WO2003090694A2 - Methods and compositions for diagnosing and monitoring auto immune and chronic inflammatory diseases - Google Patents

Methods and compositions for diagnosing and monitoring auto immune and chronic inflammatory diseases Download PDF

Info

Publication number
WO2003090694A2
WO2003090694A2 PCT/US2003/013015 US0313015W WO03090694A2 WO 2003090694 A2 WO2003090694 A2 WO 2003090694A2 US 0313015 W US0313015 W US 0313015W WO 03090694 A2 WO03090694 A2 WO 03090694A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
expression
disease
genes
rna
Prior art date
Application number
PCT/US2003/013015
Other languages
English (en)
French (fr)
Other versions
WO2003090694A3 (en
Inventor
Jay Wohlgemuth
Kirk Fry
Robert Woodward
Ngoc Ly
Original Assignee
Expression Diagnostics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Expression Diagnostics, Inc. filed Critical Expression Diagnostics, Inc.
Priority to AU2003231132A priority Critical patent/AU2003231132A1/en
Priority to US10/512,028 priority patent/US7604936B2/en
Priority to JP2003587333A priority patent/JP4741191B2/ja
Publication of WO2003090694A2 publication Critical patent/WO2003090694A2/en
Publication of WO2003090694A3 publication Critical patent/WO2003090694A3/en
Priority to US12/561,213 priority patent/US7771950B2/en
Priority to US12/829,172 priority patent/US20110070584A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/08Vasodilators for multiple indications
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/14Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A90/00Technologies having an indirect contribution to adaptation to climate change
    • Y02A90/10Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation

