, preferably between 10 and 60*C, and while being gassed with oxygen, in a liquid medium which comprises a carbon source, usually in the form of sugars, a nitrogen 35 source, usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts, and also, if appropriate, vitamins. In this connection, the pH of the nutrient liquid can be maintained at a fixed value, that is regulated or not during the growth. The growth can take place batch-wise, semibatch-wise or continuously. Nutrients can be 40 introduced initially at the beginning of the fermentation or be subsequently fed in semicontinuously or continuously. The enzymes can be isolated from the organisms 13 using the method described in the examples or be used for the reaction as a crude extract. Proteins, or functional biologically active fragments thereof, which are used in 5 accordance with the invention can be prepared by means of a recombinant method in which a microorganism which produces proteins is cultured, the expression of the proteins is induced, if appropriate, and the proteins are isolated from the culture. The proteins can also be produced in this way on an industrial scale if desired. The recombinant microorganism can be cultured and fermented using known methods. 10 Bacteria can, for example, be propagated in TB medium or LB medium and at a temperature of from 20 to 400C and a pH of from 6 to 9. Suitable culturing conditions are described in detail in, for example, T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989). 15 If the proteins which are used in accordance with the invention are not secreted into the culture medium, the cells are then disrupted and the product is isolated from the lysate using known methods for isolating proteins. The cells can, as desired, be disrupted by high-frequency ultrasound, by high pressure, such as, for example, in a French 20 pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by using homogenizers or by combination of several of the methods cited. The proteins which are used in accordance with the invention can be purified by means of known chromatographic methods such as molecular sieve chromatography (gel 25 filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, as well as by means of other customary methods such as ultrafiltration, crystallization, salting-out, dialysis and native gel electrophoresis. Suitable methods are described, for example in Cooper, F. G., Biochemische Arbeitsmethoden (Biochemical Working Methods], Verlag Water de Gruyter, Berlin, 30 New York, or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin. For the purpose of isolating the recombinant protein, it can be advantageous to use vector systems or oligonucleotides which extend the cDNA by particular nucleotide 35 sequences and thereby encode altered proteins or fusion proteins which, for example, serve to simply purification. Suitable modifications of this nature comprise tags which function as anchors, for example the modification known as the hexahistidine anchor, or epitopes which can be recognized as antigens by antibodies (described, for example, in Harlow, E. and Lane, D., 1988, Antibodies : A Laboratory Manual. Cold 40 Spring Harbor (N. Y. ) Press). Examples of other suitable tags are HA, calmodulin-BD, GST, MBD; chitin-BD, streptavidin-BD-avi tag, flag tag, T7, etc. These anchors can be used for attaching the proteins to a solid support, such as a polymer matrix which can 14 be used, for example, to fill a chromatography column, or to a microtiter plate or to any other support. The corresponding purification protocols can be obtained from the commercial suppliers of affinity tags. 5 The proteins which are prepared as described can either be used directly as fusion proteins or be used as "pure" hydrophobins after the fusion partner has been cleaved off and separated off. If it is planned for the fusion partner to be separated off, it is advisable for a potential 10 cleavage site (specific recognition site for proteases) to be incorporated into the fusion protein between the hydrophobin moiety and the fusion partner moiety. Peptide sequences which do not otherwise occur in the hydrophobin moiety or in the fusion partner moiety, as can readily be determined using bioinformatic tools, are particularly suitable cleavage sites. BrCN cleavage at methionine, or protease-mediated cleavage 15 by means of factor Xa, enterokinase, thrombin or TEV (tobacco etch virus protease) cleavage are, for example, particularly suitable. There is no restriction on the choice of hydrophobins for carrying out the invention. The skilled person will make a suitable choice. Fusion proteins such as yaad-Xa-dewA-his 20 (SEQ ID NO: 19) or yaad-Xa-rodA-his (SEQ ID NO: 21) have proved to be of particular value. For carrying out the invention, the hydrophobins can advantageously be used as aqueous formulations. The aqueous solutions which are obtained in connection with 25 synthesis and/or isolation can preferably be used for this purpose. However, it is naturally also possible to add water-miscible organic solvents to the aqueous formulations. Examples of these solvents include water-miscible alcohols such as ethanol, propanol or ethylene glycol. 30 However, the hydrophobins can naturally also be initially isolated as the substance, for example by means of freeze-drying, and be used as such or dissolved in a nonaqueous solvent or corresponding formulations based on nonaqueous solvents. Hydrophobin formulations which are used in accordance with the invention can 35 naturally comprise further auxiliary substances and additives. Examples comprise surfactants, buffers, solvents, preservatives such as protease inhibitors, stabilizers such as proteins, sugars or sugar derivatives, alcohols and water-soluble polymers. The skilled person will choose the concentration of the hydrophobins in the formulation. 40 Concentrations of from 0.001 ppm to 10% have proved to be of value.

