EP1532265A2 - Verfahren zur herstellung von ketocarotinoiden in genetisch veränderten organismen - Google Patents

Verfahren zur herstellung von ketocarotinoiden in genetisch veränderten organismen

Info

Publication number
EP1532265A2
EP1532265A2 EP03792348A EP03792348A EP1532265A2 EP 1532265 A2 EP1532265 A2 EP 1532265A2 EP 03792348 A EP03792348 A EP 03792348A EP 03792348 A EP03792348 A EP 03792348A EP 1532265 A2 EP1532265 A2 EP 1532265A2
Authority
EP
European Patent Office
Prior art keywords
sequence
ketolase
amino acid
seq
sequence seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03792348A
Other languages
English (en)
French (fr)
Inventor
Matt Sauer
Ralf Flachmann
Martin Klebsattel
Christel Renate Schopfer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SunGene GmbH
Original Assignee
SunGene GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE10238979A external-priority patent/DE10238979A1/de
Priority claimed from DE10238978A external-priority patent/DE10238978A1/de
Priority claimed from DE2002138980 external-priority patent/DE10238980A1/de
Priority claimed from DE2002153112 external-priority patent/DE10253112A1/de
Priority claimed from DE2002158971 external-priority patent/DE10258971A1/de
Application filed by SunGene GmbH filed Critical SunGene GmbH
Publication of EP1532265A2 publication Critical patent/EP1532265A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/30—Animal feeding-stuffs from material of plant origin, e.g. roots, seeds or hay; from material of fungal origin, e.g. mushrooms
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/179—Colouring agents, e.g. pigmenting or dyeing agents
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K50/00—Feeding-stuffs specially adapted for particular animals
    • A23K50/80—Feeding-stuffs specially adapted for particular animals for aquatic animals, e.g. fish, crustaceans or molluscs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/15—Vitamins
    • A23L33/155—Vitamins A or D
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L5/00—Preparation or treatment of foods or foodstuffs, in general; Food or foodstuffs obtained thereby; Materials therefor
    • A23L5/40—Colouring or decolouring of foods
    • A23L5/42—Addition of dyes or pigments, e.g. in combination with optical brighteners
    • A23L5/43—Addition of dyes or pigments, e.g. in combination with optical brighteners using naturally occurring organic dyes or pigments, their artificial duplicates or their derivatives
    • A23L5/44—Addition of dyes or pigments, e.g. in combination with optical brighteners using naturally occurring organic dyes or pigments, their artificial duplicates or their derivatives using carotenoids or xanthophylls
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09B—ORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
    • C09B61/00—Dyes of natural origin prepared from natural sources, e.g. vegetable sources
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/823—Reproductive tissue-specific promoters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
    • Y02A40/81—Aquaculture, e.g. of fish
    • Y02A40/818—Alternative feeds for fish, e.g. in aquacultures

Definitions

  • the present invention relates to a process for the preparation of ketocarotenoids by cultivating genetically modified organisms which have a modified ketolase activity compared to the wild type, the genetically modified organisms, and their use as food and feed and for the production of ketocarotenoid extracts.
  • Ketocarotenoids are synthesized de novo in bacteria, algae, fungi and plants.
  • Ketocarotenoids i.e. carotenoids that contain at least one keto group, such as astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3'-hydroxyechinenone, adonirubin and adonixanthin are natural antioxidants and pigments that are produced by some algae and microorganisms as secondary metabolites ,
  • ketocarotenoids and especially astaxanthin are used as pigmentation aids in animal nutrition, especially in trout, salmon and shrimp farming.
  • Natural ketocarotenoids such as natural astaxanthin
  • Nucleic acids encoding a ketolase and the corresponding protein sequences have been isolated and annotated from various organisms, such as nucleic acids encoding a ketolase from Agrobacterium aurantiacum (EP 735 137, Accession NO: D58420), from Alcaligenes sp. PC-1 (EP 735137, Accession NO: D58422), Haematococcus pluvialis Flotow em.
  • EP 735 137 describes the production of xanthophylls in microorganisms, such as, for example, E. coli by introducing ketolase genes (crtW) from Agrobacterium aurantiacum or Alcaligenes sp. PC-1 in microorganisms.
  • ketolase genes crtW
  • WO 98/18910 and Hirschberg et al. describe the synthesis of ketocarotenoids in nectaries of tobacco flowers by introducing the ketolase gene from Haematococcus pluvialis (crtO) into tobacco.
  • WO 01/20011 describes a DNA construct for the production of ketocarotenoids, in particular astaxanthin, in seeds of oilseed plants such as oilseed rape, sunflower, soybean and mustard using a seed-specific promoter and a ketolase from Haematococcus pluvialis.
  • ketocarotenoids All processes described in the prior art for the production of ketocarotenoids and in particular the processes described for the production of astaxanthin have the disadvantage that the transgenic organisms provide a large amount of hydroxylated by-products, such as zeaxanthin and adonixanthin.
  • the invention was therefore based on the object of providing a process for the preparation of ketocarotenoids by cultivating genetically modified organisms, or of providing further genetically modified organisms which produce ketocarotenoids which have the disadvantages of the prior art described above to a lesser extent or no longer.
  • a method for producing ketocarotenoids has been found by cultivating genetically modified organisms which have an altered ketolase activity compared to the wild type and the altered ketolase activity is caused by a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
  • the organisms according to the invention are preferably naturally able, as starting organisms, to produce carotenoids such as, for example, ⁇ -carotene or zeaxanthin, or can be put into a position by carotinoids such as, for example, reorganization of metabolic pathways or complementation for example, to produce ⁇ -carotene or zeaxanthin.
  • ketocarotenoids such as astaxanthin or canthaxanthin.
  • These organisms such as Haematococcus pluvialis, Paracoccus marcusii, Xan- thophyllomyces dendrorhous, Bacillus circulans, Chlorococcum, Phaffia rhodozyma, Adonis, Neochloris wimmeri, vacuolatus Protosiphon botryoides, Scotiellopsis oocystifor- mis, Scenedesmus, Chlorela zofingiensis, braunii Ankistrodesmus, Euglena sanguinea, Bacillus atrophaeus, Blakeslea already have ketolase activity as a starting or wild-type organism.
  • organisms are therefore used as starting organisms which already have ketolase activity as a wild type or starting organism.
  • the genetic modification causes an increase in ketolase activity compared to the wild type or parent organism.
  • Ketolase activity means the enzyme activity of a ketolase.
  • a ketolase is understood to mean a protein which has the enzymatic activity of introducing a keto group on the optionally substituted ⁇ -ionone ring of carotenoids.
  • a ketolase is understood to be a protein which has the enzymatic activity to convert ⁇ -carotene into canthaxanthin.
  • ketolase activity is understood to mean the amount of ⁇ -carotene or amount of canthaxanthin formed by the protein ketolase in a certain time.
  • the amount of ⁇ -carotene converted or the amount of canthaxanthin formed is increased in a certain time by the protein ketolase compared to the wild type.
  • This increase in ketolase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the ketolase activity of the wild type.
  • wild type is understood to mean the corresponding starting organism.
  • organism can be understood to mean the starting organism (wild type) or a genetically modified organism according to the invention, or both.
  • wild type is used to increase or cause the ketolase activity, for the increase in hydroxylase activity described below, for the increase described below ⁇ -cyclase activity and the increase in the content of ketocarotenoids each understood a reference organism.
  • This reference organism is preferably Haematococcus pluvialis for microorganisms which already have ketolase activity as a wild type.
  • This reference organism is preferably Blakeslea for microorganisms which, as a wild type, have no ketolase activity.
  • This reference organism is for plants which already have a ketolase activity as a wild type, preferably Adonis aestivalis, Adonis flammeus or Adonis annuus, particularly preferably Adonis aestivalis.
  • This reference organism is particularly preferred for plants which have no ketolase activity in petals as a wild type, preferably Tagetes erecta, Tagetes patula, Tagetes lucida, Tagetes pringlei, Tagetes palmeri, Tagetes minuta or Tagetes campanulata, particularly preferably Tagetes erecta.
  • ketolase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:
  • the ketolase activity in plant or microorganism material is determined in accordance with the method of Frazer et al., (J. Biol. Chem. 272 (10): 6128-6135, 1997).
  • the ketolase activity in plant or microorganism extracts is determined with the substrates ⁇ -carotene and canthaxanthin in the presence of lipid (soy lecithin) and detergent (sodium cholate).
  • Substrate / product ratios from the ketolase assays are determined by means of HPLC.
  • the ketolase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms at the translation and protein levels or by increasing the gene expression of a nucleic acid encoding a ketolase compared to the wild type, for example by inducing the ketolase gene by activators or by introducing nucleic acids encoding a ketolase into the organism.
  • Increasing the gene expression of a nucleic acid encoding a ketolase means, in this embodiment, the manipulation of the expression of the organisms' own endogenous ketolases. For example can be achieved by changing the promoter DNA sequence for genes coding for ketolase. Such a change, which results in a changed or preferably increased expression rate of at least one endogenous ketolase gene, can be carried out by deleting or inserting DNA sequences.
  • an increased expression of at least one endogenous ketolase gene can be achieved in that a regulatory protein which is not found or modified in the wild-type organism interacts with the promoter of these genes.
  • Such a regulator can represent a chimeric protein which consists of a DNA binding domain and a transcription activator domain, as described, for example, in WO 96/06166.
  • the ketolase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
  • the gene expression of a nucleic acid encoding a ketolase is increased by introducing nucleic acids encoding ketolases into the organisms, the ketolases having the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
  • At least one further ketolase gene is present in the transgenic organisms according to the invention in comparison to the wild type, encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or one of these This sequence is derived by substitution, insertion or deletion of amino acids and has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
  • organisms are used as the starting organisms which, as a wild type, have no ketase activity.
  • the genetic modification causes it. Ketolase activity in organisms.
  • the genetically modified organism according to the invention thus has a ketolase activity in comparison to the genetically unmodified wild type and is therefore preferred. It is able to transgenically express a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
  • the gene expression of a nucleic acid encoding a ketolase is caused analogously to the above-described increase in gene expression of a nucleic acid.
  • Encoding a ketolase preferably by introducing nucleic acids encoding ketolases containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has, in the starting organism.
  • any nucleic acids encoding a ketolase containing the amino acid sequence SEQ can be used in both embodiments. ID. NO. 2 or one of these Sequence derived by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has to be used.
  • ketocarotenoids with a smaller amount of hydroxylated by-products in the method according to the invention than when using the ketolase genes used in the prior art.
  • nucleic acids mentioned in the description can be, for example, an RNA, DNA or cDNA sequence.
  • nucleic acid sequences which have already been processed such as the corresponding cDNAs, are preferred use.
  • Nostoc punctiforme ATTC 29133 nucleic acid: Acc.-No. NZ_AABC01000195, base pair 55.604 to 55.392 (SEQ ID NO: 3); Protein: Acc.-No. ZP_00111258 (SEQ ID NO: 4) (annotated as putative protein) or
  • Nostoc punctiforme ATTC 29133 nucleic acid: Acc.-No. NZ_AABC01000196, base pair 140.571 to 139.810 (SEQ ID NO: 5), protein: (SEQ ID NO: 6) (not annotated), Synechococcus sp. WH 8102, nucleic acid: Acc.-No. NZ_AABD01000001, base pair 1, 354.725-1, 355.528 (SEQ ID NO: 46), protein: Acc.-No. ZP_00115639 (SEQ ID NO: 47) (annotated as putative protein),
  • Nodularia spumigena NSOR10 (Accession NO: AY210783, AAO64399; Nucleic acid: SEQ ID NO: 52, Protein: SEQ ID NO: 53)
  • ketolases and ketolase genes that can be used in the method according to the invention can be obtained, for example, from different organisms whose genomic sequence is known by comparing the identity of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the sequences SEQ ID NO described above : 2 easy to find.
  • ketolases and ketolase genes can also be easily found using hybridization techniques in a manner known per se, starting from the nucleic acid sequences described above, in particular starting from the sequences SEQ ID NO: 1 from various organisms, the genomic sequence of which is not known.
  • the hybridization can take place under moderate (low stringency) or preferably under stringent (high stringency) conditions.
  • the conditions during the washing step can be selected from the range of conditions limited by those with low stringency (with 2X SSC at 50_C) and those with high stringency (with 0.2X SSC at 50_C, preferably at 65_C) (20X SSC: 0, 3 M sodium citrate, 3 M sodium chloride, pH 7.0).
  • the temperature during the washing step can be raised from moderate conditions at room temperature, 22 ° C, to stringent conditions at 65 ° C. s
  • Both parameters, salt concentration and temperature, can be varied at the same time, one of the two parameters can also be kept constant and only the other can be varied.
  • Denaturing agents such as formamide or SDS can also be used during hybridization. In the presence of 50% formamide, the hybridization is preferably carried out at 42 ° C.
  • 6X SSC 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA at 68 ° C, or (v) 6XSSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA, 50% formamide at 42 ° C, or
  • nucleic acids encoding a ketolase are introduced, containing the amino acid sequence SEQ ID NO: 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which preferably has an identity of at least 50% at least 60%, preferably at least 65%, preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, particularly preferably at least 98% at the amino acid level with the Sequence SEQ ID NO: 2 has.
  • This can be a natural ketolase sequence that can be found as described above by comparing the identity of the sequences from other organisms or an artificial ketolase sequence that can be started from the sequence SEQ ID NO: 2 by artificial variation, for example by Substitution, insertion or deletion of amino acids has been modified.
  • substitution is to be understood as meaning the replacement of one or more amino acids by one or more amino acids. So-called conservative exchanges are preferably carried out, in which the replaced amino acid has a similar property to the original amino acid, for example replacement of Glu by Asp, Gin by Asn, Val by Ile, Leu by Ile, Ser by Thr.
  • Deletion is the replacement of an amino acid with a direct link.
  • Preferred positions for deletions are the termini of the polypeptide and the links between the individual protein domains.
  • Inserts are insertions of amino acids into the polypeptide chain, with a direct bond being formally replaced by one or more amino acids.
  • Identity between two proteins is understood to mean the identity of the amino acids over the respective total protein length, in particular the identity which is obtained by comparison using the Vector NTI Suite 7.1 software from Informax (USA) using the Clustal method (Higgins DG, Sharp PM.Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151-1) is calculated using the following parameters:
  • Gap opening penalty 10 Gap extension penalty 10
  • a ketolase which has an identity of at least 42% at the amino acid level with the sequence SEQ ID NO: 2 is accordingly understood to be a ketolase which, when comparing its sequence with the sequence SEQ ID NO: 2, in particular according to the above program logarithm with the above parameter set has an identity of at least 42%.
  • the sequence of the ketolase from Nostoc punctiform ATTC 29133 (SEQ ID NO: 4) with the sequence of the ketolase from Nostoc sp.
  • Strain PCC7120 (SEQ ID NO: 2) has an identity of 65%.
  • the sequence of the second ketolase from Nostoc punctiform ATTC 29133 (SEQ ID NO: 6) with the sequence of the ketolase from Nostoc sp.
  • Strain PCC7120 (SEQ ID NO: 2), for example, has an identity of 58%.
  • Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.
  • codons are preferably used for this which are frequently used in accordance with the organism-specific "codon usage".
  • the "codon usage” can easily be determined on the basis of computer evaluations of other, known genes of the organisms in question.
  • a nucleic acid containing the sequence SEQ ID NO: 1 is introduced into the organism.
  • All of the above-mentioned ketolase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
  • the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897).
  • the sequence of the ketolase from Nostoc sp. Strain PCC7120 (SEQ ID NO: 2) has an identity of 39% (Agrobacterium aurantiacum (EP 735 137, Accession NO: D58420), 40% (Alcaligenes) with the sequences of the ketolases used in the methods of the prior art sp. PC-1 (EP 735137, Accession NO: D58422) and 20 to 21% (Haematococcus pluvialis Flotow em.
  • organisms are cultivated which, in addition to the increased ketolase activity, have an increased hydroxylase activity and / or ⁇ -cyclase activity compared to the wild type.
  • Hydroxylase activity means the enzyme activity of a hydroxylase.
  • a hydroxylase is understood to mean a protein which has the enzymatic activity of introducing a hydroxyl group on the optionally substituted ⁇ -ionone ring of carotenoids.
  • a hydroxylase is understood to mean a protein which has the enzymatic activity, ⁇ -carotene in zeaxanthin or canthaxanthin in
  • hydroxylase activity is understood to mean the amount of ⁇ -carotene or canthaxanthin converted or the amount of zeaxanthin or astaxanthin formed in a certain time by the protein hydroxylase.
  • the amount of ⁇ -carotene or canthaxantine or the amount of zeaxanthin or astaxanthin formed is increased by the protein hydroxylase in a certain time compared to the wild type.
  • This increase is preferably the hydroxylase activity of at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, more preferably at least • 500%, especially at least 600% of the hydroxylase activity of the wild type.
  • ⁇ -cyclase activity means the enzyme activity of a ⁇ -cyclase.
  • a ⁇ -cyclase is understood to mean a protein which has the enzymatic activity to convert a terminal, linear residue of lycopene into a ⁇ -ionone ring.
  • a ⁇ -cyclase is understood to be a protein which has the enzymatic activity to convert ⁇ -carotene into ⁇ -carotene.
  • ß-cyclase activity is understood to mean the amount of ⁇ -carotene converted or the amount of ß-carotene formed in a certain time by the protein ß-cyclase.
  • the amount of lycopene or ⁇ -carotene converted or the amount of ⁇ -carotene formed from lycopene or the formed amount of ß-carotene from ⁇ -carotene increased.
  • This increase in the ⁇ -cyclase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably min. at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the ⁇ -cyclase activity of the wild type.
  • hydroxylase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:
  • the activity of the hydroxylase is according to Bouvier et al. (Biochim. Biophys. Acta 1391 (1998), 320-328) in vitro. Ferredoxin, ferredoxin-NADP oxidoreductase, catalase, NADPH and ⁇ -carotene with mono- and digalactosylglycerides are added to a certain amount of organism extract.
  • the hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, Keller, d'Harlingue and Camara (Xanthophyll bio-synthesis: molecular and functional identification of carotenoid hydroxylases for rom pepper fruits (Capsicum annuum L; Biochim. Biophys. Acta 1391 (1998), 320-328):
  • the in vitro assay is carried out in a volume of 0.250 ml.
