WO2000032773A1 - Compositions and methods for increasing bone mineralization - Google Patents
Compositions and methods for increasing bone mineralization Download PDFInfo
- Publication number
- WO2000032773A1 WO2000032773A1 PCT/US1999/027990 US9927990W WO0032773A1 WO 2000032773 A1 WO2000032773 A1 WO 2000032773A1 US 9927990 W US9927990 W US 9927990W WO 0032773 A1 WO0032773 A1 WO 0032773A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- nucleic acid
- tgf
- acid molecule
- oligonucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/18—Growth factors; Growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
- A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/51—Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/22—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/84—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving inorganic compounds or pH
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
- C07K2317/11—Immunoglobulins specific features characterized by their source of isolation or production isolated from eggs
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/23—Immunoglobulins specific features characterized by taxonomic origin from birds
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/475—Assays involving growth factors
- G01N2333/495—Transforming growth factor [TGF]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/475—Assays involving growth factors
- G01N2333/51—Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/02—Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/20—Screening for compounds of potential therapeutic value cell-free systems
Definitions
- the present invention relates generally to pharmaceutical products and methods and, more specifically, to methods and compositions suitable for increasing the mineral content of bone.
- Such compositions and methods may be utilized to treat a wide variety of conditions, including for example, osteopenia, osteoporosis, fractures and other disorders in which low bone mineral density are a hallmark of the disease.
- the first phase occurs in both men and women, and proceeds to attainment of a peak bone mass. This first phase is achieved through linear growth of the endochondral growth plates, and radial growth due to a rate of periosteal apposition.
- the second phase begins around age 30 for trabecular bone (flat bones such as the vertebrae and pelvis) and about age 40 for cortical bone (e.g., long bones found in the limbs) and continues to old age. This phase is characterized by slow bone loss, and occurs in both men and women.
- osteoporosis is a debilitating disease in humans characterized by marked decreases in skeletal bone mass and mineral density, structural deterioration of bone including degradation of bone microarchitecture and corresponding increases in bone fragility and susceptibility to fracture in afflicted individuals.
- Osteoporosis in humans is preceded by clinical osteopenia (bone mineral density that is greater than one standard deviation but less than 2.5 standard deviations below the mean value for young adult bone), a condition found in approximately 25 million people in the United States. Another 7-8 million patients in the United States have been diagnosed with clinical osteoporosis (defined as bone mineral content greater than 2.5 standard deviations below that of mature young adult bone).
- Osteoporosis is one of the most expensive diseases for the health care system, costing tens of billions of dollars annually in the United States In addition to health care-related costs, long-term residential care and lost working days add to the financial and social costs of this disease.
- Worldwide approximately 75 million people are at risk for osteoporosis The frequency of osteoporosis in the human population increases with age, and among Caucasians is predominant in women (who comprise 80% of the osteoporosis patient pool in the United States)
- the increased fragility and susceptibility to fracture of skeletal bone in the aged is aggravated by the greater risk of accidental falls in this population More than 1 5 million osteoporosis-related bone fractures are reported in the United States each year
- Fractured hips, wrists, and vertebrae are among the most common injuries associated with osteoporosis Hip fractures in particular are extremely uncomfortable and expensive for the patient, and for women correlate with high rates of mortality and morbidity
- osteoporosis has been defined as an increase in the risk of fracture due to decreased bone mass
- none of the presently available treatments for skeletal disorders can substantially increase the bone density of adults
- drugs are needed which could increase bone density in adults, particularly in the bones of the wrist, spinal column and hip that are at risk in osteopenia and osteoporosis
- Current strategies for the prevention of osteoporosis may offer some benefit to individuals but cannot ensure resolution of the disease
- These strategies include moderating physical activity (particularly in weight-bearing activities) with the onset of advanced age, including adequate calcium in the diet, and avoiding consumption of products containing alcohol or tobacco
- all current therapeutic drugs and strategies are directed to reducing further loss of bone mass by inhibiting the process of bone absorption, a natural component of the bone remodeling process that occurs constitutively
- estrogen is now being prescribed to retard bone loss There is, however, some controversy over whether there is any long term benefit to patients and whether there is any effect at all on patients over 75 years old Moreover, use of estrogen is believed to increase the risk of breast and endometrial cancer
- the present invention provides compositions and methods which can be utilized to increase bone mineralization, and thus may be utilized to treat a wide variety of conditions where it is desired to increase bone mass Further, the present invention provides other, related advantages
- the present invention provides a novel class or family of TGF-beta binding-proteins, as well as assays for selecting compounds which increase bone mineral content and bone mineral density, compounds which increase bone mineral content and bone mineral density and methods for utilizing such compounds in the treatment or prevention of a wide variety of conditions
- isolated nucleic acid molecules are provided, wherein said nucleic acid molecules are selected from the group consisting of (a) an isolated nucleic acid molecule comprising sequence ID Nos 1, 5, 7, 9, 1 1, 13, or, 15, or complementary sequence thereof, (b) an isolated nucleic acid molecule that specifically hybridizes to the nucleic acid molecule of (a) under conditions of high stringency, and (c) an isolated nucleic acid that encodes a TGF-beta binding-protein according to (a) or (b)
- isolated nucleic acid molecules are provided based upon hybridization to only a portion of one of the above-identified sequences (e g , for (a) hybridization may be to a probe of at least 20, 25, 50, or 100 nucleotides selected from nucleotides 156 to 539 or 555 to 687 of Sequence ID No 1)
- the necessary stringency to be utilized for hybridization may vary based upon the size of the probe For example, for
- isolated nucleic acid molecules are provided which have homology to Sequence ID Nos 1, 5, 7, 9, 11, 13, or 15, at a 50%>, 60%, 75%, 80%, 90%, 95%, or 98% level of homology utilizing a Wilbur-Lipman algorithm
- Representative examples of such isolated molecules include, for example, nucleic acid molecules which encode a protein comprising Sequence ID NOs 2, 6, 10, 12, 14, or 16, or have homology to these sequences at a level of 50%, 60%, 75%, 80%, 90%, 95%, or 98% level of homology utilizing a Lipman-Pearson algorithm
- Isolated nucleic acid molecules are typically less than lOOkb in size, and, within certain embodiments, less than 50kb, 25kb, lOkb, or even 5kb in size
- isolated nucleic acid molecules do not exist in a "library" of other unrelated nucleic acid molecules (e g , a subclone BAC such as described in Gen
- methods of producing TGF-beta binding-proteins comprising the step of cultu ⁇ ng the aforementioned host cell containing vector under conditions and for a time sufficient to produce the TGF-beta binding protein
- the protein produced by this method may be further purified (e g , by column chromatography, affinity purification, and the like)
- isolated proteins which are encoded by the above-noted nucleic acid molecules (e g , Sequence ID NOs 2, 4, 6, 8, 10, 12, 14, or 16) may be readily produced given the disclosure of the subject application
- fusion proteins comprising a first polypeptide segment comprising a TGF-beta binding-protein encoded by a nucleic acid molecule as described above, or a portion thereof of at least 10, 20, 30, 50, or 100 amino acids in length, and a second polypeptide segment comprising a non-TGF-beta binding-protein
- the second polypeptide may be a tag suitable for purification or recognition (e g , a polypeptide comprising multiple anionic amino acid residues - see U S Patent No 4,851,341), a marker (e g , green fluorescent protein, or alkaline phosphatase), or a toxic molecule (e g , ⁇ cin)
- antibodies are provided which are capable of specifically binding the above-described class of TGF-beta binding proteins (e g , human BEER)
- the antibody may be a polyclonal antibody, or a monoclonal antibody (e g , of human or murine origin)
- the antibody is a fragment of an antibody which retains the binding characteristics of a whole antibody (e g , an F(ab') 2 , F(ab) 2 , Fab', Fab, or Fv fragment, or even a CDR)
- hyb ⁇ domas and other cells which are capable of producing or expressing the aforementioned antibodies
- methods are provided detecting a TGF-beta binding protein, comprising the steps of incubating an antibody as described above under conditions and for a time sufficient to permit said antibody to bind to a TGF-beta binding protein, and detecting the binding
- the antibody may be bound to a solid support to facilitate washing or separation, and/or labeled (e g , with a marker selected from the group consisting of enzymes, fluorescent proteins, and radioisotopes)
- isolated oligonucleotides are provided which hybridize to a nucleic acid molecule according to Sequence ID NOs 1, 3, 5, 7, 9, 11, 13, 15, 17, or 18 or the complement thereto, under conditions of high stringency
- the oligonucleotide may be found in the sequence which encodes Sequence ID Nos 2, 4, 6, 8, 10, 12, 14, or 16
- the oligonucleotide is at least 15, 20, 30, 50, or 100 nucleotides in length
- the oligonucleotide is labeled with another molecule (e g , an enzyme, fluorescent molecule, or radioisotope)
- primers which are capable of specifically amplifying all or a portion of the above- mentioned nucleic acid molecules which encode TGF-beta binding-proteins
- the term "specifically amplifying" should be understood to refer to primers which amplify the aforementioned TGF-beta binding-proteins, and not
- oligonucleotide which encodes a TGF-beta binding protein
- methods are provided for detecting a nucleic acid molecule which encodes a TGF-beta binding protein, comprising the steps of incubating an oligonucleotide as described above under conditions of high stringency, and detecting hybridization of said oligonucleotide
- the oligonucleotide may be labeled and/or bound to a solid support
- ribozymes are provided which are capable of cleaving RNA which encodes one of the above-mentioned TGF- beta binding-proteins (e.g., Sequence ID NOs 2, 6, 8, 10, 12, 14, or 16)
- Such ribozymes may be composed of DNA, RNA (including 2'-O-methyl ribonucleic acids), nucleic acid analogs (e.g., nucleic acids having phosphorothioate linkages) or mixtures thereof
- nucleic acid molecules e.g., DNA or cDNA
- vectors include plasmids, retrotransposons, cosmids, and viral-based vectors (e.g., viral vectors generated at least in part from a retrovirus, adenovirus, or, adeno-associated virus)
- host cells e.g., human, dog, rat, or mouse
- ribozymes either synthetically, or by in vitro or in vivo transcription
- the ribozymes so produced may be further purified and / or formulated into pharmaceutical compositions (e.g., the ribozyme or nucleic acid molecule encoding the ribozyme along with a pharmaceutically acceptable carrier or diluent)
- the antisense oligonucleotides and antibodies or other selected molecules described herein may be formulated into pharmaceutical compositions
- antisense oligonucleotides comprising a nucleic acid molecule which hybridizes to a nucleic acid molecule according to Sequence ID NOs 1, 3, 5, 7, 9, 1 1, 13, or 15, or the complement thereto, and wherein said oligonucleotide inhibits the expression of TGF-beta binding protein as described herein (e g , human BEER)
- the oligonucleotide is 15, 20, 25, 30, 35, 40, or 50 nucleotides in length
- the oligonucleotide is less than 100, 75, or 60 nucleotides in length
- the oligonucleotide may be comprised of one or more nucleic acid analogs, ribonucleic acids, or deoxyribonucleic acids
- the oligonucleotide may be modified by one or more linkages, including for example, covalent linkage such as a phosphorothioate link
- methods for increasing bone mineralization, comprising introducing into a warm-blooded animal an effective amount of the ribozyme as described above
- such methods comprise the step of introducing into a patient an effective amount of the nucleic acid molecule or vector as described herein which is capable of producing the desired ribozyme, under conditions favoring transcription of the nucleic acid molecule to produce the ribozyme
- transgenic, non-human animals are provided within one embodiment a transgenic animal is provided whose germ cells and somatic cells contain a nucleic acid molecule encoding a TGF-beta binding-protein as described above which is operably linked to a promoter effective for the expression of the gene, the gene being introduced into the animal, or an ancestor of the animal, at an embryonic stage, with the proviso that said animal is not a human
- transgenic knockout animals comprising an animal whose germ cells and somatic cells comprise a disruption of at least one allele of an endogenous nucleic acid molecule which hybridizes to a nucleic acid molecule which encodes a TGF-binding protein as described herein, wherein the disruption prevents transcription of messenger RNA from said allele as compared to an animal without the disruption, with the proviso that the animal is not a human
- the disruption is a nucleic acid deletion, substitution, or, insertion
- the transgenic founder is a nucleic acid deletion, substitution, or, insertion
- kits for the detection of TGF-beta binding-protein gene expression, comprising a container that comprises a nucleic acid molecule, wherein the nucleic acid molecule is selected from the group consisting of (a) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs 1, 3, 5, 7, 9, 1 1, 13, or 15, (b) a nucleic acid molecule comprising the complement of the nucleotide sequence of (a), (c) a nucleic acid molecule that is a fragment of (a) or (b) of at least 15, 20 30, 50, 75, or, 100 nucleotides in length
- kits for the detection of a TGF-beta binding-protein which comprise a container that comprise one of the TGF-beta binding protein antibodies described herein
- methods for determining whether a selected molecule is capable of increasing bone mineral content comprising the steps of (a) mixing one or more candidate molecules with TGF-beta-binding-protein encoded by the nucleic acid molecule according to claim 1 and a selected member of the TGF-beta family of proteins (e g , BMP 5 or 6), (b) determining whether the candidate molecule alters the signaling of the TGF-beta family member, or alters the binding of the TGF-beta bindmg-protein to the TGF-beta family member
- the molecule alters the ability of TGF- beta to function as a positive regulator of mesenchymal cell differentiation
- the candidate molecule(s) may alter signaling or binding by, for example, either decreasing (e g , inhibiting), or increasing (e g , enhancing) signaling or binding
- methods for determining whether a selected molecule is capable of increasing bone mineral content, comprising the step of determining whether a selected molecule inhibits the binding of TGF-beta binding-protein to bone, or an analogue thereof
- Representative examples of bone or analogues thereof include hydroxyapatite and primary human bone samples obtained via biopsy
- the selected molecule is contained within a mixture of molecules and the methods may further comprise the step of isolating one or more molecules which are functional within the assay
- TGF-beta family of proteins is bound to a solid support and the binding of TGF-beta binding-protein is measured or TGF-beta binding- protein are bound to a solid support and the binding of TGF-beta proteins are measured
- a wide variety of molecules may be assayed for their ability to increase bone mineral content by inhibiting the binding of the TGF-beta binding-protein to the TGF-beta family of proteins
- Representative examples of such molecules include proteins or peptides, organic molecules, and nucleic acid molecules
- methods are provided for increasing bone mineral content in a warm-blooded animal, comprising the step of administering to a warm-blooded animal a therapeutically effective amount of a molecule identified from the assays recited
- molecules are provided (preferably isolated) which inhibit the binding of the TGF-beta binding-protein to the TGF-beta super-family of proteins
- the molecules may be provided as a composition, and can further comprise an inhibitor of bone resorption
- an inhibitor of bone resorption Representative examples of such inhibitors include calcitonin, estrogen, a bisphosphonate, a growth factor having anti-resorptive activity and tamoxifen
- molecules which may be utilized in the afore-mentioned therapeutic contexts include, e g , ribozymes, ribozyme genes, antisense molecules, and/or antibodies (e g , humanized antibodies) Such molecules may depending upon their selection, used to alter, antagonize, or agonize the signalling or binding of a TGF-beta binding-protein family member as described herein
- the above-described molecules and methods of treatment or prevention may be utilized on conditions such as osteoporosis, osteomalasia, periodontal disease, scurvy, Cushing's Disease, bone fracture and conditions due to limb immobilization and steroid usage
- conditions such as osteoporosis, osteomalasia, periodontal disease, scurvy, Cushing's Disease, bone fracture and conditions due to limb immobilization and steroid usage
- Figure 1 is a schematic illustration comparing the amino acid sequence of Human Dan, Human Gremlin, Human Cerberus and Human Beer Arrows indicate the Cysteine backbone
- Figure 2 summarizes the results obtained from surveying a variety of human tissues for the expression of a TGF-beta bind g-protem gene, specifically, the Human Beer gene
- RT-PCR Reverse Transc ⁇ ption-Polymerase Chain Reaction
- Figure 3 summarizes the results obtained from RNA m silu hybridization of mouse embryo sections, using a cRNA probe that is complementary to the mouse Beer transcript (described in more detail in EXAMPLE 2B)
- Panel A is a transverse section of 10 5 dpc embryo
- Panel B is a sagittal section of 12 5 dpc embryo
- panels C and D are sagittal sections of 15 5 dpc embryo
- Figure 5 illustrates, by western blot analysis, the selectivity of the TGF- beta binding-protein, Beer, for BMP-5 and BMP-6, but not BMP-4 (described in more detail in EXAMPLE 5)
- Figure 6 demonstrates that the ionic interaction between the TGF-beta binding-protein, Beer, and BMP-5 has a dissociation constant in the 15-30 nM range DETAILED DESCRIPTION OF THE INVENTION
- TGF-beta should be understood to include any known or novel member of the TGF-beta super-family, which also includes bone morphogenic proteins (BMPs)
- TGF-beta receptor should be understood to refer to the receptor specific for a particular member of the TGF-beta super-family (including bone morphogenic proteins (BMPs))
- TGF-beta binding-protein should be understood to refer to a protein with specific binding affinity for a particular member or subset of members of the TGF-beta super-family (including bone morphogenic proteins (BMPs))
- BMPs bone morphogenic proteins
- Specific examples of TGF-beta binding-proteins include proteins encoded by Sequence ID Nos 1, 5, 7, 9, 1 1, 13, and 15
- Inhibiting the "binding of the TGF-beta binding-protein to the TGF-beta family of proteins and bone morphogenic proteins (BMPs)" should be understood to refer to molecules which allow the activation of TGF-beta or bone morphogenic proteins (BMPs), or allow the binding of TGF-beta family members including bone morphogenic proteins (BMPs) to their respective receptors, by removing or preventing TGF-beta from binding to TGF-binding-protein Such inhibition may be accomplished, for example, by molecules which inhibit the binding of the TGF-beta binding-protein to specific members of theTGF-beta super-family
- Vector refers to an assembly which is capable of directing the expression of desired protein
- the vector must include transcriptional promoter elements which are operably linked to the gene(s) of interest
- the vector may be composed of either deoxyribonucleic acids ("DNA”), ribonucleic acids ("RNA”), or a combination of the two (e.g., a DNA-RNA chimeric)
- the vector may include a polyadenylation sequence, one or more restriction sites, as well as one or more selectable markers such as neomycin phosphotransferase or hygromycin phosphotransferase
- other genetic elements such as an origin of replication, additional nucleic acid restriction sites, enhancers, sequences conferring inducibility of transcription, and selectable markers, may also be incorporated into the vectors described herein
- isolated nucleic acid molecule is a nucleic acid molecule that is not integrated in the genomic DNA of an organism
- a DNA molecule that encodes a TGF-binding protein that has been separated from the genomic DNA of a eukaryotic cell is an isolated DNA molecule
- Another example of an isolated nucleic acid molecule is a chemically-synthesized nucleic acid molecule that is not integrated in the genome of an organism
- the isolated nucleic acid molecule may be genomic DNA, cDNA, RNA, or composed at least in part of nucleic acid analogs
- isolated polypeptide is a polypeptide that is essentially free from contaminating cellular components, such as carbohydrate, lipid, or other proteinaceous impurities associated with the polypeptide in nature
- a particular protein preparation contains an isolated polypeptide if it appears nominally as a single band on SDS-PAGE gel with Coomassie Blue staining
- isolated when referring to organic molecules means that the compounds are greater than 90 percent pure utilizing methods which are well known in the art (e g , NMR, melting point)
- “Sclerosteosis” Sclerosteosis is a term that was applied by Hansen (1967) (Hansen, H G , Sklerosteose In Opitz, H , Schmid, F , Handbuch der Kinderheil ambience Berlin Springer (pub ) 6 1967 Pp 351-355) to a disorder similar to van Buchem hyperostosis corticahs generahsata but possibly differing in radiologic appearance of the bone changes and in the presence of asymmetric cutaneous syndactyly of the index and middle fingers in many cases The jaw has an unusually square appearance in this condition "Humanized antibodies” are recombinant proteins in which murine complementary determining regions of monoclonal antibodies have been transferred from heavy and light variable chains of the murine immunoglobulin into a human variable domain
- an "antibody fragment” is a portion of an antibody such as F(ab') 2 , F(ab) 2 , Fab', Fab, and the like Regardless of structure, an antibody fragment binds with the same antigen that is recognized by the intact antibody
- an anti-TGF-beta binding-protein monoclonal antibody fragment binds with an epitope of TGF-beta binding-protein
- antibody fragment also includes any synthetic or genetically engineered protein that acts like an antibody by binding to a specific antigen to form a complex
- antibody fragments include isolated fragments consisting of the light chain variable region, "Fv” fragments consisting of the variable regions of the heavy and light chains, recombinant single chain polypeptide molecules in which light and heavy variable regions are connected by a peptide linker (“sFv proteins”), and minimal recognition units consisting of the amino acid residues that mimic the hyperva ⁇ able region
- a “detectable label” is a molecule or atom which can be conjugated to an antibody moiety to produce a molecule useful for diagnosis
- detectable labels include chelators, photoactive agents, radioisotopes, fluorescent agents, paramagnetic ions, enzymes, and other marker moieties
- an "lmmunoconiugate” is a molecule comprising an anti-TGF-beta binding-protein antibody, or an antibody fragment, and a detectable label An immunoconjugate has roughly the same, or only slightly reduced, ability to bind TGF-beta binding-protein after conjugation as before conjugation
- TGF-beta Transforming Growth Factor-beta
- TGF- bBP Transforming Growth Factor-beta binding-protein
- BMP BMP - "bone morphogenic protein”
- PCR polymerase chain reaction
- RT-PCR PCR process in which RNA is first transcribed into DNA at the first step using reverse transc ⁇ ptase (RT), cDNA - any DNA made by copying an RNA sequence into DNA form
- the present invention provides a novel class of TGF- beta bindmg-proteins, as well as methods and compositions for increasing bone mineral content in warm-blooded animals
- the present inventions are based upon the unexpected discovery that a mutation in the gene which encodes a novel member of the TGF-beta binding-protein family results in a rare condition (sclerosteosis) characterized by bone mineral contents which are one- to four-fold higher than in normal individuals
- assays which may be utilized to select molecules which inhibit the binding of the TGF- beta binding-protein to the TGF-beta family of proteins and bone morphogenic proteins (BMPs), and methods of utilizing such molecules for increasing the bone mineral content of warm-blooded animals (including for example, humans)
- Sclerosteosis is now known to be an autosomal semi-dommant disorder which is characterized by widely disseminated sclerotic lesions of the bone in the adult
- the condition is progressive Sclerosteosis also has a developmental aspect which is associated with syndactyly (two or more fingers are fused together)
- the Sclerosteosis Syndrome is associated with large stature and many affected individuals attain a height of six feet or more
- the bone mineral content of homozygotes can be 1 to 6 fold over normal individuals and bone mineral density can be 1 to 4 fold above normal values (e g , from unaffected siblings)
- the Sclerosteosis Syndrome occurs primarily in Af ⁇ kaaners of Dutch descent in South Africa Approximately 1/140 individuals in the Af ⁇ kaaner population are carriers of the mutated gene (heterozygotes) The mutation shows 100% penetrance There are anecdotal reports of increased of bone mineral density in heterozygotes with no associated pathologies (syndactyly or skull overgrowth)
- Sclerosteosis is characterized by the continual deposition of bone throughout the skeleton during the lifetime of the affected individuals In homozygotes the continual deposition of bone mineral leads to an overgrowth of bone in areas of the skeleton where there is an absence of mechanoreceptors (skull, jaw, cranium) In homozygotes with Sclerosteosis, the overgrowth of the bones of the skull leads to cranial compression and eventually to death due to excessive hydrostatic pressure on the brain stem In all other parts of the skeleton there is a generalized and diffuse sclerosis Cortical areas of the long bones are greatly thickened resulting in a substantial increase in bone strength Trabecular connections are increased in thickness which in turn increases the strength of the trabecular bone. Sclerotic bones appear unusually opaque to x-rays.
- the rare genetic mutation that is responsible for the Sclerosteosis syndrome has been localized to the region of human chromosome 17 that encodes a novel member of the TGF-beta binding-protein family (one representative example of which is designated "H. Beer").
- H. Beer a novel member of the TGF-beta binding-protein family
- the mechanism of bone mineralization is more fully understood, allowing the development of assays for molecules which increase bone mineralization, and use of such molecules to increase bone mineral content, and in the treatment or prevention of a wide number of diseases.
- TGF-beta The Transforming Growth Factor-beta (TGF-beta) super-family contains a variety of growth factors that share common sequence elements and structural motifs (at both the secondary and tertiary levels). This protein family is known to exert a wide spectrum of biological responses on a large variety of cell types. Many of them have important functions during the embryonal development in pattern formation and tissue specification; in adults they are involved, e.g., in wound healing and bone repair and bone remodeling, and in the modulation of the immune system.
- the super-family includes the Bone Morphogenic Proteins (BMPs), Activins, Inhibins, Growth and Differentiation Factors (GDFs), and Glial-Derived Neurotrophic Factors (GDNFs).
- BMPs Bone Morphogenic Proteins
- GDFs Growth and Differentiation Factors
- GDNFs Glial-Derived Neurotrophic Factors
- Primary classification is established through general sequence features that bin a specific protein into a general sub-family. Additional stratification within the sub-family is possible due to stricter sequence conservation between members of the smaller group. In certain instances, such as with BMP-5, BMP-6 and BMP-7, this can be as high as 75 percent amino acid homology between members of the smaller group. This level of identity enables a single representative sequence to illustrate the key biochemical elements of the sub-group that separates it from other members of the larger family.
- TGF-beta signals by inducing the formation of hetero-oligomeric complexes of type I and type II receptors.
- the crystal structure of TGF-beta2 has been determined.
- the general fold of the TGF-beta2 monomer contains a stable, compact, cysteine knotlike structure formed by three disulphide bridges. Dimerization, stabilized by one disulphide bridge, is antiparallel.
- TGF-beta family members initiate their cellular action by binding to receptors with intrinsic serine/threonine kinase activity.
- This receptor family consists of two subfamilies, denoted type I and type II receptors Each member of the TGF-beta family binds to a characteristic combination of type I and type II receptors, both of which are needed for signaling
- TGF-beta receptor activation TGF-beta first binds to the type II receptor (TbR-II), which occurs in the cell membrane in an ohgome ⁇ c form with activated kinase Thereafter, the type I receptor (TbR-I), which can not bind ligand in the absence of TbR-II, is recruited into the complex TbR-II then phosphorylates TbR-I predominantly in a domain rich in glycine and se ⁇ ne residues (GS domain) in the
- uxtamembrane region thereby activates TbR-I
- BMPs bone morphogenic proteins
- OPs osteogenic proteins
- BMP 2-14, and osteogenic protein 1 and -2, OP-1 and OP-2 are members of the TGF-beta super-family
- the striking evolutionary conservation between members the BMP/OP sub-family suggests that they are critical in the normal development and function of animals Moreover, the presence of multiple forms of BMPs/OPs raises an important question about the biological relevance of this apparent redundancy
- BMP ANTAGONISM The BMP and Activin sub-families are subject to significant post- translational regulation An intricate extracellular control system exists, whereby a high affinity antagonist is synthesized and exported, and subsequently complexes selectively with BMPs or activins to disrupt their biological activity (W C Smith (1999) TIG I5( ⁇ ) 3-6) A number of these natural antagonists have been identified, and based on sequence divergence appear to have evolved independently due to the lack of primary sequence conservation There has been no structural work to date on this class of proteins Studies of these antagonists has highlighted a distinct preference for interacting and neutralizing BMP-2 and BMP-4 Furthermore, the mechanism of inhibition seems to differ for the different antagonists (S lemura et al (1998) Proc Nail Acad Sci USA 95 9337-9342)
- the present invention provides a novel class of TGF- beta binding-proteins that possess a nearly identical cysteine (disulfide) scaffold when compared to Human DAN, Human Gremlin, and Human Cerberus, and SCGF (U S Patent No 5,780,263) but almost no homology at the nucleotide level (for background information, see generally Hsu, D R , Economides, A N , Wang, X , Eimon, P M , Harland, R M , "The Xenopits Dorsalizing Factor Gremlin Identifies a Novel Family of Secreted Proteins that Antagonize BMP Activities," Molecular Cell 1 673-683, 1998)
- One representative example of the novel class of TGF-beta binding- proteins is disclosed in Sequence ID Nos 1 , 5, 9, 1 1, 13, and 15 Representative members of this class of binding proteins should also be understood to include variants of the TGF-beta binding-protein (e g , Sequence ID Nos 5 and
- a variant TGF-beta binding-protein should have at least a 50% amino acid sequence identity to SEQ ID NOs 2, 6, 10, 12, 14 or 16 and preferably, greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity
- TGF-beta binding-protein variants can be identified by having at least a 70% nucleotide sequence identity to SEQ ID NOs 1, 5, 9, 1 1, 13 or 15
- the present invention contemplates TGF-beta binding-protein gene variants having greater than 75%, 80%>, 85%, 90%, or 95% identity to SEQ ID NO 1
- a variant TGF-beta binding-protein or a polypeptide encoded by a variant TGF-beta binding-protein gene can be functionally characterized by, for example, its ability to bind to and/or inhibit the signaling of a selected member of the TGF
- DNA molecules encoding a binding-protein gene can be obtained by screening a human cDNA or genomic library using polynucleotide probes based upon, for example, SEQ ID NO 1
- RNA isolation techniques must provide a method for breaking cells, a means of inhibiting RNase-directed degradation of RNA, and a method of separating RNA from DNA, protein, and polysaccharide contaminants
- total RNA can be isolated by freezing tissue in liquid nitrogen, grinding the frozen tissue with a mortar and pestle to lyse the cells, extracting the ground tissue with a solution of phenol/chloroform to remove proteins, and separating RNA from the remaining impurities by selective precipitation with lithium chloride (see, for example, Ausubel et al (eds ), Short Protocols in Molecular Biology, 3rd Edition, pages 4-1 to 4-6 (John Wiley & Sons 1995) ["Ausubel (1995)”], Wu et al , Methods in Gene Biotechnology, pages 33-41 (CRC Press, Inc 1997) ["Wu (1997)”])
- total RNA can be isolated by extracting ground tissue with guanidinium isothiocyanate, extracting with organic solvents, and separating RNA from contaminants using differential centrifugation (see, for example, Ausubel (1995) at pages 4- 1 to 4-6, Wu (1997) at pages 33-41)
- poly(A) + RNA In order to construct a cDNA library, poly(A) + RNA must be isolated from a total RNA preparation Poly(A) T RNA can be isolated from total RNA by using the standard technique of oligo(dT)-cellulose chromatography (see, for example, Ausubel (1995) at pages 4-11 to 4-12) Double-stranded cDNA molecules are synthesized from poly(A) + RNA using techniques well-known to those in the art (see, for example, Wu (1997) at pages 41-46) Moreover, commercially available kits can be used to synthesize double- stranded cDNA molecules For example, such kits are available from Life Technologies, Inc (Gaithersburg, Maryland), CLONTECH Laboratories, Inc (Palo Alto, California), Promega Corporation (Madison, Wisconsin) and Stratagene Cloning Systems (La Jolla, California)
- TGF-beta binding-protein cDNA clones can be modified by constructing a subtracted cDNA library which is enriched in TGF- binding-protein-specific cDNA molecules.