15 According to the invention, the hydrophobins can be added to the liquid (L) and/or the barrier layer. This can be effected by simply mixing the hydrophobin, or preferably a suitable hydrophobin formulation, with the liquid and/or the barrier fluid. The hydrophobin can be added before the liquid surface is covered with the barrier fluid or 5 not until after this has occurred. It is also preferably possible for only the surface of the liquid to be treated with the hydrophobin. This can be effected, for example, by the surface, in particular a water surface, being sprayed with a hydrophobin solution before being covered with the barrier fluid. It is also possible for a surface which has already been covered with the barrier fluid to be sprayed with a hydrophobin formulation. 10 Preference is given to dissolving or suspending the hydrophobin in the liquid before the barrier fluid is applied. Small quantities of hydrophobins are already sufficient to bring about an evaporation retardation in accordance with the invention. The skilled person will determine the 15 quantity of hydrophobins. Quantities of from approx. 1 to 10 g/m 2 of surface, preferably of from 3 to 8 g/m 2 , have proved to be of value. The invention is suitable, in particular, for protecting service water from evaporation, for example in storage lakes or similarly stored water for mining applications. 20 Preference is given to employing hydrophobins, as natural substances, in biodegradable systems, for example by using, as the barrier fluid, a fluid which is readily biodegradable, such as a naturally occurring vegetable, animal or bacterial oil. Examples comprise rapeseed oil and what is termed "biodiesel". 25 It has been proposed that, to prevent or at least weaken hurricanes, oil be poured on the water in a hurricane's region of formation in order that the evaporation of the water may be at least retarded as a result. Such oil films can likewise be further stabilized with hydrophobins according to the invention to reduce the evaporation rate. What 30 presents itself in particular for this purpose is to use biodegradable barrier fluids. The following examples are intended to illustrate the invention. Section A: Preparing and testing the hydrophobins which are used in accordance with the invention 35 Example 1 Preliminary work for cloning vaad-Hisr/ vaaE-His6 A polymerase chain reaction was carried out using the oligonucleotides Hal570 and Hal571 (Hal 572/ Hal 573). Genomic DNA from the bacterium Bacillus subtilis was 40 used as template DNA. The resulting PCR fragment comprised the coding sequence of 16 the Bacillus subtilis yaaD / yaaE gene and an Ncol and a BgllI restriction cleavage site at the respective ends. The PCR fragment was purified and cut with the restriction endonucleases Ncol and Bglll. This DNA fragment was used as an insert and cloned into the Qiagen vector pQE60, which had been previously linearized with the restriction 5 endonucleases Ncol and Bglli. The vectors which were formed in this way, i.e. pQE60YAAD#2 / pQE60YaaE#5, can be used for expressing proteins consisting of