  • the mixture contains 50 mM potassium phosphate (pH 7.6), 0.025 mg ferredoxin from spinach, 0.5 units ferredoxin-NADP + oxidoreductase from spinach, 0.25 mM NADPH, 0.010 mg beta
  • Carotene (emulsified in 0.1 mg Tween 80), 0.05 mM of a mixture of mono- and digalactosylglycerides (1: 1), 1 unit of catalysis, 200 mono- and digalactosylglycerides (1: 1), 0.2 mg bovine serum albumin and organism extract in different volumes.
  • the reaction mixture is incubated at 30 ° C for 2 hours.
  • the reaction products are extracted with organic solvent such as acetone or chloroform / methanol (2: 1) and determined by HPLC.
  • ⁇ -cyclase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:
  • the activity of the ⁇ -cyclase is determined according to Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15) / n vitro. Potassium phosphate as a buffer (pH 7.6), lycopene as a substrate, stomaprotein from paprika, NADP +, NADPH and ATP are added to a certain amount of organism extract.
  • the ⁇ -cyclase activity is particularly preferably determined under the following conditions according to Bouvier, d'Harlingue and Camara (Molecular Analysis of carotenoid cyclae inhibition; Arch. Biochem. Biophys. 346 (1) (1997) 53-64):
  • the in vitro assay is carried out in a volume of 250 ⁇ l volume.
  • the mixture contains 50 mM potassium phosphate (pH 7.6), different amounts of organism extract, 20 nM lycopene, 250 ⁇ g of chromoplastid stromal protein from paprika, 0.2 mM NADP +, 0.2 mM NADPH and 1 mM ATP.
  • NADP / NADPH and ATP are dissolved in 10 ml ethanol with 1 mg Tween 80 immediately before adding to the incubation medium. After a reaction time of 60 minutes at 30 ° C., the reaction is terminated by adding chloroform / methanol (2: 1). The reaction products extracted in chloroform are analyzed by HPLC.
  • the hydroxylase activity and / or ⁇ -cyclase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing the gene expression of nucleic acids encoding a hydroxylase and / or of nucleic acids , encoding a ⁇ -cyclase, compared to the wild type.
  • the increase in the gene expression of the nucleic acids encoding a hydroxylase and / or the increase in the gene expression of the nucleic acid encoding a ⁇ -cyclase compared to the wild type can also be achieved in various ways, for example by inducing the hydroxylase gene and / or ⁇ -cyclase Gene by activators or by introducing one or more hydroxylase gene copies and / or ⁇ -cyclase gene copies, ie by introducing at least one nucleic acid encoding a hydroxylase and / or at least one nucleic acid encoding a ⁇ -cyclase into the organism ,
  • Increasing the gene expression of a nucleic acid encoding a hydroxylase and / or ⁇ -cyclase means according to the invention the manipulation of the expression of the organism's own endogenous hydroxylase and / or ⁇ -cyclase. This can be achieved, for example, by changing the promoter DNA sequence for genes encoding hydroxylases and / or ⁇ -cyclases. Such a change, which results in an increased expression rate of the gene, can take place, for example, by deleting or inserting DNA sequences.
  • an altered or increased expression of an endogenous hydroxylase and / or ⁇ -cyclase gene can be achieved in that a regulator protein which does not occur in the non-transformed organism interacts with the promoter of this gene.
  • Such a regulator can represent a chimeric protein which consists of a DNA binding domain and a transcription activator domain, as for example in
  • the gene expression of a nucleic acid encoding a hydroxylase is increased and / or the gene expression of a nucleic acid encoding a ⁇ -cyclase is increased by introducing at least one nucleic acid encoding a hydroxylase and / or by introducing at least one a nucleic acid encoding a ⁇ -cyclase in the organism.
  • any hydroxylase gene or each ⁇ -cyclase gene that is to say any nucleic acid which codes for a hydroxylase and any nucleic acid which codes for a ⁇ -cyclase, can be used for this purpose.
  • genomic hydroxylase or. ⁇ -cyclase nucleic acid sequences from eukaryotic sources which contain introns are, in the event that the host organism is unable or cannot be able to express the corresponding hydroxylase or ⁇ -cyclase, preferably to use already processed nucleic acid sequences, such as the corresponding cDNAs.
  • An example of a hydroxylase gene is a nucleic acid encoding a hydroxylase from Haematococcus pluvialis, accession AX038729, WO 0061764); (Nucleic acid: SEQ ID NO: 15, protein: SEQ ID NO: 16).
  • ⁇ -cyclase gene is a nucleic acid encoding a ⁇ -cyclase from tomato (Accession X86452) (nucleic acid: SEQ ID NO: 17, protein: SEQ ID NO: 18).
  • the preferred transgenic organisms according to the invention therefore have at least one further hydroxylase gene and / or ⁇ -cyclase gene compared to the wild type.
  • the genetically modified organism has, for example, at least one exogenous nucleic acid encoding a hydroxylase, or at least two endogenous nucleic acids encoding a hydroxylase and / or at least one exogenous nucleic acid encoding a ⁇ -cyclase, or at least two endogenous nucleic acids encoding one ⁇ -cyclase.
  • nucleic acids encoding proteins are preferably used as the hydroxylase genes, containing the amino acid sequence SEQ ID NO: 16 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the
  • Sequence SEQ ID NO: 16 which have the enzymatic property of a hydroxylase.
  • hydroxylases and hydroxylase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID. NO: 16 easy to find.
  • hydroxylases and hydroxylase genes can also be found, for example, starting from the sequence SEQ ID NO: 15 from various organisms. whose genomic sequence is not known, as described above, can easily be found by hybridization and PCR techniques in a manner known per se.
  • nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the hydroxylase of the sequence SEQ ID NO: 16.
  • Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.
  • codons which are frequently used in accordance with the organism-specific "codon usage” are preferably used for this. This "codon usage” can easily be determined on the basis of computer evaluations of other known genes of the organisms in question.
  • a nucleic acid containing the sequence SEQ is brought. ID. NO: 15, in the organism.
  • nucleic acids which encode proteins are preferably used as the ⁇ -cyclase genes, comprising the amino acid sequence SEQ ID NO: 18 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30 %, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 18, and which have the enzymatic property of a ⁇ -cyclase.
  • ⁇ -cyclases and ⁇ -cyclase genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with SEQ ID NO: 18.
  • ⁇ -cyclases and ⁇ -cyclase genes can also be derived, for example, from the sequence SEQ ID NO: 17 from different organisms, whose genomic sequence is not known can easily be found by hybridization and PCR techniques in a manner known per se.
  • nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the ⁇ -cyclase of the sequence SEQ. ID. NO: 18.
  • Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.
  • codons which are frequently used in accordance with the organism-specific "codon usage” are preferably used for this. This "codon usage” can easily be determined on the basis of computer evaluations of other known genes of the organisms in question.
  • a nucleic acid containing the sequence SEQ is brought. ID. NO: 17 in the organism.
  • All of the above-mentioned hydroxylase genes or ⁇ -cyclase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
  • the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897).
  • the attachment of synthetic oligonucleotides and the filling of gaps using the Kleenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
  • these genetically modified organisms can be produced, for example, by introducing individual nucleic acid constructs (expression cassettes) or by introducing multiple constructs which contain up to two or three of the activities described.
  • organisms are preferably understood to mean organisms which, as wild-type or starting organisms, naturally or by genetic complementation and / or reorganization of the metabolic pathways, are capable of producing carotenoids, in particular ⁇ -carotene and / or zeaxanthin and / or neoxanthine and / or violaxanthin and / or to produce lutein.
  • Further preferred organisms already have hydroxylase activity as wild-type or starting organisms and are therefore capable of producing zeaxanthin as wild-type or starting organisms.
  • Preferred organisms are plants or microorganisms, such as bacteria, yeasts, algae or fungi.
  • Both bacteria can be used as bacteria that are able to synthesize xanthophylls due to the introduction of genes of the carotenoid biosynthesis of a carotenoid-producing organism, such as bacteria of the genus Escherichia, which contain, for example, crt genes from Erwinia, as well as bacteria. which are capable of synthesizing xanthophylls, such as, for example, bacteria of the genus Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Paracoccus, Nostoc or cyanobacteria of the genus Synechocystis.
  • Preferred bacteria are Escherichia coli, Erwinia herbicola, Erwinia uredovora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobacterium sp. strain R1534, the Cyanobacterium Synechocystis sp. PCC6803, Paracoccus marcusii or Paracoccus carotinifaciens.
  • yeasts are Candida, Saccharomyces, Hansenula, Pichia or Phaffia. Particularly preferred yeasts are Xanthophyllomyces dendrorhous or Phaffia rhodozyma.
  • Preferred fungi are Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium or others in Indian Chem. Engr. Section B. Vol. 37, No. 1, 2 (1995) on page 15, table 6 described mushrooms.
  • Preferred algae are green algae, such as algae of the genus Haematococcus, Phaedactylum tricornatum, Volvox or Dunaliella. Particularly preferred algae are Haematococcus puvialis or Dunaliella bardawil.
  • Plants selected from the Ranuncu families are particularly preferred plants. iaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Lina- ceae, Vitaceae, Brassicaceae, Cucurbitaceae, Primulaceae, Caryophyl Iaceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae , Poaceae, Orchidaceae, Malvaceae, liliaceae or Lamiaceae.
  • Very particularly preferred plants are selected from the group of the plant genera Marigold, Tagetes errecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aquilegia, Aster, Astragalus, Bignonia, Calendula, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum , Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillaea, Helenium, Helianthus, Hepatica , Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kenya, Labumum, Lathyrus, Leontodon, Lili
  • the cultivation step of the genetically modified organisms is preferably followed by harvesting the organisms and, more preferably, additionally isolating ketocarotenoids from the organisms.
  • the organisms are harvested in a manner known per se in accordance with the respective organism.
  • Microorganisms such as bacteria, yeast, algae or fungi or plant cells, which are cultivated by fermentation in liquid nutrient media, can be separated off, for example, by centrifuging, decanting or filtering. Plants are grown in a conventional manner on nutrient media and corresponds' speaking harvested.
  • the cultivation of the genetically modified microorganisms is preferably carried out in the presence of oxygen at a cultivation temperature of at least about 20 ° C, e.g. 20 ° C to 40 ° C, and a pH of about 6 to 9.
  • the microorganisms are preferably first cultivated in the presence of oxygen and in a complex medium, such as e.g. TB or LB medium at a cultivation temperature of about 20 ° C or more, and a pH of about 6 to 9 until a sufficient cell density is reached.
  • a complex medium such as e.g. TB or LB medium
  • the cultivation is carried out after induction of ketolase expression in the presence of oxygen, e.g. 12 hours to 3 days continued.
  • ketocarotenoids are isolated from the harvested biomass in a manner known per se, for example by extraction and, if appropriate, further chemical or physical purification processes, such as, for example, precipitation methods, crystallography, thermal separation processes, such as rectification processes or physical separation processes, such as, for example, chromatography.
  • the ketocarotenoids in the genetically modified plants according to the invention can preferably be produced specifically in various plant tissues, such as, for example, seeds, leaves, fruits, flowers, in particular in petals.
  • Ketocarotenoids are isolated from the harvested petals in a manner known per se, for example by drying and subsequent extraction and, if appropriate, further chemical or physical purification processes, such as, for example, precipitation methods, crystallography, thermal separation processes, such as rectification processes or physical separation processes, such as chromatography. Ketocarotenoids are isolated from the petals, for example, preferably using organic solvents such as acetone, hexane, ether or tert-methylbutyl ether.
  • ketocarotenoids in particular from petals, are described, for example, in Egger and Kleinig (Phytochemistry (1967) 6, 437-440) and Egger (Phytochemistry (1965) 4, 609-618).
  • ketocarotenoids are preferably selected from the group consisting of astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3'-hydroxyechinenone, adonirubin and adonixanthin.
  • ketocarotenoid is astaxanthin.
  • ketocarotenoids are obtained in free form or as fatty acid esters.
  • the ketocarotenoids are obtained in the process according to the invention in the form of their mono- or diesters with fatty acids.
  • Some proven fatty acids are e.g. Myristic acid, palmitic acid, stearic acid, oleic acid, linolenic acid, and lauric acid (Kamata and Simpson (1987) Comp. Biochem. Physiol. Vol. 86B (3), 587-591).
  • the ketocarotenoids can be produced in the whole plant or, in a preferred embodiment, specifically in plant tissues which contain chromoplasts.
  • Preferred plant tissues are, for example, roots, seeds, leaves, Fruits, flowers and especially nectaries and petals, which are also called petals.
  • genetically modified plants are used which have the highest expression rate of a ketolase in flowers.
  • the gene expression of the ketolase takes place under the control of a flower-specific promoter.
  • the nucleic acids described above, as described in detail below are introduced into the plant in a nucleic acid construct functionally linked with a flower-specific promoter.
  • genetically modified plants are used which have the highest expression rate of a ketolase in fruits.
  • the gene expression of the ketolase takes place under the control of a fruit-specific promoter.
  • the nucleic acids described above, as described in detail below are introduced into the plant in a nucleic acid construct functionally linked with a fruit-specific promoter.
  • genetically modified plants are used which have the highest expression rate of a ketolase in seeds.
  • the gene expression of the ketolase takes place under the control of a seed-specific promoter.
  • the nucleic acids described above, as described in detail below are introduced into the plant in a nucleic acid construct functionally linked with a seed-specific promoter.
  • the targeting in the chrome peaks is carried out by a functionally linked plastid transit peptide.
  • a functionally linked plastid transit peptide The production of genetically modified plants with increased or caused ketolase activity is described as an example.
  • Other activities such as the hydroxylase activity and / or the ⁇ -cyclase activity, can be increased analogously using nucleic acid sequences encoding a hydroxylase or ⁇ -cyclase instead of nucleic acid sequences encoding a ketolase.
  • the transformation can take place individually or through multiple constructs.
  • the transgenic plants are preferably produced by transforming the starting plants, using a nucleic acid construct which contains the nucleic acids described above, encoding a ketolase, which are functionally linked to one or more regulation signals which ensure transcription and translation in plants.
  • nucleic acid constructs in which the coding nucleic acid sequence is functionally linked to one or more regulatory signals which ensure transcription and translation in plants, are also called expression cassettes below.
  • the regulation signals preferably contain one or more promoters which ensure transcription and translation in plants.
  • the expression cassettes contain regulation signals, that is to say regulative nucleic acid sequences, which control the expression of the coding sequence in the host cell.
  • an expression cassette upstream, ie at the 5 'end of the coding sequence, a promoter and downstream, ie at the 3' end, a polyadenylation signal and, if appropriate, further regulatory elements which match the coding sequence for at least one of the above genes described are operatively linked.
  • An operative link is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended when expressing the coding sequence.
  • the preferred nucleic acid constructs, expression cassettes and vectors for plants and methods for producing transgenic plants and the transgenic plants themselves are described below by way of example.
  • sequences which are preferred, but not limited to, for operative linking are targeting sequences to ensure subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochondrion, in the endoplasmic reticulum (ER), in the cell nucleus, in oil bodies or other compartments and Translation enhancers such as the 5 'leader sequence from the tobacco mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711).
  • any promoter which can control the expression of foreign genes in plants is suitable as the promoter of the expression cassette.
  • Constant promoter means those promoters which ensure expression in numerous, preferably all, tissues over a relatively long period of plant development, preferably at all times during plant development.
  • a plant promoter or a plant virus-derived promoter is preferably used.
  • Particularly preferred is the promoter of the 35S transcript of the CaMV cauliflower mosaic virus (Franck et al. (1980) Cell 21: 285-294; Odell et al. (1985) Nature 313: 810-812; Shewmaker et al. (1985) Virology 140: 281-288; Gardner et al. (1986) Plant Mol Biol 6: 221-228), the 19S CaMV promoter (US 5,352,605; WO 84/02913; Benfey et al.
  • TPT triose phosphate translocator
  • Another suitable constitutive promoter is the pds promoter (Pecker et al. (1992) Proc. Natl. Acad. Be USA 89: 4962-4966) or the "Rubisco small subunit (SSU)" promoter (US 4,962,028), the LeguminB Promoter (GenBank Acc. No. X03677), the promoter of nopaline synthase from Agrobacterium, the TR double promoter, the OCS (octopine synthase) promoter from Agrobacterium, the ubiquitin promoter (Holtorf S et al. (1995) Plant Mol Biol 29: 637-649), the ubiquitin 1 promoter (Christensen et al.
  • the expression cassettes can also contain a chemically inducible promoter (review article: Gatz et al. (1997) Annu Rev Plant Physiol Plant Mol Biol 48: 89-108), by means of which the expression of the ketolase gene in the plant is controlled at a specific point in time can.
  • a chemically inducible promoter e.g. the PRP1 promoter (Ward et al. (1993) Plant Mol Biol 22: 361-366), a salicylic acid-inducible promoter (WO 95/19443), a benzenesulfonamide-inducible promoter (EP 0388 186), a tetracycline-inducible promoter Promoter (Gatz et al.
  • promoters that are induced by biotic or abiotic stress such as the pathogen-inducible promoter of the PRP1 gene (Ward et al. (1993) Plant Mol Biol 22: 361-366), the heat-inducible hsp70 or hsp80 Promoter from tomato (US 5,187,267), the cold-inducible alpha-amylase promoter from the potato (WO 96/12814), the light-inducible PPDK promoter or the wound-induced pinII promoter (EP375091).
  • pathogen-inducible promoter of the PRP1 gene Ward et al. (1993) Plant Mol Biol 22: 361-366
  • the heat-inducible hsp70 or hsp80 Promoter from tomato US 5,187,267
  • the cold-inducible alpha-amylase promoter from the potato
  • the light-inducible PPDK promoter or the wound-induced pinII promoter EP375091.
  • Pathogen-inducible promoters include those of genes that are induced as a result of a pathogen attack, such as, for example, genes from PR proteins, SAR proteins, b-1, 3-glucanase, chitinase etc. (for example Redolfi et al. (1983) Neth J Plant Pathol 89: 245-254; Uknes, et al. (1992) The Plant Cell 4: 645-656; Van Loon (1985) Plant Mol Viral 4: 111-116; Marineau et al. (1987) Plant Mol Biol 9 : 335-342; Matton et al. (1987) Molecular Plant-Microbe Interactions 2: 325-342; Somssich et al.