- Techniques for constructing subtracted libraries are well-known to those of skill in the art (see, for example, Sargent, "Isolation of Differentially Expressed Genes," in Me th. Enzymol. 152 423, 1987, and Wu et al (eds ), "Construction and Screening of Subtracted and Complete Expression cDNA Libraries," in Methods in Gene Biotechnology, pages 29-65 (CRC Press, Inc 1997))
- a cDNA library can be prepared in a vector derived from bacteriophage, such as a ⁇ gtlO vector (see, for example, Huynh et al , "Constructing and Screening cDNA Libraries in ⁇ gtlO and ⁇ gtl l," in DNA Cloning: A Practical Approach Vol. I, Glover (ed ), page 49 (IRL Press, 1985), Wu (1997) at pages 47-52)
- double-stranded cDNA molecules can be inserted into a plasmid vector, such as a pBluescript vector (Stratagene Cloning Systems, La Jolla, California), a LambdaGEM-4 (Promega Corp , Madison, Wisconsin) or other commercially available vectors Suitable cloning vectors also can be obtained from the American Type Culture Collection (Rockville, Maryland)
- the cDNA library is inserted into a prokaryotic host, using standard techniques
- a cDNA library can be introduced into competent E. coli DH5 cells, which can be obtained from Life Technologies, Inc (Gaithersburg, Maryland)
- a human genomic DNA library can be prepared by means well-known in the art (see, for example, Ausubel (1995) at pages 5-1 to 5-6, Wu (1997) at pages 307-327) Genomic DNA can be isolated by lysing tissue with the detergent Sarkosyl, digesting the lysate with proteinase K, clearing insoluble debris from the lysate by centrifugation, precipitating nucleic acid from the lysate using isopropanol, and purifying resuspended DNA on a cesium chloride density gradient
- DNA fragments that are suitable for the production of a genomic library can be obtained by the random shearing of genomic DNA or by the partial digestion of genomic DNA with restriction endonucleases
- Genomic DNA fragments can be inserted into a vector, such as a bacteriophage or cosmid vector, in accordance with conventional techniques, such as the use of restriction enzyme digestion to provide appropriate termini, the use of alkaline phosphatase treatment to avoid undesirable joining of DNA molecules, and ligation with appropriate ligases Techniques for such manipulation are well-known in the art (see, for example, Ausubel (1995) at pages 5-1 to 5-6, Wu (1997) at pages 307-327)
- Nucleic acid molecules that encode a TGF-beta binding-protein gene can also be obtained using the polymerase chain reaction (PCR) with oligonucleotide primers having nucleotide sequences that are based upon the nucleotide sequences of the human TGF-beta binding-protein gene, as described herein
- PCR polymerase chain reaction
- oligonucleotide primers having nucleotide sequences that are based upon the nucleotide sequences of the human TGF-beta binding-protein gene, as described herein
- General methods for screening libraries with PCR are provided by, for example, Yu et al , "Use of the Polymerase Chain Reaction to Screen Phage Libraries," in Methods in Molecular- Biology, Vol. 15: PCR Protocols: Current Methods and AppUcations, White (ed ), pages 211-215 (Humana Press, Inc. 1993).
- human genomic libraries can be obtained from commercial sources such as Research Genetics (Huntsville, AL) and the American Type Culture Collection (Rockville, Maryland).
- a library containing cDNA or genomic clones can be screened with one or more polynucleotide probes based upon SEQ ID NO: l, using standard methods (see, for example, Ausubel (1995) at pages 6-1 to 6-11).
- Anti-TGF-beta binding-protein antibodies produced as described below, can also be used to isolate DNA sequences that encode TGF-beta binding-protein genes from cDNA libraries.
- the antibodies can be used to screen ⁇ gtl l expression libraries, or the antibodies can be used for immunoscreening following hybrid selection and translation (see, for example, Ausubel (1995) at pages 6-12 to 6- 16; Margolis et al., "Screening ⁇ expression libraries with antibody and protein probes," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.), pages 1-14 (Oxford University Press 1995)).
- TGF-beta binding-protein cDNA or TGF-beta binding-protein genomic fragment can be determined using standard methods. Moreover, the identification of genomic fragments containing a TGF-beta binding- protein promoter or regulatory element can be achieved using well-established techniques, such as deletion analysis (see, generally, Ausubel (1995)).
- a TGF-beta binding-protein gene can be obtained by synthesizing DNA molecules using mutually priming long oligonucleotides and the nucleotide sequences described herein (see, for example, Ausubel (1995) at pages 8-8 to 8-9).
- Established techniques using the polymerase chain reaction provide the ability to synthesize DNA molecules at least two kilobases in length (Adang et al., Plant Molec. Biol. 27: 1 131, 1993; Bambot et al., PCR Methods and Applications 2:266, 1993; Dillon et al., "Use of the Polymerase Chain Reaction for the Rapid Construction of Synthetic Genes," in Methods in Molecular Biology, Vol.
- Nucleic acid molecules encoding variant TGF-beta bindmg-protein genes can be obtained by screening various cDNA or genomic libraries with polynucleotide probes having nucleotide sequences based upon SEQ ID NO 1, 5, 9, 1 1, 13, or 15, using procedures described above TGF-beta binding-protein gene variants can also be constructed synthetically
- a nucleic acid molecule can be devised that encodes a polypeptide having a conservative amino acid change, compared with the amino acid sequence of SEQ ID NOs 2, 6, 8, 10, 12, 14, or 16 That is, variants can be obtained that contain one or more amino acid substitutions of SEQ ID NOs 2, 6, 8, 10, 12, 14 or 16, in which an alkyl amino acid is substituted for an alkyl amino acid in a TGF-beta binding-protein amino acid sequence, an aromatic amino acid is substituted for an aromatic amino acid in a TGF-beta binding-protein amino acid sequence, a sulfur-containing amino acid is substituted for a sulfur-containm
- a “conservative amino acid substitution” is illustrated by a substitution among amino acids within each of the following groups (1) glycine, alanine, valine, leucine, and isoleucine, (2) phenylalanme, tyrosine, and tryptophan, (3) se ⁇ ne and threonine, (4) aspartate and glutamate, (5) glutamine and asparagine, and (6) lysine, arginine and histidine In making such substitutions, it is important to, where possible, maintain the cysteine backbone outlined in Figure 1
- Conservative amino acid changes in a TGF-beta binding-protein gene can be introduced by substituting nucleotides for the nucleotides recited in SEQ ID NO 1
- Such "conservative amino acid” variants can be obtained, for example, by ohgonucleotide-directed mutagenesis, linker-scanning mutagenesis, mutagenesis using the polymerase chain reaction, and the like (see Ausubel (1995) at pages 8-10 to 8-22, and McPherson (ed ), Directed Mutagenesis A Practical Approach (IRL Press 1991))
- the functional ability of such variants can be determined using a standard method, such as the assay described herein
- a variant TGF-beta binding-protein polypeptide can be identified by the ability to specifically bind anti-TGF-beta binding- protein antibodies
- Routine deletion analyses of nucleic acid molecules can be performed to obtain "functional fragments" of a nucleic acid molecule that encodes a TGF-beta binding-protein polypeptide
- DNA molecules having the nucleotide sequence of SEQ ID NO 1 can be digested with Ba/31 nuclease to obtain a series of nested deletions
- the fragments are then inserted into expression vectors in proper reading frame, and the expressed polypeptides are isolated and tested for activity, or for the ability to bind anti-TGF-beta binding-protein antibodies
- exonuclease digestion is to use ohgonucleotide-directed mutagenesis to introduce deletions or stop codons to specify production of a desired fragment
- particular fragments of a TGF-beta binding-protein gene can be synthesized using the polymerase chain reaction
- the present invention also contemplates functional fragments of a TGF- beta binding-protein gene that have conservative amino acid changes
- a TGF-beta binding-protein variant gene can be identified on the basis of structure by determining the level of identity with nucleotide and amino acid sequences of SEQ ID NOs 1, 5, 9, 1 1, 13, or, 15 and 2, 6, 10, 12, 14, or 16, as discussed above
- An alternative approach to identifying a variant gene on the basis of structure is to determine whether a nucleic acid molecule encoding a potential variant TGF-beta binding-protein gene can hybridize under stringent conditions to a nucleic acid molecule having the nucleotide sequence of SEQ ID Nos 1, 5, 9, 1 1, 13, or, 15, or a portion thereof of at least 15 or 20 nucleotides in length
- a nucleic acid molecule encoding the polypeptide must be operably linked to regulatory sequences that control transcriptional expression in an expression vector and then introduced into a host cell
- expression vectors can include translational regulatory sequences and a marker gene which is suitable for selection of cells that carry the expression vector
- Expression vectors that are suitable for production of a foreign protein in eukaryotic cells typically contain (1) prokaryotic DNA elements coding for a bacterial replication origin and an antibiotic resistance marker to provide for the growth and selection of the expression vector in a bacterial host, (2) eukaryotic DNA elements that control initiation of transcription, such as a promoter, and (3) DNA elements that control the processing of transcripts, such as a transcription termination/polyadenylation sequence TGF-beta binding-proteins ofthe present invention are preferably expressed in mammalian cells Examples of mammalian host cells include African green monkey kidney cells (Vero, ATCC CRL 1587), human embryonic kidney cells (293-HEK, ATCC CRL 1573), baby hamster kidney cells (BHK-21, ATCC CRL 8544), canine kidney cells (MDCK, ATCC CCL 34), Chinese hamster ovary cells (CHO-K1, ATCC CCL61), rat pituitary cells (GHl, ATCC CCL82), HeLa S3 cells (ATCC CCL
- the transcriptional and translational regulatory signals may be derived from viral sources, such as adenovirus, bovine papilloma virus, simian virus, or the like, in which the regulatory signals are associated with a particular gene which has a high level of expression.
- viral sources such as adenovirus, bovine papilloma virus, simian virus, or the like, in which the regulatory signals are associated with a particular gene which has a high level of expression.
- Suitable transcriptional and translational regulatory sequences also can be obtained from mammalian genes, such as actin, collagen, myosin, and metallothionein genes.
- Transcriptional regulatory sequences include a promoter region sufficient to direct the initiation of RNA synthesis.
- Suitable eukaryotic promoters include the promoter of the mouse metallothionein I gene [Hamer et al., J. Molec. Appl. Genet. 7:273, 1982], the TK promoter of Herpes virus [McKnight, Cell 37:355, 1982], the SV40 early promoter [Benoist et al., Nature 290:304, 1981], the Rons sarcoma virus promoter [Gorman et al., Proc. Nat '/ Acad Sci.
- a prokaryotic promoter such as the bacteriophage T3 RNA polymerase promoter
- a prokaryotic promoter can be used to control TGF-beta binding-protein gene expression in mammalian cells if the prokaryotic promoter is regulated by a eukaryotic promoter (Zhou et & ⁇ ., Mol. Cell. Biol. 10:4529, 1990; Kaufman et al., N,/c7. Acids Res. 79:4485, 1991).
- TGF-beta binding-protein genes may also be expressed in bacterial, yeast, insect, or plant cells.
- Suitable promoters that can be used to express TGF-beta binding- protein polypeptides in a prokaryotic host are well-known to those of skill in the art and include promoters capable of recognizing the T4, T3, Sp6 and T7 polymerases, the P R and P L promoters of bacteriophage lambda, the trp, recA, heat shock, lacUVS, lac, Ipp- lacSpr, phoA, and lacZ promoters of E. coli, promoters of B.
- subtilis the promoters of the bacteriophages of Bacillus, Streplomyces promoters, the ml promoter of bacterio- phage lambda, the bla promoter of pBR322, and the CAT promoter of the chloram- phenicol acetyl transferase gene.
- Prokaryotic promoters have been reviewed by Glick, J. bid. Microbiol. 7:277, 1987, Watson et al., Molecular Biology of the Gene, 4th Ed. (Benjamin Cummins 1987), and by Ausubel et al. (1995).
- Preferred prokaryotic hosts include E. coli and Bacillus subtihts.
- Suitable strains of E. coli include BL21(DE3), BL21(DE3)pLysS, BL21(DE3)pLysE, DH1, DH4I, DH5, DH5I, DH5IF', DH5IMCR, DH10B, DH10B/p3, DH1 1 S, C600, HB101, JM101, JM105, JM109, JM1 10, K38, RR1, Y1088, Y1089, CSH18, ER1451, and ER1647 (see, for example, Brown (Ed.), Molecular Biology Labfax (Academic Press 1991)).
- Suitable strains of Bacillus subtihts include BR151, YB886, Mil 19, MI120, and B170 (see, for example, Hardy, “Bacillus Cloning Methods,” in DNA Cloning: A Practical Approach, Glover (Ed.) (IRL Press 1985)).
- Methods for expressing proteins in prokaryotic hosts are well-known to those of skill in the art (see, for example, Williams et al., "Expression of foreign proteins in E. coli using plasmid vectors and purification of specific polyclonal antibodies," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al.
- Suitable expression vectors are based upon the Autographa californica multiple nuclear polyhedrosis virus (AcMNPV), and contain well-known promoters such as Drosophila heat shock protein (hsp) 70 promoter, Autogr-apha californica nuclear polyhedrosis virus immediate-early gene promoter (/e-7) and the delayed early 39K promoter, baculovirus plO promoter, and the Drosophila metallothionein promoter.
- AcMNPV Autographa californica multiple nuclear polyhedrosis virus
- hsp Drosophila heat shock protein
- /e-7 Autogr-apha californica nuclear polyhedrosis virus immediate-early gene promoter
- delayed early 39K promoter baculovirus plO promoter
- baculovirus plO promoter baculovirus plO promoter
- Drosophila metallothionein promoter Drosophila metallothionein promoter
- Suitable insect host cells include cell lines derived from IPLB-S -21, a Spodoptera frugiperda pupal ovarian cell line, such as S 9 (ATCC CRL 171 1), S/21AE, and S/21 (Invitrogen Corporation; San Diego, CA), as well as Drosophila Schneider-2 cells.
- S 9 ATCC CRL 171 1
- S/21AE Spodoptera frugiperda pupal ovarian cell line
- S/21 Invitrogen Corporation; San Diego, CA
- Drosophila Schneider-2 cells Drosophila Schneider-2 cells.
- Established techniques for producing recombinant proteins in baculovirus systems are provided by Bailey et al., "Manipulation of Baculovirus Vectors," in Methods in Molecular Biology, Volume ⁇ : Gene Transfer and Expression Protocols, Murray (ed ), pages 147-168 (The Humana Press, Inc.
- Promoters for expression in yeast include promoters from GAL1 (galactose), PGK (phosphoglycerate kinase), ADH (alcohol dehydrogenase), AOXI (alcohol oxidase), HIS4 (histidinol dehydrogenase), and the like.
- Many yeast cloning vectors have been designed and are readily available. These vectors include YIp-based vectors, such as YIp5, YRp vectors, such as YRpl7, YEp vectors such as YEpl3 and YCp vectors, such as YCpl9.
- YIp5 YIp5
- YRp vectors such as YRpl7
- YEp vectors such as YEpl3
- YCp vectors such as YCpl9.
- Expression vectors can also be introduced into plant protoplasts, intact plant tissues, or isolated plant cells. General methods of culturing plant tissues are provided, for example, by Miki et al., "Procedures for Introducing Foreign DNA into Plants," in Methods in Plan! Molecular Biology and Biotechnology, Glick et al. (eds.), pages 67-88 (CRC Press, 1993).
- An expression vector can be introduced into host cells using a variety of standard techniques including calcium phosphate transfection, liposome-mediated transfection, microprojectile-mediated delivery, electroporation, and the like.
- the transfected cells are selected and propagated to provide recombinant host cells that comprise the expression vector stably integrated in the host cell genome.
- Standard techniques for recovering protein produced by a bacterial system is provided by, for example, Grisshammer et al , "Purification of over-produced proteins from E. coli cells," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.), pages 59-92 (Oxford University Press 1995).
- Established methods for isolating recombinant proteins from a baculovirus system are described by Richardson (ed.), Baculovirus Expression Protocols (The Humana Press, Inc., 1995). More generally, TGF-beta binding-protein can be isolated by standard techniques, such as affinity chromatography, size exclusion chromatography, ion exchange chromatography, HPLC and the like.
- TGF-beta binding-protein isolation and purification can be devised by those of skill in the art.
- anti-TGF-beta binding-protein antibodies obtained as described below, can be used to isolate large quantities of protein by immunoaffinity purification.
- Antibodies to TGF-beta binding-protein can be obtained, for example, using the product of an expression vector as an antigen.
- Particularly useful anti-TGF- beta binding-protein antibodies "bind specifically" with TGF-beta binding-protein of Sequence ID Nos.
- TGF-beta binding-proteisn such as Dan, Cerberus, SCGF, or Gremlin
- Antibodies of the present invention may be a polyclonal or, especially a monoclonal antibody
- the antibody may belong to any immunoglobulm class, and may be for example an IgG, for example IgG b IgG , IgG 3 , IgG 4 , IgE, IgM, or IgA antibody It may be of animal, for example mammalian origin, and may be for example a murine, rat, human or other primate antibody Where desired the antibody may be an internalising antibody
- Polyclonal antibodies to recombinant TGF-beta binding-protein can be prepared using methods well-known to those of skill in the art (see, for example, Green et al , "Production of Polyclonal Antisera,” in Immunochemical Protocols (Manson, ed ), pages 1 -5 (Humana Press 1992), Williams et al , "Expression of foreign proteins in E coli using plasmid vectors and purification of specific polyclonal antibodies," in DNA Cloning 2 Expression Systems, 2nd Edition, Glover et al (eds ), page 15 (Oxford University Press 1995))
- polyclonal antibodies are typically raised in animals such as rats, mice, rabbits, goats, or sheep
- an anti-TGF-beta binding-protein antibody of the present invention may also be derived from a subhuman primate antibody
- General techniques for raising diagnostically and therapeutically useful antibodies in baboons may be found, for example, in Goldenberg et al , international patent publication No
- variable region domain may be of any size or amino acid composition and will generally comprise at least one hyperva ⁇ able amino acid sequence responsible for antigen binding embedded in a framework sequence
- variable (V) region domain may be any suitable arrangement of immunoglobulm heavy (V H ) and/or light (V j chain variable domains
- V H immunoglobulm heavy
- V j chain variable domains the V region domain may be monome ⁇ c and be a V H or V L domain where these are capable of independently binding antigen with acceptable affinity
- the V region domain may be dime ⁇ c and contain V H -V H , V H -V L , or V L -V L , dimers in which the V H and V L chains are non-covalently associated (abbreviated hereinafter as F v )
- the chains may be covalently coupled either directly, for example via a disulphide bond between the two variable domains, or through a linker, for example a peptide linker, to form a single chain domain (abbreviated here
- variable region domain may be any naturally occu ⁇ ng variable domain or an engineered version thereof
- engineered version is meant a variable region domain which has been created using recombinant DNA engineering techniques
- engineered versions include those created for example from natural antibody variable regions by insertions, deletions or changes in or to the amino acid sequences of the natural antibodies
- Particular examples of this type include those engineered variable region domains containing at least one CDR and optionally one or more framework amino acids from one antibody and the remainder of the variable region domain from a second antibody
- variable region domain may be covalently attached at a C-terminal amino acid to at least one other antibody domain or a fragment thereof
- a V H domain is present in the variable region domain this may be linked to an immunoglobulin C H 1 domain or a fragment thereof
- a V L domain may be linked to a C ⁇ domain or a fragment thereof
- the antibody may be a Fab fragment wherein the antigen binding domain contains associated V j _r and V L domains covalently linked at their C-termini to a CHI and C ⁇ domain respectively
- the CHI domain may be extended with further amino acids, for example to provide a hinge region domain as found in a Fab' fragment, or to provide further domains, such as antibody CH2 and CH3 domains
- an antibody fragment is a peptide coding for a single complementarity-determining region (CDR) CDR peptides ("minimal recognition units") can be obtained by constructing genes encoding the CDR of an antibody of interest Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells (see, for example, Larrick et al , Methods: A Companion to Methods in Enzymology 2.106, 1991 , Courtenay-Luck, "Genetic Manipulation of Monoclonal Antibodies," in Monoclonal Antibodies: Production, Engineering and Clinical Application, Ritter et al.
- CDR complementarity-determining region
- Antibodies for use in the invention may in general be monoclonal (prepared by conventional immunisation and cell fusion procedures) or in the case of fragments, derived therefrom using any suitable standard chemical e g reduction or enzymatic cleavage and/or digestion techniques, for example by treatment with pepsin
- monoclonal anti-TGF-beta binding-protein antibodies can be generated utilizing a variety of techniques Rodent monoclonal antibodies to specific antigens may be obtained by methods known to those skilled in the art (see, for example, Kohler et al , Nature 256 495, 1975; and Coligan et al (eds ), Current Protocols in Immunology, 7 2 5 1-2 6 7 (John Wiley & Sons 1991) ["Coligan”], Picksley et al , "Production of monoclonal antibodies against proteins expressed in E. coli," in DNA Cloning 2 Expression Systems, 2nd Edition, Glover et al (eds ), page 93 (Oxford University Press 1995))
- monoclonal antibodies can be obtained by injecting mice with a composition comprising a TGF-beta bmding-protein gene product, verifying the presence of antibody production by removing a serum sample, removing the spleen to obtain B-lymphocytes, fusing the B-lymphocytes with myeloma cells to produce hyb ⁇ domas, cloning the hyb ⁇ domas, selecting positive clones which produce antibodies to the antigen, cultunng the clones that produce antibodies to the antigen, and isolating the antibodies from the hyb ⁇ doma cultures
- an anti-TGF-beta bindmg-protein antibody of the present invention may be derived from a human monoclonal antibody
- Human monoclonal antibodies are obtained from transgenic mice that have been engineered to produce specific human antibodies in response to antigenic challenge In this technique, elements of the human heavy and light chain locus are introduced into strains of mice derived from embryonic stem cell lines that contain
- Monoclonal antibodies can be isolated and purified from hybndoma cultures by a variety of well-established techniques Such isolation techniques include affinity chromatography with Protein-A Sepharose, size-exclusion chromatography, and ion-exchange chromatography (see, for example, Coligan at pages 2 7 1-2 7 12 and pages 2 9 1-2 9 3, Barnes et al , "Purification of Immunoglobulm G (IgG)," in Methods in Molecular Biology, Vo 10, pages 79-104 (The Humana Press, Inc 1992))
- antibody fragments can be obtained, for example, by proteolytic hydrolysis of the antibody
- Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods
- antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5S fragment denoted F(ab') 2
- This fragment can be further cleaved using a thiol reducing agent to produce 3 5S Fab' monovalent fragments
- the cleavage reaction can be performed using a blocking group for the sulfhydryl groups that result from cleavage of disulfide linkages
- an enzymatic cleavage using pepsin produces two monovalent Fab fragments and an Fc fragment directly
- the antibody may be a recombinant or engineered antibody obtained by the use of recombinant DNA techniques involving the manipulation and re- expression of DNA encoding antibody variable and/or constant regions
- DNA is known and/or is readily available from DNA libraries including for example phage- antibody libraries (see Chiswell, D J and McCafferty, J Tibtech K) 80-84 (1992)) or where desired can be synthesised Standard molecular biology and/or chemistry procedures may be used to sequence and manipulate the DNA, for example, to introduce codons to create cysteine residues, to modify, add or delete other amino acids or domains as desired
- one or more rephcable expression vectors containing the DNA may be prepared and used to transform an appropriate cell line, e g a non-producing myeloma cell line, such as a mouse NSO line or a bacterial, e g E coli line, in which production of the antibody will occur
- an appropriate cell line e g a non-producing myeloma cell line, such as a mouse NSO line or a bacterial, e g E coli line
- the DNA sequence in each vector should include appropriate regulatory sequences, particularly a promoter and leader sequence operably linked to the variable domain sequence
- Particular methods for producing antibodies in this way are generally well known and routinely used For example, basic molecular biology procedures are described by Mamatis et al (Molecular Cloning, Cold Spring Harbor Laboratory, New York, 1989), DNA sequencing can be performed as described in Sanger et al (PNAS 74, 5463, (1977)) and the Amersham International pic sequencing handbook, and site directed mutagenesis can be carried out
- the antibody according to the invention may have one or more effector or reporter molecules attached to it and the invention extends to such modified proteins
- the effector or reporter molecules may be attached to the antibody through any available amino acid side-cham, terminal amino acid or, where present carbohydrate functional group located in the antibody, always provided of course that this does not adversely affect the binding properties and eventual usefulness of the molecule
- Particular functional groups include, for example any free amino, lmino, thiol, hydroxyl, carboxyl or aldehyde group Attachment of the antibody and the effector and/or reporter molecule(s) may be achieved via such groups and an appropriate functional group in the effector or reporter molecules
- the linkage may be direct or indirect, through spacing or bridging groups
- Effector molecules include, for example, antineoplastic agents, toxins (such as enzymatically active toxins of bacterial or plant origin and fragments thereof e g ⁇ cin and fragments thereof) biologically active proteins, for example enzymes, nucleic acids and fragments thereof, e g DNA, RNA and fragments thereof, naturally occurring and synthetic polymers e g polysaccharides and polyalkylene polymers such as poly( ethylene glycol) and derivatives thereof, radionuchdes, particularly radioiodide, and chelated metals
- Suitable reporter groups include chelated metals, fluorescent compounds or compounds which may be detected by NMR or ESR spectroscopy
- Particular antineoplastic agents include cytotoxic and cytostatic agents, for example alkylating agents, such as nitrogen mustards (e g chlorambucil, melphalan, mechlorethamine, cyclophosphamide, or uracil mustard) and derivatives thereof, t ⁇ ethylenephosphoramide, t ⁇ ethylenethiophosphor-amide, busulphan, or cisplatin, antimetabohtes, such as methotrexate, fluorouracil, floxu ⁇ dine, cytarabine, mercaptopu ⁇ ne, thioguanine, fluoroacetic acid or fluorocit ⁇ c acid, antibiotics, such as bleomycins (e g bleomycin sulphate), doxorubicin, daunorubicin, mitomycins (e g mitomycm C), actinomycins (e g dactinomycin) p camycin, calichaemicin and derivatives thereof, or e
- Chelated metals include chelates of di-or t ⁇ positive metals having a coordination number from 2 to 8 inclusive.
- Particular examples of such metals include technetium (Tc), rhenium (Re), cobalt (Co), copper (Cu), gold (Au), silver (Ag), lead (Pb), bismuth (Bi), indium (In), gallium (Ga), yttrium (Y), terbium (Tb), gadolinium (Gd), and scandium (Sc).
- the metal is preferably a radionuclide. Particular radionuchdes
- the chelated metal may be for example one of the above types of metal chelated with any suitable polydentate chelating agent, for example acyclic or cyclic polyamines, polyethers, (e.g. crown ethers and derivatives thereof); polyamides; porphyrins; and carbocyclic derivatives.
- any suitable polydentate chelating agent for example acyclic or cyclic polyamines, polyethers, (e.g. crown ethers and derivatives thereof); polyamides; porphyrins; and carbocyclic derivatives.
- chelating agent in conjugates according to the invention, is acyclic and cyclic polyamines, especially polyaminocarboxylic acids, for example diethylenetriaminepentaacetic acid and derivatives thereof, and macrocyclic amines, e.g. cyclic tri-aza and tetra-aza derivatives (for example as described in International Patent Specification No. WO 92/22583); and polyamides, especially desferrioxamine and derivatives thereof.
- polyaminocarboxylic acids for example diethylenetriaminepentaacetic acid and derivatives thereof
- macrocyclic amines e.g. cyclic tri-aza and tetra-aza derivatives (for example as described in International Patent Specification No. WO 92/22583)
- polyamides especially desferrioxamine and derivatives thereof.
- a thiol group in the antibody when it is desired to use this may be achieved through reaction with a thiol reactive group present in the effector or reporter molecule.