YAAD::HIS

6 and, respectively, YAAE::HIS6. Hal570: gcgcgcccatggctcaaacaggtactga 10 Hal571: gcagatctccagccgcgttcttgcatac Hal572: ggccatgggattaacaataggtgtactagg Hal573: gcagatcttacaagtgccttttgcttatattcc Example 2 15 Cloning yaad-hydrophobin DewA-His6 A polymerase chain reaction was carried out using the oligonucleotides KaM 416 and KaM 417. Genomic DNA from the mold Aspergillus nidulans was used as template 20 DNA. The resulting PCR fragment comprised the coding sequence of the hydrophobin gene dewA and an N-terminal factorXa proteinase cleavage site. The PCR fragment was purified and cut with the restriction endonuclease BamHI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD#2, which had been previously linearized with the restriction endonuclease Bglll. 25 The vector which was formed, i.e. #508 can be used for expressing a fusion protein consisting of YAAD::Xa::dewA::HIS 6 . KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC 30 KaM417: CCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC Example 3 Cloning vaad-hydrophobin RodA-His 6 35 The plasmid #513 was cloned in analogy with plasmid #508 using the oligonucleotides KaM 434 and KaM 435. KaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC 40 KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG 17 Example 4 Cloning vaad-hydrophobin BASF1-His 6 5 The plasmid #507 was cloned in analogy with plasmid #508 using the oligonucleotides KaM 417 and KaM 418. An artificially synthesized DNA sequence, i.e. hydrophobin BASF1, was used as template DNA (see annex). 10 KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT GAAGTTCTCCGTCTCCGC KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG Example 5 15 Cloning vaad-hydrophobin BASF2-His 6 The plasmid #506 was cloned in analogy with plasmid #508 using the oligonucleotides KaM 417 and KaM 418. 20 An artificially synthesized DNA sequence, i.e. hydrophobin BASF2, was used as template DNA (see annex). KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT GAAGTTCTCCGTCTCCGC 25 KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG Example 6 Cloning vaad-hydrophobin SC3-His 6 30 The plasmid #526 was cloned in analogy with plasmid #508 using the oligonucleotides KaM464 and KaM465. cDNA from Schyzophyllum commune was used as template DNA (see annex). 35 KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC KaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT Example 7 40 Fermenting the recombinant E.coli strain yaad-hydrophobin DewA-His 6 18 3 ml of LB liquid medium are inoculated, in a 15 ml Greiner tube, with an E.coli strain which is expressing yaad-hydrophobin DewA-His 6 . The medium is incubated at 370C for 8 h on a shaker rotating at 200 rpm. In each case 2 x 11 baffled Erlenmeyer flasks containing 250 ml of LB medium (+ 100 pg of ampicillin/ml) are inoculated with in each 5 case 1 ml of the preliminary culture and incubated at 370C for 9 h on a shaker which is rotating at 180 rpm. 13.5 I of LB medium (+100 pg of ampicillin/ml) are inoculated, in a 20 I fermenter, with 0.5 I of preliminary culture (ODsoonm 1:10 measured against H 2 0). 140 ml of 100 mM IPTG are added at an OD6onm of -3.5. After 3 h, the fermenter is cooled down to 10 C 10 and the fermentation broth is centrifuged. The cell pellet is used for the further purification. Example 8 15 Purifying the recombinant hydrophobin fusion protein (Purifying hydrophobin fusion proteins which possess a C-terminal His6 tag) 100 g of cell pellet (100 - 500 mg of hydrophobin) are made to a total volume of 200 ml with 50 mM sodium phosphate buffer, pH 7.5, and resuspended. The suspension is 20 treated for 10 minutes with an Ultraturrax type T25 (Janke and Kunkel; IKA Labortechnik) and then incubated at room temperature for 1 hour with 500 units of Benzonase (Merck, Darmstadt; order No. 1.01697.0001) for the purpose of degrading the nucleic acids. Prior to the cell disruption, filtration is carried out using a glass cartridge (P1). Two homogenizer runs at 1500 bar are carried out for the cell disruption 25 and for shearing the remaining genomic DNA (M-1 1 OEH microfluidizer; Microfluidics Corp.). The homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge bottles, 60 minutes, 40C, 12 000 rpm, 23 000 g), after which the supernatant is placed on ice and the pellet is resuspended in 100 ml of sodium phosphate buffer, pH 7.5. The centrifugation and resuspension are repeated three times, with the sodium phosphate 30 buffer comprising 1% SDS during the third repeat. After the resuspension, the mixture is stirred for an hour and a final centrifugation is carried out (Sorvall RC-5B, GSA rotor, 250 ml centrifuge bottles, 60 minutes, 40C, 12 000 rpm, 23 000 g). SDS-PAGE analysis indicates that the hydrophobin is present in the supernatant after the final centrifugation (Figure 1). The experiments show that the hydrophobin is probably present in the form 35 of inclusion bodies in the corresponding E.coli cells. 50 ml of the hydrophobin comprising supernatant are loaded to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) which has been equilibrated with 50 mM Tris-CI, pH 8.0, buffer. The column is washed with 50 mM Tris-CI, pH 8.0, buffer and the hydrophobin is then eluted with 50 mM Tris-CI, pH 8.0, buffer, which comprises 40 200 mM imidazole. The solution is dialyzed against 50 mM Tris-CI, pH 8.0, buffer in order to remove the imidazole.