  • suitable promoters are, for example, fruit ripening-specific promoters, such as the fruit ripening-specific promoter from tomato (WO
  • Development-dependent promoters partly include the tissue-specific promoters, since the formation of individual tissues is naturally development-dependent.
  • promoters are particularly preferred which ensure expression in tissues or parts of plants in which, for example, the biosynthesis of ketocarotenoids or their precursors takes place.
  • promoters with specificities for the anthers, ovaries, petals, sepals, flowers, leaves, stems, seeds and roots and combinations thereof.
  • Tuber, storage root or root-specific promoters are, for example, the patatin class I (B33) promoter or the potato cathepsin D inhibitor promoter.
  • Leaf-specific promoters are, for example, the cytosolic promoter
  • FBPase from potato (WO 97/05900), the SSU promoter (small subunit) of Rubisco (ribulose-1, 5-bisphosphate carboxylase) or the ST-LSI promoter from potato (Stockhaus et al. (1989) EMBO J 8: 2445- 2451).
  • Flower-specific promoters are, for example, the phytoene synthase promoter (WO 92/16635) or the promoter of the P-rr gene (WO 98/22593), the AP3 promoter from Arabidopsis thaliana (see Example 5), the CHRC promoter (chromoplast-specific carotenoid-associated protein (CHRC) gene promoter from Cucumis sativus Acc.-No. AF099501, base pair 1 to 1532), the EPSP_Synthase promoter (5-enol-pyruvylshikimate-3-phosphate synthase gene promoter from Petunia hybrida, Acc.-No.
  • CHRC chromoplast-specific carotenoid-associated protein
  • the PDS promoter (Phytoene desaturase gene pro- moter from Solanum lycopersicum, Acc.-No. U46919, base pair 1 to 2078), the DFR-A promoter (dihydroflavonol 4-reductase gene A promoter from Petunia hybrida, Acc.- No. X79723, base pair 32 to 1902) or the FBP1 promoter (Floral Binding Protein 1 gene promoter from Petunia hybrida, Acc.-No. L10115, base pair 52 to 1069).
  • the DFR-A promoter dihydroflavonol 4-reductase gene A promoter from Petunia hybrida, Acc.- No. X79723, base pair 32 to 1902
  • the FBP1 promoter Floral Binding Protein 1 gene promoter from Petunia hybrida, Acc.-No. L10115, base pair 52 to 1069.
  • Anther-specific promoters are, for example, the 5126 promoter (US 5,689,049, US 5,689,051), the glob-1 promoter or the g-zein promoter.
  • Seed-specific promoters are, for example, the ACP05 promoter (acyl carrier protein gene, WO9218634), the promoters AtS1 and AtS3 from Arabidopsis
  • the present invention therefore relates in particular to a nucleic acid construct containing functionally linked a flower-specific or in particular a petal-specific promoter and a nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
  • An expression cassette is preferably produced by fusing a suitable promoter with a nucleic acid described above, encoding a ketolase, and preferably a nucleic acid inserted between promoter and nucleic acid sequence, which codes for a plastid-specific transit peptide, and a polyadenylation signal according to common recombination and cloning technology. techniques such as those described in T. Maniatis, EF Fritsch and J.
  • nucleic acids encoding a plastid transit peptide ensure localization in plastids and in particular in chromoplasts.
  • Expression cassettes can also be used, the nucleic acid sequence of which codes for a ketolase fusion protein, part of the fusion protein being a transit peptide which controls the translocation of the polypeptide.
  • Preferred transit peptides are preferred for the chromoplasts, which are cleaved enzymatically from the ketolase part after translocation of the ketolase into the chromoplasts.
  • the transit peptide which is derived from the plastid Nicotiana tabacum transketolase or another transit peptide (for example the transit peptide of the small subunit of the Rubisco (rbcS) or the ferredoxin NADP oxidoreductase as well as the isopentenyl pyrophosphate isomerase-2) or its functional equivalent is particularly preferred ,
  • Nucleic acid sequences of three cassettes of the plastid transit peptide of plastid transketolase from tobacco in three reading frames are particularly preferred as Kpnl / BamHI fragments with an ATG codon in the Ncol interface:
  • plastid transit peptide examples include the transit peptide of the plastid
  • IPP-2 X ren isopentenyl pyrophosphate isomerase-2
  • rbcS ribulose bisphosphate carboxylase
  • nucleic acids according to the invention can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural nucleic acid constituents, and can consist of different heterologous gene segments from different organisms.
  • various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame.
  • adapters or linkers can be attached to the fragments.
  • the promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction sites for the insertion of this sequence.
  • the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites.
  • the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges.
  • the promoter can be native or homologous as well as foreign or heterologous to the host plant.
  • the expression cassette preferably contains the promoter, a coding nucleic acid sequence or a nucleic acid construct and a region for the transcriptional termination in the 5'-3 'transcription direction. Different termination areas are interchangeable.
  • Examples of a terminator are the 35S terminator (Guerineau et al. (1988) Nucl Acids Res. 16: 11380), the nos terminator (Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM. Nopaline synthase: transcript mapping and DNA sequence. J Mol Appl Genet. 1982; 1 (6): 561-73) or the ocs terminator (Gielen, J, de Beuckeleer, M, Seurinck, J, Debroek, H, de Greve, H , Lemmers, M, van Montagu, M,
  • Manipulations which provide suitable restriction sites or which remove superfluous DNA or restriction sites can also be used. Where insertions, deletions or substitutions such as, for example, transitions and transversions come into question, w ' tro mutagenesis, "primer repair", restriction or ligation can be used.
  • Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially contain T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) from Ti Plasmids correspond to pTiACH ⁇ (Gielen et al., EMBO J. 3 (1984), 835 ff) or functional equivalents.
  • transformation The transfer of foreign genes into the genome of a plant is called transformation.
  • Suitable methods for the transformation of plants are protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene gun - the so-called "particle bombardment” method, electroporation, the incubation of dry embryos in DNA-containing solution, the Microinjection and the Agrobacterium-mediated gene transfer described above.
  • the methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, published by S.D. Kung and R. Wu, Academic Press (1993), 128-143 and in Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225).
  • the construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711) or particularly preferably pSUN2, pSUN3, pSUN4 or pSUN5 (WO 02/00900).
  • Agrobacteria transformed with an expression plasmid can be used in a known manner to transform plants, e.g. by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.
  • the fused expression cassette which expresses a ketolase is cloned into a vector, for example pBin19 or in particular pSUN5 and pSUN3, which is suitable for being transformed into Agrobacterium tumefaciens.
  • Agrobacteria transformed with such a vector can then be used in a known manner to transform plants, in particular cultivated plants. are used, for example, by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.
  • transgenic plants can be regenerated in a known manner which contain a gene integrated into the expression cassette for the expression of a nucleic acid encoding a ketolase.
  • an expression cassette is inserted as an insert in a recombinant vector whose vector DNA contains additional functional regulation signals, for example sequences for replication or integration.
  • additional functional regulation signals for example sequences for replication or integration.
  • Suitable vectors are inter alia in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, pp. 71-119 (1993).
  • the expression cassettes can be cloned into suitable vectors that allow their proliferation, for example in E. coli.
  • suitable cloning vectors include PJIT117 (Guerineau et al. (1988) Nucl. Acids Res. 16: 11380), pBR332, pUC series, M13mp series and pACYC184.
  • Binary vectors which can replicate both in E. coli and in agrobacteria are particularly suitable.
  • Hydroxylase or ⁇ -cyclase are preferably incorporated into expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for an enzyme according to the invention; and vectors comprising at least one of these expression constructs.
  • Such constructs according to the invention preferably comprise a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream and, if appropriate, further customary regulatory elements, in each case operatively linked to the coding sequence.
  • An “operative linkage” is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can perform its function as intended when expressing the coding sequence.
  • sequences which can be linked operatively are targeting sequences as well
  • Translation enhancers include selectable markers, amplification signals, origins of replication and the like.
  • the natural regulatory sequence can still be present before the actual structural gene. This natural regulation can possibly be switched off by genetic modification and the
  • genes can be increased or decreased.
  • the gene construct can also have a simpler structure, ie no additional regulation signals are inserted in front of the structural gene and the natural promoter with its regulation is not removed. Instead, the natural regulatory sequence is mutated so that regulation no longer takes place and gene expression is increased or decreased.
  • the nucleic acid sequences can be contained in one or more copies in the gene construct.
  • Examples of useful promoters in microorganisms are: cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac-, Ipp-lac-, laclq-, T7-, T5-, T3-, gal- , trc, ara, SP6, lambda PR or in the lambda PL promoter, which are advantageously used in gram-negative bacteria; as well as the gram-positive promoters amy and SPO2 or the yeast promoters ADC1, MFa, AC, P-60, CYC1, GAPDH.
  • inducible promoters such as, for example, light and in particular temperature-inducible promoters, such as the P r P r promoter
  • inducible promoters such as, for example, light and in particular temperature-inducible promoters, such as the P r P r promoter
  • all natural prorriotors with their regulatory sequences can be used.
  • synthetic promoters can also be used advantageously.
  • the regulatory sequences mentioned are intended to enable the targeted expression of the nucleic acid sequences and the protein expression. Depending on the host organism, this can mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
  • the regulatory sequences or factors can preferably have a positive influence on the expression and thereby increase or decrease it.
  • the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or "enhancers".
  • an increase in translation is also possible, for example, by improving the stability of the mRNA.
  • An expression cassette is produced by fusing a suitable promoter with the nucleic acid sequences described above, encoding a ketolase, ⁇ -hydroxylase or ⁇ -cyclase and a terminator or polyadenylation signal.
  • Common recombination and cloning techniques are used, such as those described in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in T.J. Silhavy, M.L. Berman and L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausu, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
  • the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector which enables optimal expression of the genes in the host.
  • Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels PH et al., Ed., Elsevier, Amsterdam-New York-Oxford, 1985).
  • vectors also include all other vectors known to the person skilled in the art, such as, for example, phages, viruses such as SV40, CMV, baculovirus and adevirus, transposons, IS elements, phasmids, cosmids, and linear or circular Understand DNA. These vectors can be replicated autonomously in the host organism or replicated chromosomally.
  • fusion expression vectors such as pGEX (Pharmacia Biotech ine; Smith, DB and Johnson, KS (1988) Gene 67: 31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT 5 (Pharmacia, Piscataway, NJ) which glutathione-S-transferase (GST), maltose E-binding protein or protein A is fused to the recombinant target protein.
  • GST glutathione-S-transferase
  • Non-fusion protein expression vectors such as pTrc (Amann et al., (1988) Gene 69: 301-315) and pET 11d (Studier et al. Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (19g ⁇ ) 60-89) or pBluescript and pUC vectors.
  • yeast expression vector for expression in the yeast S. cerevisiae such as pYepSed (Baldari et al., (1987) Embo J. 6: 229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30: 933-943) , pJRY88 (Schultz et al. (1987) Gene 54: 113-123) and pYES2 (Invitrogen Corporation, San Diego, CA).
  • Vectors and methods of constructing vectors suitable for use in other fungi such as filamentous fungi include those described in detail in: van den Hondel, C.A.M.J.J. & Punt, P.J. (1991) "Gene transfer Systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, J.F. Peberdy et al., Eds., Pp. 1-28, Cambridge University Press: Cambridge.
  • Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith et al., (1983) Mol. Cell Biol .. 3: 2156-2165) and pVL series (Lucklow and Summers (1989) Virology 170: 31-39).
  • recombinant constructs according to the invention described above are advantageously introduced and expressed in a suitable host system.
  • Common cloning and transfection methods known to the person skilled in the art such as, for example, co-precipitation, protoplast fusion, electroporation, retroviral transfection and the like, are preferably used to bring the nucleic acids mentioned into expression in the respective expression system. Suitable systems are described, for example, in Current Protocols in Molecular Biology, F. Ausubel et al., Ed., Wiley Interscience, New York 1997.
  • marker genes which are also contained in the vector or in the expression cassette.
  • marker genes are genes for antibiotic resistance and for enzymes which catalyze a coloring reaction which stains the transformed cell. These can then be selected using automatic cell sorting.
  • Microorganisms successfully transformed with a vector and carrying an appropriate antibiotic resistance gene can be selected using appropriate antibiotic-containing media or nutrient media.
  • Marker proteins that are presented on the cell surface can be used for selection by means of affinity chromatography.
  • the invention further relates to a method for producing genetically modified organisms, characterized in that a nucleic acid construct comprising functionally linked a promoter and nucleic acids encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which a Identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2, and optionally introduces a terminator into the genome of the starting organism or extrachromosomally into the starting organism.
  • the invention further relates to the genetically modified organisms, the genetic modification being the activity of a ketolase
  • ketolase activity increased after A or caused after B is caused by a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
  • the ketolase activity is increased or caused compared to the wild type, preferably by increasing or causing the gene expression of a nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
  • the gene expression of a nucleic acid, coding for a ketolase is increased or caused by introducing nucleic acids, coding for a ketolase, into the plants and thus preferably for overexpression or transgenic expression of nucleic acids, coding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.
  • the invention further relates to a genetically modified organism containing at least one transgenic nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO.
  • the invention further relates to a genetically modified organism containing at least two endogenous nucleic acids encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has. This is the case if the starting organism has an endogenous ketolase and the endogenous ketolase is overexpressed.
  • genetically modified organisms additionally have an increased hydroxlase activity and / or ⁇ -cyclase activity compared to a wild-type organism. Further preferred embodiments are described above in the method according to the invention.
  • organisms are preferably understood to mean organisms which, as wild-type or starting organisms, naturally or by genetic complementation and / or reorganization of the metabolic pathways, are capable of producing carotenoids, in particular ⁇ -carotene and / or zeaxanthin and / or neoxanthine and / or violaxanthin and / or to produce lutein.
  • Further preferred organisms already have hydroxylase activity as wild-type or starting organisms and are therefore capable of producing zeaxanthin as wild-type or starting organisms.
  • Preferred organisms are plants or microorganisms, such as bacteria, yeasts, algae or fungi.
  • Both bacteria can be used as bacteria which, due to the introduction of genes of the carotenoid biosynthesis of a carotenoid-producing organism, must be able to synthesize xanthophylls, such as, for example, bacteria of the genus Escherichia, which, for example, contain crt genes from Erwinia, and also bacteria which are capable of synthesizing xanthophylls, such as, for example, bacteria of the genus Erwinia, Agrobacterium , Flavobacterium, Alcaligenes, Paracoccus, Nostoc or cyanobacteria of the genus Synechocystis.
  • xanthophylls such as, for example, bacteria of the genus Escherichia, which, for example, contain crt genes from Erwinia
  • bacteria which are capable of synthesizing xanthophylls such as, for example, bacteria of the genus Erwinia, Agrobacterium , Flavobacter
  • Preferred bacteria are Escherichia coli, .Erwinia herbicola, Erwinia uredovora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobacterium sp. strain R1534, the Cyanobacterium Synechocystis sp. PCC6803, Paracoccus marcusii or Paracoccus carotinifaciens.
  • yeasts are Candida, Saccharomyces, Hansenula, Pichia or Phaffia. Particularly preferred yeasts are Xanthophyllomyces dendrorhous or Phaffia rhodozyma.
  • Preferred fungi are Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium or others in Indian Chem. Engr. Section B. Vol. 37, No. 1, 2
  • Preferred algae are green algae, such as algae of the genus Haematococcus, Phaedactylum tricornatum, Volvox or Dunaliella. Particularly preferred algae are Haematococcus puvialis or Dunaliella bardawil.
  • Particularly preferred plants are plants selected from the Ranuncu-laceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Lina- ceae, Vitaceae, Brassicaceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Amaranthaceae, Geraniaceaeaceae, Gentianaceaeaea, Gentianaceae , • Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Orchidaceae, Malvaceae, liliaceae or Lamiaceae.
  • Very particularly preferred plants are selected from the group of the plant species chard, tagetes errectta, tagetes patula, acacia, aconite, adonis, ami ca, Aquilegia, Aster, Astragalus, Bignonia, Calenduia, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Foria, Forsy Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Laburnum, Lathyrus, Leonto
  • Very particularly preferred genetically modified plants are selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Adonis, Lycopersicon; Rosa, Calenduia, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium or Tropaeolum, the genetically modified plant containing at least one transgenic nucleic acid, coding for a ketolase.
  • the present invention further relates to the transgenic plants, their reproductive material and their plant cells, tissue or parts, in particular their fruits, seeds, flowers and petals.
  • the genetically modified plants can be used to produce ketocarotenoids, in particular astaxanthin.
  • Genetically modified organisms according to the invention which can be consumed by humans and animals, in particular plants or parts of plants, such as in particular petals with an increased content of ketocarotenoids, in particular astaxanthin, can also be used, for example, directly or after processing known per se as foods or feeds or as feed and food supplements become. Furthermore, the genetically modified organisms can be used for the production of ketocarotenoid-containing extracts of the organisms and / or for the production of feed and food supplements.
  • the genetically modified organisms have an increased ketocarotenoid content compared to the wild type.
  • An increased ketocarotenoid content is generally understood to mean an increased total ketocarotenoid content.
  • ketocarotenoids is also understood to mean, in particular, a changed content of the preferred ketocarotenoids, without the total carotenoid content necessarily having to be increased.
  • the genetically modified plants according to the invention have an increased astaxanthin content compared to the wild type.
  • an increased content is also understood to mean a caused content of ketocarotenoids or astaxanthin.
  • the invention further relates to the new ketolases and the new nucleic acids encoding them.
  • the invention relates to ketolases containing the amino acid sequence SEQ. ID. NO. 8 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 8, with the proviso that the amino acid sequences SEQ ID NO: 4 is not included.
  • the sequence SEQ ID NO: 4, as mentioned above, is annotated as a putative protein in databases.
  • the invention further relates to ketolases containing the amino acid sequence SEQ. ID. NO. 6 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% on amino acid level with the sequence SEQ. ID. NO. 6 has.
  • the sequence SEQ ID NO: 6, as mentioned above, is not annotated in databases.
  • the invention relates to ketolases containing the amino acid sequence SEQ. ID. NO. 12 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 12, with the proviso that the amino acid sequences SEQ ID NO: 6 is not included.
  • the invention further relates to ketolases containing the amino acid sequence SEQ. ID. NO. 49 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 50%, preferably at least 60%, particularly preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 49, with the proviso that the amino acid sequences SEQ ID NO: 47 is not included.
  • the sequence SEQ ID NO: 47 is, as mentioned above, annotated as a putative protein in databases.