Definitions

  • This application is in the field of chronic inflammatory diseases.
  • this invention relates to methods and compositions for diagnosing or monitoring chronic inflammatory diseases.
  • nucleotide sequences or sets of nucleotide sequences whose expression patterns predict the occurrence or progression of disease states, or predict a patient's response to a particular therapeutic intervention.
  • identification of nucleotide sequences and sets of nucleotide sequences with such predictive value from cells and tissues that are readily accessible would be extremely valuable. For example, peripheral blood is attainable from all patients and can easily be obtained at multiple time points at low cost. This is a desirable contrast to most other cell and tissue types, which are less readily accessible, or accessible only through invasive and aversive procedures.
  • the various cell types present in circulating blood are ideal for expression profiling experiments as the many cell types in the blood specimen can be easily separated if desired prior to analysis of gene expression.
  • blood provides a very attractive substrate for the study of diseases using expression profiling techniques, and for the development of diagnostic technologies and the identification of therapeutic targets, the value of expression profiling in blood samples rests on the degree to which changes in gene expression in these cell types are associated with a predisposition to, and pathogenesis and progression of a disease.
  • leukocytes e.g., T-and B-lymphocytes, monocytes and granulocytes, including neutrophils
  • diseases including such broad classes as cardiovascular diseases, inflammatory, autoimmune and rheumatic diseases, infectious diseases, transplant rejection, cancer and malignancy, and endocrine diseases.
  • SLE Systemic lupus erythematosis
  • RA Rheumatoid Arthritis
  • SLE Systemic lupus erythematosis
  • RA Rheumatoid Arthritis
  • Leukocyte expression profiling can be applied to discover expression markers for SLE and RA and apply them as patient management tools in the clinical setting.
  • osteoarthirtis is a degenerative joint disease that can be confused with RA. This disease also involves leukocytes and expression profiling of leukocytes associated with osteoarthritis may lead to the discovery of new diagnostic and therapeutic approaches to the disease.
  • SLE in particular is a chronic, usually life-long, potentially fatal autoimmune disease characterized by unpredictable exacerbations and remissions with protean clinical manifestations. SLE is notable for unpredictable exacerbations and remissions and a predilection for clinical involvement of the joints, skin, kidney, brain, serosa, lung, heart, and gastrointestinal tract. The pathologic hallmark of the disease is recurrent, widespread, and diverse vascular lesions.
  • SLE is not a rare disorder. Although reported at both extremes of life (e.g. diagnosed in infants and in the tenth decade of life) chiefly it affects women of child bearing age. Among children, SLE occurs three times more commonly in females than in males. In the 60% of SLE patients who experience onset of their disease between puberty and the fourth decade of life the female to male ratio is 9: 1. Thereafter, the female preponderance again falls to that observed in prepubescents.
  • the disorder is three times more common in African American blacks than American Caucasians. SLE is also more common in Asians and in China may be more common than Rheumatoid Arthritis. The ethnic group at greatest risk is African Caribbean blacks.
  • the annual incidence of SLE ranges from six to 35 new cases per 100,000 population in relatively low-risk to high-risk groups. The prevalence of SLE in the United States is an issue of some debate. Prevalence estimates of between 250,000 to 500,000 are contradicted by a recent nationwide telephone poll suggesting a prevalence of between one and two million.
  • Such specialized medical care includes care by experienced clinicians with access to state of the art diagnostic and therapeutic measures will result in improved outcomes and the most cost- effective utilization of resources.
  • Expert care of patients with SLE leads to fewer hospitalizations secondary to uncontrolled disease exacerbation, less severe renal disease with fewer patients experiencing end stage renal disease requiring chronic dialysis, fewer episodes of avascular necrosis requiring total joint replacement, and less severe osteoporosis and fractures.
  • more judicious use of steroids and steroid sparing agents can also reduce the severity of atherosclerosis and resulting incidence of myocardial infarctions and cerebral vascular accidents, which now complicate the natural history of SLE.
  • Improved monitoring, diagnosis and prognosis of SLE should aid clinicians in determining appropriate care for SLE patients, including which drugs to use and at what amounts.
  • SLE is an autoimmune disease characterized by immune dysregulation resulting in the production of antinuclear antibodies (ANA), generation of circulating immune complexes, and activation of the complement system.
  • ANA antinuclear antibodies
  • SLE is futher characterized by end organ damage that results from deposition of circulating autoantibodies and subsequent complement- and Fc receptor-mediated inflammation.
  • extensive immune system abnormalities including altered T lymphocyte function and spontaneous apoptosis, contribute to the lymphopenia and increased susceptibility to infection that confer considerable morbidity.
  • SLE The clinical features of SLE are protean and may mimic infectious mononucleosis, lymphoma, or other systemic disease. Therefore, the American College of Rheumatology developed criteria to include " patients with SLE and exclude those with other disorders. These criteria are best used to insure the appropriateness of subjects for epidemiological or research studies. Although many patients do not fulfill the rigid criteria at first encounter most will when followed over periods of time.
  • the etiology of SLE remains unknown.
  • a genetic predisposition, sex hormones, and environmental trigger(s) likely result in the disordered immune response that typifies the disease.
  • SLE The origin of autoantibody production in SLE is unclear but a role has been suggested for an antigen driven process, spontaneous B-cell hyper-responsiveness, or impaired immune regulation. Regardless of the etiology of autoantibody production, SLE is associated with the impaired clearance of circulating immune complexes secondary to decreased CR1 expression, defective Fc receptor function, or deficiencies of early complement components such as C4A.
  • the health status of a patient with SLE is related not only to disease activity, but to the damage that results from recurrent episodes of disease flare (i.e. deforming arthropathy, shrinking lung, end stage renal disease, organic mental syndrome, etc.), as well as the adverse effects of treatment (i.e. avascular necrosis of bone, infections, and precocious atherosclerosis, etc.).
  • disease flare i.e. deforming arthropathy, shrinking lung, end stage renal disease, organic mental syndrome, etc.
  • adverse effects of treatment i.e. avascular necrosis of bone, infections, and precocious atherosclerosis, etc.
  • the present invention identifies genes and gene sets that have clinical utility as diagnostic tools for the management of lupus patients and patients with a variety of chronic inflammatory and autoimmune diseases.
  • the present invention is thus directed to a method of diagnosing or monitoring chronic autoimmune or inflammatory disease in a patient.
  • the method of the invention involves detecting in a patient expression of one or more genes such as those genes depicted in Table 2E and surrogates derived therefrom. Exemplary surrogates are provided in Table 2D.
  • the present invention is further directed to a method of diagnosing or monitoring an autoimmune or chronic inflammatory disease in a patient by detecting the expression level of one or more genes or surrogates derived therefrom in said patient to diagnose or monitor the autoimmune or chronic inflammatory disease in the patient wherein said genes include a nucleotide sequence selected from SEQ ID NO:503, SEQ ID NO:504, SEQ ID NO:505, SEQ ID NO:506, SEQ ID NO:507, SEQ ID NO:508, SEQ ID NO:509, SEQ ID NO:510, SEQ ID NO:511, SEQ ID NO:512, SEQ ID NO:513, SEQ ID NO:514, SEQ ID NO:515, SEQ ID NO:516, SEQ ID NO:517, SEQ ID NO:518, SEQ ID NO:519, SEQ ID NO:520, SEQ ID NO:521, SEQ ID NO:522, SEQ ID NO:523, SEQ ID NO:524, SEQ ID NO:525, SEQ ID NO:526, SEQ ID
  • the diagnosing of monitoring may be performed by detecting the expression level of two or more genes, three or more genes, four or more genes, five or more genes, six or more genes, seven or more genes, eight or more genes, nine or more genes, ten or more genes, fifteen or more genes, twenty or more genes, thirty or more genes, fifty or more genes, one hundred or more genes, two hundred or more genes, or all five hundred and two of the genes.
  • the methods of the invention also includes diagnosing or monitoring auto immune and chronic inflammatory diseases in a patient by detecting the expression level of one or more genes in said patient to diagnose or monitor auto immune and chronic inflammatory diseases in said patient wherein said one or more genes identified by a nucleotide sequence selected from the following group: SEQ ID NO:503, SEQ ID NO:505, SEQ JD NO:506, SEQ ID NO:508, SEQ ID NO:509, SEQ ID NO:510, SEQ ID NO:511, SEQ JD NO:512, SEQ ID NO:513, SEQ ID NO:514, SEQ ID NO:515, SEQ ID NO:516, SEQ ID NO:517, SEQ ID NO:518, SEQ ID NO:519, SEQ ID NO:520, SEQ ID NO:521, SEQ JD NO:522, SEQ ID NO:523, SEQ ID NO:524, SEQ ID NO:525, SEQ ID NO:526, SEQ ID NO:527, SEQ ID NO:528, SEQ ID NO:5
  • the methods of the invention may further include detecting the expression level of one or more additional genes in said patient to diagnose or monitor auto immune and chronic inflammatory diseases in a patient, wherein said one or more additional genes identified by a nucleotide sequence selected from the following group: SEQ DD NO:504, SEQ ID NO:507, SEQ ID NO:603, SEQ ED NO:740, SEQ ID NO:811, SEQ ID NO:812, SEQ ID NO:854, SEQ ID NO:867, SEQ ID NO:912, SEQ ID NO:922, SEQ ID NO:950, SEQ ID NO:971.
  • the chronic inflammatory disease or autoimmune disease may be systemic lupus erythematosis (SLE), Rheumatoid Arthritis, Cholecystitis, Sjogrens Disease, CREST syndrome, Scleroderma, Ankylosing Spondylitis, Crohn's, Ulcerative Colitis, Primary Sclerosing Cholangitis, Appendicitis, Diverticulitis, Primary Biliary Sclerosis, Wegener's Granulomatosis, Polyarteritis nodosa, Whipple's Disease, Psoriasis, Microscopic Polyanngiitis, Takayasu's Disease, Kawasaki's Disease, Autoimmune hepatitis, Asthma, Churg-Strauss Disease, Beurger's Disease, Raynaud's Disease, or Cholecystitis.
  • SLE systemic lupus erythematosis
  • Rheumatoid Arthritis Cholec
  • expression is detecting by measuring RNA levels or protein levels from the genes.
  • Example of detecting of such detection include measuring protein in serum, measuring cell surface proteins, measuring using a a fluorescent activated cell sorter.
  • RNA may be isolated from the patient prior to detecting expression of a gene such as those depicted in Table 2E. RNA levels may be detected by PCR or hybridization.
  • the nucleotide sequence may include comprises DNA, cDNA, PNA, genomic DNA, or synthetic oligonucleotides.
  • the hybridization methods of the present invention may include high stringency, moderate stringency, or low stringency hybridization conditions.
  • the RNA may be detected by hybridization to an oligonucleotide having a nucleotide sequence selected from SEQ ID NO:503, SEQ ID NO:504, SEQ ID NO:505, SEQ ID NO:506, SEQ ID NO:507, SEQ ID NO:508, SEQ ID NO:509, SEQ DD NO:510, SEQ ID NO:511, SEQ ID NO:512, SEQ ID NO:513, SEQ DD NO:514, SEQ JD NO:515, SEQ DD NO:516, SEQ ID NO:517, SEQ ID NO:518, SEQ ED NO:519, SEQ ID NO:520, SEQ ID NO:521, SEQ ID NO:522, SEQ DD NO:523, SEQ ID NO:524, SEQ ED NO:525, SEQ ED NO:526, SEQ ID NO:527, SEQ ID NO:528, SEQ ID NO:529, SEQ ID NO:530, SEQ ID NO:531, S
  • the methods of the present invention further includes detection of proteins expressed by one or more genes with an amino acid sequence encoded by a nucleotide sequence selected from the following group SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:l 1, SEQ ID NO:12, SEQ ED NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ED NO:16, SEQ ID NO:17, SEQ ED NO:18, SEQ ED NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33
  • the methods of the present invention further include detection of one or more proteins expressed by one or more additional genes with an amino acid sequence encoded by a nucleotide sequence selected from the following group SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:101, SEQ ED NO:238, SEQ ED NO:309, SEQ ID NO:310, SEQ ID NO:352, SEQ ED NO:365, SEQ ID NO:410, SEQ ID NO:420, SEQ ID NO:448, SEQ ID NO:469.
  • a nucleotide sequence selected from the following group SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:101, SEQ ED NO:238, SEQ ED NO:309, SEQ ID NO:310, SEQ ID NO:352, SEQ ED NO:365, SEQ ID NO:410, SEQ ID NO:420, SEQ ID NO:448, SEQ ID NO:469.
  • the present invention is further directed to a diagnostic oligonucleotide for detecting chronic or inflammatory disease wherein the oligonucleotide has a nucleotide sequence selected from SEQ ED NO:503, SEQ ID NO:504, SEQ ID NO:505, SEQ ID NO:506, SEQ ID NO:507, SEQ ID NO:508, SEQ ID NO:509, SEQ ID NO:510, SEQ ID NO:511, SEQ ID NO:512, SEQ ID NO:513, SEQ ID NO:514, SEQ ID NO:515, SEQ ID NO:516, SEQ ID NO:517, SEQ ID NO:518, SEQ ID NO:519, SEQ ID NO:520, SEQ BD NO:521, SEQ HD NO:522, SEQ ID NO:523, SEQ ID NO:524, SEQ ID NO:525, SEQ ID NO:526, SEQ ID NO:527, SEQ ID NO:528, SEQ ID NO:529, SEQ ID NO:530, SEQ
  • the method of the present invention may further comprise selecting an appropriate therapy based upon the diagnosis and or monitoring.
  • Such therapies may include administering appropriate drugs such as drugs that target alpha-interferon.
  • the methods of the present invention may be applied to bodily fluids from or in a patient, including peripheral blood and urine.
  • the present invention is further directed to a system or kit for diagnosing or monitoring chronic inflammatory or autoimmune disease in a patient comprising an isolated DNA molecule wherein the isolated DNA molecule detects expression of a gene listed in Table 2E.
  • the DNA molecules may be synthetic DNA, genomic DNA, PNA or cDNA.
  • the isolated DNA molecule may be immobilized on an array.
  • arrays may include a chip array, a plate array, a bead array, a pin array, a membrane array, a solid surface array, a liquid array, an oligonucleotide array, polynucleotide array or a cDNA array, a microtiter plate, a membrane and a chip.
  • the present invention is further directed to a system or detecting differential gene expression.
  • the system has one or more isolated DNA molecules wherein each isolated DNA molecule detects expression of a gene selected from the group of genes corresponding to the oligonucleotides depicted in the Sequence Listing. It is understood that the DNA sequences and oligonucleotides of the invention may have slightly different sequences than those identified herein. Such sequence variations are understood to those of ordinary skill in the art to be variations in the sequence which do not significantly affect the ability of the sequences to detect gene expression.
  • DNA molecules are less than about any of the following lengths (in bases or base pairs): 10,000; 5,000; 2500; 2000; 1500; 1250; 1000; 750; 500; 300; 250; 200; 175; 150; 125; 100; 75; 50; 25; 10.
  • DNA molecule is greater than about any of the following lengths (in bases or base pairs): 10; 15; 20; 25; 30; 40; 50; 60; 75; 100; 125; 150; 175; 200; 250; 300; 350; 400; 500; 750; 1000; 2000; 5000; 7500; 10000; 20000; 50000.
  • a DNA molecule can be any of a range of sizes having an upper limit of 10,000; 5,000; 2500; 2000; 1500; 1250; 1000; 750; 500; 300; 250; 200; 175; 150; 125; 100; 75; 50; 25; or 10 and an independently selected lower limit of 10; 15; 20; 25; 30; 40; 50; 60; 75; 100; 125; 150; 175; 200; 250; 300; 350; 400; 500; 750; 1000; 2000; 5000; 7500 wherein the lower limit is less than the upper limit.
  • the gene expression system may be a candidate library, a diagnostic agent, a diagnostic oligonucleotide set or a diagnostic probe set.
  • the DNA molecules may be genomic DNA, protein nucleic acid (PNA), cDNA or synthetic oligonucleotides.
  • the gene expression system is immobilized on an array.
  • the array may be a chip array, a plate array, a bead array, a pin array, a membrane array, a solid surface array, a liquid array, an oligonucleotide array, a polynucleotide array, a cDNA array, a microfilter plate, a membrane or a chip.
  • Listing presents 50mer oligonucleotide sequences derived from human leukocyte, plant and viral genes.
  • the 50mer sequences and the corresponding gene sequences are also listed Table 2. Most of these 50mers were designed from sequences of genes in Table 2 and the Sequence listing.
  • SEQ ED's 1-502 represent mRNA sequences of genes those expression was altered in persons with SLE.
  • SEQ ID's 2-1004 are 50 nucleotide oligonucleotides used as probes to monitor RNA expression in blood.
  • SEQ ID's 1005-1037 are PCR primers and probes used to monitor expression of selected genes from 1-502
  • SEQ ID's 1038-1065 are sequences discussed in the Examples.
  • Figure 1 is a schematic flow chart illustrating an instruction set for characterization of the nucleotide sequence and/or the predicted protein sequence of novel nucleotide sequences.
  • Figure 2 shows PCR Primer efficiency testing. A standard curve of Ct versus log of the starting RNA amount is shown for 2 genes.
  • Figure 3 describes kits useful for the practice of the invention.
  • Figure 3 A describes the contents of a kit useful for the discovery of diagnostic nucleotide sets using microarrays.
  • Figure 3B describes the contents of a kit useful for the application of diagnostic nucleotide sets using microarrays.
  • Figure 3C describes contents of a kit useful for the application of diagnostic nucleotide sets using realtime PCR.
  • Figure 4 depicts a graph comparing the median background subtracted expression signals for various leukocyte reference RNAs.
  • Figure 5 depicts Diagnostic genes, gene sets and diagnostic algorithms for Systemic Lupus Erythematosis are identified.
  • Figure 5A shows the relative expression level of oligonucleotide and SEQ ID #16 (Sialyltransferase 4A) between Lupus and control samples is shown. The gene is identified as having a false detection rate for differential expression from the SAM algorithm of 0.5%.
  • Figure 5B shows the scaled ratios (non log) for Sialyltransferase (SEQ ID # 16) are given for the samples in the analysis. The average ratio of each group along with the standard deviation of the ratio is shown. The average fold change from control to Lupus is 1.48.
  • Figure 5C shows CART gene expression models for diagnosis of SLE.
  • the number of genes used, the relative cost with 10 fold cross validation, the SEQ ID, Locus accession number, the name and the position and values in the CART model are given.
  • the CART values given are the expression level thresholds for classification of the sample as SLE after the node. For example, in the single gene model II, the first node of the decision tree asks if expression of gene SEQ ID NO 2 is >0.103. If yes, the sample is placed in the lupus class.
  • Figure 5D shows the sensitivity and specificity of Model 1. The sensitivity and specificity are given for both the 2 and 3 gene models and both the training set and on cross validation. The relative cost is given for cross-validation.
  • Figure 5E shows the CART Model 1, 2 genes.
  • the model uses 2 genes in a single node to classify samples as Lupus (Class 1) or non-Lupus (Class 2).
  • Figure 5F shows CART Model I, 3 genes.
  • the model uses a second node to classify all samples correctly as lupus (class 1) or non-lupus (class 2) for the training set.
  • G2412 SEQ ID 514
  • G2648 SEQ ID 510
  • G1436 SEQ ED 509.
  • Figure 6 shows endpoint testing of PCR primers. Electrophoresis and microfluidics are used to assess the product of gene specific PCR primers.
  • Figure 6A is a ⁇ -GUS gel image. Lane 3 is the image for GUS primers. Lanes 2 and 1 correspond to the no-template control and-RT control, respectively.
  • Figure 6B shows the electropherogram of ⁇ -GUS primers, a graphical representation of Lane 3 from the gel image.
  • Figure 6C shows a ⁇ -Actin gel image. Lane 3 is the image for endpoint testing of actin primers. Lanes 2 and 1 correspond to the no-template control and -RT control, respectively.
  • Figure 6D shows the electropherogram of ⁇ -Actin primers, a graphical representation of Lave 3 from the gel image.
  • Figure 7 shows the validation of differential expression of a gene discovered using microarrays using Real-time PCR.
  • Figure 7A shows the Ct for each patient sample on multiple assays is shown along with the Ct in the R50 control RNA.
  • Triangles represent — RT (reverse transcriptase) controls.
  • Figure 7B shows the fold difference between the expression of Granzyme B and an Actin reference is shown for 3 samples from patients with and without CMV disease.
  • FIG 8 Real-time PCR control gene analysis. 11 candidate control genes were tested using real-time PCR on 6 whole blood samples (PAX) paired with 6 mononuclear samples (CPT) from the same patient. Each sample was tested twice. For each gene, the variability of the gene across the samples is shown on the vertical axis (top graph). The average Ct value for each gene is also shown (bottom graph). 2 ⁇ g RNA was used for PAX samples and 0.5 ⁇ g total RNA was used for the mononuclear samples (CPT)
  • Table 1 Samples used in array and PCR expression profiling experiments.
  • PCR was done on the set of samples marked with an x.
  • Table 2 Gene expression markers for SLE and autoimmune disease
  • SAM Significance analysis for Microarrays
  • Lupus/Autoimmune merkers Each gene is identified by an oligonucleotide (SEQ ID 50 mer), Genbank accession number from VERSION (ACC), a full length (or longest known) RNA transcript (SEQ ID FL), and a unigene number VERSION (HS).
  • results for microarry analysis of blood gene expression are given as the false detection rate (SAM FDR) and a direction of expression change in Lupus patients / controls (SAM Up/Down).
  • Real-time PCR gene expression analysis Real-time PCR was used to validate and quantify expression behavior of marker genes as described in Example 11. Each gene is identified by an oligonucleotide (SEQ ID 50 mer), Genbank accession number from VERSION (ACC), a full length (or longest known) RNA transcript (SEQ ID FL), and a unigene number VERSION (HS). The fold change between Lupus patients and controls (PCR fold) and results of an unpaired t-test (PCR p-value) are given.
  • Table 3 Table 3 lists some of the diseases or conditions amenable to study by leukocyte profiling.
  • Table 4 Real-time PCR assay reporter and quencher dyes. Various combinations of reporter and quencher dyes are useful for real-time PCR assays. Reporter and quencher dyes work optimally in specific combinations defined by their spectra. For each reporter, appropriate choices for quencher dyes are given.
  • the term “gene expression system” refers to any system, device or means to detect gene expression and includes diagnostic agents, candidate libraries oligonucleotide, oligonucleotide sets or probe sets.
  • diagnostic agents include diagnostic agents, candidate libraries oligonucleotide, oligonucleotide sets or probe sets.
  • diagnostic oligonucleotide or “diagnostic oligonucleotide set” generally refers to an oligonucleotide or to a set of two or more oligonucleotides that, when evaluated for differential expression their corresponding diagnostic genes, collectively yields predictive data. Such predictive data typically relates to diagnosis, prognosis, monitoring of therapeutic outcomes, and the like.
  • the components of a diagnostic oligonucleotide or a diagnostic oligonucleotide set are distinguished from oligonucleotide sequences that are evaluated by analysis of the DNA to directly determine the genotype of an individual as it correlates with a specified trait or phenotype, such as a disease, in that it is the pattern of expression of the components of the diagnostic oligonucleotide set, rather than mutation or polymorphism of the DNA sequence that provides predictive value.
  • a particular component (or member) of a diagnostic oligonucleotide set can, in some cases, also present one or more mutations, or polymorphisms that are amenable to direct genotyping by any of a variety of well known analysis methods, e.g., Southern blotting, RFLP, AFLP, SSCP, SNP, and the like.
  • a "diagnostic gene” is a gene whose expression is detected by a diagnostic oligonucleotide or diagnostic oligonucleotide set.
  • a "disease specific target oligonucleotide sequence” is a gene or other oligonucleotide that encodes a polypeptide, most typically a protein, or a subunit of a multi-subunit protein that is a therapeutic target for a disease, or group of diseases.
  • a “candidate library” or a “candidate oligonucleotide library” refers to a collection of oligonucleotide sequences (or gene sequences) that by one or more criteria have an increased probability of being associated with a particular disease or group of diseases.
  • the criteria can be, for example, a differential expression pattern in a disease state or in activated or resting leukocytes in vitro as reported in the scientific or technical literature, tissue specific expression as reported in a sequence database, differential expression in a tissue or cell type of interest, or the like.
  • a candidate library has at least 2 members or components; more typically, die library has in excess of about 10, or about 100, or about 1000, or even more, members or components.
  • disease criterion is used herein to designate an indicator of a disease, such as a diagnostic factor, a prognostic factor, a factor indicated by a medical or family history, a genetic factor, or a symptom, as well as an overt or confirmed diagnosis of a disease associated with several indicators such as those selected from the above list.
  • a disease criterian includes data describing a patient's health status, including retrospective or prospective health data, e.g. in the form of the patient's medical history, laboratory test results, diagnostic test result, clinical events, medications, lists, response(s) to treatment and risk factors, etc.
  • An autoimmune disorder is defined as a disease state in which a patient's immune system recognizes an antigen in that patient's organs or tissues as foreign and becomes activated.
  • the activated immune cells can then cause damage to the inciting organ or tissue or can damage other organs or tissues.
  • the disorder may be caused by a dysregulation of the immune system cells, rather than by the recognition as a self-antigen as foreign.
  • Dysregulated immune cells can secrete inflammatory cytokines that cause systemic inflammation or they can recognize self-antigens as foreign.
  • autoimmune diseases include: Autoimmune hepatitis, Multiple Sclerosis, Myasthenia Gravis, Type I diabetes, Rheumatoid Arthritis, Psoriasis, Systemic Lupus Erythematosis, Hashimoto's Thyroiditis, Grave's disease, Ankylosing Spondylitis Sjogrens Disease, CREST syndrome, Scleroderma and many more.
  • autoimmune diseases are also chronic inflammatory diseases. This is defined as a disease process associated with long-term (>6 months) activation of inflammatory cells (leukocytes).
  • the chronic inflammation leads to damage of patient organs or tissues.
  • Many diseases are chronic inflammatory disorders, but are not know to have an autoimmune basis. For example, Atherosclerosis, Congestive Heart Failure, Crohn's disease, Ulcerative Colitis, Polyarteritis nodosa, Whipple's Disease, Primary Sclerosing Cholangitis and many more.
  • molecular signature or “expression profile” refers to the collection of expression values for a plurality (e.g., at least 2, but frequently about 10, about 100, about 1000, or more) of members of a candidate library. In many cases, the molecular signature represents the expression pattern for all of the nucleotide sequences in a library or array of candidate or diagnostic nucleotide sequences or genes. Alternatively, the molecular signature represents the expression pattern for one or more subsets of the candidate library.
  • oligonucleotide refers to two or more nucleotides. Nucleotides may be DNA or RNA, naturally occurring or synthetic.
  • the term "healthy individual,” as used herein, is relative to a specified disease or disease criterion. That is, the individual does not exhibit the specified disease criterion or is not diagnosed with the specified disease. It will be understood, that the individual in question, can, of course, exhibit symptoms, or possess various indicator factors for another disease.
  • an "individual diagnosed with a disease” refers to an individual diagnosed with a specified disease (or disease criterion). Such an individual may, or may not, also exhibit a disease criterion associated with, or be diagnosed with another (related or unrelated) disease.
  • monitoring is used herein to describe the use of gene sets to provide useful information about an individual or an individual's health or disease status.
  • Monitoring can include, determination of prognosis, risk-stratification, selection of drug therapy, assessment of ongoing drug therapy, prediction of outcomes, determining response to therapy, diagnosis of a disease or disease complication, following progression of a disease or providing any information relating to a patients health status over time, selecting patients most likely to benefit from experimental therapies with known molecular mechanisms of action, selecting patients most likely to benefit from approved drugs with known molecular mechanisms where that mechanism may be important in a small subset of a disease for which the medication may not have a label, screening a patient population to help decide on a more invasive/expensive test, for example a cascade of tests from a non-invasive blood test to a more invasive option such as biopsy, or testing to assess side effects of drugs used to treat another indication.
  • an “array” is a spatially or logically organized collection, e.g., of oligonucleotide sequences or nucleotide sequence products such as RNA or proteins encoded by an oligonucleotide sequence.
  • an array includes antibodies or other binding reagents specific for products of a candidate library.
  • a “qualitative" difference in gene expression refers to a difference that is not assigned a relative value. That is, such a difference is designated by an "all or nothing" valuation.
  • Such an all or nothing variation can be, for example, expression above or below a threshold of detection (an on/off pattern of expression).
  • a qualitative difference can refer to expression of different types of expression products, e.g., different alleles (e.g., a mutant or polymorphic allele), variants (including sequence variants as well as post-translationally modified variants), etc.
  • different alleles e.g., a mutant or polymorphic allele
  • variants including sequence variants as well as post-translationally modified variants
  • a “quantitative" difference when referring to a pattern of gene expression, refers to a difference in expression that can be assigned a value on a graduated scale, (e.g., a 0-5 or 1-10 scale, a + - +++ scale, a grade 1- grade 5 scale, or the like; it will be understood that the numbers selected for illustration are entirely arbitrary and in no-way are meant to be interpreted to limit the invention).
  • a graduated scale e.g., a 0-5 or 1-10 scale, a + - +++ scale, a grade 1- grade 5 scale, or the like; it will be understood that the numbers selected for illustration are entirely arbitrary and in no-way are meant to be interpreted to limit the invention).
  • the invention is directed to methods of detecting gene expression with a gene expression system having one or more DNA molecules wherein the one or more DNA molecules has a nucleotide sequence which detects expression of a gene corresponding to the oligonucleotides depicted in the Sequence Listing.
  • the oligonucleotide detects expression of a gene that is differentially expressed in leukocytes.
  • the gene expression system may be a candidate library, a diagnostic agent, a diagnostic oligonucleotide set or a diagnostic probe set.
  • the DNA molecules may be genomic DNA, RNA, protein nucleic acid (PNA), cDNA or synthetic oligonucleotides. Following the procedures taught herein, one can identity sequences of interest for analyzing gene expression in leukocytes. Such sequences may be predictive of a disease state.
  • the invention relates to diagnostic oligonucleotides and diagnostic oligonucleotide set(s) comprising members of the leukocyte candidate library listed in Table 2 and the Sequence Listing, for which a correlation exists between the health status of an individual, and the individual's expression of RNA or protein products corresponding to the nucleotide sequence. In some instances, only one oligonucleotide is necessary for such detection.
  • RNA or protein products may be identified by any means capable of detecting expression of RNA or protein products, including but not limited to differential expression screening, PCR, RT-PCR, SAGE analysis, high-throughput sequencing, microarrays, liquid or other arrays, protein-based methods (e.g., western blotting, proteomics, and other methods described herein), and data mining methods, as further described herein.
  • a diagnostic oligonucleotide set comprises at least two oligonucleotide sequences listed in Table 2 or the Sequence Listing which are differentially expressed in leukocytes in an individual with at least one disease criterion for at least one leukocyte-implicated disease relative to the expression in individual without the at least one disease criterion, wherein expression of the two or more nucleotide sequences is correlated with at least one disease criterion, as described below.
  • a diagnostic oligonucleotide set comprises at least one oligonucleotide having an oligonucleotide sequence listed in Table 2 or the Sequence Listing which is differentially expressed, and further wherein the differential expression/correlation has not previously been described.
  • the diagnostic oligonucleotide set is immobilized on an array.
  • diagnostic oligonucleotides are related to the members of the leukocyte candidate library listed in Table 2 and in the Sequence Listing, for which a correlation exists between the health status (or disease criterion) of an individual.
  • the diagnostic oligonucleotides are partially or totally contained in (or derived from) full-length gene sequences (or predicted full-length gene sequences) for the members of the candidate library listed in Table 2 and the Sequence Listing.
  • the diagnostic oligonucleotides may also be derived from other genes that are coexpressed with the correlated sequence or full-length gene. Genes may share expression patterns because they are regulated in the same molecular pathway. Because of the similarity of expression, behavior genes are identified as surrogates in that they can substitute for a diagnostic gene in a diagnostic gene set.
  • Example 4 demonstrates the discovery of surrogates from the data. Surrogate oligonucleotide and surrogate oligonucleotide sets can be utilized to detect expression of surrogate genes and thereby diagnose or monitor patients with a disease.
  • the term “gene cluster” or “cluster” refers to a group of genes related by expression pattern.
  • a cluster of genes is a group of genes with similar regulation across different conditions, such as a patient having a chronic autoimmune or inflammatory disease or a patient without chronic autoimmune or inflammatory disease.
  • the expression profile for each gene in a cluster should be correlated with the expression profile of at least one other gene in that cluster. Correlation may be evaluated using a variety of statistical methods.
  • surrogate refers to a gene with an expression profile such that it can substitute for a diagnostic gene in a diagnostic assay. Such genes are often members of the same gene cluster as the diagnostic gene. For each member of a diagnostic gene set, a set of potential surrogates can be identified through identification of genes with similar expression patterns as described below.
  • Patterns may be considered correlated if the correlation coefficient is greater than or equal to 0.8. In preferred embodiments, the correlation coefficient should be greater than 0.85, 0.9 or 0.95. Other statistical methods produce a measure of mutual information to describe the relatedness between two gene expression patterns. Patterns may be considered correlated if the normalized mutual information value is greater than or equal to 0.7. In preferred embodiments, the normalized mutual information value should be greater than 0.8, 0.9 or 0.95. Patterns may also be considered similar if they cluster closely upon hierarchical clustering of gene expression data (Eisen et al. 1998).
  • Similar patterns may be those genes that are among the 1, 2, 5, 10, 20, 50 or 100 nearest neighbors in a hierarchical clustering or have a similarity score (Eisen et al. 1998) of > 0.5, 0.7, 0.8, 0.9, 0.95 or 0.99. Similar patterns may also be identified as those genes found to be surrogates in a classification tree by CART (Breiman et al. 1994). Often, but not always, members of a gene cluster have similar biological functions in addition to similar gene expression patterns. Correlated genes, clusters and surrogates are identified for the diagnostic genes of the invention. These surrogates may be used as diagnostic genes in an assay instead of, or in addition to, the diagnostic genes for which they are surrogates.
  • the invention also provides diagnostic probe sets. It is understood that a probe includes any reagent capable of specifically identifying a nucleotide sequence of the diagnostic nucleotide set, including but not limited to amplified DNA, amplified RNA, cDNA, synthetic oligonucleotide, partial or full-length nucleic acid sequences. In addition, the probe may identify the protein product of a diagnostic nucleotide sequence, including, for example, antibodies and other affinity reagents.
  • each probe can correspond to one gene, or multiple probes can correspond to one gene, or both, or one probe can correspond to more than one gene.
  • Homologs and variants of the disclosed nucleic acid molecules may be used in the present invention. Homologs and variants of these nucleic acid molecules will possess a relatively high degree of sequence identity when aligned using standard methods.
  • the sequences encompassed by the invention have at least 40-50, 50-60, 70-80, 80-85, 85-90, 90-95 or 95-100% sequence identity to the sequences disclosed herein.
  • sequences of the present invention may contain sequencing errors. That is, there may be incorrect nucleotides, frameshifts, unknown nucleotides, or other types of sequencing errors in any of the sequences; however, the correct sequences will fall within the homology and stringency definitions herein.
  • the minimum length of an oligonucleotide probe necessary for specific hybridization in the human genome can be estimated using two approaches.
  • the first method uses a statistical argument that the probe will be unique in the human genome by chance.
  • the number of independent perfect matches (Po) expected for an oligonucleotide of length L in a genome of complexity C can be calculated from the equation (Laird CD, Chromosoma 32:378 (1971):
  • the second method for estimating the length of a specific probe is to use a probe long enough to hybridize under the chosen conditions and use a computer to search for that sequence or close matches to the sequence in the human genome and choose a unique match.
  • Probe sequences are chosen based on the desired hybridization properties as described in Chapter 11 of Sambrook et al, infra.
  • the PRIMER3 program is useful for designing these probes (S. Rozen and H. Skaletsky 1996,1997; Primer3 code available at genome.wi.mit.edu/genome_software/other/ ⁇ rimer3.html, the website).
  • Probe sequences are then compared pair wise against a database of the human genome sequences using a program such as BLAST or MEGABLAST (Madden, T.L et al.(1996) Meth. Enzymol. 266:131-141). Since most of the human genome is now contained in the database, the number of matches will be determined. Probe sequences are chosen that are unique to the desired target sequence.
  • a diagnostic oligonucleotide or oligonucleotide probe set is immobilized on an array.
  • the array is optionally comprises one or more of: a chip array, a plate array, a bead array, a pin array, a membrane array, a solid surface array, a liquid array, an oligonucleotide array, a polynucleotide array or a cDNA array, a microtiter plate, a pin array, a bead array, a membrane or a chip.
  • the leukocyte-implicated disease is selected from the diseases listed in Table 3.
  • the disease is chronic autoimmune and inflammatory diseases, systemic lupus erythematosis (SLE) and rheumatoid arthritis.
  • diagnostic oligonucleotides of the invention are used as a diagnostic gene set in combination with genes that are know to be associated with a disease state ("known markers").
  • known markers genes that are know to be associated with a disease state
  • the use of the diagnostic oligonucleotides in combination with the known markers can provide information that is not obtainable through the known markers alone.
  • the known markers include those identified by the prior art listing provided.
  • nucleic acids and/or proteins are manipulated according to well known molecular biology techniques. Detailed protocols for numerous such procedures are described in, e.g., in Ausubel et al. Current Protocols in Molecular Biologv (supplemented through 2000) John Wiley & Sons, New York (“Ausubel”); Sambrook et al. Molecular Cloning - A Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989 (“Sambrook”), and Berger and Kimmel Guide to Molecular Cloning Techniques. Methods in Enzvmology volume 152 Academic Press, Inc., San Diego, CA (“Berger”).
  • RNA polymerase mediated techniques e.g., NASBA
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • NASBA RNA polymerase mediated techniques
  • oligonucleotides of the invention can be synthesized utilizing various solid-phase strategies involving mononucleotide- and/or trinucleotide-based phosphoramidite coupling chemistry.
  • nucleic acid sequences can be synthesized by the sequential addition of activated monomers and/or trimers to an elongating polynucleotide chain. See e.g., Caruthers, M.H. et al. (1992) Meth Enzymol 211:3.
  • any nucleic acid can be custom ordered from any of a variety of commercial sources, such as The Midland Certified Reagent Company (mcrc@oligos.com), The Great American Gene Company (genco.com), ExpressGen, Inc. (expressgen.com), Operon Technologies, Inc. (operon.com), and many others.
  • nucleic acid and protein microarrays include, e.g., Agilent Technologies, Palo Alto, CA and Affymetrix, Santa Clara,CA.
  • hybridization of oligonucleotides One area of relevance to the present invention is hybridization of oligonucleotides.
  • Those of skill in the art differentiate hybridization conditions based upon the stringency of hybridization.
  • highly stringent conditions could include hybridization to filter-bound DNA in 0.5 M NaHP0 4> 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C, and washing in O.lXSSC/0.1% SDS at 68° C.
  • SDS sodium dodecyl sulfate
  • O.lXSSC/0.1% SDS O.lXSSC/0.1% SDS at 68° C.
  • Moderate stringency conditions could include, e.g., washing in 0.2XSSC/0.1% SDS at 42°C. (Ausubel et al., 1989, supra).
  • the invention also includes nucleic acid molecules, preferably DNA molecules, that hybridize to, and are therefore the complements of, the DNA sequences of the present invention.
  • Such hybridization conditions may be highly stringent or less highly stringent, as described above.
  • highly stringent conditions may refer, e.g., to washing in 6xSSC/0.05% sodium pyrophosphate at 37°C. (for 14-base oligos), 48°C. (for 17-base oligos), 55°C. (for 20-base oligos), and 60°C. (for 23-base oligos).
  • nucleic acid molecules may act as target nucleotide sequence antisense molecules, useful, for example, in target nucleotide sequence regulation and/or as antisense primers in amplification reactions of target nucleotide sequence nucleic acid sequences. Further, such sequences may be used as part of ribozyme and/or triple helix sequences, also useful for target nucleotide sequence regulation. Still further, such molecules maybe used as components of diagnostic methods whereby the presence of a disease- causing allele, may be detected.
  • Libraries of candidate genes that are differentially expressed in leukocytes are substrates for the identification and evaluation of diagnostic oligonucleotides and oligonucleotide sets and disease specific target nucleotide sequences.
  • leukocyte is used generically to refer to any nucleated blood cell that is not a nucleated erythrocyte. More specifically, leukocytes can be subdivided into two broad classes. The first class includes granulocytes, including, most prevalently, neutrophils, as well as eosinophils and basophils at low frequency. The second class, the non-granular or mononuclear leukocytes, includes monocytes and lymphocytes (e.g., T cells and B cells).
  • monocytes and lymphocytes e.g., T cells and B cells.
  • leukocytes e.g., neutrophils, monocytes and lymphocytes
  • inflammatory and rheumatic diseases e.g., neutrophils, monocytes and lymphocytes
  • cardiovascular disease e.g., hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma,
  • leukocytes are particularly attractive substrates for clinical and experimental evaluation for a variety of reasons. Most importantly, they are readily accessible at low cost from essentially every potential subject. Collection is minimally invasive and associated with little pain, disability or recovery time. Collection can be performed by minimally trained personnel (e.g., phlebotomists, medical technicians, etc.) in a variety of clinical and non-clinical settings without significant technological expenditure. Additionally, leukocytes are renewable, and thus available at multiple time points for a single subject.
  • the initial candidate library was assembled from a combination of "mining" publication and sequence databases and construction of a differential expression library.
  • Candidate oligonucleotide sequences in the library may be represented by a full-length or partial nucleic acid sequence, deoxyribonucleic acid (DNA) sequence, cDNA sequence, RNA sequence, synthetic oligonucleotides, etc.
  • the nucleic acid sequence can be at least 19 nucleotides in length, at least 25 nucleotides, at least 40 nucleotides, at least 100 nucleotides, or larger.
  • the protein product of a candidate nucleotide sequence may be represented in a candidate library using standard methods, as further described below. In selecting and validatating diagnostic oligonucleotides, an initial library of 8,031 candidate oligonucleotide sequences using nucleic acid sequences of 50 nucleotides in length was constructed as described below.
  • the invention provides the candidate leukocyte nucleotide library comprising the nucleotide sequences listed in Table 2 and in the Sequence Listing.
  • the invention provides a candidate library comprising at least two nucleotide sequences listed in Table 2 and the Sequence Listing.
  • at least two nucleotide sequences are 18 nucleotides in length, at least 35 nucleotides, at least 40 nucleotides or at least 100 nucleotides.
  • the nucleotide sequences comprises deoxyribonucleic acid (DNA) sequence, ribonucleic acid (RNA) sequence, synthetic oligonucleotide sequence, or genomic DNA sequence. It is understood that the nucleotide sequences may each correspond to one gene, or that several nucleotide sequences may correspond to one gene, or that a single nucleotide sequence may correspond to multiple genes.
  • the invention also provides probes to the candidate nucleotide library.
  • the probes comprise at least two nucleotide sequences listed in Table 2 or the Sequence Listing which are differentially expressed in leukocytes in an individual with a least one disease criterion for at least one leukocyte-related disease and in leukocytes in an individual without the at least one disease criterion, wherein expression of the two or more nucleotide sequences is correlated with at least one disease criterion.
  • a probe may detect either the RNA expression or protein product expression of the candidate nucleotide library.
  • a probe can detect a genotype associated with a candidate nucleotide sequence, as further described below.
  • the probes for the candidate nucleotide library are immobilized on an array.
  • the candidate nucleotide library of the invention is useful in identifying diagnostic nucleotide sets of the invention and is itself a diagnostic nucleotide set of the invention, as described below.
  • the candidate nucleotide sequences may be further characterized, and may be identified as a disease target nucleotide sequence, as described below.
  • the candidate nucleotide sequences may also be suitable for use as imaging reagents, as described below.
  • leukocyte expression profiles corresponding to multiple members of the candidate library are obtained.
  • Leukocyte samples from one or more subjects are obtained by standard methods. Most typically, these methods involve trans-cutaneous venous sampling of peripheral blood. While sampling of circulating leukocytes from whole blood from the peripheral vasculature is generally the simplest, least invasive, and lowest cost alternative, it will be appreciated that numerous alternative sampling procedures exist, and are favorably employed in some circumstances.
  • leukocytes sampled from the peripheral vasculature and those obtained, e.g., from a central line, from a central artery, or indeed from a cardiac catheter, or during a surgical procedure which accesses the central vasculature.
  • other body fluids and tissues that are, at least in part, composed of leukocytes are also desirable leukocyte samples.
  • fluid samples obtained from the lung during bronchoscopy may be rich in leukocytes, and amenable to expression profiling in the context of the invention, e.g., for the diagnosis, prognosis, or monitoring of lung transplant rejection, inflammatory lung diseases or infectious lung disease.
  • Fluid samples from other tissues e.g., obtained by endoscopy of the colon, sinuses, esophagus, stomach, small bowel, pancreatic duct, biliary tree, bladder, ureter, vagina, cervix or uterus, etc.
  • Samples may also be obtained other sources containing leukocytes, e.g., from urine, bile, cerebrospinal fluid, feces, gastric or intestinal secretions, semen, or solid organ or joint biopsies.
  • mixed populations of leukocytes such as are found in whole blood are utilized in the methods of the present invention.
  • a crude separation e.g., of mixed leukocytes from red blood cells, and/or concentration, e.g., over a sucrose, percoll or f ⁇ coll gradient, or by other methods known in the art, can be employed to facilitate the recovery of RNA or protein expression products at sufficient concentrations, and to reduce non-specific background.
  • FACS Fluorescence Activated Cell Sorting
  • RNA isolation techniques are available for the isolation of RNA from whole blood. Any technique that allows isolation of mRNA from cells (in the presence or absence of rRNA and tRNA) can be utilized.
  • one method that allows reliable isolation of total RNA suitable for subsequent gene expression analysis is described as follows.
  • Peripheral blood (either venous or arterial) is drawn from a subject, into one or more sterile, endotoxin free, tubes containing an anticoagulant (e.g., EDTA, citrate, heparin, etc.).
  • an anticoagulant e.g., EDTA, citrate, heparin, etc.
  • the sample is divided into at least two portions.
  • One portion, e.g., of 5-8 ml of whole blood is frozen and stored for future analysis, e.g., of DNA or protein.
  • a second portion e.g., of approximately 8 ml whole blood is processed for isolation of total RNA by any of a variety of techniques as described in, e.g, Sambook, Ausubel, below, as well as U.S. Patent Numbers: 5,728,822 and 4,843,155.
  • a subject sample of mononuclear leukocytes obtained from about 8 ml of whole blood a quantity readily available from an adult human subject under most circumstances, yields 5-20 ⁇ g of total RNA.
  • This amount is ample, e.g., for labeling and hybridization to at least two probe arrays.
  • Labeled probes for analysis of expression patterns of nucleotides of the candidate libraries are prepared from the subject's sample of RNA using standard methods.
  • cDNA is synthesized from total RNA using a polyT primer and labeled, e.g., radioactive or fluorescent, nucleotides.
  • RNA isolated from subject samples e.g., peripheral blood leukocytes, or leukocytes obtained from other biological fluids and samples
  • subject samples e.g., peripheral blood leukocytes, or leukocytes obtained from other biological fluids and samples
  • RNA that is extracted from the leukocyte sample is limiting, and amplification of the RNA is desirable. Amplification may be accomplished by increasing the efficiency of probe labeling, or by amplifying the RNA sample prior to labeling. It is appreciated that care must be taken to select an amplification procedure that does not introduce any bias (with respect to gene expression levels) during the amplification process.
  • RNA sample is amplified prior to labeling.
  • linear amplification may be performed, as described in U.S. Patent No. 6,132,997.
  • a T7-polyT primer is used to generate the cDNA copy of the RNA.
  • a second DNA strand is then made to complete the substrate for amplification.
  • the T7 promoter incorporated into the primer is used by a T7 polymerase to produce numerous antisense copies of the original RNA.
  • Fluorescent dye labeled nucleotides are directly incorporated into the RNA.
  • amino allyl labeled nucleotides are incorporated into the RNA, and then fluorescent dyes are chemically coupled to the amino allyl groups, as described in Hughes et al. 2001.
  • Other exemplary methods for amplification are described below.
  • RNA isolated must contain RNA derived from leukocytes, but may also contain RNA from other cell types to a variable degree. Additionally, the isolated RNA may come from subsets of leukocytes, e.g. monocytes and/or T-lymphocytes, as described above. Such consideration of cell type used for the derivation of RNA depends on the method of expression profiling used. Subsets of leukocytes can be obtained by fluorescence activated cell sorting (FACS), microfluidics cell seperation systems or a variety of other methods. Cell sorting may be necessary for the discovery of diagnostic gene sets, for the implementation of gene sets as products or both. Cell sorting can be achieved with a variety of technologies (See Galbraith et al. 1999, Cantor et al. 1975, see also the technology of Guava Technologies, Hayward, CA).
  • FACS fluorescence activated cell sorting
  • DNA samples may be obtained for analysis of the presence of DNA mutations, single nucleotide polymorphisms (SNPs), or other polymorphisms.
  • SNPs single nucleotide polymorphisms
  • DNA is isolated using standard techniques, e.g. Maniatus, supra.
  • Protein(s) are detected in samples of patient semm or from leukocyte cellular protein. Serum is prepared by centrifugation of whole blood, using standard methods. Proteins present in the serum may have been produced from any of a variety of leukocytes and non-leukocyte cells, and may include secreted proteins from leukocytes. Alternatively, leukocytes or a desired sub-population of leukocytes are prepared as described above. Cellular protein is prepared from leukocyte samples using methods well known in the art, e.g., Trizol (Invitrogen Life Technologies, cat # 15596108; Chomczynski, P. and Sacchi, N. (1987) Anal. Biochem.
  • the assay itself may be a cell sorting assay in which cells are sorted and/or counted based on cell surface expression of a protein marker. (See Cantor et al. 1975, Galbraith et al. 1999) Obtaining expression patterns
  • Expression patterns, or profiles, of a plurality of nucleotides corresponding to members of the candidate library are then evaluated in one or more samples of leukocytes.
  • the leukocytes are derived from patient peripheral blood samples, although, as indicated above, many other sample sources are also suitable.
  • These expression patterns constitute a set of relative or absolute expression values for some number of RNAs or protein products corresponding to the plurality of nucleotide sequences evaluated, which is referred to herein as the subject's "expression profile" for those nucleotide sequences.
  • expression patterns for as few as one independent member of the candidate library can be obtained, it is generally preferable to obtain expression patterns corresponding to a larger number of nucleotide sequences, e.g., about 2, about 5, about 10, about 20, about 50, about 100, about 200, about 500, or about 1000, or more.
  • the expression pattern for each differentially expressed component member of the library provides a finite specificity and sensitivity with respect to predictive value, e.g., for diagnosis, prognosis, monitoring, and the like.
  • the term subject, or subject sample of leukocytes refers to an individual regardless of health and/or disease status.
  • a subject can be a patient, a study participant, a control subject, a screening subject, or any other class of individual from whom a leukocyte sample is obtained and assessed in the context of the invention.
  • a subject can be diagnosed with a disease, can present with one or more symptom of a disease, or a predisposing factor, such as a family (genetic) or medical history (medical) factor, for a disease, or the like.
  • a subject can be healthy with respect to any of the aforementioned factors or criteria.
  • the term “healthy” as used herein is relative to a specified disease, or disease factor, or disease criterion, as the term “healthy” cannot be defined to correspond to any absolute evaluation or status.
  • an individual defined as healthy with reference to any specified disease or disease criterion can in fact be diagnosed with any other one or more disease, or exhibit any other one or more disease criterion.
  • non-human animals such as laboratory animals, e.g., mice, rats, guinea pigs, rabbits; domesticated livestock, e.g., cows, horses, goats, sheep, chicken, etc.; and companion animals, e.g., dogs, cats, etc.
  • expression patterns can be evaluated by northern analysis, PCR, RT-PCR, Taq Man analysis, FRET detection, monitoring one or more molecular beacon, hybridization to an oligonucleotide array, hybridization to a cDNA array, hybridization to a polynucleotide array, hybridization to a liquid microarray, hybridization to a microelectric array, molecular beacons, cDNA sequencing, clone hybridization, cDNA fragment fingerprinting, serial analysis of gene expression (SAGE), subfractive hybridization, differential display and/or differential screening (see, e.g., Lockhart and Winzeler (2000) Nature 405:827-836, and references cited therein).
  • SAGE serial analysis of gene expression
  • PCR primers are designed to a member(s) of a candidate nucleotide library.
  • cDNA is prepared from subject sample RNA by reverse transcription from a poly-dT oligonucleotide primer, and subjected to PCR.
  • Double stranded cDNA may be prepared using primers suitable for reverse transcription of the PCR product, followed by amplification of the cDNA using in vitro transcription.
  • the product of in vitro transcription is a sense-RNA corresponding to the original member(s) of the candidate library.
  • PCR product may be also be evaluated in a number of ways known in the art, including real-time assessment using detection of labeled primers, e.g. TaqMan or molecular beacon probes.
  • Technology platforms suitable for analysis of PCR products include the ABI 7700, 5700, or 7000 Sequence Detection Systems (Applied Biosystems, Foster City, CA), the MJ Research Opticon (MJ Research, Waltham, MA), the Roche Light Cycler (Roche Diagnostics, Indianapolis, IN), the Stratagene MX4000 (Stratagene, La Jolla, CA), and the Bio-Rad iCycler (Bio-Rad Laboratories,
  • molecular beacons are used to detect presence of a nucleic acid sequence in an unamplified RNA or cDNA sample, or following amplification of the sequence using any method, e.g. IVT (In Vitro transcription) or NASBA (nucleic acid sequence based amplification).
  • IVT In Vitro transcription
  • NASBA nucleic acid sequence based amplification.
  • Molecular beacons are designed with sequences complementary to member(s) of a candidate nucleotide library, and are linked to fluorescent labels. Each probe has a different fluorescent label with non- overlapping emission wavelengths. For example, expression often genes may be assessed using ten different sequence-specific molecular beacons.
  • molecular beacons are used to assess expression of multiple nucleotide sequences at once.
  • Molecular beacons with sequence complimentary to the members of a diagnostic nucleotide set are designed and linked to fluorescent labels. Each fluorescent label used must have a non-overlapping emission wavelength.
  • 10 nucleotide sequences can be assessed by hybridizing 10 sequence specific molecular beacons (each labeled with a different fluorescent molecule) to an amplified or un-amplified RNA or cDNA sample. Such an assay bypasses the need for sample labeling procedures.
  • bead arrays can be used to assess expression of multiple sequences at once (See, e.g, LabMAP 100, Luminex Corp, Austin, Texas).
  • electric arrays are used to assess expression of multiple sequences, as exemplified by the e-Sensor technology of Motorola (Chicago, 111.) or Nanochip technology of Nanogen (San Diego, CA.)
  • the particular method elected will be dependent on such factors as quantity of RNA recovered, practitioner preference, available reagents and equipment, detectors, and the like. Typically, however, the elected method(s) will be appropriate for processing the number of samples and probes of interest. Methods for high-throughput expression analysis are discussed below.
  • protein expression in a sample of leukocytes, can be evaluated by one or more method selected from among: western analysis, two-dimensional gel analysis, chromatographic separation, mass spectrometric detection, protein-fusion reporter constructs, colorimetric assays, binding to a protein array and characterization of polysomal mRNA.
  • One particularly favorable approach involves binding of labeled protein expression products to an array of antibodies specific for members of the candidate library. Methods for producing and evaluating antibodies are widespread in the art, see, e.g., Coligan, supra; and Harlow and Lane (1989) Antibodies: A Laboratory Manual, Cold Spring Harbor Press, NY (“Harlow and Lane”).
  • affinity reagents e.g., antibodies, small molecules, etc.
  • affinity reagents are developed that recognize epitopes of the protein product.