- a thiol reactive group present in the effector or reporter molecule.
- examples of such groups include an a- halocarboxylic acid or ester, e.g. iodoacetamide, an imide, e.g. maleimide, a vinyl sulphone, or a disulphide.
- the present invention provides methods for selecting and/or isolating compounds which are capable of increasing bone density. For example, within one aspect of the present invention methods are provided for determining whether a selected molecule is capable of increasing bone mineral content, comprising the steps of (a) mixing a selected molecule with TGF-beta binding protein and a selected member of the TGF-beta family of proteins, (b) determining whether the selected molecule stimulates signaling by the TGF-beta family of proteins, or inhibits the binding of the TGF-beta binding protein to the TGF-beta family of proteins. Within certain embodiments, the molecule enhances the ability of TGF-beta to function as a positive regulator of mesenchymal cell differentiation.
- methods for determining whether a selected molecule is capable of increasing bone mineral content, comprising the steps of (a) exposing a selected molecule to cells which express TGF- beta binding-protein and (b) determining whether the expression (or activity) of TGF- beta binding-protein from said exposed cells decreases, and therefrom determining whether the compound is capable of increasing bone mineral content.
- the cells are selected from the group consisting of the spontaneously transformed or untransformed normal human bone from bone biopsies and rat parietal bone osteoblasts.
- Such methods may be accomplished in a wide variety of assay formats including, for example, Countercurrent Immuno-Electrophoresis (CIEP), Radioimmunoassays, Radioimmunoprecipitations, Enzyme-Linked Immuno-Sorbent Assays (ELISA), Dot Blot assays, Inhibition or Competition assays, and sandwich assays (see U.S. Patent Nos. 4,376, 1 10 and 4,486,530; .see also Antibodies: A Laboratory Manual, supra). Representative embodiments of such assays are provided below in
- Examples 5 and 6 Briefly, a family member of the TGF-beta super-family or a TGF- beta binding protein is first bound to a solid phase, followed by addition of a candidate molecule The labeled family member of the TGF-beta super-family or a TGF-beta binding protein is then added to the assay, the solid phase washed, and the quantity of bound or labeled TGF-beta super-family member or TGF-beta binding protein on the solid support determined.
- Molecules which are suitable for use in increasing bone mineral content as described herein are those molecules which decrease the binding of TGF-beta binding protein to a member or members of the TGF-beta super-family in a statistically significant manner.
- assays suitable for use within the present invention should not be limited to the embodiments described within Examples 2 and 3. In particular, numerous parameters may be altered, such as by binding TGF-beta to a solid phase, or by elimination of a solid phase entirely.
- methods for determining whether a selected molecule is capable of increasing bone mineral content, comprising the steps of (a) exposing a selected molecule to cells which express TGF- beta and (b) determining whether the activity of TGF-beta from said exposed cells is altered, and therefrom determining whether the compound is capable of increasing bone mineral content. Similar to the above described methods, a wide variety of methods may be utilized to assess the changes of TGF-beta binding-protein expression due to a selected test compound.
- methods for determining whether a selected molecule is capable of increasing bone mineral content comprising the steps of (a) mixing a selected molecule with TGF-beta- binding-protein and a selected member of the TGF-beta family of proteins, (b) determining whether the selected molecule up-regulates the signaling of the TGF- beta family of proteins, or inhibits the binding of the TGF-beta binding-protein to the TGF-beta family of proteins
- the molecule enhances the ability of TGF-beta to function as a positive regulator of mechemchymal cell differentiation Similar to the above described methods, a wide variety of methods may be utilized to assess stimulation of TGF-beta due to a selected test compound One such representative method is provided below in Example 6 (see also Durham et al , Endo 136 1374-1380
- methods for determining whether a selected molecule is capable of increasing bone mineral content, comprising the step of determining whether a selected molecule inhibits the binding of TGF-beta binding-protein to bone, or an analogue thereof
- bone or analogues thereof refers to hydroxyapatite, or a surface composed of a powdered form of bone, crushed bone or intact bone
- the methods recited herein may refer to the analysis of an individual test molecule, that the present invention should not be so limited
- the selected molecule may be contained within a mixture of compounds
- the recited methods may further comprise the step of isolating a molecule which inhibits the binding of TGF-beta binding-protein to a TGF-beta family member
- CANDIDATE MOLECULES A wide variety of molecules may be assayed for their ability to inhibit the binding of TGF-beta binding-protein to a TGF-beta family member Representative examples which are discussed in more detail below include organic molecules, proteins or peptides, and nucleic acid molecules Although it should be evident from the discussion below that the candidate molecules described herein may be utilized in the assays described herein, it should also be readily apparent that such molecules can also be utilized in a variety of diagnostic and therapeutic settins
- Numerous organic molecules may be assayed for their ability to inhibit the binding of TGF-beta binding-protein to a TGF-beta family member
- suitable organic molecules may be selected from either a chemical library, wherein chemicals are assayed individually, or from combinatorial chemical libraries where multiple compounds are assayed at once, then deconvoluted to determine and isolate the most active compounds
- combinatorial chemical libraries include those described by Agrafiotis et al , "System and method of automatically generating chemical compounds with desired properties," U S Patent No 5,463,564, Armstrong, R W , "Synthesis of combinatorial arrays of organic compounds through the use of multiple component combinatorial array syntheses," WO 95/02566, Baldwin, J J et al , “Sulfonamide derivatives and their use,” WO 95/24186, Baldwin, J J et al , “Combinatorial dihydrobenzopyran library,” WO 95/30642, Brenner, S , “New kit for preparing combinatorial libraries,” WO 95/16918, Chenera, B et al , “Preparation of library of resin-bound aromatic carbocychc compounds,” WO 95/16712, Ellman, J A , "Solid phase and combinatorial synthesis of benzodiazepine compounds on a solid support," U S Patent No 5,288,514, Felder, E et al , “S
- a wide range of proteins and peptides may likewise be utilized as candidate molecules for inhibitors of the binding of TGF-beta binding-protein to a TGF-beta family member
- Peptide molecules which are putative inhibitors of the binding of TGF- beta binding-protein to a TGF-beta family member may be obtained through the screening of combinatorial peptide libraries
- Such libraries may either be prepared by one of skill in the art (see e g , U S Patent Nos 4,528,266 and 4,359,535, and Patent Cooperation Treaty Publication Nos WO 92/15679, WO 92/15677, WO 90/07862, WO 90/02809, or purchased from commercially available sources (e g , New England Biolabs Ph D TM Phage Display Peptide Library Kit)
- antibodies which inhibit the binding of TGF-beta bindmg-protein to a TGF-beta family member may readily be prepared given the disclosure provided herein within the context of the present invention, antibodies are understood to include monoclonal antibodies, polyclonal antibodies, anti-idiotypic antibodies, antibody fragments (e g , Fab, and F(ab')2, F v variable regions, or complementarity determining regions) As discussed above, antibodies are understood to be specific against TGF-beta binding-protem , or against a specific TGF-beta family member, if they bind with a K a of greater than or equal to 10 ⁇ M, preferably greater than or equal to 10 ⁇ M, and do not bind to other TGF-beta binding-proteins, or, bind with a K a of less than or equal to 10 ⁇ M Furthermore, antibodies of the present invention should block or inhibit the binding of TGF-beta binding-protein to a TGF-beta family member The affinity of a monoclon
- polyclonal antibodies may be readily generated by one of ordinary skill in the art from a variety of warm-blooded animals such as horses, cows, various fowl, rabbits, mice, or rats
- the TGF-beta binding-protein or unique peptide thereof of 13-20 amino acids preferably conjugated to keyhole limpet hemocyanin by cross-linking with glutaraldehyde
- an adjuvant such as Freund's complete or incomplete adjuvant
- samples of serum are collected and tested for reactivity to the protein or peptide
- Particularly preferred polyclonal antisera will give a signal on one of these assays that is at least three times greater than background Once the titer of the animal has reached a plateau in terms of its reactivity to the protein, larger quantities of antisera may be readily obtained either by weekly bleedings, or by exsanguin
- Monoclonal antibodies may also be readily generated using conventional techniques (see U S Patent Nos RE 32,01 1, 4,902,614, 4,543,439, and 4,41 1,993 which are incorporated herein by reference, see also Monoclonal Antibodies, Hyb ⁇ domas A New Dimension in Biological Analyses, Plenum Press, Kennett, McKearn, and Bechtol (eds ), 1980, and Antibodies A Laboratory Manual, Harlow and Lane (eds ), Cold Spring Harbor Laboratory Press, 1988, which are also incorporated herein by reference)
- a subject animal such as a rat or mouse is immunized with TGF-beta binding-protein or portion thereof as described above
- the protein may be admixed with an ad]uvant such as Freund's complete or incomplete adjuvant in order to increase the resultant immune response
- an ad]uvant such as Freund's complete or incomplete adjuvant
- the animal may be reimmunized with another booster immunization, and tested for reactivity to the protein utilizing assays described above
- organs which contain large numbers of B cells such as the spleen and lymph nodes are harvested
- Cells which are obtained from the immunized animal may be immortalized by infection with a virus such as the Epstein-Barr virus (EBV) (see Glasky and Reading, Hybridoma 5(4) 377-389, 1989)
- EBV Epstein-Barr virus
- the harvested spleen and/or lymph node cell suspensions are fused with a suitable myeloma cell in order to create a "hybridoma" which secretes monoclonal antibody
- Suitable myeloma lines include, for example, NS-1 (ATCC No TIB 18), and P3X63 - Ag 8 653 (ATCC No CRL 1580)
- the cells may be placed into culture plates containing a suitable medium, such as RPMI 1640, or DMEM (Dulbecco's Modified Eagles Medium) (JRH Biosciences, Lenexa, Kansas), as well as additional ingredients, such as fetal bovine serum (FBS, / e , from Hyclone,
- portions or fragments, such as Fab and Fv fragments, of antibodies may also be constructed utilizing conventional enzymatic digestion or recombinant DNA techniques to incorporate the variable regions of a gene which encodes a specifically binding antibody
- the genes which encode the variable region from a hybridoma producing a monoclonal antibody of interest are amplified using nucleotide primers for the variable region
- These primers may be synthesized by one of ordinary skill in the art, or may be purchased from commercially available sources Stratagene (La Jolla, California) sells primers for mouse and human variable regions including, among others, primers for V Ha , V H b, H C ' ⁇ Hd > C j ], V L and C L regions
- These primers may be utilized to amplify heavy or light chain variable regions, which may then be inserted into vectors such as ImmunoZAPTM H or ImmunoZAPTM L (Stratagene), respectively These vectors may then be introduced into E.
- Suitable antibodies may be isolated or purified by many techniques well known to those of ordinary skill in the art (see Antibodies: A Laboratory Manual, Harlow and Lane (eds ), Cold Spring Harbor Laboratory Press, 1988) Suitable techniques include peptide or protein affinity columns, HPLC or RP-HPLC, purification on protein A or protein G columns, or any combination of these techniques
- TGF-beta binding-protein As described herein and below in the Examples (e g , Examples 8 and 9), altered versions of TGF-beta binding-protein which compete with native TGF-beta binding-protein's ability to block the activity of a particular TGF-beta family member should lead to increased bone density
- mutants of TGF-beta binding-protein which bind to the TGF-beta family member but do not inhibit the function of the TGF- beta family member would meet the criteria
- the mutant versions must effectively compete with the endogenous inhibitory functions of TGF-beta binding-protein
- nucleotide sequence is deemed to be “substantially similar” if (a) the nucleotide sequence is derived from the coding region of the above-described genes and includes, for example, portions of the sequence or allelic variations of the sequences discussed above, or alternatively, encodes a molecule which inhibits the binding of TGF-beta binding-protein to a member of the TGF-beta family, (b) the nucleotide sequence is capable of hybridization to nucleotide sequences of the present invention under moderate, high or very high stringency (.see Sambrook et al , Molecular Cloning: A Laboratory Manual, 2nd ed ,
- the structure of the proteins encoded by the nucleic acid molecules described herein may be predicted from the primary translation products using the hydrophobicity plot function of, for example, P/C Gene or Intelligenetics Suite (Intelligenetics, Mountain View, California), or according to the methods described by Kyte and Doolittle (J. Mol. Biol. 75 " 105-132, 1982)
- Proteins of the present invention may be prepared in the form of acidic or basic salts, or in neutral form
- individual amino acid residues may be modified by oxidation or reduction
- various substitutions, deletions, or additions may be made to the amino acid or nucleic acid sequences, the net effect of which is to retain or further enhance or decrease the biological activity of the mutant or wild-type protein
- nucleotide sequences encoding the same amino acid sequence
- Other derivatives of the proteins disclosed herein include conjugates of the proteins along with other proteins or polypeptides This may be accomplished, for example, by the synthesis of N-terminal or C-terminal fusion proteins which may be added to facilitate purification or identification of proteins (see U S Patent No 4,851,341, .see also, Hopp et al , Bio/Technology 6 1204, 1988 )
- fusion proteins such as Flag/TGF-beta binding-protein be constructed in order to assist in the identification,
- Proteins of the present invention may be constructed using a wide variety of techniques described herein Further, mutations may be introduced at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence Following ligation, the resulting reconstructed sequence encodes a derivative having the desired amino acid insertion, substitution, or deletion.
- ohgonucleotide-directed site-specific (or segment specific) mutagenesis procedures may be employed to provide an altered gene having particular codons altered according to the substitution, deletion, or insertion required.
- Exemplary methods of making the alterations set forth above are disclosed by Walder et al. (Gene 42: 133, 1986); Bauer et al. (Gene 37:73, 1985); Craik (BioTechnic ⁇ ies, January 1985, 12-19); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); and Sambrook et al. (supra).
- Deletion or truncation derivatives of proteins may also be constructed by utilizing convenient restriction endonuclease sites adjacent to the desired deletion. Subsequent to restriction, overhangs may be filled in, and the DNA religated. Exemplary methods of making the alterations set forth above are disclosed by Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, 1989). Mutations which are made in the nucleic acid molecules of the present invention preferably preserve the reading frame of the coding sequences. Furthermore, the mutations will preferably not create complementary regions that could hybridize to produce secondary mRNA structures, such as loops or hairpins, that would adversely affect translation of the mRNA.
- a mutation site may be predetermined, it is not necessary that the nature of the mutation per se be predetermined. For example, in order to select for optimum characteristics of mutants at a given site, random mutagenesis may be conducted at the target codon and the expressed mutants screened for indicative biological activity. Alternatively, mutations may be introduced at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes a derivative having the desired amino acid insertion, substitution, or deletion.
- Nucleic acid molecules which encode proteins of the present invention may also be constructed utilizing techniques of PCR mutagenesis, chemical mutagenesis (Drinkwater and Klinedinst, PNAS 53:3402-3406, 1986), by forced nucleotide misincorporation (e.g., Liao and Wise Gene 55: 107-1 11, 1990), or by use of randomly mutagenized oligonucleotides (Horwitz et al., Genome 3: 1 12-117, 1989).
- the present invention also provides for the manipulation and expression of the above described genes by culturing host cells containing a vector capable of expressing the above-described genes.
- vectors or vector constructs include either synthetic or cDNA-derived nucleic acid molecules encoding the desired protein, which are operably linked to suitable transcriptional or translational regulatory elements Suitable regulatory elements may be derived from a variety of sources, including bacterial, fungal, viral, mammalian, insect, or plant genes Selection of appropriate regulatory elements is dependent on the host cell chosen, and may be readily accomplished by one of ordinary skill in the art Examples of regulatory elements include a transcriptional promoter and enhancer or RNA polymerase binding sequence, a transcriptional terminator, and a ribosomal binding sequence, including a translation initiation signal
- Nucleic acid molecules that encode any of the proteins described above may be readily expressed by a wide variety of prokaryotic and eukaryotic host cells, including bacterial, mammalian, yeast or other fungi, viral, insect, or plant cells Methods for transforming or transfecting such cells to express foreign DNA are well known in the art (see, e.g., Itakura et al , U S Patent No 4,704,362, Hinnen et al , Proc. Nail. Acad. Sci.
- Bacterial host cells suitable for carrying out the present invention include E. coli, B. subtilis, Salmonella typhimurium, and various species within the genera Pseudomonas, Streplomyces, and Staphylococcus, as well as many other bacterial species well known to one of ordinary skill in the art
- Representative examples of bacterial host cells include DH5 ⁇ (Stratagene, LaJolla, California)
- Bacterial expression vectors preferably comprise a promoter which functions in the host cell, one or more selectable phenotypic markers, and a bacterial origin of replication
- Representative promoters include the ⁇ -lactamase (penicillinase) and lactose promoter system (see Chang et al , Nature 275 615, 1978), the T7 RNA polymerase promoter (Studier et al , Melh. Enzymol. 755 60-89, 1990), the lambda promoter (Elvin et al , Gene 87 123-126, 1990), the trp promoter (Nichols and Yanofsky, Melh.
- selectable markers include various antibiotic resistance markers such as the kanamycin or ampicillin resistance genes
- selectable markers include various antibiotic resistance markers such as the kanamycin or ampicillin resistance genes
- Many plasmids suitable for transforming host cells are well known in the art, including among others, pBR322 (see Bolivar et al , Gene 2 95, 1977), the pUC plasmids pUC18, pUC19, pUC1 18, pUC 1 19 (see Messing, Melh.
- Yeast and fungi host cells suitable for carrying out the present invention include, among others, Saccharomyces po be, Saccharomyces cerevisiae, the genera Pichia or Kluyveromyces and various species of the genus Aspergillus (McKnight et al , U S Patent No 4,935,349)
- Suitable expression vectors for yeast and fungi include, among others, YCp50 (ATCC No 37419) for yeast, and the amdS cloning vector pV3 (Turnbull, Bio/Technology " 169, 1989), YRp7 (Struhl et al , Proc. Natl. Acad. Sci.
- promoters for use in yeast include promoters from yeast glycolytic genes (Hitzeman et al , J. Biol. Chem. 255 12073-12080, 1980, Alber and Kawasaki, J. Mol. Appl. Genet. I 419-434, 1982) or alcohol dehydrogenase genes (Young et al , in Genetic Engineering of Microorganisms for Chemicals, Hollaender et al (eds ), p 355, Plenum, New York, 1982, Ammerer, Melh. Enzymol.
- Examples of useful promoters for fungi vectors include those derived from Aspergillus nidulans glycolytic genes, such as the adh3 promoter (McKnight et al , EMBO J. 4 2093-2099, 1985)
- the expression units may also include a transcriptional terminator
- An example of a suitable terminator is the adh3 terminator (McKnight et al , ibid , 1985)
- the yeast vectors will generally include a selectable marker, which may be one of any number of genes that exhibit a dominant phenotype for which a phenotypic assay exists to enable transformants to be selected
- selectable markers are those that complement host cell auxotrophy, provide antibiotic resistance or enable a cell to utilize specific carbon sources, and include le ⁇ 2 (Broach et al , ibid.), ura3 (Botstein et al , Gene 8 17, 1979), or his3 (Struhl et al , ibid.)
- Another suitable selectable marker is the cat gene, which confers chloramphenicol resistance on yeast cells.
- the genotype of the host cell may contain a genetic defect that is complemented by the selectable marker present on the expression vector
- Choice of a particular host and selectable marker is well within the level of ordinary skill in the art
- Protocols for the transformation of yeast are also well known to those of ordinary skill in the art
- transformation may be readily accomplished either by preparation of spheroplasts of yeast with DNA (.see Hinnen et al , PNAS USA " 5 1929, 1978) or by treatment with alkaline salts such as LiCl (see Itoh et al , J Bacteriology 153 163, 1983) Transformation of fungi may also be carried out using polyethylene glycol as described by Cullen et al (Bio/Technology 5 369, 1987)
- Viral vectors include those which comprise a promoter that directs the expression of an isolated nucleic acid molecule that encodes a desired protein as described above
- promoters such as MoMLV LTR, RSV LTR, Friend MuLV LTR, adenoviral promoter (Ohno et al , Science 265 781-784, 1994), neomycin phosphotransferase promoter/enhancer, late parvovirus promoter (Koermg et al , Hum Gene Therap 5 457-463, 1994), Herpes TK promoter, SV40 promoter, metallothionein Ila gene enhancer/promoter, cytomegalovirus immediate early promoter, and the cytomegalovirus immediate late promoter
- the promoter is a tissue-specific promoter (see e g , WO 91/02805, EP 0,415,731 ,
- Mammalian cells suitable for carrying out the present invention include, among others COS, CHO, SaOS, osteosarcomas, KS483, MG-63, primary osteoblasts, and human or mammalian bone marrow stroma
- Mammalian expression vectors for use in carrying out the present invention will include a promoter capable of directing the transcription of a cloned gene or cDNA
- Preferred promoters include viral promoters and cellular promoters
- Bone specific promoters include the bone sialo-protein and the promoter for osteocalcin
- Viral promoters include the cytomegalovirus immediate early promoter (Boshart et al , Cell 77 521-530, 1985), cytomegalovirus immediate late promoter, SV40 promoter (Subramani et al , Mol Cell Biol I 854-864, 1981), MMTV LTR, RSV LTR, metallothionein- 1, adenovirus El a Cellular promoters
- Vector constructs comprising cloned DNA sequences can be introduced into cultured mammalian cells by, for example, calcium phosphate-mediated transfection (Wigler et al , Cell 77 725, 1978, Corsaro and Pearson, Somatic Cell Genetics 7 603, 1981 , Graham and Van der Eb, Virology 52 456, 1973), electroporation (Neumann et al , EMBO J 1 841 -845, 1982), or DEAE-dextran mediated transfection (Ausubel et al (eds ), Current Protocols in Molecular Biology, John Wiley and Sons, Inc , NY, 1987)
- a selectable marker is generally introduced into the cells along with the gene or cDNA of interest
- Preferred selectable markers for use in cultured mammalian cells include genes that confer resistance to drugs, such as neomycin, hygromycin, and methotrexate
- the selectable marker may be an amplifiable select
- Mammalian cells containing a suitable vector are allowed to grow for a period of time, typically 1-2 days, to begin expressing the DNA sequence(s) of interest
- Drug selection is then applied to select for growth of cells that are expressing the selectable marker in a stable fashion
- the drug concentration may be increased in a stepwise manner to select for increased copy number of the cloned sequences, thereby increasing expression levels
- Cells expressing the introduced sequences are selected and screened for production of the protein of interest in the desired form or at the desired level Cells that satisfy these criteria can then be cloned and scaled up for production
- Protocols for the transfection of mammalian cells are well known to those of ordinary skill in the art Representative methods include calcium phosphate mediated transfection, electroporation, lipofection, retroviral, adenoviral and protoplast fusion-mediated transfection (see Sambrook et al , supra) Naked vector constructs can also be taken up by muscular cells or other suitable cells subsequent to injection into the muscle of a mammal (or other animals)
- proteins of the present invention may be expressed in a transgenic animal whose germ cells and somatic cells contain a gene which encodes the desired protein and which is operably linked to a promoter effective for the expression of the gene
- transgenic animals may be prepared that lack the desired gene (e.g., "knock-out" mice)
- Such transgenics may be prepared in a variety of non-human animals, including mice, rats, rabbits, sheep, dogs, goats and pigs (.see Hammer et al., Nature 315 680-683, 1985, Palmiter et al., Science 222:809-814, 1983, Brinster et al., Proc.
- an expression vector including a nucleic acid molecule to be expressed together with appropriately positioned expression control sequences, is introduced into pronuclei of fertilized eggs, for example, by microinjection. Integration of the injected DNA is detected by blot analysis of DNA from tissue samples.
- the introduced DNA be incorporated into the germ line of the animal so that it is passed on to the animal's progeny Tissue-specific expression may be achieved through the use of a tissue-specific promoter, or through the use of an inducible promoter, such as the metallothionein gene promoter (Palmiter et al , 1983, ibid), which allows regulated expression of the transgene
- Proteins can be isolated by, among other methods, cultu ⁇ ng suitable host and vector systems to produce the recombinant translation products of the present invention
- Supernatants from such cell lines, or protein inclusions or whole cells where the protein is not excreted into the supernatant can then be treated by a variety of purification procedures in order to isolate the desired proteins
- the supernatant may be first concentrated using commercially available protein concentration filters, such as an A icon or Milhpore Pelhcon ultrafiltration unit Following concentration, the concentrate may be applied to a suitable purification matrix such as, for example, an anti-protein antibody bound to a suitable support
- anion or cation exchange resins may be employed in order to purify the protein
- one or more reverse-phase high performance liquid chromatography (RP-HPLC) steps may be employed to further purify the protein
- RP-HPLC reverse-phase high performance liquid chromatography
- a protein is deemed to be "isolated" within the context of the present invention if no other (undesired) protein is detected pursuant to SDS-PAGE analysis followed by Coomassie blue staining
- the desired protein can be isolated such that no other (undesired) protein is detected pursuant to SDS- PAGE analysis followed by silver staining
- nucleic acid molecules are provided which are capable of inhibiting TGF-beta binding-protein binding to a member of the TGF-beta family
- antisense oligonucleotide molecules are provided which specifically inhibit expression of TGF- beta binding-protein nucleic acid sequences (see generally, Hirashima et al in Molecular Biology of RNA New Perspectives (M Inouye and B S Dudock, eds , 1987 Academic Press, San Diego, p 401), Oligonucleotides Antisense Inhibitors of Gene Expression (J S Cohen, ed , 1989 MacMillan Press, London), Stein and Cheng, Science 261 1004-1012, 1993, WO 95/10607, U S Patent No 5,359,051, WO 92/06693, and EP-A2-612844) Briefly, such molecules are constructed such that they are complementary to, and able to form Watson-Crick base pairs with, a region of transcribed TGF-
- ribozymes are provided which are capable of inhibiting the TGF-beta binding-protein binding to a member of the TGF- beta family
- ribozymes are intended to include RNA molecules that contain anti-sense sequences for specific recognition, and an RNA-cleaving enzymatic activity The catalytic strand cleaves a specific site in a target RNA at greater than stoichiometric concentration
- ribozymes may be utilized within the context of the present invention, including for example, the hammerhead ribozyme (for example, as described by Forster and Symons, Cell 75 21 1-220, 1987, Haseloff and Gerlach, Nature 325 596-600, 1988, Walbot and Bruening, Nature 337 196, 1988, Haseloff and Gerlach, Nature 334 585, 1988), the hairpin ribozyme (for example, as described by Haseloff et al , U S Patent No 5,25
- the gene product or any of the candidate molecules described above and below, may be labeled with a variety of compounds, including for example, fluorescent molecules, toxins, and radionuchdes
- fluorescent molecules include fluorescein, Phycobili proteins, such as phycoerythrin, rhodamine, Texas red and luciferase
- toxins include ricin, abrin diphtheria toxin, cholera toxin, gelonin, pokeweed antiviral protein, tritin, Shigella toxin, and Pseudomonas exotoxin
- radionuchdes include Cu-64, Ga-67, Ga-68, Zr-89, Ru-97, Tc-99m, Rh-105, Pd-109, ln-1 1 1, 1-123, 1-125, I- 131, Re-186, Re-188, Au-198, Au-199, Pb-203, At-21 1, Pb-212 and Bi-212
- the antibodies described above may also be labeled with a
- the present invention also provides a variety of pharmaceutical compositions, comprising one of the above-described molecules which inhibits the TGF-beta binding-protein binding to a member of the TGF-beta family along with a pharmaceutically or physiologically acceptable carrier, excipients or diluents
- a pharmaceutically or physiologically acceptable carrier such as a pharmaceutically or physiologically acceptable carrier, excipients or diluents
- such carriers should be nontoxic to recipients at the dosages and concentrations employed
- the preparation of such compositions entails combining the therapeutic agent with buffers, antioxidants such as ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, proteins, amino acids, carbohydrates including glucose, sucrose or dext ⁇ ns, chelating agents such as EDTA, glutathione and other stabilizers and excipients
- Neutral buffered saline or saline mixed with nonspecific serum albumin are exemplary approp ⁇ ate diluents
- the present invention also provides methods for increasing the mineral content and mineral density of bone
- numerous conditions result in the loss of bone mineral content, including for example, disease, genetic predisposition, accidents which result in the lack of use of bone (e g , due to fracture), therapeutics which effect bone resorption, or which kill bone forming cells and normal aging
- diseases including for example, disease, genetic predisposition, accidents which result in the lack of use of bone (e g , due to fracture), therapeutics which effect bone resorption, or which kill bone forming cells and normal aging
- therapeutics which effect bone resorption, or which kill bone forming cells and normal aging
- TGF-beta binding-protein binding to a TGF-beta family member such conditions may be treated or prevented.
- bone mineral content has been increased, if bone mineral content has been increased in a statistically significant manner (e.g., greater than one-half standard deviation), at a selected site.
- a wide variety of conditions which result in loss of bone mineral content may be treated with the molecules described herein. Patients with such conditions may be identified through clinical diagnosis utilizing well known techniques (see, e.g., Harrison's Principles of Internal Medicine, McGraw-Hill, Inc.). Representative examples of diseases that may be treated included dysplasias, wherein there is abnormal growth or development of bone.
- Representative examples of such conditions include achondroplasia, cleidocranial dysostosis, enchondromatosis, fibrous dysplasia, Gaucher's, hypophosphatemic rickets, Marfan's, multiple hereditary exotoses, neurofibromatosis, osteogenesis imperfecta, osteopetrosis, osteopoikilosis, sclerotic lesions, fractures, periodontal disease, pseudoarthrosis and pyogenic osteomyelitis.