  • the invention further relates to nucleic acids encoding a protein described above, with the proviso that the nucleic acid does not contain the sequence SEQ ID NO: 5.
  • a protein containing the amino acid sequence SEQ. ID. NO. 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 4 and has the property of a ketolase has a property as a ketolase.
  • the invention therefore also relates to the use of a protein containing the amino acid sequence SEQ. ID. NO. 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the SEQ sequence. ID. NO. 4 and has the property of a ketolase as a ketolase.
  • a protein containing the amino acid sequence SEQ. ID. NO. 6 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has an identity of at least 65%, preferably at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the SEQ sequence. ID. NO. 6 and has the property of a ketolase, has a property as a ketolase.
  • the invention therefore also relates to the use of a protein containing the amino acid sequence SEQ. ID. NO. 6 or one of this sequence by substitution,
  • Insertion or deletion of amino acid-derived sequence which has an identity of at least 65%, preferably at least 70%, preferably at least 75%, x particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level the sequence SEQ. ID. NO. 6 and has the property of a ketolase as a ketolase.
  • a protein containing the amino acid sequence SEQ. ID. NO. 47 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has an identity of at least 50%, preferably at least 60%, preferably at least 70%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90% , more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 47 and has the property of a ketolase, has a property as a ketolase.
  • the invention therefore also relates to the use of a protein containing the amino acid sequence SEQ. ID. NO. 47 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 50%, preferably at least 60%, preferably at least 70%, particularly preferably at least 80%, more preferably at least 85% at least 90%, more preferably at least 95% at the amino acid level with the SEQ sequence. ID. NO. 47 and has the property of a ketolase as ketolase.
  • the process according to the invention provides a higher amount of ketocarotenoids, in particular astaxanthin with a lower amount of hydroxylated by-products.
  • the sequencing of recombinant DNA molecules was carried out using a laser fluorescence DNA sequencer from Licor (distributed by MWG Biotech, Ebersbach) according to the
  • the DNA required for the NOST ketolase from Nostoc sp. PCC 7120 coded was by means of PCR from Nostoc sp. PCC 7120 (strain of the "Pasteur Culture Collection of Cyanobacterium”) amplified.
  • the bacterial cells were pelleted from a 10 ml liquid culture by centrifugation at 8,000 rpm for 10 minutes. The bacterial cells were then crushed and ground in liquid nitrogen using a mortar. The cell material was resuspended in 1 ml of 10 mM Tris HCl (pH 7.5) and transferred to an Eppendorf reaction vessel (2 ml volume). After adding 100 ⁇ l Proteinase K (concentration: 20 mg / ml), the cell suspension was incubated for 3 hours at 37 ° C. The suspension was then extracted with 500 ⁇ l of phenol. After centrifugation at 13,000 rpm for ⁇ minutes, the upper, aqueous phase was transferred to a new 2 ml Eppendorf reaction vessel.
  • the extraction with phenol was repeated 3 times.
  • the DNA was precipitated by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 0.6 volume of isopropanol and then washed with 70% ethanol.
  • the DNA pellet was dried at room temperature, taken up in 25 ⁇ l of water and dissolved with heating to 65 ° C.
  • the nucleic acid encoding a ketolase from Nostoc PCC 7120 was determined by means of a "polymerase chain reaction” (PCR) from Nostoc sp.
  • PCC 7120 was amplified using a sense-specific primer (NOSTF, SEQ ID No. 19) and an antisense-specific primer (NOSTG SEQ ID No. 20).
  • the PCR conditions were as follows:
  • the PCR for the amplification of the DNA which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 ⁇ l reaction mixture which contained:
  • the PCR was carried out under the following cycle conditions: 1X 94 ° C 2 minutes 35X 94 ° C 1 minute 55 ° C 1 minutes 72 ° C 3 minutes
  • PCR amplification with SEQ ID No. 19 and SEQ ID No. 20 resulted in an 805 bp fragment that codes for a protein consisting of the entire primary sequence (SEQ ID No. 21).
  • the amplificate was cloned into the PCR cloning vector pGEM-T (Promega) and the clone pNOSTF-G was obtained.
  • This clone pNOSTF-G was therefore used for the cloning into the expression vector pJIT117 (Guerineau et al. I g88, Nucl. Acids Res. 16: 11380). Cloning was carried out by isolating the 799 bp Sphl fragment from pNOSTF-G and ligation into the Sphl cut vector pJIT117.
  • the clone that is the ketolase from Nostoc sp. PCC 7120, in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide, is called pJNOST.
  • PMCL-CrtYlBZ / idi / gps was constructed in three steps using the intermediate stages pMCL-CrtYlBZ and pMCL-CrtYlBZ / idi.
  • the plasmid pMCL200 compatible with high-copy-number vectors was used as the vector (Nakano, Y., Yoshida, Y., Yamashita, Y. and Koga, T .; Construction of a series of pACYC-derived plasmid vectors; Gene 162 ( 1995), 157-158).
  • Example 2.1. Construction of pMCL-CrtYlBZ
  • the biosynthetic genes crtY, crtB, crtl and crtZ come from the bacterium Erwinia ure- dovora and were amplified by PCR.
  • Erwinia uredovora genomic DNA (DSM 30080) was prepared by the German Collection of Microorganisms and Cell Culture (DSMZ, Braunschweig) as part of a service.
  • the PCR reaction was carried out according to the manufacturer's instructions (Röche, Long Template PCR: Procedure for amplification of 5-20 kb targets with the expand long template PCR system).
  • the PCR conditions for the amplification of the Erwinia uredovora biosynthesis cluster were as follows:
  • the plasmid pCR2.1-CrtYIBZ was cut Sall and Hindill, the resulting Sall / Hindlll fragment isolated and transferred by ligation into the Sall / Hindlll cut vector pMCL200.
  • the Sall / Hindlll fragment from pCR2.1-CrtYIBZ cloned in pMCL 200 is 4624 bp long, codes for the genes CrtY, CrtI, crtB and CrtZ and corresponds to the sequence from positions 2295 to 6918 in D90087 (SEQ ID No. 24).
  • the resulting clone is called pMCL-CrtYlBZ.
  • Example 2.2 Construction of pMCL-CrtYlBZ / idi
  • the gene / d / ' (isopentenyl diphosphate isomerase; IPP isomerase) was amplified from E coli by means of PCR.
  • the nucleic acid encoding the entire / cf gene with idi promoter and ribosome binding site was extracted from E. coli by means of "polymerase chain reaction” (PCR) using a sense-specific primer (5'-idi SEQ ID No. 28) and an antisense-specific primer (3'-idi SEQ ID No.29).
  • PCR polymerase chain reaction
  • the PCR conditions were as follows:
  • the PCR for the amplification of the DNA was carried out in a 50 ⁇ l reaction mixture, which contained:
  • the PCR was carried out under the following cycle conditions: 1X 94 ° C 2 minutes 20X 94 ° C 1 minute
  • PCR amplification with SEQ ID No. 28 and SEQ ID No. 29 resulted in a 679 bp fragment coding for a protein consisting of the entire primary sequence (SEQ ID No. 30).
  • the amplificate was cloned into the PCR cloning vector pCR2.1 (Invitrogen) and the clone pCR2.1-idi was obtained.
  • Sequencing of the clone pCR2.1-idi confirmed a sequence that does not differ from the published sequence AE000372 in position 8774 to position 9440.
  • This region comprises the promoter region, the potential ribosome binding site and the entire "open reading frame" for the IPP isomerase.
  • the fragment cloned into pCR2.1-idi has a total length of 679 bp by inserting an Xhol site at the 5 'end and a SalI site at the 3' end of the gene.
  • This clone was therefore used for the cloning of the / oY gene in the vector pMCL-CrtYlBZ.
  • the cloning was carried out by isolating the Xhol / Sall fragment from pCR2.1-idi and ligating into the Xhol / Sall cut vector pMCL-CrtYlBZ.
  • the resulting clone is called pMCL-CrtYlBZ / idi.
  • Example 2.3 Construction of pMCL-CrtYlBZ / idi / gps
  • the gene gps (geranylgeranyl pyrophosphate synthase; GGPP synthase) was amplified from Archaeoglobus fulgidus by means of PCR.
  • the DNA of Archaeoglobus fulgidus was prepared by the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig) as part of a service.
  • the PCR conditions were as follows: The PCR for the amplification of the DNA, which codes for a GGPP synthase protein consisting of the entire primary sequence, was carried out in a 50 ⁇ l reaction mixture which contained:
  • the PCR was carried out under the following cycle conditions:
  • SEQ ID No. 32 and SEQ ID No. 33 amplified DNA fragments were eluted from the agarose gel using methods known per se and cut with the restriction enzymes Ncol and Hindill. This results in a 962 bp fragment which codes for a protein consisting of the entire primary sequence (SEQ ID No. 34).
  • Ncol / HindIII cut amplificate was cloned into the vector pCB97-30 and the clone pCB-gps was obtained.
  • Sequencing of the clone pCB-gps confirmed a sequence for the GGPP synthase from A. fulgidus, which differs from the published sequence AF120272 in one nucleotide.
  • the second codon of the GGPP synthase was changed by inserting an Ncol site in the gps gene.
  • CTG position 4-6
  • this second codon was changed to GTG, which codes for valine.
  • the clone pCB-gps was therefore used for the cloning of the gps gene into the vector pMCL-CrtYlBZ / idi.
  • the cloning was carried out by isolating the Kpnl / Xhol fragment from pCB-gps and ligation into the Kpnl and Xhol cut vector pMCL-CrtYlBZ / idi.
  • the cloned Kpnl / Xhol fragment (SEQ ID No.
  • GGPP synthase 34 carries the Prm16 promoter together with a minimal 5 'UTR sequence of rbcL, the first 6 codons of rbcL, which extend the GGPP synthase N-terminally, and 3 'from the gps gene the psbA sequence.
  • the N-terminus of the GGPP synthase thus has the changed amino acid sequence Met-Thr-Pro-Gln-Thr-Ala-Met instead of the natural amino acid sequence with Met-Leu-Lys-Glu (amino acid 1 to 4 from AF120272) -Val-Lys- GIu.
  • the recombinant GGPP synthase starting with Lys in position 3 (in AF120272), is identical and has no further changes in the amino acid sequence.
  • the rbcL and psbA sequences were based on a reference according to Eibl et al. (Plant J. 1. (I 99), 1-13).
  • the resulting clone is called pMCL-CrtYlBZ / idi / gps.
  • E. co // strains were produced which are capable of producing zeaxanthin by heterologous complementation.
  • Strains of E. coli TOP10 were used as host cells for the complementation experiments with the plasmids pNOSTF-G and pMCL-CrtYlBZ / idi / gps.
  • the plasmid pMCL-CrtYlBZ / idi / gps was constructed in order to produce E. co // strains which enable the synthesis of zeaxanthin in high concentrations.
  • the plasmid carries the genes crtY, crtB, crtl and crtY from Erwinia uredovora, the gene gps (for geranylgeranyl pyrophoshate synthastase) from Archaeoglobus fulgidus and the gene / ⁇ / (isopentenyl diphosphate isomerase) from E. coli. Limiting steps for a high accumulation of carotenoids and their biosynthetic precursors were eliminated with this construct.
  • the cells were extracted with acetone, the organic solvent was evaporated to dryness and the carotenoids were separated by means of HPLC on a C30 column. The following procedural conditions were set.
  • the spectra were determined directly from the elution peaks using a photodiode array detector.
  • the isolated substances were identified by their absorption spectra and their retention times in comparison to standard samples.
  • Figure 1 shows the chromatographic analysis of a sample obtained from an E. co // strain transformed with pNOSTF-G and pMCL-CrtYlBZ / idi / gps. It appears, that this strain can synthesize various ketocarotenoids due to the heterologous complementation. With increasing retention time, astaxanthin (peak 1), adonirubin (peak 2) and canthaxanthin (peak 3) are eluted.
  • a E. coli strain was produced as a comparative example, which contains a ketolase from Haematococcus pluvialis Flotow em. Will expressed.
  • the cDNA was used for the entire primary sequence of the ketolase from Haematococcus pluvialis Flotow em. Wille coded amplified and cloned into the same expression vector according to Example 1.
  • the cDNA coding for the ketolase from Haematococcus pluvialis was amplified by means of PCR from Haematococcus pluvialis (strain 192.80 from the "Collection of algal cultures of the University of Göttingen") suspension culture.
  • RNA For the preparation of total RNA from a suspension culture of Haematococcus pluvialis (strain 192.80), which with indirect daylight at room temperature for 2 weeks in Haematococcus medium (1.2 g / l sodium acetate, 2 g / l yeast extract, 0.2 g / l MgCI2x6H2O , 0.02 CaCI2x2H2O; pH 6.8; after autoclaving 400 mg / l L-Asparagine, 10 mg / l FeSO4xH2O) had been grown, the cells were harvested, frozen in liquid nitrogen and pulverized in a mortar.
  • Haematococcus pluvialis strain 192.80
  • RNA For the cDNA synthesis, 2.5 ⁇ g of total RNA were denatured for 10 min at 60_C, cooled on ice for 2 min and used using a cDNA kit (ready-to-go-you-prime-beads, Pharmacia Biotech) according to the manufacturer's instructions of an antisense-specific primer PR1 (gcaagctcga cagctacaaa cc) was rewritten in cDNA.
  • a cDNA kit ready-to-go-you-prime-beads, Pharmacia Biotech
  • the nucleic acid encoding a kematolase from Haematococcus pluvialis was amplified by means of a polymerase chain reaction (PCR) from Haematococcus pluvialis using a sense-specific primer PR2 (gaagcatgca gctagcagcg acag) and an antisense-specific primer PR1.
  • PCR polymerase chain reaction
  • the PCR conditions were as follows:
  • the PCR for the amplification of the cDNA which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 ml reaction mixture which contained:
  • the PCR was carried out under the following cycle conditions:
  • the PCR amplification with PR1 and PR2 resulted in a 1155 bp fragment consisting encodes a protein consisting of the entire primary sequence: gaagcatgca gctagcagcg acagtaatgt tggagcagct taccggaagc gctgaggcac 60 tcaaggagaa ggagaaggag gttgcaggca gctctgacgt gtgtaca tgggcgaccc 120 agtactcgct tccgtcagag gagtcagacg cggccccc gggactgaag aatgcctaca 180 agccaccaccacc ttccgacaca aagggcatca caatggcgct agctcatc ggctctggg 240 ccgcagtgttt c
  • the amplificate was cloned into the PCR cloning vector pGEM-Teasy (Promega) and the clone pGKETO2 was obtained.
  • This clone was used for the cloning in the expression vector described in Example 1.
  • the cloning was carried out analogously to that described in Example 1.
  • the transformation of the E. coli strains, their cultivation and the analysis of the carotenoid profile were carried out as described in Example 3.
  • Figure 2 shows the chromatographic analysis of a sample obtained from an E. co // strain transformed with this expression vector and pMCL-CrtYlBZ / idi / gps.
  • a ketolase from Haematococcus pluvialis as described for example in EP 725137, elute with increasing retention time astaxanthin (peak 1), adonixanthin (peak 2) and unreacted zeaxanthin (peak 3).
  • This carotenoid profile has already been described in EP 0725137.
  • Table 1 shows a comparison of the bacterially produced amounts of carotenoids:
  • Table 1 Comparison of the bacterial ketocarotenoid synthesis using two different ketolases, the NOST ketolase from Nostoc sp. PCC7120 (Example 3) and the ketolase from Haematococcus pluvialis as a comparative example (Example 3.1). Amounts of carotenoids are given in ng / ml culture fluid.
  • ketolase from Nostoc sp. Strain PCC7120 leads to a carotenoid pattern, which differs significantly from the carotenoid pattern after expression of a ketolase from Haematococcus pluvialis. While the keto lens from the prior art provides the desired ketocarotenoid astaxanthin only incompletely, astaxanthin is the main product when using the ketolase according to the invention. In the process according to the invention, hydroxylated by-products occur in a significantly smaller amount.
  • the expression of the NOST ketolase from Nostoc sp. PCC7120 in Lesculentum and in Tagetes erecta was carried out under control of the constitutive promoter FNR (ferredoxin-NADPH-oxidoreductase, database entry AB011474 position 70127 to 69493; WO03 / 006660) from Arabidopsis thallana.
  • FNR constitutive promoter
  • the FNR gene begins at base pair 69492 and is annotated with "ferredoxin-NADP + reductase”. Expression was carried out using the pea transit peptide rbcS (Anderson et al. 1986, Biochem J. 240: 709-715).
  • the DNA fragment containing the FNR promoter region from Arabidopsis thallana was PCR-analyzed using genomic DNA (isolated from Arabidopsis thallana according to standard methods) as well as the primers FNR-A (SEQ ID No.38) and FNR-B (SEQ ID No. 39).
  • the PCR conditions were as follows:
  • the PCR for the amplification of the DNA which contains the FNR promoter fragment FNR # 1), was carried out in a 50 ⁇ l reaction mixture which contained: 100 ng genomic DNA from A.thaliana 0.25 mM dNTPs 0.2 mM FNR-A (SEQ ID No. 38) 0.2 mM FNR-B (SEQ ID No. 39) - 5 ⁇ l IOX PCR buffer (Stratagene)
  • the PCR was carried out under the following cycle conditions:
  • the 647 bp amplificate was determined using standard methods in the PCR
  • Cloning vector pCR 2.1 (Invitrogen) cloned and the plasmid pFNR # 1 obtained.
  • Sequencing of clone pFNR # 1 confirmed a sequence which corresponds to a sequence section on chromosome 5 of Arabidopsis thaliana (database entry AB011474; WO03 / 006660) from position 70127 to 6g4g3.
  • the FNR gene begins - at base pair 6g4 2 and is annotated with "ferredoxin-NADP + reductase".
  • pFNR was therefore used for cloning into the expression vector pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380).
  • the cloning was carried out by isolating the 637 bp Sacl-Hindlll fragment from pFNR # 1 (partial Sacl hydrolysis) and ligating into the Sacl-Hindlll cut vector pJIT117.
  • the clone that contains the promoter FNR # 1 instead of the original promoter d35S is called pJITFNR.
  • the 799 bp SpHI fragment NOSTF-G (described in Example 1) was cut into the SpHI vector pJITFNR cloned.
  • the clone that contains the fragment NOSTF-G in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJFNRNOST.