  • Affinity assays are used in protein array assays, e.g. to detect the presence or absence of particular proteins.
  • affinity reagents are used to detect expression using the methods described above.
  • labeled affinity reagents are bound to populations of leukocytes, and leukocytes expressing the protein are identified and counted using fluorescent activated cell sorting (FACS).
  • FACS fluorescent activated cell sorting
  • high throughput formats for evaluating gene expression.
  • the term high throughput refers to a format that performs at least about 100 assays, or at least about 500 assays, or at least about 1000 assays, or at least about 5000 assays, or at least about 10,000 assays, or more per day.
  • the number of samples or the number of candidate nucleotide sequences evaluated can be considered.
  • a northern analysis of, e.g., about 100 samples performed in a gridded array, e.g., a dot blot, using a single probe corresponding to a candidate nucleotide sequence can be considered a high throughput assay.
  • such an assay is performed as a series of duplicate blots, each evaluated with a distinct probe corresponding to a different member of the candidate library.
  • methods that simultaneously evaluate expression of about 100 or more candidate nucleotide sequences in one or more samples, or in multiple samples, are considered high throughput.
  • Such methods involve a logical or physical array of either the subject samples, or the candidate library, or both.
  • Common array formats include both liquid and solid phase arrays.
  • assays employing liquid phase arrays e.g., for hybridization of nucleic acids, binding of antibodies or other receptors to ligand, etc.
  • Microtiter plates with 96, 384 or 1536 wells are widely available, and even higher numbers of wells, e.g, 3456 and 9600 can be used.
  • the choice of microtiter plates is determined by the methods and equipment, e.g., robotic handling and loading systems, used for sample preparation and analysis.
  • Exemplary systems include, e.g., the ORCATM system from Beckman-Coulter, Inc. (Fullerton, CA) and the Zymate systems from Zymark Corporation (Hopkinton, MA).
  • solid phase arrays can favorably be employed in to determine expression patterns in the context of the invention.
  • Exemplary formats include membrane or filter arrays (e.g, nitrocellulose, nylon), pin arrays, and bead arrays (e.g., in a liquid "slurry").
  • probes corresponding to nucleic acid or protein reagents that specifically interact with (e.g., hybridize to or bind to) an expression product corresponding to a member of the candidate library are immobilized, for example by direct or indirect cross-linking, to the solid support.
  • any solid support capable of withstanding the reagents and conditions necessary for performing the particular expression assay can be utilized.
  • functionalized glass silicon, silicon dioxide, modified silicon, any of a variety of polymers, such as (poly)tetrafluoroethylene, (poly)vinylidenedifluoride, polystyrene, polycarbonate, or combinations thereof can all serve as the substrate for a solid phase array.
  • polymers such as (poly)tetrafluoroethylene, (poly)vinylidenedifluoride, polystyrene, polycarbonate, or combinations thereof can all serve as the substrate for a solid phase array.
  • the array is a "chip" composed, e.g., of one of the above-specified materials.
  • Polynucleotide probes e.g., RNA or DNA, such as cDNA, synthetic oligonucleotides, and the like, or binding proteins such as antibodies, that specifically interact with expression products of individual components of the candidate library are affixed to the chip in a logically ordered manner, i.e., in an array.
  • any molecule with a specific affinity for either the sense or anti-sense sequence of the marker nucleotide sequence can be fixed to the array surface without loss of specific affinity for the marker and can be obtained and produced for array production, for example, proteins that specifically recognize the specific nucleic acid sequence of the marker, ribozymes, peptide nucleic acids (PNA), or other chemicals or molecules with specific affinity.
  • proteins that specifically recognize the specific nucleic acid sequence of the marker ribozymes, peptide nucleic acids (PNA), or other chemicals or molecules with specific affinity.
  • PNA peptide nucleic acids
  • RNA, or cDNA corresponding to RNA, isolated from a subject sample of leukocytes is labeled, e.g., with a fluorescent tag, and a solution containing the RNA (or cDNA) is incubated under conditions favorable for hybridization, with the "probe" chip. Following incubation, and washing to eliminate non-specific hybridization, the labeled nucleic acid bound to the chip is detected qualitatively or quantitatively, and die resulting expression profile for the corresponding candidate nucleotide sequences is recorded.
  • the probe used for diagnostic purposes may be identical to the probe used during diagnostic nucleotide sequence discovery and validation. Alternatively, the probe sequence may be different than the sequence used in diagnostic nucleotide sequence discovery and validation. Multiple cDNAs from a nucleotide sequence that are non-overlapping or partially overlapping may also be used.
  • oligonucleotides corresponding to members of a candidate nucleotide library are synthesized and spotted onto an array.
  • oligonucleotides are synthesized onto the array using methods known in the art, e.g. Hughes, et al. supra.
  • the oligonucleotide is designed to be complementary to any portion of the candidate nucleotide sequence.
  • an oligonucleotide in the context of expression analysis for, e.g. diagnostic use of diagnostic nucleotide sets, an oligonucleotide can be designed to exhibit particular hybridization characteristics, or to exhibit a particular specificity and/or sensitivity, as further described below.
  • Hybridization signal may be amplified using methods known in the art, and as described herein, for example use of the Clontech kit (Glass Fluorescent Labeling Kit), Stratagene kit (Fairplay Microarray Labeling Kit), the Micromax kit (New England Nuclear, Inc.), the Genisphere kit (3DNA Submicro), linear amplification, e.g. as described in U.S. Patent No. 6,132,997 or described in Hughes, TR, et al., Nature Biotechnology, 19:343-347 (2001) and/or Westin et al. Nat Biotech. 18:199-204. In some cases, amplification techniques do not increase signal intensity, but allow assays to be done with small amounts of RNA.
  • fluorescently labeled cDNA are hybridized directly to the microarray using methods known in the art.
  • labeled cDNA are generated by reverse transcription using Cy3- and Cy5-conjugated deoxynucleotides, and the reaction products purified using standard methods. It is appreciated that the methods for signal amplification of expression data useful for identifying diagnostic nucleotide sets are also useful for amplification of expression data for diagnostic purposes.
  • Microarray expression may be detected by scanning the microarray with a variety of laser or CCD-based scanners, and extracting features with numerous software packages, for example, Imagene (Biodiscovery), Feature Extraction Software (Agilent), Scanalyze (Eisen, M. 1999. SCANALYZE User Manual; Stanford Univ., Stanford, CA. Ver 2.32.), GenePix (Axon Instruments).
  • Imagene Biodiscovery
  • Feature Extraction Software Agilent
  • Scanalyze Eisen, M. 1999. SCANALYZE User Manual; Stanford Univ., Stanford, CA. Ver 2.32.
  • GenePix GenePix
  • hybridization to microelectric arrays is performed, e.g. as described in Umek et al (2001) J Mol Diagn. 3:74-84.
  • An affinity probe e.g. DNA
  • Unlabelled RNA or cDNA is hybridized to the array, or alternatively, RNA or cDNA sample is amplified before hybridization, e.g. by PCR.
  • Specific hybridization of sample RNA or cDNA results in generation of an electrical signal, which is transmitted to a detector. See Westin (2000) Nat Biotech. 18:199-204 (describing anchored multiplex amplification of a microelectronic chip array); Edman (1997) NAR 25:4907-14; Vignali (2000) J Immunol Methods 243:243-55.
  • a microfluidics chip is used for RNA sample preparation and analysis. This approach increases efficiency because sample preparation and analysis are streamlined. Briefly, microfluidics may be used to sort specific leukocyte sub-populations prior to RNA preparation and analysis. Microfluidics chips are also useful for, e.g., RNA preparation, and reactions involving RNA (reverse transcription, RT-PCR). Briefly, a small volume of whole, anti-coagulated blood is loaded onto a microfluidics chip, for example chips available from Caliper (Mountain View, CA) or Nanogen (San Diego, CA.) A microfluidics chip may contain channels and reservoirs in which cells are moved and reactions are performed.
  • RNA isolation in the chip or is then removed for further processing, for example, RNA extraction by standard methods.
  • the microfluidics chip is a circular disk containing ficoll or another density reagent. The blood sample is injected into the center of the disc, the disc is rotated at a speed that generates a centrifugal force appropriate for density gradient separation of mononuclear cells, and the separated mononuclear cells are then harvested for further analysis or processing.
  • Expression patterns can be evaluated by qualitative and/or quantitative measures. Certain of the above described techniques for evaluating gene expression (as RNA or protein products) yield data that are predominantly qualitative in nature. That is, the methods detect differences in expression that classify expression into distinct modes without providing significant information regarding quantitative aspects of expression. For example, a technique can be described as a qualitative technique if it detects the presence or absence of expression of a candidate nucleotide sequence, i.e., an on/off pattern of expression. Alternatively, a qualitative technique measures the presence (and/or absence) of different alleles, or variants, of a gene product.
  • some methods provide data that characterize expression in a quantitative manner. That is, the methods relate expression on a numerical scale, e.g., a scale of 0-5, a scale of 1-10, a scale of + - +++, from grade 1 to grade 5, a grade from a to z, or the like.
  • a numerical scale e.g., a scale of 0-5, a scale of 1-10, a scale of + - +++, from grade 1 to grade 5, a grade from a to z, or the like.
  • the numerical, and symbolic examples provided are arbitrary, and that any graduated scale (or any symbolic representation of a graduated scale) can be employed in the context of the present invention to describe quantitative differences in nucleotide sequence expression.
  • such methods yield information corresponding to a relative increase or decrease in expression.
  • any method that yields either quantitative or qualitative expression data is suitable for evaluating expression of candidate nucleotide sequence in a subject sample of leukocytes.
  • the recovered data e.g., the expression profile, for the nucleotide sequences is a combination of quantitative and qualitative data.
  • expression of the plurality of candidate nucleotide sequences is evaluated sequentially. This is typically the case for methods that can be characterized as low- to moderate-throughput. In contrast, as the throughput of the elected assay increases, expression for the plurality of candidate nucleotide sequences in a sample or multiple samples of leukocytes, is assayed simultaneously.
  • the methods (and throughput) are largely determined by the individual practitioner, although, typically, it is preferable to employ methods that permit rapid, e.g. automated or partially automated, preparation and detection, on a scale that is time-efficient and cost-effective.
  • the selected loci can be, for example, chromosomal loci corresponding to one or more member of the candidate library, polymorphic alleles for marker loci, or alternative disease related loci (not contributing to the candidate library) known to be, or putatively associated with, a disease (or disease criterion).
  • chromosomal loci corresponding to one or more member of the candidate library
  • polymorphic alleles for marker loci or alternative disease related loci (not contributing to the candidate library) known to be, or putatively associated with, a disease (or disease criterion).
  • RFLP restriction fragment length polymorphism
  • PCR polymerase chain reaction
  • AFLP amplification length polymorphism
  • SSCP single stranded conformation polymorphism
  • SNP single nucleotide polymorphism
  • Many such procedures are readily adaptable to high throughput and/or automated (or semi-automated) sample preparation and analysis methods. Most, can be performed on nucleic acid samples recovered via simple procedures from the same sample of leukocytes as yielded the material for expression profiling. Exemplary techniques are described in, e.g., Sambrook, and Ausubel, supra.
  • Identification of diagnostic nucleotides and nucleotide sets and disease specific target nucleotide sequence proceeds by correlating the leukocyte expression profiles with data regarding the subject's health status to produce a data set designated a "molecular signature.” Examples of data regarding a patient's health status, also termed “disease criteria(ion)", is described below and in the Section titled “selected diseases,” below. Methods useful for correlation analysis are further described elsewhere in the specification.
  • relevant data regarding the subject's health status includes retrospective or prospective health data, e.g., in the form of the subject's medical history, as provided by the subject, physician or third party, such as, medical diagnoses, laboratory test results, diagnostic test results, clinical events, or medication lists, as further described below.
  • Such data may include information regarding a patient's response to treatment and/or a particular medication and data regarding the presence of previously characterized "risk factors.” For example, cigarette smoking and obesity are previously identified risk factors for heart disease.
  • Further examples of health status information, including diseases and disease criteria, is described in the section titled Selected diseases, below.
  • the data describes prior events and evaluations (i.e., retrospective data).
  • data collected subsequent to the sampling i.e., prospective data
  • the tissue sampled e.g., peripheral blood, bronchial lavage, etc., can be obtained at one or more multiple time points and subject data is considered retrospective or prospective with respect to the time of sample procurement.
  • longitudinal data Data collected at multiple time points, called “longitudinal data", is often useful, and thus, the invention encompasses the analysis of patient data collected from the same patient at different time points.
  • Analysis of paired samples such as samples from a patient at different times, allows identification of differences that are specifically related to the disease state since the genetic variability specific to the patient is controlled for by the comparison. Additionally, other variables that exist between patients may be controlled for in this way, for example, the presence or absence of inflammatory diseases (e.g., rheumatoid arthritis) the use of medications that may effect leukocyte gene expression, the presence or absence of co-morbid conditions, etc.
  • inflammatory diseases e.g., rheumatoid arthritis
  • the analysis of a pattern of expression profiles provides information relating to changes in expression level over time, and may permit the determination of a rate of change, a trajectory, or an expression curve.
  • Two longitudinal samples may provide information on the change in expression of a gene over time, while three longitudinal samples may be necessary to determine the "trajectory" of expression of a gene.
  • Such information may be relevant to the diagnosis of a disease.
  • the expression of a gene may vary from individual to individual, but a clinical event, for example, a heart attack, may cause the level of expression to double in each patient.
  • clinically interesting information is gleaned from the change in expression level, as opposed to the absolute level of expression in each individual.
  • a reference expression profile can be determined for all patients without the disease criterion in question who have similar characteristics, such as age, sex, race, diagnoses etc.
  • a reference expression profile can be determined for all patients without the disease criterion in question who have similar characteristics, such as age, sex, race, diagnoses etc.
  • small sample sizes of 10-40 samples from 10-20 individuals are used to identify a diagnostic nucleotide set. Larger sample sizes are generally necessary to validate the diagnostic nucleotide set for use in large and varied patient populations, as further described below. For example, extension of gene expression correlations to varied ethnic groups, demographic groups, nations, peoples or races may require expression correlation experiments on the population of interest.
  • Expression profiles derived from a patient are compared to a control or standard expression RNA to facilitate comparison of expression profiles (e.g. of a set of candidate nucleotide sequences) from a group of patients relative to each other (i.e., from one patient in the group to other patients in the group, or to patients in another group).
  • the reference RNA used should have desirable features of low cost and simplicity of production on a large scale. Additionally, the reference RNA should contain measurable amounts of as many of the genes of the candidate library as possible.
  • Standard expression reference can be, for example, RNA derived from resting cultured leukocytes or commercially available reference RNA, such as Universal reference RNA from Stratagene. See Nature, V406, 8-17- 00, p. 747-752.
  • Use of an expression reference standard is particularly useful when the expression of large numbers of nucleotide sequences is assayed, e.g. in an array, and in certain other applications, e.g. qualitative PCR, RT-PCR, etc., where it is desirable to compare a sample profile to a standard profile, and/or when large numbers of expression profiles, e.g.
  • an expression reference standard should be available in large quantities, should be a good substrate for amplification and labeling reactions, and should be capable of detecting a large percentage of candidate nucleic acids using suitable expression profiling technology.
  • the expression profile derived from a patient sample is compared with the expression of an internal reference control gene, for example, ⁇ -actin or CD4.
  • the relative expression of the profiled genes and the internal reference control gene (from the same individual) is obtained.
  • An internal reference control may also be used with a reference RNA.
  • an expression profile for "gene 1" and the gene encoding CD4 can be determined in a patient sample and in a reference RNA.
  • the expression of each gene can be expressed as the "relative" ratio of expression the gene in the patient sample compared with expression of the gene in the reference RNA.
  • the expression ratio (sample/reference) for gene 1 may be divided by the expression ration for CD4 (sample/reference) and thus the relative expression of gene 1 to CD4 is obtained.
  • the invention also provides a buffy coat control RNA useful for expression profiling, and a method of using control RNA produced from a population of buffy coat cells, the white blood cell layer derived from the centrifugation of whole blood.
  • Buffy coat contains all white blood cells, including granulocytes, mononuclear cells and platelets.
  • the invention also provides a method of preparing control RNA from buffy coat cells for use in expression profile analysis of leukocytes. Buffy coat fractions are obtained, e.g. from a blood bank or directly from individuals, preferably from a large number of individuals such that bias from individual samples is avoided and so that the RNA sample represents an average expression of a healthy population. Buffy coat fractions from about 50 or about 100, or more individuals are preferred.
  • the buffy cell sample can be further enriched for a particular leukocyte sub-populations, e.g. mononuclear cells, T- lymphocytes, etc.
  • the buffy cell pellet is diluted in PBS (phosphate buffered saline) and loaded onto a non-polystyrene tube containing a polysucrose and sodium diatrizoate solution adjusted to a density of 1.077+/-0.001 g/ml.
  • PBS phosphate buffered saline
  • the tube is centrifuged at 1200 x g, and the enriched cell layer at the plasma : medium interface is removed, washed with PBS + 2% FBS, and cells collected by centrifugation at 1200 x g.
  • the cell pellet is treated with 5 ml of erythrocyte lysis buffer (EL buffer, Qiagen) for 10 minutes on ice, and enriched T-lymphoctes are collected by centrifugation.
  • EL buffer erythrocyte lysis buffer
  • Qiagen erythrocyte lysis buffer
  • the buffy cells (whole buffy coat or sub-population, e.g. mononuclear fraction) can be cultured in vitro and subjected to stimulation with cytokines or activating chemicals such as phorbol esters or ionomycin.
  • cytokines or activating chemicals such as phorbol esters or ionomycin.
  • Such stimuli may increase expression of nucleotide sequences that are expressed in activated immune cells and might be of interest for leukocyte expression profiling experiments.
  • RNA is prepared using standard methods. For example, cells are pelleted and lysed with a phenol/guanidinium thiocyanate and RNA is prepared. RNA can also be isolated using a silica gel- based purification column or the column method can be used on RNA isolated by the phenol/guanidinium thiocyanate method. RNA from individual buffy coat samples can be pooled during this process, so that the resulting reference RNA represents the RNA of many individuals and individual bias is minimized or eliminated.
  • RNA derived from one or more of the following sources can be used as controls for an experiment: stimulated or unstimulated whole buffy coat, stimulated or unstimulated peripheral mononuclear cells, or stimulated or unstimulated T- lymphocytes.
  • the expression reference standard can be derived from any subject or class of subjects including healthy subjects or subjects diagnosed with the same or a different disease or disease criterion. Expression profiles from subjects in two or more distinct classes are compared to determine which subset of nucleotide sequences in the candidate library can best distinguish between the subject classes, as further discussed below. It will be appreciated that in the present context, the term "distinct classes" is relevant to at least one distinguishable criterion relevant to a disease of interest, a "disease criterion.” The classes can, of course, demonstrate significant overlap (or identity) with respect to other disease criteria, or with respect to disease diagnoses, prognoses, or the like.
  • the mode of discovery involves, e.g., comparing the molecular signature of different subject classes to each other (such as patient to control, patients with a first diagnosis to patients with a second diagnosis, etc.) or by comparing the molecular signatures of a single individual taken at different time points.
  • the invention can be applied to a broad range of diseases, disease criteria, conditions and other clinical and/or epidemiological questions, as further discussed above/below.
  • expression reference controls are also useful during use of diagnostic nucleotide sets, e.g. use of a diagnostic nucleotide set for diagnosis of a disease, as further described below. Analysis of expression profiles
  • the molecular signatures/expression profiles are typically recorded in a database.
  • the database is a relational database accessible by a computational device, although other formats, e.g., manually accessible indexed files of expression profiles as photographs, analogue or digital imaging readouts, spreadsheets, etc. can be used. Further details regarding preferred embodiments are provided below.
  • the expression patterns initially recorded are analog or digital in nature and/or whether they represent quantitative or qualitative differences in expression
  • the expression patterns, expression profiles (collective expression patterns), and molecular signatures (correlated expression patterns) are stored digitally and accessed via a database.
  • the database is compiled and maintained at a central facility, with access being available locally and/or remotely.
  • the ensuing molecular signatures are likewise recorded in the database.
  • the algorithms optionally additionally query additional samples against the existing database to further refine the association between a molecular signature and disease criterion.
  • the data set comprising the one (or more) molecular signatures is optionally queried against an expanding set of additional or other disease criteria.
  • Expression data is analyzed using methods well known in the art, including the software packages Imagene (Biodiscovery, Marina del Rey, CA), Feature Extraction Software (Agilent, Palo Alto, CA), and Scanalyze (Stanford University).
  • a "feature" refers to an individual spot of DNA on an array. Each gene may be represented by more than one feature.
  • hybridized microarrays are scanned and analyzed on an Axon Instruments scanner using GenePix 3.0 software (Axon Instruments, Union City, CA).
  • GenePix 3.0 software Axon Instruments, Union City, CA.
  • the data extracted by GenePix is used for all downsfream quality control and expression evaluation. The data is derived as follows.
  • the data for all features flagged as “not found” by the software is removed from the dataset for individual hybridizations.
  • the "not found” flag by GenePix indicates that the software was unable to discriminate the feature from the background.
  • Each feature is examined to determine the value of its signal.
  • the median pixel intensity of the background (B n ) is subtracted from the median pixel intensity of the feature (F n ) to produce the background-subtracted signal (hereinafter, "BGSS").
  • the BGSS is divided by the standard deviation of the background pixels to provide the signal-to-noise ratio (hereinafter, "S/N").
  • S/N features with a S/N of three or greater in both the Cy3 channel (corresponding to the sample RNA) and Cy5 channel (corresponding to the reference RNA) are used for further analysis (hereinafter denoted "useable features").
  • different S/Ns are used for selecting expression data for an analysis. For example, only expression data with signal to noise ratios > 3 might be used in an analysis.
  • features with S/N values ⁇ 3 may be flagged as such and included in the analysis. Such flagged data sets include more values and may allow one to discover expression markers that would be missed otherwise. However, such data sets may have a higher variability than filtered data, which may decrease significance of findings or performance of correlation statistics.
  • the expression level (e) is expressed as the logarithm of the ratio (R) of the Background Subtracted Signal (hereinafter "BGSS") for the Cy3 (sample RNA) channel divided by the BGSS for the Cy5 channel (reference RNA). This "log ratio" value is used for comparison to other experiments.
  • Variation in signal across hybridizations may be caused by a number of factors affecting hybridization, DNA spotting, wash conditions, and labeling efficiency.
  • a single reference RNA may be used with all of the experimental RNAs, permitting multiple comparisons in addition to individual comparisons.
  • the gene expression levels from each sample are compared across arrays, permitting the use of a consistent denominator for our experimental ratios.
  • Alternative methods of analyzing the data may involve 1) using the sample channel without normalization by the reference channel, 2) using an intensity-dependent normalization based on the reference which provides a greater correction when the signal in the reference channel is large, 3) using the data without background subtraction or subtracting an empirically derived function of the background intensity rather than the background itself.
  • the data may be scaled (normalized) to control for labeling and hybridization variability within the experiment, using methods known in the art. Scaling is desirable because it facilitates the comparison of data between different experiments, patients, etc. Generally the BGSS are scaled to a factor such as the median, the mean, the trimmed mean, and percentile. Additional methods of scaling include: to scale between 0 and 1, to subtract the mean, or to subtract the median. Scaling is also performed by comparison to expression patterns obtained using a common reference RNA, as described in greater detail above. As with other scaling methods, the reference RNA facilitates multiple comparisons of the expression data, e.g., between patients, between samples, etc. Use of a reference RNA provides a consistent denominator for experimental ratios.
  • a scaling factor (a) may be used to adjust individual expression levels as follows.
  • the median of the scaling factor (a), for example, BGSS is determined for the set of all features with a S/N greater than three.
  • the BGSS; (the BGSS for each feature "i") is divided by the median for all features (a), generating a scaled ratio.
  • the scaled ration is used to determine the expression value for the feature (e), or the log ratio.
  • control features are used to normalize the data for labeling and hybridization variability within the experiment.
  • Control feature may be cDNA for genes from the plant, Arabidopsis thaliana, that are included when spotting the mini-array. Equal amounts of RNA complementary to control cDNAs are added to each of the samples before they were labeled. Using the signal from these control genes, a normalization constant (L) is determined according to the following formula:
  • BGSS is the signal for a specific feature
  • Nis the number of A. thaliana control features
  • K is the number of hybridizations
  • L ⁇ is the normalization constant for each individual hybridization.
  • the control feature means for all Cy3 hybridizations are averaged, and the confrol feature mean in one hybridization divided by the average of all hybridizations to generate a normalization constant for that particular Cy3 hybridization (Lj), which is used as a in equation (0.3).
  • Lj Cy3 hybridization
  • the same normalization steps may be performed for Cy3 and Cy5 values.
  • An alternative scaling method can also be used.
  • the log of the ratio of Green/Red is determined for all features.
  • the median log ratio value for all features is determined.
  • the average ratio of Cy3 BGSS / Cy5 BGSS is determined for all features on an array. This ratio is then scaled to some arbitrary number, such as 1 or some other number. The ratio for each probe is then multiplied by the scaling factor required to bring the average ratio to the chosen level. This is performed for each array in an analysis. Alternatively, the ratios are normalized to the average ratio across all arrays in an analysis.
  • these repeats can be used to derive an average expression value for each gene. If some of the replicate features are of poor qualitay and don't meet requirements for analysis, the remaining features can be used to represent the gene or gene sequence.
  • Correlation analysis is performed to determine which array probes have expression behavior that best distinguishes or serves as markers for relevant groups of samples representing a particular clinical condition. Correlation analysis, or comparison among samples representing different disease criteria (e.g., clinical conditions), is performed using standard statistical methods. Numerous algorithms are useful for correlation analysis of expression data, and the selection of algorithms depends in part on the data analysis to be performed. For example, algorithms can be used to identify the single most informative gene with expression behavior that reliably classifies samples, or to identify all the genes useful to classify samples. Alternatively, algorithms can be applied that determine which set of 2 or more genes have collective expression behavior that accurately classifies samples. The use of multiple expression markers for diagnostics may overcome the variability in expression of a gene between individuals, or overcome the variability intrinsic to the assay.
  • Multiple expression markers may include redundant markers (surrogates), in that two or more genes or probes may provide the same information with respect to diagnosis. This may occur, for example, when two or more genes or gene probes are coordinately expressed. For diagnostic application, it may be appropriate to utilize a gene and one or more of its surrogates in the assay. This redundancy may overcome failures (technical or biological) of a single marker to distinguish samples. Alternatively, one or more surrogates may have properties that make them more suitable for assay development, such as a higher baseline level of expression, better cell specificity, a higher fold change between sample groups or more specific sequence for the design of PCR primers or complimentary probes.
  • expression profile data may be formatted or prepared for analysis using methods known in the art. For example, often the log ratio of scaled expression data for every array probe is calculated using the following formula: log (Cy 3 BGSS/ Cy5 BGSS), where Cy 3 signal corresponds to the expression of the gene in the clinical sample, and Cy5 signal corresponds to expression of the gene in the reference RNA.
  • Data may be further filtered depending on the specific analysis to be done as noted below. For example, filtering may be aimed at selecting only samples with expression above a certain level, or probes with variability above a certain level between sample sets.
  • t-test and ANOVA are used to identify single genes with expression differences between or among populations, respectively.
  • Multivariate methods are used to identify a set of two or more genes for which expression discriminates between two disease states more specifically than expression of any single gene.
  • the simplest measure of a difference between two groups is the Student's t test. See, e.g., Welsh et al. (2001) Proc Natl Acad Sci USA 98:1176-81 (demonstrating the use of an unpaired Student's t-test for the discovery of differential gene expression in ovarian cancer samples and control tissue samples).
  • the t- test assumes equal variance and normally distributed data. This test identifies the probability that there is a difference in expression of a single gene between two groups of samples. The number of samples within each group that is required to achieve statistical significance is dependent upon the variation among the samples within each group.
  • the standard formula for a t-test is:
  • e is the difference between the mean expression level of gene i in groups c and t
  • S ⁇ C is the variance of gene x in group c and is the variance of gene x in group t
  • n c and n t are the numbers of samples in groups c and t.
  • the combination of the t statistic and the degrees of freedom [min(nallow ⁇ c )-l ] provides a p value, the probability of rejecting the null hypothesis.
  • a correction factor When performing tests on a large scale, for example, on a large dataset of about 8000 genes, a correction factor must be included to adjust for the number of individual tests being performed.
  • the most common and simplest correction is the Bonferroni correction for multiple tests, which divides the p-value by the number of tests run. Using this test on an 8000 member dataset indicates that a p value of ⁇ 0.00000125 is required to identify genes that are likely to be truly different between the two test conditions.
  • SAM Significance analysis for microarrays
  • FDR False Discovery Rate
  • Wilcoxon's signed ranks method is one example of a non-parametric test and is utilized for paired comparisons. See e.g., Sokal and Rohlf (1987) Introduction to Biostatistics 2 nd edition, WH Freeman, New York. At least 6 pairs are necessary to apply this statistic. This test is useful for analysis of paired expression data (for example, a set of patients who have had samples taken before and after administration of a pharmacologic agent). The Fisher Exact Test with a threshold and the Mann-Whitney Test are other non-parametric tests that may be used
  • ANOVA Analysis of Variance
  • a set of two or more genes for which expression discriminates between two disease states more specifically than expression of any single gene is identified by searching through the possible combinations of genes using a criterion for discrimination, for example the expression of gene X must increase from normal 300 percent, while the expression of genes Y and Z must decrease from normal by 75 percent.
  • a criterion for discrimination for example the expression of gene X must increase from normal 300 percent, while the expression of genes Y and Z must decrease from normal by 75 percent.
  • the search starts with a single gene, then adds the next best fit at each step of the search.
  • the search starts with all of the genes and genes that do not aid in the discrimination are eliminated step-wise.
  • Paired samples or samples collected at different time-points from the same patient, are often useful, as described above.
  • use of paired samples permits the reduction of variation due to genetic variation among individuals.
  • use of paired samples has a statistical significance in that data derived from paired samples can be calculated in a different manner that recognizes the reduced variability.
  • the formula for a t-test for paired samples is:
  • D is the difference between each set of paired samples and b is the number of sample pairs.
  • D is the mean of the differences between the members of the pairs. In this test, only the differences between the paired samples are considered, then grouped together (as opposed to taking all possible differences between groups, as would be the case with an ordinary t-test). Additional statistical tests useful with paired data, e.g., ANOVA and Wilcoxon's signed rank test, are discussed above. Diagnostic classification
  • the diagnostic classifier (a mathematical function that assigns samples to diagnostic categories based on expression data) is applied to unknown sample expression levels.
  • CLEAVER is an algorithm used for classification of useful expression profile data. See Raychaudhuri et al. (2001) Trends Biotechnol 19:189-193. CLEAVER uses positive training samples (e.g., expression profiles from samples known to be derived from a particular patient or sample diagnostic category, disease or disease criteria), negative training samples (e.g., expression profiles from samples known not to be derived from a particular patient or sample diagnostic category, disease or disease criteria) and test samples (e.g., expression profiles obtained from a patient), and determines whether the test sample correlates with the particular disease or disease criteria, or does not correlate with a particular disease or disease criteria. CLEAVER also generates a list of the 20 most predictive genes for classification.
  • positive training samples e.g., expression profiles from samples known to be derived from a particular patient or sample diagnostic category, disease or disease criteria
  • negative training samples e.g., expression profiles from samples known not to be derived from a particular patient or sample diagnostic category, disease or disease criteria
  • test samples
  • ANN Artificial neural networks
  • ANN Artificial neural networks
  • the use of artificial neural networks for discovery of gene expression diagnostics for cancers using expression data generated by oligonucleotide expression microarrays is demonsfrated by Khan et al. (2001) Nature Med. 7:673-9. Khan found that 96 genes provided 0% error rate in classification of the tumors. The most important of these genes for classification was then determined by measuring the sensitivity of the classification to a change in expression of each gene. Hierarchical clustering using the 96 genes results in correct grouping of the cancers into diagnostic categories.
  • Golub uses cDNA microarrays and a distinction calculation to identify genes with expression behavior that distinguishes myeloid and lymphoid leukemias. See Golub et al. (1999) Science 286:531-7. Self organizing maps were used for new class discovery. Cross validation was done with a "leave one out” analysis. 50 genes were identified as useful markers. Tins was reduced to as few as 10 genes with equivalent diagnostic accuracy.
  • Hierarchical and non-hierarchical clustering methods are also useful for identifying groups of genes that correlate with a subset of clinical samples such as those with and without Lupus.
  • Alizadeh used hierarchical clustering as die primary tool to distinguish different types of diffuse B-cell lymphomas based on gene expression profile data. See Alizadeh et al. (2000) Nature 403:503-11.
  • Alizadeh used hierarchical clustering as the primary tool to distinguish different types of diffuse B-cell lymphomas based on gene expression profile data. A cDNA array carrying 17856 probes was used for these experiments, 96 samples were assessed on 128 arrays, and a set of 380 genes was identified as being useful for sample classification.
  • Hastie describes the use of gene shaving for discovery of expression markers. Hastie et al. (2000) Genome Biol. 1(2):RESEARCH 0003.1-0003.21.
  • the gene shaving algorithm identifies sets of genes with similar or coherent expression patterns, but large variation across conditions (RNA samples, sample classes, patient classes). In this manner, genes with a tight expression pattern within a diagnostic group, but also with high variability across the diagnoses are grouped together.
  • the algorithm takes advantage of both characteristics in one grouping step. For example, gene shaving can identify useful marker genes with co-regulated expression. Sets of useful marker genes can be reduced to a smaller set, with each gene providing some non-redundant value in classification. This algorithm was used on the data set described in Alizadeh et al., supra, and the set of 380 informative gene markers was reduced to 234.
  • Supervised harvesting of expression trees identifies genes or clusters that best distinguish one class from all the others on the data set.
  • the method is used to identify the genes/clusters that can best separate one class versus all the others for datasets that include two or more classes or all classes from each other. This algorithm can be used for discovery or testing of a diagnostic gene set.
  • CART is a decision tree classification algorithm (Breiman 1984). From gene expression and or other data, CART can develop a decision tree for the classification of samples. Each node on the decision tree involves a query about the expression level of one or more genes or variables. Samples that are above the threshold go down one branch of the decision free and samples that are not go down the other branch. See examples 10 and 16 for further description of its use in classification analysis and examples of its usefulness in discovering and implementing a diagnostic gene set. CART identifies surrogates for each splitter (genes that are the next best substitute for a useful gene in classification.
  • MART Multiple Additive Regression Trees
  • CART CART
  • MART Multiple Additive Regression Trees
  • MART builds numerous trees for any classification problem and the resulting model involves a combination of die multiple trees.
  • MART can select variables as it build models and thus can be used on large data sets, such as those derived from an 8000 gene microarray. Because MART uses a combination of many trees and does not take too much information from any one tree, it resists over training.
  • MART identifies a set of genes and an algorithm for their use as a classifier.
  • a Nearest Shrunken Centroids Classifier can be applied to microarray or other data sets by the methods described by Tibshirani et al. 2002.
  • This algorithms also identified gene sets for classification and determines their 10 fold cross validation error rates for each class of samples.
  • the algorithm determines the error rates for models of any size, from one gene to all genes in the set. The error rates for either or both sample classes can are minimized when a particular number of genes are used. When this gene number is determined, the algorithm associated with the selected genes can be identified and employed as a classifier on prospective sample.
  • cross validation is done. There are many approaches, including a 10 fold cross validation analysis in which 10% of the training samples are left out of the analysis and the classification algorithm is built with the remaining 90%. The 10% are then used as a test set for the algorithm. The process is repeated 10 times with 10% of the samples being left out as a test set each time. Through this analysis, one can derive a cross validation error which helps estimate the robustness of the algorithm for use on prospective (test) samples.
  • Clinical data are gathered for every patient sample used for expression analysis.
  • Clinical variables can be quantitative or non-quantitative.
  • a clinical variable that is quantitiative can be used as a variable for significance or classification analysis.
  • Non-quantitative clinical variables such as the sex of the patient, can also be used in a significance analysis or classification analysis with some statistical tool. It is appreciated that the most useful diagnostic gene set for a condition may be optimal when considered along with one or more predictive clinical variables.
  • Clinical data can also be used as supervising vectors for a correlation analysis. That is to say that the clinical data associated with each sample can be used to divide the samples into meaningful diagnostic categories for analysis. For example, samples can be divided into 2 or more groups based on the presence or absence of some diagnostic criterion (a).
  • clinical data can be utilized to select patients for a correlation analysis or to exclude them based on some undesirable characteristic, such as an ongoing infection, a medicine or some other issue.
  • Clincial data can also be used to assess the pre-test probability of an outcome. For example, patients who are female are much more likely to be diagnosed as having systemic lupus erythematosis than patients who are male.
  • the predictive value of the probe set is validated.
  • the diagnostic probe set is discovered by microarray based expression analysis, the differential expression of the member genes may be validated by a less variable and more quantitive and accurate technology such as real time PCR.
  • the amplification product is measured during the PCR reaction. This enables the researcher to observe the amplification before any reagent becomes rate limiting for amplification.
  • kinetic PCR the measurement is of C ⁇ (threshold cycle) or C P (crossing point).
  • the threshold is set to a point within the area where all of the reactions were in their linear phase of amplification.
  • the Sybr Green method is sensitive to non-specific amplification products, increasing the importance of primer design and selection.
  • Other detection chemistries can also been used, such as ethedium bromide or other DNA-binding dyes and many modifications of the fluorescent dye/quencher dye Taqman chemistry, for example scorpions.
  • Real-time PCR validation can be done as described in Example 8.
  • the oligonucleotide sequence of each probe is confirmed, e.g. by DNA sequencing using an oligonucleotide-specific primer. Partial sequence obtained is generally sufficient to confirm the identity of the oligonucleotide probe.
  • a complementary polynucleotide is fluorescently labeled and hybridized to the array, or to a different array containing a resynthesized version of the oligo nucleotide probe, and detection of the correct probe is confirmed.
  • validation is performed by statistically evaluating the accuracy of the correspondence between the molecular signature for a diagnostic probe set and a selected indicator.
  • the expression differential for a nucleotide sequence between two subject classes can be expressed as a simple ratio of relative expression.
  • the expression of the nucleotide sequence in subjects with selected indicator can be compared to the expression of that nucleotide sequence in subjects without the indicator, as described in the following equations.
  • E X A the average expression of nucleotide sequence x in the members of group A;
  • E x bi/M E X B the average expression of nucleotide sequence x in the members of group B;
  • E X A/ ExB ⁇ E X AB the average differential expression of nucleotide sequence x between groups A and B: where ⁇ indicates a sum; Ex is the expression of nucleotide sequence x relative to a standard; ai are the individual members of group A, group A has N members; bi are the individual members of group B, group B has M members.
  • Individual components of a diagnostic probe set each have a defined sensitivity and specificity for distinguishing between subject groups. Such individual nucleotide sequences can be employed in concert as a diagnostic probe set to increase the sensitivity and specificity of the evaluation.
  • the database of molecular signatures is queried by algorithms to identify the set of nucleotide sequences (i.e., corresponding to members of the probe set) with the highest average differential expression between subject groups.
  • the predictive value that is, the sensitivity and specificity of the probe set.
  • the probe sets may be used for diagnosis and patient monitoring as discussed below.
  • the diagnostic sensitivity and specificity of the probe sets for the defined use can be determined for a given probe set with specified expression levels as demonsfrated above. By altering the expression threshold required for the use of each nucleotide sequence as a diagnostic, the sensitivity and specificity of the probe set can be altered by the practitioner.
  • sensitivity and specificity are inversely related and the predictive accuracy of the probe set is continuous and dependent on the expression threshold set for each nucleotide sequence.
  • sensitivity and specificity tend to have an inverse relationship when expression thresholds are altered, both parameters can be increased as nucleotide sequences with predictive value are added to the diagnostic nucleotide set.
  • a single or a few markers may not be reliable expression markers across a population of patients. This is because of the variability in expression and measurement of expression that exists between measurements, individuals and individuals over time.
  • a large number of candidate nucleotide sequences or large numbers of nucleotide sequences in a diagnostic nucleotide set allows for this variability as not all nucleotide sequences need to meet a threshold for diagnosis.
  • more markers are better than a single marker. If many markers are used to make a diagnosis, the likelihood that all expression markers will not meet some thresholds based upon random variability is low and thus the test will give fewer false negatives.
  • Surrogate markers are useful for these purposes. These are markers or genes that are coordinately expressed. Surrogate markers essential provide redundant infomation, but this redundancy can improve accuracy by decreasing errors due to assay variability.
  • the desired diagnostic sensitivity and specificity of the diagnostic nucleotide set may vary depending on the intended use of the set. For example, in certain uses, high specificity and high sensitivity are desired. For example, a diagnostic nucleotide set for predicting which patient population may experience side effects may require high sensitivity so as to avoid treating such patients. In other settings, high sensitivity is desired, while reduced specificity may be tolerated. For example, in the case of a beneficial freatment with few side effects, it may be important to identify as many patients as possible (high sensitivity) who will respond to the drug, and treatment of some patients who will not respond is tolerated. In other settings, high specificity is desired and reduced sensitivity may be tolerated.
  • Leukocyte gene expression can be used to monitor the immune system. Immune monitoring examines both the level of gene expression for a set of genes in a given cell type and for genes which are expressed in a cell type selective manner gene expression monitoring will also detect the presence or absence of new cell types, progenitor cells, differentiation of cells and the like. Gene expression patterns may be associated with activation or the resting state of cells of the immune system that are responsible for or responsive to a disease state. For example, in the process of lupus and other autoimmune diseases, cells of the immune system are activated by self-antigens. Genes and gene sets that monitor and diagnose this process are providing a measure of the level and type of activation of the immune system.
  • Genes and gene sets that are useful in monitoring the immune system may be useful for diagnosis and monitoring of all diseases that involve the immune system. Some examples are rheumatoid arthritis, lupus, inflammatory bowel diseases, multiple sclerosis, HIV/ AIDS, and viral, bacterial and fungal infection. All disorders and diseases disclosed herein are contemplated. Genes and gene sets that monitor immune activation are useful for momtoring response to immunosuppressive drag therapy, which is used to decrease immune activation. Genes are found to correlate with immune activation by correlation of expression patterns to the known presence of immune activation or quiescence in a sample as determined by some other test.
  • individual oligonucleotides and diagnostic oligonucleotide sets of die invention may be developed and applied to essentially any disease, or disease criterion, as long as at least one subset of oligonucleotide sequences is differentially expressed in samples derived from one or more individuals with a disease criteria or disease and one or more individuals without the disease criteria or disease, wherein the individual may be the same individual sampled at different points in time, or the individuals may be different individuals (or populations of individuals).
  • the subset of oligonucleotide sequences may be differentially expressed in the sampled tissues of subjects with the disease or disease criterion (e.g., a patient with a disease or disease criteria) as compared to subjects without the disease or disease criterion (e.g., patients without a disease (confrol patients)).
  • the subset of oligonucleotide sequence(s) may be differentially expressed in different samples taken from the same patient, e.g at different points in time, at different disease stages, before and after a freatment, in the presence or absence of a risk factor, etc.
  • Expression profiles corresponding to oligonucleotides and sets of oligonucleotide sequences that correlate not with a diagnosis, but rather with a particular aspect of a disease can also be used to identify the diagnostic oligonucleotide sets and disease specific target oligonucleotide sequences of the invention.
  • an aspect, or disease criterion can relate to a subject's medical or family history, e.g., occurance of an autoimmune disease, childhood illness, cause of death of a parent or other relative, prior surgery or other intervention, medications, laboratory values and results of diagnostic testing (radiology, pathology, etc.), symptoms (including onset and/or duration of symptoms), etc.
  • the disease criterion can relate to a diagnosis, e.g., chronic inflammatory disease such as lupus, rheumatoid arthritis, osteoarthritis, or prognosis (e.g., prediction of future diagnoses, events or complications), e.g., renal failure from lupus, joint replacement surgery for rheumatoid arthritis, rheumatoid arthritis or systemic lupus erythematosis disease activity or the like.
  • the disease criterion corresponds to a therapeutic outcome, e.g., response to a medication, response to a surgery or physical therapy for a joint.
  • the disease criteria correspond with previously identified or classic risk factors and may correspond to prognosis or future disease diagnosis.
  • a disease criterion can also correspond to genotype for one or more loci.
  • Disease criteria including patient data
  • Longitudinal data i.e., data collected at different time points from an individual (or group of individuals) may be used for comparisons of samples obtained from an individual (group of individuals) at different points in time, to permit identification of differences specifically related to the disease state, and to obtain information relating to the change in expression over time, including a rate of change or trajectory of expression over time.
  • the usefulness of longitudinal data is further discussed in the section titled "Identification of diagnostic nucleotide sets of the invention".
  • diagnostic oligonucleotides and oligonucleotide sets may be developed for use in diagnosing conditions for which there is no present means of diagnosis. For example, in rheumatoid arthritis, joint destruction is often well under way before a patient experience symptoms of the condition.
  • a diagnostic nucleotide or nucleotide set may be developed that diagnoses rheumatic joint destruction at an earlier stage than would be possible using present means of diagnosis, which rely in part on the presentation of symptoms by a patient. Diagnostic nucleotide sets may also be developed to replace or augment current diagnostic procedures. For example, the use of a diagnostic nucleotide or nucleotide set to diagnose lupus may replace or supplement the current diagnostic tests and strategies. '
  • SLE Systemic Lupus Erythematosis
  • SLE is a chronic, systemic inflammatory disease characterized by dysregulation of the immune system, which effects up to 2 million patients in the US. Symptoms of SLE include rashes, joint pain, abnormal blood counts, renal dysfunction and damage, infections, CNS disorders, arthralgias and autoimmunity. Patients may also have early onset atherosclerosis. The diagnosis of SLE is difficult to make with certainty using current diagnostic tests and algorithms. Antibody tests can be specific for the disease, but often lack sensitivity. Clinical diagnosis may lack both high sensisivity and specificity. SLE is a disease that clearly involves differential gene expression in leukocytes compared to patients without the disease.
  • Diagnostic oligonucleotides and oligonucleotide sets are identified and validated for use in diagnosis and monitoring of SLE activity and progression.
  • Disease criteria correspond to clinical data, e.g. symptom rash, joint pain, malaise, rashes, blood counts (white and red), tests of renal function e.g.
  • RA Rheumatoid arthritis
  • Diagnostic oligonucleotides and oligonucleotide sets of the invention are developed and validated for use in diagnosis and freatment of RA.
  • Disease criteria correspond to disease symptoms (e.g., joint pain, joint swelling and joint stiffness and any of the American College for Rheumatology criteria for the diagnosis of RA, see Arnett et al (1988) Arthr. Rheum. 31:315-24), progression of joint destruction (e.g.
  • disease criteria correspond to response to drug therapy and presence or absence of side- effects or measures of improvement exemplified by the American College of Rheumatology "20%” and "50%” response/improvement rates. See Felson et al (1995) Arthr Rheum 38:531-37. Diagnostic nucleotide sets are identified that monitor and predict disease progression including flaring (acute worsening of disease accompanied by joint pain or other symptoms), response to drug treatment and likelihood of side-effects.
  • peripheral leukocytes surgical specimens of rheumatoid joints can be used for leukocyte expression profiling experiments.
  • Members of diagnostic nucleotide sets are candidates for leukocyte target nucleotide sequences, e.g. as a candidate drug target for rheumatoid arthritis.
  • Synovial specimens can be used for expression profiling or cells derived and sorted from that tissue (such as subsets of leukocytes) can be used. Cells can be separated by fluorescence activated cell sorting or magnetic affinity reagent techniques or some other technique. Synovial specimens and blood can be obtained from the same patient and gene expression can be compared between these 2 sample types. Osteoarthritis
  • Leukocyte infiltration 20-40 million patients in the US have osteoarthritis.
  • Leukocyte diagnostics can be used to distinguish osteoarihritis from rheumatoid arthritis and other diffemtial diagnoses, define likelihood and degree of response to NSAID therapy (non-steroidal anti-inflammatory drugs) or other anti-inflammatory therapies. Rate of progression of joint damage can also be assessed. Diagnostic nucleotide sets may be developed for use in selection and titration of treatment therapies. Disease criteria correspond to response to therapy, and disease progression using certain therapies, response to medications, need for joint surgery, joint pain and disability.
  • surgical specimens of osteoarthritic joints can be used for leukocyte expression profiling experiments.
  • Diagnostic oligonucleotides and diagnostic oligonucleotide sets are candidates for leukocyte target nucleotide sequences, e.g. as a candidate drug target for osteoarthritis.
  • Synovial specimens can be used for expression profiling or cells derived and sorted from that tissue (such as subsets of leukocytes) can be used. Cells can be separated by fluorescence activated cell sorting or magnetic affinity reagent techniques or some other technique.
  • Synovial specimens and blood can be obtained from the same patient and gene expression can be compared between these 2 sample types.
  • diagnostic nucleotide sets are developed and validated for use in diagnosis and therapy of peri-prosthetic osteolysis.
  • a prosthetic joint such as a knee or hip is found to loosen over time and requires repeat surgery. Loosening may occur in some patients due to an inflammatory response incited by the foreign material of the prosthesis.
  • Disease criteria include joint loosening, radiographic evidence of peri-prosthetic osteolysis, need for repeat surgery, response to pharmacological therapy, and/or histological (from biopsy or surgery) or biochemical (markers of bone metabolism such as alkaline phosphatase) evidence of osteolysis.
  • Tissues used for expression profiling can include peripheral leukocytes or leukocyte subsets, periprosthetic tissue, or synovial fluid.
  • gene sets can be discovered using an in vz ' fr-omodel of the disease in which immune cells are exposed to prostiiesis materials such as cement or titanium.
  • Pharmocogenomics is the study of the individual propensity to respond to a particular drug therapy (combination of therapies).
  • response can mean whether a particular drag will work on a particular patient, e.g. some patients respond to one drag but not to another drug.
  • One example of this would be prediction of a patient's response to drugs that target IFNs.
  • Response can also refer to the likelihood of successful freatment or the assessment of progress in freatment.