- Other conditions which may be treated or prevented include a wide variety of causes of osteopenia (i.e., a condition that causes greater than one standard deviation of bone mineral content or density below peak skeletal mineral content at youth).
- Such conditions include anemic states, conditions caused steroids, conditions caused by heparin, bone marrow disorders, scurvy, malnutrition, calcium deficiency, idiopathic osteoporosis, congenital osteopenia or osteoporosis, alcoholism, chronic liver disease, senility, postmenopausal state, oligomenorrhea , amenorrhea, pregnancy, diabetes mellitus, hyperthyroidism, Cushing's disease, acromegaly, hypogonadism, immobilization or disuse, reflex sympathetic dystrophy syndrome, transient regional osteoporosis and osteomalacia.
- bone mineral content or density may be increased by administering to a warm-blooded animal a therapeutically effective amount of a molecule which inhibits the TGF-beta binding-protein binding to a TGF-beta family member.
- warm-blooded animals that may be treated include both vertebrates and mammals, including for example horses, cows, pigs, sheep, dogs, cats, rats and mice.
- therapeutic molecules include ribozymes, ribozyme genes, antisense oligonucleotides and antibodies (e.g, humanized antibodies).
- methods for increasing bone density, comprising the step of introducing into cells which home to bone a vector which directs the expression of a molecule which inhibits the TGF-beta binding-protein binding to a member of the TGF-beta family, and administering the vector containing cells to a warm-blooded animal
- cells which home to bone may be obtained directly from the bone of patients (e.g., cells obtained from the bone marrow such as CD34+, osteoblasts, osteocytes, and the like), from peripheral blood, or from cultures
- TGF-beta binding-protein binding to a member of the TGF-beta family is introduced into the cells
- suitable vectors include viral vectors such as herpes viral vectors (e g , U S Patent No 5,288,641), adenoviral vectors (e.g., WO 94/26914, WO 93/9191 , Kolls et al , PNAS 97(1) 215-219, 1994, Kass-Eisler et al , PNAS 90(24) 1 1498-502, 1993, Guzman et al , Circulation 55(6) 2838-48, 1993, Guzman et al , Cir Res.
- viral vectors such as herpes viral vectors (e g , U S Patent No 5,288,641), adenoviral vectors (e.g., WO 94/26914, WO 93/9191 , Kolls et al , PNAS 97(1) 215-219, 1994, Kass-Eisler
- Viral vectors may likewise be constructed which contain a mixture of different elements (e.g , promoters, envelope sequences and the like) from different viruses, or non-viral sources within various embodiments, either the viral vector itself, or a viral particle which contains the viral vector may be utilized in the methods and compositions described below
- nucleic acid molecules which encode a molecule which inhibits the TGF-beta binding-protein binding to a member of the TGF-beta family themselves may be administered by a variety of techniques, including, for example, administration of asialoosomucoid (ASOR) conjugated with poly-L-lysine DNA complexes (Cristano et al , PNAS 92122-92126, 1993), DNA linked to killed adenovirus (Curiel et al , Hum. Gene Ther.
- ASOR asialoosomucoid
- molecules which may be expressed by the vectors of present invention include ribozymes and antisense molecules, each of which are discussed in more detail above.
- Determination of increased bone mineral content may be determined directly through the use of X-rays (e.g., Dual Energy X-ray Absorptometry or "DEXA”), or by inference through bone turnover markers (osteoblast specific alkaline phosphatase, osteocalcin, type 1 procollagen C propeptide (PICP), and total alkaline phosphatase; see Cornier, C, Curr. Opin. in Rheu. 7.243, 1995), or markers of bone resorption (pyridinoline, deoxypryridinoline, N-telopeptide, urinary hydroxyproline, plasma tartrate-resistant acid phosphatases and galactosyl hydroxylysine; see Cornier, supra).
- the amount of bone mass may also be calculated from body weights, or utilizing other methods (see Guinness-Hey, Meiab. Bone Dis. and Rel. Res. 5: 177-181, 1984).
- compositions may be administered by a variety of techniques, as noted above.
- RNA samples were prepared from the following total RNA samples using a commercially available kit ("Superscript Preamplification System for First- Strand cDNA Synthesis", Life Technologies, Rockville, MD) human brain, human liver, human spleen, human thymus, human placenta, human skeletal muscle, human thyroid, human pituitary, human osteoblast (NHOst from Clonetics Corp , San Diego, CA), human osteosarcoma cell line (Saos-2, ATCC# HTB-85), human bone, human bone marrow, human cartilage, vervet monkey bone, saccharomyces cerevisiae, and human peripheral blood monocytes All RNA samples were purchased from a commercial source (Clontech, Palo Alto, CA), except the following which were prepared in-house human osteoblast, human osteosarcoma cell line
- PCR was performed on these samples, and additionally on a human genomic sample as a control
- the sense Beer oligonucleotide primer had the sequence 5'-CCGGAGCTGGAGAACAACAAG-3' (SEQ ID NO 19)
- the antisense Beer oligonucleotide primer had the sequence 5'-GCACTGGCCGGAGCACACC-3' (SEQ ID NO 20)
- PCR was performed using primers for the human beta-actin gene, as a control
- the sense beta-actin oligonucleotide primer had the sequence 5'- AGGCCAACCGCGAGAAGATGA CC -3' (SEQ ID NO 21)
- the antisense beta-actm oligonucleotide primer had the sequence 5'-GAAGT CCAGGGCGACGTAGCA-3' (SEQ ID NO 22)
- PCR was performed using standard conditions in 25 ul reactions, with an annealing temperature of 61 degrees Celsius Thirty-two cycles of PCR were performed with the Beer primer
- mouse 7 eer cDNA (Sequence ID No 1 1) was cloned into the pCR2 1 vector (Invitrogen, Carlsbad, CA) in the antisense and sense direction using the manufacturer's protocol ⁇ S-alpha-GTP-labeled cRNA sense and antisense transcripts were synthesized using m-vitro transcription reagents supplied by Ambion, Inc (Austin, TX) In-situ hybridization was performed according to the protocols of Lyons et al (7 Cell Biol 777 2427-2436, 1990)
- the mouse Beer cRNA probe detected a specific message expressed in the neural tube, limb buds, blood vessels and ossifying cartilages of developing mouse embryos
- Panel A in Figure 3 shows expression in the apical ectodermal ridge (aer) of the limb (1) bud, blood vessels (bv) and the neural tube (nt)
- Panel B shows expression in the 4 th ventricle of the brain (4)
- Panel C shows expression in the mandible (ma) cervical vertebrae (cv), occipital bone (oc), palate (pa) and a blood vessel (bv)
- Panel D shows expression in the ribs (r) and a heart valve (va)
- Panel A is a transverse section of 10 5 dpc embryo
- the DNA sequence encoding the full length human Beer protein was amplified using the following PCR oligonucleotide primers
- the 5' oligonucleotide primer had the sequence 5'-AAGCTTGGTACCATGCAGCTCCCAC-3' (SEQ ID NO 23) and contained a Hindlll restriction enzyme site (in bold) followed by 19 nucleotides of the Beer gene starting 6 base pairs prior to the presumed amino terminal start codon (ATG)
- the 3' oligonucleotide primer had the sequence 5'- AAGCTTCTACTTGTCATCGTCGTCCT TGTAGTCGTAGGCGTTCTCCAGCT-3 ' (SEQ ID NO 24) and contained a Hindlll restriction enzyme site (in bold) followed by a reverse complement stop codon (CTA) followed by the reverse complement of the FLAG epitope (underlined, Sigma-Aldrich Co , St Louis, MO) flanked by the reverse complement of nucleotides coding for the
- COS-1 cells (ATCC# CRL-1650) were used for transfection 50 ⁇ g of the expression plasmid pcDNA-Beer-Flag was transfected using a commercially available kit following protocols supplied by the manufacturer ("DEAE-Dextran Transfection Kit", Sigma Chemical Co , St Louis, MO) The final media following transfection was DMEM (Life Technologies, Rockville, MD) containing 0 1% Fetal Bovine Serum After 4 days in culture, the media was removed Expression of recombinant BEER was analyzed by SDS-PAGE and Western Blot using anti-FLAG M2 monoclonal antibody (Sigma-Aldrich Co , St Louis, MO) Purification of recombinant BEER protein was performed using an anti-FLAG M2 affinity column ("Mammalian Transient Expression System", Sigma-Aldrich Co , St Louis, MO) The column profile was analyzed via SDS-PAGE and Western Blot using anti-FLAG M2 monoclonal antibody B Expression in SF9 insect cells
- the human 7 eer gene sequence was amplified using PCR with standard conditions and the following primers Sense primer 5'-GTCGTCGGATCCATGGGGTGGCAGGCGTTCAAGAATGAT-3' (SEQ ID NO 26)
- the resulting cDNA contained the coding region of Beer with two modifications
- the N-terminal secretion signal was removed and a FLAG epitope tag (Sigma) was fused in frame to the C-terminal end of the insert BamHl and Hindlll cloning sites were added and the gene was subcloned into pMelBac vector (Invitrogen) for transfer into a baculoviral expression vector using standard methods
- SF9 cells (Invitrogen) were maintained in TNM_FH media (Invitrogen) containing 10% fetal calf serum
- TNM_FH media Invitrogen
- SF9 cultures in spinner flasks were infected at an MOI of greater than 10 Samples of the media and cells were taken daily for five days, and Beer expression monitored by western blot using an anti-FLAG M2 monoclonal antibody (Sigma) or an anti-Beer rabbit polyclonal antiserum
- the baculovirus-infected SF9 cells were harvested by centrifugation and cell associated protein was extracted from the cell pellet using a high salt extraction buffer (1.5 M NaCI, 50 mM Tris pH 7 5)
- the extract (20 ml per 300 ml culture) was clarified by centrifugation, dialyzed three times against four liters of Tris buffered saline (150 mM NaCI, 50 mM Tris pH 7 5), and clarified by centrifugation again
- This high salt fraction was applied to Hitrap Heparin (Pharmacia, 5 ml bed volume), washed extensively with HEPES buffered saline (25 mM HEPES 7.5, 150 mM Nacl) and bound proteins were eluted with a gradient from 150 mM NaCI to 1200 mM NaCI Beer elution was observed at aproximately 800 mM NaCI Beer containing fractions were supplemented to 10% glycerol and 1 m
- the E. co//-derived Beer protein was recovered in significant quantity using solubilization in 6M guanidine and dialyzed to 2-4M to prevent precipitation during storage
- Gremlin and Dan protein were recovered in higher quantity with solubilization in 6M guanidine and a post purification guanidine concentration of 0.5M
- Rabbit antisera and chicken egg Igy fraction were screened for activity via Western blot Each of the three antigens was separated by PAGE and transferred to
- nitrocellulose strips of Beer, Gremlin or Dan were incubated with dilutions (1 5000 and 1 10,000) of their respective rabbit antisera or chicken egg IgY as well as to antisera or chicken egg Igy (dilutions 1 1000 and 1 5000) made to the remaining two antigens
- dilutions 1 5000 and 1 10,000 of their respective rabbit antisera or chicken egg IgY as well as to antisera or chicken egg Igy (dilutions 1 1000 and 1 5000) made to the remaining two antigens
- the increased levels of nonmatching antibodies was performed to detect low affinity binding by those antibodies that may be seen only at increased concentration
- the protocol and duration of development is the same for all three binding events using the protocol described above There was no antigen cross-reactivity observed for any of the antigens tested
- TGF ⁇ -1, TGF ⁇ -2, TGF ⁇ -3, BMP-4, BMP-5, BMP-6 and GDNF were obtained from comme ⁇ cal sources (R&D systems, Minneapolis, MN)
- a representative protocol is as follows Partially purified Beer was dialyzed into HEPES buffered saline (25 mM HEPES 7 5, 150 mM NaCI) Immunoprecipitations were done in 300 ul of IP buffer (150 mM NaCI, 25 mM Tris pH 7 5, ImM EDTA, 1 4 mM ⁇ -mercaptoethanol, 0 5 % t ⁇ ton X 100, and 10% glycerol) 30 ng recombinant human BMP-5 protein (R&D systems) was applied to 15 ul of FLAG affinity matrix (Sigma, St Louis MO)) in the presence and absence of 500 ng FLAG epitope-tagged Beer
- Beer is engineered and expressed as a human Fc fusion protein
- ligand BMP is engineered and expressed as mouse Fc fusion
- TGF-beta binding-protein binding includes organic compounds derived from commercial or internal collections representing diverse chemical structures These compounds are prepared as stock solutions in DMSO and are added to assay wells at ⁇ 1% of final volume under the standard assay conditions These are incubated for 2 hours at room temperature with the BMP and Beer, the solution removed and the bound BMP is quantitated as described Agents that inhibit 40%) of the BMP binding observed in the absence of compound or antibody are considered antagonists of this interaction These are further evaluated as potential inhibitors based on titration studies to determine their inhibition constants and their influence on TGF-beta binding-protein binding affinity Comparable specificity control assays may also be conducted to establish the selectivity profile for the identified antagonist through studies using assays dependent on the BMP ligand action (e g BMP/
- TGF-beta binding-protein is prepared as described by Nicolas (supra) Hydroxyapatite is added to each well of a 96 well microtiter plate equipped with a polypropylene filtration membrane (Polyfiltroninc, Weymouth MA) TGF-beta binding-protein is added to 0 2% albumin in PBS buffer The wells containing matrix are washed 3 times with this buffer Adsorbed TGF-beta binding-protein is eluted using 0 3M NaOH and quantitated Inhibitor identification is conducted via incubation of TGF-beta binding- protein with test molecules and applying the mixture to the matrix as described above The matrix is washed 3 times with 0 2% albumin in PBS buffer Adsorbed TGF-beta binding-protein is eluted
- TGF-beta binding-protein cDNA in pBluescript SK serves as a template for mutagenesis
- appropriate primers are utilized to generate the DNA fragment by polymerase chain reaction using Vent DNA polymerase (New England Biolabs, Beverly, MA)
- the polymerase chain reaction is run for 23 cycles in buffers provided by the manufacturer using a 57°C annealing temperature
- the product is then exposed to two restriction enzymes and after isolation using agarose gel electrophoresis, ligated back into pRBP4- 503 from which the matching sequence has been removed by enzymatic digestion Integrity of the mutant is verified by DNA sequencing
- mutant TGF-beta binding-protein cDNAs are transferred into the pcDNA3 1 mammalian expression vector described in EXAMPLE 3 After verifying the sequence, the resultant constructs are transfected into COS-1 cells, and secreted protein is purified as described in EXAMPLE 3
- the presence of the transgene was ascertained by performing Southern blot analysis of genomic DNA extracted from a small amount of mouse tissue, such as the tip of a tail DNA was extracted using the following protocol tissue was digested overnight at 55° C in a lysis buffer containing 200 mM NaCI, 100 mM Tris pH8 5, 5 mM EDTA, 0 2% SDS and 0 5 mg/ml Proteinase K The following day, the DNA was extracted once with phenol/chloroform (50 50), once with chloroform/isoamylalcohol (24 1) and precipitated with ethanol Upon resuspension in TE (lOmM Tris pH7 5, 1 mM EDTA) 8-10 ug of each DNA sample were digested with a restriction endonuclease, such as EcoRI, subjected to gel electrophoresis and transferred to a charged nylon membrane, such as HyBondN+ (Amersham, Arlington Heights, IL ) The resulting filter was
- Homologous recombination in embryonic stem (ES) cells can be used to inactivate the endogenous mouse 7 eer gene and subsequently generate animals carrying the loss-of-function mutation
- a reporter gene such as the E coli ⁇ -galactosidase gene, was engineered into the targeting vector so that its expression is controlled by the endogenous Tieer gene's promoter and translational initiation signal In this way, the spatial and temporal patterns of 7 eer gene expression can be determined in animals carrying a targeted allele
- the targeting vector was constructed by first cloning the drug-selectable phosphoglycerate kinase (PGK) promoter driven neomycrn-resi stance gene (neo) cassette from pGT-N29 (New England Biolabs, Beverly, MA) into the cloning vector pSP72 (Promega, Madson, WI) PCR was used to flank the PGKneo cassette with bacteriophage PI loxP sites, which are recognition sites for the PI Cre recombinase (Hoess et al., PNAS USA, 79 3398, 1982) This allows subsequent removal of the neo- resistance marker in targeted ES cells or ES cell-derived animals (US Patent 4,959,317)
- the PCR primers were comprised of the 34 nucleotide (ntd) loxP sequence, 15-25 ntd complementary to the 5' and 3' ends of the PGKneo cassette, as well as restriction enzyme recognition
- the next step was to clone a 3 6 kb Xhol-Hindlll fragment, containing the E. coli ⁇ -galactosidase gene and SV40 polyadenylation signal from pSV ⁇ (Clontech, Palo Alto, CA) into the pSP72-PGKneo plasmid
- the "short arm" of homology from the mouse Beer gene locus was generated by amplifying a 2 4 kb fragment from the BAC clone 15G5
- the 3' end of the fragment coincided with the translational initiation site of the Beer gene, and the anti-sense primer used in the PCR also included 30 ntd complementary to the 5' end of the ⁇ -galaciosidase gene so that its coding region could be fused to the Beer initiation site in-frame
- the approach taken for introducing the "short arm" into the pSP72- ⁇ gal-PGKneo plasmid was to linearize the plasmid at
- the sequence of the sense primer was 5'-ATTTAGGTGACACT ATAGAACTCGAGCAGCTGAAGCTTAACCACATGGTGGCTCACAACCAT-3' (SEQ ID NO:36) and the sequence of the anti-sense primer was 5'- AACGACGGCCAGTGAATCCGTA
- the "long arm" from the Reer gene locus was generated by amplifying a 6 1 kb fragment from BAC clone 15G5 with primers which also introduce the rare- cutting restriction enzyme sites SgrAI, Fsel, Ascl and Pad Specifically, the sequence of the sense primer was 5'-ATTACCACCGGTGACACCCGCTTCCTGACAG-3' (SEQ ID NO:38), the sequence of the anti-sense primer was 5'- ATTACTTAATTAAACATGGCGCGCCAT
- the resulting PCR product was cloned into the TA vector (Invitrogen, Carlsbad, CA ) as an intermediate step
- the mouse 7 eer gene targeting construct also included a second selectable marker, the herpes simplex vn us I thymidine kinase gene (HSVTK) under the control of rous sarcoma virus long terminal repeat element (RSV LTR) Expression of this gene renders mammalian cells sensitive (and inviable) to gancyclovir, it is therefore a convenient way to select against neomycin-resistant cells in which the construct has integrated by a non-homologous event (US Patent 5,464,764)
- the RSVLTR-HSVTK cassette was amplified from pPS 1337 using primers that allow subsequent cloning into the Fsel and Ascl sites of the "long arm"-TA vector plasmid For this PCR, the sequence of
- the final step in the construction of the targeting vector involved cloning the 8 8 kb SgrAI-AscI fragment containing the "long arm” and RSVLTR- HSVTK gene into the SgrAI and Ascl sites of the pSP72-"short arm"- ⁇ gal-PGKneo plasmid
- This targeting vector was linearized by digestion with either Ascl or Pad before electroporation into ES cells
- 17-nucleot ⁇ de antisense oligonucleotides are prepared in an overlapping format, in such a way that the 5' end of the first oligonucleotide overlaps the translation initiating AUG of the Beer transcript, and the 5' ends of successive oligonucleotides occur in 5 nucleotide increments moving in the 5' direction (up to 50 nucleotides away), relative to the Beer AUG
- responding control oligonucleotides are designed and prepared using equivalent base composition but redistributed in sequence to inhibit any significant hybridization to the coding mRNA
- Reagent delivery to the test cellular system is conducted through cationic hpid delivery (P L Feigner, Proc Natl Acad Sci USA 57 7413, 1987) 2 ug of antisense oligonucleotide is added to 100 ul of reduced serum media (Opti-MEM I reduced serum media, Life Technologies, Gaithersburg MD) and this is mixed with Lipofectin reagent (6
- MC3T3E21 or KS483 cells are cultured and the mRNA recovered. Beer mRNA is monitored using RT-PCR in conjunction with Beer specific primers.
- separate experimental wells are collected and protein levels characterized through western blot methods described in Example 4. The cells are harvested, resuspended in lysis buffer (50 mM Tris pH 7.5, 20 mM NaCI, ImM EDTA, 1% SDS) and the soluble protein collected. This material is applied to 10-20 % gradient denaturing SDS PAGE. The separated proteins are transferred to nitrocellulose and the western blot conducted as above using the antibody reagents described.
- control oligonucleotides are added to identical cultures and experimental operations are repeated.
- Decrease in Beer mRNA or protein levels are considered significant if the treatment with the antisense oligonucleotide results in a 50% change in either instance compared to the control scrambled oligonucleotide.
- This methodology enables selective gene inactivation and subsequent phenotype characterization of the mineralized nodules in the tissue culture model.
- a TEIIFELGEYFEFLEELNNKTMNR a ENGCRFFHHFFETRDASEYSCRELHFTRYVTDGECRS KPVTELVCSGQGGE a RLLFNAIGRGKWWRESGPDFRCIFDRYR a QRVQLLCFGG a J i FR R VRLV a SCKCKRLTRFHNQSELKDFGPE a .
- CGCGTTTTGGTG E GCAGCA avoids TTGCGCTTCG B TG a GCCTTGGCGTTGAG»TTGAT ⁇ CCTCTGCTGCACAAA n GGCA.
- B T3 CCG a L ⁇ L a cmGCLC a TTCGT& a C r Gr-GTCTf-C ,T ' T, -.._ u ncTT a "'" precede3C a ATuLAGTGTC a TTC arr r AAGC CNGCC
- T a CG a CGTTCTC' ⁇ , T _ a C GGTGGCTGGGCTGTCTCTT iGOCGGGCGTC- r -3' T, G a C a GCTGCCT a TTCTGC a GTG a GGTC a CCGT ⁇ G represents a TGTCTuCGTTCCTTGCC a TGGC an 3GG'- a T J a 3GTT a C - T ⁇ 'T, G3GTGTu& a GCTTTTCCTGTCGGTGTC a
- a GCC a GGuGGCTTGGCGGTCTC a G3AGCCTGGTT3CTGGGGGAC a GCTTGTTG a GTTTT a TCTGC GTAGGTTGCCT AGGC T a GTGTCAGG a CTGATGGCTGCCTTGGAG a - a CAC a TCCTTTGCCrTCTATuCAA shall be a TCTG a CCTTG a C TGGGGGC
- GGA a AGCG a AGGGCCTCTTTGACC TTC a GTC a - a GGT a CCTTCT a ACTCGC a TCGTATTGGGGGGCT a CTCT a GTGCTPG a C a TTGC a GAG a GCCTCAG a ACTGT a GTT a CCAGTuTGGT a GGATTG a TCCTTC a GGGAGCCTGAC a TGTGACAGTTCC a
- GGCAC a GGACGAT a T a AGTGGCTTGCTTA a GCTTGTCTGCATGGTAAATGGCAGGGCTGGATTG a G a CCCAGAC a TTCC -3Tr T"GGGTCT a TTT ⁇ TTTTTT ⁇ TCGTTGTTCG a TCT-,ur r""-n ""Y ⁇ T-- a ⁇ TC a G L CT a G3rTG a 3 a CTr am
- a ACA,AC AAC a AA CAAACAAACAAAGGACCTCC a TTTGGAC a ATTGC a AGG a TTTTATCrTG a ATTAT a GTGTTGGTGAGTTC a did a GTC a TC C GCCAAGTGCTTGCC a TGr ⁇ GuTTGCT a TTCTA.
- TTGCCTCA CC a CTGuTTTTG B AG a GA a ATTC aa C- A a TGTCCTl CGTCAA a TTGT a GC- -,CTu a GC a a TGTbA B CC
- TCCcACTTC T T a G a AGCCi-.C a CTTGTTTCCTT T ⁇ - J '""A ⁇ ACG " a -.TTTCTTTTC -aa -r TCAGGG ACC a -.
- CCTCCCCC a C a TACC a CCTCTGC a GGGGTGAGTA a ATT a AGCC a GCC a C a GAAGGGTGGC a AGCCCT a C a CCTCCCCCCT GTTGTGCCCCCCCCCCCCGTG a AGGTGC a TCCTGGCCTCTGCCCCTCTC3CTTTGGT a CTGGGATTTTTTTTTTCCTT
- TTGu r ⁇ GG a G"TTu caac ⁇ Gu ⁇ TuGuCTuGCTa-f T CT A Tf ALCL-AA" ' a T a TCTCTC ⁇ T should T a GTu( T3G a TTac r GTca ⁇ B T a TG a GCac a CCTGGCTTTTTT a TGTL-.r-,uTTL.
- TCacTATTC a CTTCT B CTTGGCTC a TG a AACTT a AGT a C a C a CAGaca acaGac a cac a Ar caGn TC a T r"acAA
- GCCTTT uT AGk a GuTTCC a AG a TTGGTACTGGCGT a CTGG a A B CTG a AC a AG&Ta3 B C a TCT a G a AATCac a 3CAGC TCaGA a GGACACCTGTac a AGac a G a CTTCC a CacCTTCC B Gu a ACaCTGa3C a GGGGGCTGL-.& a CCTTGCCTCA a u
- TCTGG B &G D AGG a ATC B GGGTGGG a "TG a TCaAATacaa ⁇ a TC a AGG a aAAAGTA a AAAAC a T a ' r AT a TAT a T a Ta ⁇ T a ACTGaTCT a GGG a GCTGGCTC a GC3TT a AG a GTTCT&GCTGCCCTTG r, TTC B GaTCTTLCTTTGATTCCC a GC a CCCA C a TGATGGCTTTCAaCTGTa ⁇ CTCTGCTTCCAGGGG a TCCA.AC a GCCTCTTCTGaCCTCCa ⁇ a GaCAAGACCT a GTCCTC
- r 3 a an a u aGTGCTL,TT a TT a r T a AAAACau a u CC rGCa CCACCA a C-, ac a AGT a T3 m a ⁇ G B ⁇ TuT ⁇ 3a ⁇ ⁇ , , a 'cT ⁇ a AAGCGacAC a ACCa ⁇ TTT a C a TC a TL.GC a TCTTCCT a AC c a 1 ⁇ ⁇ TTT uTTTTGT TTT TT a G B C a G3GTTTCTCTGTGT a GTCCTGGL.TGTCCTGL Ba CT r ' a CTT ⁇ GTaG a CC a G .CTCGCCTCC .
- Sequence ID No . 18 Human Beer Genomic Sequence (This gene has two exons , at positions 161-427 abd 3186-5219) .