19 Figure 1 shows the purification of the hydrophobin which was prepared: Lane 1: solution loaded on nickel-Sepharose column (diluted 1:10) Lane 2: flowthrough = washing step eluate 5 Lanes 3 - 5: OD 280 maxima of the elution fractions The hydrophobin in Figure 1 has a molecular weight of approx. 53 kD. Some of the smaller bands represent breakdown products of the hydrophobin. 10 Example 9 Characterizing the hydrophobin by the change in the contact anqle of a water drop on glass Substrate: 15 Glass (window glass, SOddeutsche Glas, Mannheim): The hydrophobin purified according to Example 8 was used. Concentration of the hydrophobin in the solution: 100 pg/ml, the solution further 20 comprised 50 mM Na acetate buffer and also 0.1% polyoxyethylene(20)-sorbitan monolaurate (Tween@ 20), pH of the solution: 4 Immersion of small glass plates in this solution overnight (temperature 80*C) Thereafter the hydrophobin-coated small glass plate is removed from the solution and washed in distilled water, 25 After that, an incubation is carried out, at 80 0 C for 10 min, in a 1 % solution of SDS in dist. water Further washing is carried out in dist. water The samples are dried in air and the contact angle (in degrees) of a 5 pl drop of water 30 is determined with the coated glass surface at room temperature. The contact angle was determined on a Dataphysics Contact Angle System OCA 15+, software SCA 20.2.0. (November 2002), appliance. The measurement was carried out in accordance with the manufacturer's instructions. 35 Untreated glass gave a contact angle of 30 ± 50. The small glass plates coated with the hydrophobin in accordance with example 8 (yaad-dewA-his 6 ) gave a contact angle of 75 ± 50. 40 Increase in the contact angle: 450 20 Section B: Using the hydrophobins for reducing the rate of evaporation Solution employed: 5 A solution of the fusion protein yaad-Xa-dewA-his (SEQ ID NO: 19), which was prepared as described in example 8, was used for the application technology experiments. The concentration of the hydrophobin in the solution was 6.1 mg/ml. 10 Blank experiment: Water without barrier fluid A solution having a hydrophobin concentration of 1 mg/ml was obtained by diluting with water. 100 g of this solution were transferred to a glass beaker having a diameter of 10 cm. 100 g of water without any addition of hydrophobin were used for comparative 15 purposes. Both the samples were stored in a climatic test cabinet at 220C and a relative humidity of 50-60%. No significant difference was observed in the evaporation of the water and of the hydrophobin solution. In the case of both samples, approx. 70% of the water had 20 evaporated after 3 days. Example 10: 6.56 g of the abovementioned hydrophobin solution were diluted with water to a total of 25 200 g (hydrophobin concentration 0.2 mg/ml, total quantity 40 mg) in a glass beaker having a diameter of 10 cm. The surface of the liquid (area: 78.5 cm 2 ) was covered with 3.5 g of diesel oil (density 0.83 g/ml) as barrier fluid. The surface of the water was completely covered by the diesel oil. The thickness of the barrier layer was approx. 0.54 mm. 30 Comparative example: For comparative purposes, 200 g of water without any addition of hydrophobin were overlaid with the barrier fluid in the described manner. 35 Storing the samples: The samples were stored in a climatic test cabinet at 220C and a relative humidity of 50-60%. The decrease in weight was determined, in each case by weighing, over a 40 total of 20 days. Two experiments and two comparative experiments were carried out in each case and the values obtained were averaged. The results are summarized in table 1.