  • Tifration of drag therapy to a particular patient is also included in this description, e.g. different patients can respond to different doses of a given medication. This aspect may be important when drugs with side- effects or interactions with other drag therapies are contemplated.
  • Diagnostic oligonucleotides and oligonucleotide sets are developed and validated for use in assessing whether a patient will respond to a particular therapy and/or monitoring response of a patient to drag tiierapy (therapies).
  • Disease criteria correspond to presence or absence of clinical symptoms or clinical endpoints, presence of side-effects or interaction with other drug(s).
  • the diagnostic nucleotide set may further comprise nucleotide sequences that are targets of drag treatment or markers of active disease.
  • Diagnostic oligonucleotides and oligonucleotide sets are developed and validated for use in assessing whether a patient has a particular drug toxicity or toxicity due to an environmental, work- related or other agent. Such exposures of the patient may also be related to biological or biochemical agents used in warfare. Diagnostic oligonucleotides and oligonucleotide sets may allow early diagnosis of a toxicity or exposure or may monitor the severity and course of toxic responses.
  • the invention also provide methods of using the diagnostic oligonucleotides and oligonucleotide sets to: diagnose or monitor disease; assess severity of disease; predict future occurrence of disease; predict future complications of disease; determine disease prognosis; evaluate the patient's risk, or "stratify" a group of patients; assess response to current drag therapy; assess response to current non-pharmacological therapy; determine the most appropriate medication or treatment for the patient; predict whether a patient is likely to respond to a particular drug; and determine most appropriate additional diagnostic testing for die patient, among other clinically and epidemiologically relevant applications.
  • oligonucleotides and oligonucleotide sets of the invention can be utilized for a variety of purposes by physicians, healthcare workers, hospitals, laboratories, patients, companies and other institutions.
  • essentially any disease, condition, or status for which at least one nucleotide sequence is differentially expressed in leukocyte populations (or sub-populations) can be evaluated, e.g., diagnosed, monitored, etc. using the diagnostic nucleotide sets and methods of the invention.
  • die diagnostic nucleotide sets of the present invention are suitable for evaluating subjects at a "population level," e.g., for epidemiological studies, or for population screening for a condition or disease. Collection and preparation of sample
  • RNA, protein and or DNA are prepared using methods well-known in the art, as further described herein. It is appreciated that subject samples collected for use in the methods of the invention are generally collected in a clinical setting, where delays may be introduced before RNA samples are prepared from the subject samples of whole blood, e.g. the blood sample may not be promptly delivered to the clinical lab for further processing. Further delay may be introduced in the clinical lab setting where multiple samples are generally being processed at any given time. For this reason, methods that feature lengthy incubations of intact leukocytes at room temperature are not preferred, because the expression profile of the leukocytes may change during this extended time period.
  • RNA can be isolated from whole blood using a phenol/guanidine isothiocyanate reagent or another direct whole-blood lysis method, as described in, e.g., U.S. Patent Nos. 5,346,994 and 4,843,155.
  • This method may be less preferred under certain circumstances because the large majority of the RNA recovered from whole blood RNA extraction comes from erythrocytes since these cells outnumber leukocytes 1000: 1. Care must be taken to ensure that the presence of erythrocyte RNA and protein does not infroduce bias in the RNA expression profile data or lead to inadequate sensitivity or specificity of probes.
  • intact leukocytes may be collected from whole blood using a lysis buffer that selectively lyses erythrocytes, but not leukocytes, as described, e.g., in (U.S. Patent Nos. 5,973,137, and 6,020,186). Intact leukocytes are then collected by centrifugation, and leukocyte RNA is isolated using standard protocols, as described herein.
  • this method does not allow isolation of sub- populations of leukocytes, e.g. mononuclear cells, which may be desired.
  • the expression profile may change during the lengthy incubation in lysis buffer, especially in a busy clinical lab where large numbers of samples are being prepared at any given time.
  • specific leukocyte cell types can be separated using density gradient reagents (Boyum, A, 1968.).
  • mononuclear cells may be separated from whole blood using density gradient centrifugation, as described, e.g., in U.S. Patents Nos. 4190535, 4350593, 4751001, 4818418, and 5053134. Blood is drawn directly into a tube containing an anticoagulant and a density reagent (such as Ficoll or Percoll). Centrifugation of this tube results in separation of blood into an erythrocyte and granulocyte layer, a mononuclear cell suspension, and a plasma layer.
  • a density reagent such as Ficoll or Percoll
  • the mononuclear cell layer is easily removed and the cells can be collected by centrifugation, lysed, and frozen. Frozen samples are stable until RNA can be isolated. Density centrifugation, however, must be conducted at room temperature, and if processing is unduly lengthy, such as in a busy clinical lab, the expression profile may change.
  • cells can be separated using fluorescence activated cell sorting (FACS) or some other technique, which divides cells into subsets based on gene or protein expression. This may be desirable to enrich the sample for cells of interest, but it may also introduce cell manipulations and time delays, which result in alteration of gene expression profiles (Cantor et al. 1975; Galbraith et al. 1999).
  • FACS fluorescence activated cell sorting
  • the quality and quantity of each clinical RNA sample is desirably checked before amplification and labeling for array hybridization, using methods known in the art. For example, one microliter of each sample may be analyzed on a Bioanalyzer (Agilent 2100 Palo Alto, CA. USA) using an RNA 6000 nano LabChip (Caliper, Mountain View, CA. USA). Degraded RNA is identified by the reduction of the 28S to 18S ribosomal RNA ratio and/or the presence of large quantities of RNA in the 25-100 nucleotide range.
  • RNA sample for use with a diagnostic oligonucleotide or oligonucleotide set may be produced from the same or a different cell population, sub-population and/or cell type as used to identify the diagnostic nucleotide set.
  • a diagnostic oligonucleotide or oligonucleotide set identified using RNA extracted from mononuclear cells may be suitable for analysis of RNA extracted from whole blood or mononuclear cells, depending on the particular characteristics of the members of the diagnostic nucleotide set.
  • diagnostic oligonucleotides or oligonucleotide sets must be tested and validated when used with RNA derived from a different cell population, sub-population or cell type than that used when obtaining the diagnostic gene set.
  • Factors such as the cell-specific gene expression of diagnostic nucleotide set members, redundancy of the information provided by members of the diagnostic nucleotide set, expression level of the member of the diagnostic nucleotide set, and cell-specific alteration of expression of a member of the diagnostic nucleotide set will contribute to the usefullness of a different RNA source than that used when identifying the members of the diagnostic nucleotide set. It is appreciated that it may be desirable to assay RNA derived from whole blood, obviating the need to isolate particular cell types from the blood.
  • RNA preparations suitable for expression profiling from a desired population of leukocytes poses certain technical challenges, including: the lack of capacity for rapid, high-throughput sample processing in the clinical setting, and the possibility that delay in processing (in a busy lab or in the clinical setting) may adversely affect RNA quality, e.g. by a permitting the expression profile of certain nucleotide sequences to shift. Also, use of toxic and expensive reagents, such as phenol, may be disfavored in the clinical setting due to the added expense associated with shipping and handling such reagents.
  • RNA isolation for leukocyte expression profiling would allow the isolation of monocyte and lymphocyte RNA in a timely manner, while preserving the expression profiles of the cells, and allowing inexpensive production of reproducible high-quality RNA samples. Accordingly, the invention provides a method of adding inhibitor(s) of RNA transcription and/or inhibitor(s) of protein synthesis, such that the expression profile is "frozen” and RNA degradation is reduced. A desired leukocyte population or sub-population is then isolated, and the sample may be frozen or lysed before further processing to extract the RNA.
  • Blood is drawn from subject population and exposed to ActinomycinD (to a final concentration of 10 ug/ml) to inhibit transcription, and cycloheximide (to a final concentration of 10 ug/ml) to inhibit protein synthesis.
  • the inhibitor(s) can be injected into the blood collection tube in liquid form as soon as the blood is drawn, or the tube can be manufactured to contain either lyophilized inhibitors or inhibitors that are in solution with the anticoagulant.
  • the blood sample can be stored at room temperature until the desired leukocyte population or sub-population is isolated, as described elsewhere.
  • RNA is isolated using standard methods, e.g., as described above, or a cell pellet or extract can be frozen until further processing of RNA is convenient.
  • the invention also provides a method of using a low-temperature density gradient for separation of a desired leukocyte sample.
  • the invention provides the combination of use of a low-temperature density gradient and the use of transcriptional and/or protein synthesis inhibitor(s).
  • a desired leukocyte population is separated using a density gradient solution for cell separation that maintains the required density and viscosity for cell separation at 0-4GC. Blood is drawn into a tube containing this solution and may be refrigerated before and during processing as the low temperatures slow cellular processes and minimize expression profile changes.
  • Leukocytes are separated, and RNA is isolated using standard methods. Alternately, a cell pellet or extract is frozen until further processing of RNA is convenient. Care must be taken to avoid rewarming the sample during further processing steps.
  • the invention provides a method of using low-temperature density gradient separation, combined with die use of actinomycin A and cyclohexamide, as described above. Assessing expression for diagnostics
  • Expression profiles for the oligonucleotides or the set of diagnostic oligonucleotide sequences in a subject sample can be evaluated by any technique that determines the expression of each component oligonucleotide sequence. Methods suitable for expression analysis are known in the art, and numerous examples are discussed in the Sections titled “Methods of obtaining expression data” and “high throughput expression Assays", above.
  • RNA expression profiles are most efficiently, and cost effectively, performed by analyzing RNA expression.
  • the proteins encoded by each component of the diagnostic nucleotide set are detected for diagnostic purposes by any technique capable of determining protein expression, e.g., as described above.
  • Expression profiles can be assessed in subject leukocyte sample using the same or different techniques as those used to identify and validate the diagnostic oligonucleotide or oligonucleotide set.
  • a diagnostic nucleotide set identified as a subset of sequences on a cDNA microarray can be utilized for diagnostic (or prognostic, or monitoring, etc.) purposes on the same array from which they were identified.
  • the diagnostic nucleotide sets for a given disease or condition can be organized onto a dedicated sub-array for the indicated purpose. It is important to note tiiat if diagnostic nucleotide sets are discovered using one technology, e.g. RNA expression profiling, but applied as a diagnostic using another technology, e.g. protein expression profiling, the nucleotide (or gene, or protein) sets must generally be validated for diagnostic purposes with the new technology. In addition, it is appreciated that diagnostic nucleotide sets that are developed for one use, e.g. to diagnose a particular disease, may later be found to be useful for a different application, e.g. to predict the likelihood that the particular disease will occur.
  • the diagnostic nucleotide set will need to be validated for use in the second circumstance.
  • the sequence of diagnostic nucleotide set members maybe amplified from RNA or cDNA using methods known in the art providing specific amplification of the nucleotide sequences.
  • Protein products of the nucleotide sequences of the invention may include proteins that represent functionally equivalent gene products.
  • Such an equivalent gene product may contain deletions, additions or substitutions of amino acid residues within the amino acid sequence encoded by the nucleotide sequences described, above, but which result in a silent change, tiius producing a functionally equivalent nucleotide sequence product.
  • Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved.
  • nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
  • “Functionally equivalent”, as utilized herein, refers to a protein capable of exhibiting a substantially similar in vivo activity as the endogenous gene products encoded by the nucleotides described herein.
  • the gene products may be produced by recombinant DNA technology using techniques well known in the art. Methods which are well known to those skilled in the art can be used to construct expression vectors containing novel nucleotide sequence protein coding sequences and appropriate transcriptional/franslational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques and in vivo recombination/genetic recombination. See, for example, the techniques described in Sambrook et al., 1989, supra, and Ausubel et al., 1989, supra.
  • RNA capable of encoding novel nucleotide sequence protein sequences may be chemically synthesized using, for example, synthesizers. See, for example, the techniques described in "Oligonucleotide Synthesis", 1984, Gait, M. J. ed., IRL Press, Oxford, which is incorporated by reference herein in its entirety.
  • host-expression vector systems may be utilized to express the nucleotide sequence coding sequences of the invention.
  • Such host-expression systems represent vehicles by which die coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, exhibit the protein encoded by the nucleotide sequence of the invention in situ.
  • These include but are not limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing nucleotide sequence protein coding sequences; yeast (e.g.
  • Saccharomyces, Pichia transformed with recombinant yeast expression vectors containing the nucleotide sequence protein coding sequences; insect cell systems infected with recombinant viras expression vectors (e.g., baculovirus) containing the nucleotide sequence protein coding sequences; plant cell systems infected with recombinant viras expression vectors (e.g., cauliflower mosaic viras, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing nucleotide sequence protein coding sequences; or mammalian cell systems (e.g.
  • COS COS, CHO, BHK, 293, 3T3 harboring recombinant expression constracts containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5 K promoter).
  • promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5 K promoter).
  • a number of expression vectors may be advantageously selected depending upon the use intended for the nucleotide sequence protein being expressed. For example, when a large quantity of such a protein is to be produced, for the generation of antibodies or to screen peptide libraries, for example, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable.
  • vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J.
  • nucleotide sequence protein coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced;
  • pIN vectors Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 264:5503;-5509); and the likes of pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S- transferase (GST).
  • fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
  • the pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target nucleotide sequence protein can be released from the GST moiety.
  • Other systems useful in the invention include use of the FLAG epitope or the 6-HIS systems.
  • Autographa califomica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign nucleotide sequences.
  • the viras grows in Spodoptera fragiperda cells.
  • the nucleotide sequence coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under confrol of an AcNPV promoter (for example the polyhedrin promoter).
  • Successful insertion of nucleotide sequence coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene).
  • a number of viral-based expression systems may be utilized.
  • the nucleotide sequence coding sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
  • This chimeric nucleotide sequence may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing nucleotide sequence encoded protein in infected hosts.
  • Specific initiation signals may also be required for efficient translation of inserted nucleotide sequence coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where an entire nucleotide sequence, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional franslational control signals may be needed. However, in cases where only a portion of the nucleotide sequence coding sequence is inserted, exogenous translational confrol signals, including, perhaps, the ATG initiation codon, must be provided.
  • initiation codon must be in phase with tire reading frame of the desired coding sequence to ensure translation of the entire insert.
  • exogenous franslational control signals and initiation codons can be of a variety of origins, both natural and synthetic.
  • the efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., 1987, Methods in Enzymol. 153:516-544;).
  • a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the product of the nucleotide sequence in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein.
  • Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
  • eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used.
  • mammalian host cells include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, etc.
  • cell lines which stably express the nucleotide sequence encoded protein may be engineered.
  • host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
  • appropriate expression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
  • engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
  • the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
  • This method may advantageously be used to engineer cell lines which express nucleotide sequence encoded protein. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that affect the endogenous activity of the nucleotide sequence encoded protein.
  • a number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11:223;), hypoxanthine-guanine phosphoribosylfransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026;), and adenine phosphoribosylfransferase (Lowy, et al., 1980, Cell 22:817;) genes can be employed in tk-, hgprt- or aprt- cells, respectively.
  • antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527;); gpt, which confers resistance to mycophenoHc acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072;); neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol.
  • hygro which confers resistance to hygromycin
  • An alternative fusion protein system allows for the ready purification of non-denatured fusion proteins expressed in human cell lines (Janknecht, et al., 1991, Proc. Natl. Acad. Sci. USA 88: 8972- 8976).
  • the nucleotide sequence of interest is subcloned into a vaccinia recombination plasmid such that the nucleotide sequence's open reading frame is franslationally fused to an amino- terminal tag consisting of six histidine residues.
  • Extracts from cells infected with recombinant vaccinia virus are loaded onto Ni.sup.2 +-nitriloacetic acid-agarose columns and histidine-tagged proteins are selectively eluted with imidazole-containing buffers.
  • Indirect labeling involves the use of a protein, such as a labeled antibody, which specifically binds to the protein encoded by the nucleotide sequence.
  • a protein such as a labeled antibody
  • Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by an Fab expression library.
  • the invention also provides for antibodies to the protein encoded by the nucleotide sequences. Described herein are methods for the production of antibodies capable of specifically recognizing one or more nucleotide sequence epitopes. Such antibodies may include, but are not limited to polyclonal antibodies, monoclonal antibodies (mAbs), humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab')2 fragments, fragments produced by a Fab expression library, anti-idiotypic (anti- Id) antibodies, and epitope-binding fragments of any of the above.
  • mAbs monoclonal antibodies
  • humanized or chimeric antibodies single chain antibodies
  • Fab fragments fragments
  • F(ab')2 fragments fragments produced by a Fab expression library
  • anti-idiotypic (anti- Id) antibodies fragments produced by a Fab expression library
  • epitope-binding fragments of any of the above.
  • Such antibodies may be used, for example, in the detection of a nucleotide sequence in a biological sample, or, alternatively, as a method for the inhibition of abnormal gene activity, for example, the inhibition of a disease target nucleotide sequence, as further described below.
  • Such antibodies may be utilized as part of cardiovascular or other disease treatment method, and/or may be used as part of diagnostic techniques whereby patients maybe tested for abnormal levels of nucleotide sequence encoded proteins, or for the presence of abnormal forms of the such proteins.
  • various host animals may be immunized by injection with a protein encoded by the nucleotide sequence, or a portion thereof.
  • host animals may include but are not limited to rabbits, mice, and rats, to name but a few.
  • adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
  • BCG Bacille Calmette-Guerin
  • Corynebacterium parvum bacille Calmette-Guerin
  • Polyclonal antibodies are heterogeneous populations of antibody molecules derived from the sera of animals immunized with an antigen, such as gene product, or an antigenic functional derivative thereof.
  • an antigen such as gene product, or an antigenic functional derivative thereof.
  • host animals such as those described above, may be immunized by injection with gene product supplemented with adjuvants as also described above.
  • Monoclonal antibodies, which are homogeneous populations of antibodies to a particular antigen may be obtained by any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to the hybridoma technique of Kohler and Milstein, (1975, Nature 256:495-497; and U.S. Pat. No.
  • Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof.
  • the hybridoma producing the mAb of this invention may be cultivated in vitro or in vivo.
  • a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region.
  • single chain antibodies can be adapted to produce nucleotide sequence-single chain antibodies.
  • Single chain antibodies are formed by linking the heavy and light chain fragments of die Fv region via an amino acid bridge, resulting in a single chain polypeptide.
  • Antibody fragments which recognize specific epitopes may be generated by known techniques
  • such fragments include but are not limited to: the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments.
  • Fab expression libraries may be constructed (Huse et al., 1989, Science, 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity.
  • the invention also provides disease specific target oligonucleotide sequences, and sets of disease specific target oligonucleotide sequences.
  • the diagnostic oligonucleotide sets, subsets thereof, novel oligonucleotide sequences, and individual members of the diagnostic oligonucleotide sets identified as described above are also disease specific target oligonucleotide sequences.
  • individual oligonucleotide sequences that are differentially regulated or have predictive value that is strongly correlated with a disease or disease criterion are especially favorable as disease specific target oligonucleotide sequences.
  • Sets of genes that are co-regulated may also be identified as disease specific target oligonucleotide sets.
  • Such oligonucleotide sequences and/or oligonucleotide sequence products are targets for modulation by a variety of agents and techniques.
  • disease specific target oligonucleotide sequences (or the products of such oligonucleotide sequences, or sets of disease specific target oligonucleotide sequences) can be inhibited or activated by, e.g., target specific monoclonal antibodies or small molecule inhibitors, or delivery of the oligonucleotide sequence or gene product of the oligonucleotide sequence to patients.
  • sets of genes can be inhibited or activated by a variety of agents and techniques.
  • the specific usefulness of the target oligonucleotide sequence(s) depends on the subject groups from which they were discovered, and tiie disease or disease criterion with which they correlate.
  • the invention also encompasses a method of identifying nucleotide sequences involved in leukocyte adhesion.
  • the interaction between the endothelial cell and leukocyte is a fundamental mechanism of all inflammatory disorders, including the diseases listed in Table 3.
  • the first visible abnormality in atherosclerosis is the adhesion to the endothelium and diapedesis of mononuclear cells (e.g., T-cell and monocyte).
  • mononuclear cells e.g., T-cell and monocyte.
  • Insults to the endothelium for example, cytokines, tobacco, diabetes, hypertension and many more
  • the endothelium then expresses adhesion molecules, which have counter receptors on mononuclear cells.
  • leukocyte receptors Once the leukocyte receptors have bound the endothelial adhesion molecules, they stick to the endothelium, roll a short distance, stop and transmigrate across the endothelium. A similar set of events occurs in both acute and chronic inflammation.
  • the leukocyte binds the endothelial adhesion molecule, or to soluble cytokines secreted by endothelial or other cells, a program of gene expression is activated in the leukocyte. This program of expression leads to leukocyte rolling, firm adhesion and transmigration into the vessel wall or tissue parenchyma. Inhibition of this process is highly desirable goal in anti- inflammatory drug development.
  • leukocyte nucleotide sequences and epithelial cell nucleotide sequences, that are differentially expressed during this process may be disease-specific target nucleotide sequences.
  • Human endothelial cells e.g. derived from human coronary arteries, human aorta, human pulmonary artery, human umbilical vein or microvascular endothelial cells, are cultured as a confluent monolayer, using standard methods. Some of the endothelial cells are then exposed to cytokines or another activating stimuli such as oxidized LDL, hyperglycemia, shear stress, or hypoxia (Moser et al. 1992). Some endothelial cells are not exposed to such stimuli and serve as controls.
  • the endothelial cell monolayer is incubated with culture medium containing 5 U/ml of human recombinant IL-1 alpha or 10 ng/ml TNF (tumor necrosis factor), for a period of minutes to overnight.
  • the culture medium composition is changed or the flask is sealed to induce hypoxia.
  • tissue culture plate is rotated to induce sheer stress.
  • Human T-cells and/or monocytes are cultured in tissue culture flasks or plates, with LGM-3 media from Clonetics. Cells are incubated at 37 degree C, 5% C02 and 95% humidity. These leukocytes are exposed to the activated or control endothelial layer by adding a suspension of leukocytes on to the endothelial cell monolayer. The endothelial cell monolayer is cultured on a tissue culture treated plate/ flask or on a microporous membrane.
  • the endothelial cells and leukocytes are harvested separately by treating all cells with trypsin and then sorting the endothelial cells from the leukocytes by magnetic affinity reagents to an endothelial cell specific marker such as PECAM-1 (Stem Cell Technologies).
  • RNA is exfracted from the isolated cells by standard techniques.
  • Leukocyte RNA is labeled as described above, and hybridized to leukocyte candidate nucleotide library.
  • Epithelial cell RNA is also labeled and hybridized to the leukocyte candidate nucleotide library.
  • the epithelial cell RNA is hybridized to a epithelial cell candidate nucleotide library, prepared according to the methods described for leukocyte candidate libraries, above.
  • Hybridization to candidate nucleotide libraries will reveal nucleotide sequences that are up- regulated or down-regulated in leukocyte and/or epithelial cells undergoing adhesion.
  • the differentially regulated nucleotide sequences are further characterized, e.g. by isolating and sequencing the full-length sequence, analysis of the DNA and predicted protein sequence, and functional characterization of the protein product of the nucleotide sequence, as described above. Further characterization may result in the identification of leukocyte adhesion specific target nucleotide sequences, which may be candidate targets for regulation of the inflammatory process.
  • Small molecule or antibody inhibitors can be developed to inhibit the target nucleotide sequence function. Such inhibitors are tested for their ability to inhibit leukocyte adhesion in the in vitro test described above.
  • Integrated systems for the collection and analysis of expression profiles, and molecular signatures, as well as for the compilation, storage and access of the databases of the invention typically include a digital computer with software including an instruction set for sequence searching and analysis, and, optionally, high-throughput liquid control software, image analysis software, data interpretation software, a robotic control armature for transferring solutions from a source to a destination (such as a detection device) operably linked to the digital computer, an input device (e.g., a computer keyboard) for entering subject data to the digital computer, or to control analysis operations or high throughput sample transfer by the robotic control armature.
  • a digital computer with software including an instruction set for sequence searching and analysis, and, optionally, high-throughput liquid control software, image analysis software, data interpretation software, a robotic control armature for transferring solutions from a source to a destination (such as a detection device) operably linked to the digital computer, an input device (e.g., a computer keyboard) for entering subject data to the digital computer, or to control analysis operations or
  • the integrated system further comprises an image scanner for digitizing label signals from labeled assay components, e.g., labeled nucleic acid hybridized to a candidate library microarray.
  • the image scanner can interface with image analysis software to provide a measurement of the presence or intensity of the hybridized label, i.e., indicative of an on/off expression pattern or an increase or decrease in expression.
  • standard desktop applications such as word processing software (e.g., Corel WordPerfectTM or Microsoft WordTM) and database software (e.g., spreadsheet software such as Corel Quattro ProTM, Microsoft ExcelTM, or database programs such as Microsoft AccessTM or ParadoxTM) can be adapted to the present invention by inputting one or more character sfring corresponding, e.g., to an expression pattern or profile, subject medical or historical data, molecular signature, or the like, into the software which is loaded into the memory of a digital system, and carrying out the operations indicated in an instruction set.
  • word processing software e.g., Corel WordPerfectTM or Microsoft WordTM
  • database software e.g., spreadsheet software such as Corel Quattro ProTM, Microsoft ExcelTM, or database programs such as Microsoft AccessTM or ParadoxTM
  • systems can include the foregoing software having the appropriate character string information, e.g., used in conjunction with a user interface in conjunction with a standard operating system such as a Windows, Macintosh or LINUX system.
  • a standard operating system such as a Windows, Macintosh or LINUX system.
  • an instruction set for manipulating strings of characters either by programming the required operations into the applications or with the required operations performed manually by a user (or both).
  • specialized sequence alignment programs such as PILEUP or BLAST can also be inco ⁇ orated into the systems of the invention, e.g., for alignment of nucleic acids or proteins (or corresponding character strings).
  • Software for performing the statistical methods required for the invention e.g., to determine correlations between expression profiles and subsets of members of the diagnostic nucleotide libraries, such as programmed embodiments of the statistical methods described above, are also included in the computer systems of the invention.
  • programming elements for performing such methods as principle component analysis (PCA) or least squares analysis can also be included in the digital system to identify relationships between data.
  • PCA principle component analysis
  • Exemplary software for such methods is provided by Partek, Inc., St. Peter, Mo; at the web site partek.com.
  • Any controller or computer optionally includes a monitor which can include, e.g., a flat panel display (e.g., active matrix liquid crystal display, liquid crystal display), a cathode ray tube (“CRT") display, or another display system which serves as a user interface, e.g., to output predictive data.
  • a monitor which can include, e.g., a flat panel display (e.g., active matrix liquid crystal display, liquid crystal display), a cathode ray tube (“CRT”) display, or another display system which serves as a user interface, e.g., to output predictive data.
  • Computer circuitry including numerous integrated circuit chips, such as a microprocessor, memory, interface circuits, and the like, is often placed in a casing or box which optionally also includes a hard disk drive, a floppy disk drive, a high capacity removable drive such as a writeable CD-ROM, and other common peripheral elements.
  • Inputting devices such as a keyboard, mouse, or touch sensitive screen, optionally provide for input from a user and for user selection, e.g., of sequences or data sets to be compared or otherwise manipulated in the relevant computer system.
  • the computer typically includes appropriate software for receiving user instructions, either in the form of user input into a set parameter or data fields (e.g., to input relevant subject data), or in the form of preprogrammed instructions, e.g., preprogrammed for a variety of different specific operations.
  • the software then converts these instructions to appropriate language for instructing the system to carry out any desired operation.
  • the integrated system may also be embodied within the circuitry of an application specific integrated circuit (ASIC) or programmable logic device (PLD).
  • ASIC application specific integrated circuit
  • PLD programmable logic device
  • the invention is embodied in a computer readable descriptor language that can be used to create an ASIC or PLD.
  • the integrated system can also be embodied within the circuitry or logic processors of a variety of other digital apparatus, such as PDAs, laptop computer systems, displays, image editing equipment, etc.
  • the digital system can comprise a learning component where expression profiles, and relevant subject data are compiled and monitored in conjunction with physical assays, and where correlations, e.g., molecular signatures with predictive value for a disease, are established or refined. Successful and unsuccessful combinations are optionally documented in a database to provide justification/preferences for user-base or digital system based selection of diagnostic nucleotide sets with high predictive accuracy for a specified disease or condition.
  • the integrated systems can also include an automated workstation.
  • a workstation can prepare and analyze leukocyte RNA samples by performing a sequence of events including: preparing RNA from a human blood sample; labeling the RNA with an isotopic or non- isotopic label; hybridizing the labeled RNA to at least one array comprising all or part of the candidate library; and detecting the hybridization pattern.
  • the hybridization pattern is digitized and recorded in the appropriate database.
  • the invention also includes an automated RNA preparation tool for the preparation of mononuclear cells from whole blood samples, and preparation of RNA from the mononuclear cells.
  • an automated RNA preparation tool for the preparation of mononuclear cells from whole blood samples, and preparation of RNA from the mononuclear cells.
  • the use of the RNA preparation tool is fully automated, so that the cell separation and RNA isolation would require no human manipulations. Full automation is advantageous because it minimizes delay, and standardizes sample preparation across different laboratories. This standardization increases the reproducibility of the results.
  • a primary component of the device is a cenfrifuge. Tubes of whole blood containing a density gradient solution, transcription/translation inhibitors, and a gel barrier that separates erythrocytes from mononuclear cells and serum after centrifugation are placed in the cenfrifuge.
  • the barrier is permeable to erythrocytes and granulocytes during centrifugation, but does not allow mononuclear cells to pass through (or the barrier substance has a density such that mononuclear cells remain above the level of tiie barrier during the centrifugation).
  • the erythrocytes and granulocytes are trapped beneath the barrier, facilitating isolation of the mononuclear cell and serum layers.
  • a mechanical arm removes the tube and inverts it to mix the mononuclear cell layer and the serum. The arm next pours the supernatant into a fresh tube, while the erythrocytes and granulocytes remained below the barrier. Alternatively, a needle is used to aspirate the supernatant and transfer it to a fresh tube.
  • the mechanical arms of the device opens and closes lids, dispenses PBS to aid in the collection of the mononuclear cells by centrifugation, and moves the tubes in and out of the centrifuge.
  • RNA isolation is performed using a column or filter method.
  • the invention includes an onboard homogenizer for use in cell lysis. Other automated systems
  • robotic devices for preparation of nucleic acids from bacterial colonies, e.g., to facilitate production and characterization of the candidate library include, for example, an automated colony picker (e.g., die Q-bot, Genetix, U.K.) capable of identifying, sampling, and inoculating up to 10,000/4 hrs different clones into 96 well microtiter dishes.
  • robotic systems for liquid handling are available from a variety of sources, e.g., automated workstations like the automated synthesis apparatus developed by Takeda Chemical Industries, LTD.
  • High throughput screening systems that automate entire procedures, e.g., sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for the relevant assay are commercially available, (see, e.g., Zymark Corp., Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman Instruments, Inc. FuUerton, CA; Precision Systems, Inc., Natick, MA, etc.). These configurable systems provide high throughput and rapid start up as well as a high degree of flexibility and customization. Similarly, arrays and array readers are available, e.g., from Affymeteix, PE Biosystems, and others.
  • Zymark Corp. provides technical bulletins describing screening systems for detecting the modulation of gene transcription, ligand binding, and the like.
  • peripheral equipment including, e.g., optical and fluorescent detectors, optical and fluorescent microscopes, plate readers, CCD arrays, phosphorimagers, scintillation counters, phototubes, photodiodes, and the like, and software is available for digitizing, storing and analyzing a digitized video or digitized optical or other assay results, e.g., using PC (Intel x86 or pentium chip- compatible DOSTM, OS2TM WINDOWSTM, WINDOWS NTTM or WINDOWS95TM based machines), MACINTOSHTM, or UNIX based (e.g., SUNTM work station) computers.
  • PC Intel x86 or pentium chip- compatible DOSTM
  • OS2TM WINDOWSTM, WINDOWS NTTM or WINDOWS95TM based machines e.g., MACINTOSHTM
  • UNIX based e.g., SUNTM work station
  • Embodiment in a web site Embodiment in a web site.
  • an array comprising a candidate nucleotide library, or diagnostic nucleotide set, is configured in proximity to a detector, which is, in turn, linked to a computational device equipped with user input and output features.
  • the methods can be implemented on a single computer with multiple processors or, alternatively, on multiple computers.
  • the computers can be linked, e.g. through a shared bus, but more commonly, the com ⁇ uter(s) are nodes on a network.
  • the network can be generalized or dedicated, at a local level or distributed over a wide geographic area.
  • the computers are components of an infra-net or an internet.
  • the predictive data corresponding to subject molecular signatures can be shared by a variety of parties.
  • information can be utilized by the subject, the subject's health care practitioner or provider, a company or other institution, or a scientist.
  • An individual subject's data, a subset of the database or the entire database recorded in a computer readable medium can be accessed directly by a user by any method of communication, including, but not limited to, the internet.
  • the database can access the recorded information.
  • access to the database can be controlled using unique alphanumeric passwords that provide access to a subset of the data.
  • Such provisions can be used, e.g., to ensure privacy, anonymity, etc.
  • a client executes a Web browser and is linked to a server computer executing a Web server.
  • the Web browser is, for example, a program such as IBM's Web Explorer, Internet explorer, NetScape or Mosaic, or the like.
  • the Web server is typically, but not necessarily, a program such as EBM's HTTP Daemon or other WWW daemon (e.g., LINUX-based forms of the program).
  • the client computer is bi-directionally coupled with the server computer over a line or via a wireless system.
  • the server computer is bi- directionally coupled with a website (server hosting the website) providing access to software implementing the methods of this invention.
  • a user of a client connected to the Intranet or Internet may cause the client to request resources that are part of the web site(s) hosting the application(s) providing an implementation of the methods described herein.
  • Server program(s) then process the request to return the specified resources (assuming they are currently available).
  • a standard naming convention has been adopted, known as a Uniform Resource Locator ("URL"). This convention encompasses several types of location names, presently including subclasses such as Hypertext Transport Protocol (“http"), File Transport Protocol (“ftp”), gopher, and Wide Area Information Service (“WAIS").
  • http Hypertext Transport Protocol
  • ftp File Transport Protocol
  • WAIS Wide Area Information Service
  • subjects can access the results of the expression analysis of their leukocyte samples and any accraed knowledge regarding the likelihood of the patient's belonging to any specified diagnostic (or prognostic, or momtoring, or risk group), i.e., their expression profiles, and/or molecular signatures.
  • subjects can add to the predictive accuracy of the database by providing additional information to the database regarding diagnoses, test results, clinical or otiier related events that have occurred since the time of the expression profiling.
  • Such information can be provided to the database via any form of communication, including, but not limited to, the internet.
  • Such data can be used to continually define (and redefine) diagnostic groups.
  • the 300 patients define a new "group A.”
  • a new diagnostic nucleotide set that differentiates groups A and B (i.e., with and without myocardial infarction within a five year period) is identified.
  • This newly defined nucleotide set is then be used (in the manner described above) as a test that predicts the occurrence of myocardial infarction over a five-year period. While submission directly by the patient is exemplified above, any individual with access and authority to submit the relevant data e.g., the patient's physician, a laboratory technician, a health care or study administrator, or the like, can do so.
  • transmission of information via the internet is optionally bi-directional. That is, for example, data regarding expression profiles, subject data, and the like are transmitted via a communication system to the database, while information regarding molecular signatures, predictive analysis, and the like, are transmitted from the database to the user.
  • a detector linked to a computational device can directly transmit (locally or from a remote workstation at great distance, e.g., hundreds or thousands of miles distant from the database) expression profiles and a corresponding individual identifier to a central database for analysis according to the methods of the invention.
  • the individual identifier is assigned to one or more diagnostic (or prognostic, or monitoring, etc.) categories.
  • the results of this classification are then relayed back, via, e.g., the same mode of communication, to a recipient at the same or different internet (or intranet) address.
  • kits contain one or more diagnostic nucleotide sets of the invention.
  • the kit contains the candidate nucleotide library of the invention.
  • the kit contains a diagnostic nucleotide probe set, or other subset of a candidate library, (e.g., as a cDNA, oligonucleotide or antibody microarray or reagents for performing an assay on a diagnostic gene set using any expression profiling technology), packaged in a suitable container.
  • the kit may further comprise, one or more additional reagents, e.g., substrates, labels, primers, for labeling expression products, tubes and/or other accessories, reagents for collecting blood samples, buffers, e.g., erythrocyte lysis buffer, leukocyte lysis buffer, hybridization chambers, cover slips, etc., as well as a software package, e.g., including the statistical methods of the invention, e.g., as described above, and a password and/or account number for accessing the compiled database.
  • the kit optionally further comprises an instruction set or user manual detailing preferred methods of using the diagnostic nucleotide sets in die methods of the invention.
  • the kit may include contents useful for the discovery of diagnostic nucleotide sets using microarrays.
  • the kit may include sterile, endotoxin and RNAse free blood collection tubes.
  • the kit may also include alcohol swabs, tourniquet, blood collection set, and/or PBS (phosphate buffer saline; needed when method of example 8 is used to derived mononuclear RNA).
  • the kit may also include cell lysis buffer.
  • the kit may include RNA isolation kit, substrates for labeling of RNA (may vary for various expression profiling techniques).
  • the kit may also include materials for fluorescence microarray expression profiling, including one or more of the following: reverse transcriptase and lOx RT buffer, T7(dT)24 primer (primer with T7 promoter at 5' end), DTT, deoxynucleotides, optionally lOOmM each, RNAse inhibitor, second strand cDNA buffer, DNA polymerase, Rnase H, T7 RNA polymerase ribonucleotides, in vitro transcription buffer, and/or Cy3 and Cy5 labeled ribonucleotides.
  • the kit may also include microarrays containing candidate gene libraries, cover slips for slides, and/or hybridization chambers.
  • the kit may further include software package for identification of diagnostic gene set from data, that contains statistical methods, and/or allows alteration in desired sensitivity and specificity of gene set.
  • the software may further facilitate access to and data analysis by centrally a located database server.
  • the software may further include a password and account number to access central database server.
  • the kit may include a kit user manual.
  • the kit may include contents useful for the application of diagnostic nucleotide sets using microarrays.
  • the kit may include sterile, endotoxin and/or RNAse free blood collection tubes.
  • the kit may also include, alcohol swabs, tourniquet, and/or a blood collection set.
  • the kit may further include PBS (phosphate buffer saline; needed when method of example 7 is used to derived mononuclear RNA), cell lysis buffer, and/or an RNA isolation kit.
  • the kit may include subsfrates for labeling of RNA (may vary for various expression profiling techniques).
  • components may include reverse transcriptase and lOx RT buffer, T7(dT)24 primer (primer with T7 promoter at 5' end), DTT, deoxynucleotides (optionally lOOmM each), RNAse inhibitor, second strand cDNA buffer, DNA polymerase, Rnase H, T7 RNA polymerase, ribonucleotides, in vitro transcription buffer, and/or Cy3 and Cy5 labeled ribonucleotides.
  • the kit may further include microarrays containing candidate gene libraries.
  • the kit may also include cover slips for slides, and/or hybridization chambers.
  • the kit may include a software package for identification of diagnostic gene set from data.
  • the software package may contain statistical methods, allow alteration in desired sensitivity and specificity of gene set, and/or facilitate access to and data analysis by centrally located database server.
  • the software package may include a password and account number to access central database server.
  • the kit may include a kit user manual.
  • the kit may include contents useful for the application of diagnostic nucleotide sets using real-time PCR.
  • This kit may include terile, endotoxin and/or RNAse free blood collection tubes.
  • the kit may further include alcohol swabs, tourniquet, and/or a blood collection set.
  • the kit may also include PBS (phosphate buffer saline; needed when method of example 7 is used to derived mononuclear RNA).
  • the kit may include cell lysis buffer and/or an RNA isolation kit.
  • the kit may laso include substrates for real time RT-PCR, which may vary for various real-time PCR techniques, including poly dT primers, random hexamer primers, reverse Transcriptase and RT buffer, DTT, deoxynucleotides 100 mM, RNase H, primer pairs for diagnostic and confrol gene set, lOx PCR reaction buffer, and/or Taq DNA polymerase.
  • the kit may also include fluorescent probes for diagnostic and control gene set (alternatively, fluorescent dye that binds to only double stranded DNA).
  • the kit may further include reaction tubes with or without barcode for sample tracking, 96-well plates with barcode for sample identification, one barcode for entire set, or individual barcode per reaction tube in plate.
  • the kit may also include a software package for identification of diagnostic gene set from data, and /or statistical methods.
  • the software package may allow alteration in desired sensitivity and specificity of gene set, and/or facilitate access to and data analysis by centrally located database server.
  • the kit may include a password and account number to access central database server.
  • the kit may include a kit user manual.
  • Example 1 Preparation of RNA from mononuclear cells for expression profiling
  • Example 3 Identification of diagnostic oligonucleotide sets for use in diagnosis of rheumatoid arthritis.
  • Example 4 Identification of diagnostic oligonucleotide sets for diagnosis of Systemic Lupus
  • Example 5 Design of oligonucleotide probes.
  • Example 6 Production of an array of 8,000 spotted 50 mer oligonucleotides.
  • Example 7 Amplification, labeling, and hybridization of total RNA to an oligonucleotide microarray
  • Example 11 Identification and validation of gene expression markers for diagnosis and monitoring of lupus and autoimmune diseases. Examples
  • Example 1 Preparation of RNA from mononuclear cells for expression profiling
  • Blood was drawn from either a standard peripheral venous blood draw or directly from a large-bore infra-arterial or intravenous catheter inserted in the femoral artery, femoral vein, subclavian vein or internal jugular vein. Care was taken to avoid sample contamination with heparin from the intravascular catheters, as heparin can interfere with subsequent RNA reactions.
  • a tube For each tube, 8 ml of whole blood was drawn into a tube (CPT, Becton-Dickinson order #362753) containing the anticoagulant Citrate, 25°C density gradient solution (e.g. Ficoll, Percoll) and a polyester gel barrier that upon centrifugation was permeable to RBCs and granulocytes but not to mononuclear cells.
  • the tube was inverted several times to mix the blood with the anticoagulant.
  • the tubes were centrifuged at 1750xg in a swing-out rotor at room temperature for 20 minutes. The tubes were removed from the centrifuge and inverted 5-10 times to mix the plasma with the mononuclear cells, while trapping the RBCs and the granulocytes beneath the gel barrier.
  • the plasma/mononuclear cell mix was decanted into a 15ml tube and 5ml of phosphate-buffered saline (PBS) is added.
  • PBS phosphate-buffered saline
  • the 15ml tubes were spun for 5 minutes at 1750xg to pellet the cells.
  • the supernatant was discarded and 1.8 ml of RLT lysis buffer is added to the mononuclear cell pellet.
  • the buffer and cells were pipetted up and down to ensure complete lysis of the pellet.
  • the cell lysate was frozen and stored until it is convenient to proceed with isolation of total RNA.
  • Total RNA was purified from the lysed mononuclear cells using the Qiagen Rneasy Miniprep kit, as directed by the manufacturer (10/99 version) for total RNA isolation, including homogenization (Qiashredder columns) and on-column DNase freatment. The purified RNA was eluted in 50ul of water.
  • Two 8 ml blood samples were drawn from a peripheral vein into a tube (CPT, Becton- Dickinson order #362753) containing anticoagulant (Citrate), 25°C density gradient solution (Ficoll) and a polyester gel barrier that upon centrifugation is permeable to RBCs and granulocytes but not to mononuclear cells.
  • the mononuclear cells and plasma remained above the barrier while the RBCs and granulocytes were trapped below.
  • the tube was inverted several times to mix the blood with the anticoagulant, and the tubes were subjected to centrifugation at 1750xg in a swing-out rotor at room temperature for 20 min.
  • the tubes were removed from the cenfrifuge, and the clear plasma layer above the cloudy mononuclear cell layer was aspirated and discarded.
  • the cloudy mononuclear cell layer was aspirated, with care taken to rinse all of the mononuclear cells from the surface of the gel barrier with PBS (phosphate buffered saline). Approximately 2 mis of mononuclear cell suspension was transferred to a 2ml microcentrifuge tube, and centrifuged for 3min. at 16,000 rpm in a microcentrifuge to pellet the cells.
  • PBS phosphate buffered saline
  • RLT lysis buffer Qiagen
  • the cells and lysis buffer were pipetted up and down to ensure complete lysis of the pellet.
  • Cell lysate was frozen and stored until it was convenient to proceed with isolation of total RNA.
  • RNA samples were isolated from 8 mL of whole blood. Yields ranged from 2 ⁇ g to 20 ⁇ g total RNA for 8mL blood. A260/A280 spectrophotomefric ratios were between 1.6 and 2.0, indicating purity of sample. 2ul of each sample were run on an agarose gel in the presence of ethidium bromide. No degradation of the RNA sample and no DNA contamination were visible.
  • Confrol RNA was prepared using total RNA from Buffy coats and/or total RNA from enriched mononuclear cells isolated from Buffy coats, both with and without stimulation with ionomycin and PMA. The following control RNAs were prepared: Control 1 : Buffy Coat Total RNA Control 2: Mononuclear cell Total RNA Control 3: Stimulated buffy coat Total RNA Control 4: Stimulated mononuclear Total RNA
  • Control 5 50% Buffy coat Total RNA / 50% Stimulated buffy coat Total RNA
  • Control 6 50% Mononuclear cell Total RNA / 50% Stimulated Mononuclear Total RNA.
  • Buffy coats from 38 individuals were obtained from Stanford Blood Center. Each buffy coat is derived from ⁇ 350 mL whole blood from one individual. 10 ml buffy coat was removed from the bag, and placed into a 50 ml tube. 40 ml of Buffer EL (Qiagen) was added, the tube was mixed and placed on ice for 15 minutes, then cells were pelleted by centrifugation at 2000xg for 10 minutes at 4°C. The supernatant was decanted and the cell pellet was re-suspended in 10 ml of Qiagen Buffer EL. The tube was then centrifuged at 2000xg for 10 minutes at 4°C.
  • Buffer EL Qiagen
  • the cell pellet was then re-suspended in 20 ml TRIZOL (GibcoBRL) per Buffy coat sample, the mixture was shredded using a rotary homogenizer, and the lysate was then frozen at — 80°C prior to proceeding to RNA isolation.
  • TRIZOL GibcoBRL
  • confrol RNAs were prepared from enriched mononuclear cells prepared from Buffy coats. Buffy coats from Stanford Blood Center were obtained, as described above. 10 ml buffy coat was added to a 50 ml polypropylene tube, and 10 ml of phosphate buffer saline (PBS) was added to each tube. A polysucrose (5.7 g/dL) and sodium diattizoate (9.0 g/dL) solution at a 1.077 +/-0.0001 g/ml density solution of equal volume to diluted sample was prepared (Histopaque 1077, Sigma cat. no 1077-1). This and all subsequent steps were performed at room temperature.
  • PBS phosphate buffer saline
  • 15 ml of diluted buffy coat PBS was layered on top of 15 ml of the histopaque solution in a 50 ml tube.
  • the tube was centrifuged at 400xg for 30 minutes at room temperature. After centrifugation, the upper layer of the solution to within 0.5 cm of the opaque interface containing the mononuclear cells was discarded. The opaque interface was transferred into a clean cenfrifuge tube. An equal volume of PBS was added to each tube and centrifuged at 350xg for 10 minutes at room temperature. The supernatant was discarded. 5 ml of Buffer EL (Qiagen) was used to resuspend the remaining cell pellet and the tube was centrifuged at 2000xg for 10 minutes at room temperature.
  • Buffer EL Qiagen
  • RNA samples were prepared by a different protocol, as follows. The further use of RNA prepared using this protocol is described in Example 7.
  • the cell pellet was resuspended in 10 ml of Buffer EL (Qiagen) by vortexing and incubated on ice for 10 minutes to remove any remaining erthythrocytes.
  • the mononuclear cells were spun at 2000 g for 10 minutes at 4 degrees Celsius.
  • the cell pellet was lysed in 25 ml of a phenol/guanidinium thiocyanate solution (TRIZOL Reagent, Invitrogen).
  • the sample was homogenized using a PowerGene 5 rotary homogenizer (Fisher Scientific) and Omini disposable generator probes (Fisher Scientific).
  • the Trizol lysate was frozen at -80 degrees C until the next step.
  • RNA samples were thawed out and incubated at room temperature for 5 minutes. 5 ml chloroform was added to each sample, mixed by vortexing, and incubated at room temperature for 3 minutes. The aqueous layers were transferred to new 50 ml tubes. The aqueous layer containing total RNA was further purified using the Qiagen RNeasy Maxi kit (PN 75162), per the manufacturer's protocol (October 1999). The columns were eluted twice with 1 ml Rnase-free water, with a minute incubation before each spin. Quantity and quality of RNA was assessed using standard methods.
  • RNA was isolated from batches of 10 buffy coats at a time, with an average yield per buffy coat of 870 ⁇ ig, and an estimated total yield of 43.5 mg total RNA with a 260/280 ratio of 1.56 and a 28S/18S ratio of 1.78. Quality of the RNA was tested using the Agilent 2100 Bioanalyzer using RNA 6000 microfluidics chips. Analysis of the elecfrophorgrams from the Bioanalyzer for five different batches demonsfrated the reproducibility in quality between the batches.
  • RNA from all five batches were combined and mixed in a 50 ml tube, then aliquoted as follows: 2 x 10 ml aliquots in 15 ml tubes, and the rest in 100 ⁇ l aliquots in 1.5 ml microcentrifuge tubes. The aliquots gave highly reproducible results with respect to RNA purity, size and integrity. The RNA was stored at -80°C.
  • the R50 targets were fluorescently labeled with Cy-5 using methods described herein and the amplified and labeled aRNA was hybridized (as in example 7) to the olignoucleotide array described in example 6.
  • the R50 detected 97.3% of probes with a Signal to Noise ratio (S/N) of greater than three and 99.9 % of probes with S/N greater one.
  • S/N Signal to Noise ratio
  • Example 3 Identification of diagnostic oligonucleotides and oligonucleotide sets for use in monitoring treatment and/or progression of Rheumatoid arthritis
  • RA Rheumatoid arthritis
  • TNF blockers A new class of medication, TNF blockers, are effective, but the drugs are expensive, have side effects and not all patients respond to treatment. In addition, relief of disease symptoms does not always correlate with inhibition of joint destruction. For these reasons, an alternative mechanism for the tifration of therapy is needed.
  • ARC American College of Rheumatology
  • Demographic information information relating to the ACR criteria for RA; presence or absence of additional diagnoses of inflammatory and non-inflammatory conditions; data from laboratory test, including complete blood counts with differentials, CRP, ESR, ANA, Serum IL6, Soluble CD40 ligand, LDL, HDL, Anti-DNA antibodies, rheumatoid factor, C3, C4, serum creatinine and any medication levels; data from surgical procedures such as gross operative findings and pathological evaluation of resected tissues and biopsies; information on pharmacological therapy and treatment changes; clinical diagnoses of disease "flare”; hospitalizations; quantitative joint exams; results from health assessment questionnaires (HAQs); other clinical measures of patient symptoms and disability; physical examination results and radiographic data assessing joint involvement, synovial thickening, bone loss and erosion and joint space narrowing and deformity.
  • data includes pathological evaluation of synovial memebranes and joint tissues from RA and control patients.
  • Pathology scoring systems including pathological evaluation of synovial memebranes and joint tissues
  • mononuclear cells or subsets of mononuclear cells can be isolated for expression profiling.