- tctctcacac acacacacag acacacacac acgctctgta ggggtctact tatgctccaa 7620
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Analytical Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Physical Education & Sports Medicine (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Wood Science & Technology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Rheumatology (AREA)
- Toxicology (AREA)
Priority Applications (17)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2013001685A MX343200B (es) | 1998-11-27 | 1999-11-24 | Composiciones y metodos para aumentar la mineralizacion ósea. |
| HK02105515.3A HK1044171B (zh) | 1998-11-27 | 1999-11-24 | 增加骨矿化的组合物和方法 |
| AU20313/00A AU2031300C1 (en) | 1998-11-27 | 1999-11-24 | Compositions and methods for increasing bone mineralization |
| BRPI9915679A BRPI9915679B8 (pt) | 1998-11-27 | 1999-11-24 | composições e métodos para aumentar a mineralização óssea |
| JP2000585404A JP4813660B2 (ja) | 1998-11-27 | 1999-11-24 | 骨鉱化作用を増加するための組成物および方法 |
| NZ512122A NZ512122A (en) | 1998-11-27 | 1999-11-24 | Compositions and methods for increasing bone mineralization |
| DE69933044.0T DE69933044T3 (de) | 1998-11-27 | 1999-11-24 | Zusammensetzungen und verfahren zur erhöhung der knochenmineralisierung |
| CA2352532A CA2352532C (en) | 1998-11-27 | 1999-11-24 | Compositions and methods for increasing bone mineralization |
| CN99815505.5A CN1333828B (zh) | 1998-11-27 | 1999-11-24 | 增加骨矿化的组合物和方法 |
| IL14326699A IL143266A0 (en) | 1998-11-27 | 1999-11-24 | Transforming growth factor-beta binding proteins and pharmaceutical compositions for increasing bone mineral content utilizing the same |
| EP99963986.7A EP1133558B2 (en) | 1998-11-27 | 1999-11-24 | Compositions and methods for increasing bone mineralization |
| DK99963986.7T DK1133558T4 (en) | 1998-11-27 | 1999-11-24 | Compositions and methods for increasing bone mineralization |
| MXPA01005275A MXPA01005275A (es) | 1998-11-27 | 1999-11-24 | Composiciones y metodos para aumentar la mineralizacion de huesos. |
| ES99963986.7T ES2272093T5 (es) | 1998-11-27 | 1999-11-24 | Composiciones y métodos para incrementar la mineralización de la substancia ósea |
| IL143266A IL143266A (en) | 1998-11-27 | 2001-05-21 | Antibodies that bind β – TGF-binding proteins with a 1– M 6 10 strain and their use |
| CY20061101623T CY1106260T1 (el) | 1998-11-27 | 2006-11-09 | Συνθεσεις και μεθοδοι για την αυξηση της ασβεστοποιησεως των οστων |
| IL210392A IL210392A (en) | 1998-11-27 | 2010-12-30 | A nucleic acid molecule that encodes a polypeptide that reduces bone mineral content |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US11028398P | 1998-11-27 | 1998-11-27 | |
| US60/110,283 | 1998-11-27 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2000032773A1 true WO2000032773A1 (en) | 2000-06-08 |
| WO2000032773A9 WO2000032773A9 (en) | 2001-12-13 |
Family
ID=22332193
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1999/027990 Ceased WO2000032773A1 (en) | 1998-11-27 | 1999-11-24 | Compositions and methods for increasing bone mineralization |
Country Status (18)
| Country | Link |
|---|---|
| US (12) | US6395511B1 (enExample) |
| EP (3) | EP1721979B1 (enExample) |
| JP (2) | JP4813660B2 (enExample) |
| CN (2) | CN101469329B (enExample) |
| AT (2) | ATE481487T1 (enExample) |
| BR (1) | BRPI9915679B8 (enExample) |
| CA (1) | CA2352532C (enExample) |
| CY (3) | CY1106260T1 (enExample) |
| DE (2) | DE69933044T3 (enExample) |
| DK (3) | DK1721979T3 (enExample) |
| ES (3) | ES2639020T3 (enExample) |
| HK (1) | HK1044171B (enExample) |
| IL (3) | IL143266A0 (enExample) |
| MX (2) | MX343200B (enExample) |
| NZ (3) | NZ552959A (enExample) |
| PT (3) | PT1721979E (enExample) |
| WO (1) | WO2000032773A1 (enExample) |
| ZA (1) | ZA200104234B (enExample) |
Cited By (39)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000055193A3 (en) * | 1999-03-12 | 2001-01-18 | Regeneron Pharma | Human dan/cerberus related protein 6 (dcr6) |
| CN1333828A (zh) * | 1998-11-27 | 2002-01-30 | 达尔文发现有限公司 | 增加骨矿化的组合物和方法 |
| WO2001092308A3 (en) * | 2000-06-01 | 2002-04-11 | Amgen Inc | Cystine-knot polypeptides: cloaked-2 molecules and uses thereof |
| WO2001098491A3 (en) * | 2000-06-19 | 2003-10-02 | Hoffmann La Roche | Osteolevin gene polymorphisms |
| WO2005003158A2 (en) | 2003-06-16 | 2005-01-13 | Celltech R & D, Inc. | Compositions and methods for increasing bone mineralization |
| WO2005014650A3 (en) * | 2003-06-16 | 2005-07-28 | Celltech R & D Inc | Antibodies specific for sclerostin and methods for increasing bone mineralization |
| JP2005532998A (ja) * | 2002-03-01 | 2005-11-04 | セルテック アール アンド ディー インコーポレイテッド | 骨密度を増減させる方法 |
| WO2006119107A3 (en) * | 2005-05-03 | 2006-12-28 | Ucb Sa | Sclerostin binding agents |
| EP1857551A3 (en) * | 2000-06-01 | 2007-11-28 | Amgen Inc. | Cystine-knot polypeptides: cloaked-2 molecules and uses thereof |
| US7585501B2 (en) | 2002-06-14 | 2009-09-08 | Stowers Institute For Medical Research | Compositions and methods for treating kidney disease |
| US7744874B2 (en) | 2007-03-20 | 2010-06-29 | Eli Lilly And Company | Anti-sclerostin antibodies |
| US7799523B2 (en) | 2002-04-03 | 2010-09-21 | Celltech R & D, Inc. | Association of polymorphisms in the SOST gene region with bone mineral density |
| WO2010115932A1 (en) | 2009-04-08 | 2010-10-14 | Novartis Ag | Combination for the treatment of bone loss |
| US7879322B2 (en) | 2007-10-12 | 2011-02-01 | Novartis Ag | Compositions and methods for use for antibodies against sclerostin |
| US7893218B2 (en) | 2003-06-16 | 2011-02-22 | Stowers Institute For Medical Research | Antibodies that specifically bind SOST peptides |
| EP2298800A1 (en) * | 2005-05-03 | 2011-03-23 | UCB Pharma, S.A. | Sclerostin binding antibodies |
| US7968301B2 (en) | 2002-06-14 | 2011-06-28 | Stowers Institute For Medical Research | Method of modulating Sost binding to LRP |
| US8017120B2 (en) | 2007-09-17 | 2011-09-13 | Amgen Inc. | Method for inhibiting bone resorption |
| WO2011128424A1 (en) | 2010-04-16 | 2011-10-20 | Novartis Ag | Methods and compositions for improving implant osseointegration |
| WO2012059598A2 (en) | 2010-11-05 | 2012-05-10 | Novartis Ag | Methods of treating rheumatoid arthritis using il-17 antagonists |
| WO2012149246A1 (en) | 2011-04-29 | 2012-11-01 | Novartis Ag | Methods of treating squamous cell carcinoma related applications |
| WO2014118705A1 (en) | 2013-01-31 | 2014-08-07 | Novartis Ag | Methods of treating chronic kidney disease-mineral and bone disorder using sclerostin antagonists |
| WO2014155278A2 (en) | 2013-03-26 | 2014-10-02 | Novartis Ag | Methods of treating autoimmune diseases using il-17 antagonists |
| US9145457B2 (en) | 2011-03-25 | 2015-09-29 | Amgen Inc. | Sclerostin antibody crystals and formulations thereof |
| US9352043B2 (en) | 2010-05-14 | 2016-05-31 | Amgen Inc. | High concentration antibody formulations |
| US9657090B2 (en) | 2011-12-28 | 2017-05-23 | Amgen Inc. | Method of treating alveolar bone loss through the use of anti-sclerostin antibodies |
| US9822173B2 (en) | 2012-11-21 | 2017-11-21 | Amgen Inc. | Heterodimeric immunoglobulins |
| US9925260B2 (en) | 2012-07-05 | 2018-03-27 | Ucb Pharma S.A. | Treatment for bone diseases |
| WO2018115880A1 (en) | 2016-12-21 | 2018-06-28 | Mereo Biopharma 3 Limited | Use of anti-sclerostin antibodies in the treatment of osteogenesis imperfecta |
| WO2020002673A1 (en) | 2018-06-29 | 2020-01-02 | Mereo Biopharma 3 Limited | Use of a sclerostin antagonist |
| US10538584B2 (en) | 2011-08-04 | 2020-01-21 | Amgen Inc. | Methods for treating bone gap defects |
| US10961305B2 (en) | 2016-12-21 | 2021-03-30 | Mereo Biopharma 3 Limited | Use of anti-sclerostin antibodies in the treatment of osteogenesis imperfecta |
| US11466079B2 (en) | 2018-03-30 | 2022-10-11 | Amgen Inc. | C-terminal antibody variants |
| EP3345607B1 (en) | 2006-12-29 | 2022-10-26 | Ossifi-Mab LLC | Methods of altering bone growth by administration of sost or wise antagonist or agonist |
| US11576970B2 (en) | 2016-03-10 | 2023-02-14 | UCB Biopharma SRL | Pharmaceutical formulations |
| US11851483B2 (en) | 2014-12-12 | 2023-12-26 | Amgen Inc. | Anti-sclerostin antibodies and their use to treat bone disorders as part of a regimen |
| EP4372005A2 (en) | 2014-12-22 | 2024-05-22 | Novartis AG | Pharmaceutical products and stable liquid compositions of il-17 antibodies |
| US12194078B2 (en) | 2017-03-11 | 2025-01-14 | Cartesian Therapeutics, Inc. | Methods and compositions related to combined treatment with anti-inflammatories and synthetic nanocarriers comprising an immunosuppressant |
| US12472167B2 (en) | 2013-05-03 | 2025-11-18 | Cartesian Therapeutics, Inc. | Methods providing a therapeutic macromolecule and synthetic nanocarriers comprising immunosuppressant locally and concomitantly to reduce both Type 1 and Type IV hypersensitivity |
Families Citing this family (126)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020042926A1 (en) * | 1998-10-28 | 2002-04-11 | Matzuk Martin M. | Ovary-specific genes and proteins |
| US20030138902A1 (en) * | 1999-08-31 | 2003-07-24 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| AU2002230390A1 (en) * | 2000-10-05 | 2002-04-29 | The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services | Ixodes scapularis tissue factor pathway inhibitor |
| CA2468125A1 (en) * | 2001-10-24 | 2003-05-01 | Dgi Biotechnologies, Inc. | Target specific screening and its use for identifying target binders |
| US7202102B2 (en) * | 2001-11-27 | 2007-04-10 | Jds Uniphase Corporation | Doped absorption for enhanced responsivity for high speed photodiodes |
| ES2379689T3 (es) * | 2003-03-14 | 2012-04-30 | Ucb Manufacturing, Inc. A Company Incorporated Under The Laws Of The State Of Delaware | Complejo de esclerostina y nogina o cordina, y agentes que modulan la formación de dicho complejo |
| WO2004086953A2 (en) * | 2003-03-26 | 2004-10-14 | The Board Of Trustees Of The University Of Arkansas | Method for diagnosis and treatment of bone turnover |
| JP3848288B2 (ja) * | 2003-04-25 | 2006-11-22 | キヤノン株式会社 | 放射線画像撮影装置 |
| WO2004108160A1 (ja) * | 2003-06-05 | 2004-12-16 | Nippon Shinyaku Co., Ltd. | 骨形成促進増強剤及びそのスクリーニング方法 |
| US8461155B2 (en) * | 2003-09-22 | 2013-06-11 | University Of Connecticut | Sclerostin and the inhibition of WNT signaling and bone formation |
| WO2005063983A1 (en) * | 2003-12-29 | 2005-07-14 | Galapagos Genomics N.V. | Modulators of bone homeostasis identified in a high-throughput screen |
| US8193312B2 (en) | 2004-01-28 | 2012-06-05 | The Regents Of The University Of California | Bone morphogenic protein binding peptide |
| US8415302B2 (en) | 2004-01-28 | 2013-04-09 | The Regents Of The University Of California | Surgical applications for BMP binding protein |
| US8188219B2 (en) | 2004-01-28 | 2012-05-29 | The Regents Of The University Of California | Bone morphogenic protein binding peptide |
| EP1853283B1 (en) * | 2004-11-29 | 2015-09-16 | The Regents of The University of California | Activating extraction of demineralized bone matrix |
| ITMI20050739A1 (it) * | 2005-04-22 | 2006-10-23 | Effebi Spa | Piastrina di connsessione valvola-attuatore |
| WO2006135734A2 (en) * | 2005-06-10 | 2006-12-21 | The Regents Of The University Of California | Compositions and methods for altering bone density and bone patterning |
| US7901710B2 (en) | 2005-08-04 | 2011-03-08 | Vertical Pharmaceuticals, Inc. | Nutritional supplement for use under physiologically stressful conditions |
| US8263137B2 (en) | 2005-08-04 | 2012-09-11 | Vertical Pharmaceuticals, Inc. | Nutritional supplement for women |
| US7998500B2 (en) | 2005-08-04 | 2011-08-16 | Vertical Pharmaceuticals, Inc. | Nutritional supplement for women |
| US8202546B2 (en) | 2005-08-04 | 2012-06-19 | Vertical Pharmaceuticals, Inc. | Nutritional supplement for use under physiologically stressful conditions |
| EA201692543A1 (ru) * | 2005-11-23 | 2017-08-31 | Акселерон Фарма Инк. | Антагонисты активина-actriia и их применение для стимулирования роста кости |
| EP2460828A3 (en) * | 2006-11-10 | 2012-08-08 | UCB Pharma, S.A. | Antibodies and diagnostics |
| US20100036091A1 (en) * | 2006-11-10 | 2010-02-11 | Amgen Inc. | Antibody-based diagnostics and therapeutics |
| US20080200425A1 (en) * | 2007-02-16 | 2008-08-21 | Kurtz Seymour J | Methods and compositions for regulating bone mineral density |
| WO2008157367A1 (en) * | 2007-06-15 | 2008-12-24 | Genzyme Corporation | Fusion proteins containing two tgf-beta binding domains of tgf-beta type ii receptor |
| MX2010002249A (es) * | 2007-08-31 | 2010-03-17 | Amgen Inc | Formulacion de proteina de estado solido. |
| CA2701032C (en) | 2007-09-27 | 2021-01-26 | Amgen Inc. | Pharmaceutical formulations |
| EP3381445B1 (en) | 2007-11-15 | 2023-10-25 | Amgen Inc. | Aqueous formulation of antibody stablised by antioxidants for parenteral administration |
| BRPI0819688A2 (pt) * | 2007-12-14 | 2015-06-16 | Amgen Inc | Processo para tratamento de fratura óssea com anticorpos anti-esclerostina. |
| EP2274620A2 (en) * | 2008-04-02 | 2011-01-19 | Tel HaShomer Medical Research Infrastructure and Services Ltd. | Procollagen c-proteinase enhancer (pcpe) biomarker for bone formation |
| US8518656B2 (en) | 2008-04-02 | 2013-08-27 | Ramot Tel-Aviv University Ltd. | Procollagen C-proteinase enhancer (PCPE) biomarker for bone formation |
| US8198292B2 (en) * | 2008-07-03 | 2012-06-12 | Osteogenex, Inc. | Vinpocetine and eburnamonine derivatives for promoting bone growth, treating renal damage and cancer, and devices thereof |
| MX371080B (es) | 2009-06-23 | 2020-01-15 | Univ California | Aumento de retención de bmp. |
| AU2010310457B2 (en) | 2009-10-23 | 2015-07-02 | Amgen Inc. | Vial adapter and system |
| KR102513760B1 (ko) | 2010-06-07 | 2023-03-27 | 암젠 인크 | 약물 전달 장치 |
| JP2014509588A (ja) | 2011-03-01 | 2014-04-21 | アムジエン・インコーポレーテツド | 二特異性結合剤 |
| EP2691065B1 (en) | 2011-03-31 | 2017-03-01 | Amgen Inc. | Vial adapter and system |
| EP2699261B1 (en) | 2011-04-19 | 2018-07-11 | Amgen Inc. | Method for treating osteoporosis |
| CA2833748C (en) | 2011-04-20 | 2019-07-16 | Amgen Inc. | Autoinjector apparatus |
| EP3453711B1 (en) | 2011-09-02 | 2021-08-18 | The Regents of the University of California | Llp2a- bisphosphonate conjugates for osteoporosis treatment |
| EP3335747B1 (en) | 2011-10-14 | 2021-04-07 | Amgen Inc. | Injector and method of assembly |
| EP3072548B1 (en) | 2012-11-21 | 2019-03-06 | Amgen, Inc | Drug delivery device |
| JP6336564B2 (ja) | 2013-03-15 | 2018-06-06 | アムゲン・インコーポレーテッド | 薬物カセット、自動注入器、および自動注入器システム |
| CN111617347B (zh) | 2013-03-15 | 2023-09-29 | 安进公司 | 身体轮廓可调适的自动注射器装置 |
| US10492990B2 (en) | 2013-03-15 | 2019-12-03 | Amgen Inc. | Drug cassette, autoinjector, and autoinjector system |
| WO2014144817A2 (en) | 2013-03-15 | 2014-09-18 | Amgen Inc. | Inhibitory polypeptides specific to wnt inhibitors |
| PL3312195T3 (pl) * | 2013-03-20 | 2020-04-30 | Genzyme Corporation | Sposoby leczenia wrodzonej łamliwości kości |
| EP2976117B1 (en) | 2013-03-22 | 2020-12-30 | Amgen Inc. | Injector and method of assembly |
| SG11201602876WA (en) | 2013-10-24 | 2016-05-30 | Amgen Inc | Injector and method of assembly |
| WO2015061389A1 (en) | 2013-10-24 | 2015-04-30 | Amgen Inc. | Drug delivery system with temperature-sensitive control |
| US10994112B2 (en) | 2014-02-05 | 2021-05-04 | Amgen Inc. | Drug delivery system with electromagnetic field generator |
| SG10201811702TA (en) | 2014-05-07 | 2019-01-30 | Amgen Inc | Autoinjector with shock reducing elements |
| MX387194B (es) | 2014-06-03 | 2025-03-18 | Amgen Inc | Sistemas y metodos para procesar de manera remota datos recolectados por un dispositivo de suministro de farmaco. |
| EP3943135B1 (en) | 2014-10-14 | 2025-09-24 | Amgen Inc. | Drug injection device with visual and audible indicators |
| US10799630B2 (en) | 2014-12-19 | 2020-10-13 | Amgen Inc. | Drug delivery device with proximity sensor |
| EP3689394A1 (en) | 2014-12-19 | 2020-08-05 | Amgen Inc. | Drug delivery device with live button or user interface field |
| ES2748750T3 (es) | 2015-02-17 | 2020-03-17 | Amgen Inc | Dispositivo de administración de fármacos con sujeción asistida por vacío y/o realimentación |
| US11806509B2 (en) | 2015-02-27 | 2023-11-07 | Amgen Inc. | Drug delivery device having a needle guard mechanism with a turnable threshold of resistance to needle guard movement |
| WO2017039786A1 (en) | 2015-09-02 | 2017-03-09 | Amgen Inc. | Syringe assembly adapter for a syringe |
| US11351308B2 (en) | 2015-12-09 | 2022-06-07 | Amgen Inc. | Auto-injector with signaling cap |
| US11154661B2 (en) | 2016-01-06 | 2021-10-26 | Amgen Inc. | Auto-injector with signaling electronics |
| EP3429663B1 (en) | 2016-03-15 | 2020-07-15 | Amgen Inc. | Reducing probability of glass breakage in drug delivery devices |
| US11541168B2 (en) | 2016-04-29 | 2023-01-03 | Amgen Inc. | Drug delivery device with messaging label |
| US11389588B2 (en) | 2016-05-02 | 2022-07-19 | Amgen Inc. | Syringe adapter and guide for filling an on-body injector |
| JP7309363B2 (ja) | 2016-05-13 | 2023-07-18 | アムジエン・インコーポレーテツド | バイアル・スリーブ組立体 |
| US11238150B2 (en) | 2016-05-16 | 2022-02-01 | Amgen Inc. | Data encryption in medical devices with limited computational capability |
| WO2017209899A1 (en) | 2016-06-03 | 2017-12-07 | Amgen Inc. | Impact testing apparatuses and methods for drug delivery devices |
| EP3478342B1 (en) | 2016-07-01 | 2025-03-12 | Amgen Inc. | Drug delivery device having minimized risk of component fracture upon impact events |
| CN110214021A (zh) | 2016-08-08 | 2019-09-06 | 安进公司 | 使用抗硬化蛋白抗体改善结缔组织附着的方法 |
| WO2018034784A1 (en) | 2016-08-17 | 2018-02-22 | Amgen Inc. | Drug delivery device with placement detection |
| US20200261643A1 (en) | 2016-10-25 | 2020-08-20 | Amgen Inc. | On-body injector |
| WO2018109670A1 (en) | 2016-12-15 | 2018-06-21 | Nestec Sa | Compositions and methods that modulate vitamin d and bone mineral content in a companion animal |
| MX2019008432A (es) | 2017-01-17 | 2019-11-18 | Amgen Inc | Dispositivos de inyeccion y metodos relacionados de uso y ensamblaje. |
| MX2019009755A (es) | 2017-02-17 | 2019-10-07 | Amgen Inc | Mecanismo de insercion para dispositivo de suministro de farmacos. |
| US11752258B2 (en) | 2017-02-17 | 2023-09-12 | Amgen Inc. | Drug delivery device with sterile fluid flowpath and related method of assembly |
| WO2018165143A1 (en) | 2017-03-06 | 2018-09-13 | Amgen Inc. | Drug delivery device with activation prevention feature |
| WO2018164829A1 (en) | 2017-03-07 | 2018-09-13 | Amgen Inc. | Needle insertion by overpressure |
| IL268386B2 (en) | 2017-03-09 | 2023-11-01 | Amgen Inc | Insertion mechanism for a drug delivery device |
| PL3600491T3 (pl) | 2017-03-28 | 2024-03-04 | Amgen Inc. | Układ i sposób montażu trzonu tłoka i strzykawki |
| WO2018226515A1 (en) | 2017-06-08 | 2018-12-13 | Amgen Inc. | Syringe assembly for a drug delivery device and method of assembly |
| EP3634546A1 (en) | 2017-06-08 | 2020-04-15 | Amgen Inc. | Torque driven drug delivery device |
| WO2018236619A1 (en) | 2017-06-22 | 2018-12-27 | Amgen Inc. | Device activation impact/shock reduction |
| JP7475860B2 (ja) | 2017-06-23 | 2024-04-30 | アムジエン・インコーポレーテツド | スイッチアセンブリにより起動されるキャップを含む電子薬物送達デバイス |
| EP3651832B1 (en) | 2017-07-14 | 2023-12-13 | Amgen Inc. | Needle insertion-retraction system having dual torsion spring system |
| US11672733B2 (en) | 2017-07-21 | 2023-06-13 | Amgen Inc. | Gas permeable sealing member for drug container and methods of assembly |
| JP2020528296A (ja) | 2017-07-25 | 2020-09-24 | アムジエン・インコーポレーテツド | ギヤモジュールを有する薬物送達デバイス及び関連する組立方法 |
| JP7242562B2 (ja) | 2017-07-25 | 2023-03-20 | アムジエン・インコーポレーテツド | 容器アクセスシステムを有する薬物送達デバイス及び関連する組立方法 |
| US12318593B2 (en) | 2017-08-09 | 2025-06-03 | Amgen Inc. | Hydraulic-pneumatic pressurized chamber drug delivery system |
| EP3668567A1 (en) | 2017-08-18 | 2020-06-24 | Amgen Inc. | Wearable injector with sterile adhesive patch |
| US11103636B2 (en) | 2017-08-22 | 2021-08-31 | Amgen Inc. | Needle insertion mechanism for drug delivery device |
| US11759565B2 (en) | 2017-10-04 | 2023-09-19 | Amgen Inc. | Flow adapter for drug delivery device |
| EP3691716B1 (en) | 2017-10-06 | 2023-11-29 | Amgen Inc. | Drug delivery device with interlock assembly and related method of assembly |
| IL273323B2 (en) | 2017-10-09 | 2024-10-01 | Amgen Inc | Drug delivery device with drive assembly and related assembly method |
| US11826480B2 (en) | 2017-11-03 | 2023-11-28 | Amgen Inc. | Systems and approaches for sterilizing a drug delivery device |
| MA50553A (fr) | 2017-11-06 | 2020-09-16 | Amgen Inc | Dispositif d'administration de médicament avec détection de positionnement et de débit |
| MA50569A (fr) | 2017-11-06 | 2020-09-16 | Amgen Inc | Ensembles de remplissage-finition et procédés associés |
| SG11202002966QA (en) | 2017-11-10 | 2020-05-28 | Amgen Inc | Plungers for drug delivery devices |
| AU2018368340B2 (en) | 2017-11-16 | 2024-03-07 | Amgen Inc. | Door latch mechanism for drug delivery device |
| JP7747438B2 (ja) | 2017-11-16 | 2025-10-01 | アムジエン・インコーポレーテツド | 失速及び終点検出を有するオートインジェクタ |
| CN112368051A (zh) | 2018-03-23 | 2021-02-12 | 马萨诸塞大学 | 用于治疗骨病的基因治疗剂 |
| US10835685B2 (en) | 2018-05-30 | 2020-11-17 | Amgen Inc. | Thermal spring release mechanism for a drug delivery device |
| US11083840B2 (en) | 2018-06-01 | 2021-08-10 | Amgen Inc. | Modular fluid path assemblies for drug delivery devices |
| WO2020023220A1 (en) | 2018-07-24 | 2020-01-30 | Amgen Inc. | Hybrid drug delivery devices with tacky skin attachment portion and related method of preparation |
| WO2020023336A1 (en) | 2018-07-24 | 2020-01-30 | Amgen Inc. | Hybrid drug delivery devices with grip portion |
| MX2021000749A (es) | 2018-07-24 | 2021-03-29 | Amgen Inc | Dispositivos de suministro para administrar farmacos. |
| EP3826701A1 (en) | 2018-07-24 | 2021-06-02 | Amgen Inc. | Delivery devices for administering drugs |
| WO2020028009A1 (en) | 2018-07-31 | 2020-02-06 | Amgen Inc. | Fluid path assembly for a drug delivery device |
| EP3833327A1 (en) | 2018-08-10 | 2021-06-16 | Amgen Inc. | Method of preparing an antibody pharmaceutical formulation |
| JP2022500095A (ja) | 2018-09-24 | 2022-01-04 | アムジエン・インコーポレーテツド | インターベンション投薬システム及び方法 |
| IL281469B2 (en) | 2018-09-28 | 2024-08-01 | Amgen Inc | Muscle wire escapement activation assembly for a drug delivery device |
| EP3860685A1 (en) | 2018-10-02 | 2021-08-11 | Amgen Inc. | Injection systems for drug delivery with internal force transmission |
| US12151089B2 (en) | 2018-10-05 | 2024-11-26 | Amgen Inc. | Drug delivery device having dose indicator |
| SG11202101824VA (en) | 2018-10-15 | 2021-03-30 | Amgen Inc | Platform assembly process for drug delivery device |
| MA53912A (fr) | 2018-10-15 | 2022-01-19 | Amgen Inc | Dispositif d'administration de médicament comprenant un mécanisme d'amortissement |
| TWI831847B (zh) | 2018-11-01 | 2024-02-11 | 美商安進公司 | 部分針頭縮回之藥物遞送裝置及其操作方法 |
| AU2019370159B2 (en) | 2018-11-01 | 2025-05-29 | Amgen Inc. | Drug delivery devices with partial drug delivery member retraction |
| EP3873566B1 (en) | 2018-11-01 | 2024-11-27 | Amgen Inc. | Drug delivery devices with partial drug delivery member retraction |
| US20220160972A1 (en) | 2019-04-24 | 2022-05-26 | Amgen Inc. | Syringe sterilization verification assemblies and methods |
| WO2021030179A1 (en) | 2019-08-12 | 2021-02-18 | Amgen Inc. | Anti-sclerostin antibody formulations |
| JP7608439B2 (ja) | 2019-08-23 | 2025-01-06 | アムジエン・インコーポレーテツド | 構成可能な針シールド係合構成要素を備えた薬物送達デバイス及び関連方法 |
| WO2022120080A1 (en) * | 2020-12-03 | 2022-06-09 | University Of Massachusetts | Development of novel gene therapeutics for fibrodysplasia ossificans progressiva |
| CN113354724A (zh) * | 2021-04-28 | 2021-09-07 | 蒋青 | 骨硬化蛋白及其在制备治疗或预防阿尔兹海默症的相关产品上应用 |
| US20240208680A1 (en) | 2021-05-21 | 2024-06-27 | Amgen Inc. | Method of optimizing a filling recipe for a drug container |
| WO2024244941A1 (en) * | 2023-05-26 | 2024-12-05 | The University Of Hong Kong | Compositions and methods for the treatment of bone loss |
| WO2025019728A1 (en) | 2023-07-19 | 2025-01-23 | Amgen Inc. | Methods of buffer preparation for a therapeutic protein formulation |
Citations (83)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4018884A (en) | 1975-06-26 | 1977-04-19 | Hoffmann-La Roche Inc. | Fluorogenic materials and labeling techniques |
| US4331647A (en) | 1980-03-03 | 1982-05-25 | Goldenberg Milton David | Tumor localization and therapy with labeled antibody fragments specific to tumor-associated markers |