  • An expression cassette for the Agrobacterium -mediated transformation of the ketolase from Nostoc into lesculentum was produced using the binary vector pSUN3 (WO0200900).
  • fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP fragment the rbcS transit peptide from pea (194 bp), fragment Nost Ketolase CDS (777 bp) the entire primary sequence coding for the Nostoc Ketolase, fragment 35S Term (746 bp) the polyadenylation signal of CaMV.
  • An expression cassette for the Agrobacterium-vet rMeWe transformation of the expression vector with the ketolase from Nostoc in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).
  • fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS transit peptide the rbcS transit peptide from pea (1 g4 bp), fragment Nost ketolase (777 bp) the entire primary sequence, coding for the nostoc ketolase, fragment 35S Terminator (746 bp) the CaMV polyadenylation signal.
  • the expression of the ketolase from Nostoc in L. esculentum and Tagetes erecta was carried out with the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715).
  • the expression was carried out under the control of a modified version AP3P of the flower-specific promoter AP3 from Arabidopsis thaliana (AL132971: nucleotide region 9298-10200; Hill et al. (1998) Development 125: 1711-1721).
  • the DNA fragment which contains the AP3 promoter region -902 to +15 from Arabidopsis thalia- na, was PCR-analyzed using genomic DNA (isolated from Arabidopsis thaliana according to standard methods) and the primers AP3-1 (SEQ ID No.41) and AP3 -2 (SEQ ID No. 42).
  • the PCR conditions were as follows:
  • the PCR for the amplification of the DNA which contains the AP3 promoter fragment (-902 to +15), was carried out in a 50 ⁇ l reaction mixture, which contained:
  • the PCR was carried out under the following cycle conditions:
  • the 2 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pAP3 was obtained.
  • Sequencing of the clone pAP3 confirmed a sequence consisting only of an insertion (a G in position g765 of the sequence AL132g71) and a base exchange (a G instead of an A in position g726 of the sequence AL132971) of the published AP3 sequence (AL132g71, nucleotide region g2g8-10200) differs. These nucleotide differences were reproduced in an independent amplification experiment and thus represent the actual nucleotide sequence in the Arabidopsis thaliana plants used.
  • the modified version AP3P was produced by means of recombinant PCR using the plasmid pAP3.
  • the region 10200 - g771 was amplified with the primers AP3-1 (SEQ ID No. 41) and primers AP3-4 (SEQ ID No. 44) (amplificate A1 / 4), the region g526-g285 with the AP3-3 (SEQ ID No. 43) and AP3-2 (SEQ ID No. 42) amplified (amplificate A2 / 3).
  • the PCR conditions were as follows:
  • the PCR was carried out under the following cycle conditions:
  • the recombinant PCR includes annealing of the amplificates A1 / 4 and A2 / 3, which overlap over a sequence of 25 nucleotides, completion into a double strand and subsequent amplification.
  • the denaturation (5 min at 95 ° C.) and annealing (slow cooling at room temperature to 40 ° C.) of both amplicons A1 / 4 and A2 / 3 was carried out in a 17.6 ⁇ l reaction mixture which contained:
  • the nucleic acid coding for the modified promoter version AP3P was amplified by means of PCR using a sense-specific primer (AP3-1 SEQ ID No. 41) and an antisense-specific primer (AP3-2 SEQ ID No. 42).
  • the PCR conditions were as follows:
  • the PCR for the amplification of the AP3P fragment was carried out in a 50 ⁇ l reaction mixture, which contained:
  • the PCR was carried out under the following cycle conditions:
  • the amplificate was cloned into the cloning vector pCR2.1 (Invitrogen) and the plasmid pAP3P was obtained. Sequencing with the primers T7 and M13 confirmed a sequence identical to the sequence AL132971, region 10200-92g8, the internal region g285-g526 being deleted. This clone was therefore used for the cloning into the expression vector pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380).
  • the cloning was carried out by isolating the 767 bp SacI-HindIII fragment from pAP3P and ligating into the SacI-HindIII cut vector pJIT117.
  • the clone that contains the promoter AP3P instead of the original promoter d35S is called pJITAP3P.
  • the 79 g bp SpHI fragment NOSTF-G (described in Example 1) was cloned into the SpHI-cut vector pJITAP3P.
  • the clone that contains the fragment NOSTF-G in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJAP3PNOST.
  • An expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled ketolase from Nostoc to Lesculentum was produced using the binary vector pSUN3 (WO02 / 00900).
  • fragment AP3P PROMOTER contains the modified AP3P promoter (765 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NOST KETOLASE CDS (777bp) the entire primary sequence coding for the nostoc ketolase, fragment 35S TERM (746 bp) the polyadenylation signal of CaMV.
  • An expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled ketolase from Nostoc into Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).
  • fragment AP3P PROMOTER contains the modified AP3P promoter (765 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (207 bp), fragment NOST KETOLASE CDS (777 bp) the entire primary sequence coding for the nostoc ketolase, fragment 35S TERM (746 bp) the polyadenylation signal of CaMV.
  • X was amplified by PCR from Nostoc punctiform ATCC 29133 (strain of the "American Type Culture Collection").
  • the bacterial cells were pelleted from a 10 ml liquid culture by centrifugation at 8000 rpm for 10 minutes. The bacterial cells were then crushed and ground in liquid nitrogen using a mortar. The cell material was resuspended in 1 ml of 10 mM Tris_HCI (pH 7.5) and placed in an Eppendorf reaction vessel (2 ml of lumen) transferred. After adding 100 ⁇ l Proteinase K (concentration: 20 mg / ml), the cell suspension was incubated for 3 hours at 37 ° C. The suspension was then extracted with 500 ⁇ l of phenol.
  • the upper, aqueous phase was transferred to a new 2 ml Eppendorf reaction vessel i.
  • the extraction with phenol was repeated 3 times.
  • the DNA was precipitated by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 0.6 volume of isopropanol and then washed with 70% ethanol.
  • the DNA pellet was dried at room temperature, taken up in 25 ⁇ l of water and dissolved with heating to 65 ° C.
  • the nucleic acid encoding a ketolase from Nostoc punctiform ATCC 29133 was determined by means of a "polymerase chain reaction” (PCR) from Nostoc punctiform ATCC 29133 using a sense-specific primer (NP196-1, SEQ ID No. 54) and an antisense-specific Primers (NP196-2 SEQ ID No. 55) amplified.
  • PCR polymerase chain reaction
  • the PCR conditions were as follows:
  • the PCR for the amplification of the DNA which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 ⁇ l reaction mixture which contained
  • the PCR was carried out under the following cycle conditions:
  • PCR amplification with SEQ ID No. 54 and SEQ ID No. 55 resulted in a 792 bp fragment that codes for a protein consisting of the entire primary sequence (NPig ⁇ , SEQ ID No. 56).
  • the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNP196 was obtained.
  • pJIT117 was modified by using the 35S terminator through the OCS terminator (octopine synthase) of the Ti plasmid pTi15g55 from Agrobacterium tumefaciens (database entry X004g3 from position 12.541-12.350, Gielen et al. (ig84) EMBO J. 3835-846 ) was replaced.
  • the DNA fragment which contains the OCS terminator region was PCR-isolated using the plasmid pHELLSGATE (database entry AJ311874, Wesley et al. (2001) Plant J. 27581-590, isolated from E. coli by standard methods) and the primer OCS -1 (SEQ ID No. 58) and OCS-2 (SEQ ID No. 59).
  • the PCR conditions were as follows:
  • the PCR for the amplification of the DNA which contains the octopine synthase (OCS) terminator region (SEQ ID No. 60), was carried out in a 50 ⁇ l reaction mixture, which contained: 100 ng pHELLSGATE plasmid DNA 0.25 mM dNTPs 0.2 mM OCS-1 (SEQ ID No. 58) 0.2 mM OCS-2 (SEQ ID No. 5) 5 ul IOX PCR buffer (Stratagene) 0.25 ul Pfu polymerase (Stratagene) 28.8 ul aq. Least.
  • OCS octopine synthase
  • the PCR was carried out under the following cycle conditions:
  • the 210 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pOCS was obtained.
  • Sequencing of the clone pOCS confirmed a sequence which corresponds to a sequence section on the Ti plasmid pTi15955 from Agrobacterium tumefaciens (database entry X00493) from positions 12,541 to 12,350.
  • the cloning was carried out by isolating the 210 bp Sall-Xhol fragment from pOCS and ligation into the Sall-Xhol cut vector pJIT117.
  • This clone is called pJO and was therefore used for the cloning into the expression vector pJONP196.
  • the cloning was carried out by isolating the 782 bp Sphl fragment from pNP196 and ligating into the SphI cut vector pJO.
  • the clone that contains the Nostoc punctiforme NPig6 ketolase in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJONP196.
  • the expression of the NP196 ketolase from Nostoc punctiforme in L. esculentum and in Tagetes erecta was carried out under the control of the constitutive promoter FNR (ferredoxin NADPH oxidoreductase, database entry AB011474 position 70127 to 694g3; WO03 / 006660), from Arabidopsis thallana.
  • FNR constitutive promoter
  • the FNR gene begins at base pair 69492 and is annotated with "ferredoxin-NADP + reductase”. Expression was carried out using the pea transit peptide rbcS (Anderson et al. 1986, Biochem J. 240: 709-715).
  • the DNA fragment containing the FNR promoter region from Arabidopsis thallana was PCR-analyzed using genomic DNA (isolated from Arabidopsis thaliana according to standard methods) and the primers FNR-1 (SEQ ID No. 61) and FNR-2 (SEQ ID No. 62).
  • the PCR conditions were as follows:
  • the PCR for the amplification of the DNA which contains the FNR promoter fragment FNR (SEQ ID No. 63), was carried out in a 50 ⁇ l reaction mixture which contained:
  • the PCR was carried out under the following cycle conditions:
  • the 652 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Jnvitrogen) using standard methods and the plasmid pFNR was obtained.
  • Sequencing of the clone pFNR confirmed a sequence which corresponds to a sequence section on chromosome 5 of Arabidopsis thaliana (database entry AB011474) from position 70127 to 6g493.
  • This clone is called pFNR and was therefore used for the cloning into the expression vector pJONP196 (described in Example 6).
  • the cloning was carried out by isolating the 644 bp Smal-Hindlll fragment from pFNR and ligating into the Ecl136ll-Hindlll cut vector pJONP196.
  • the clone which contains the promoter FNR instead of the original promoter d35S and the fragment NP196 in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJOFNR: NP196.
  • fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (ig4 bp), fragment NP196 KETO CDS (761 bp), coding for the nostoc punctiform NPig ⁇ ketolase, fragment OCS W2 bp) the polyadenylation signal from the octopine synthase.
  • fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP196 KETO CDS (761 bp), coding for the nostoc punctiform NP196 ketolase, Fragment OCS terminator (192 bp) the octopine synthase polyadenylation signal.
  • Example 8 Production of expression vectors for the flower-specific expression of the NP196 ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum and Tagetes erecta
  • NPig ⁇ -ketolase from Nostoc punctiforme in Lesculentum and Unes erecta was carried out with the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715). Expression was carried out under the control of the flower-specific promoter EPSPS from Petunia hybrida (database entry M37029: nucleotide region 7-1787; Benfey et al. (1990) Plant Cell 2: 849-856).
  • the DNA fragment which contains the EPSPS promoter region (SEQ ID No. 66) from Petunia hybrida, was PCR-analyzed using genomic DNA (isolated from Petunia hybrida according to standard methods) and the primers EPSPS-1 (SEQ ID No. 64) and EPSPS -2 (SEQ ID No. 65).
  • the PCR conditions were as follows:
  • the PCR for the amplification of the DNA which contains the EPSPS promoter fragment (database entry M37029: nucleotide region 7-1787), was carried out in a 50 ⁇ l reaction mixture which contained:
  • the PCR was carried out under the following cycle conditions:
  • the 1773 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pEPSPS was obtained.
  • Sequencing of the clone pEPSPS confirmed a sequence consisting only of two deletions (bases ctaagtttcagga in position 46-58 of sequence M3702g; bases aaaaatat in positions 1422-142g of sequence M3702g) and the base exchanges (T instead of G in position 1447 of sequence M3702g ; A instead of C in position 1525 of sequence M3702g; A instead of G in position 1627 of sequence M3702g) differs from the published EPSPS sequence (database entry M3702g: nucleotide region 7-1787).
  • the two deletions and the two base changes at positions 1447 and 1627 of the sequence M3702g were reproduced in an independent amplification experiment and thus represent the actual nucleotide sequence in the Petunia hybrida plants used.
  • the clone pEPSPS was therefore used for the cloning into the expression vector pJONPI g6 (described in Example 6).
  • the cloning was carried out by isolating the 1763 bp SacI-HindIII fragment from pEPSPS and ligation into the SacI-HindIII cut vector pJONPI 6.
  • the clone which contains the promoter EPSPS instead of the original promoter d35S is called pJOESP: NP196.
  • This expression cassette contains the fragment NP196 in the correct orientation as an N-terminal fusion with the rbcS transit peptide.
  • fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (1 g4 bp), fragment NP196 KETO CDS (761 bp), coding for the Nostoc punctiform NPig ⁇ -ketolase, fragment OCS terminator (ig2 bp) the polyadenylation signal of octopine synthase.
  • An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NP196 ketolase from Nostoc punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00g00).
  • fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (1 4 bp), fragment NP196 KETO CDS (761 bp), coding for the Nostoc punctiform NPig ⁇ ketolase, fragment OCS terminator (192 bp) the polyadenylation signal of octopine synthase.
  • Example g Amplification of a DNA encoding the entire primary sequence of the NP1 g5 ketolase from Nostoc punctiforme ATCC 29133
  • the nucleic acid encoding a Nostoc punctiform ATCC 29133 ketolase was synthesized by means of a "polymerase chain reaction” (PCR) from Nostoc punctiform ATCC 29133 using a sense-specific primer (NP195-1, SEQ ID No. 67) and an antisense-specific one Primers (NPig5-2 SEQ ID No. 68) amplified.
  • PCR polymerase chain reaction
  • the PCR for the amplification of the DNA which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 ⁇ l reaction mixture, which contained:
  • the PCR was carried out under the following cycle conditions:
  • PCR amplification with SEQ ID No. 67 and SEQ ID No. 68 resulted in an 819 bp fragment coding for a protein consisting of the entire primary sequence (NP195, SEQ ID No. 69).
  • the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNP195 was obtained.
  • This clone pNP105 was therefore used for the cloning into the expression vector pJO (described in Example 6).
  • the cloning was carried out by isolating the 800 bp Sphl fragment from pNPigs and ligation into the SphI cut vector pJO.
  • the clone which contains the NPig ⁇ ketolase from Nostoc punctiforme in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJONPI 95.
  • the expression of the NP195 ketolase from Nostoc punctiforme in L. esculentum and in Tagetes erecta was carried out under the control of the constitutive promoter FNR (ferredoxin NADPH oxidoreductase, database entry AB011474 position 70127 to 69493; WO03 / 006660), from Arabidopsis thallana.
  • FNR constitutive promoter
  • the FNR gene begins at base pair 694g2 and is annotated with "ferredoxin-NADP + reductase”. Expression was carried out using the pea transit peptide rbcS (Anderson et al. 1086, Biochem J. 240: 700-715).
  • the clone pFNR (described in Example 7) was therefore used for the cloning into the expression vector pJONPI 05 (described in Example 10).
  • the cloning was carried out by isolating the 644 bp Sma-Hindlll fragment from pFNR and ligating into the Ecl136ll-Hindlll cut vector pJONPI 05.
  • the clone which contained the promoter FNR instead of the original promoter d35S and the fragment NPi ⁇ in the correct orientation as contains terminal fusion with the rbcS transit peptide is called pJOFNR: NP195.
  • An expression cassette for the Agrobacterium-mediated transformation of the NP195 ketolase from Nostoc punctiforme into lesculentum was produced using the binary vector pSUN3 (WO02 / 00000).
  • fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (78g bp), coding for the nostoc punctiform NPi g ⁇ -ketolase, fragment OCS terminator (ig2 bp) the polyadenylation signal of octopine synthase.
  • the expression of the NP1 g5 ketolase from Nostoc punctiforme in L. esculentum and Tagetes erecta was carried out with the transit peptide rbcS from pea (Anderson et al. Ig86, Biochem J. 240: 700-715). The expression was carried out under the control of the flower-specific promoter EPSPS from Petunia hybrida (database entry M37020: nucleotide region 7-1787; Benfey et al. (1990) Plant Cell 2: 840-856).
  • the clone pEPSPS (described in Example 8) was therefore used for the cloning into the expression vector pJONPI 95 (described in Example 10).
  • the cloning was carried out by isolating the 1763 bp SacI-HindIII fragment from pEPSPS and ligation into the SacI-HindIII cut vector pJONPI 05.
  • the clone which contains the promoter EPSPS instead of the original promoter d35S, is called pJOESP: NPig5.
  • This expression cassette contains the fragment NPi ⁇ in the correct orientation as an N-terminal fusion with the rbcS transit peptide.
  • fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (789 bp), coding for the Nostoc punctiform NPig ⁇ -ketolase, fragment OCS terminator (192 bp) the polyadenylation signal of octopine synthase.
  • An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NPig ⁇ -ketolase from Nostoc punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00 ⁇ 00).
  • fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (1 g4 bp), fragment NP195 KETO CDS (78g bp), coding for the Nostoc punctiform NPig ⁇ -ketolase, fragment OCS Terminator (192 bp) the polyadenylation signal of octopine synthase.
  • Example 12 Amplification of a DNA encoding the entire primary sequence of the NODK ketolase from Noularia spumignea ⁇ / SOft 70.
  • the DNA encoding the ketolase from Nodularia spumignea NSOR 10 was amplified by PCR from Nodularia spumignea NSOR10.