  • the relative number of lyphocyte subsets for some specimens can be determined by fluorescence activated cell sorting. Examples are determination of the CD4/CD8 T-cell ratio for a specimen. This information can be used as a variable to correlate to other outcomes or as an outcome for correlation analysis.
  • measures of improvement in RA are derived as exemplified by the ACR 20% and 50% response/improvement rates (Felson et al. 1996).
  • Measures of disease activity over some period of time is derived from these data as are measures of disease progression.
  • Serial radiography of effected joints is used for objective determination of progression (e.g., joint space narrowing, peri- articular osteoporosis, synovial thickening).
  • Disease activity is determined from the clinical scores, medical history, physical exam, lab studies, surgical and pathological findings.
  • the collected clinical data (disease criteria) is used to define patient or sample groups for correlation of expression data.
  • Patient groups are identified for comparison, for example, a patient group that possesses a useful or interesting clinical distinction, verses a patient group that does not possess the distinction. Examples of useful and interesting patient distinctions that can be made on the basis of collected clinical data are listed here:
  • Samples from patients who subsequently respond to a given medication or freatment regimen versus samples from those same or different patients who subsequently do not respond to a given medication or treatment regimen for example, TNF pathway blocking medications.
  • Expression profiles correlating with progression of RA are identified. Subsets of the candidate library (or a previously identified diagnostic nucleotide set) are identified, according to the above procedures, that have predictive value for the progression of RA.
  • Diagnostic nucleotide set(s) are identified which predict respond to TNF blockade. Patients are profiled before and during freatment with these medications. Patients are followed for relief of symptoms, side effects and progression of joint destruction, e.g., as measured by hand radiographs. Expression profiles correlating with response to TNF blockade are identified. Subsets of the candidate library (or a previously identified diagnostic nucleotide set) are identified, according to the above procedures that have predictive value for response to TNF blockade.
  • Example 4 Identification of diagnostic oligonucleotide and oligonucleotide sets for diagnosis of Systemic Lupus Erythematosis
  • SLE is a chronic, systemic inflammatory disease characterized by dysregulation of the immune system. Clinical manifestations affect every organ system and include skin rash, renal dysfunction, CNS disorders, arthralgias and hematologic abnormalities. SLE clinical manifestations tend to both recur intermittently (or "flare”) and progress over time, leading to permanent end-organ damage.
  • ACR American College of Rheumatology
  • Demographic information ACR criteria for SLE, additional diagnoses of inflammatory and non-inflammatory conditions, data from laboratory testing including complete blood counts with differentials, CRP, ESR, ANA, Serum IL6, Soluble CD40 ligand, LDL, HDL, Anti-DNA antibodies, rheumatoid factor, C3, C4, serum creatinine (and other measures of renal dysfunction), medication levels, data from surgical procedures such as gross operative findings and pathological evaluation of resected tissues and biopsies (e.g., renal, CNS), information on pharmacological therapy and treatment changes, clinical diagnoses of disease "flare", hospitalizations, quantitative joint exams, results from health assessment questionnaires (HAQs), SLEDAIs (a clinical score for SLE activity that assess many clinical variables; Bombadier C, Gladman DD, Urowitz MB, Caron D, Chang CH and the Committee on Prognosis Studies in SLE: Derivation of the SLEDAI for Lupus Patients.
  • HAQs health assessment questionnaires
  • the collected clinical data (disease criteria) is used to define patient or sample groups for correlation of expression data.
  • Patient groups are identified for comparison, for example, a patient group that possesses a useful or interesting clinical distinction, verses a patient group that does not possess the distinction.
  • Measures of disease activity in SLE are derived from the clinical data described above to divide patients (and patient samples) into groups with higher and lower disease activity over some period of time or at any one point in time.
  • Such data are SLEDAI scores and other clinical scores, levels of inflammatory markers or complement, number of hospitalizations, medication use and changes, biopsy results and data measuring progression of end-organ damage or end-organ damage, including progressive renal failure, carotid atherosclerosis, and CNS dysfunction.
  • Expression profiles correlating with progression of SLE are identified, including expression profiles corresponding to end-organ damage and progression of end-organ damage. Expression profiles are identified predicting disease progression or disease "flare”, response to treatment or likelihood of response to treatment, predict likelihood of "low” or “high” disease measures (optionally described using the SLEDAI score), and presence or likelihood of developing premature carotid atherosclerosis. Subsets of the candidate library (or a previously identified diagnostic nucleotide set) are identified, according to the above procedures that have predictive value for the progression of SLE. Further examples of useful and interesting patient distinctions that can be made on the basis of collected clinical data are listed here. Samples can be grouped and groups are compared to discover diagnostic gene sets:
  • RNA samples were collected from patients with SLE and patients with Rheumatoid or Osteoarthritis (RA and OA) or controls using the protocol described in example 1.
  • the patient diagnoses were determined using standard diagnostic algorithms such as those that are employed by tiie American College of Rheumatology (see example See Tan et al. (1982) Arthritis Rheum 25:1271-7; Arnett et al. (1988) Arthritis Rheum 31:315-24).
  • samples were included in the anaysis. 15 samples were derived from patients with a clinical diagnosis of SLE and the remainder were derived from patients with RA (9), OA (4) and subjects without known disease (4) who served as controls. Samples from patients with SLE or RA were classified as "Active” or “Controlled” (with respect to disease activity) by the patient's physician based on objective and subjective criteria, such as patient history, physical exam and lab studies. An attempt was made to match SLE patients and controls with respect to important variables such as medication use, sex, age and secondary diagnoses.
  • RNA After preparation of RNA (example 1), amplification, labeling, hybridization, scanning, feature extraction and data processing were done as described in Example 7 using the oligonucleotide microarrays described in Example 6. The resulting log ratio of expression of Cy3 (patient sample)/ Cy5 (R50 reference RNA) was used for analysis.
  • the oligonucleotide GCCTCTTGCTTGGCGTGATAACCCTGTCATCTTCCCAAAGCTCATTTATG detects a specific human gene: sialyltransferase (SIAT4A), Unigene : Hs.301698
  • Locus NM_003033, GI: 4506950. Expression ratios for the gene are given for each sample in Figure 5A-B. The average fold change in expression between SLE and controls was 1.48.
  • CART was used to build a decision tree for classification of samples as lupus or not lupus using the gene expression data from the arrays.
  • the analysis identitifies sets of genes that can be used together to accurately identify samples derived from lupus patients.
  • the set of genes and the identified threshold expression levels for the decision tree are referred to as "models”. Multiple models for diagnosis of Lupus were derived by using different settings and parameters for the CART algorithm and using different sets of genes in the analysis. When using CART, it may be desirable to limit the number of independent variables. In the case of the genes on the arrays, a subset of ⁇ 8000 can be selected for analysis in CART based on significant differential expression discovered by using SAM or some other algorithm.
  • Model I was based on a data set consisting of thirty-two samples (fifteen SLE and seventeen non-SLE). These samples were used to derive the model and are referred to a the "fraining set'. Model I used the expression values for twenty-nine genes, which were found to be most significant in differentiating SLE and non-SLE samples in the analysis using SAM described above. SLE samples were designated as Class 1 and non-SLE samples were designated as Class 2. For this analysis, the following settings were used in the MODEL SETUP (CART, Salford Systems, San Diego, CA.). In the Model settings, the free type selected for the analysis was classification. In the Categorical settings, the default values were used.
  • V-fold cross-validation was selected with a value of 10.
  • the default values were used.
  • the Best Tree settings the default values were used.
  • tiie Combine settings the default values were used.
  • Symmetric Gim was selected as the type of classification tree and Linear combinations for splitting was also selected. The default values were used for the linear combinations.
  • the Advance Settings the default values were used.
  • the Costs settings the default values were used.
  • Equal was selected as the priors for Class.
  • the penalty settings the default values were used.
  • CART built two models, a two-gene model and a three-gene model ( Figures 5C-E).
  • the sensitivity and specificity for the identification of lupus in the fraining set samples of the two genes model were 100% and 94%, respectively.
  • the sensitivity and specificity for the 10- fold cross validation set of the two-gene model were 100% and 88%, respectively, with a relative cost of 0.118.
  • the sensitivity and specificity for the training set of the three genes model were 100% and 100%, respectively.
  • the sensitivity and specificity for the 10-fold cross validation set of the tiiree genes model were 93% and 94%, respectively, with a relative cost of 0.125.
  • Model II was based on a data set consisted of thirty-two samples, fifteen SLE and seventeen non-SLE (fraining set) and six thousand forty-four genes with expression values for at least 80% of the samples.
  • the MODEL SETUP for the analysis of this data set was the same as for the analysis above, except for the following correction.
  • Linear combination for splitting was unchecked after the analysis yielded no classification free. The change in the linear combination setting resulted in the following.
  • the sensitivity and specificity for the training set of the one gene model were 87% and 82%, respectively.
  • the sensitivity and specificity for the 10-fold cross validation set of the one gene model were 80% and 59%, respectively, with a relative cost of 0.612.
  • the sensitivity and specificity for the training set of the three genes model were 100% and 88%, respectively.
  • the sensitivity and specificity for the 10-fold cross validation set of the three genes model were 67% and 65%, respectively, with a relative cost of 0.686.
  • the sensitivity and specificity for the training set of the five genes model were 100% and 94%, respectively.
  • the sensitivity and specificity for the 10-fold cross validation set of the five genes model were 67% and 59%, respectively, with a relative cost of 0.745. Results and models are summarized in Figure 5 C and F.
  • genes can be used alone or in association with other genes or variables to build a diagnostic gene set or a classification algorithm. These genes can be used in association with known gene markers for lupus (such as those identified in the prior art) to provide a diagnostic algorithm.
  • Surrogates for some of the most useful genes were identified. Surrogates can be used in addition to or in place of a diagnostic gene in a method of detecting lupus or in diagnostic gene set. For genes that were splitters in CART, surrogates were identified and reported by the software. In these cases, the best available surrogates are listed. For other genes, hierarchical clustering of the data was performed with default settings (x-miner, X-mine, Brisbane, CA) and members of gene expression clusters were noted. A cluster was selected that included the gene of interest and the members of that cluster were recorded in Table 2D.
  • this section describes the design of four oligonucleotide probes using Array Designer Ver 1.1 (Premier Biosoft International, Palo Alto, CA). The major steps in the process are given first.
  • Use probe design software such as Array Designer, version 1.1, to select a sequence of 50 residues with specified physical and chemical properties.
  • the 50 residues nearest the 3' end constitute a search frame.
  • the residues it contains are tested for suitability. If they don't meet the specified criteria, the search frame is moved one residue closer to the 5' end, and the 50 residues it now contains are tested. The process is repeated until a suitable 50-mer is found.
  • Clone 40H12 was sequenced and compared to the nr, dbEST, and UniGene databases at NCBI using the BLAST search tool.
  • the sequence matched accession number NM_002310, a 'curated RefSeq project' sequence, see Pruitt et al. (2000) Trends Genet. 16:44-47, encoding leukemia inhibitory factor receptor (LIFR) mRNA with a reported E value of zero.
  • An E value of zero indicates there is, for all practical purposes, no chance that the similarity was random based on the length of the sequence and the composition and size of the database.
  • accession number NM_002310 This sequence, cataloged by accession number NM_002310, is much longer than the sequence of clone 40H12 and has a poly-A tail. This indicated that the sequence cataloged by accession number NM_002310 is the sense strand and a more complete representation of the mRNA than the sequence of clone 40H12, especially at the 3' end. Accession number "NM_002310" was included in a text file of accession numbers representing sense strand mRNAs, and sequences for the sense strand mRNAs were obtained by uploading a text file containing desired accession numbers as an Entrez search query using the Batch Enfrez web interface and saving the results locally as a FASTA file. The following sequence was obtained, and the region of alignment of clone 40H12 is outlined:
  • the length of this sequence was determined using batch, automated computational methods and the sequence, as sense strand, its length, and the desired location of the probe sequence near the 3' end of the mRNA was submitted to Array Designer Ver 1.1 (Premier Biosoft International, Palo Alto, CA). Search quality was set at 100%, number of best probes set at 1, length range set at 50 base pairs, Target Tm set at 75 C. degrees plus or minus 5 degrees, Hairpin max deltaG at 6.0 -kcal/mol., Self dimmer max deltaG at 6.0 -kcal/mol, Run/repeat (dinucleotide) max length set at 5, and Probe site minimum overlap set at 1.
  • the probe site When none of the 49 possible probes met the criteria, the probe site would be moved 50 base pairs closer to the 5' end of the sequence and resubmitted to Array Designer for analysis. When no possible probes met the criteria, the variation on melting temperature was raised to plus and minus 8 degrees and the number of identical basepairs in a run increased to 6 so that a probe sequence was produced.
  • Array Designer Ver 1.1 designed a probe with the following sequence oligonucleotide SEQ ID NO: 1041 and is indicated by underlining in the sequence above. It has a melting temperature of 68.4 degrees Celsius and a max run of 6 nucleotides and represents one of the cases where the criteria for probe design in Array Designer Ver 1.1 were relaxed in order to obtain an oligonucleotide near the 3' end of the mRNA (Low melting temperature was allowed).
  • Clone 463D12 was sequenced and compared to the nr, dbEST, and UniGene databases at NCBI using the BLAST search tool. The sequence matched accession number All 84553, an EST sequence with the definition line "qd60a05.xl Soares_testis_NHT Homo sapiens cDNA clone IMAGE:1733840 3' similar to gb:M29550 PROTETN PHOSPHATASE 2B CATALYTIC SUBUNIT 1 (HUMAN);, mRNA sequence.” The E value of the alignment was 1.00 x 10 "118 . The GenBank sequence begins with a poly-T region, suggesting that it is the antisense strand, read 5' to 3'.
  • the FASTA file including the sequence of AA184553, was then masked using the RepeatMasker web interface, as shown below.
  • the region of alignment of clone 463D12 is outlined.
  • the sequence was submitted to Array Designer as described above, however, the desired location of the probe was indicated at base pair 50 and if no probe met the criteria, moved in the 3' direction.
  • the complementary sequence from Array Designer was used, because the original sequence was antisense.
  • the oligonucleotide designed by Array Designer has the following sequence oligonucleotide SEQ ID NO: 1044 and is complementary to the underlined sequence above.
  • the probe has a melting temperature of 72.7 degrees centigrade and a max run of 4 nucleotides.
  • Clone 72D4 was sequenced and compared to the nr, dbEST, and UniGene databases at NCBI using the BLAST search tool. No significant matches were found in any of these databases. When compared to the human genome draft, significant alignments were found to three consecutive regions of the reference sequence NT_008060, as depicted below, suggesting that the insert contains three spliced exons of an unidentified gene.
  • BioCardia's own sequence file was used to design the oligonucleotide. Two complementary probes were designed to ensure that the sense strand was represented. The sequence of the insert in clone 72D4 is shown below, with the three putative exons outlined.
  • CTCCGAGGAGACAGAAGGGAGTGTCGGACACCATGACGAGAGCTTGGCA AATA ⁇ TAAC ⁇ CT ⁇ jGTTTA ⁇
  • each probe sequence was confirmed by comparing the sequence against dbEST, the UniGene cluster set, and the assembled human genome using BLASTn at NCBI. Alignments, accession numbers, gi numbers, UniGene cluster numbers and names were examined and the most common sequence used for the probe.
  • the final probe set was compiled into Table 2.
  • the sequence ID is given which corresponds to the sequence listing. The origin of the sequence for inclusion on the array is noted as coming from one of the cDNA libraries described in example 1, mining from databases as described in examples 2 and 11 or identification from the published literature. The unigene number, genebank accession and GI number are also given for each sequence when known. The name of the gene associated with the accession number is noted. Finally, the nucleotide sequence of each probe is also given.
  • tetrazole and a phosphoramidite derivative of tiie next nucleotide were added.
  • the tetrazole protonates the nitrogen of the phosphoramidite, making it susceptible to nucleophilic attack.
  • the DMT group at the 5'-end of the hydroxyl group blocks further addition of nucleotides in excess.
  • the inter-nucleotide linkage was converted to a phosphofriester bond in an oxidation step using an oxidizing agent and water as the oxygen donor. Excess nucleotides were filtered out and the cycle for the next nucleotide was started by the removal of the DMT protecting group. Following the synthesis, the oligo was cleaved from the solid support.
  • the oligonucleotides were desalted, resuspended in water at a concentration of 100 or 200 ⁇ M, and placed in 96-deep well format. The oligonucleotides were re-arrayed into Whatman Uniplate 384-well polyproylene V bottom plates. The oligonucleotides were diluted to a final concentration 30 ⁇ M in IX Micro Spotting Solution Plus (Telechem/arrayit.com, Sunnyvale, CA) in a total volume of 15 ⁇ l. In total, 8,031 oligonucleotides were arrayed into twenty-one 384-well plates.
  • Arrays were produced on Telechem/arrayitxom Super amine glass substrates (Telechem arrayit.com), which were manufactured in 0.1 mm filtered clean room with exact dimensions of 25x76x0.96 mm.
  • the arrays were printed using the Virtek Chipwriter with a Telechem 48 pin Micro Spotting Printhead.
  • the Printhead was loaded with 48 Stealth SMP3B TeleChem Micro Spotting Pins, which were used to print oligonucleotides onto the slide with the spot size being 110-115 microns in diameter.
  • Example 7 Amplification, labeling, and hybridization of total RNA to an oligonucleotide microarray
  • RNA samples consisting of at least 0.5 to 2 ⁇ g of intact total RNA were further processed for array hybridization. When available, 2 ⁇ g of intact total RNA is used for amplification. Amplification and labeling of total RNA samples was performed in three successive enzymatic reactions. First, a single- stranded DNA copy of the RNA was made (hereinafter, "ss-cDNA"). Second, the ss-cDNA was used as a template for the complementary DNA strand, producing double-stranded cDNA (hereinafter, "ds- cDNA, or cDNA"). Third, linear amplification was performed by in vitro transcription from a bacterial T 7 promoter. During this step, fluorescent-conjugated nucleotides were incorporated into the amplified RNA (hereinafter, "aRNA").
  • aRNA fluorescent-conjugated nucleotides
  • the first strand cDNA was produced using the Invitrogen kit (Superscript II).
  • the first strand cDNA was produced in a reaction composed of 50 mM Tris-HCl (pH 8.3), 75 mM KC1, and 3 mM MgCl 2 (lx First Strand Buffer, Invitrogen), 0.5 mM dGTP, 0.5 mM dATP, 0.5 mM dTTP, 0.5 mM dCTP, 10 mM DTT, 200 U reverse transcriptase (Superscript II, Invitrogen, #18064014), 15 U RNase inhibitor (RNAGuard, Amersham Pharmacia, #27-0815-01), 5 ⁇ M T7T24 primer (5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGTTTTT ⁇ TTT-3'), (SEQ ID NO: 1048) and 0.5 to 2 ⁇ g of selected sample total RNA.
  • control mRNAs from the plant Arabidopsis thaliana were added to the reaction mixture: 2- 20 pg of the following genes CAB, RCA, LTP4, NACl, RCP1,XCP2, RBCL, LTP6, TIM, and PRKase (Sfratagene, #252201, #252202, #252204, #252208, #252207, #252206, #252203, #252205, #252209, #252210 respectively).
  • the control RNAs allow the estimate of copy numbers for individual mRNAs in the clinical sample because corresponding sense oligonucleotide probes for each of these plant genes are present on the microarray.
  • the final reaction volume of 20 ⁇ l was incubated at 42°C for 90 min.
  • DNA polymerase and RNase were added to the previous reaction, bringing the final volume to 150 ⁇ l.
  • the previous contents were diluted and new substrates were added to a final concentration of 20 mM Tris-HCl (pH 7.0) (Fisher Scientific, Pittsburgh, PA #BP1756-100), 90 mMKCl (Teknova, Half Moon Bay, CA, #0313-500) , 4.6 mM MgCl 2 (Teknova, Half Moon Bay, CA, #0304-500), 10 mM(NH 4 ) 2 S0 4 (Fisher Scientific #A702- 500)(lx Second Strand buffer, Invitrogen), 0.266 mM dGTP, 0.266 mM dATP, 0.266 mM dTTP, 0.266 mM dCTP, 40 U E. coli DNA polymerase (Invitrogen, #18010-025), and 2 U RNaseH (Invitrogen, #18021-014).
  • the ds-cDNA was purified from the enzymes, dNTPs, and buffers before proceeding to amplification, using phenol-chloroform extraction followed by ethanol precipitation of the cDNA in the presence of glycogen.
  • a silica-gel column is used to purify the cDNA (e.g. Qiaquick PCR cleanup from Qiagen, #28104).
  • the volume of the column purified cDNA was reduced by ethanol precipitation in the presence of glycogen in which the cDNA was collected by centrifugation at >10,000 xg for 30 minutes, the supernatant is aspirated, and 150 ⁇ l of 70% ethanol, 30% water was added to wash the DNA pellet. Following centrifugation, the supernatant was removed, and residual ethanol was evaporated at room temperature.
  • the volume of the column purified cDNA is reduce in a vacuum evaporator where the supernatant is reduce to a final volume of 7.4 ⁇ l.
  • Linear amplification of the cDNA was performed by in vitro franscription of tiie cDNA.
  • the cDNA pellet from the step described above was resuspended in 7.4 ⁇ l of water, and in vitro transcription reaction buffer was added to a final volume of 20 ⁇ l containing 7.5 mM GTP, 7.5 mM ATP, 7.5 mM TTP, 2.25 mM CTP, 1.025 mM Cy3-conjugated CTP (Perkin Elmer; Boston, MA, #NEL-580), lx reaction buffer (Ambion, Megascript Kit, Austin, TX and #1334) and 1 % T 7 polymerase enzyme mix (Ambion, Megascript Kit, Austin, TX and #1334).
  • RNA was quantified using an Agilent 2100 bioanalyzer with the RNA 6000 nano LabChip.
  • RNA was prepared as described above, except Cy5-CTP was incorporated instead of Cy3CTP. Reference RNA from five reactions, each reaction started with 2 ⁇ g total RNA, was pooled together and quantitated as described above. Hybridization to an array
  • RNA was prepared for hybridization as follows: for an 18mmx55mm array, 20 ⁇ g of amplified RNA (aRNA) was combined with 20 ⁇ g of reference aRNA. The combined sample and reference aRNA was concentrated by evaporating the water to 10 ⁇ l in a vacuum evaporator. The sample was fragmented by heating the sample at 95°C for 30 minutes to fragment the RNA into 50-200 bp pieces. Alternatively, the combined sample and reference aRNA was concentrated by evaporating the water to 5 ⁇ l in a vacuum evaporator. Five ⁇ l of 20 mM zinc acetate was added to the aRNA and the mix incubated at 60°C for 10 minutes.
  • aRNA amplified RNA
  • hybridization buffer was added to achieve final concentrations of 5xSSC and 0.20 %SDS with 0.1 ⁇ g/ul of Cot-1 DNA (Invitrogen) as a competitor DNA.
  • the final hybridization mix was heated to 98°C, and then reduced to 50°C at 0.1 °C per second.
  • formamide is included in the hybridization mixture to lower the hybridization temperature.
  • the hybridization mixture was applied to a pre-heated 65°C microarray, surface, covered with a glass coverslip (Corning, #2935-246), and placed on a pre-heated 65°C hybridization chamber (Telechem, AHC- 10). 15 ul of 5xSSC was placed in each of the reservoir in the hybridization chamber and the chamber was sealed and placed in a water bath at 62°C for overnight (16-20 hrs).
  • the slides were washed in 2xSSC, 0.1 % SDS for five minutes at 30°C, then in 2xSSC for five minutes at 30°C, then in 2xSSC for another five minutes at 30°C, then in 0.2xSSC for two minutes at room temperature.
  • the arrays were spun at lOOOxg for 2 minutes to dry them. The dry microarrays are then scanned by methods described above.
  • the microarrays were imaged on the Agilent (Palo Alto, CA) scanner G2565AA.
  • the scan settings using the Agilent software were as follows: for the PMT Sensitivity (100% Red and 100% Green); Scan Resolution (10 microns); red and green dye channels; used the default scan region for all slides in the carousel; using the largest scan region; scan date for Instrument ID; and barcode for Slide ID.
  • the full image produced by the Agilent scanner was flipped, rotated, and split into two images (one for each signal channel) using TIFFSplitter (Agilent, Palo Alto, CA). The two channels are the output at 532 nm (Cy3-labeled sample) and 633 nm (Cy5-labeled R50).
  • the individual images were loaded into GenePix 3.0 (Axon Instruments, Union City, CA) for feature extraction, each image was assigned an excitation wavelength corresponding the file opened; Red equals 633 nm and Green equals 532 nm.
  • the setting file (gal) was opened and the grid was laid onto the image so that each spot in the grid overlaped with >50% of the feature. Then the GenePix software was used to find the features without setting minimum threshold value for a feature. For features with low signal intensity, GenePix reports "not found". For all features, the diameter setting was adjusted to include only the feature if necessary.
  • the GenePix software determined the median pixel intensity for each feature (F ; ) and the median pixel intensity of the local background for each feature (Bj) in both channels.
  • the standard deviation (SDF; m a SDBj) for each is also determined.
  • Features for which GenePix could not discriminate the feature from the background were "flagged" as described below.
  • the header information of the .gpr file was changed to carry accurate information into the database.
  • An Excel macro was written to include the following information: Name of the original .tif image file, SlideBD, Version of the feature extraction software, GenePix Array List file, GenePix Settings file, ScanlD, Name of person who scanned the slide, Green PMT setting, Red PMT setting, ExtractID (date .gpr file was created, formatted as yyyy.mm.dd-hh.mm.ss), Results file name (same as the .gpr file name), StorageCD, and Extraction comments.
  • the data from each hybridization was pre-processed to extract data that was entered into the database and subsequently used for analysis.
  • the complete GPR file produced by the feature extraction in GenePix was imported into an excel file pre-processing template or processed using a AWK script. Botii programs used the same processing logic and produce identical results.
  • the same excel template or AWK script was used to process each GPR file.
  • the template performs a series of calculations on the data to differentiate poor features from others and to combine duplicate or triplicate feature data into a single data point for each probe.
  • the data columns used in die pre-processing were: Oligo ID, F633 Median (median value from all the pixels in the feature for die Cy5 dye), B633 Median (the median value of all the pixels in the local background of the selected feature for Cy5), B633 SD (the standard deviation of the values for the pixels in the local background of the selected feature for Cy5), F532 Median (median value from all the pixels in the feature for the Cy3 dye), B532 Median (the median value of all the pixels in the local background of the selected feature for Cy3), B532 SD (the standard deviation of the values for the pixels in the local background of the selected feature for Cy3), and Flags.
  • the GenePix Flags column contains the flags set during feature extraction. "-75" indicates there were no features printed on the array in that position, "-50" indicates that GenePix could not differentiate the feature signal from the local background, and "-100" indicates that the user marked the feature as bad.
  • an adjusted background-subtracted signal was calculated as the fluorescence minus the mimmum local background on the slide.
  • An adjusted S/ ⁇ was then calculated as the adjusted background subtracted signal divided by the median noise over all features for that channel. If the adjusted S/ ⁇ was greater than three and the original S/ ⁇ were less than three, a flag of 25 was set for the Cy5 channel, a flag of 23 was set for the Cy3 channel, and if both met these criteria, then a flag of 28 was set. If both the adjusted S/ ⁇ and the original S/ ⁇ were less than three, tiien a flag of 65 was set for Cy5, 63 set for Cy3, and 68 set if both dye channels had an adjusted S/ ⁇ less than three. All signal to noise calculations, adjusted background-subtracted signal, and adjusted S/ ⁇ were calculated for each dye channel. If the BGSS value was greater than or equal to 64000, a flag was set to indicate saturation; 55 for Cy5, 53 for Cy3, 58 for both.
  • the BGSS used for further calculations was the original BGSS if the original S/ ⁇ was greater than or equal to three. If the original S/ ⁇ ratio was less than three and the adjusted S/ ⁇ ratio was greater than or equal to tliree, then the adjusted BGSS was used. If the adjusted S/ ⁇ ratio was less than three, then the adjusted BGSS was used, but with knowledge of the flag status.
  • the log of the scaled, averaged ratios was taken as described below and stored for use in analyzing the data. Whichever features were used to calculate the probe value, the flag from those features was carried forward and stored as the flag value for that probe. 2 different data sets can be used for analysis. Flagged data uses all values, including those with flags. Filtered data sets are created by removing flagged data from the set before analysis.
  • Leukocyte microarray gene expression was used to discover expression markers and diagnostic gene sets for clinical outcomes. It is desirable to validate the gene expression results for each gene using a more sensitive and quantitative technology such as real-time PCR. Further, it is possible for the diagnostic nucleotide sets to be implemented as a diagnostic test as a real-time PCR panel. Alternatively, the quantitative information provided by real-time PCR validation can be used to design a diagnostic test using any alternative quantitative or semi-quantitative gene expression technology.
  • amplification product is measured during the PCR reaction. This enables the researcher to observe the amplification before any reagent becomes rate limiting for amplification.
  • C threshold cycle
  • Cp crossing point
  • This measurement is the point at which an amplification curve crosses a threshold fluorescence value.
  • the threshold is set to a point within the area where all of the reactions were in their linear phase of amplification.
  • the Sybr Green method is sensitive to non-specific amplification products, increasing the importance of primer design and selection.
  • Other detection chemistries can also been used, such as ethedium bromide or other DNA-binding dyes and many modifications of the fluorescent dye/quencher dye Taqman chemistry.
  • the inputs for real time PCR reaction are gene-specific primers, cDNA from specific patient samples, and standard reagents.
  • the cDNA was produced from mononuclear RNA (prepared as in example 1) by reverse franscription using Oligo dT primers (Invitrogen, 18418-012) and random hexamers (Invitrogen, 48190-011) at a final concentration of 0.5ng/ ⁇ l and 3ng/ ⁇ l respectively.
  • Oligo dT primers Invitrogen, 18418-012
  • random hexamers Invitrogen, 48190-011
  • For the first strand reaction mix 0.5 ⁇ g of mononuclear total RNA or 2 ⁇ g of whole blood RNA and 1 ⁇ l of the Oligo dT/ Random Hexamer Mix, were added to water to a final volume of 11.5 ⁇ l.
  • the sample mix was then placed at 70°C for 10 minutes. Following the 70°C incubation, the samples were chilled on ice, spun down, and 88.5 ⁇ l of first strand buffer mix dispensed into the reaction tube.
  • the final first strand buffer mix produced final concentrations of IX first strand buffer (Invitrogen, Y00146, Carlsbad, CA), 10 mM DTT (Invitrogen, Y00147), 0.5 mM dATP (NEB, N0440S, Beverly, MA), 0.5 mM dGTP (NEB, N0442S), 0.5mM dTTP (NEB, N0443S), 0.5 mM dCTP (NEB, N0441S), 200U of reverse transcriptase (Superscript II, Invitrogen, 18064-014), and 18U of RNase inhibitor (RNAGaurd Amersham Pharmacia, 27-0815-01, Piscataway, NJ).
  • the reaction was incubated at 42°C for 90 minutes.
  • Primer Express* Two methods were used to design primers. The first was to use the software, Primer Express*" 1 and recommendations for primer design that are provided with the GeneAmp® 7700 Sequence Detection System supplied by Applied BioSystems (Foster City, CA). The second method used to design primers was the PRIMER3 ver 0.9 program that is available from the Whitehead Research Institute, Cambridge, Massachusetts at the web site genome.wi.mit.edu/genome_software/other/primer3.html. The program can also be accessed on the World Wide Web at the web site genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi. Primers and Taqman/hybridization probes were designed as described below using both programs.
  • primers should be designed with a melting temperature between 58 and 60 degrees C. while the Taqman probes should have a melting temperature of 68 to 70 under the salt conditions of the supplied reagents.
  • the salt concentration is fixed in the software.
  • Primers should be between 15 and 30 basepairs long.
  • the primers should produce and amplicon in size between 50 and 150 base pairs, have a C-G content between 20% and 80%, have no more than 4 identical base pairs next to one another, and no more than 2 C's and G's in the last 5 bases of the 3' end.
  • the probe cannot have a G on the 5' end and the strand with the fewest G's should be used for the probe.
  • Primer3 has a large number of parameters. The defaults were used for all except for melting temperature and the optimal size of the amplicon was set at 100 bases. One of the most critical is salt concentration as it affects the melting temperature of the probes and primers. In order to produce primers and probes with melting temperatures equivalent to Primer Express, a number of primers and probes designed by Primer Express were examined using PRIMER3. Using a salt concentration of 50 mM these primers had an average melting temperature of 3.7 degrees higher than predicted by Primer Express.
  • the C source code for Primer3 was downloaded and complied on a Sun Enterprise 250 server using the GCC complier.
  • the program was then used from the command line using a input file that contained the sequence for which we wanted to design primers and probes along with the input parameters as described by help files that accompany the software. Using scripting it was possible to input a number of sequences and automatically generate a number of possible probes and primers.
  • the first step was to mask out repetitive sequences found in the mRNA sequences using RepeatMasker program that can be accessed at: the web site repeatmasker.genome.washington.edu/cgi- bin/RepeatMasker (Smit, AFA & Green, P "RepeatMasker” at the web site ftp.genome.washington.edu/RM/RepeatMasker.html).
  • ACTB 100 sets of primers and probes were generated for ACTB and GUSB. From this set, nested primers were chosen based on whether both left primers could be paired with both right primers and a single Taqman probe could be used on an insert of the correct size. With more experience we have decided not use the mix and match approach to primer selection and just use several of the top pairs of predicted primers. For ACTB this turned out to be:
  • Primer Express predicted the following primers for GUSB: Forward 178 TACCACCTGCGTGTCCCTTC (SEQ ID NO:1059) and Reverse 242 GAGGCACTTGTTCTGCTGCTG (SEQ ID NO: 1060). This pair of primers worked to amplify the GUSB mRNA.
  • Probe Tm 10 degrees > primers, do not begin with a G on 5' end
  • Granzyme B is a marker of transplant rejection.
  • the PCR reaction consisted of IX RealTime PCR Buffer (Ambion, Austin, TX), 2mM MgC12 (Applied BioSystems, B02953), 0.2mM dATP (NEB), 0.2mM dTTP (NEB), 0.2mM dCTP (NEB), 0.2mM dGTP (NEB), .625U AmpliTaq Gold (Applied BioSystems, Foster City, CA), 0.3 ⁇ M of each primer to be used (Sigma Genosys, The Woodlands, TX), 5 ⁇ l of the R50 reverse-transcription reaction and water to a final volume of 19 ⁇ l.
  • cDNA was synthesized from starting total RNA as described above. A set of 5 serial dilutions of the R50 reverse-transcribed cDNA (as described above) were made in water: 1:10, 1:20, 1:40, 1:80, and 1:160.
  • the Sybr Green real-time PCR reaction was performed using the Taqman PCR Reagent kit (Applied BioSystems, Foster City, CA, N808-0228). A master mix was made that consisted of all reagents except the primes and template. The final concentration of all ingredients in the reaction was IX Taqman Buffer A (Applied BioSystems), 2mM MgC12 (Applied BioSystems), 200 ⁇ M dATP (Applied BioSystems), 200 ⁇ M dCTP (Applied BioSystems), 200 ⁇ M dGTP (Applied BioSystems), 400 ⁇ M dUTP (Applied BioSystems), 1:400,000 diluted Sybr Green dye (Molecular Probes), 1.25U AmpliTaq Gold (Applied BioSystems).
  • the PCR master mix was dispensed into two, light-tight tubes. Each ⁇ - Actin primer F75 and R178 (Sigma-Genosys, The Woodlands, TX), was added to one tube of PCR master mix and Each j3-GUS primer F178 and R242 (Sigma-Genosys), was added to the other tube of PCR master mix to a final primer concentration of 300nM. 45 ⁇ l of the ⁇ -Actin or 0-GUS master mix was dispensed into wells, in a 96-well plate (Applied BioSystems). 5 ⁇ l of the template dilution series was dispensed into triplicate wells for each primer.
  • reaction was run on an ABI 7900 Sequence Detection System (Applied BioSystems) with the following conditions: 10 min. at 95°C; 40 cycles of 95°C for 15 sec, 60°C for 1 min; followed by a disassociation curve starting at 50°C and ending at 95°C. .
  • the Sequence Detection System v2.0 software was used to analyze the fluorescent signal from each well.
  • the high end of the baseline was adjusted to between 8 and 20 cycles to reduce the impact on any data curves, yet be as high as possible to reduce baseline drift.
  • a threshold value was selected that allowed the majority of the amplification curves to cross the threshold during the linear phase of amplification.
  • the disassociation curve for each well was compared to other wells for that marker. This comparison allowed identification of "bad" wells, those that did not amplify, that amplified the wrong size product, or that amplified multiple products.
  • the cycle number at which each amplification curve crossed the threshold (C ) was recorded and the file transferred to MS Excel for further analysis. The C ⁇ values for triplicate wells were averaged.
  • the data were plotted as a function of the log 10 of the calculated starting concenfration of RNA.
  • the starting RNA concentration for each cDNA dilution was determined based on the original amount of RNA used in the RT reaction, the dilution of the RT reaction, and the amount used (5 ⁇ l) in the real-time PCR reaction.
  • a linear regression line was plotted through all of the dilutions series points. The slope of the line was used to calculate the efficiency of the reaction for each primer set using the equation:
  • RNA samples were reverse-transcribed to cDNA (as described above) and 1:10 dilutions made in water, addition to the patient samples, a no template control (NTC) and a pooled reference RNA (see example 2) described in were included on every plate.
  • NTC no template control
  • a pooled reference RNA see example 2
  • the Sybr Green real-time PCR reaction was performed using the Taqman Core PCR Reagent kit (Applied BioSystems, Foster City, CA, N808-0228). A master mix was made that consisted of all reagents except the primers and template. The final concenfration of all ingredients in the reaction was IX Taqman Buffer A (Applied BioSystems), 2mM MgC12 (Applied BioSystems), 200 ⁇ M dATP (Applied BioSystems), 200 ⁇ M dCTP (Applied BioSystems), 200 ⁇ M dGTP (Applied BioSystems), 400 ⁇ M dUTP (Applied BioSystems), 1:400,000 diluted Sybr Green dye (Molecular Probes), 1.25U AmpliTaq Gold (Applied BioSystems).
  • the PCR master mix was aliquotted into eight light-tight tubes, one for each marker to be examined across a set of samples.
  • the optimized primer pair for each marker was then added to the PCR master mix to a final primer concentration of 300nM.
  • 18 ⁇ l of the each marker master mix was dispensed into wells in a 384well plate (Applied BioSystems).
  • 2 ⁇ l of the 1:10 diluted confrol or patient cDNA sample was dispensed into triplicate wells for each primer pair.
  • the reaction was run on an ABI 7900 Sequence Detection System (Applied BioSystems) using the cycling conditions described above.
  • the Sequence Detection System v2.0 software (Applied BioSystems) was used to analyze the fluorescent signal from each well.
  • the high end of the baseline was adjusted to between 8 and 20 cycles to reduce the impact on any data curves, yet be as high as possible to reduce baseline drift.
  • a threshold value was selected that allowed the majority of the amplification curves to cross the threshold during the linear phase of amplification.
  • the disassociation curve for each well was compared to other wells for that marker. This comparison allowed identification of "bad" wells, those that did not amplify, that amplified the wrong size product, or that amplified multiple products.
  • the cycle number at which each amplification curve crossed the threshold (CT) was recorded and the file transferred to MS Excel for further analysis.
  • the C ⁇ value representing any well identified as bad by analysis of disassociation curves was deleted.
  • the C ⁇ values for triplicate wells were averaged.
  • a standard deviation (Stdev) and a coefficient of variation (CV) were calculated for the triplicate wells. If the CV was greater than 2, an outlier among the three wells was identified and deleted. Then the average was re-calculated.
  • ⁇ C T was calculated for each marker-control combination by subtracting the average C ⁇ of the target marker from the average C ⁇ of the control ( ⁇ -Actin or jS-GUS).
  • the Taqman real-time PCR reaction was performed using the Taqman Universal PCR Master Mix (Applied BioSystems, Foster City, CA, #4324018). The master mix was aliquoted into eight, light-tight tubes, one for each marker. The optimized primer pair for each marker was then added to the correctly labeled tube of PCR master mix. A FAM/TAMRA dual-labeled Taqman probe (Biosearch Technologies, Navoto, CA, DLO-FT-2) was then added to the correctly labeled tube of PCR master mix. Alternatively, different combinations of fluorescent reporter dyes and quenchers can be used such that the absorption wavelength for the quencher matches the emission wavelength for the reporter, as shown in table 4.
  • each marker master mix 18 ⁇ l of the each marker master mix was dispensed into a 384 well plate (Applied BioSystems). 2 ⁇ l of the template sample was dispensed into triplicate wells for each primer pair. The final concentration of each reagent was: IX TaqMan Universal PCR Master Mix, 300nM each primer, 0.25nM probe, 2 ⁇ l 1:10 diluted template. The reaction was run on an ABI 7900 Sequence Detection System (Applied Biosystems) using standard conditions (95°C for 10 min., 40 cycles of 95°C for 15 sec, 60°C for 1 min.).
  • the Sequence Detector v2.0 software (Applied BioSystems) was used to analyze the fluorescent signal from each well.
  • the high end of the baseline was adjusted to between 8 and 20 cycles to reduce the impact on any data curves, yet be as high as possible to reduce baseline drift.
  • a threshold value was selected that allowed most of the amplification curves to cross the threshold during the linear phase of amplification.
  • the cycle number at which each amplification curve crossed the threshold was recorded and the file transferred to MS Excel for further analysis.
  • the C ⁇ values for triplicate wells were averaged.
  • the C ⁇ values for triplicate wells were averaged.
  • a standard deviation (Stdev) and a coefficient of variation (CV) were calculated for the triplicate wells.
  • Variation of real-time PCR assays can arise from unequal amounts of RNA starting material between reactions.
  • the control gene amplification was included in the same reaction well as the target gene.
  • different fluorescent dyes were used for the control gene. j3-Actin was used as the control gene and the TaqMan probe used was labeled with the fluorescent dye VIC and the quencher TAMRA (Biosearch Technologies, Navoto, CA, DLO-FT-2).
  • other combinations of fluorescent reporter dyes and quenchers can be used as long as the emission wavelength of the reporter for the control gene is sufficiently different from the wavelength of the reporter dye used for the target.
  • control gene primers and probe were used at limiting concentrations in the reaction (150 nM primers and 0.125 nM probe) to ensure that there were enough reagents to amplify the target marker.
  • the plates were run under the same protocol and the data are analyzed in the same way, but with a separate baseline and threshold for the VIC signal. Outliers were removed as above from both the FAM and VIC signal channels. The expression relative to control was calculated as above, using the VIC signal from the confrol gene. ABSOLUTE QUANTITATION
  • an absolute quantitation can be performed using real-time PCR.
  • a standard curve is constructed using serial dilutions from a known amount of template for each marker on the plate.
  • the standard curve may be made using cloned genes purified from bacteria or using synthetic complimentary oligonucleotides. In either case, a dilution series that covers the expected range of expression is used as template in a series of wells in the plate. From the average C ⁇ values for these known amounts of template a standard curve can be plotted. From this curve the C ⁇ values for the unknowns are used to identify the starting concentration of cDNA.
  • These absolute quantities can be compared between disease classes (i.e. rejection vs. no-rejection) or can be taken as expression relative to a control gene to correct for variation among samples in sample collection, RNA purification and quantification, cDNA synthesis, and the PCR amplification.
  • markers are expressed only in specific types of cells. These markers maybe useful markers for differentiation of rejection samples from no-rejection samples or may be used to identify differential expression of other markers in a single cell type.
  • a specific marker for cytotoxic T- lymphocytes (such as CD8) can be used to identify differences in cell proportions in the sample.
  • Other markers that are known to be expressed in this cell type can be compared to the level of CD8 to indicate differential gene expression within CD8 T-cells.
  • PCR expression measurements can be made as either absolute quantification of gene expression using a standard curve or relative expression of a gene of interest compared to a control gene.
  • the gene of interest and the control gene are measured in the same sample. This can be done in separate reactions or in the same reaction (biplex format, see above).
  • the final measurement for expression of a gene is expressed as a ratio of gene expression to control gene expression. It is important for a control gene to be constitutively expressed in the target tissue of interest and have minimal variation in expression on a per cell basis between individuals or between samples derived from an individual. If the gene has this type of expression behavior, the relative expression ratio will help correct for variability in the amount of sample RNA used in an assay.
  • an ideal confrol gene has a high level of expression in the sample of interest compared to the genes being assayed. This is important if the gene of interest and control gene are used in a biplex format.
  • the assay is set up so that the control gene reaches its threshold Ct value early and its amplification is limited by primers so that it does not compete for limiting reagents with the gene of interest.
  • Variation can also enter in data extraction and analysis.
  • Real-time PCR results are measured as the time (measured in PCR cycles) at which the fluorescence intensity ( ⁇ Rn in Applied Biosystems SDS v2.1 software) crosses a user-determined threshold (CT).
  • CT fluorescence intensity
  • ⁇ CT the CT value for the target gene is subtracted from the CT value for a control gene. This difference, called ⁇ CT, is the value compared among experiments to determine whether there is a difference between samples.
  • Variation in setting the threshold can introduce additional error. This is especially true in the duplexed experimental format, where both the target gene and the control gene are measured in the same reaction tube. Duplexing is performed using dyes specific to each of the two genes. Since two different fluorescent dyes are used on the plate, two different thresholds are set. Both of these thresholds contribute to each ⁇ CT. Slight differences in the each dye's threshold settings (relative to the other dye) from one plate to the next can have significant effects on the ⁇ CT.
  • TCb threshold calibrator
  • the TCb wells contain a template, primers, and probes that are common among all plates within an experiment.
  • the threshold is set within the minimum threshold and maximum threshold determined above. 3.
  • the threshold is set to a value in this range that results in the average CT value for the TCb wells to be the same on all plates.
  • a log ratio value is used for most subsequent analysis. This is the logarithm of the expression ratio for each gene between sample and universal reference.
  • the processing algorithm assigns a number of flags to data that are of low signal to noise, saturated signal or are in some other way of low or uncertain quality. Correlation analysis can proceed with all the data (including the flagged data) or can be done on filtered data sets where the flagged data is removed from the set. Filtered data should have less variability and noise and may result in more significant or predictive results. Flagged data contains all information available and may allow discovery of genes that are missed with the filtered data set.
  • missing data are common in microarray data sets. Some algorithms don't require complete data sets and can thus tolerate missing values. Other algorithms are optimal with or require imputed values for missing data. Analysis of data sets with missing values can proceed by filtering all genes from the analysis that have more than 5%, 10%, 20%, 40%, 50%, 60%o or other % of values missing across all samples in the analysis. Imputation of data for missing values can be done by a variety of metiiods such as using the row mean, the column mean, the nearest neighbor or some other calculated number. Except when noted, default settings for filtering and imputation were used to prepare the data for all analytical software packages.
  • Continuous variables such as the ejection fraction of the heart measured by echocardiography or the white blood cell count can be used for correlation analysis. Any piece of clinical data collected on study subjects can be used in a correlation or classification analysis. In some cases, it may be desirable to take the logarithm of the values before analysis.
  • These variables can be included in an analysis along with gene expression values, in which case they are treated as another "gene”. Sets of markers can be discovered that work to diagnose a patient condition and these can include both genes and clinical parameters.
  • Categorical variables such as male or female can also be used as variables for correlation analysis. For example, the sex of a patient may be an important splitter for a classification tree.
  • Clinical data are used as supervising vectors (dependent variables) for the significance or classification analysis of expression data.
  • clinical data associated with the samples are used to divide samples in to clinically meaningful diagnostic categories for correlation or classification analysis.
  • pathologic specimens from kidney biopsies can be used to divide lupus patients into groups with and without kidney disease.
  • a third or more categories can also be included (for example "unknown” or “not reported”).
  • correlation, significance and classification analysis are used to determine which set of genes and set of genes are most appropriate for diagnosis and classification of patients and patient samples.
  • Two main types of expression data analyses are commonly performed on the expression data with differing results and purposes. The first is significance analyses or analyses of difference. In this case, the goal of the analysis is to identify genes that are differentially expressed between sample groups and to assign a statistical confidence to those genes that are identified. These genes may be markers of the disease process in question and are further studied and developed as diagnostic tools for the indication.
  • the second major type of analysis is classification analysis. While significance analysis identifies individual genes that are differentially expressed between sample groups, classification analysis identifies gene sets and an algorithm for their gene expression values that best distinguish sample (patient) groups. The resulting gene expression panel and algorithm can be used to create and implement a diagnostic test. The set of genes and the algorithm for their use as a diagnostic tool are often referred to herein as a "model”. Individual markers can also be used to create a gene expression diagnostic model. However, multiple genes (or gene sets) are often more useful and accurate diagnostic tools.
  • SAM Significance analysis for microarrays
  • FDR False Discovery Rate
  • the algorithm may not identify genes that are useful in classification, but are not differentially expressed in many of the samples.
  • a gene that is a useful marker for disease in women and not men may not be a highly significant marker in a SAM analysis, but may be useful as part of a gene set for diagnosis of a multi-gene algorithm.
  • SAM is used to detect genes that are likely to be differentially expressed between the groupings. Those genes with the highest significance can be validated by real-time PCR (Example 8) or can be used to build a classification algorithm as described here.
  • Classification algorithms are used to identify sets of genes and formulas for the expression levels of those genes that can be applied as diagnostic and disease monitoring tests.
  • the same classification algorithms can be applied to all types of expression and proteomic data, including microarray and PCR based expression data. The discussion below describes the algorithms that were used and how they were used.
  • CART Classification and Regression Trees
  • CART can be used as independent variables for CART that are of known importance to the clinical question or are found to be significant predictors by multivariate analysis or some other technique.
  • CART identifies predictive variables and their associated decision rules for classification (diagnosis).
  • CART also identifies surrogates for each splitter (genes that are the next best substitute for a useful gene in classification). Analysis is performed in CART by weighting misclassification costs to optimize desired performance of the assay. For example, it may be most important that the sensitivity of a test for a given diagnosis be > 90%.
  • CART models can be built and tested using 10 fold cross- validation or v-fold cross validation (see below). CART works best with a smaller number of variables (5-50).
  • MART Multiple Additive Regression Trees
  • CART CART
  • MART Multiple Additive Regression Trees
  • MART builds numerous trees for any classification problem and the resulting model involves a combination of the multiple trees.
  • MART can select variables as it build models and thus can be used on large data sets, such as those derived from an 8000 gene microarray. Because MART uses a combination of many trees and does not take too much information from any one free, it resists over training. MART identifies a set of genes and an algorithm for their use as a classifier.
  • a Nearest Shrunken Centroids Classifier can be applied to microarray or other data sets by the methods described by Tibshirani et al. 2002.
  • This algorithms also identified gene sets for classification and determines their 10 fold cross validation error rates for each class of samples.
  • the algorithm determines the error rates for models of any size, from one gene to all genes in the set. The error rates for either or both sample classes can are minimized when a particular number of genes are used. When this gene number is determined, the algorithm associated with the selected genes can be identified and employed as a classifier on prospective sample.
  • test samples samples that were not included in the initial analysis
  • samples may be taken from archives generated during the clinical study.
  • a new prospective clinical study can be initiated, where samples are obtained and the gene set is used to predict patient diagnoses.
  • RNA was prepared from 14 mononuclear samples (CPT, BD) paired with 14 whole blood samples (PAXgene, PreAnalytix) from transplant recipients.
  • cDNA was prepared from each sample using 2 ⁇ g total RNA as starting material. Resulting cDNA was diluted 1:10 and Sybr green real-time PCR assays were performed.
  • Ct values of 15-30 are desired for each gene. If a gene's Ct value is much above 30, the result may be variable and non-linear.
  • target RNA will be more dilute than in CPT samples.
  • cDNA dilutions must be appropriate to bring Ct values to less than 30.
  • the genes have higher Ct values in whole blood. Using this protocol, all genes can be detected with Cts ⁇ 35. For genes found to have Ct values above 30 in target samples, less diluted cDNA may be needed.
  • Example 11 Identification and validation of gene expression markers for diagnosis and monitoring of lupus and autoimmune diseases.
  • PCR primers for all marker genes can be designed by these same methods. Many of the genes tested were validated and showed highly significant correlation or anti-correlation to lupus samples.
  • Hierarchical cluster analysis (Eisen et al. 1998, Example 9) identified both known and undescribed genes that are coexpressed with genes that showed promise in either the array or PCR data as being markers of SLE (Table 2D). Genes were thus grouped into pathways.
  • IFN-a levels are elevated in sera from patients with SLE, RA, Sjogren's syndrome, and scleroderma. IFN-a may also be involved in the very earliest events that initiate autoimmunity. Identification of the specific IFN-a gene products expressed in SLE may allow selective therapeutic targeting of pathogenic cytokines while sparing those IFN's that are protective in the setting of virus infection. Table 1: Samples used in array and PCR expression profiling experiments
  • Table 2A Si nificance anal sis for Microarra s, Lu us/Autoimmune merkers
  • Table 2A Si nificance anal sis for Microarra s, Lu us/Autoimmune merkers
  • Table 2A Si nificance anal sis for Microarra s, Lu us/Autoimmune merkers
  • Table 2A Si nificance analysis for Microarra s, Lupus/Autoimmune merkers
  • Table 2A Si nificance anal sis for Microarra s, Lupus/Autoimmune merkers
  • Table 2A Si nificance anal sis for Microarrays, Lu us/Autoimmune merkers
  • Table 2A Si nificance anal sis for Microarra s, Lu us/Autoimmune merkers
  • Table 2D Hierarchical Clusterin of Lu us/Autoimmunit Markers
  • Table 4 Real-time PCR assay chemistries. Narious combinations of reporter and quencher dyes are useful for real-time PCR assays.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Pulmonology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Cardiology (AREA)
  • Rheumatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Dermatology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Neurology (AREA)
  • Diabetes (AREA)
PCT/US2003/013015 2001-10-22 2003-04-24 Methods and compositions for diagnosing and monitoring auto immune and chronic inflammatory diseases WO2003090694A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU2003231132A AU2003231132A1 (en) 2002-04-24 2003-04-24 Methods and compositions for diagnosing and monitoring auto immune and chronic inflammatory diseases
US10/512,028 US7604936B2 (en) 2002-04-24 2003-04-24 Methods and compositions for diagnosis and monitoring auto immune and chronic inflammatory diseases
JP2003587333A JP4741191B2 (ja) 2002-04-24 2003-04-24 自己免疫疾患および慢性炎症性疾患を診断およびモニタリングするための方法および組成物
US12/561,213 US7771950B2 (en) 2002-04-24 2009-09-16 Methods and compositions for diagnosing and monitoring auto immune and chronic inflammatory diseases
US12/829,172 US20110070584A1 (en) 2001-10-22 2010-07-01 Methods and compositions for diagnosing and monitoring autoimmune and chronic inflammatory diseases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10/131,827 US6905827B2 (en) 2001-06-08 2002-04-24 Methods and compositions for diagnosing or monitoring auto immune and chronic inflammatory diseases
US10/131,827 2002-04-24