| US4359535A (en) | 1979-10-01 | 1982-11-16 | George Pieczenik | Autonomously replicating DNA containing inserted DNA sequences |
| US4376110A (en) | 1980-08-04 | 1983-03-08 | Hybritech, Incorporated | Immunometric assays using monoclonal antibodies |
| US4399216A (en) | 1980-02-25 | 1983-08-16 | The Trustees Of Columbia University | Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials |
| US4411993A (en) | 1981-04-29 | 1983-10-25 | Steven Gillis | Hybridoma antibody which inhibits interleukin 2 activity |
| US4486530A (en) | 1980-08-04 | 1984-12-04 | Hybritech Incorporated | Immunometric assays using monoclonal antibodies |
| US4528266A (en) | 1979-10-01 | 1985-07-09 | George Pieczenik | Method of inserting unique DNA sequences into DNA vectors |
| US4543439A (en) | 1982-12-13 | 1985-09-24 | Massachusetts Institute Of Technology | Production and use of monoclonal antibodies to phosphotyrosine-containing proteins |
| USRE32011E (en) | 1981-12-14 | 1985-10-22 | Scripps Clinic And Research Foundation | Ultrapurification of factor VIII using monoclonal antibodies |
| US4579821A (en) | 1981-11-23 | 1986-04-01 | University Patents, Inc. | Control of DNA sequence transcription |
| ZA858794B (en) | 1984-11-16 | 1986-07-30 | American Cyanamid Co | Antitumor antibiotics(ll-e33288 complex) |
| US4704362A (en) | 1977-11-08 | 1987-11-03 | Genentech, Inc. | Recombinant cloning vehicle microbial polypeptide expression |
| US4736866B1 (en) | 1984-06-22 | 1988-04-12 | Transgenic non-human mammals | |
| US4744981A (en) | 1985-10-17 | 1988-05-17 | Neorx Corporation | Trichothecene antibody conjugates |
| US4766075A (en) | 1982-07-14 | 1988-08-23 | Genentech, Inc. | Human tissue plasminogen activator |
| US4784950A (en) | 1985-04-17 | 1988-11-15 | Zymogenetics, Inc. | Expression of factor VII activity in mammalian cells |
| US4801542A (en) | 1984-10-12 | 1989-01-31 | Zymogenetics, Inc. | Expression of biologically active PDGF analogs in eucaryotic cells |
| WO1989001476A1 (en) | 1987-08-12 | 1989-02-23 | Celltech Limited | Tetra-aza macrocycles and metal complexes thereof |
| US4851341A (en) | 1986-12-19 | 1989-07-25 | Immunex Corporation | Immunoaffinity purification system |
| ZA888127B (en) | 1987-10-30 | 1989-07-26 | American Cyanamid Co | Targeted forms of methyltrithio antitumor agents |
| US4873191A (en) | 1981-06-12 | 1989-10-10 | Ohio University | Genetic transformation of zygotes |
| US4897255A (en) | 1985-01-14 | 1990-01-30 | Neorx Corporation | Metal radionuclide labeled proteins for diagnosis and therapy |
| US4902614A (en) | 1984-12-03 | 1990-02-20 | Teijin Limited | Monoclonal antibody to human protein C |
| WO1990002809A1 (en) | 1988-09-02 | 1990-03-22 | Protein Engineering Corporation | Generation and selection of recombinant varied binding proteins |
| EP0360257A2 (en) | 1988-09-20 | 1990-03-28 | The Board Of Regents For Northern Illinois University | RNA catalyst for cleaving specific RNA sequences |
| US4935349A (en) | 1986-01-17 | 1990-06-19 | Zymogenetics, Inc. | Expression of higher eucaryotic genes in aspergillus |
| WO1990007936A1 (en) | 1989-01-23 | 1990-07-26 | Chiron Corporation | Recombinant therapies for infection and hyperproliferative disorders |
| WO1990007862A2 (en) | 1989-01-06 | 1990-07-26 | Protein Engineering Corporation | Generation and selection of novel dna-binding proteins and polypeptides |
| WO1990009195A1 (en) | 1989-02-10 | 1990-08-23 | Celltech Limited | Cross-linked antibodies and processes for their preparation |
| US4959317A (en) | 1985-10-07 | 1990-09-25 | E. I. Du Pont De Nemours And Company | Site-specific recombination of DNA in eukaryotic cells |
| WO1991000285A1 (en) | 1989-06-23 | 1991-01-10 | Celltech Limited | Tri-aza macrocycles and processes for their preparation |
| US4987071A (en) | 1986-12-03 | 1991-01-22 | University Patents, Inc. | RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods |
| US4988496A (en) | 1988-05-31 | 1991-01-29 | Neorx Corporation | Metal radionuclide chelating compounds for improved chelation kinetics |
| EP0415731A2 (en) | 1989-08-30 | 1991-03-06 | The Wellcome Foundation Limited | Novel entities for cancer therapy |
| WO1991002805A2 (en) | 1989-08-18 | 1991-03-07 | Viagene, Inc. | Recombinant retroviruses delivering vector constructs to target cells |
| WO1991009967A1 (en) | 1989-12-21 | 1991-07-11 | Celltech Limited | Humanised antibodies |
| WO1991011465A1 (en) | 1990-01-26 | 1991-08-08 | Immunomedics, Inc. | Vaccines against cancer and infectious diseases |
| WO1991013152A1 (en) * | 1990-02-27 | 1991-09-05 | Ludwig Institute For Cancer Research | SUBSTANTIALLY PURE TRANSFORMING GROWTH FACTOR-β1-BINDING PROTEIN AND NUCLEOTIDE SEQUENCES EXPRESSING THE BINDING PROTEIN |
| ZA902839B (en) | 1989-04-14 | 1991-12-24 | American Cyanamid Co | N-acyl derivatives of the ll-e33288 antitumor antibiotics |
| US5087571A (en) | 1984-06-22 | 1992-02-11 | President And Fellows Of Harvard College | Method for providing a cell culture from a transgenic non-human mammal |
| US5106951A (en) | 1988-02-19 | 1992-04-21 | Neorx Corporation | Antibody conjugates |
| WO1992006693A1 (en) | 1990-10-22 | 1992-04-30 | Fox Chase Cancer Center | Dna construct for providing rna therapy |
| WO1992015677A1 (en) | 1991-03-01 | 1992-09-17 | Protein Engineering Corporation | Process for the development of binding mini-proteins |
| WO1992022583A2 (en) | 1991-06-11 | 1992-12-23 | Celltech Limited | Tri- and tetra-valent monospecific antigen-binding proteins |
| US5175384A (en) | 1988-12-05 | 1992-12-29 | Genpharm International | Transgenic mice depleted in mature t-cells and methods for making transgenic mice |
| US5175383A (en) | 1989-02-17 | 1992-12-29 | President And Fellows Of Harvard College | Animal model for benign prostatic disease |
| WO1993006231A1 (en) | 1991-09-26 | 1993-04-01 | Celltech Limited | Anti-human milk fat globule humanised antibodies |
| WO1993009191A1 (en) | 1991-10-29 | 1993-05-13 | E.I. Du Pont De Nemours And Company | Process for cathodic electrodeposition of a clear coating over a conductive paint layer |
| WO1993010218A1 (en) | 1991-11-14 | 1993-05-27 | The United States Government As Represented By The Secretary Of The Department Of Health And Human Services | Vectors including foreign genes and negative selective markers |
| WO1993011230A1 (en) | 1991-12-02 | 1993-06-10 | Dynal As | Modified mammalian stem cell blocking viral replication |
| US5219740A (en) | 1987-02-13 | 1993-06-15 | Fred Hutchinson Cancer Research Center | Retroviral gene transfer into diploid fibroblasts for gene therapy |
| US5221778A (en) | 1988-08-24 | 1993-06-22 | Yale University | Multiplex gene regulation |
| WO1993020242A1 (en) | 1992-03-30 | 1993-10-14 | The Scripps Research Institute | Encoded combinatorial chemical libraries |
| US5254678A (en) | 1987-12-15 | 1993-10-19 | Gene Shears Pty. Limited | Ribozymes |
| WO1993025234A1 (en) | 1992-06-08 | 1993-12-23 | The Regents Of The University Of California | Methods and compositions for targeting specific tissue |
| WO1993025698A1 (en) | 1992-06-10 | 1993-12-23 | The United States Government As Represented By The | Vector particles resistant to inactivation by human serum |
| WO1994003622A1 (en) | 1992-07-31 | 1994-02-17 | Imperial College Of Science, Technology & Medicine | D-type retroviral vectors, based on mpmv |
| US5288641A (en) | 1984-06-04 | 1994-02-22 | Arch Development Corporation | Herpes Simplex virus as a vector |
| US5288514A (en) | 1992-09-14 | 1994-02-22 | The Regents Of The University Of California | Solid phase and combinatorial synthesis of benzodiazepine compounds on a solid support |
| EP0612844A2 (en) | 1993-02-25 | 1994-08-31 | Ortho Pharmaceutical Corporation | Expression constructs containing HIV inhibitory antisense and other nucleotide sequences, retroviral vectors and recombinant retroviruses containing same |
| US5347075A (en) | 1987-05-01 | 1994-09-13 | Stratagene | Mutagenesis testing using transgenic non-human animals carrying test DNA sequences |
| US5359051A (en) | 1990-01-11 | 1994-10-25 | Isis Pharmaceuticals | Compounds useful in the synthesis of nucleic acids capable of cleaning RNA |
| WO1994026914A1 (fr) | 1993-05-18 | 1994-11-24 | Rhone-Poulenc Rorer S.A. | Vecteurs adenoviraux d'origine animale et utilisation en therapie genique |
| WO1995002566A1 (en) | 1993-07-16 | 1995-01-26 | Ontogen Corporation | Synthesis of combinatorial arrays of organic compounds through the use of multiple component combinatorial array syntheses |
| US5387742A (en) | 1990-06-15 | 1995-02-07 | Scios Nova Inc. | Transgenic mice displaying the amyloid-forming pathology of alzheimer's disease |
| WO1995004277A1 (en) | 1993-08-03 | 1995-02-09 | Sphinx Pharmaceuticals Corporation | A method for preparing and selecting pharmaceutically useful non-peptide compounds from a structurally diverse universal library |
| WO1995010607A1 (en) | 1993-10-14 | 1995-04-20 | The Regents Of The University Of California | Antisense oligonucleotide generators |
| WO1995013365A1 (en) | 1993-11-09 | 1995-05-18 | Targeted Genetics Corporation | Generation of high titers of recombinant aav vectors |
| WO1995016209A1 (en) | 1993-12-09 | 1995-06-15 | Ciba-Geigy Ag | Process for the production of combinatorial compound libraries |
| WO1995016918A1 (en) | 1993-12-15 | 1995-06-22 | Combichem, Inc. | Combinatorial libraries and methods for their use |
| WO1995016712A1 (en) | 1993-12-15 | 1995-06-22 | Smithkline Beecham Corporation | Compounds and methods |
| WO1995024186A1 (en) | 1994-03-11 | 1995-09-14 | Pharmacopeia, Inc. | Sulfonamide derivatives and their use |
| US5453492A (en) * | 1993-07-28 | 1995-09-26 | La Jolla Cancer Research Foundation | 60 kDa transforming growth factor-β-binding protein and its use to detect or purify TGF-β |
| US5463564A (en) | 1994-09-16 | 1995-10-31 | 3-Dimensional Pharmaceuticals, Inc. | System and method of automatically generating chemical compounds with desired properties |
| US5464764A (en) | 1989-08-22 | 1995-11-07 | University Of Utah Research Foundation | Positive-negative selection methods and vectors |
| WO1995030642A1 (en) | 1994-05-06 | 1995-11-16 | Pharmacopeia, Inc. | Combinatorial dihydrobenzopyran library |
| WO1996000148A1 (en) | 1994-06-23 | 1996-01-04 | Affymax Technologies N.V. | Methods for the solid phase synthesis of thiazolidinones, metathiazanones, and derivatives thereof |
| US5506337A (en) | 1985-03-15 | 1996-04-09 | Antivirals Inc. | Morpholino-subunit combinatorial library and method |
| US5780263A (en) | 1995-06-05 | 1998-07-14 | Human Genome Sciences, Inc. | Human CCN-like growth factor |
| US5811238A (en) | 1994-02-17 | 1998-09-22 | Affymax Technologies N.V. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
| US5837458A (en) | 1994-02-17 | 1998-11-17 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
| US5989912A (en) | 1996-11-21 | 1999-11-23 | Oligos Etc. Inc. | Three component chimeric antisense oligonucleotides |
Family Cites Families (93)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US649445A (en) * | 1899-08-31 | 1900-05-15 | James Alpheus Green | Steam-injector for fire-boxes of steam-boilers. |
| US4378110A (en) * | 1978-04-17 | 1983-03-29 | Greene Ronald W | Continuous paper sorting machine |
| US4427115A (en) * | 1981-10-19 | 1984-01-24 | Laipply Thomas C | One piece alcohol preparation device |
| US6054561A (en) * | 1984-02-08 | 2000-04-25 | Chiron Corporation | Antigen-binding sites of antibody molecules specific for cancer antigens |
| DE3417525C1 (de) * | 1984-05-11 | 1986-01-09 | Matter + Siegmann Ag, Wohlen | Vorrichtung zur quantitativen und qualitativen Erfassung von kohlenwasserstoffhaltigen Schwebeteilchen in Gasen |
| US5223409A (en) * | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5571714A (en) * | 1988-12-22 | 1996-11-05 | Celtrix Pharmaceuticals, Inc. | Monoclonal antibodies which bind both transforming growth factors β1 and β2 and methods of use |
| US5530101A (en) * | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5549910A (en) * | 1989-03-31 | 1996-08-27 | The Regents Of The University Of California | Preparation of liposome and lipid complex compositions |
| US5466468A (en) * | 1990-04-03 | 1995-11-14 | Ciba-Geigy Corporation | Parenterally administrable liposome formulation comprising synthetic lipids |
| GB9015198D0 (en) | 1990-07-10 | 1990-08-29 | Brien Caroline J O | Binding substance |
| JP3218637B2 (ja) * | 1990-07-26 | 2001-10-15 | 大正製薬株式会社 | 安定なリポソーム水懸濁液 |
| WO1992002551A1 (en) | 1990-08-02 | 1992-02-20 | B.R. Centre Limited | Methods for the production of proteins with a desired function |
| JP2958076B2 (ja) * | 1990-08-27 | 1999-10-06 | 株式会社ビタミン研究所 | 遺伝子導入用多重膜リポソーム及び遺伝子捕捉多重膜リポソーム製剤並びにその製法 |
| US5877397A (en) * | 1990-08-29 | 1999-03-02 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5698426A (en) * | 1990-09-28 | 1997-12-16 | Ixsys, Incorporated | Surface expression libraries of heteromeric receptors |
| JPH04141095A (ja) | 1990-10-02 | 1992-05-14 | Chemo Sero Therapeut Res Inst | 組換え抗hiv改変抗体および改変抗体の調製方法 |
| US5070108A (en) * | 1990-10-12 | 1991-12-03 | Trustees Of The University Of Pennsylvania | Methods of treating osteoporosis, increasing bone mineral content and preventing the occurrence of compression fractures in a mammal |
| US5145684A (en) * | 1991-01-25 | 1992-09-08 | Sterling Drug Inc. | Surface modified drug nanoparticles |
| US5399363A (en) * | 1991-01-25 | 1995-03-21 | Eastman Kodak Company | Surface modified anticancer nanoparticles |
| US6949505B1 (en) * | 1991-03-11 | 2005-09-27 | Curis, Inc. | Morphogen-induced dendritic growth |
| US5795965A (en) | 1991-04-25 | 1998-08-18 | Chugai Seiyaku Kabushiki Kaisha | Reshaped human to human interleukin-6 receptor |
| US5118667A (en) * | 1991-05-03 | 1992-06-02 | Celtrix Pharmaceuticals, Inc. | Bone growth factors and inhibitors of bone resorption for promoting bone formation |
| FR2688514A1 (fr) | 1992-03-16 | 1993-09-17 | Centre Nat Rech Scient | Adenovirus recombinants defectifs exprimant des cytokines et medicaments antitumoraux les contenant. |
| NZ267838A (en) * | 1993-06-07 | 1997-12-19 | Genentech Inc | Preparation of an hiv gp 120 subunit vaccine involving determining a neutralising epitope in the v2 and/or c4 domains |
| US5543158A (en) * | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
| ATE378407T1 (de) | 1994-04-29 | 2007-11-15 | Curis Inc | Morphogene protein-spezifische zelloberflächenrezeptoren und ihre verwendungen |
| DE4427221A1 (de) | 1994-08-01 | 1996-02-08 | Gsf Forschungszentrum Umwelt | Retrovirus-induzierte Osteoklasten-Modulation für die Osteoporose-Therapie |
| US5846770A (en) | 1994-11-22 | 1998-12-08 | Genetics Institute, Inc. | DNA molecules encoding human chordin |
| US6057421A (en) * | 1994-11-30 | 2000-05-02 | Immpheron, Inc. | Variable heavy and light chain regions of murine monoclonal antibody 1F7 |
| US5795587A (en) * | 1995-01-23 | 1998-08-18 | University Of Pittsburgh | Stable lipid-comprising drug delivery complexes and methods for their production |
| IE80468B1 (en) * | 1995-04-04 | 1998-07-29 | Elan Corp Plc | Controlled release biodegradable nanoparticles containing insulin |
| US5738868A (en) * | 1995-07-18 | 1998-04-14 | Lipogenics Ltd. | Liposome compositions and kits therefor |
| DE69738868D1 (de) * | 1996-05-22 | 2008-09-11 | Viventia Biotech Inc | Odieren, und deren verwendung zur vorbeugung und zum nachweis von krebs |
| US6133426A (en) * | 1997-02-21 | 2000-10-17 | Genentech, Inc. | Humanized anti-IL-8 monoclonal antibodies |
| US5989909A (en) | 1997-09-26 | 1999-11-23 | Millennium Biotherapeutics, Inc. | Huchordin and uses thereof |
| AU6959898A (en) * | 1997-04-11 | 1998-11-11 | David J. Grainger | Compounds and therapies for the prevention of vascular and non-vascular pathol ogies |
| JP4062551B2 (ja) * | 1997-04-29 | 2008-03-19 | リジェネロン ファーマシューティカルズ,インコーポレイテッド | ヒトケルベロスタンパク質 |
| EP0985039B1 (en) * | 1997-06-12 | 2008-02-20 | Novartis International Pharmaceutical Ltd. | Artificial antibody polypeptides |
| US6075007A (en) | 1997-07-17 | 2000-06-13 | Regeneron Pharmaceuticals, Inc. | Modified noggin polypeptide and compositions |
| AU8555798A (en) * | 1997-08-01 | 1999-02-22 | Genset | 5' ests for secreted proteins expressed in muscle and other mesodermal tissues |
| US6815201B2 (en) * | 1997-09-08 | 2004-11-09 | The Public Health Research Institute Of The City Of New York, Inc. | HIV-1 gp120 V1/V2 domain epitopes capable of generating neutralizing antibodies |
| US6544485B1 (en) * | 2001-01-29 | 2003-04-08 | Sharper Image Corporation | Electro-kinetic device with enhanced anti-microorganism capability |
| US20040009535A1 (en) * | 1998-11-27 | 2004-01-15 | Celltech R&D, Inc. | Compositions and methods for increasing bone mineralization |
| US6395511B1 (en) * | 1998-11-27 | 2002-05-28 | Darwin Discovery, Ltd. | Nucleic acids encoding a novel family of TGF-β binding proteins from humans |
| CA2361553A1 (en) | 1999-01-29 | 2000-08-03 | Zhenping Zhu | Antibodies specific to kdr and uses thereof |
| DE60042799D1 (de) | 1999-06-09 | 2009-10-01 | Genentech Inc | Methoden zur Diagnose von Tumoren |
| JP4141095B2 (ja) | 1999-10-29 | 2008-08-27 | 三洋電機株式会社 | 半導体装置とその製造方法 |
| JP2003525611A (ja) | 2000-03-02 | 2003-09-02 | アムジェン インコーポレーテッド | コルディン様−2分子およびその使用 |
| MXPA02011808A (es) * | 2000-06-01 | 2003-04-10 | Amgen Inc | Polipeptidos de nudos de cistinas: moleculas de polipeptidos encubierto-2 y usos de los mismos. |
| WO2001098491A2 (en) | 2000-06-19 | 2001-12-27 | F. Hoffmann-La Roche Ag | Osteolevin gene polymorphisms |
| CA2421056A1 (en) | 2000-09-01 | 2002-03-28 | Genentech, Inc. | A polypeptide for use as a diagnostic marker for the presence of colon tumours |
| IL155002A0 (en) | 2000-10-12 | 2003-10-31 | Genentech Inc | Reduced-viscosity concentrated protein formulations |
| US20030133939A1 (en) * | 2001-01-17 | 2003-07-17 | Genecraft, Inc. | Binding domain-immunoglobulin fusion proteins |
| CA2374027A1 (en) * | 2001-03-13 | 2002-09-13 | The Minister Of National Defence | Cloning, expression, sequencing, and functional enhancement of monoclonal scfv antibody against venezuelan equine encephalitis virus(vee) |
| DE10145772A1 (de) | 2001-09-17 | 2003-04-10 | Bayer Cropscience Ag | DELTA·1·-Pyrroline |
| CA2469025A1 (en) | 2001-12-06 | 2003-06-19 | Biocontrol Systems, Inc. | Sample collection and testing system |
| US20030186915A1 (en) * | 2002-02-11 | 2003-10-02 | Yang Pan | Regulatory polynucleotides and uses thereof |
| AU2003223214B2 (en) | 2002-03-01 | 2008-09-18 | Celltech R & D, Inc. | Methods to increase or decrease bone density |
| US7799523B2 (en) | 2002-04-03 | 2010-09-21 | Celltech R & D, Inc. | Association of polymorphisms in the SOST gene region with bone mineral density |
| FR2838379B1 (fr) | 2002-04-12 | 2005-06-24 | Valeo Climatisation | Dispositif de purification de l'air de l'habitacle d'un vehicule automobile |
| AU2003276430A1 (en) | 2002-06-14 | 2003-12-31 | Stowers Institute For Medical Research | Wise/sost nucleic acid sequences and amino acid sequences |
| US7893218B2 (en) | 2003-06-16 | 2011-02-22 | Stowers Institute For Medical Research | Antibodies that specifically bind SOST peptides |
| EP1572122A4 (en) | 2002-11-01 | 2008-04-09 | Us Gov Health & Human Serv | METHOD FOR PREVENTING INFECTIONS OF BIOTERRORISM AGENTS WITH IMMUNOSTIMULATING CPG OLIGONUCLEOTIDES |
| DE10255152A1 (de) | 2002-11-26 | 2004-06-03 | Von Langen Ursula Lang | Schadstoffsauger |
| US7642238B2 (en) | 2002-12-05 | 2010-01-05 | Shaughnessy John D | Molecular determinants of myeloma bone disease and uses thereof |
| US20040141875A1 (en) * | 2003-01-15 | 2004-07-22 | Rajiv Doshi | System and method for treating microorganisms within motor vehicle heating, ventilation, and air conditioning units |
| ES2379689T3 (es) | 2003-03-14 | 2012-04-30 | Ucb Manufacturing, Inc. A Company Incorporated Under The Laws Of The State Of Delaware | Complejo de esclerostina y nogina o cordina, y agentes que modulan la formación de dicho complejo |
| US20050158303A1 (en) | 2003-04-04 | 2005-07-21 | Genentech, Inc. | Methods of treating IgE-mediated disorders comprising the administration of high concentration anti-IgE antibody formulations |
| CU23403A1 (es) | 2003-04-23 | 2009-08-04 | Centro Inmunologia Molecular | Anticuerpos recombinantes y fragmentos que reconocen el gangliósido n-glicolil gm3 y su uso para diagnóstico y tratamiento de tumores |
| NZ544618A (en) | 2003-06-16 | 2009-02-28 | Celltech R & D Inc | Antibodies specific for sclerostin and methods for increasing bone mineralization |
| US8461155B2 (en) | 2003-09-22 | 2013-06-11 | University Of Connecticut | Sclerostin and the inhibition of WNT signaling and bone formation |
| US20050267233A1 (en) | 2004-05-25 | 2005-12-01 | Joshi Ashok V | Anti-microbial handle system |
| ES2414460T3 (es) | 2004-08-04 | 2013-07-19 | Amgen Inc. | Anticuerpos para Dkk-1 |
| US7592429B2 (en) | 2005-05-03 | 2009-09-22 | Ucb Sa | Sclerostin-binding antibody |
| US8003108B2 (en) | 2005-05-03 | 2011-08-23 | Amgen Inc. | Sclerostin epitopes |
| EP1981910B1 (en) | 2006-01-13 | 2013-06-26 | A Chan Holding B.V. | Method for identifying inhibitor of the glypican-sclerostin interaction |
| US20100036091A1 (en) | 2006-11-10 | 2010-02-11 | Amgen Inc. | Antibody-based diagnostics and therapeutics |
| EP2460828A3 (en) | 2006-11-10 | 2012-08-08 | UCB Pharma, S.A. | Antibodies and diagnostics |
| FI3345607T3 (fi) | 2006-12-29 | 2022-11-30 | Menetelmiä luun kasvun muuttamiseksi antamalla SOST- tai WISE-antagonistia tai antagonistia | |
| MX2009008096A (es) | 2007-02-02 | 2009-08-07 | Novartis Ag | Moduladores de los componentes de enlace de esclerostatina para el tratamiento de trastornos relacionados con los huesos. |
| MY149129A (en) | 2007-03-20 | 2013-07-15 | Lilly Co Eli | Anti-sclerostin antibodies |
| CL2008002775A1 (es) | 2007-09-17 | 2008-11-07 | Amgen Inc | Uso de un agente de unión a esclerostina para inhibir la resorción ósea. |
| TWI489993B (zh) | 2007-10-12 | 2015-07-01 | Novartis Ag | 骨硬化素(sclerostin)抗體組合物及使用方法 |
| ES2560532T3 (es) | 2007-11-02 | 2016-02-19 | Novartis Ag | Moléculas y métodos de modulación de la proteína 6 relacionada con el receptor de lipoproteína de baja densidad (LRP6) |
| BRPI0819688A2 (pt) | 2007-12-14 | 2015-06-16 | Amgen Inc | Processo para tratamento de fratura óssea com anticorpos anti-esclerostina. |
| SG191639A1 (en) | 2008-06-03 | 2013-07-31 | Abbott Lab | Dual variable domain immunoglobulins and uses thereof |
| WO2010100179A2 (en) | 2009-03-05 | 2010-09-10 | Novartis Ag | Self-forming gel system for sustained drug delivery |
| WO2010100200A2 (en) | 2009-03-05 | 2010-09-10 | Novartis Ag | Lyophilised antibody formulation |
| WO2010115932A1 (en) | 2009-04-08 | 2010-10-14 | Novartis Ag | Combination for the treatment of bone loss |
| WO2010130830A2 (en) | 2009-05-15 | 2010-11-18 | Ablynx N.V. | Amino acid sequences directed against sclerostin and polypeptides comprising the same for the treatment of bone diseases and disorders |
| WO2012028683A1 (en) | 2010-09-02 | 2012-03-08 | Novartis Ag | Antibody gel system for sustained drug delivery |
| TWI636993B (zh) | 2010-10-27 | 2018-10-01 | 安美基公司 | Dkk1抗體及使用方法 |
-
1999
- 1999-11-24 US US09/449,218 patent/US6395511B1/en not_active Expired - Lifetime
- 1999-11-24 ES ES10008049.8T patent/ES2639020T3/es not_active Expired - Lifetime
- 1999-11-24 JP JP2000585404A patent/JP4813660B2/ja not_active Expired - Lifetime
- 1999-11-24 AT AT06011535T patent/ATE481487T1/de active
- 1999-11-24 AT AT99963986T patent/ATE338120T2/de active
- 1999-11-24 CA CA2352532A patent/CA2352532C/en not_active Expired - Lifetime
- 1999-11-24 NZ NZ552959A patent/NZ552959A/en not_active IP Right Cessation
- 1999-11-24 EP EP06011535A patent/EP1721979B1/en not_active Revoked
- 1999-11-24 ES ES06011535T patent/ES2350454T3/es not_active Expired - Lifetime
- 1999-11-24 CN CN2008100992340A patent/CN101469329B/zh not_active Expired - Lifetime
- 1999-11-24 WO PCT/US1999/027990 patent/WO2000032773A1/en not_active Ceased
- 1999-11-24 EP EP10008049.8A patent/EP2261335B1/en not_active Expired - Lifetime
- 1999-11-24 EP EP99963986.7A patent/EP1133558B2/en not_active Expired - Lifetime
- 1999-11-24 PT PT06011535T patent/PT1721979E/pt unknown
- 1999-11-24 DE DE69933044.0T patent/DE69933044T3/de not_active Expired - Lifetime
- 1999-11-24 IL IL14326699A patent/IL143266A0/xx active IP Right Grant
- 1999-11-24 DK DK06011535.9T patent/DK1721979T3/da active
- 1999-11-24 CN CN99815505.5A patent/CN1333828B/zh not_active Expired - Lifetime