  • genomic DNA from a suspension culture of Nodularia spumignea NSOR10, d ⁇ e 1 week with continuous light and constant shaking (150 rpm) at 25 ° C in BG 77 medium (1.5 g / l NaN0 3 , 0.04 g / l K 2 P0 4 x3H 2 0, 0.075 g / l MgS0 4 xH 2 O, 0.036 g / l CaCI 2 x2H 2 O, 0.006 g / l citric acid, 0.006 g / l Ferric ammonium citrate, 0.001 g / l EDTA disodium magnesium, 0.04 g / l Na 2 CO 3 , 1 ml trace metal mix "A5 + Co" (2.86 g / l H 3 BO 3 ,
  • the bacterial cells were pelleted from a 10 ml liquid culture by centrifugation at 8000 rpm for 10 minutes. The bacterial cells were then crushed and ground in liquid nitrogen using a mortar. The cell material was resuspended in 1 ml of 10 mM Tris HCl (pH 7.5) and transferred to an Eppendorf reaction vessel (2 ml volume). After adding 100 ⁇ l Proteinase K (concentration: 20 mg / ml), the cell suspension was incubated for 3 hours at 37 ° C. Then the
  • the nucleic acid encoding a ketolase from Nodularia spumignea NSOR10 was determined by means of a "polymerase chain reaction” (PCR) from Nodularia spumignea NSOR10 using a sense-specific primer (NODK-1, SEQ ID No. 71) and an antisense-specific primer ( NODK-2 SEQ ID No. 72).
  • PCR polymerase chain reaction
  • the PCR conditions were as follows:
  • the PCR for the amplification of the DNA which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 ⁇ l reaction mixture, which contained: 1 ul of a Nodularia spumignea NSOR10 DNA (prepared as described above)
  • 0.2 mM NODK-1 (SEQ ID No. 71) - 0.2 mM NODK-2 (SEQ ID No. 72) 5 ul 10X PCR buffer (TAKARA) 0.25 ul R Taq polymerase (TAKARA) 25.8 ul Aq. Least.
  • the PCR was carried out under the following cycle conditions:
  • PCR amplification with SEQ ID No. 71 and SEQ ID No. 72 resulted in a 720 bp fragment coding for a protein consisting of the entire primary sequence (NODK, SEQ ID No. 73).
  • the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNODK was obtained.
  • This clone pNODK was therefore used for the cloning into the expression vector pJO (described in Example 6).
  • the cloning was carried out by isolating the 710 bp Sphl fragment from pNODK and ligation into the SphI-cut vector pJO.
  • the clone that shows the NODK ketolase from Nodularia spumignea in the correct orientation contains as an N-terminal translational fusion with the rbcS transit peptide is called pJONODK.
  • Example 13 Production of expression vectors for the constitutive expression of the NODK ketolase from Nodularia spumignea NSOR10 in Lycopersicon esculentum and Tagetes erecta.
  • the expression of the NODK ketolase from Nodularia spumignea NSOR10 in L. esculentum and in Tagetes erecta was carried out under the control of the constitutive promoter FNR (ferredoxin-NADPH-oxidoreductase, database entry AB011474 position 70127 to 60403; WO03 / 006660) from Arabidopsis thall.
  • FNR constitutive promoter
  • the FNR gene begins at base pair 604g2 and is annotated with "ferredoxin-NADP + reductase”. Expression was carried out using the pea transit peptide rbcS (Anderson et al. Ig86, Biochem J. 240: 700-715).
  • the clone pFNR (described in Example 7) was therefore used for the cloning into the expression vector pJONODK (described in Example 12).
  • the cloning was carried out by isolating the 644 bp Sma-HindIII fragment from pFNR and ligating into the Ecl136II-HindIII cut vector pJONODK.
  • the clone which contains the promoter FNR instead of the original promoter d35S and the fragment NODK in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJOFNR: NODK.
  • fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (104 bp), fragment NODK KETO CDS (600 bp), coding for the Nodularia spumignea NSOR10 NODK ketolase, fragment OCS terminator (102 bp) the polyadenylation signal from the octopine synthase.
  • An expression cassette for the / 4grobactet / um-mediated transformation of the expression vector with the NODK ketolase from Nodularia spumignea NSOR10 punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).
  • fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NODK KETO CDS (6g ⁇ bp), coding for the Nodularia spumignea NSOR10 NODK ketolase , Fragment OCS terminator (102 bp) the polyadenylation signal of octopine synthase.
  • Example 14 Production of expression vectors for the flower-specific expression of the NODK ketolase from Nodularia spumignea NSORW in Lycopersicon esculentum and Tagetes erecta.
  • the NODK ketolase from Nodularia spumignea NSOR10 ⁇ n L. esculenum and Tagetes erecta was expressed with the transit peptide rbcS from pea (Anderson et al: 1086, Biochem J. 240: 709-715). The expression was carried out under the control of the flower-specific promoter EPSPS from Petunia hybrida (database entry M37029: nucleotide region 7-1787; Benfey et al. (1990) Plant Cell 2: 840-856).
  • the clone pEPSPS (described in Example 8) was therefore used for the cloning into the expression vector pJONODK (described in Example 12).
  • the cloning was carried out by isolating the 1763 bp SacI-HindIII fragment from pEPSPS and ligation into the SacI-HindIII cut vector pJONODK.
  • the clone that contains the promoter EPSPS instead of the original promoter d35S is called pJOESP: NODK.
  • This expression cassette contains the fragment NODK in the correct orientation as an N-terminal fusion with the rbcS transit peptide.
  • fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NODK KETO CDS (690 bp), coding for the Nodularia spumignea NSOR 10 NODK ketolase, fragment OCS terminator (102 bp) the polyadenylation signal of octopine synthase.
  • An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NODK ketolase from Nodularia spumignea NSOR10 in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00 ⁇ 00).
  • the 2,880 KB bp Sacl-Xhol was used to produce the expression vector MSP116
  • fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT ' the rbcS transit peptide from pea (104 bp), fragment NODK KETO CDS (600 bp), coding for the Nodularia spumignea NSOR10 NODK-Ketolase, fragment OCS terminator (102 bp) the polyadenylation signal of octopine synthase.
  • Transformation and regeneration of tomato plants was carried out according to the published method by Ling and co-workers (Plant Cell Reports (1998), 17: 843-847).
  • Ling and co-workers Plant Cell Reports (1998), 17: 843-847).
  • kanamycin concentrations 100 mg / L were selected.
  • the starting explant for the transformation was cotyledons and hypocotyls, seven to ten day old seedlings of the Microtome line.
  • the culture medium according to Murashige and Skoog (1062: Murashige and Skoog, 1062, Physiol. Plant 15, 473-) with 2% sucrose, pH 6.1 was used for the germination. Germination took place at 21 ° C in low light (20 - 100 ⁇ E).
  • the cotyledons became divided transversely and the hypocotyls cut into sections about 5 to 10 mm long and placed on the medium MSBN (MS, pH 6.1, 3% sucrose + 1 mg / l BAP, 0.1 mg / l NAA), which on The previous day was loaded with suspension-cultivated tomato cells.
  • the tomato cells were covered with sterile filter paper without air bubbles.
  • the explants were precultured on the medium described for three to five days.
  • Cells from the Agrobacterium tumefaciens LBA4404 strain were individually transformed with the plasmids pS3FNR: NOST, pS3AP3: NOST, pS3FNR: NP106, pS3EPS: NP106, pS3FNR: NP105, pS3EPS: NP105, pS3FNR: NODK and pS3FNR: NODK and pS3FNR: NODK and pS3FNR: NODK and pS3FNR: NODK and pS3FNR: NODK and pS3FNR: NODK and pS3FNR: NODK and pS3FNR: NODK and pS3FNR: transform.
  • the bacterial pellet was resuspended with liquid MS medium (3% sucrose, pH 6.1) and adjusted to an optical density of 0.3 (at 600 nm).
  • the precultivated explants were transferred to the suspension and incubated for 30 minutes at room temperature with gentle shaking.
  • the explants were then dried with sterile filter paper and placed back on their preculture medium for the three-day co-culture (21 ° C.).
  • the explants were transferred to MSZ2 medium (MS pH 6.1 + 3% sucrose, 2 mg / l zeatin, 100 mg / l kanamycin, 160 mg / l timentin) and for selective regeneration at 21 ° C stored under low light conditions (20 - 100 ⁇ E, light rhythm 16h / 8h).
  • MSZ2 medium MS pH 6.1 + 3% sucrose, 2 mg / l zeatin, 100 mg / l kanamycin, 160 mg / l timentin
  • the explants were transferred every two to three weeks until shoots formed. Small shoots could be separated from the explant and rooted on MS (pH 6.1 + 3% sucrose) 160 mg / l timentin, 30 mg / l kanamycin, 0.1 mg / l IAA. Rooted plants were transferred to the greenhouse.
  • NP196 was obtained: MSP107-1, MSP107-2, MSP107-3
  • NP105 was obtained: MSP100-1, MSP100-2, MSP100-3
  • germination medium MS medium; Murashige and Skoog, Physiol. Plant. 15 (1062), 473-407) pH 5.8, 2% sucrose). Germination takes place in a temperature / light / time interval of 18-28 ° C / 20-200 ⁇ E / 3-16 weeks, but preferably at 21 ° C, 20-70 ⁇ E, for 4-8 weeks.
  • pS5FNR NOST
  • pS5AP3 NOST
  • pS5FNR NP106
  • pS5EPS NP196
  • pS5FNR NP1
  • pS5EPS NP1 g5
  • pS5FNR NODK
  • pS5EPS NODK
  • the bacterial strain can be grown as follows: A single colony of the corresponding strain is in YEB (0.1% yeast extract, 0.5% beef extract, 0.5% peptone, 0.5% sucrose, 0.5% magnesium sulfate x 7 H) 2 0) inoculated with 25 mg / l kanamycin and dressed at 28 ° C for 16 to 20 h. The bacterial suspension is then harvested by centrifugation at 6000 g for 10 min and resuspended in liquid MS medium such that an OD 600 of approximately 0.1 to 0.8 was formed. This suspension is used for C cultivation with the leaf matter! used.
  • the MS medium in which the leaves have been kept is replaced by the bacterial suspension.
  • the leaflets were incubated in the agrobacterial suspension for 30 min with gentle shaking at room temperature.
  • the infected explants are then placed on an MS medium solidified with agar (for example 0.8% plant agar (Duchefa, NL) with growth regulators, such as 3 mg / l benzylaminopurine (BAP) and 1 mg / l indolylacetic acid (IAA).
  • agar for example 0.8% plant agar (Duchefa, NL) with growth regulators, such as 3 mg / l benzylaminopurine (BAP) and 1 mg / l indolylacetic acid (IAA).
  • the orientation of the leaves on the medium is irrelevant: the explants are cultivated for 1 to 8 days, but preferably for 6 days, the following conditions can be used: light intensity: 30-80 ⁇ mol / m 2 x sec, temperature: 22-24 ° C., light / dark change of 16/8 hours, after which the co-cultivated explants are transferred to fresh MS medium, preferably with the same growth regulators, this second medium additionally containing an antibiotic to suppress bacterial growth
  • a concentration of 200 to 500 mg / l is very suitable for this purpose, and the second selective component is one used to select the success of the transformation.
  • Phosphinothricin in a concentration of 1 to 5 mg / l selects very efficiently, but other selective components according to the method to be used are also conceivable.
  • the explants are transferred to fresh medium until shoot buds and small shoots develop, which are then on the same basal medium including timentin and PPT or alternative components with growth regulators, namely, for example, 0.5 mg / l indolylbutyric acid (IBA) and 0.5 mg / l gibberillic acid GA 3 , are transferred for rooting. Rooted shoots can be transferred to the greenhouse.
  • IBA 0.5 mg / l indolylbutyric acid
  • GA 3 gibberillic acid
  • the explants Before the explants are infected with the bacteria, they can be pre-incubated for 1 to 12 days, preferably 3-4, on the medium described above for the co-culture become. The infection, co-culture and selective regeneration then take place as described above.
  • the pH value for regeneration (normally 5.8) can be lowered to pH 5.2. This improves the control of agrobacterial growth.
  • Liquid culture medium can also be used for the entire process.
  • the culture can also be incubated on commercially available carriers which are positioned on the liquid medium.
  • pS5FNR NOST, for example, the following was obtained: MSP102-1, MSP102-2, MSP102-3,
  • pS5AP3 NOST, for example, the following was obtained: MSP104-1, MSP104-2, MSP104-3
  • NP106 was obtained: MSP106-1, MSP106-2, MSP106-3
  • NP106 was obtained: MSP108-1, MSP108-2, MSP108-3
  • NP105 was obtained: MSP110-1, MSP110-2, MSP110-3
  • the petals of the transgenic plants are mortarized in liquid nitrogen and the petalen powder (about 40 mg) extracted with 100% acetone (three times 500 ul). The solvent is evaporated and the carotenoids are resuspended in 100-200 ul of petroleum ether / acetone (5: 1, v / v).
  • the carotenoids are separated in concentrated form by means of thin layer chromatography (TLC) on Silica ⁇ O F254 plates (Merck) in an organic solvent (petroleum ether / acetone; 5: 1) according to their phobicity. Yellow (xanthophyll esters), red (ketocarotenoid esters) and orange bands (mixture of xanthophyll and ketocarotenoid esters) are scraped out on the TLC.
  • TLC thin layer chromatography
  • the carotenoids bound to silica are eluted three times with 500 ⁇ l of acetone, the solvent is evaporated and the carotenoids are separated and identified by means of HPLC.
  • a C30 reverse phase column can be used to differentiate between mono- and diesters of carotenoids.
  • HPLC running conditions were almost identical to a published method (Frazer et al. (2000), Plant Journal 24 (4): 551-558). The following process conditions were set.
  • Solvent B 80% methanol, 0.2% ammonium acetate solvent
  • C 100% t-butyl methyl ether gradient profile:
  • the carotenoids can be identified on the basis of the UV-VIS spectra.
  • Petal material from the transgenic tomato plants is ground and extracted with acetone. Extracted carotenoids are separated by means of TLC. In the lines can
  • Mono and diesters of ketocarotenoids can be detected; the monoesters are present in a significantly lower concentration than the diesters.
  • Mortar petal material (30-100 mg fresh weight) is extracted with 100% acetone (three times 500 ul; shake for about 15 minutes each). The solvent is evaporated. Carotenoids are then taken up in 405 ⁇ l of acetone, 4.95 ml of potassium phosphate buffer (100 mM, pH 7.4) are added and mixed well. Then about 17 mg of Bile salts (Sigma) and 140 ⁇ l of a NaCI / CaCI2 solution (3M NaCI and 75 mM CaCI2) are added. The suspension is incubated for 30 minutes at 37C.
  • a lipase solution 50 mg / ml lipase type 7 from Candida rugosa (Sigma)
  • 505 ⁇ l of a lipase solution 50 mg / ml lipase type 7 from Candida rugosa (Sigma)
  • a lipase solution 50 mg / ml lipase type 7 from Candida rugosa (Sigma)
  • 595 ⁇ l of lipase was added again and incubation was continued for at least 5 hours at 37C.
  • be about 700 mg of Na2SO4x10H20 dissolved in the solution After adding 1800 ⁇ l of petroleum ether, the carotenoids are extracted into the organic phase by vigorous mixing. This shaking is repeated until the organic phase remains indolent.
  • the petroleum ether fractions are combined and the petroleum ether evaporated. Free carotenoids are taken up in 100-120 ul acetone. Free carotenoids can be identified on the basis of retention time and UV-VlS spectra by means of HPLC

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Polymers & Plastics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Animal Husbandry (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Reproductive Health (AREA)
  • Insects & Arthropods (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Pregnancy & Childbirth (AREA)
  • Birds (AREA)
  • Botany (AREA)
  • Physiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Fodder In General (AREA)

Description

Verfahren zur Herstellung von Ketocarόtinoiden in genetisch veränderten Organismen
Beschreibung
Die vorliegende Erfindung betrifft ein Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen, die im Vergleich zum Wildtyp eine veränderte Ketolase-Aktivität aufweisen, die genetisch veränderten Organismen, sowie deren Verwendung als Nahrungs- und Futtermittel und zur Herstellung von Ketocarotinoidextrakten.
Carotinoide werden de novo in Bakterien, Algen, Pilzen und Pflanzen synthetisiert. Ketocarotinoide, also Carotinoide, die mindestens eine Keto-Gruppe enthalten, wie- beispielsweise Astaxanthin, Canthaxanthin, Echinenon, 3-Hydroxyechinenon, 3'- Hydroxyechinenon, Adonirubin und Adonixanthin sind natürliche Antioxidantien und Pigmente, die von einigen Algen und Mikroorganismen als Sekundärmetabolite produziert werden.
Aufgrund ihrer farbgebenden Eigenschaften werden die Ketocarotinoide und irisbesondere Astaxanthin als Pigmentierhilfsstoffe in der Tieremähruηg, insbesondere in der Forellen-, Lachs- und Shrimpszucht verwendet.
Die Herstellung von Astaxanthin erfolgt heutzutage größtenteils durch chemische Syntheseverfahren. Natürliche Ketocarotinoide, wie beispielsweise natürliches Astaxanthin, werden heutzutage in biotechnologischen Verfahren in kleinen Mengen durch Kultivierung von Algen, beispielsweise Haematococcus pluvialis oder durch Fermentation von gentechnologisch optimierten Mikroorganismen und anschließender Isolierung gewonnen.
Ein wirtschaftliches biotechnologisches Verfahren zur Herstellung von natürlichen Ketocarotinoiden ist daher von großer Bedeutung.
Nukleinsäuren kodierend eine Ketolase und die entsprechenden Proteinsequenzen sind aus verschiedenen Organismen isoliert und annotiert worden, wie beispielsweise Nukleinsäuren kodierend eine Ketolase aus Agrobacterium aurantiacum (EP 735 137, Accession NO: D58420), aus Alcaligenes sp. PC-1 (EP 735137, Accession NO: D58422), Haematococcus pluvialis Flotow em. 7//e und Haematoccus pluvialis, NIES- 144 (EP 725137, WO 98/18910 und Lotan et al, FEBS Letters 1995, 364, 125-128, Accession NO: X86782 und D45881), Paracoccus marcusii (Accession NO: Y15112), Synechocystis sp. Strain PC6803 (Accession NO: NP_442491), Bradyrhizobium sp. (Accession NO: AF218415) und Nostoc sp. PCC 7120 (Kaneko et al, DNA Res. 2001 , 8(5), 205 - 213; Accession NO: AP003592, BAB74888).
EP 735 137 beschreibt die Herstellung von Xanthophyllen in Mikroorganismen, wie beispielsweise E. coli durch Einbringen von Ketolase-Genen (crtW) aus Agrobacterium aurantiacum oder Alcaligenes sp. PC-1 in Mikroorganismen.