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/131,827 Continuation-In-Part US6905827B2 (en) 2001-06-08 2002-04-24 Methods and compositions for diagnosing or monitoring auto immune and chronic inflammatory diseases

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US10/512,028 A-371-Of-International US7604936B2 (en) 2002-04-24 2003-04-24 Methods and compositions for diagnosis and monitoring auto immune and chronic inflammatory diseases
US12/561,213 Division US7771950B2 (en) 2001-10-22 2009-09-16 Methods and compositions for diagnosing and monitoring auto immune and chronic inflammatory diseases

Publications (2)

Publication Number Publication Date
WO2003090694A2 true WO2003090694A2 (en) 2003-11-06
WO2003090694A3 WO2003090694A3 (en) 2004-11-18

Family

ID=29268744

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/013015 WO2003090694A2 (en) 2001-10-22 2003-04-24 Methods and compositions for diagnosing and monitoring auto immune and chronic inflammatory diseases

Country Status (4)

Country Link
US (7) US6905827B2 (US07604936-20091020-C00031.png)
JP (3) JP4741191B2 (US07604936-20091020-C00031.png)
AU (1) AU2003231132A1 (US07604936-20091020-C00031.png)
WO (1) WO2003090694A2 (US07604936-20091020-C00031.png)

Cited By (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005068655A2 (en) * 2004-01-16 2005-07-28 Cambridge University Technical Services Limited Methods of assessing a tissue inflammatory response using expression profiles of endothelial cells
WO2005106471A2 (en) * 2004-04-30 2005-11-10 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with c-c chemokine receptor 4 (ccr4)
JP2005314397A (ja) * 2004-03-31 2005-11-10 Mitsubishi Chemicals Corp 抗コンドロモジュリン−1特異的抗体及びその利用
US7118865B2 (en) 2002-08-16 2006-10-10 Regents Of The University Of Minnesota Methods for diagnosing severe systemic lupus erythematosus
JP2006333770A (ja) * 2005-06-01 2006-12-14 Japan Science & Technology Agency 血管炎(angiitis)患者の血液細胞特異的遺伝子群
WO2007019219A3 (en) * 2005-08-05 2007-05-31 Genentech Inc Methods and compositions for detecting autoimmune disorders
EP1795610A1 (en) * 2005-12-06 2007-06-13 Oligene GmbH A composition of nucleic acid sequences, specific for inflammatory disease, in particular rheumatoid arthritis
WO2008060785A2 (en) * 2006-10-06 2008-05-22 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Prevention of tissue ischemia, related methods and compositions
EP2005175A2 (en) * 2006-04-07 2008-12-24 Hitachi Chemical Company, Ltd. Enhanced t cell receptor-mediated tumor necrosis factor superfamily and chemokine mrna expression in peripheral blood leukocytes in patients with crohn's disease
US7473528B2 (en) 1999-01-06 2009-01-06 Genenews Inc. Method for the detection of Chagas disease related gene transcripts in blood
US7571055B2 (en) 2004-10-13 2009-08-04 Regents Of The University Of Minnesota Systemic lupus erythematosus
WO2010067308A2 (en) 2008-12-08 2010-06-17 Compugen Ltd. Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics
US7741023B2 (en) 2005-06-08 2010-06-22 Hitachi Chemical Co., Ltd. Method for predicting immune response to neoplastic disease based on mRNA expression profile in neoplastic cells and stimulated leukocytes
EP2215254A1 (en) * 2007-10-05 2010-08-11 Pacific Edge Biotechnology Ltd Proliferation signature and prognosis for gastrointestinal cancer
US7820382B2 (en) * 2004-08-03 2010-10-26 Bauer A Robert Method for the early detection of breast cancer, lung cancer, pancreatic cancer and colon polyps, growths and cancers as well as other gastrointestinal disease conditions and the preoperative and postoperative monitoring of transplanted organs from the donor and in the recipient and their associated conditions related and unrelated to the organ transplantation
EP2264071A1 (en) * 2008-03-14 2010-12-22 Medinet., Co. Ltd. Antibody having an immune-enhancement function
US8080373B2 (en) 2004-08-03 2011-12-20 Bauer Jr A Robert Method for the early detection of pancreatic cancer and other gastrointestinal disease conditions
US8110364B2 (en) 2001-06-08 2012-02-07 Xdx, Inc. Methods and compositions for diagnosing or monitoring autoimmune and chronic inflammatory diseases
US8142998B2 (en) 2003-08-08 2012-03-27 Genenews, Inc. Osteoarthritis biomarkers and uses thereof
US8148074B2 (en) 2006-03-31 2012-04-03 Regents Of The University Of Minnesota IRF-5 haplotypes in systemic lupus erythematosus
EP2441848A1 (de) * 2010-10-12 2012-04-18 Protagen AG Markersequenzen für systemischer Lupus Erythematodes und deren Verwendung
US8268566B2 (en) 2006-04-07 2012-09-18 Hitachi Chemical Research Center, Inc. Enhanced FC receptor-mediated tumor necrosis factor superfamily MRNA expression in peripheral blood leukocytes in patients with rheumatoid arthritis
US8962249B2 (en) 2006-04-24 2015-02-24 Genentech, Inc. Methods for detecting and treating systemic lupus erythematous
US8999335B2 (en) 2010-09-17 2015-04-07 Compugen Ltd. Compositions and methods for treatment of drug resistant multiple myeloma
EP2884279A3 (de) * 2007-09-03 2015-10-07 Protagen AG Markersequenzen für Multiple Sklerose und deren Verwendung
US10316083B2 (en) 2013-07-19 2019-06-11 Cedars-Sinai Medical Center Signature of TL1A (TNFSF15) signaling pathway
US10633449B2 (en) 2013-03-27 2020-04-28 Cedars-Sinai Medical Center Treatment and reversal of fibrosis and inflammation by inhibition of the TL1A-DR3 signaling pathway
US11028443B2 (en) 2015-08-31 2021-06-08 Showa Denko Materials Co., Ltd. Molecular methods for assessing urothelial disease
US11186872B2 (en) 2016-03-17 2021-11-30 Cedars-Sinai Medical Center Methods of diagnosing inflammatory bowel disease through RNASET2
US11236393B2 (en) 2008-11-26 2022-02-01 Cedars-Sinai Medical Center Methods of determining responsiveness to anti-TNFα therapy in inflammatory bowel disease
CN114127288A (zh) * 2019-05-14 2022-03-01 莫纳什大学 晚期糖基化终产物受体rna的调节剂和调节
EP4099015A1 (en) * 2016-06-10 2022-12-07 Gadeta B.V. Novel method for identifying deltat-cell (or gammat-cell) receptor chains or parts thereof that mediate an anti-tumour or an anti-infective response
WO2023012356A3 (en) * 2021-08-06 2023-03-16 INSERM (Institut National de la Santé et de la Recherche Médicale) New method to diagnose inflammatory diseases
US11686724B2 (en) 2012-03-28 2023-06-27 Gadeta B.V. Compositions comprising gamma 9 delta 2 T-cell receptors and methods of use thereof to treat cancer
CN117153316A (zh) * 2023-09-05 2023-12-01 中普达科技股份有限公司 一种多用户的医疗信息采集终端的管理系统
WO2023235773A1 (en) * 2022-06-01 2023-12-07 Genentech, Inc. Method to identify a patient with an increased likelihood of chronic spontaneous urticaria