- 1999-11-24 ES ES99963986.7T patent/ES2272093T5/es not_active Expired - Lifetime
- 1999-11-24 PT PT100080498T patent/PT2261335T/pt unknown
- 1999-11-24 PT PT99963986T patent/PT1133558E/pt unknown
- 1999-11-24 DK DK99963986.7T patent/DK1133558T4/en active
- 1999-11-24 DE DE69942782T patent/DE69942782D1/de not_active Expired - Lifetime
- 1999-11-24 NZ NZ568033A patent/NZ568033A/en not_active IP Right Cessation
- 1999-11-24 BR BRPI9915679A patent/BRPI9915679B8/pt not_active IP Right Cessation
- 1999-11-24 MX MX2013001685A patent/MX343200B/es unknown
- 1999-11-24 DK DK10008049.8T patent/DK2261335T3/en active
- 1999-11-24 HK HK02105515.3A patent/HK1044171B/zh not_active IP Right Cessation
- 1999-11-24 NZ NZ512122A patent/NZ512122A/en not_active IP Right Cessation
- 1999-11-24 MX MXPA01005275A patent/MXPA01005275A/es active IP Right Grant
-
2000
- 2000-09-21 US US09/668,037 patent/US6495736B1/en not_active Expired - Lifetime
- 2000-09-21 US US09/668,021 patent/US6803453B1/en not_active Expired - Lifetime
- 2000-09-21 US US09/668,529 patent/US6489445B1/en not_active Expired - Lifetime
-
2001
- 2001-05-21 IL IL143266A patent/IL143266A/en not_active IP Right Cessation
- 2001-05-23 ZA ZA200104234A patent/ZA200104234B/en unknown
-
2002
- 2002-03-07 US US10/095,248 patent/US7572899B2/en not_active Expired - Fee Related
-
2003
- 2003-03-06 US US10/384,893 patent/US7192583B2/en not_active Expired - Lifetime
-
2004
- 2004-02-27 US US10/788,606 patent/US7758858B2/en not_active Expired - Fee Related
-
2006
- 2006-11-09 CY CY20061101623T patent/CY1106260T1/el unknown
-
2007
- 2007-10-31 US US11/931,812 patent/US7977312B2/en not_active Expired - Fee Related
- 2007-10-31 US US11/931,853 patent/US20110150866A1/en not_active Abandoned
- 2007-10-31 US US11/931,768 patent/US7994299B2/en not_active Expired - Fee Related
-
2010
- 2010-12-10 CY CY20101101148T patent/CY1110982T1/el unknown
- 2010-12-30 IL IL210392A patent/IL210392A/en not_active IP Right Cessation
-
2011
- 2011-06-30 JP JP2011145326A patent/JP5691036B2/ja not_active Expired - Lifetime
-
2012
- 2012-10-04 US US13/644,728 patent/US8986685B2/en not_active Expired - Fee Related
-
2015
- 2015-02-19 US US14/626,274 patent/US9791462B2/en not_active Expired - Fee Related
-
2017
- 2017-08-30 CY CY20171100914T patent/CY1119263T1/el unknown
Patent Citations (86)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4018884A (en) | 1975-06-26 | 1977-04-19 | Hoffmann-La Roche Inc. | Fluorogenic materials and labeling techniques |
| US4704362A (en) | 1977-11-08 | 1987-11-03 | Genentech, Inc. | Recombinant cloning vehicle microbial polypeptide expression |
| US4528266A (en) | 1979-10-01 | 1985-07-09 | George Pieczenik | Method of inserting unique DNA sequences into DNA vectors |
| US4359535A (en) | 1979-10-01 | 1982-11-16 | George Pieczenik | Autonomously replicating DNA containing inserted DNA sequences |
| US4399216A (en) | 1980-02-25 | 1983-08-16 | The Trustees Of Columbia University | Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials |
| US4331647A (en) | 1980-03-03 | 1982-05-25 | Goldenberg Milton David | Tumor localization and therapy with labeled antibody fragments specific to tumor-associated markers |
| US4486530A (en) | 1980-08-04 | 1984-12-04 | Hybritech Incorporated | Immunometric assays using monoclonal antibodies |
| US4376110A (en) | 1980-08-04 | 1983-03-08 | Hybritech, Incorporated | Immunometric assays using monoclonal antibodies |
| US4411993A (en) | 1981-04-29 | 1983-10-25 | Steven Gillis | Hybridoma antibody which inhibits interleukin 2 activity |
| US4873191A (en) | 1981-06-12 | 1989-10-10 | Ohio University | Genetic transformation of zygotes |
| US4579821A (en) | 1981-11-23 | 1986-04-01 | University Patents, Inc. | Control of DNA sequence transcription |
| USRE32011E (en) | 1981-12-14 | 1985-10-22 | Scripps Clinic And Research Foundation | Ultrapurification of factor VIII using monoclonal antibodies |
| US4766075A (en) | 1982-07-14 | 1988-08-23 | Genentech, Inc. | Human tissue plasminogen activator |
| US4543439A (en) | 1982-12-13 | 1985-09-24 | Massachusetts Institute Of Technology | Production and use of monoclonal antibodies to phosphotyrosine-containing proteins |
| US5288641A (en) | 1984-06-04 | 1994-02-22 | Arch Development Corporation | Herpes Simplex virus as a vector |
| US4736866A (en) | 1984-06-22 | 1988-04-12 | President And Fellows Of Harvard College | Transgenic non-human mammals |
| US5087571A (en) | 1984-06-22 | 1992-02-11 | President And Fellows Of Harvard College | Method for providing a cell culture from a transgenic non-human mammal |
| US4736866B1 (en) | 1984-06-22 | 1988-04-12 | Transgenic non-human mammals | |
| US4801542A (en) | 1984-10-12 | 1989-01-31 | Zymogenetics, Inc. | Expression of biologically active PDGF analogs in eucaryotic cells |
| ZA858794B (en) | 1984-11-16 | 1986-07-30 | American Cyanamid Co | Antitumor antibiotics(ll-e33288 complex) |
| US4902614A (en) | 1984-12-03 | 1990-02-20 | Teijin Limited | Monoclonal antibody to human protein C |
| US4897255A (en) | 1985-01-14 | 1990-01-30 | Neorx Corporation | Metal radionuclide labeled proteins for diagnosis and therapy |
| US5506337A (en) | 1985-03-15 | 1996-04-09 | Antivirals Inc. | Morpholino-subunit combinatorial library and method |
| US4784950A (en) | 1985-04-17 | 1988-11-15 | Zymogenetics, Inc. | Expression of factor VII activity in mammalian cells |
| US4959317A (en) | 1985-10-07 | 1990-09-25 | E. I. Du Pont De Nemours And Company | Site-specific recombination of DNA in eukaryotic cells |
| US4744981A (en) | 1985-10-17 | 1988-05-17 | Neorx Corporation | Trichothecene antibody conjugates |
| US4935349A (en) | 1986-01-17 | 1990-06-19 | Zymogenetics, Inc. | Expression of higher eucaryotic genes in aspergillus |
| US4987071A (en) | 1986-12-03 | 1991-01-22 | University Patents, Inc. | RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods |
| US4851341A (en) | 1986-12-19 | 1989-07-25 | Immunex Corporation | Immunoaffinity purification system |
| US5219740A (en) | 1987-02-13 | 1993-06-15 | Fred Hutchinson Cancer Research Center | Retroviral gene transfer into diploid fibroblasts for gene therapy |
| US5347075A (en) | 1987-05-01 | 1994-09-13 | Stratagene | Mutagenesis testing using transgenic non-human animals carrying test DNA sequences |
| WO1989001476A1 (en) | 1987-08-12 | 1989-02-23 | Celltech Limited | Tetra-aza macrocycles and metal complexes thereof |
| ZA888127B (en) | 1987-10-30 | 1989-07-26 | American Cyanamid Co | Targeted forms of methyltrithio antitumor agents |
| US5254678A (en) | 1987-12-15 | 1993-10-19 | Gene Shears Pty. Limited | Ribozymes |
| US5106951A (en) | 1988-02-19 | 1992-04-21 | Neorx Corporation | Antibody conjugates |
| US4988496A (en) | 1988-05-31 | 1991-01-29 | Neorx Corporation | Metal radionuclide chelating compounds for improved chelation kinetics |
| US5221778A (en) | 1988-08-24 | 1993-06-22 | Yale University | Multiplex gene regulation |
| WO1990002809A1 (en) | 1988-09-02 | 1990-03-22 | Protein Engineering Corporation | Generation and selection of recombinant varied binding proteins |
| EP0360257A2 (en) | 1988-09-20 | 1990-03-28 | The Board Of Regents For Northern Illinois University | RNA catalyst for cleaving specific RNA sequences |
| US5175384A (en) | 1988-12-05 | 1992-12-29 | Genpharm International | Transgenic mice depleted in mature t-cells and methods for making transgenic mice |
| WO1990007862A2 (en) | 1989-01-06 | 1990-07-26 | Protein Engineering Corporation | Generation and selection of novel dna-binding proteins and polypeptides |
| WO1990007936A1 (en) | 1989-01-23 | 1990-07-26 | Chiron Corporation | Recombinant therapies for infection and hyperproliferative disorders |
| WO1990009195A1 (en) | 1989-02-10 | 1990-08-23 | Celltech Limited | Cross-linked antibodies and processes for their preparation |
| US5175383A (en) | 1989-02-17 | 1992-12-29 | President And Fellows Of Harvard College | Animal model for benign prostatic disease |
| ZA902839B (en) | 1989-04-14 | 1991-12-24 | American Cyanamid Co | N-acyl derivatives of the ll-e33288 antitumor antibiotics |
| WO1991000285A1 (en) | 1989-06-23 | 1991-01-10 | Celltech Limited | Tri-aza macrocycles and processes for their preparation |
| WO1991002805A2 (en) | 1989-08-18 | 1991-03-07 | Viagene, Inc. | Recombinant retroviruses delivering vector constructs to target cells |
| US5464764A (en) | 1989-08-22 | 1995-11-07 | University Of Utah Research Foundation | Positive-negative selection methods and vectors |
| EP0415731A2 (en) | 1989-08-30 | 1991-03-06 | The Wellcome Foundation Limited | Novel entities for cancer therapy |
| WO1991009967A1 (en) | 1989-12-21 | 1991-07-11 | Celltech Limited | Humanised antibodies |
| US5359051A (en) | 1990-01-11 | 1994-10-25 | Isis Pharmaceuticals | Compounds useful in the synthesis of nucleic acids capable of cleaning RNA |
| WO1991011465A1 (en) | 1990-01-26 | 1991-08-08 | Immunomedics, Inc. | Vaccines against cancer and infectious diseases |
| WO1991013152A1 (en) * | 1990-02-27 | 1991-09-05 | Ludwig Institute For Cancer Research | SUBSTANTIALLY PURE TRANSFORMING GROWTH FACTOR-β1-BINDING PROTEIN AND NUCLEOTIDE SEQUENCES EXPRESSING THE BINDING PROTEIN |
| US5387742A (en) | 1990-06-15 | 1995-02-07 | Scios Nova Inc. | Transgenic mice displaying the amyloid-forming pathology of alzheimer's disease |
| WO1992006693A1 (en) | 1990-10-22 | 1992-04-30 | Fox Chase Cancer Center | Dna construct for providing rna therapy |
| WO1992015679A1 (en) | 1991-03-01 | 1992-09-17 | Protein Engineering Corporation | Improved epitode displaying phage |
| WO1992015677A1 (en) | 1991-03-01 | 1992-09-17 | Protein Engineering Corporation | Process for the development of binding mini-proteins |
| WO1992022583A2 (en) | 1991-06-11 | 1992-12-23 | Celltech Limited | Tri- and tetra-valent monospecific antigen-binding proteins |
| WO1993006231A1 (en) | 1991-09-26 | 1993-04-01 | Celltech Limited | Anti-human milk fat globule humanised antibodies |
| WO1993009191A1 (en) | 1991-10-29 | 1993-05-13 | E.I. Du Pont De Nemours And Company | Process for cathodic electrodeposition of a clear coating over a conductive paint layer |
| WO1993010218A1 (en) | 1991-11-14 | 1993-05-27 | The United States Government As Represented By The Secretary Of The Department Of Health And Human Services | Vectors including foreign genes and negative selective markers |
| WO1993011230A1 (en) | 1991-12-02 | 1993-06-10 | Dynal As | Modified mammalian stem cell blocking viral replication |
| WO1993020242A1 (en) | 1992-03-30 | 1993-10-14 | The Scripps Research Institute | Encoded combinatorial chemical libraries |
| WO1993025234A1 (en) | 1992-06-08 | 1993-12-23 | The Regents Of The University Of California | Methods and compositions for targeting specific tissue |
| WO1993025698A1 (en) | 1992-06-10 | 1993-12-23 | The United States Government As Represented By The | Vector particles resistant to inactivation by human serum |
| WO1994003622A1 (en) | 1992-07-31 | 1994-02-17 | Imperial College Of Science, Technology & Medicine | D-type retroviral vectors, based on mpmv |
| US5288514A (en) | 1992-09-14 | 1994-02-22 | The Regents Of The University Of California | Solid phase and combinatorial synthesis of benzodiazepine compounds on a solid support |
| EP0612844A2 (en) | 1993-02-25 | 1994-08-31 | Ortho Pharmaceutical Corporation | Expression constructs containing HIV inhibitory antisense and other nucleotide sequences, retroviral vectors and recombinant retroviruses containing same |
| WO1994026914A1 (fr) | 1993-05-18 | 1994-11-24 | Rhone-Poulenc Rorer S.A. | Vecteurs adenoviraux d'origine animale et utilisation en therapie genique |
| WO1995002566A1 (en) | 1993-07-16 | 1995-01-26 | Ontogen Corporation | Synthesis of combinatorial arrays of organic compounds through the use of multiple component combinatorial array syntheses |
| US5453492A (en) * | 1993-07-28 | 1995-09-26 | La Jolla Cancer Research Foundation | 60 kDa transforming growth factor-β-binding protein and its use to detect or purify TGF-β |
| WO1995004277A1 (en) | 1993-08-03 | 1995-02-09 | Sphinx Pharmaceuticals Corporation | A method for preparing and selecting pharmaceutically useful non-peptide compounds from a structurally diverse universal library |
| WO1995010607A1 (en) | 1993-10-14 | 1995-04-20 | The Regents Of The University Of California | Antisense oligonucleotide generators |
| WO1995013365A1 (en) | 1993-11-09 | 1995-05-18 | Targeted Genetics Corporation | Generation of high titers of recombinant aav vectors |
| WO1995016209A1 (en) | 1993-12-09 | 1995-06-15 | Ciba-Geigy Ag | Process for the production of combinatorial compound libraries |
| WO1995016712A1 (en) | 1993-12-15 | 1995-06-22 | Smithkline Beecham Corporation | Compounds and methods |
| WO1995016918A1 (en) | 1993-12-15 | 1995-06-22 | Combichem, Inc. | Combinatorial libraries and methods for their use |
| US5811238A (en) | 1994-02-17 | 1998-09-22 | Affymax Technologies N.V. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
| US5837458A (en) | 1994-02-17 | 1998-11-17 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
| US5830721A (en) | 1994-02-17 | 1998-11-03 | Affymax Technologies N.V. | DNA mutagenesis by random fragmentation and reassembly |
| WO1995024186A1 (en) | 1994-03-11 | 1995-09-14 | Pharmacopeia, Inc. | Sulfonamide derivatives and their use |
| WO1995030642A1 (en) | 1994-05-06 | 1995-11-16 | Pharmacopeia, Inc. | Combinatorial dihydrobenzopyran library |
| WO1996000148A1 (en) | 1994-06-23 | 1996-01-04 | Affymax Technologies N.V. | Methods for the solid phase synthesis of thiazolidinones, metathiazanones, and derivatives thereof |
| US5463564A (en) | 1994-09-16 | 1995-10-31 | 3-Dimensional Pharmaceuticals, Inc. | System and method of automatically generating chemical compounds with desired properties |
| US5780263A (en) | 1995-06-05 | 1998-07-14 | Human Genome Sciences, Inc. | Human CCN-like growth factor |
| US5989912A (en) | 1996-11-21 | 1999-11-23 | Oligos Etc. Inc. | Three component chimeric antisense oligonucleotides |
Non-Patent Citations (194)
| Title |
|---|
| "Harrison's Principles of Internal Medicine", MCGRAW-HILL, INC. |
| ACSADI ET AL., NATURE, vol. 352, 1991, pages 815 - 818 |
| ADANG ET AL., PLANT MOLEC. BIOL., vol. 21, 1993, pages 1131 |
| ALBER; KAWASAKI, J. MOL. APPL. GENET., vol. 1, 1982, pages 419 - 434 |
| AMMERER, MELH. ENZYMOL., vol. 101, 1983, pages 192 - 201 |
| ATKINSON ET AL., PESTIE. SCI., vol. 28, 1990, pages 215 - 224 |
| AUSUBEL AND BY MURRAY: "Gene Transfer and Expression Protocols", 1991, HUMANA PRESS |
| AUSUBEL ET AL.: "Current Protocols in Mulecular Biology", 1987, JOHN WILEY AND SONS, INC. |
| AUSUBEL ET AL.: "MOLECULAR BIOLOGY OF THE GENE", 1995 |
| AUSUBEL ET AL.: "Short Protocols in Molecular Biology.. 3rd Edition,", 1995, JOHN WILEY & SONS, pages: 4-1 - 4-6 |
| AUSUBEL: "Baculovirus Expression Protocols", 1995, THE HUMANA PRESS, INC., pages: 16 - 37,16-57 |
| BAILEY ET AL.: "Methods in Molecular Biology, Volume 7: Gene Transfer and Expression Protocols", 1991, THE HUMANA PRESS, INC., article "Manipulation of Baculovirus Vectors", pages: 147 - 168 |
| BAINES ET AL.: "Methods in Molecular Biology", vol. 10, 1992, THE HUMANA PRESS, INC., article "Purification of Immunoglobulin G (IgG", pages: 79 - 104 |
| BAMBOT ET AL., PCR METHODS AND APPLICATIONS, vol. 2, 1993, pages 266 |
| BAUER ET AL., GENE, vol. 37, 1985, pages 73 |
| BEGGS, NATURE, vol. 275, 1978, pages 104 - 108 |
| BENOIST ET AL., NATURE, vol. 290, 1981, pages 304 |
| BERGMAN ET AL., PROC. NALL. ACAD SCI. USA, vol. 81, 1983, pages 7041 - 7045 |
| BIRD ET AL., SCIENCE, vol. 2-12, 1988, pages 423 - 426 |
| BIRREN ET AL.: "Homo sapiens chromosome 17, clone HRPC905N1, complete sequence", EMBL SEQUENCE DATABASE, 14 November 1997 (1997-11-14), HEIDELBERG DE, XP002133385 * |
| BISHOP: "Guide to Human Genome Computing, 2nd Edition", 1998, ACADEMIC PRESS, INC. |
| BOLIVAR ET AL., GENE, vol. 2, 1977, pages 95 |
| BONALDO ET AL.: "Normalization and substraction: two approches to faciliate gene discovery", EMBL SEQUENCE DATABASE, 4 September 1998 (1998-09-04), HEIDELBERG DE, XP002133484 * |
| BONALDO ET AL.: "Normalization and substraction: two approches to faciliate gene discovery", GENOME RES, vol. 6, no. 9, 1996, pages 791 - 806 * |
| BOSHART ET AL., CELL, vol. 41, 1985, pages 521 - 530 |
| BOTSTEIN ET AL., GENE, vol. 8, 1979, pages 17 |
| BRINSTER ET AL., PROC. NAIL. ACAD SCI. USA, vol. 82, 1985, pages 4438 - 4442 |
| BROACH ET AL., GENE, vol. 8, 1979, pages 121 - 133 |
| BROWN: "Molecular Biology Lahfax", 1991, ACADEMIC PRESS |
| CAILLAUD ET AL., EUR. J. NEUROSCI., vol. 5, no. 10, 1993, pages 1287 - 1291 |
| CHANG ET AL., NATURE, vol. 275, 1978, pages 615 |
| CHISWELL, D J; MCCAFFERTY, J., TIBTECH, vol. 10, 1992, pages 80 - 84 |
| COLIGAN ET AL.: "Current Protocols in Immunology", vol. 1, 1991, JOHN WILEY & SONS, pages: 2.5.1 - 2.6.7 |
| COMIER, C., CURR. OPIII. ILL RHEIT., vol. 7, 1995, pages 243 |
| COMIER, C., CURR. OPIN. IN RHEU., vol. 7, 1995, pages 243 |
| CONTENT ET AL.: "Biological Interferon Systems, Proceedings of ISIR-TNO Meeting on Interferon Systems", 1987, article "Expression and preliminary deletion analysis of the 42 kDa 2-5A synthetase induced by human interferon", pages: 65 - 72 |
| CORSARO; PEARSON, SOMATIC CELL GENETICS, vol. 7, 1981, pages 603 |
| COUMAILLEAU ET AL., J. BIUL. CHEM., vol. 270, 1995, pages 29270 |
| COURTENAY-LUCK ET AL.: "Monoclonal Antibodies: Production, Engineering and Clinical Application", 1995, CAMBRIDGE UNIVERSITY PRESS, article "Genetic Manipulation of Monoclonal Antibodies", pages: 166 |
| CRAIK, BIOTECHNIQUES, January 1985 (1985-01-01), pages 12 - 19 |
| CRISTANO ET AL., PNAS, 1993, pages 92122 - 92126 |
| CULLEN ET AL., BIO/TECHNOLOGY, vol. 5, 1987, pages 369 |
| CURIEL ET AL., HUM. GEIIE THER., vol. 3, no. 2, 1992, pages 147 - 154 |
| CZAKO; MARTON, PLANT PHYSIOL., vol. 104, 1994, pages 1067 - 1071 |
| DENOTO ET AL., NUC. ACIDS RES., vol. 9, 1981, pages 3719 - 3730 |
| DILLON ET AL.: "Methods in Molecular Biology, Vol 15: PCR Protocols: Current Methods and Applications", vol. 15, 1993, HUMANA PRESS, INC., article "Use of the Polymerase Chain Reaction for the Rapid Construction of Synthetic Genes", pages: 263 - 268 |
| DRINKWATER; KLINEDINST, PNAS, vol. 83, 1986, pages 3402 - 3406 |
| DURHAM ET AL., ENDO., vol. L3G, pages 1374 - 1380 |
| EDELMAN ET AL.: "Methods in Enzymology", vol. 1, 1967, ACADEMIC PRESS, pages: 422 |
| ELVIN ET AL., GENE, vol. 87, 1990, pages 123 - 126 |
| ETCHEVERRY ET AL.: "Protein Engineering: Principles and Practice", 1996, JOHN WILEY & SONS, INC., article "Expression of Engineered Proteins in Mammalian Cell Culture", pages: 163 - 181 |
| ETCHEVERRY ET AL.: "Protein Engineering: Principles and Practice", 1996, WILEY-LISS, INC., article "Expression of Engineered Proteins in Mammalian Cell Culture", pages: 163 |
| F.M. AUSUBEL ET AL., CURRENT PROTOCOLS IN MOL BIOL., vol. 2, 1998, pages 11.2.1 - 11.2.22 |
| FELGNER ET AL., PROC. NATL. ACAD SCI. USA, vol. 84, 1989, pages 7413 - 7417 |
| FLOTTE ET AL., PNAS, vol. 90, no. 22, 1993, pages 10613 - 10617 |
| FOECKING ET AL., GENE, vol. 45, 1980, pages 101 |
| FORSTER; SYMONS, CELL, vol. 48, 1987, pages 211 - 220 |
| FUKUNAGA ET AL., BIOL. CHEM., vol. 270, 1995, pages 25291 |
| G.W. MELLOR ET AL., J OF BIOMOL SCREENING, vol. 3, no. 2, 1998, pages 91 - 99 |
| GEORGIOU ET AL.: "Protein Engineering: Principles and Practice", 1996, JOHN WILEY & SONS, INC., article "Expression of Proteins in Bacteria", pages: 101 |
| GLASKY; READING, HYHRIDOMA, vol. 8, no. 4, 1989, pages 377 - 389 |
| GLICK, J. IND. MICROBIOL., vol. 1, 1987, pages 277 |
| GORMAN ET AL., PROC. NAT'L ACAD SCI. USA, vol. 79, 1981, pages 6777 |
| GRAHAM; VAN DER EB, VIROLOGY, vol. 52, 1973, pages 456 |
| GRANT ET AL., NUCL. ACIDS RES., vol. 15, 1987, pages 5496 |
| GREEN ET AL., NATURE GENET., vol. 7, 1994, pages 13 |
| GREEN ET AL.: "Immunochemical Protocols", 1992, HUMANA PRESS, article "Production of Polyclonal Antisera", pages: 1 - 5 |
| GRISSHAMMER ET AL.: "DNA Cloning 2: Expression Systems", 1995, OXFORD UNIVERSITY PRESS, article "Purification of over-produced proteins from E. coli cells", pages: 59 - 92 |
| GUINNESS-HEY, METAB. BONE DIS. AND REL. RES., vol. 5, 1984, pages 177 - 181 |
| GUZMAN ET AL., CIR. RES., vol. 73, no. 6, 1993, pages 1202 - 1207 |
| GUZMAN ET AL., CIRCULATION, vol. 88, no. 6, 1993, pages 2838 - 48 |
| HAMER ET AL., J. MOLEC. APPL. GENET., vol. 1, 1982, pages 273 |
| HAMMER ET AL., NATURE, vol. 315, 1985, pages 680 - 683 |
| HANSEN, H. G.; SKLEROSTEOSE.LN; OPITZ, H.; SCHMID, F.: "Handbuch der Kinderheilkunde.", vol. 6, 1967, SPRINGER, pages: 351 - 355 |
| HANSEN, H. G.; SKLEROSTEOSE: "Handbuch der Kinderheilkunde", vol. 6, 1967, SPRINGER, pages: 351 - 355 |
| HARDY: "DNA Cloning: A Practical Approach", 1985, IRL PRESS, article "Bacillus Cloning Methods" |
| HARLOW AND LANE: "Antibodies: A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY PRESS |
| HASELOFF; GERLACH, NATURE, vol. 328, 1988, pages 596 - 600 |
| HASELOFF; GERLACH, NATURE, vol. 334, 1988, pages 585 |
| HERSCHMAN ET AL.: "Control of Animal Cell Proliferation.", vol. 1, 1985, ACADEMIC PRESS, article "The EGF Receptor", pages: 169 - 199 |
| HILLIER ET AL.: "WshU-Merck EST Project 1997", EMBL SEQUENCE DATABASE, 19 May 1997 (1997-05-19), HEIDELBERG DE, XP002133386 * |
| HINNEN ET AL., PNAS USA, vol. 75, 1978, pages 1929 |
| HINNEN ET AL., PROC. NATL. ACAD SCI. USA, vol. 75, 1978, pages 1929 - 1933 |
| HIRASHIMA ET AL.: "Molecular Biology of RNA: New Perspectives", 1987, ACADEMIC PRESS, pages: 401 |
| HITZEMAN ET AL., J. BIOL. CHEM., vol. 255, 1980, pages 12073 - 12080 |
| HOESS ET AL., PNAS USA, vol. 79, pages 3398 |
| HOLOWACHUK ET AL., PCR METHODV APPL., vol. 4, 1995, pages 299 |
| HOPP ET AL., BIO/TECHNOLOGY, vol. 6, 1988, pages 1204 |
| HORWITZ ET AL., GENOME, vol. 3, 1989, pages 112 - 117 |
| HSU D R ET AL: "The Xenopus dorsalizing factor Gremlin identifies a novel family of secretes proteins that antagonize BMP activities", MOLECULAR CELL,US,CELL PRESS, CAMBRIDGE, MA, vol. 1, no. 5, April 1998 (1998-04-01), pages 673 - 683, XP002113640, ISSN: 1097-2765 * |
| HSU, D.R.; ECONOMIDES, A.N.; WANG, X.; EIMON, P.M.; HARLAND, R.M.: "The Xenopus Dorsalizing Factor Gremlin Identifies a Novel Family of Secreted Proteins that Antagonize BMP Activities", MOLECULAR CELL, vol. 1, 1998, pages 673 - 683 |
| HUYNH ET AL.: "DNA Cloning: A Practical Approach", vol. I, 1985, IRL PRESS, article "Constructing and Screening cDNA Libraries in ?gt10 and ?gt11", pages: 49 |
| INMAN: "Affinity Techniques. Enzyme Purification: Part B", vol. 34, 1974, ACADEMIC PRESS, article "Method< In Enzymology", pages: 30 |
| ITOH ET AL., BACTERIOLOGY, vol. 153, 1983, pages 163 |
| J.S. COHEN,: "Oligonucleotides: Antisense Inhihitors of Gene Expression", 1989, MACMILLAN PRESS |
| JAFFE ET AL., NAT. GENET., vol. 1, no. 5, 1992, pages 372 - 378 |
| KASS-EISLER ET AL., PNAS, vol. 90, no. 24, 1993, pages 11498 - 502 |
| KAUFMAN ET AL., NUCL. ACIDS RES., vol. 19, 1991, pages 4485 |
| KHOSLA; RIGSS, AFAYO CLIN. PROC., vol. 70, 1995, pages 978 - 982 |
| KOERING ET AL., HUM. GENE THERAP., vol. 5, 1994, pages 457 - 463 |
| KOHLER ET AL., NATURE, vol. 256, 1975, pages 495 |
| KOLLS ET AL., PNAS, vol. 91, no. 1, 1994, pages 215 - 219 |
| KRAMER ET AL., NUCL. ACIDS RES., vol. J2, 1984, pages 9441 |
| KYTE; DOOLITTLE, J. MOL. BIOL., vol. 157, 1982, pages 105 - 132 |
| L. SASTRY ET AL.: "Cloning of the Immunological Repertoire in Escherichia coli for Generation of Monoclonal Catalytic Antibodies: Construction of a Heavy Chain Variable Region-Specific cDNA Library", PROC. NATL. ACAD SCI. USA, vol. 86, August 1989 (1989-08-01), pages 5728 - 5732 |
| LARRICK ET AL., METHODS: A COMPANION TO METHODS IN ENZYMOLOGY, vol. 2, 1991, pages 106 |
| LEVRERO ET AL., GENE, vol. 101, no. 2, 1991, pages 195 - 202 |
| LI ET AL., HUM GENE THER., vol. 4, no. 4, 1993, pages 403 - 409 |
| LIAO; WISE, GENE, vol. 88, 1990, pages 107 - 111 |
| LOH, CELL, vol. 33, 1983, pages 85 - 93 |
| LONBERG ET AL., NATURE, vol. 368, 1994, pages 856 |
| LOOK, G.C. ET AL.: "The Indentification of Cyclooxygenase-I Inhibitors from 4-Thiazolidinone Combinatorial Libraries", BIOORG AND MED CHEM. LETTERS, vol. 6, 1996, pages 707 - 12 |
| LOSMAN ET AL., INT. J. CANCER, vol. 46, 1990, pages 310 |
| LUCKNOW ET AL.: "Protein Engineering: Principles and Practice", 1996, JOHN WILEY & SONS, INC., article "Insect Cell Expression Technology", pages: 183 - 218 |
| LYONS ET AL., L. CELL BIOL., vol. 111, 1990, pages 2427 - 2436 |