Aus EP 725 137, WO 98/18910, Kajiwara et al. (Plant Mol. Biol. 1995, 29, 343-352) und Hirschberg et al.(FEBS Letters 1995, 364, 125-128) ist es bekannt, Astaxanthin durch Einbringen von Ketolase-Genen aus Haematococcus pluvialis (crtW, crtO oder bkt) in E. coli herzustellen.
Hirschberg et al.(FEBS Letters 1997, 404, 129-134) beschreiben die Herstellung von Astaxanthin in Synechococcus durch Einbringen von Ketolase-Genen (crtO) aus Haematococcus pluvialis. Sandmann et al. (Photochemistry and Photobiology 2001 , 73(5), 551-55) beschreiben ein analoges Verfahren, das jedoch zur.Herstellung von Cantha- xanthin führt und nur Spuren Astaxanthin liefert.
WO 98/18910 und Hirschberg et al. (Nature Biotechnology 2000, 18(8), 888-892) beschreiben die Synthese von Ketocarotinoiden in Nektarien von Tabakblüten durch Einbringen des Ketolase-Gens aus Haematococcus pluvialis (crtO) in Tabak.
WO 01/20011 beschreibt ein DNA Konstrukt zur Produktion von Ketocarotinoiden, insbesondere Astaxanthin, in Samen von Ölsaatpflanzen wie Raps, Sonnenblume, Sojabohne und Senf unter Verwendung eines Samen-spezifischen Promotors und einer Ketolase aus Haematococcus pluvialis.
Alle im Stand der Technik beschriebenen Verfahren zur Herstellung von Ketocarotinoiden und insbesondere die beschriebenen Verfahren zur Herstellung von Astaxanthin weisen den Nachteil auf, daß die transgenen Organismen eine große Menge an hydro- xylierten Nebenprodukten, wie beispielsweise Zeaxanthin und Adonixanthin liefern. Der Erfindung lag daher die Aufgabe zugrunde, ein Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen zur Verfügung zu stellen, bzw. weitere genetisch veränderte Organismen, die Ketocarotinoide herstellen, zur Verfügung zu stellen, die die vorstehend beschriebenen Nachteile des Standes der Technik in geringerem Maße oder nicht mehr aufweisen.
Demgemäß wurde ein Verfahren zur Herstellung von Ketocarotinoiden gefunden, indem man genetisch veränderte Organismen kultiviert, die im Vergleich zum Wildtyp eine veränderte Ketolase-Aktivität aufweisen und die veränderte Ketolase-Aktivität durch eine Ketolase verursacht wird, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
Die erfindungsgemäßen Organismen wie beispielsweise Mikroorganismen oder Pflanzen sind vorzugsweise als Ausgangsorganismen natürlicherweise in der Lage, Carotinoide wie beispielsweise ß-Carotin oder Zeaxanthin herzustellen, oder können durch genetische Veränderung, wie beispielsweise Umregulierung von Stoffwechselwegen oder Komplementierung in die Lage versetzt werden, Carotin'oide wie beispielsweise ß- Carotin oder Zeaxanthin herzustellen.
Einige Organismen sind als Ausgangs- oder Wildtyporganismen bereits in der Lage, Ketocarotinoidewie beispielsweise Astaxanthin oder Canthaxanthin herzustellen. Diese Organismen, wie beispielsweise Haematococcus pluvialis, Paracoccus marcusii, Xan- thophyllomyces dendrorhous, Bacillus circulans, Chlorococcum, Phaffia rhodozyma, Adonisröschen, Neochloris wimmeri,Protosiphon botryoides, Scotiellopsis oocystifor- mis, Scenedesmus vacuolatus, Chlorela zofingiensis, Ankistrodesmus braunii, Euglena sanguinea, Bacillus atrophaeus, Blakeslea weisen bereits als Ausgangs- oder Wildtyporganismus eine Ketolase-Aktivität auf.
In einer Ausführungsform des erfindungsgemäßen Verfahrens werden daher als Ausgangsorganismen Organismen verwendet, die bereits als Wildtyp oder Ausgangsorganismus eine Ketolaseaktivität aufweisen. In dieser Ausführungsform bewirkt die genetische Veränderung eine Erhöhung der Ketolase-Aktivität im Vergleich zum Wildtyp oder Ausgangsorganismus. Unter Ketolase-Aktivität wird die Enzymaktivität einer Ketolase verstanden. Unter einer Ketolase wird ein Protein verstanden, das die enzymatische Aktivität aufweist, am, gegebenenfalls substituierten, ß-lonon-Ring von Carotinoiden eine Keto- Gruppe einzuführen.
Insbesondere wird unter einer Ketolase ein Protein verstanden, das die enzymatische Aktivität aufweist, ß-Carotin in Canthaxanthin umzuwandeln.
Dementsprechend wird unter Ketolase-Aktivität die in einer bestimmten Zeit durch das Protein Ketolase umgesetzte Menge ß-Carotin bzw. gebildete Menge Canthaxanthin verstanden.
Bei einer erhöhten Ketolase-Aktivität gegenüber dem Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Protein Ketolase die umgesetzte Men- ge ß-Carotin bzw. die gebildete Menge Canthaxanthin erhöht.
Vorzugsweise beträgt diese Erhöhung der Ketolase-Aktivität mindestens 5 %, weiter bevorzugt mindestens 20 %, weiter bevorzugt mindestens 50 %, weiter bevorzugt mindestens 100 %, bevorzugter mindestens 300 %, noch bevorzugter mindestens 500 %, insbesondere mindestens 600 % der Ketolase-Aktivität des Wildtyps.
Unter dem Begriff "Wildtyp" wird erfindungsgemäß der entsprechende Ausgangsorganismus verstanden.
Je nach Zusammenhang kann unter dem Begriff Organismus" der Ausgangsorganismus (Wildtyp) oder ein erfindungsgemäßer, genetisch veränderter Organismus oder beides verstanden werden.
Vorzugsweise und insbesondere in Fällen, in denen der Organismus oder der Wildtyp nicht eindeutig zugeordnet werden kann, wird unter "Wildtyp" für die Erhöhung oder Verursachung der Ketolase-Aktivität, für die nachstehend beschriebene Erhöhung der Hydroxylase-Aktivität, für die nachstehend beschriebene Erhöhung der ß-Cyclase- Aktivität und die Erhöhung des Gehalts an Ketocarotinoiden jeweils ein Referenzorganismus verstanden. Dieser Referenzorganimus ist für Mikroorganismen, die bereits als Wildtyp eine Ketolase Aktivität aufweisen, vorzugsweise Haematococcus pluvialis.
Dieser Referenzorganismus ist für Mikroorganismen, die als Wildtyp keine Ketolase Aktivität aufweisen, vorzugsweise Blakeslea.
Dieser Referenzorganismus ist für Pflanzen, die bereits als Wildtyp eine Ketolase- Aktivität aufweisen, vorzugsweise Adonis aestivalis, Adonis flammeus oder Adonis annuus, besonders bevorzugt Adonis aestivalis.
Dieser Referenzorganismus ist für Pflanzen, die als Wildtyp keine Ketolase-Aktivität in Blütenblätter aufweisen, vorzugsweise Tagetes erecta, Tagetes patula, Tagetes lucida, Tagetes pringlei, Tagetes palmeri, Tagetes minuta oder Tagetes campanulata, besonders bevorzugt Tagetes erecta.
Die Bestimmung der Ketolase-Aktivität in erfindungsgemäßen genetisch veränderten Organismen und in Wildtyp- bzw. Referenzorganismen erfolgt vorzugsweise unter folgenden Bedingungen:
Die Bestimmung der Ketolase-Aktivität in Pflanzen- oder Mikroorganismenmaterial erfolgt in Anlehnung an die Methode von Frazer et al., (J. Biol. Chem. 272(10): 6128- 6135, 1997). Die Ketolase-Aktivität in pflanzlichen oder Mikroorganismus-Extrakten wird mit den Substraten ß-Carotin und Canthaxanthin in Gegenwart von Lipid (Sojaleci- thin) und Detergens (Natriumcholat) bestimmt. Substrat/Produkt- Verhältnisse aus den Ketolase-Assays werden mittels HPLC ermittelt.
Die Erhöhung der Ketolase-Aktivität kann durch verschiedene Wege erfolgen, beispielsweise durch Ausschalten von hemmenden Regulationsmechanismen auf Trans- lations- und Proteinebene oder durch Erhöhung der Genexpression einer Nukleinsäu- re, kodierend eine Ketolase, gegenüber dem Wildtyp, beispielsweise durch Induzierung des Ketolase-Gens durch Aktivatoren oder durch Einbringen von Nukleinsäuren, kodierend eine Ketolase, in den Organismus.
Unter Erhöhung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, wird erfindungsgemäß in dieser Ausführungsform auch die Manipulation der Expression der Organismen eigenen endogenen Ketolasen verstanden. Dies kann beispielsweise durch Veränderung der Promotor DNA-Sequenz für Ketolase kodierende Gene erreicht werden. Eine solche Veränderung, die eine veränderte oder vorzugsweise erhöhte Expressionsrate mindestens eines endogenen Ketolase Gens zur Folge hat, kann durch Deletion oder Insertion von DNA Sequenzen erfolgen.
Es ist wie vorstehend beschrieben möglich, die Expression mindestens einer endogenen Ketolase durch die Applikation exogener Stimuli zu verändern. Dies kann durch besondere physiologische Bedingungen, also durch die Applikation von Fremdsubstanzen erfolgen.
Des weiteren kann eine erhöhte Expression mindestens eines endogenen Ketolase- Gens dadurch erzielt werden, dass ein im Wildtyporganismus nicht vorkommendes oder modifiziertes Regulatorprotein mit dem Promotor dieser Gene in Wechselwirkung tritt.
Solch ein Regulator kann ein chimäres Protein darstellen, welches aus einer DNA- Bindedomäne und einer Transkriptionsaktivator-Domäne besteht, wie beispielsweise in WO 96/06166 beschrieben.
In einer bevorzugten Ausführungsform erfolgt die Erhöhung der Ketolase-Aktivität gegenüber dem Wildtyp durch die Erhöhung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
In einer weiter bevorzugten Ausführungsform erfolgt die Erhöhung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, durch Einbringen von Nukleinsäuren, die Ketolasen kodieren, in die Organismen, wobei die Ketolasen die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz enthalten, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
In den erfindungsgemäßen transgenen Organismen liegt also in dieser Ausführungs- form gegenüber dem Wildtyp mindestens ein weiteres Ketolase-Gen vor, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von die- ser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
In dieser Ausführungsform weist der erfindungsgemäße genetisch veränderte Organismus dementsprechend mindestens eine exogene (=heterologe) Nukleinsäure, kodierend eine Ketolase, auf oder mindestens zwei endogene Nukleinsäuren, kodierend eine Ketolase, auf, wobei die Ketolasen die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz enthalten, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
In einer anderen, bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens werden als Ausgangsorganismen Organismen verwendet, die als Wildtyp keine Keto- laseaktivität aufweisen.
In dieser bevorzugten Ausführungsform verursacht die genetische Veränderung die. Ketolase-Aktivität in den Organismen. Der erfindungsgemäße genetisch veränderte Organismus weist somit in dieser bevorzugten Ausführungsform im Vergleich zum ge- netisch nicht veränderten Wildtyp eine Ketolase-Aktivität auf und ist somit vorzugswei- . se in der Lage, transgen eine Ketolase zu exprimieren, enthaltend die Aminosäurese- quenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
In dieser bevorzugten Ausführungsform erfolgt die Verursachung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, analog zu der vorstehend beschriebenen Erhöhung der Genexpression einer Nukleinsäure.kodierend eine Ketolase, vorzugsweise durch Einbringen von Nukleinsäuren, die Ketolasen kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, in den Ausgangsorganismus.
Dazu kann in beiden Ausführungsformen prinzipiell jede Nukleinsäuren, die eine Ketolase kodiert, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion öder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, verwendet werden.
Die Verwendung der erfindungsgemäßen Nukleinsäuren, kodierend eine Ketolase, führt im erfindungsgemäßen Verfahren überraschenderweise zu Ketocarotinoiden mit einer geringeren Menge an hydroxylierten Nebenprodukten als bei der Verwendung der im Stand der Technik verwendeten Ketolase-Gene.
Alle in der Beschreibung erwähnten Nukleinsäuren können beispielsweise eine RNA-, DNA- oder cDNA-Sequenz sein.
Bei genomischen Ketolase-Sequenzen aus eukaryotischen Quellen, die Introns enthalten, sind für den Fall, dass der Wirtsorganismus nicht in der Lage ist oder nicht in die Lage versetzt werden kann, die entsprechenden Ketolase zu exprimieren, bevorzugt bereits prozessierte Nukleinsäuresequenzen wie die entsprechenden cDNAs zu verwenden.
Beispiele für Nukleinsäuren, kodierend eine Ketolase, und die entsprechenden Ketola- sen, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID.
NO. 2 aufweist, die im erfindungsgemäßen Verfahren vorteilhaft verwendet werden können, sind beispielsweise Sequenzen aus
Nostoc sp. Strain PCC7120 (Accession NO: AP003592, BAB74888; Nukleinsäure:
SEQ ID NO: 1, Protein SEQ ID NO: 2),
Nostoc punctiforme ATTC 29133, Nukleinsäure: Acc.-No. NZ_AABC01000195, Basen- paar 55,604 bis 55,392 (SEQ ID NO: 3); Protein: Acc.-No. ZP_00111258 (SEQ ID NO: 4) (als putatives Protein annotiert) oder
Nostoc punctiforme ATTC 29133, Nukleinsäure: Acc.-No. NZ_AABC01000196, Basenpaar 140,571 bis 139,810 (SEQ ID NO: 5), Protein: (SEQ ID NO: 6) (nicht annotiert), Synechococcus sp. WH 8102, Nukleinsäure: Acc.-No. NZ_AABD01000001 , Basenpaar 1 ,354,725-1 ,355,528 (SEQ ID NO: 46), Protein: Acc.-No. ZP_00115639 (SEQ ID NO: 47) (als putatives Protein annotiert),
Nodularia spumigena NSOR10, (Accession NO: AY210783, AAO64399; Nukleinsäure: SEQ ID NO: 52, Protein: SEQ ID NO: 53)
oder von diesen Sequenzen abgeleitete Ketolasesequenzen wie beispielsweise
die Ketolasen der Sequenz SEQ ID NO: 8 oder 10 und die entsprechenden kodierenden Nukleinsäuresequenzen SEQ ID NO: 7 oder SEQ ID NO: 9, die beispielsweise durch Variation/Mutation aus der Sequenz SEQ ID NO: 4 bzw. SEQ ID NO: 3 hervorgehen,
die Ketolasen der Sequenz SEQ ID NO: 12 oder 14 und die entsprechenden kodierenden Nukleinsäuresequenzen SEQ ID NO: 11 oder SEQ ID NO: 13, die beispielsweise durch Variation/Mutation aus der Sequenz SEQ ID NO: 6 bzw. SEQ ID NO: 5 hervor- gehen, oder
die Ketolasen der Sequenz SEQ ID NO: 49 oder 51 und die entsprechenden kodierenden Nukleinsäuresequenzen SEQ ID NO: 48 oder SEQ ID NO: 50, die beispielsweise durch Variation bzw. Mutation aus der Sequenz SEQ ID NO: 47 bzw. SEQ ID NO: 46 hervorgehen.
Weitere natürliche Beispiele für Ketolasen und Ketolase-Gene, die im erfindungsgemäßen Verfahren verwendet werden können, lassen sich beispielsweise aus verschiedenen Organismen, deren genomische Sequenz bekannt ist, durch Identitätsvergleiche der Aminosäuresequenzen oder der entsprechenden rückübersetzten Nukleinsäuresequenzen aus Datenbanken mit der vorstehend beschriebenen Sequenzen SEQ ID NO: 2 leicht auffinden.
Weitere natürliche Beispiele für Ketolasen und Ketolase-Gene lassen sich weiterhin ausgehend von den vorstehend beschriebenen Nukleinsäuresequenzen, insbesondere ausgehend von den Sequenzen SEQ ID NO: 1 aus verschiedenen Organismen, deren genomische Sequenz nicht bekannt ist, durch Hybridisierungstechniken in an sich bekannter Weise leicht auffinden. Die Hybridisierung kann unter moderaten (geringe Stringenz) oder vorzugsweise unter stringenten (hohe Stringenz) Bedingungen erfolgen.
Solche Hybridisierungsbedingungen sind beispielsweise bei Sambrook, J., Fritsch, E.F., Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2. Auflage, Cold Spring Harbor Laboratory Press, 1989, Seiten 9.31-9.57 oder in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6 beschrieben.
Beispielhaft können die Bedingungen während des Waschschrittes ausgewählt sein aus dem Bereich von Bedingungen begrenzt von solchen mit geringer Stringenz (mit 2X SSC bei 50_C) und solchen mit hoher Stringenz (mit 0.2X SSC bei 50_C, bevorzugt bei 65_C) (20X SSC: 0,3 M Natriumeitrat, 3 M Natriumchlorid, pH 7.0).
Darüberhinaus kann die Temperatur während des Waschschrittes von moderaten Be- dingungen bei Raumtemperatur, 22°C, bis zu stringenten Bedingungen bei 65°C angehoben werden. s
Beide Parameter, Salzkonzentration und Temperatur, können gleichzeitig variiert werden, auch kann einer der beiden Parameter konstant gehalten und nur der andere vari- iert werden. Während der Hybridisierung können auch denaturierende Agenzien wie zum Beispiel Formamid oder SDS eingesetzt werden. In Gegenwart von 50 % Forma- mid wird die Hybridisierung bevorzugt bei 42°C ausgeführt.
Einige beispielhafte Bedingungen für Hybridisierung und Waschschritt sind infolge ge- geben:
(1) Hybridiserungsbedingungen mit zum Beispiel
(i) 4X SSC bei 65°C, oder
(ii) 6X SSC bei 45°C, oder
(iii) 6X SSC bei 68°C, 100 mg/ml denaturierter Fischsperma-DNA, oder
(iv) 6X SSC, 0.5 % SDS, 100 mg/ml denaturierte, fragmentierte Lachssperma-DNA bei 68°C, oder (v) 6XSSC, 0.5 % SDS, 100 mg/ml denaturierte, fragmentierte Lachssperma-DNA, 50 % Formamid bei 42°C, oder
(vi) 50 % Formamid, 4X SSC bei 42_C, oder
(vii) 50 % (vol/vol) Formamid, 0.1 % Rinderserumalbumin, 0.1 % Ficoll, 0.1 % Polyvi- nylpyrrolidon, 50 mM Natriumphosphatpuffer pH 6.5, 750 mM NaCI, 75 mM Natriumcit- rat bei 42°C, oder
(viii) 2X oder 4X SSC bei 50°C (moderate Bedingungen), oder
(ix) 30 bis 40 % Formamid, 2X oder 4X SSC bei 42° (moderate Bedingungen).