Families Citing this family (233)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040146879A1 (en) * 1998-08-31 2004-07-29 Bayer Healthcare Llc Novel human genes and gene expression products
US20080070243A1 (en) * 1999-06-28 2008-03-20 Michael Bevilacqua Gene expression profiling for identification, monitoring and treatment of multiple sclerosis
US7146209B2 (en) * 2000-05-08 2006-12-05 Brainsgate, Ltd. Stimulation for treating eye pathologies
US7117033B2 (en) * 2000-05-08 2006-10-03 Brainsgate, Ltd. Stimulation for acute conditions
EP1286621A4 (en) * 2000-05-08 2009-01-21 Brainsgate Ltd METHOD AND DEVICE FOR SPREADING THE SPHENOPALATINEN GANGLION TO CHANGE PROPERTIES OF THE BLOOD BRAIN BARRIER AND CEREBRAL BLOOD FLOW
US7432060B2 (en) 2000-11-09 2008-10-07 The Brigham And Women's Hospital, Inc. Methods for diagnosis of cardiovascular disease
JP2002300883A (ja) * 2001-04-05 2002-10-15 Jenokkusu Soyaku Kenkyusho:Kk ステロイド応答性の検査方法
US7026121B1 (en) 2001-06-08 2006-04-11 Expression Diagnostics, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US7235358B2 (en) * 2001-06-08 2007-06-26 Expression Diagnostics, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
CA2459758A1 (en) * 2001-09-04 2003-03-13 International Business Machines Corporation A sampling approach for data mining of association rules
EP1427858A2 (en) * 2001-09-12 2004-06-16 F. Hoffmann-La Roche Ag Specific markers for multiple sclerosis
EP2385123B1 (en) * 2001-09-28 2018-04-25 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Microrna molecules
US20030198959A1 (en) * 2002-03-28 2003-10-23 Kurnit David M. Methods and compositions for analysis of urine samples in the diagnosis and treatment of kidney diseases
US7684859B2 (en) * 2002-04-25 2010-03-23 Brainsgate Ltd. Stimulation of the OTIC ganglion for treating medical conditions
IL164828A0 (en) * 2002-04-25 2005-12-18 Brainsgate Ltd Methods and apparatus for modifying properties of the bbb and cerebral circulation by using the neuroexcitatory and/or neuroinhibitory effects of odorants on nerves in the head
HUE039881T2 (hu) 2002-05-09 2019-02-28 Brigham & Womens Hospital Inc 1L1RL-1, mint egy kardiovaszkuláris betegség-marker
US7221785B2 (en) * 2002-05-21 2007-05-22 Agilent Technologies, Inc. Method and system for measuring a molecular array background signal from a continuous background region of specified size
US20040137441A1 (en) * 2003-01-15 2004-07-15 Isis Pharmaceuticals Inc. Modulation of thyroid hormone receptor interactor 3 expression
AU2003243859A1 (en) * 2002-06-20 2004-01-06 Mcgill University Oligonucleotide inhibitors of mbd2/dna demethylase and uses thereof
US20040043405A1 (en) * 2002-07-17 2004-03-04 Gene Logic, Inc. Nucleic acid detection assay control genes
US8722872B2 (en) 2002-10-02 2014-05-13 The University Of British Columbia Compositions and methods for treatment of prostate and other cancers
EP1545561B1 (en) * 2002-10-02 2010-04-28 The University of British Columbia Oligonucleotides for treatment of prostate and other cancers
JP2006515999A (ja) * 2002-11-14 2006-06-15 ブレインズゲート リミティド 刺激のための外科用ツール及び技法
US7561919B2 (en) * 2002-11-14 2009-07-14 Brainsgate Ltd. SPG stimulation via the greater palatine canal
US20040143403A1 (en) * 2002-11-14 2004-07-22 Brandon Richard Bruce Status determination
US20040185481A1 (en) * 2003-02-06 2004-09-23 Canon Kabushiki Kaisha Testing method using DNA microarray
US7282331B2 (en) * 2003-03-18 2007-10-16 Advandx, Inc. Method for improved specificity in probe based assays
US7892745B2 (en) * 2003-04-24 2011-02-22 Xdx, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US20050208518A1 (en) * 2003-05-16 2005-09-22 Longueville Francoise D Method and apparatus for determination of RNAi cell transfection effects by multiple gene expression analysis on micro-arrays
US20040229225A1 (en) * 2003-05-16 2004-11-18 Jose Remacle Determination of a general three-dimensional status of a cell by multiple gene expression analysis on micro-arrays
DK2270159T3 (en) * 2003-05-21 2015-04-20 Andes Biotechnologies S A Markers for pre-cancerous cells and cancer cells and a method for affecting cell proliferation
CA2527863A1 (en) * 2003-06-02 2004-12-23 Alexion Pharmaceuticals, Inc. Cell surface protein associated with human chronic lymphocytic leukemia
US7947450B2 (en) 2003-07-10 2011-05-24 Universite Libre De Bruxelles Device, kit and method for pulsing biological samples with an agent and stabilising the sample so pulsed
CA2545494C (en) * 2003-07-10 2009-12-29 Universite Libre De Bruxelles Device, kit and method for pulsing biological samples with an agent and stabilising the sample so pulsed
ITRM20030376A1 (it) 2003-07-31 2005-02-01 Univ Roma Procedimento per l'isolamento e l'espansione di cellule staminali cardiache da biopsia.
US7888497B2 (en) * 2003-08-13 2011-02-15 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
US8538704B2 (en) * 2003-10-06 2013-09-17 Cerner Innovation, Inc. Computerized method and system for inferring genetic findings for a patient
US7101679B2 (en) 2003-11-25 2006-09-05 Mayo Foundation For Medical Education And Research Marker for neuromyelitis optica
US8053182B2 (en) * 2004-01-30 2011-11-08 The Trustees Of The University Of Pennsylvania Predictors of transplant rejection determined by peripheral blood gene-expression profiling
CA2557438C (en) * 2004-02-19 2017-01-17 Yale University Identification of cancer protein biomarkers using proteomic techniques
US8055347B2 (en) 2005-08-19 2011-11-08 Brainsgate Ltd. Stimulation for treating brain events and other conditions
US8010189B2 (en) * 2004-02-20 2011-08-30 Brainsgate Ltd. SPG stimulation for treating complications of subarachnoid hemorrhage
US9233245B2 (en) 2004-02-20 2016-01-12 Brainsgate Ltd. SPG stimulation
US7552005B2 (en) * 2004-03-16 2009-06-23 Honeywell International Inc. Method for fault diagnosis of a turbine engine
US7387877B2 (en) * 2004-04-06 2008-06-17 Oro Grande Technology Bio-sensor and bio-sensor reporting system
US20050260659A1 (en) * 2004-04-23 2005-11-24 Exagen Diagnostics, Inc. Compositions and methods for breast cancer prognosis
JP4903703B2 (ja) * 2004-06-10 2012-03-28 ザイモジェネティクス, インコーポレイテッド 可溶性ZcytoR14、抗ZcytoR14抗体および結合相手ならびに炎症における使用方法
US20060094018A1 (en) * 2004-08-03 2006-05-04 Bauer A R Jr Discovery and a method for the early detection of pancreatic cancer and other disease conditions
US20080280282A1 (en) * 2004-08-03 2008-11-13 Bauer Jr A Robert Method for early detection of various cancers and gastrointestinal disease and monitoring of transplanted organs
WO2006021957A2 (en) * 2004-08-23 2006-03-02 Brainsgate Ltd. Concurrent bilateral spg modulation
US20090083075A1 (en) * 2004-09-02 2009-03-26 Cornell University System and method for analyzing medical data to determine diagnosis and treatment
US20060059145A1 (en) * 2004-09-02 2006-03-16 Claudia Henschke System and method for analyzing medical data to determine diagnosis and treatment
US7645575B2 (en) * 2004-09-08 2010-01-12 Xdx, Inc. Genes useful for diagnosing and monitoring inflammation related disorders
US20060094028A1 (en) * 2004-11-04 2006-05-04 Welch Allyn, Inc. Rapid diagnostic assay
NZ555575A (en) * 2004-11-05 2010-11-26 Us Gov Sec Navy Diagnosis and prognosis of infectious disease clinical phenotypes and other physiologic states using host gene expression biomarkers in blood
US11660317B2 (en) 2004-11-08 2023-05-30 The Johns Hopkins University Compositions comprising cardiosphere-derived cells for use in cell therapy
US20080311572A1 (en) * 2004-11-26 2008-12-18 Ahuja Sunil K Methods and Compositions For Correlating Ccl3l1/Ccr5 Genotypes With Disorders
AU2005332331A1 (en) * 2004-11-26 2006-12-07 Board Of Regents, The University Of Texas System Methods and compositions for correlating CCL3L1/CCR5 genotypes with disorders
US20060129324A1 (en) * 2004-12-15 2006-06-15 Biogenesys, Inc. Use of quantitative EEG (QEEG) alone and/or other imaging technology and/or in combination with genomics and/or proteomics and/or biochemical analysis and/or other diagnostic modalities, and CART and/or AI and/or statistical and/or other mathematical analysis methods for improved medical and other diagnosis, psychiatric and other disease treatment, and also for veracity verification and/or lie detection applications.
US7356521B2 (en) * 2005-01-14 2008-04-08 Siemens Medical Solutions Usa, Inc. System and method for automatic molecular diagnosis of ALS based on boosting classification
US7951078B2 (en) * 2005-02-03 2011-05-31 Maren Theresa Scheuner Method and apparatus for determining familial risk of disease
US20060194238A1 (en) * 2005-02-28 2006-08-31 Norman Latov Peripheral neuropathy diagnosis
US20060194237A1 (en) * 2005-02-28 2006-08-31 Norman Latov Method for diagnosing peripheral neuropathy
EP1885889A4 (en) * 2005-05-11 2010-01-20 Expression Diagnostics Inc METHOD FOR MONITORING THE OPERATING STATUS OF TRANSPLANTS OVER GENLISTS
US20090191543A1 (en) * 2005-05-27 2009-07-30 Theregents Of The University Of California Identification of rac1b as a marker and mediator of metalloproteinase-induced malignancy
US20070099239A1 (en) * 2005-06-24 2007-05-03 Raymond Tabibiazar Methods and compositions for diagnosis and monitoring of atherosclerotic cardiovascular disease
US7803932B2 (en) * 2005-07-15 2010-09-28 The Trustees Of Columbia University In The City Of New York Compositions and methods for inhibiting EB-1-mediated microtubule stability
WO2007030531A2 (en) * 2005-09-06 2007-03-15 Molecular Image Inc. Reagents for testing and molecular imaging of liver cancer
WO2007038501A2 (en) * 2005-09-27 2007-04-05 The Feinstein Institute For Medical Research Rheumatoid arthritis markers
US20070249533A1 (en) * 2005-09-28 2007-10-25 Levin Steven D Il-17a and il-17f antagonists and methods of using the same
WO2007044937A2 (en) * 2005-10-13 2007-04-19 President And Fellows Of Harvard College Compositions and methods to modulate memory
US20070231816A1 (en) * 2005-12-09 2007-10-04 Baylor Research Institute Module-Level Analysis of Peripheral Blood Leukocyte Transcriptional Profiles
US20070238094A1 (en) * 2005-12-09 2007-10-11 Baylor Research Institute Diagnosis, prognosis and monitoring of disease progression of systemic lupus erythematosus through blood leukocyte microarray analysis
EP1801234A1 (en) * 2005-12-22 2007-06-27 Stichting Sanquin Bloedvoorziening Diagnostic methods involving determining gene copy numbers and use thereof
CA2648580A1 (en) * 2006-04-07 2008-05-02 Xdx, Inc. Steroid responsive nucleic acid expression and prediction of disease activity
AR060536A1 (es) * 2006-04-20 2008-06-25 Glaxo Group Ltd Agonista del receptor de glucocorticoides y composiciones farmaceuticas
ES2351623T3 (es) 2006-04-24 2011-02-08 Critical Care Diagnostics, Inc. Predicción de la mortalidad y detección de una enfermedad grave.
EP2021799B1 (en) * 2006-04-27 2011-07-20 Critical Care Diagnostics, Inc. Interleukin-33 (il-33) for the diagnosis and prognosis of cardiovascular disease
JP5377289B2 (ja) * 2006-05-01 2013-12-25 クリティカル ケア ダイアグノスティクス インコーポレイテッド 心血管疾患の診断方法
SI2019965T1 (sl) * 2006-05-02 2015-10-30 Critical Care Diagnostics, Inc. Diferencialna diagnoza med pljučno boleznijo in boleznijo srca in ožilja
JP5011830B2 (ja) * 2006-06-09 2012-08-29 富士通セミコンダクター株式会社 データ処理方法、データ処理プログラム、該プログラムを記録した記録媒体およびデータ処理装置
EP2037737B1 (en) 2006-07-11 2014-04-02 University Of Medicine And Dentistry Of New Jersey Cell membrane repair proteins, nucleic acids encoding the same and associated methods of use
GB0613844D0 (en) * 2006-07-12 2006-08-23 Progenika Biopharma Sa Methods and products for in vitro genotyping
CN101541976A (zh) * 2006-08-11 2009-09-23 贝勒研究院 利用血液白细胞中的基因表达标记物的急性感染的鉴别诊断
WO2008021431A2 (en) * 2006-08-14 2008-02-21 Xdx, Inc. Methods and compositions for diagnosing and monitoring the status of transplant rejection and immune disorders
US20090210026A1 (en) * 2006-08-17 2009-08-20 Brainsgate Ltd. Spg stimulation for enhancing neurogenesis and brain metabolism
WO2008027558A2 (en) 2006-08-31 2008-03-06 Codon Devices, Inc. Iterative nucleic acid assembly using activation of vector-encoded traits
CN101557818A (zh) 2006-10-03 2009-10-14 新泽西医科和牙科大学 Atap肽、编码atap肽的核酸以及相关的应用方法
EP2102367A2 (en) * 2006-11-09 2009-09-23 XDX, Inc. Methods for diagnosing and monitoring the status of systemic lupus erythematosus
AU2007327993B2 (en) * 2006-12-06 2013-06-20 Medimmune, Llc. Methods of treating systemic lupus erythematosus
WO2008106781A1 (en) * 2007-03-05 2008-09-12 The University Of British Columbia Treatment of squamous cell carcinoma with hsp27 antisense oligonucleotides and radiotherapy
CA2718127A1 (en) * 2007-03-14 2008-09-18 Baylor Research Institute Gene expression in peripheral blood mononuclear cells from children with diabetes
US20080228699A1 (en) 2007-03-16 2008-09-18 Expanse Networks, Inc. Creation of Attribute Combination Databases
CN101679497A (zh) 2007-03-26 2010-03-24 津莫吉尼蒂克斯公司 可溶性il-17ra/rc融合蛋白以及相关方法
EP1975252A1 (en) * 2007-03-29 2008-10-01 INSERM (Institut National de la Santé et de la Recherche Medicale) Methods for the prognosis or for the diagnosis of a thyroid disease
US20100129361A1 (en) * 2007-05-01 2010-05-27 The Brigham And Women's Hospital Immunosuppression with antibody against itm2a
US20100261172A1 (en) * 2007-05-03 2010-10-14 Medimmune, Llc Interferon alpha-induced pharmacodynamic markers
WO2008148216A1 (en) * 2007-06-06 2008-12-11 Centre Hospitalier De L'universite De Montreal Drak2 expression is associated with diabetes
NZ581742A (en) * 2007-06-08 2012-09-28 Biogen Idec Inc Biomarkers for predicting anti-tnf responsiveness or non-responsiveness
US8962677B2 (en) * 2007-07-12 2015-02-24 Acumen Pharmaceuticals, Inc. Methods of restoring cognitive ability using non-peptidic compounds
US9006283B2 (en) 2007-07-12 2015-04-14 Acumen Pharmaceuticals, Inc. Methods of modifying amyloid β oligomers using non-peptidic compounds
US20110098309A1 (en) * 2007-07-12 2011-04-28 Acumen Pharmaceuticals, Inc. Methods of inhibiting the formation of amyloid-beta diffusable ligands using acylhydrazide compounds
WO2009015398A1 (en) * 2007-07-26 2009-01-29 Oklahoma Medical Research Foundation Methods for inflammatory disease management
US20090043752A1 (en) 2007-08-08 2009-02-12 Expanse Networks, Inc. Predicting Side Effect Attributes
US7968293B2 (en) * 2007-08-13 2011-06-28 Baxter International Inc. IVIG modulation of chemokines for treatment of multiple sclerosis, alzheimer's disease, and parkinson's disease
US7860569B2 (en) 2007-10-18 2010-12-28 Brainsgate, Ltd. Long-term SPG stimulation therapy for prevention of vascular dementia
US20090177450A1 (en) * 2007-12-12 2009-07-09 Lawrence Berkeley National Laboratory Systems and methods for predicting response of biological samples
BRPI0906858B8 (pt) 2008-01-18 2021-07-27 Harvard College métodos in vitro para detectar a presença de uma célula de câncer em um indivíduo e para identificar uma assinatura específica de tumor em um indivíduo tendo câncer.
JP2011509676A (ja) 2008-01-18 2011-03-31 ザ ブライハム アンド ウイメンズ ホスピタル, インコーポレイテッド ヒトTh17細胞の選択的分化、同定および調節
WO2009097593A1 (en) * 2008-01-30 2009-08-06 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Single nucleotide polymorphisms associated with renal disease
EP2752193B1 (en) 2008-03-03 2017-01-11 The University of Miami Allogeneic cancer cell-based immunotherapy
PT2269063E (pt) 2008-04-18 2013-11-27 Critical Care Diagnostics Inc Predição do risco de eventos cardíacos adversos maiores
CN102089444A (zh) 2008-05-14 2011-06-08 德玛泰克国际公司 利用核酸分析方法来诊断黑素瘤和太阳能雀斑
WO2010009398A1 (en) * 2008-07-18 2010-01-21 Xenomics, Inc. Methods for pcr-based detection of "ultra short" nucleic acid sequences
US20100255467A1 (en) * 2008-07-22 2010-10-07 Los Alamos National Security, Llc Assays for determining exposure to multiwalled carbon nanotubes
US8285719B1 (en) 2008-08-08 2012-10-09 The Research Foundation Of State University Of New York System and method for probabilistic relational clustering
US10679749B2 (en) 2008-08-22 2020-06-09 International Business Machines Corporation System and method for virtual world biometric analytics through the use of a multimodal biometric analytic wallet
WO2010025310A2 (en) 2008-08-27 2010-03-04 Westend Asset Clearinghouse Company, Llc Methods and devices for high fidelity polynucleotide synthesis
US7917438B2 (en) 2008-09-10 2011-03-29 Expanse Networks, Inc. System for secure mobile healthcare selection
US8200509B2 (en) 2008-09-10 2012-06-12 Expanse Networks, Inc. Masked data record access
US9580752B2 (en) 2008-12-24 2017-02-28 Cedars-Sinai Medical Center Methods of predicting medically refractive ulcerative colitis (MR-UC) requiring colectomy
US8386519B2 (en) 2008-12-30 2013-02-26 Expanse Networks, Inc. Pangenetic web item recommendation system
US8108406B2 (en) 2008-12-30 2012-01-31 Expanse Networks, Inc. Pangenetic web user behavior prediction system
TWI387750B (zh) * 2009-02-10 2013-03-01 Nat Defense Medical Ct Biomarker and detection method for detecting kidney disease
US20120073585A1 (en) * 2009-04-08 2012-03-29 Cedars-Sinai Medical Center Methods of predicting complication and surgery in crohn's disease
WO2010141954A1 (en) * 2009-06-06 2010-12-09 Ceetox, Inc. Method for predicting respiratory toxicity of compounds
CN107385034B (zh) * 2009-09-03 2021-08-17 弗·哈夫曼-拉罗切有限公司 用于治疗、诊断和监控类风湿性关节炎的方法
WO2011056872A2 (en) 2009-11-03 2011-05-12 Gen9, Inc. Methods and microfluidic devices for the manipulation of droplets in high fidelity polynucleotide assembly
WO2011066185A1 (en) 2009-11-25 2011-06-03 Gen9, Inc. Microfluidic devices and methods for gene synthesis
US9315857B2 (en) 2009-12-15 2016-04-19 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse label-tags
US8835358B2 (en) 2009-12-15 2014-09-16 Cellular Research, Inc. Digital counting of individual molecules by stochastic attachment of diverse labels
WO2011085075A2 (en) 2010-01-07 2011-07-14 Gen9, Inc. Assembly of high fidelity polynucleotides
JP5806122B2 (ja) * 2010-02-08 2015-11-10 国立大学法人浜松医科大学 潰瘍性大腸炎の検出方法
US20110195854A1 (en) * 2010-02-09 2011-08-11 Cornell Research Foundation, Inc. Detecting and monitoring inflammatory neuropathy
US9845457B2 (en) 2010-04-30 2017-12-19 Cedars-Sinai Medical Center Maintenance of genomic stability in cultured stem cells
US9249392B2 (en) 2010-04-30 2016-02-02 Cedars-Sinai Medical Center Methods and compositions for maintaining genomic stability in cultured stem cells
BR112013001685B1 (pt) 2010-07-23 2021-10-13 Sigma-Aldrich Co. Llc Método para editar pelo menos uma sequência cromossômica endógena em uma célula pela inserção de uma sequência na sequência cromossômica
EP2596116A4 (en) 2010-07-23 2014-03-19 Harvard College METHODS FOR DETECTION OF AUTOIMMUNE OR IMMUNE-RELATED DISEASES / PATHOLOGIES
AU2011280936A1 (en) 2010-07-23 2013-02-28 President And Fellows Of Harvard College Methods of detecting prenatal or pregnancy-related diseases or conditions
CA2806296A1 (en) * 2010-07-23 2012-01-26 President And Fellows Of Harvard College Methods of detecting kidney-associated diseases or conditions
US20130216557A1 (en) * 2010-08-14 2013-08-22 Biogen Idec Ma Inc. Ltbr blockade: methods for optimizing therapeutic responsiveness of patients
US9295965B2 (en) 2010-11-12 2016-03-29 Gen9, Inc. Methods and devices for nucleic acid synthesis
EP2637780B1 (en) 2010-11-12 2022-02-09 Gen9, Inc. Protein arrays and methods of using and making the same
US20120164642A1 (en) * 2010-12-22 2012-06-28 Erickson-Johnson Michele R Methods and materials for identifying nodular fasciitis
US9902996B2 (en) 2011-02-11 2018-02-27 Cedars-Sinai Medical Center Methods of predicting the need for surgery in crohn's disease
US8728742B2 (en) 2011-03-17 2014-05-20 Critical Care Diagnostics, Inc. Methods predicting risk of an adverse clinical outcome
JP6072768B2 (ja) * 2011-04-15 2017-02-01 チルドレンズ メディカル センター コーポレーション 川崎病の診断マーカーおよび治療標的
EA036545B1 (ru) * 2011-05-25 2020-11-20 Иннейт Фарма, С.А. Анти-kir антитела для лечения воспалительных заболеваний
US9752176B2 (en) 2011-06-15 2017-09-05 Ginkgo Bioworks, Inc. Methods for preparative in vitro cloning
US9708643B2 (en) * 2011-06-17 2017-07-18 Affymetrix, Inc. Circulating miRNA biomaker signatures
US20130059296A1 (en) 2011-08-26 2013-03-07 Gen9, Inc. Compositions and Methods For High Fidelity Assembly of Nucleic Acids
WO2013040062A2 (en) * 2011-09-12 2013-03-21 Vanderbilt University Characterizing multiple sclerosis
RU2459209C1 (ru) * 2011-09-13 2012-08-20 Зарема Римовна Хисматуллина Способ прогнозирования степени тяжести акне у пациентов с дисбиозом кишечника
EP2602621A1 (en) * 2011-12-08 2013-06-12 Julius-Maximilians-Universität Würzburg LASP-1, a novel urinary marker for transitional cell carcinoma detection
GB2513024B (en) 2012-02-27 2016-08-31 Cellular Res Inc A clonal amplification method
US11177020B2 (en) 2012-02-27 2021-11-16 The University Of North Carolina At Chapel Hill Methods and uses for molecular tags
US9150853B2 (en) 2012-03-21 2015-10-06 Gen9, Inc. Methods for screening proteins using DNA encoded chemical libraries as templates for enzyme catalysis
CA2871505C (en) 2012-04-24 2021-10-12 Gen9, Inc. Methods for sorting nucleic acids and multiplexed preparative in vitro cloning
AR091069A1 (es) 2012-05-18 2014-12-30 Amgen Inc Proteinas de union a antigeno dirigidas contra el receptor st2
EP2861238A4 (en) 2012-06-05 2016-03-16 Capricor Inc OPTIMIZED METHODS FOR GENERATING CARDIAC STEM CELLS FROM CARDIAC TISSUE AND THEIR USE IN CARDIAC THERAPY
US20150191719A1 (en) 2012-06-25 2015-07-09 Gen9, Inc. Methods for Nucleic Acid Assembly and High Throughput Sequencing
EP2882445B1 (en) 2012-08-13 2019-04-24 Cedars-Sinai Medical Center Exosomes and micro-ribonucleic acids for tissue regeneration
CA2882303A1 (en) 2012-08-21 2014-02-27 Critical Care Diagnostics, Inc. Multimarker risk stratification
CN104797933A (zh) 2012-09-07 2015-07-22 阿尔伯达大学董事会 用于诊断发炎性肝病的方法和组合物
CA2885216A1 (en) 2012-09-17 2014-03-20 The Research Institute At Nationwide Children's Hospital Compositions and methods for treating amyotrophic lateral sclerosis
US10494675B2 (en) 2013-03-09 2019-12-03 Cell Mdx, Llc Methods of detecting cancer
US20150032681A1 (en) * 2013-07-23 2015-01-29 International Business Machines Corporation Guiding uses in optimization-based planning under uncertainty
GB2525104B (en) 2013-08-28 2016-09-28 Cellular Res Inc Massively Parallel Single Cell Nucleic Acid Analysis
JP2017504307A (ja) 2013-10-07 2017-02-09 セルラー リサーチ, インコーポレイテッド アレイ上のフィーチャーをデジタルカウントするための方法およびシステム
EP3065784A4 (en) 2013-11-05 2017-05-10 The Research Institute at Nationwide Children's Hospital COMPOSITIONS AND METHODS FOR INHIBITING NF- kB AND SOD-1 TO TREAT AMYOTROPHIC LATERAL SCLEROSIS
US9675796B2 (en) 2013-11-10 2017-06-13 Brainsgate Ltd. Implant and delivery system for neural stimulator
CA2935022A1 (en) 2013-12-27 2015-07-02 Bonac Corporation Artificial match-type mirna for controlling gene expression and use therefor
US11357799B2 (en) 2014-10-03 2022-06-14 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy
US20170298402A1 (en) * 2014-10-03 2017-10-19 President And Fellows Of Harvard College Self-labeling nucleic acids and methods of use
US10417225B2 (en) 2015-09-18 2019-09-17 Splunk Inc. Entity detail monitoring console
EP3239297B1 (en) 2014-12-27 2021-03-10 Bonac Corporation Naturally occuring mirna for controlling gene expression, and use of same
EP3259371B1 (en) 2015-02-19 2020-09-02 Becton, Dickinson and Company High-throughput single-cell analysis combining proteomic and genomic information
WO2016138496A1 (en) 2015-02-27 2016-09-01 Cellular Research, Inc. Spatially addressable molecular barcoding
US11142769B2 (en) 2015-03-27 2021-10-12 Bonac Corporation Single-stranded nucleic acid molecule having delivery function and gene expression regulating ability
US11535882B2 (en) 2015-03-30 2022-12-27 Becton, Dickinson And Company Methods and compositions for combinatorial barcoding
WO2016172373A1 (en) 2015-04-23 2016-10-27 Cellular Research, Inc. Methods and compositions for whole transcriptome amplification
US10437910B2 (en) 2015-04-29 2019-10-08 Entit Software Llc Trend correlations
EP3093043B1 (en) 2015-05-13 2018-11-14 Brainsgate Ltd. Implant and delivery system for neural stimulator
US11124823B2 (en) 2015-06-01 2021-09-21 Becton, Dickinson And Company Methods for RNA quantification
EP3347465B1 (en) 2015-09-11 2019-06-26 Cellular Research, Inc. Methods and compositions for nucleic acid library normalization
BR112018013323A2 (pt) * 2015-12-29 2018-12-11 National University Corporation Hokkaido University molécula de ácido nucleico, inibidor de expressão, medicamento, agente terapêutico, método para inibir expressão de um gene pró-renina ou um gene receptor pró-renina, e, uso de uma molécula de ácido nucleico.
EP3402543B1 (en) 2016-01-11 2021-09-08 Cedars-Sinai Medical Center Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of heart failure with preserved ejection fraction
EP3452614B1 (en) 2016-05-02 2023-06-28 Becton, Dickinson and Company Accurate molecular barcoding
US10301677B2 (en) 2016-05-25 2019-05-28 Cellular Research, Inc. Normalization of nucleic acid libraries
WO2017205691A1 (en) 2016-05-26 2017-11-30 Cellular Research, Inc. Molecular label counting adjustment methods
US10202641B2 (en) 2016-05-31 2019-02-12 Cellular Research, Inc. Error correction in amplification of samples
US10640763B2 (en) 2016-05-31 2020-05-05 Cellular Research, Inc. Molecular indexing of internal sequences
US11351200B2 (en) 2016-06-03 2022-06-07 Cedars-Sinai Medical Center CDC-derived exosomes for treatment of ventricular tachyarrythmias
WO2018057542A1 (en) 2016-09-20 2018-03-29 Cedars-Sinai Medical Center Cardiosphere-derived cells and their extracellular vesicles to retard or reverse aging and age-related disorders
CA3034924A1 (en) 2016-09-26 2018-03-29 Cellular Research, Inc. Measurement of protein expression using reagents with barcoded oligonucleotide sequences
KR20190077061A (ko) 2016-11-08 2019-07-02 셀룰러 리서치, 인크. 세포 표지 분류 방법
CN109952612B (zh) 2016-11-08 2023-12-01 贝克顿迪金森公司 用于表达谱分类的方法
WO2018132610A1 (en) 2017-01-13 2018-07-19 Cellular Research, Inc. Hydrophilic coating of fluidic channels
US11319583B2 (en) 2017-02-01 2022-05-03 Becton, Dickinson And Company Selective amplification using blocking oligonucleotides
EP3612191A4 (en) 2017-04-19 2020-12-30 Cedars-Sinai Medical Center METHODS AND COMPOSITIONS FOR TREATING SKELETAL MUSCLE DYSTROPHY
AU2018281745B2 (en) 2017-06-05 2022-05-19 Becton, Dickinson And Company Sample indexing for single cells
WO2019009606A1 (ko) * 2017-07-05 2019-01-10 고려대학교 산학협력단 Mir-4507 microrna 유효 성분으로 함유하는 피부염의 예방 또는 치료용 약학 조성물
CN107463879A (zh) * 2017-07-05 2017-12-12 成都数联铭品科技有限公司 基于深度学习的人体行为识别方法
US11106442B1 (en) 2017-09-23 2021-08-31 Splunk Inc. Information technology networked entity monitoring with metric selection prior to deployment
US11093518B1 (en) 2017-09-23 2021-08-17 Splunk Inc. Information technology networked entity monitoring with dynamic metric and threshold selection
US11159397B2 (en) 2017-09-25 2021-10-26 Splunk Inc. Lower-tier application deployment for higher-tier system data monitoring
WO2019126209A1 (en) 2017-12-19 2019-06-27 Cellular Research, Inc. Particles associated with oligonucleotides
US11660355B2 (en) 2017-12-20 2023-05-30 Cedars-Sinai Medical Center Engineered extracellular vesicles for enhanced tissue delivery
JP2021511019A (ja) * 2018-01-24 2021-05-06 ジェネンテック, インコーポレイテッド 関節リウマチ(ra)の処置のための診断方法及び治療方法
EP3752645A4 (en) 2018-02-14 2022-04-13 Dermtech, Inc. NEW GENE CLASSIFIERS AND THEIR USES IN NON-MELANOMA SKIN CANCERS
US12089930B2 (en) 2018-03-05 2024-09-17 Marquette University Method and apparatus for non-invasive hemoglobin level prediction
US11773441B2 (en) 2018-05-03 2023-10-03 Becton, Dickinson And Company High throughput multiomics sample analysis
WO2019213237A1 (en) 2018-05-03 2019-11-07 Becton, Dickinson And Company Molecular barcoding on opposite transcript ends
EP3813678A4 (en) 2018-05-09 2022-06-08 Dermtech, Inc. NOVEL GENE CLASSIFIERS AND USES THEREOF IN AUTOIMMUNE DISEASES
US10769543B2 (en) 2018-08-01 2020-09-08 Forcepoint Llc Double-layered image classification endpoint solution
WO2020072380A1 (en) 2018-10-01 2020-04-09 Cellular Research, Inc. Determining 5' transcript sequences
US11932849B2 (en) 2018-11-08 2024-03-19 Becton, Dickinson And Company Whole transcriptome analysis of single cells using random priming
CN113195717A (zh) 2018-12-13 2021-07-30 贝克顿迪金森公司 单细胞全转录组分析中的选择性延伸
US11371076B2 (en) 2019-01-16 2022-06-28 Becton, Dickinson And Company Polymerase chain reaction normalization through primer titration
ES2945227T3 (es) 2019-01-23 2023-06-29 Becton Dickinson Co Oligonucleótidos asociados con anticuerpos
US12071617B2 (en) 2019-02-14 2024-08-27 Becton, Dickinson And Company Hybrid targeted and whole transcriptome amplification
WO2020198229A1 (en) 2019-03-26 2020-10-01 Dermtech, Inc. Novel gene classifiers and uses thereof in skin cancers
US11965208B2 (en) 2019-04-19 2024-04-23 Becton, Dickinson And Company Methods of associating phenotypical data and single cell sequencing data
CN114051534A (zh) 2019-07-22 2022-02-15 贝克顿迪金森公司 单细胞染色质免疫沉淀测序测定
US20220146527A1 (en) * 2019-09-17 2022-05-12 Chang Gung University Method of creating characteristic profiles of mass spectra and identification model for analyzing and identifying features of microorganisms
JP7522189B2 (ja) 2019-11-08 2024-07-24 ベクトン・ディキンソン・アンド・カンパニー 免疫レパートリーシーケンシングのための完全長v(d)j情報を得るためのランダムプライミングの使用
EP4090763A1 (en) 2020-01-13 2022-11-23 Becton Dickinson and Company Methods and compositions for quantitation of proteins and rna
EP4150118A1 (en) 2020-05-14 2023-03-22 Becton Dickinson and Company Primers for immune repertoire profiling
US11932901B2 (en) 2020-07-13 2024-03-19 Becton, Dickinson And Company Target enrichment using nucleic acid probes for scRNAseq
EP4247967A1 (en) 2020-11-20 2023-09-27 Becton, Dickinson and Company Profiling of highly expressed and lowly expressed proteins
US11676072B1 (en) 2021-01-29 2023-06-13 Splunk Inc. Interface for incorporating user feedback into training of clustering model
CN113435168B (zh) * 2021-06-10 2024-03-22 上海美吉生物医药科技有限公司 胶图自动编辑方法、系统、终端及介质
CN116790737A (zh) * 2022-03-15 2023-09-22 中山大学附属口腔医院 Pik3ip1蛋白在制备诊断或治疗自身免疫性疾病的试剂或药物中的应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0217102A1 (en) * 1985-08-28 1987-04-08 Yeda Research And Development Company, Ltd. Interferon-induced (2'-5') oligo a synthetase gene, mRNA, cDNA and enzymes having (2'-5') oligo a synthetase activity
US6274312B1 (en) * 1996-12-11 2001-08-14 Schering Corporation Intracellular regulatory molecules; related reagents