21 Comparative example Example 10 Days Total quantity [g] % Total quantity [g] % 0 203.5 100.0% 203.5 100.0% 3 184.2 90.5% 197.9 97.2% 5 169.55 83.3% 193.65 95.2% 7 156.15 76.7% 190 93.4% 10 141.75 69.7% 185.4 91.1% 12 127.65 62.7% 183.15 90.0% 14 112.2 55.1% 181.1 89.0% 17 96.3 47.3% 178.95 87.9% 20 77.4 38.0% 176.7 86.8% Table 1: Total quantity of liquid in the beaker in dependence on the storage period 5 The examples and comparative examples demonstrate that the evaporation-inhibiting effect of the barrier layer is significantly increased by adding hydrophobins. Whereas, without the addition of hydrophobin, more than 60% of the water evaporates after 20 days despite the barrier layer, only about 13% by weight evaporates in the 10 same time when hydrophobins are used as additive. The quality of the barrier layer is significantly improved by adding hydrophobin. Example 11: 15 6.56 g of the abovementioned hydrophobin solution were diluted with water to a total of 200 g (hydrophobin concentration 0.2 mg/ml, total quantity 40 mg) in a glass beaker having a diameter of 10 cm. The surface of the liquid (area: 78.5 cm 2 ) was covered with 6.0 g of RME biodiesel as barrier fluid. The surface of the water was completely covered by the biodiesel. The thickness of the barrier layer was approx. 1.0 mm. 20 Comparative example: For comparative purposes, 200 g of water without any addition of hydrophobin were overlaid with the barrier fluid in the described manner. 25 Storing the samples: The samples were stored in a climatic test cabinet at 220C and a relative humidity of 50-60%. The decrease in weight was determined, in each case by weighing, over a 30 total of 19 days. Two experiments and two comparative experiments were carried out in each case and the values obtained were averaged. The results are summarized in table 2.

22 Comparative experiment Example 11 Days Total quantity [g] % Total quantity [g] % 0 206.0 100.0% 206.0 100.0% 3 182.2 88.4% 187.45 91.0% 5 166.7 80.9% 181.15 87.9% 7 136.25 66.1% 178.45 86.6% 10 106.5 51.7% 177.15 86.0% 12 69.55 33.8% 175.85 85.4% 14 37.25 18.1% 175.3 85.1% 17 15.7 7.6% 174.15 84.5% 19 6.7 3.3% 173.2 84.1% Table 2: Total quantity of liquid in the beaker in dependence on the storage period 5 The examples and comparative examples demonstrate that the evaporation-inhibiting effect of the barrier layer is significantly increased by adding hydrophobins. Whereas, without the hydrophobin addition, more than 95% of the water evaporates after 19 days despite the barrier layer, only about 15% by weight evaporates in the 10 same time when using hydrophobins as additive. Example 12: 6.56 g of the abovementioned hydrophobin solution were diluted with water to a total of 15 200 g (hydrophobin concentration 0.2 mg/ml, total quantity 40 mg) in a glass beaker having a diameter of 10 cm. The surface of the liquid (area: 78.5 cm 2 ) was covered with 6.0 g of rapeseed oil as barrier fluid. The surface of the water was completely covered by the rapeseed oil. The thickness of the barrier layer was approx. 1.0 mm. 20 Comparative example: For comparative purposes, 200 g of water, without any addition of hydrophobin, were overlaid with the barrier fluid in the described manner. 25 Storinq the samples: The samples were stored in a climatic test cabinet at 220C and at a relative humidity of 50-60%. The decrease in weight was determined, in each case by weighing, over a total of 19 days. In each case, two experiments and two comparative experiments were 30 carried out and the values obtained were averaged. The results are summarized in table 3.