| MAMMALIAN: "Cell Technology", BUTTERWORTH PUBLISHERS |
| MANIATIS ET AL.: "Molecular Cloning", 1989, COLD SPRING HARBOR LABORATORY |
| MARGOLIS ET AL.: "DNA Cloning 2: Expression Systems, 2nd Edition,", 1995, OXFORD UNIVERSITY PRESS, article "Screening A expression libraries with antibody and protein probes", pages: 1 - 14 |
| MCKEARN, AND BECHTOL: "Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses", 1980, PLENUM PRESS |
| MCKNIGHT ET AL., EMBO J., 1985 |
| MCKNIGHT ET AL., EMBO J., vol. 4, 1985, pages 2093 - 2099 |
| MCKNIGHT, CELL, vol. 31, 1982, pages 355 |
| MCPHERSON: "Directed mutagenesis: A Practical Approach", 1991, IRL PRESS |
| MEISEL ET AL., PLANT MOLEC. BIOL., vol. 30, 1996, pages 1 |
| MESSING, METH. IN ENZYMOLOGY, vol. 101, 1983, pages 20 - 77 |
| MICHELLE ALTING-MEES ET AL.: "Monoclonal Antibody Expression Libraries: A Rapid Alternative to Hybridomas", STRATEGIES IN MOLECULAR BIOLOGY, vol. 3, January 1990 (1990-01-01), pages 1 - 9 |
| MIKI ET AL.: "Methods in Plant Molecular Biology and Biotechnology", CRC PRESS, article "Procedures for Introducing Foreign DNA into Plants", pages: 67 - 88 |
| MOUNTAIN A; ADAIR, J R: "Biotechnology and Genetic Engineering Reviews", 1992, INTERCEPT |
| MUNSON; PODBARD, ANAL. BIOCHEM., vol. 107, 1980, pages 220 - 239 |
| NEUMANN ET AL., EMBO J., vol. 1, 1982, pages 841 - 845 |
| NICHOLS; YANOFSKY, METH. IN ENZYMOLOGY, vol. 101, 1983, pages 155 |
| NICOLAS, V., CALCIF TISSUE LILT, vol. 57, 1995, pages 206 |
| NISONOFF ET AL., ARCH BIOCHE;17. BIUPHYS., vol. 89, 1960, pages 230 |
| OHNO ET AL., SCIENCE, vol. 265, 1994, pages 781 - 784 |
| OZAKI ET AL., BIOCHEM. BIOPHYS. RES. COMM., vol. 193, no. 2, 1993, pages 653 - 660 |
| P.L. FELGNER, PROC. NATL. ACAD SCI. USA, vol. 84, 1987, pages 7413 |
| PALMITER ET AL., SCIENCE, vol. 222, 1983, pages 809 - 814 |
| PALMITER; BRINSTER, CELL, vol. 41, 1985, pages 343 - 345 |
| PANICALI; PAOLETTI, PNAS, vol. 79, 1982, pages 4927 - 4931 |
| PASZKOWSKI ET AL., BIOTECH., vol. 24, 1992, pages 387 - 392 |
| PATEL ET AL.: "DNA Cloning 2: Expression Systems, 2nd Edition,", 1995, OXFORD UNIVERSITY PRESS, article "The baculovirus expression system", pages: 205 - 244 |
| PERUSKI; PERUSKI: "The Internet and the New Biology: Tools for Genomic and Molecular Research", 1997, ASM PRESS, INC. |
| PHILLIPS, G.B.; G.P. WEI: "Solid-phase Synthesis of Benzimidazoles", TET. LETTERS, vol. 37, 1996, pages 4887 - 90 |
| PICKERING ET AL., CIRC., vol. 89, no. 1, 1994, pages 13 - 21 |
| PICKSLEY ET AL.: "DNA Cloning 2: Expression Systems", 1995, OXFORD UNIVERSITY PRESS, article "Production of monoclonal antibodies against proteins expressed in E. coli", pages: 93 |
| PORTER, BIOCHEM. J., vol. 73, 1959, pages 119 |
| PRESTON: "Methods in Molecular Biology Vol. 15: PCR Protocols: Current Methods and Applications", vol. 15, 1993, HUMANA PRESS, INC., article "Use of Degenerate Oligonucleotide Primers and the Polymerase Chain Reaction to Clone Gene Family Members", pages: 317 - 337 |
| R & R ANTIBODY; STANWOOD, WA: "Short Protocols in Molecular Biology.. 2nd edition.", 1992, article "standard protocol for rabbit immunization and antisera recovery", pages: 11.37 - 11.41 |
| RICHARDSON: "Baculovirus Expression Protocols", 1995, THE HUMANA PRESS, INC. |
| RIGGS, WEST J. MED, vol. 154, 1991, pages 63 - 77 |
| RUHLAND, B. ET AL.: "Solid-supported Combinatorial Synthesis of Structurally Diverse P-Lactams", AMER. CHEM. SOC., vol. 111, 1996, pages 253 - 4 |
| RUSSELL ET AL., GENE, vol. 20, 1982, pages 231 |
| RUSSELL, NATURE, vol. 301, 1983, pages 167 - 169 |
| S.LEMURA ET AL., PROC NATL ACAD SCI, vol. 95, 1998, pages 9337 - 9342 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, 2d Ed.,", 1989, COLD SPRING HARBOR LABORATORY PRESS |
| SAMBROOK ET AL.: "Molecular Cloning: A Lahoratory Manual 2nd ed.", 1989, COLD SPRING HARBOR LABORATORY PRESS |
| SANGER ET AL., PNAS, vol. 74, 1977, pages 5463 |
| SARGENT: "Meth. Enzymol.", vol. 52, 1987, article "Isolation of Differentially Expressed Genes", pages: 423 |
| SCATCHARD, ANN. NY. ACAD SCI., vol. 51, 1949, pages 660 - 672 |
| SHEFFIELD ET AL., HUMAN MOLECULAR GENETICS, vol. 3, 1994, pages 1331 - 1335 |
| SINKAR ET AL., J. BIOSCI. (BANGALORE, vol. 11, 1987, pages 47 - 58 |
| SMITH ET AL.: "Genetic Engineering: Principles and Methods", 1981, PLENUM PRESS |
| STEIN; CHENG, SCIENCE, vol. 261, 1993, pages 1004 - 1012 |
| STRUHL ET AL., GENE |
| STRUHL ET AL., PROC. NATL. ACAD SCI. USA, vol. 76, 1978, pages 1035 - 1039 |
| STUDIER ET AL., METH. ENZYMOL., vol. 185, 1990, pages 60 - 89 |
| SUBRAMANI ET AL., MOL. CELL. BIOL., vol. 1, 1981, pages 854 - 864 |
| TAYLOR ET AL., L/1T. IMMUN., vol. 6, 1994, pages 579 |
| TREUTER ET AL., MOLEC. GEN. GENET., vol. 240, 1993, pages 113 |
| TURNBULL, BIO/TECHNOLOGY, vol. 7, 1989, pages 169 |
| VIEIRA; MESSING, GENE, vol. 19, 1982, pages 259 - 268 |
| VILE; HART, CANCER RES., vol. 53, 1993, pages 3860 - 3864 |
| VINCENT ET AL., NAT. GENET., vol. 5, no. 2, 1993, pages 130 - 134 |
| WALBOT; BRUENING, NATURE, vol. 334, 1988, pages 196 |
| WALDER ET AL., GENE, vol. 42, 1986, pages 133 |
| WANG ET AL., PNAS, vol. 84, 1987, pages 7851 - 7855 |
| WARD ET AL.: "Monoclonal Antibodies: Principles and Applications", 1995, WILEY-LISS, INC., article "Genetic Manipulation and Expression of Antibodies", pages: 137 |
| WATSON ET AL.: "Molecular Biology of the Gene, 4th Ed.", 1987, BENJAMIN CUMMINS |
| WIGLER ET AL., CELL, vol. 14, 1978, pages 725 |
| WILCHEK; BAYER: "The Avidin-Biotin Complex in Bioanalytical Applications", ANAL. BIOCHEM., vol. 171, 1988, pages 1 - 32 |
| WILLIAM D. HUSE ET AL.: "Generation of a Large Combinational Library of the Immunoglobulin Repertoire in Phage Lambda", SCIENCE, vol. 2-16, December 1989 (1989-12-01), pages 1275 - 1281 |
| WILLIAMS ET AL., PNAS, vol. 88, 1991, pages 2726 - 2730 |
| WILLIAMS ET AL.: "DNA Cloning 2: Expression Systems", 1995, OXFORD UNIVERSITY PRESS, article "Expression of foreign proteins in E. coli using plasmid vectors and purification of specific polyclonal antibodies" |
| WILLIAMS ET AL.: "DNA Cloning 2: Expression Systems", 1995, OXFORD UNIVERSITY PRESS, article "Expression of foreign proteins in E. coli using plasmid vectors and purification of specific polyclonal antibodies", pages: 15 |
| WU ET AL., J. OF BIOL. CHEM., vol. 264, 1989, pages 16985 - 16987 |
| WU ET AL.: "Methods in Gene Biotechnology", 1997, CRC PRESS, INC., article "Construction and Screening of Subtracted and Complete Expression cDNA Libraries", pages: 29 - 65 |
| WU ET AL.: "Methods in Gene Biotechnology", 1997, CRC PRESS, INC., article "Information Superhighway and Computer Databases of Nucleic Acids and Proteins", pages: 123 - 151 |
| WU ET AL.: "Methods in Gene Biotechnology", 1997, CRC PRESS, INC., pages: 33 - 41 |
| YAMAGUCHI, BIOCHEM. PHARMACOL., vol. 50, 1995, pages 1295 |
| YELTON ET AL., PROC. NATL. ACAD SCI. USA, vol. 81, 1984, pages 1740 - 1747 |
| YOUNG ET AL.: "Genetic Engineering of Microorganisms for Chemicals", 1982, PLENUM, pages: 355 |
| YU ET AL.: "Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications", vol. 15, 1993, HUMANA PRESS, INC., article "Use of the Polymerase Chain Reaction to Screen Phage Libraries", pages: 211 - 215 |
| ZABNER ET AL., CELL, vol. 75, no. 2, 1993, pages 207 - 216 |
| ZHOU ET AL., MOL. CELL. BIOL., vol. 10, 1990, pages 4529 |
Cited By (128)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7572899B2 (en) | 1998-11-27 | 2009-08-11 | Ucb Sa | Compositions and methods for increasing bone mineralization |
| CN1333828A (zh) * | 1998-11-27 | 2002-01-30 | 达尔文发现有限公司 | 增加骨矿化的组合物和方法 |
| US7977312B2 (en) | 1998-11-27 | 2011-07-12 | Darwin Discovery Limited | Compositions and methods for increasing bone mineralization |
| US7578999B2 (en) | 1998-11-27 | 2009-08-25 | Celltech R & D, Inc. | Antibodies specific for sclerostin |
| US9791462B2 (en) | 1998-11-27 | 2017-10-17 | Ucb Pharma, S.A. | Compositions and methods for increasing bone mineralization |
| US7758858B2 (en) | 1998-11-27 | 2010-07-20 | Darwin Discovery Ltd. | Antibodies associated with alterations in bone density |
| US8986685B2 (en) | 1998-11-27 | 2015-03-24 | Ucb Pharma S.A. | Compositions and methods for increasing bone mineralization |
| US7994299B2 (en) | 1998-11-27 | 2011-08-09 | Darwin Discovery Limited | Compositions and methods for increasing bone mineralization |
| WO2000055193A3 (en) * | 1999-03-12 | 2001-01-18 | Regeneron Pharma | Human dan/cerberus related protein 6 (dcr6) |
| WO2001092308A3 (en) * | 2000-06-01 | 2002-04-11 | Amgen Inc | Cystine-knot polypeptides: cloaked-2 molecules and uses thereof |
| EP1857551A3 (en) * | 2000-06-01 | 2007-11-28 | Amgen Inc. | Cystine-knot polypeptides: cloaked-2 molecules and uses thereof |
| WO2001098491A3 (en) * | 2000-06-19 | 2003-10-02 | Hoffmann La Roche | Osteolevin gene polymorphisms |
| JP2005532998A (ja) * | 2002-03-01 | 2005-11-04 | セルテック アール アンド ディー インコーポレイテッド | 骨密度を増減させる方法 |
| JP2010213708A (ja) * | 2002-03-01 | 2010-09-30 | Celltech R & D Inc | 骨密度を増減させる方法 |
| EP2277522A3 (en) * | 2002-03-01 | 2011-04-20 | UCB Manufacturing, Inc. | Methods for increasing or decreasing bone density and identifying molecules |
| US7799523B2 (en) | 2002-04-03 | 2010-09-21 | Celltech R & D, Inc. | Association of polymorphisms in the SOST gene region with bone mineral density |
| US8546545B2 (en) | 2002-06-14 | 2013-10-01 | Stowers Institute For Medical Research | Antibody to SOST peptide |
| US7914786B2 (en) | 2002-06-14 | 2011-03-29 | Stowers Institute For Medical Research | Compositions and methods for treating kidney disease |
| US8519105B2 (en) | 2002-06-14 | 2013-08-27 | Stowers Institute For Medical Research | Compositions and methods for treating kidney disease |
| US8173125B2 (en) | 2002-06-14 | 2012-05-08 | Stowers Institute For Medical Research | Wise/Sost nucleic acid sequences and amino acid sequences |
| US7585501B2 (en) | 2002-06-14 | 2009-09-08 | Stowers Institute For Medical Research | Compositions and methods for treating kidney disease |
| US8168761B2 (en) | 2002-06-14 | 2012-05-01 | Stowers Institute For Medical Research | Antibody to SOST peptides |
| US9932393B2 (en) | 2002-06-14 | 2018-04-03 | Stowers Institute For Medical Research | Antibody that binds murine wise protein |
| US9938341B2 (en) | 2002-06-14 | 2018-04-10 | Stowers Institute For Medical Research | Antibodies that specifcally bind Sost and Wise peptides |
| US7968301B2 (en) | 2002-06-14 | 2011-06-28 | Stowers Institute For Medical Research | Method of modulating Sost binding to LRP |
| US9011856B2 (en) | 2003-06-16 | 2015-04-21 | Ucb Pharma S.A. | Antibodies specific for sclerostin and methods for increasing bone mineralization |
| KR101221147B1 (ko) * | 2003-06-16 | 2013-01-10 | 셀테크 알앤디, 인코포레이티드 | 뼈의 무기질화를 증가시키기 위한 조성물 및 방법 |
| US7893218B2 (en) | 2003-06-16 | 2011-02-22 | Stowers Institute For Medical Research | Antibodies that specifically bind SOST peptides |
| US11702468B2 (en) | 2003-06-16 | 2023-07-18 | Ucb Pharma, S.A. | Antibodies specific for sclerostin and methods for increasing bone mineralization |
| WO2005003158A2 (en) | 2003-06-16 | 2005-01-13 | Celltech R & D, Inc. | Compositions and methods for increasing bone mineralization |
| US7868134B2 (en) | 2003-06-16 | 2011-01-11 | Ucb Manufacturing, Inc. | Immunogenic peptides derived from sclerostin |
| EA014525B1 (ru) * | 2003-06-16 | 2010-12-30 | Ю-Си-Би Мэньюфэкчуринг, Инк. | Антитела к склеростину и способы их применения |
| EP2338906A1 (en) * | 2003-06-16 | 2011-06-29 | UCB Manufacturing, Inc. | Compostion and methods for increasing bone mineralization |
| EA015166B1 (ru) * | 2003-06-16 | 2011-06-30 | Ю-Си-Би Мэньюфэкчуринг, Инк. | Иммуногенные пептиды склеростина (sost), индуцирующие образование специфических антител |
| EP2341071A1 (en) * | 2003-06-16 | 2011-07-06 | UCB Manufacturing, Inc. | Compostion and methods for increasing bone mineralization |
| AU2004262640B2 (en) * | 2003-06-16 | 2010-12-23 | Ucb Manufacturing, Inc. | Antibodies specific for sclerostin and methods for increasing bone mineralization |
| US7985834B2 (en) | 2003-06-16 | 2011-07-26 | Celltech R & D, Inc. | Compositions and methods for increasing bone mineralization |
| WO2005003158A3 (en) * | 2003-06-16 | 2005-05-26 | Celltech R & D Inc | Compositions and methods for increasing bone mineralization |
| WO2005014650A3 (en) * | 2003-06-16 | 2005-07-28 | Celltech R & D Inc | Antibodies specific for sclerostin and methods for increasing bone mineralization |
| US9657095B2 (en) | 2003-06-16 | 2017-05-23 | Ucb Pharma S.A. | Antibodies specific for sclerostin and methods for increasing bone mineralization |
| EA022991B1 (ru) * | 2003-06-16 | 2016-04-29 | Юсб Фарма С.А. | Антитело к склеростину и его применение |
| US8992911B2 (en) | 2003-06-16 | 2015-03-31 | Ucb Pharma S.A. | Antibodies specific for sclerostin and methods for increasing bone mineralization |
| US7381409B2 (en) | 2003-06-16 | 2008-06-03 | Celltech R&D, Inc. | Antibodies specific for sclerostin and methods of screening and use therefor |
| US8563271B2 (en) | 2003-06-16 | 2013-10-22 | Ucb Manufacturing, Inc. | Antibodies specific for sclerostin and methods for increasing bone mineralization |
| EP2345668B1 (en) | 2005-05-03 | 2021-09-22 | UCB Pharma, S.A. | Sclerostin epitopes |
| EP2325199B1 (en) | 2005-05-03 | 2015-03-04 | Amgen, Inc. | Sclerostin binding agents |
| US11939372B2 (en) | 2005-05-03 | 2024-03-26 | Amgen Inc. | Binding agents |
| EP2264063A1 (en) * | 2005-05-03 | 2010-12-22 | UCB Pharma, S.A. | Sclerostin binding antibody |
| EP2301961B1 (en) | 2005-05-03 | 2017-02-22 | Amgen Inc. | Sclerostin epitopes |
| EP2251351B2 (en) † | 2005-05-03 | 2023-07-26 | Amgen Inc. | Sclerostin epitopes |
| US8383801B2 (en) | 2005-05-03 | 2013-02-26 | Amgen Inc. | Polynucleotide encoding a sclerostin-binding antibody |
| EP2298800A1 (en) * | 2005-05-03 | 2011-03-23 | UCB Pharma, S.A. | Sclerostin binding antibodies |
| EP2301961B2 (en) † | 2005-05-03 | 2023-07-12 | Amgen Inc. | Sclerostin epitopes |
| US7592429B2 (en) | 2005-05-03 | 2009-09-22 | Ucb Sa | Sclerostin-binding antibody |
| CN101287756A (zh) * | 2005-05-03 | 2008-10-15 | 安进公司 | 硬化素结合剂 |
| EP2295448B2 (en) † | 2005-05-03 | 2023-05-31 | Amgen Inc. | Sclerostin epitopes |
| CN103435698A (zh) * | 2005-05-03 | 2013-12-11 | Ucb医药有限公司 | Sclerostin结合剂 |
| US8637643B2 (en) | 2005-05-03 | 2014-01-28 | Ucb Pharma, S.A. | Sclerostin binding antibody |
| US8715663B2 (en) | 2005-05-03 | 2014-05-06 | Amgen Inc. | Epitopes |
| EP2295448B1 (en) | 2005-05-03 | 2017-01-18 | Amgen Inc. | Sclerostin epitopes |
| EP3985015A1 (en) * | 2005-05-03 | 2022-04-20 | UCB Pharma S.A. | Sclerostin binding agents |
| US8003108B2 (en) | 2005-05-03 | 2011-08-23 | Amgen Inc. | Sclerostin epitopes |
| EP3670528B1 (en) | 2005-05-03 | 2021-09-08 | UCB Pharma S.A. | Sclerostin binding agents |
| US10562964B2 (en) | 2005-05-03 | 2020-02-18 | Amgen Inc. | Methods for isolating antibodies that bind sclerostin |
| WO2006119107A3 (en) * | 2005-05-03 | 2006-12-28 | Ucb Sa | Sclerostin binding agents |
| US9089553B2 (en) | 2005-05-03 | 2015-07-28 | Amgen Inc. | Method for inhibiting bone resorption |
| EA021539B1 (ru) * | 2005-05-03 | 2015-07-30 | Юсб Фарма С.А. | Антитело к склеростину и его применение |
| US10273293B2 (en) | 2005-05-03 | 2019-04-30 | Amgen Inc. | Method for inhibiting bone resorption |
| US9296812B2 (en) | 2005-05-03 | 2016-03-29 | Amgen Inc. | Sclerostin binding antibodies |
| CN103435698B (zh) * | 2005-05-03 | 2018-08-31 | Ucb医药有限公司 | Sclerostin结合剂 |
| US9353174B2 (en) | 2005-05-03 | 2016-05-31 | Amgen Inc. | Epitopes |
| US7872106B2 (en) | 2005-05-03 | 2011-01-18 | Amgen Inc. | Sclerostin-binding antibodies |
| EP2298800B1 (en) | 2005-05-03 | 2016-11-30 | Amgen Inc. | Sclerostin binding antibodies |
| EP2251351B1 (en) | 2005-05-03 | 2017-01-04 | Amgen Inc. | Sclerostin epitopes |
| EP3345607B1 (en) | 2006-12-29 | 2022-10-26 | Ossifi-Mab LLC | Methods of altering bone growth by administration of sost or wise antagonist or agonist |
| US11807681B2 (en) | 2006-12-29 | 2023-11-07 | Ossifi-Mab Llc | Methods of altering bone growth by administration of Sost or Wise antagonist or agonist |
| US11891438B2 (en) | 2006-12-29 | 2024-02-06 | Ossifi-Mab Llc | Methods of altering bone growth by administration of Sost or Wise antagonist or agonist |
| US7988970B2 (en) | 2007-03-20 | 2011-08-02 | Eli Lilly And Company | Methods of treatment comprising administering an anti-sclerostin antibody |
| US8257704B2 (en) | 2007-03-20 | 2012-09-04 | Eli Lilly And Company | Anti-sclerostin antibodies |
| US7744874B2 (en) | 2007-03-20 | 2010-06-29 | Eli Lilly And Company | Anti-sclerostin antibodies |
| US8017120B2 (en) | 2007-09-17 | 2011-09-13 | Amgen Inc. | Method for inhibiting bone resorption |
| US12421304B2 (en) | 2007-09-17 | 2025-09-23 | Amgen Inc. | Method for inhibiting bone resorption |
| US11091537B2 (en) | 2007-09-17 | 2021-08-17 | Amgen Inc. | Method for inhibiting bone resorption |
| US8329176B2 (en) | 2007-09-17 | 2012-12-11 | Amgen Inc. | Method for inhibiting bone resorption |
| US8440193B2 (en) | 2007-09-17 | 2013-05-14 | Amgen Inc. | Method for inhibiting bone resorption |
| US8486661B2 (en) | 2007-10-12 | 2013-07-16 | Novartis Ag | Polynucleotides encoding antibodies against sclerostin and uses therefor |
| US8246953B2 (en) | 2007-10-12 | 2012-08-21 | Novartis Ag | Compositions and methods for use for antibodies against sclerostin |
| US7879322B2 (en) | 2007-10-12 | 2011-02-01 | Novartis Ag | Compositions and methods for use for antibodies against sclerostin |
| WO2010115932A1 (en) | 2009-04-08 | 2010-10-14 | Novartis Ag | Combination for the treatment of bone loss |
| WO2011128424A1 (en) | 2010-04-16 | 2011-10-20 | Novartis Ag | Methods and compositions for improving implant osseointegration |
| US9352043B2 (en) | 2010-05-14 | 2016-05-31 | Amgen Inc. | High concentration antibody formulations |
| US10064946B2 (en) | 2010-05-14 | 2018-09-04 | Amgen Inc. | High concentration antibody formulations |
| US12178873B2 (en) | 2010-05-14 | 2024-12-31 | Amgen Inc. | High concentration antibody formulations |
| US11040102B2 (en) | 2010-05-14 | 2021-06-22 | Amgen Inc. | High concentration antibody formulations |
| WO2012059598A2 (en) | 2010-11-05 | 2012-05-10 | Novartis Ag | Methods of treating rheumatoid arthritis using il-17 antagonists |
| EP4116325A1 (en) | 2010-11-05 | 2023-01-11 | Novartis AG | Methods of treating rheumatoid arthritis using il-17 antagonists |
| EP3757126A1 (en) | 2010-11-05 | 2020-12-30 | Novartis AG | Methods of treating psoriatic arthritis using il-17 antagonists |
| EP3542820A1 (en) | 2010-11-05 | 2019-09-25 | Novartis AG | Methods of treating psoriatic arthritis using il-17 antagonists |
| EP3912640A1 (en) | 2010-11-05 | 2021-11-24 | Novartis AG | Pharmaceutical compositions comprising secukinumab |
| US9617333B2 (en) | 2011-03-25 | 2017-04-11 | Amgen Inc. | Sclerostin antibody crystals and formulations thereof |
| US9920114B2 (en) | 2011-03-25 | 2018-03-20 | Amgen Inc. | Antibody formulations |
| US9145457B2 (en) | 2011-03-25 | 2015-09-29 | Amgen Inc. | Sclerostin antibody crystals and formulations thereof |
| WO2012149246A1 (en) | 2011-04-29 | 2012-11-01 | Novartis Ag | Methods of treating squamous cell carcinoma related applications |
| US10538584B2 (en) | 2011-08-04 | 2020-01-21 | Amgen Inc. | Methods for treating bone gap defects |
| US9913900B2 (en) | 2011-12-28 | 2018-03-13 | Amgen Inc. | Method of treating alvelor bone loss through the use of anti-sclerostin antibodies |
| US9657090B2 (en) | 2011-12-28 | 2017-05-23 | Amgen Inc. | Method of treating alveolar bone loss through the use of anti-sclerostin antibodies |
| US11896667B2 (en) | 2012-07-05 | 2024-02-13 | Ucb Pharma S.A. | Treatment for bone diseases |
| US9925260B2 (en) | 2012-07-05 | 2018-03-27 | Ucb Pharma S.A. | Treatment for bone diseases |
| US10799583B2 (en) | 2012-07-05 | 2020-10-13 | Ucb Pharma, S.A. | Treatment for bone diseases |
| US11466078B2 (en) | 2012-11-21 | 2022-10-11 | Amgen Inc. | Heterodimeric immunoglobulins |
| US10233237B2 (en) | 2012-11-21 | 2019-03-19 | Amgen Inc. | Heterodimeric immunoglobulins |
| US9822173B2 (en) | 2012-11-21 | 2017-11-21 | Amgen Inc. | Heterodimeric immunoglobulins |
| WO2014118705A1 (en) | 2013-01-31 | 2014-08-07 | Novartis Ag | Methods of treating chronic kidney disease-mineral and bone disorder using sclerostin antagonists |
| WO2014155278A2 (en) | 2013-03-26 | 2014-10-02 | Novartis Ag | Methods of treating autoimmune diseases using il-17 antagonists |
| US12472167B2 (en) | 2013-05-03 | 2025-11-18 | Cartesian Therapeutics, Inc. | Methods providing a therapeutic macromolecule and synthetic nanocarriers comprising immunosuppressant locally and concomitantly to reduce both Type 1 and Type IV hypersensitivity |
| US11851483B2 (en) | 2014-12-12 | 2023-12-26 | Amgen Inc. | Anti-sclerostin antibodies and their use to treat bone disorders as part of a regimen |
| EP4372005A2 (en) | 2014-12-22 | 2024-05-22 | Novartis AG | Pharmaceutical products and stable liquid compositions of il-17 antibodies |
| EP4559934A2 (en) | 2014-12-22 | 2025-05-28 | Novartis AG | Pharmaceutical products and stable liquid compositions of il-17 antibodies |
| EP4559935A2 (en) | 2014-12-22 | 2025-05-28 | Novartis AG | Pharmaceutical products and stable liquid compositions of il-17 antibodies |
| US11576970B2 (en) | 2016-03-10 | 2023-02-14 | UCB Biopharma SRL | Pharmaceutical formulations |
| EP3868780A1 (en) | 2016-12-21 | 2021-08-25 | Mereo Biopharma 3 Limited | Use of anti-sclerostin antibodies in the treatment of osteogenesis imperfecta |
| US12173058B2 (en) | 2016-12-21 | 2024-12-24 | Mereo Biopharma 3 Limited | Use of anti-sclerostin antibodies in the treatment of osteogenesis imperfecta |
| WO2018115880A1 (en) | 2016-12-21 | 2018-06-28 | Mereo Biopharma 3 Limited | Use of anti-sclerostin antibodies in the treatment of osteogenesis imperfecta |
| US10961305B2 (en) | 2016-12-21 | 2021-03-30 | Mereo Biopharma 3 Limited | Use of anti-sclerostin antibodies in the treatment of osteogenesis imperfecta |
| US12194078B2 (en) | 2017-03-11 | 2025-01-14 | Cartesian Therapeutics, Inc. | Methods and compositions related to combined treatment with anti-inflammatories and synthetic nanocarriers comprising an immunosuppressant |
| US11858983B2 (en) | 2018-03-30 | 2024-01-02 | Amgen Inc. | C-terminal anti-sclerostin antibody variants |
| US11466079B2 (en) | 2018-03-30 | 2022-10-11 | Amgen Inc. | C-terminal antibody variants |
| WO2020002673A1 (en) | 2018-06-29 | 2020-01-02 | Mereo Biopharma 3 Limited | Use of a sclerostin antagonist |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7994299B2 (en) | Compositions and methods for increasing bone mineralization | |
| AU2031300C1 (en) | Compositions and methods for increasing bone mineralization | |
| AU2003271274C1 (en) | Compositions and methods for increasing bone mineralization | |
| HK1151826A (en) | Compositions and methods for increasing bone mineralisation | |
| HK1151826B (en) | Compositions and methods for increasing bone mineralisation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 99815505.5 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 143266 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 20313/00 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2352532 Country of ref document: CA Ref document number: 2352532 Country of ref document: CA Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2001/04234 Country of ref document: ZA Ref document number: 200104234 Country of ref document: ZA |
|
| ENP | Entry into the national phase |
Ref document number: 2000 585404 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2001/005275 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 512122 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1999963986 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1999963986 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| AK | Designated states |
Kind code of ref document: C2 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: C2 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| COP | Corrected version of pamphlet |
Free format text: PAGES 1/6-6/6, DRAWINGS, REPLACED BY NEW PAGES 1/6-6/6; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE |
|
| WWG | Wipo information: grant in national office |
Ref document number: 20313/00 Country of ref document: AU |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1999963986 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 210392 Country of ref document: IL |