Family Cites Families (224)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5981481A (en) 1974-12-06 1999-11-09 The Johns Hopkins University Human C3b/C4b receptor (CR1)
US5212071A (en) 1988-04-01 1993-05-18 The Johns Hopkins University Nucleic acids encoding a human C3b/C4b receptor (CR1)
US4350593A (en) 1977-12-19 1982-09-21 Becton, Dickinson And Company Assembly, compositions and method for separating blood
US4190535A (en) 1978-02-27 1980-02-26 Corning Glass Works Means for separating lymphocytes and monocytes from anticoagulated blood
US4215051A (en) * 1979-08-29 1980-07-29 Standard Oil Company (Indiana) Formation, purification and recovery of phthalic anhydride
US4376110A (en) * 1980-08-04 1983-03-08 Hybritech, Incorporated Immunometric assays using monoclonal antibodies
US4358535A (en) 1980-12-08 1982-11-09 Board Of Regents Of The University Of Washington Specific DNA probes in diagnostic microbiology
US4762780A (en) 1984-04-17 1988-08-09 The Regents Of The University Of California Method and composition for screening and diagnosing "HCMV"
US4582789A (en) 1984-03-21 1986-04-15 Cetus Corporation Process for labeling nucleic acids using psoralen derivatives
US4818418A (en) 1984-09-24 1989-04-04 Becton Dickinson And Company Blood partitioning method
US4751001A (en) 1984-09-24 1988-06-14 Becton Dickinson And Company Blood partitioning apparatus
US5264351A (en) 1984-11-05 1993-11-23 The Board Of Regents For The University Of Oklahoma Monoclonal antibodies against autoimmune RNA proteins
US5053134A (en) 1984-12-04 1991-10-01 Becton Dickinson And Company Lymphocyte collection tube
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US6040166A (en) * 1985-03-28 2000-03-21 Roche Molecular Systems, Inc. Kits for amplifying and detecting nucleic acid sequences, including a probe
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US6197563B1 (en) * 1985-03-28 2001-03-06 Roche Molecular Systems, Inc. Kits for amplifying and detecting nucleic acid sequences
US5011684A (en) 1985-09-05 1991-04-30 Beth Israel Hospital Association Lysing or blocking unwanted cells with IL-2 receptor-specific binding substance
US4789630A (en) 1985-10-04 1988-12-06 Cetus Corporation Ionic compounds containing the cationic meriquinone of a benzidine
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
CA1284931C (en) 1986-03-13 1991-06-18 Henry A. Erlich Process for detecting specific nucleotide variations and genetic polymorphisms present in nucleic acids
US5604099A (en) 1986-03-13 1997-02-18 Hoffmann-La Roche Inc. Process for detecting specific nucleotide variations and genetic polymorphisms present in nucleic acids
US5405774A (en) 1986-08-22 1995-04-11 Hoffmann-La Roche Inc. DNA encoding a mutated thermostable nucleic acid polymerase enzyme from thermus species sps17
US5310652A (en) 1986-08-22 1994-05-10 Hoffman-La Roche Inc. Reverse transcription with thermostable DNA polymerase-high temperature reverse transcription
US5322770A (en) 1989-12-22 1994-06-21 Hoffman-Laroche Inc. Reverse transcription with thermostable DNA polymerases - high temperature reverse transcription
US5466591A (en) 1986-08-22 1995-11-14 Hoffmann-La Roche Inc. 5' to 3' exonuclease mutations of thermostable DNA polymerases
US5561058A (en) 1986-08-22 1996-10-01 Hoffmann-La Roche Inc. Methods for coupled high temperatures reverse transcription and polymerase chain reactions
US5795762A (en) 1986-08-22 1998-08-18 Roche Molecular Systems, Inc. 5' to 3' exonuclease mutations of thermostable DNA polymerases
US5693517A (en) 1987-06-17 1997-12-02 Roche Molecular Systems, Inc. Reagents and methods for coupled high temperature reverse transcription and polymerase chain reactions
US5352600A (en) 1986-08-22 1994-10-04 Hoffmann-La Roche Inc. Purified thermostable enzyme
US5079352A (en) 1986-08-22 1992-01-07 Cetus Corporation Purified thermostable enzyme
US5455170A (en) 1986-08-22 1995-10-03 Hoffmann-La Roche Inc. Mutated thermostable nucleic acid polymerase enzyme from Thermus species Z05
US5374553A (en) 1986-08-22 1994-12-20 Hoffmann-La Roche Inc. DNA encoding a thermostable nucleic acid polymerase enzyme from thermotoga maritima
US5407800A (en) 1986-08-22 1995-04-18 Hoffmann-La Roche Inc. Reverse transcription with Thermus thermophilus polymerase
US6127155A (en) * 1986-08-22 2000-10-03 Roche Molecular Systems, Inc. Stabilized thermostable nucleic acid polymerase compositions containing non-ionic polymeric detergents
US4889818A (en) 1986-08-22 1989-12-26 Cetus Corporation Purified thermostable enzyme
US5618711A (en) 1986-08-22 1997-04-08 Hoffmann-La Roche Inc. Recombinant expression vectors and purification methods for Thermus thermophilus DNA polymerase
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US5063162A (en) 1987-04-24 1991-11-05 Hoffmann-La Roche Inc. Process for isolating nucleic acids utilizing protease digestion
CA1297431C (en) 1987-04-24 1992-03-17 F. Hoffmann-La Roche Ag Process for the isolation of nucleic acids
US4908318A (en) 1987-09-04 1990-03-13 Integrated Genetics, Inc. Nucleic acid extraction methods
US4843155A (en) 1987-11-19 1989-06-27 Piotr Chomczynski Product and process for isolating RNA
US5120525A (en) * 1988-03-29 1992-06-09 Immunomedics, Inc. Radiolabeled antibody cytotoxic therapy of cancer
US5693760A (en) * 1988-04-14 1997-12-02 Incyte Pharmaceuticals, Inc. Method of causing selective immunosuppression using HL-60 related lectins
US5075216A (en) 1988-09-23 1991-12-24 Cetus Corporation Methods for dna sequencing with thermus aquaticus dna polymerase
US5142033A (en) 1988-09-23 1992-08-25 Hoffmann-La Roche Inc. Structure-independent DNA amplification by the polymerase chain reaction
US5066584A (en) 1988-09-23 1991-11-19 Cetus Corporation Methods for generating single stranded dna by the polymerase chain reaction
US5091310A (en) 1988-09-23 1992-02-25 Cetus Corporation Structure-independent dna amplification by the polymerase chain reaction
US5389512A (en) 1988-10-07 1995-02-14 Hoffman-La Roche Inc. Method for determining the relative amount of a viral nucleic acid segment in a sample by the polymerase chain reaction
US6040138A (en) * 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US5143854A (en) 1989-06-07 1992-09-01 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof
US5219727A (en) 1989-08-21 1993-06-15 Hoffmann-Laroche Inc. Quantitation of nucleic acids using the polymerase chain reaction
US5340720A (en) 1989-11-29 1994-08-23 University Of Kansas Methods of diagnosing and monitoring rheumatic diseases
US5215882A (en) 1989-11-30 1993-06-01 Ortho Diagnostic Systems, Inc. Method of immobilizing nucleic acid on a solid surface for use in nucleic acid hybridization assays
CA2033692A1 (en) 1990-01-25 1991-07-26 Wilhelm Bannwarth Energy transfer systems
EP0515506B1 (en) 1990-02-16 2000-01-05 F. Hoffmann-La Roche Ag Improvements in the specificity and convenience of the polymerase chain reaction
US5344755A (en) 1990-04-21 1994-09-06 The United States Of America As Represented By The Department Of Health And Human Services Method for detecting immune system dysfunction in asymptomatic, HIV-scropositive individuals
US5350683A (en) * 1990-06-05 1994-09-27 Immunex Corporation DNA encoding type II interleukin-1 receptors
US5130423A (en) 1990-07-13 1992-07-14 Microprobe Corporation Non-corrosive compositions and methods useful for the extraction of nucleic acids
ATE176002T1 (de) 1990-07-24 1999-02-15 Hoffmann La Roche Verringerung von nicht spezifischer amplifikation während einer (in vitro) nukleinsäure amplifikation unter verwendung von modifizierten nukleinsäure basen
US5210015A (en) 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
AU658378B2 (en) 1990-09-28 1995-04-13 F. Hoffmann-La Roche Ag Purified thermostable nucleic acid polymerase enzyme from thermosipho africanus
DE4034036C2 (de) 1990-10-26 1994-03-03 Diagen Inst Molekularbio Vorrichtung und Verfahren zur Isolierung von Nukleinsäuren aus Zellsuspensionen
KR100244799B1 (ko) 1991-01-22 2000-03-02 에프.쥐.엠.헤르만스 항-알엔에이 항체의 검출 방법
JPH06506358A (ja) * 1991-03-28 1994-07-21 ザ・リージェンツ・オブ・ザ・ユニバーシティ・オブ・ミネソタ ナチュラルキラー細胞に特異的なdnaおよびアミノ酸配列
US5994056A (en) 1991-05-02 1999-11-30 Roche Molecular Systems, Inc. Homogeneous methods for nucleic acid amplification and detection
DE69213112T2 (de) 1991-06-20 1997-04-03 Hoffmann La Roche Verbesserte Methoden zur Nukleinsäure-Amplifizierung
US5445940A (en) 1991-08-28 1995-08-29 Brigham & Women's Hospital Methods and compositions for detecting and treating a subset of human patients having an autoimmune disease
AU667487B2 (en) 1991-10-01 1996-03-28 General Hospital Corporation, The Preventing allograft rejection with antibodies to adhesion molecules
US5346994A (en) 1992-01-28 1994-09-13 Piotr Chomczynski Shelf-stable product and process for isolating RNA, DNA and proteins
ES2082256T3 (es) 1992-03-23 1996-03-16 Hoffmann La Roche Metodo de deteccion del adn.
WO1993025713A1 (en) 1992-06-17 1993-12-23 Arch Development Corporation Compositions and methods for detecting gene rearrangements and translocations
GB2268935B (en) 1992-06-24 1996-10-23 Nat Heart & Lung Inst Diagnosis of rejection of transplanted organs
DK88892D0 (da) * 1992-07-06 1992-07-06 Novo Nordisk As Forbindelse
ES2194843T3 (es) 1992-09-11 2003-12-01 Hoffmann La Roche Deteccion de acidos nucleicos en sangre.
US5565339A (en) 1992-10-08 1996-10-15 Hoffmann-La Roche Inc. Compositions and methods for inhibiting dimerization of primers during storage of polymerase chain reaction reagents
WO1994018156A1 (en) * 1993-02-01 1994-08-18 University Of Iowa Research Foundation Quartenary amine surfactants and methods of using same in isolation of rna
AU669420B2 (en) * 1993-03-26 1996-06-06 Minnesota Mining And Manufacturing Company Oily mist resistant electret filter media
US6403304B1 (en) * 1993-04-06 2002-06-11 Forsyth Dental Infirmary For Children Human osteoclast-specific and -related DNA sequences
US5643765A (en) 1993-04-06 1997-07-01 University Of Rochester Method for quantitative measurement of gene expression using multiplex competitive reverse transcriptase-polymerase chain reaction
US5491086A (en) 1993-05-14 1996-02-13 Hoffmann-La Roche Inc. Purified thermostable nucleic acid polymerase and DNA coding sequences from pyrodictium species
US5837832A (en) 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
US5426039A (en) * 1993-09-08 1995-06-20 Bio-Rad Laboratories, Inc. Direct molecular cloning of primer extended DNA containing an alkane diol
US6045996A (en) * 1993-10-26 2000-04-04 Affymetrix, Inc. Hybridization assays on oligonucleotide arrays
US5459037A (en) 1993-11-12 1995-10-17 The Scripps Research Institute Method for simultaneous identification of differentially expressed mRNAs and measurement of relative concentrations
US5538848A (en) 1994-11-16 1996-07-23 Applied Biosystems Division, Perkin-Elmer Corp. Method for detecting nucleic acid amplification using self-quenching fluorescence probe
AU1513495A (en) 1993-12-14 1995-07-03 University Of Pittsburgh Systemic gene treatment of connective tissue diseases
US5527884A (en) * 1993-12-21 1996-06-18 President And Fellows Of Harvard College Mediators of chronic allograft rejection and DNA molecules encoding them
DK145393D0 (da) 1993-12-23 1993-12-23 Stig Haunsoe Proteinmarkoerer til forudsigelse af akut allotransplantatafstoedning
US5811284A (en) 1993-12-29 1998-09-22 Schering Corporation Nucleic acids encoding kp43 protein and antigenic fragments thereof
US5512462A (en) 1994-02-25 1996-04-30 Hoffmann-La Roche Inc. Methods and reagents for the polymerase chain reaction amplification of long DNA sequences
US6190872B1 (en) * 1994-05-06 2001-02-20 Gus J. Slotman Method for identifying and monitoring patients at risk for systemic inflammatory conditions and apparatus for use in this method
US5807522A (en) 1994-06-17 1998-09-15 The Board Of Trustees Of The Leland Stanford Junior University Methods for fabricating microarrays of biological samples
US5658744A (en) 1994-07-22 1997-08-19 The United States Of America As Represented By The Department Of Health And Human Services Methods of identifying patients having an altered immune status
US6010953A (en) * 1994-08-02 2000-01-04 Micron Technology, Inc. Method for forming a semiconductor buried contact with a removable spacer
US6010847A (en) 1994-08-18 2000-01-04 Akzo Nobel N.V. Oligonucleotides that can be used in the amplification and detection of CMV nucleic acid
US5491063A (en) 1994-09-01 1996-02-13 Hoffmann-La Roche Inc. Methods for in-solution quenching of fluorescently labeled oligonucleotide probes
US5571673A (en) 1994-11-23 1996-11-05 Hoffmann-La Roche Inc. Methods for in-solution quenching of fluorescently labeled oligonucleotide probes
US5506145A (en) * 1994-12-02 1996-04-09 Bull; Brian S. Determination of an individual's inflammation index from whole blood fibrinogen and hematocrit or hemoglobin measurements
FR2729637B1 (fr) * 1995-01-19 1997-04-18 Semt Pielstick Dispositif et procede de reglage de la vitesse d'un navire
US6139832A (en) * 1995-02-08 2000-10-31 Human Genome Sciences, Inc. Leukocyte adhesion inhibitor-1 (LAI-1) Polypeptides
US5834248A (en) * 1995-02-10 1998-11-10 Millennium Pharmaceuticals Inc. Compositions and methods using rchd534, a gene uregulated by shear stress
US6066322A (en) 1995-03-03 2000-05-23 Millennium Pharmaceuticals, Inc. Methods for the treatment of immune disorders
EP0735144B1 (en) 1995-03-28 2002-06-05 Japan Science and Technology Corporation Method for molecular indexing of genes using restriction enzymes
US6251597B1 (en) * 1996-03-29 2001-06-26 Millennium Pharmaceuticals, Inc. Methods for detecting fohy030
US5569583A (en) 1995-04-25 1996-10-29 Health Research Inc. Rapid and sensitive detection of cytomegalovirus
WO1996039536A1 (en) 1995-06-06 1996-12-12 T Cell Diagnostics, Inc. UNIVERSAL CHEMISTRY ENZYME-LINKED IMMUNOSORBENT ASSAY FOR DETECTION OF mRNA EXPRESSION
US5635365A (en) 1995-08-07 1997-06-03 Emory University Noninvasive diagnosis for allograft rejection
US5773258A (en) 1995-08-25 1998-06-30 Roche Molecular Systems, Inc. Nucleic acid amplification using a reversibly inactivated thermostable enzyme
US5665551A (en) 1995-09-13 1997-09-09 Roche Molecular Systems, Inc. Purified nucleic acid encoding a thermostable pyrophosphatase
US5765585A (en) * 1995-10-12 1998-06-16 Peterson; Roger Sample decade dilution system and procedure
US5750345A (en) 1995-10-31 1998-05-12 Evanston Hospital Corporation Detection of human α-thalassemia mutations and their use as predictors of blood-related disorders
US7888466B2 (en) 1996-01-11 2011-02-15 Human Genome Sciences, Inc. Human G-protein chemokine receptor HSATU68
US5973137A (en) 1996-02-13 1999-10-26 Gentra Systems, Inc. Low pH RNA isolation reagents, method, and kit
US6068933A (en) * 1996-02-15 2000-05-30 American National Can Company Thermoformable multilayer polymeric film
US6099823A (en) 1996-02-16 2000-08-08 Millennium Pharmaceuticals, Inc. Compositions and methods for the treatment and diagnosis of cardiovascular disease
AU725192B2 (en) 1996-02-16 2000-10-05 Brigham And Women's Hospital Compositions and methods for the treatment and diagnosis of cardiovascular disease
US5922184A (en) 1997-07-21 1999-07-13 Bio-Rad Laboratories, Inc. Computer-directed detection of paraproteins
US5719787A (en) * 1996-05-15 1998-02-17 Cornell Research Foundation, Inc. Method for on-line dynamic contingency screening of electric power systems
US5958342A (en) 1996-05-17 1999-09-28 Incyte Pharmaceuticals, Inc. Jet droplet device
CZ293215B6 (cs) 1996-08-06 2004-03-17 F. Hoffmann-La Roche Ag Rekombinantní tepelně stálá DNA polymeráza, způsob její přípravy a prostředek, který ji obsahuje
US6146828A (en) 1996-08-14 2000-11-14 Exact Laboratories, Inc. Methods for detecting differences in RNA expression levels and uses therefor
US8212004B2 (en) 1999-03-02 2012-07-03 Human Genome Sciences, Inc. Neutrokine-alpha fusion proteins
AU722819B2 (en) 1996-12-06 2000-08-10 Urocor, Inc. Diagnosis of disease state using mRNA profiles
US6060240A (en) * 1996-12-13 2000-05-09 Arcaris, Inc. Methods for measuring relative amounts of nucleic acids in a complex mixture and retrieval of specific sequences therefrom
ES2230631T3 (es) 1997-03-20 2005-05-01 F. Hoffmann-La Roche Ag Cebadores modificados.
US6190857B1 (en) * 1997-03-24 2001-02-20 Urocor, Inc. Diagnosis of disease state using MRNA profiles in peripheral leukocytes
US6090556A (en) 1997-04-07 2000-07-18 Japan Science & Technology Corporation Method for quantitatively determining the expression of a gene
US5958688A (en) 1997-04-28 1999-09-28 The Trustees Of The University Of Pennsylvania Characterization of mRNA patterns in neurites and single cells for medical diagnosis and therapeutics
US5994076A (en) 1997-05-21 1999-11-30 Clontech Laboratories, Inc. Methods of assaying differential expression
US6010853A (en) 1997-05-29 2000-01-04 Dana-Farber Cancer Institute Siva genes, novel genes involved in CD27-mediated apoptosis
US6228628B1 (en) * 1997-07-09 2001-05-08 Roche Molecular Systems Mutant chimeric DNA polymerase
US6040168A (en) * 1997-08-06 2000-03-21 The Rockefeller University DNA encoding the human synapsin III gene and uses thereof
AU9200398A (en) 1997-08-22 1999-03-16 Yale University A process to study changes in gene expression in granulocytic cells
PT996726E (pt) 1997-08-29 2004-04-30 Brigham & Womens Hospital Proteina de membrana de celulas t (tirc7) peptidos e anticorpos dela derivados e suas utilizacoes
WO1999011822A1 (en) 1997-09-03 1999-03-11 Gene Logic Inc. Method for predicting prognosis and treatment response for genetically based abnormalities
EP1012137B1 (en) * 1997-09-09 2002-11-06 The Procter & Gamble Company Aromatic c16-c20-substituted tetrahydro prostaglandins useful as fp agonists
US6187534B1 (en) * 1997-09-24 2001-02-13 Cornell Research Foundation, Inc. Methods of evaluating transplant rejection
US20030104371A1 (en) 1997-09-24 2003-06-05 Strom Terry B. Methods of evaluating transplant rejection
DE69829402T2 (de) * 1997-10-31 2006-04-13 Affymetrix, Inc. (a Delaware Corp.), Santa Clara Expressionsprofile in adulten und fötalen organen
US6248528B1 (en) * 1998-04-06 2001-06-19 Millennium Pharmaceuticals, Inc. Methods and compositions for the diagnosis and treatment of neuropsychiatric disorders
US6004755A (en) 1998-04-07 1999-12-21 Incyte Pharmaceuticals, Inc. Quantitative microarray hybridizaton assays
US6864227B1 (en) 1998-04-13 2005-03-08 California Institute Of Technology Artery-and vein-specific proteins and uses therefor
US6048695A (en) * 1998-05-04 2000-04-11 Baylor College Of Medicine Chemically modified nucleic acids and methods for coupling nucleic acids to solid support
CA2326827A1 (en) 1998-05-05 1999-11-11 Gene Logic, Inc. A process to study changes in gene expression in t lymphocytes
US6117644A (en) * 1998-06-04 2000-09-12 Ottawa Heart Institute Research Corporation Predicting and detecting cardiac allograft rejection
US6218122B1 (en) * 1998-06-19 2001-04-17 Rosetta Inpharmatics, Inc. Methods of monitoring disease states and therapies using gene expression profiles
ATE291639T1 (de) 1998-07-17 2005-04-15 Us Gov Health & Human Serv Verfahren zur erkennung von xenogenetischen organ persistenzen und infektiösen materialien
US6056322A (en) * 1998-08-03 2000-05-02 Lupi; Louis A. Combination sample medication payment check and medication prescription device
EP1109821A4 (en) 1998-08-25 2002-04-03 Human Genome Sciences Inc 49 HUMAN-SECRETED PROTEINS
GB2340939B (en) 1998-08-27 2003-11-12 Addenbrooke S Nhs Trust Improvements in or relating to diagnosis of disease
WO2000023573A2 (en) 1998-10-20 2000-04-27 City Of Hope Cd20-specific redirected t cells and their use in cellular immunotherapy of cd20+ malignancies
US6248527B1 (en) * 1998-10-21 2001-06-19 Millennium Pharmaceuticals, Inc. Method of detecting risk of type II diabetes based on mutations found in carboxypeptidase E
US6203987B1 (en) * 1998-10-27 2001-03-20 Rosetta Inpharmatics, Inc. Methods for using co-regulated genesets to enhance detection and classification of gene expression patterns
US6406884B1 (en) 1999-06-18 2002-06-18 Millennium Pharmaceuticals, Inc. Secreted proteins and uses thereof
AU1724000A (en) * 1998-11-12 2000-05-29 Nyxis, Inc. Diagnostic assay for cancer
CA2350415A1 (en) 1998-11-18 2000-05-25 Incyte Pharmaceuticals, Inc. Inflammation-associated genes
US6177254B1 (en) * 1998-12-15 2001-01-23 Jerome Bernard Rattner Nucleolus autoantigenic marker for systemic lupus erthyematosus
US6222093B1 (en) * 1998-12-28 2001-04-24 Rosetta Inpharmatics, Inc. Methods for determining therapeutic index from gene expression profiles
US6087112A (en) 1998-12-30 2000-07-11 Oligos Etc. Inc. Arrays with modified oligonucleotide and polynucleotide compositions
AU3697300A (en) 1999-02-05 2000-08-25 Chiron Corporation Pancreatic islet genes regulated by glucose
US6303321B1 (en) 1999-02-11 2001-10-16 North Shore-Long Island Jewish Research Institute Methods for diagnosing sepsis
US6150121A (en) 1999-02-16 2000-11-21 Wisconsin Alumni Research Foundation Assessing immunological state of transplant recipients
WO2000052209A1 (en) 1999-03-02 2000-09-08 Chiron Corporation Microarrays for identifying pathway activation or induction
WO2000055375A1 (en) 1999-03-17 2000-09-21 Alphagene, Inc. Secreted proteins and polynucleotides encoding them
US6280941B1 (en) 1999-03-29 2001-08-28 Cedars-Sinai Medical Center Genetic marker test for lupus
WO2000058473A2 (en) 1999-03-31 2000-10-05 Curagen Corporation Nucleic acids including open reading frames encoding polypeptides; 'orfx'
US6242185B1 (en) * 1999-04-01 2001-06-05 Incyte Genomics, Inc. Purified nucleic acid encoding transcription factor regulatory protein
US6162604A (en) 1999-04-01 2000-12-19 Jacob; Chaim O. Methods for determining genetic predisposition to autoimmune diseases by genotyping apoptotic genes
GB9908807D0 (en) 1999-04-16 1999-06-09 Celltech Therapeutics Ltd Synthetic signalling molecules
US6245526B1 (en) * 1999-05-26 2001-06-12 Incyte Pharmaceuticals, Inc. Lipid metabolism transcription factor
US6132997A (en) 1999-05-28 2000-10-17 Agilent Technologies Method for linear mRNA amplification
WO2000073498A1 (en) 1999-06-02 2000-12-07 Millennium Pharmaceuticals, Inc. Compositions and methods for the treatment and diagnosis of immune disorders
US6168933B1 (en) * 1999-06-08 2001-01-02 Incyte Pharmaceuticals, Inc. Phospholipid transfer protein
DK1198585T3 (da) 1999-06-28 2007-10-15 Source Precision Medicine Inc Fremgangsmåde til karakterisering af en biologisk tilstand ved anvendelse af kalibrerede genudtrykkelsesprofiler
US6245527B1 (en) * 1999-06-30 2001-06-12 Millennium Pharmaceuticals, Inc. Nucleic acid molecules encoding glycoprotein VI and recombinant uses thereof
US6555374B1 (en) 1999-08-19 2003-04-29 Artecel Sciences, Inc. Multiple mesodermal lineage differentiation potentials for adipose tissue-derived stromal cells and uses thereof
EP1210428B1 (en) 1999-08-23 2015-03-18 Dana-Farber Cancer Institute, Inc. Pd-1, a receptor for b7-4, and uses therefor
US6225093B1 (en) * 1999-09-07 2001-05-01 Decode Genetics Ehf. Detection of C4A deletion by long range PCR
JP2003509053A (ja) 1999-09-15 2003-03-11 インサイト・ゲノミックス・インコーポレイテッド プロテインホスファターゼ及びプロテインキナーゼ
EP1220916A1 (en) 1999-09-27 2002-07-10 Scios Inc. Secreted factors
WO2001023426A2 (en) 1999-09-30 2001-04-05 Varian Associates, Inc. Hypoxia-related human genes, proteins, and uses thereof
IL143936A0 (en) 1999-10-21 2002-04-21 Univ Case Western Reserve Gene expression profiling of inflammatory bowel disease
WO2001032927A2 (en) 1999-11-04 2001-05-10 Incyte Genomics, Inc. Tissue specific genes of diagnostic import
WO2001038585A2 (en) 1999-11-24 2001-05-31 The Regents Of The University Of California Polymer arrays and methods of using labeled probe molecules to identify and quantify target molecule expression
GB9928136D0 (en) 1999-11-29 2000-01-26 Rose Marlene L Organ rejection and associated conditions
CA2395926A1 (en) 1999-12-28 2001-07-05 Curagen Corporation Nucleic acids containing single nucleotide polymorphisms and methods of use thereof
WO2001055320A2 (en) 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies
AU3095801A (en) 2000-01-31 2001-08-07 Human Genome Sciences Inc Nucleic acids, proteins, and antibodies
US20020042096A1 (en) * 2000-01-31 2002-04-11 Rosen Craig A. Nucleic acids, proteins, and antibodies
AU2001233114A1 (en) 2000-02-04 2001-08-14 Aeomica, Inc. Methods and apparatus for predicting, confirming, and displaying functional information derived from genomic sequence
WO2001060860A2 (en) 2000-02-17 2001-08-23 Millennium Predictive Medicine, Inc. Genes differentially expressed in human prostate cancer and their use
HUP0300919A2 (hu) 2000-03-24 2003-07-28 Micromet Ag Többfunkciós polipeptidek NKG2D receptor komplex epitóp kötőhellyel
US6900015B2 (en) * 2000-04-24 2005-05-31 Beth Israel Deaconess Medical Center, Inc. Measurement of protective genes in allograft rejection
DE10021834A1 (de) 2000-05-06 2001-11-15 Lynx Therapeutics Gmbh mRNA Moleküle zur Verwendung als Indikatoren für den Aktivierungs- und Funktionszustand von T-Lymphozyten
AU2001261585B2 (en) * 2000-05-12 2006-08-31 Beth Israel Deaconess Medical Center, Inc. Compositions and methods for achieving immune suppression
WO2002000677A1 (en) 2000-06-07 2002-01-03 Human Genome Sciences, Inc. Nucleic acids, proteins, and antibodies
AU2126502A (en) 2000-10-03 2002-04-15 Gene Logic, Inc. Gene expression profiles in granulocytic cells
JP2002118661A (ja) * 2000-10-06 2002-04-19 Nec Corp 留守番電話機能付き携帯電話システム
US20070037144A1 (en) * 2000-10-20 2007-02-15 Jay Wohlgemuth Leukocyte expression profiling
JP2002300883A (ja) 2001-04-05 2002-10-15 Jenokkusu Soyaku Kenkyusho:Kk ステロイド応答性の検査方法
US7235358B2 (en) 2001-06-08 2007-06-26 Expression Diagnostics, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
US6905827B2 (en) 2001-06-08 2005-06-14 Expression Diagnostics, Inc. Methods and compositions for diagnosing or monitoring auto immune and chronic inflammatory diseases
US7026121B1 (en) * 2001-06-08 2006-04-11 Expression Diagnostics, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
AU2002316251A1 (en) * 2001-06-18 2003-01-02 Rosetta Inpharmatics, Inc. Diagnosis and prognosis of breast cancer patients
AU2002316552A1 (en) 2001-07-02 2003-01-21 Yale University Inhibitor of t cell activation
EP1451340B1 (en) 2001-11-09 2014-01-08 Life Technologies Corporation Identification, monitoring and treatment of disease and characterization of biological condition using gene expression profiles
US20030225526A1 (en) 2001-11-14 2003-12-04 Golub Todd R. Molecular cancer diagnosis using tumor gene expression signature
EP1469733A4 (en) 2001-11-29 2008-07-23 Therakos Inc METHODS FOR PRETREATING A SUBJECT USING EXTRACORPOREAL PHOTOPHERESIS AND / OR APOPTOTIC CELLS
EP1319717A1 (en) * 2001-12-11 2003-06-18 Roche Diagnostics GmbH Method for detection of inflammatory processes
US20040072181A1 (en) * 2002-01-22 2004-04-15 Whitehead Alexander Steven Methods for determining drug responsiveness
EP2388265A1 (en) 2002-02-22 2011-11-23 Genentech, Inc. Compositions and methods for the treatment of immune related diseases
DE10234524A1 (de) 2002-07-24 2004-02-12 Oligene Gmbh Nukleinsäurearray
US7118865B2 (en) * 2002-08-16 2006-10-10 Regents Of The University Of Minnesota Methods for diagnosing severe systemic lupus erythematosus
CA2516013C (en) 2003-02-14 2014-05-13 Beth Israel Deaconess Medical Center, Inc. Predicting graft rejection
WO2005016235A2 (en) * 2003-04-14 2005-02-24 The Regents Of The University Of California Combined use of impdh inhibitors with toll-like receptor agonists
US7892745B2 (en) 2003-04-24 2011-02-22 Xdx, Inc. Methods and compositions for diagnosing and monitoring transplant rejection
CA2528162A1 (en) 2003-06-04 2004-12-16 The Government Of The United States As Represented By The Secretary Of T He Department Of Health And Human Services, Centers For Disease Control Pni microarray and uses
WO2005108428A2 (en) 2004-02-26 2005-11-17 Compugen Ltd. Cd40 splice variants and their uses
US7645575B2 (en) * 2004-09-08 2010-01-12 Xdx, Inc. Genes useful for diagnosing and monitoring inflammation related disorders
EP1885889A4 (en) 2005-05-11 2010-01-20 Expression Diagnostics Inc METHOD FOR MONITORING THE OPERATING STATUS OF TRANSPLANTS OVER GENLISTS
CA2648580A1 (en) 2006-04-07 2008-05-02 Xdx, Inc. Steroid responsive nucleic acid expression and prediction of disease activity
WO2008021431A2 (en) * 2006-08-14 2008-02-21 Xdx, Inc. Methods and compositions for diagnosing and monitoring the status of transplant rejection and immune disorders

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0217102A1 (en) * 1985-08-28 1987-04-08 Yeda Research And Development Company, Ltd. Interferon-induced (2'-5') oligo a synthetase gene, mRNA, cDNA and enzymes having (2'-5') oligo a synthetase activity
US6274312B1 (en) * 1996-12-11 2001-08-14 Schering Corporation Intracellular regulatory molecules; related reagents

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NETO E.D. ET AL: 'Shotgun sequencing of the human transcriptome with ORF expressed sequence tags' PNAS vol. 97, no. 7, 28 March 2000, pages 3491 - 3496, XP002932604 *
ZHANG L. ET AL: 'IRF-7, a new Interferon Regulatory Factor associated with Epstein-Barr virus latency' MOLECULAR AND CELLULAR BIOLOGY vol. 17, no. 10, October 1997, pages 5748 - 5757, XP002110967 *

Cited By (61)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7473528B2 (en) 1999-01-06 2009-01-06 Genenews Inc. Method for the detection of Chagas disease related gene transcripts in blood
US8110364B2 (en) 2001-06-08 2012-02-07 Xdx, Inc. Methods and compositions for diagnosing or monitoring autoimmune and chronic inflammatory diseases
US7118865B2 (en) 2002-08-16 2006-10-10 Regents Of The University Of Minnesota Methods for diagnosing severe systemic lupus erythematosus
US7910299B2 (en) 2002-08-16 2011-03-22 Regents Of The University Of Minnesota Methods for diagnosing systemic lupus erythematosus
US8142998B2 (en) 2003-08-08 2012-03-27 Genenews, Inc. Osteoarthritis biomarkers and uses thereof
GB2424947A (en) * 2004-01-16 2006-10-11 Univ Cambridge Tech Methods of assessing a tissue inflammatory response using expression profiles of endothelial cells
WO2005068655A2 (en) * 2004-01-16 2005-07-28 Cambridge University Technical Services Limited Methods of assessing a tissue inflammatory response using expression profiles of endothelial cells
WO2005068655A3 (en) * 2004-01-16 2005-11-17 Univ Cambridge Tech Methods of assessing a tissue inflammatory response using expression profiles of endothelial cells
JP2005314397A (ja) * 2004-03-31 2005-11-10 Mitsubishi Chemicals Corp 抗コンドロモジュリン−1特異的抗体及びその利用
WO2005106471A3 (en) * 2004-04-30 2006-05-11 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with c-c chemokine receptor 4 (ccr4)
WO2005106471A2 (en) * 2004-04-30 2005-11-10 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with c-c chemokine receptor 4 (ccr4)
US8080373B2 (en) 2004-08-03 2011-12-20 Bauer Jr A Robert Method for the early detection of pancreatic cancer and other gastrointestinal disease conditions
US7820382B2 (en) * 2004-08-03 2010-10-26 Bauer A Robert Method for the early detection of breast cancer, lung cancer, pancreatic cancer and colon polyps, growths and cancers as well as other gastrointestinal disease conditions and the preoperative and postoperative monitoring of transplanted organs from the donor and in the recipient and their associated conditions related and unrelated to the organ transplantation
US7571055B2 (en) 2004-10-13 2009-08-04 Regents Of The University Of Minnesota Systemic lupus erythematosus
JP2006333770A (ja) * 2005-06-01 2006-12-14 Japan Science & Technology Agency 血管炎(angiitis)患者の血液細胞特異的遺伝子群
US7741023B2 (en) 2005-06-08 2010-06-22 Hitachi Chemical Co., Ltd. Method for predicting immune response to neoplastic disease based on mRNA expression profile in neoplastic cells and stimulated leukocytes
EP2327792A1 (en) * 2005-08-05 2011-06-01 Genentech, Inc. Methods and compositions for detecting auto-immune disorders
AU2006278561C1 (en) * 2005-08-05 2013-05-02 Genentech, Inc. Methods and compositions for detecting autoimmune disorders
AU2006278561B2 (en) * 2005-08-05 2012-11-01 Genentech, Inc. Methods and compositions for detecting autoimmune disorders
WO2007019219A3 (en) * 2005-08-05 2007-05-31 Genentech Inc Methods and compositions for detecting autoimmune disorders
EP1795610A1 (en) * 2005-12-06 2007-06-13 Oligene GmbH A composition of nucleic acid sequences, specific for inflammatory disease, in particular rheumatoid arthritis
US8148074B2 (en) 2006-03-31 2012-04-03 Regents Of The University Of Minnesota IRF-5 haplotypes in systemic lupus erythematosus
US7838239B2 (en) 2006-04-07 2010-11-23 Hitachi Chemical Co., Ltd. Methods regarding enhanced T-cell receptor-mediated tumor necrosis factor superfamily mRNA expression in peripheral blood leukocytes in patients with crohn's disease
EP2005175A4 (en) * 2006-04-07 2009-06-03 Hitachi Chemical Co Ltd EXPRESSION OF ADVANCED T-CELL RECEPTOR-IMPROVED TUMOR NECROSIS FACTOR SUPERFAMILY AND CHEMOKIN-MRNA IN PERIPHERAL LEUKOCYTES IN PATIENTS WITH MORBUS CROHN
US8268566B2 (en) 2006-04-07 2012-09-18 Hitachi Chemical Research Center, Inc. Enhanced FC receptor-mediated tumor necrosis factor superfamily MRNA expression in peripheral blood leukocytes in patients with rheumatoid arthritis
EP2005175A2 (en) * 2006-04-07 2008-12-24 Hitachi Chemical Company, Ltd. Enhanced t cell receptor-mediated tumor necrosis factor superfamily and chemokine mrna expression in peripheral blood leukocytes in patients with crohn's disease
US8962249B2 (en) 2006-04-24 2015-02-24 Genentech, Inc. Methods for detecting and treating systemic lupus erythematous
US9139878B2 (en) 2006-04-24 2015-09-22 Genentech, Inc. Methods for diagnosing and treating systemic lupus erythematosus
US10370439B2 (en) 2006-10-06 2019-08-06 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Prevention of tissue ischemia and related methods
US11254735B2 (en) 2006-10-06 2022-02-22 The United States of America, as represented by the Secretary, Depar tment of Health and Human Services Prevention of tissue ischemia and related methods
US8865672B2 (en) 2006-10-06 2014-10-21 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Prevention of tissue ischemia and related methods
US8557788B2 (en) 2006-10-06 2013-10-15 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Prevention of tissue ischemia and related compositions
WO2008060785A3 (en) * 2006-10-06 2008-08-14 Us Gov Health & Human Serv Prevention of tissue ischemia, related methods and compositions
WO2008060785A2 (en) * 2006-10-06 2008-05-22 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Prevention of tissue ischemia, related methods and compositions
US8236313B2 (en) 2006-10-06 2012-08-07 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Prevention of tissue ischemia, related methods and compositions
EP2884279A3 (de) * 2007-09-03 2015-10-07 Protagen AG Markersequenzen für Multiple Sklerose und deren Verwendung
EP2215254A1 (en) * 2007-10-05 2010-08-11 Pacific Edge Biotechnology Ltd Proliferation signature and prognosis for gastrointestinal cancer
EP2215254A4 (en) * 2007-10-05 2012-07-18 Pacific Edge Biotechnology Ltd PROLIFERATION AND PROGNOSTIC SIGNATURE FOR GASTROINTESTINAL CANCER
EP2264071A4 (en) * 2008-03-14 2011-05-04 Medinet Co Ltd ANTIBODY WITH AN IMMUNE-REINFORCING FUNCTION
EP2264071A1 (en) * 2008-03-14 2010-12-22 Medinet., Co. Ltd. Antibody having an immune-enhancement function
US12084722B2 (en) 2008-11-26 2024-09-10 Cedars-Sinai Medical Center Methods of determining responsiveness to anti-TNFα therapy in inflammatory bowel disease
US11236393B2 (en) 2008-11-26 2022-02-01 Cedars-Sinai Medical Center Methods of determining responsiveness to anti-TNFα therapy in inflammatory bowel disease
WO2010067308A2 (en) 2008-12-08 2010-06-17 Compugen Ltd. Polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics
EP2865689A1 (en) 2008-12-08 2015-04-29 Compugen Ltd. FAM26F polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics
WO2010067308A3 (en) * 2008-12-08 2010-08-19 Compugen Ltd. Tmem154 polypeptides and polynucleotides, and uses thereof as a drug target for producing drugs and biologics
US8999335B2 (en) 2010-09-17 2015-04-07 Compugen Ltd. Compositions and methods for treatment of drug resistant multiple myeloma
WO2012049225A3 (de) * 2010-10-12 2012-06-21 Protagen Ag Markersequenzen für systemischer lupus erythematodes und deren verwendung
EP2441848A1 (de) * 2010-10-12 2012-04-18 Protagen AG Markersequenzen für systemischer Lupus Erythematodes und deren Verwendung
WO2012049225A2 (de) 2010-10-12 2012-04-19 Protagen Ag Markersequenzen für systemischer lupus erythematodes und deren verwendung
US11686724B2 (en) 2012-03-28 2023-06-27 Gadeta B.V. Compositions comprising gamma 9 delta 2 T-cell receptors and methods of use thereof to treat cancer
US10633449B2 (en) 2013-03-27 2020-04-28 Cedars-Sinai Medical Center Treatment and reversal of fibrosis and inflammation by inhibition of the TL1A-DR3 signaling pathway
US10316083B2 (en) 2013-07-19 2019-06-11 Cedars-Sinai Medical Center Signature of TL1A (TNFSF15) signaling pathway
US11312768B2 (en) 2013-07-19 2022-04-26 Cedars-Sinai Medical Center Signature of TL1A (TNFSF15) signaling pathway
US11028443B2 (en) 2015-08-31 2021-06-08 Showa Denko Materials Co., Ltd. Molecular methods for assessing urothelial disease
US11186872B2 (en) 2016-03-17 2021-11-30 Cedars-Sinai Medical Center Methods of diagnosing inflammatory bowel disease through RNASET2
EP4099015A1 (en) * 2016-06-10 2022-12-07 Gadeta B.V. Novel method for identifying deltat-cell (or gammat-cell) receptor chains or parts thereof that mediate an anti-tumour or an anti-infective response
CN114127288A (zh) * 2019-05-14 2022-03-01 莫纳什大学 晚期糖基化终产物受体rna的调节剂和调节
WO2023012356A3 (en) * 2021-08-06 2023-03-16 INSERM (Institut National de la Santé et de la Recherche Médicale) New method to diagnose inflammatory diseases
WO2023235773A1 (en) * 2022-06-01 2023-12-07 Genentech, Inc. Method to identify a patient with an increased likelihood of chronic spontaneous urticaria
CN117153316A (zh) * 2023-09-05 2023-12-01 中普达科技股份有限公司 一种多用户的医疗信息采集终端的管理系统
CN117153316B (zh) * 2023-09-05 2024-04-19 中普达科技股份有限公司 一种多用户的医疗信息采集终端的管理系统

Also Published As

Publication number Publication date
US20070037167A1 (en) 2007-02-15
WO2003090694A3 (en) 2004-11-18
US20090263796A1 (en) 2009-10-22
US20110070584A1 (en) 2011-03-24
JP2010094130A (ja) 2010-04-30
US7579148B2 (en) 2009-08-25
AU2003231132A1 (en) 2003-11-10
US20110262914A1 (en) 2011-10-27
JP4741191B2 (ja) 2011-08-03
US8110364B2 (en) 2012-02-07
JP5268194B2 (ja) 2013-08-21
US6905827B2 (en) 2005-06-14
AU2003231132A8 (en) 2003-11-10
JP2005523038A (ja) 2005-08-04
US20080199853A1 (en) 2008-08-21
US20100009377A1 (en) 2010-01-14
US7771950B2 (en) 2010-08-10
US7604936B2 (en) 2009-10-20
US20040009479A1 (en) 2004-01-15
JP2010104368A (ja) 2010-05-13

Similar Documents

Publication Publication Date Title
US7771950B2 (en) Methods and compositions for diagnosing and monitoring auto immune and chronic inflammatory diseases
US7785797B2 (en) Methods and compositions for diagnosing and monitoring transplant rejection
US7829286B2 (en) Methods and compositions for diagnosing and monitoring transplant rejection
US7879556B2 (en) Methods and compositions for diagnosing and monitoring transplant rejection
US7645575B2 (en) Genes useful for diagnosing and monitoring inflammation related disorders
US20070037144A1 (en) Leukocyte expression profiling

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2003587333

Country of ref document: JP

122 Ep: pct application non-entry in european phase
WWE Wipo information: entry into national phase

Ref document number: 10512028

Country of ref document: US