23 Comparative experiment Example 12 Days Total quantity [g] % Total quantity [g] % 0 206.0 100.0% 206.0 100.0% 3 175.3 85.1% 177.45 86.1% 5 155.7 75.6% 165.25 80.2% 7 122.2 59.3% 156.65 76.0% 10 96.8 47.0% 151.1 73.3% 12 73.75 35.8% 147.4 71.6% 14 54.05 26.2% 143.75 69.8% 17 34.75 16.9% 140.05 68.0% 19 18.35 8.9% 135.9 66.0% Table 3: Total quantity of liquid in the beaker in dependence on the storage period 5 The examples and comparative examples demonstrate that the evaporation-inhibiting effect of the barrier layer is significantly increased by adding hydrophobins. Whereas, without any hydrophobin addition, more than 90% of the water evaporates after 19 days despite the barrier layer, only about 35% by weight evaporates in the 10 same time when using hydrophobins as additive.

24 Assignment of the sequence names to DNA and polypeptide sequences in the sequence listing dewA DNA and polypeptide sequence SEQ ID NO: 1 dewA polypeptide sequence SEQ ID NO: 2 rodA DNA and polypeptide sequence SEQ ID NO: 3 rodA polypeptide sequence SEQ ID NO: 4 hypA DNA and polypeptide sequence SEQ ID NO: 5 hypA polypeptide sequence SEQ ID NO: 6 hypB DNA and polypeptide sequence SEQ ID NO: 7 hypB polypeptide sequence SEQ ID NO: 8 sc3 DNA and polypeptide sequence SEQ ID NO: 9 sc3 polypeptide sequence SEQ ID NO: 10 basf1 DNA and polypeptide sequence SEQ ID NO: 11 basf1 polypeptide sequence SEQ ID NO: 12 basf2 DNA and polypeptide sequence SEQ ID NO: 13 basf2 polypeptide sequence SEQ ID NO: 14 yaad DNA and polypeptide sequence SEQ ID NO: 15 yaad polypeptide sequence SEQ ID NO: 16 yaae DNA and polypeptide sequence SEQ ID NO: 17 yaae polypeptide sequence SEQ ID NO: 18 yaad-Xa-dewA-his DNA and polypeptide SEQ ID NO: 19 sequence yaad-Xa-dewA-his polypeptide sequence SEQ ID NO: 20 yaad-Xa-rodA-his DNA and polypeptide SEQ ID NO: 21 sequence yaad-Xa-rodA-his polypeptide sequence SEQ ID NO: 22 yaad-Xa-basf 1 -his DNA and polypeptide SEQ ID NO: 23 sequence yaad-Xa-basf1-his polypeptide sequence SEQ ID NO: 24

Claims (14)

1. A method of reducing the rate of evaporation of liquids (L) in which the surface of the liquid is covered with a barrier fluid (B) which is not miscible with this liquid and 5 which has a higher boiling point and a lower density than the liquid (L), wherein at least one hydrophobin is added, as auxiliary agent, to the liquid (L) and/or the barrier fluid (B).

2. The method according to claim 1, wherein the liquid is in an open liquid reservoir. 10

3. The method according to claim 1 or 2, wherein the liquid (L) is water.

4. The method according to any one of claims 1 to 3, wherein the barrier fluid (B) is a hydrocarbon mixture. 15

5. The method according to any one of claims 1 to 3, wherein the barrier fluid (B) is a biologically degradable liquid.

6. The method according to any one of claims 1 to 5, wherein the thickness of the 20 barrier layer is not more than 1 mm.

7. The method according to any one of claims 1 to 6, wherein the hydrophobin is a fusion protein. 25

8. An open liquid reservoir, at least comprising a liquid (L) and a barrier fluid (B) which has a higher boiling point and a lower density than the liquid (L), which is not miscible with this liquid and which covers the surface of the liquid (L), wherein the liquid reservoir additionally comprises at least one hydrophobin. 30

9. The open liquid reservoir according to claim 8, wherein the liquid (L) is water.

10. The open liquid reservoir according to claim 8 or 9, wherein the barrier fluid (B) is a hydrocarbon mixture. 35

11. The open liquid reservoir according to claim 8 or 9, wherein the barrier fluid (B) is a biologically degradable liquid.

12. The open liquid reservoir according to any one of claims 8 to 11, wherein the thickness of the barrier layer is not more than 1 mm. 40

13. The open liquid reservoir according to any one of claims 8 to 12, wherein the hydrophobin is a fusion protein. 26

14. The use of hydrophobins as auxiliary agents for stabilizing liquid barrier layers.