(2) Waschschritte für jeweils 10 Minuten mit zum Beispiel
(i) 0.015 M NaCI/0.0015 M Natriumcitrat/0.1 % SDS bei 50°C, oder
(ii) 0.1X SSC bei 65°C, oder
(iii) 0.1 X SSC, 0.5 % SDS bei 68°C, oder
(iv) 0.1 X SSC, 0.5 % SDS, 50 % Formamid bei 42°C, oder
(v) 0.2X SSC, 0.1 % SDS bei 42°C, oder
(vi) 2X SSC bei 65°C (moderate Bedingungen).
In einer bevorzugten Ausführungsform der erfindungsgemäßen Verfahren bringt man Nukleinsäuren ein, die eine Ketolase kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 50%, vorzugsweise mindestens 60%, vorzugsweise mindestens 65 %, vorzugsweise mindestens 70 %, bevorzugter mindestens 75 %, bevorzugter mindestens 80 %, bevorzugter mindestens 85 %, bevorzugter mindestens 90 %, bevorzugter mindestens 95 %, be- sonders bevorzugt mindestens 98 % auf Aminosäureebene mit der Sequenz SEQ ID NO: 2 aufweist. Dabei kann es sich um eine natürliche Ketolase-Sequenz handeln, die wie vorstehend beschrieben durch Identitätsvergleich der Sequenzen aus anderen Organismen gefunden werden kann oder um eine künstliche Ketolase-Sequenz, die ausgehend von der Sequenz SEQ ID NO: 2 durch künstliche Variation, beispielsweise durch Substitution, Insertion oder Deletion von Aminosäuren abgewandelt wurde.
Unter dem Begriff "Substitution" ist in der Beschreibung der Austausch einer oder mehrerer Aminosäuren durch eine oder mehrere Aminosäuren zu verstehen. Bevorzugt werden sog. konservative Austausche durchgeführt, bei denen die ersetzte Aminosäu- re eine ähnliche Eigenschaft hat wie die ursprüngliche Aminosäure, beispielsweise Austausch von Glu durch Asp, Gin durch Asn, Val durch lle, Leu durch lle, Ser durch Thr.
Deletion ist das Ersetzen einer Aminosäure durch eine direkte Bindung. Bevorzugte Positionen für Deletionen sind die Termini des Polypeptides und die Verknüpfungen zwischen den einzelnen Proteindomänen.
Insertionen sind Einfügungen von Aminosäuren in die Polypeptidkette, wobei formal eine direkte Bindung durch ein oder mehrere Aminosäuren ersetzt wird.
Unter Identität zwischen zwei Proteinen wird die Identität der Aminosäuren über die jeweils gesamte Proteinlänge verstanden, insbesondere die Identität die durch Vergleich mit Hilfe der Vector NTI Suite 7.1 Software der Firma Informax (USA) unter Anwendung der Clustal Methode (Higgins DG, Sharp PM. Fast and sensitive multiple se- quence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr;5(2):151-1) unter Einstellung folgender Parameter berechnet wird:
Multiple alignment parameter:
Gap opening penalty 10 Gap extension penalty 10
Gap Separation penalty ränge 8
Gap Separation penalty off
% identity for alignment delay 40
Residue specific gaps off Hydrophilic residue gap off
Transition weighing 0 Pairwise alignment parameter: FAST algorithm on K-tuple size 1
Gap penalty 3 Window size 5
Number of best diagonals 5
Unter einer Ketolase, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ ID NO: 2 aufweist, wird dementsprechend eine Ketolase verstan- den, die bei einem Vergleich seiner Sequenz mit der Sequenz SEQ ID NO: 2, insbesondere nach obigen Programmlogarithmus mit obigem Parametersatz eine Identität von mindestens 42 % aufweist.
Beispielsweise weist nach obigen Programmlogarithmus mit obigem Parametersatz die Sequenz der Ketolase aus Nostoc punctiforme ATTC 29133 (SEQ ID NO: 4) mit der Sequenz der Ketolase aus Nostoc sp. Strain PCC7120 (SEQ ID NO: 2) eine Identität von 65% auf.
Die Sequenz der zweiten Ketolase aus Nostoc punctiforme ATTC 29133 (SEQ ID NO: 6) weist mit der Sequenz der Ketolase aus Nostoc sp. Strain PCC7120 (SEQ ID NO: 2) beispielsweise eine Identität von 58% auf.
Die Sequenz der Ketolase aus Synechococcus sp. WH 8102 (SEQ ID NO: 47) weist mit der Sequenz der Ketolase aus Nostoc sp. Strain PCC7120 (SEQ ID NO: 2) bei- spielsweise eine Identität von 44% auf.
Geeignete Nukleinsäuresequenzen sind beispielsweise durch Rückübersetzung der Polypeptidsequenz gemäß dem genetischen Code erhältlich.
Bevorzugt werden dafür solche Codons verwendet, die entsprechend der Organismusspezifischen "codon usage" häufig verwendet werden. Die "codon usage" lässt sich anhand von Computerauswertungen anderer, bekannter Gene der betreffenden Organismen leicht ermitteln.
In einer besonders bevorzugten Ausführungsform bringt man eine Nukleinsäure, enthaltend die Sequenz SEQ ID NO: 1 , in den Organismus ein. Alle vorstehend erwähnten Ketolase-Gene sind weiterhin in an sich bekannter Weise durch chemische Synthese aus den Nukleotidbausteinen wie beispielsweise durch Fragmentkondensation einzelner überlappender, komplementärer Nukleinsäurebau- steine der Doppelhelix herstellbar. Die chemische Synthese von Oligonukleotiden kann beispielsweise, in bekannter Weise, nach der Phosphoamiditmethode (Voet, Voet, 2. Auflage, Wiley Press New York, S. 896-897) erfolgen. Die Anlagerung synthetischer Oligonukleotide und Auffüllen von Lücken mithilfe des Klenow-Fragmentes der DNA- Polymerase und Ligationsreaktionen sowie allgemeine Klonierungsverfahren werden in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, beschrieben.
Die Sequenz der Ketolase aus Nostoc sp. Strain PCC7120 (SEQ ID NO: 2) weist mit den Sequenzen der Ketolasen die in den Verfahren des Standes der Technik verwen- det werden eine Identität von 39% (Agrobacterium aurantiacum (EP 735 137, Accession NO: D58420), 40% (Alcaligenes sp. PC-1 (EP 735137, Accession NO: D58422) und 20 bis 21 % (Haematococcus pluvialis Flotow em. Wille und Haematoccus pluvialis,: NIES-144 (EP 725137, WO 98/18910 und Lotan et al, FEBS Letters 1995, 364, 125- 128, Accession NO: X86782 und D45881) auf.
In einer bevorzugten Ausführungsform werden Organismen kultiviert, die gegenüber dem Wildtyp zusätzlich zur erhöhten Ketolase-Aktivität eine erhöhte Hydroxylase- Aktivität und/oder ß-Cyclase-Aktivität aufweisen.
Unter Hydroxylase-Aktivität wird die Enzymaktivität einer Hydroxylase verstanden.
Unter einer Hydroxylase wird ein Protein verstanden, das die enzymatische Aktivität aufweist, am, gegebenenfalls substituierten, ß-lonon-Ring von Carotinoiden eine Hydroxy-Gruppe einzuführen.
Insbesondere wird unter einer Hydroxylase ein Protein verstanden, das die enzymatische Aktivität aufweist, ß-Carotin in Zeaxanthin oder Canthaxanthin in
Astaxanthin umzuwandeln. Dementsprechend wird unter Hydroxylase-Aktivität die in einer bestimmten Zeit durch das Protein Hydroxylase umgesetzte Menge ß-Carotin oder Canthaxanthin bzw. gebildete Menge Zeaxanthin oder Astaxanthin verstanden.
Bei einer erhöhten Hydroxylase-Aktivität gegenüber dem Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Protein Hydroxylase die umgesetzte Menge ß-Carotin oder Canthaxantin bzw. die gebildete Menge Zeaxanthin oder Astaxanthin erhöht.
Vorzugsweise beträgt diese Erhöhung der Hydroxylase-Aktivität mindestens 5 %, weiter bevorzugt mindestens 20 %, weiter bevorzugt mindestens 50 %, weiter bevorzugt mindestens 100 %, bevorzugter mindestens 300 %, noch bevorzugter mindestens • 500 %, insbesondere mindestens 600 % der Hydroxylase-Aktivität des Wildtyps.
Unter ß-Cyclase-Aktivität wird die Enzymaktivität einer ß-Cyclase verstanden.
Unter einer ß-Cyclase wird ein Protein verstanden, das die enzymatische Aktivität auf- weist, einen endständigen, linearen Rest von Lycopin in einen ß-lonon-Ring zu überführen.
Insbesondere wird unter einer ß-Cyclase ein Protein verstanden, das die enzymatische Aktivität aufweist, γ-Carotin in ß-Carotin umzuwandeln.
Dementsprechend wird unter ß-Cyclase-Aktivität die in einer bestimmten Zeit durch das Protein ß-Cyclase umgesetzte Menge γ-Carotin bzw. gebildete Menge ß-Carotin verstanden.
Bei einer erhöhten ß-Cyclase -Aktivität gegenüber dem Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Protein ß-Cyclase die umgesetzte Menge an Lycopin bzw. γ-Carotin oder die gebildete Menge an γ-Carotin aus Lycopin bzw. die gebildete Menge an ß-Carotin aus γ-Carotin erhöht.
Vorzugsweise beträgt diese Erhöhung der ß-Cyclase-Aktivität mindestens 5 %, weiter bevorzugt mindestens 20 %, weiter bevorzugt mindestens 50 %, weiter bevorzugt min- destens 100 %, bevorzugter mindestens 300 %, noch bevorzugter mindestens 500 %, insbesondere mindestens 600 % der ß-Cyclase-Aktivität des Wildtyps.
Die Bestimmung der Hydroxylase-Aktivität in erfindungsgemäßen genetisch veränder- ten Organismen und in Wildtyp- bzw. Referenzorganismen erfolgt vorzugsweise unter folgenden Bedingungen:
Die Aktivität der Hydroxylase wird nach Bouvier et al. (Biochim. Biophys. Acta 1391 (1998), 320-328) in vitro bestimmt. Es wird zu einer bestimmten Menge an Organis- musextrakt Ferredoxin, Ferredoxin-NADP Oxidoreductase, Katalase, NADPH sowie ß- Carotin mit Mono- und Digalaktosylglyzeriden zugegeben.
Besonders bevorzugt erfolgt die Bestimmung der Hydroxylase-Aktivität unter folgenden Bedingungen nach Bouvier, Keller, d'Harlingue und Camara (Xanthophyll bio- synthesis: molecular and f unctional characterization of carotenoid hydroxylases f rom pepper fruits (Capsicum annuum L; Biochim. Biophys. Acta 1391 (1998), 320-328):
Der in-vitro Assay wird in einem Volumen von 0.250 ml durchgeführt. Der Ansatz enthält 50 mM Kaliumphosphat (pH 7.6), 0.025 mg Ferredoxin von Spinat, 0.5 Einheiten Ferredoxin-NADP+ Oxidoreduktase von Spinat, 0.25 mM NADPH, 0.010 mg beta-
Carotin (in 0.1 mg Tween 80 emulgiert), 0.05 mM einer Mischung von Mono- und Digalaktosylglyzeriden (1 :1), 1 Einheit Katalyse, 200 Mono- und Digalaktosylglyzeriden (1 :1), 0.2 mg Rinderserumalbumin und Organismusextrakt in unterschiedlichem Volumen. Die Reaktionsmischung wird 2 Stunden bei 30°C inkubiert. Die Reaktionsproduk- te werden mit organischem Lösungsmittel wie Aceton oder Chloroform/Methanol (2:1) extrahiert und mittels HPLC bestimmt.
Die Bestimmung der ß-Cyclase-Aktivität in erfindungsgemäßen genetisch veränderten Organismen und in Wildtyp- bzw. Referenzorganismen erfolgt vorzugsweise unter fol- genden Bedingungen:
Die Aktivität der ß-Cyclase wird nach Fräser und Sandmann (Biochem. Biophys. Res. Comm. 185(1) (1992) 9-15)/n vitro bestimmt. Es werden zu einer bestimmten Menge an Organismusextrakt Kaliumphosphat als Puffer (pH 7.6), Lycopin als Substrat, Stro- maprotein von Paprika, NADP+, NADPH und ATP zugegeben. Besonders bevorzugt erfolgt die Bestimmung der ß-Cyclase -Aktivität unter folgenden Bedingungen nach Bouvier, d'Harlingue und Camara (Molecular Analysis of carotenoid cyclae inhibition; Arch. Biochem. Biophys. 346(1) (1997) 53-64):
Der in-vitro Assay wird in einem Volumen von 250 μl Volumen durchgeführt. Der Ansatz enthält 50 mM Kaliumphosphat (pH 7.6), unterschiedliche Mengen an Organismusextrakt, 20 nM Lycopin, 250 μg an chromoplastidärem Stromaprotein aus Paprika, 0.2 mM NADP+, 0.2 mM NADPH und 1 mM ATP. NADP/NADPH und ATP werden in 10 ml Ethanol mit 1 mg Tween 80 unmittelbar vor der Zugabe zum Inkubationsmedium gelöst. Nach einer Reaktionszeit von 60 Minuten bei 30°C wird die Reaktion durch Zugabe von Chloroform/Methanol (2:1) beendet. Die in Chloroform extrahierten Reaktionsprodukte werden mittels HPLC analysiert.
Ein alternativer Assay mit radioaktivem Substrat ist beschrieben in Fräser und Sand- mann (Biochem. Biophys. Res. Comm. 185(1 ) (1992) 9-15).
Die Erhöhung der Hydroxylase-Aktivität und/oder ß-Cyclase-Aktivität kann durch verschiedene Wege erfolgen, beispielsweise durch Ausschalten von hemmenden Regulationsmechanismen auf Expressions- und Proteinebene oder durch Erhöhung der Ge- nexpression von Nukleinsäuren, kodierend eine Hydroxylase, und/oder von Nukleinsäuren, kodierend eine ß-Cyclase, gegenüber dem Wildtyp.
Die Erhöhung der Genexpression der Nukleinsäuren, kodierend eine Hydroxylase, und/oder die Erhöhung der Genexpression der Nukleinsäure, kodierend eine ß- Cyclase, gegenüber dem Wildtyp kann ebenfalls durch verschiedene Wege erfolgen, beispielsweise durch Induzierung des Hydroxylase-Gens und/oder ß-Cyclase-Gens durch Aktivatoren oder durch Einbringen von einer oder mehrerer Hydroxylase- Genkopien und/oder ß-Cyclase-Genkopien, also durch Einbringen mindestens einer Nukleinsäure, kodierend eine Hydroxylase, und/oder mindestens einer Nukleinsäure, kodierend eine ß-Cyclase, in den Organismus.
Unter Erhöhung der Genexpression einer Nukleinsäure, kodierend eine Hydroxylase und/oder ß-Cyclase, wird erfindungsgemäß auch die Manipulation der Expression der Organismus eigenen endogenen Hydroxylase und/oder ß-Cyclase verstanden. Dies kann beispielsweise durch Veränderung der Promotor DNA-Sequenz für Hydroxy- lasen und/oder ß-Cyclasen kodierende Gene erreicht werden. Eine solche Veränderung, die eine erhöhte Expressionsrate des Gens zur Folge hat, kann beispielsweise durch Deletion oder Insertion von DNA Sequenzen erfolgen.
Es ist, wie vorstehend beschrieben, möglich, die Expression der endogenen Hydroxylase und/oder ß-Cyclase durch die Applikation exogener Stimuli zu verändern. Dies kann durch besondere physiologische Bedingungen, also durch die Applikation von Fremdsubstanzen erfolgen.
Des weiteren kann eine veränderte bzw. erhöhte Expression eines endogenen Hydroxylase- und/oder ß-Cyclase-Gens dadurch erzielt werden, dass ein im nicht transformierten Organismus nicht vorkommendes Regulator-Protein mit dem Promotor dieses Gens in Wechselwirkung tritt.
Solch ein Regulator kann ein chimäres Protein darstellen, welches aus einer DNA- Bindedomäne und einer Transkriptionsaktivator-Domäne besteht, wie beispielsweise in
WO 96/06166 beschrieben.
In einer bevorzugten Ausführungsform erfolgt die Erhöhung der Genexpression einer Nukleinsäure, kodierend eine Hydroxylase, und/oder die Erhöhung der Genexpression einer Nukleinsäure, kodierend eine ß-Cyclase, durch Einbringen von mindestens einer Nukleinsäure, kodierend eine Hydroxylase, und/oder durch Einbringen von mindestens einer Nukleinsäure, kodierend eine ß-Cyclase, in den Organismus.
Dazu kann prinzipiell jedes Hydroxylase-Gen bzw. jedes ß-Cyclase-Gen, also jede Nukleinsäure, die eine Hydroxylase und jede Nukleinsäure, die eine ß-Cyclase kodiert, verwendet werden.
Bei genomischen Hydroxylase-bzw. ß-Cyclase-Nukleinsäure-Sequenzen aus eukaryo- tischen Quellen, die Introns enthalten, sind für den Fall, dass der Wirtsorganismus nicht in der Lage ist oder nicht in die Lage versetzt werden kann, die entsprechende Hydroxylase bzw. ß-Cyclase zu exprimieren, bevorzugt bereits prozessierte Nukleinsäuresequenzen, wie die entsprechenden cDNAs, zu verwenden. Ein Beispiel für ein Hydroxylase-Gen ist eine Nukleinsäure, kodierend eine Hydroxylase, aus Haematococcus pluvialis, Accession AX038729, WO 0061764); (Nukleinsäure: SEQ ID NO: 15, Protein: SEQ ID NO: 16).
Ein Beispiel für ein ß-Cyclase-Gen ist eine Nukleinsäure, kodierend eine ß-Cyclase aus Tomate (Accession X86452).(Nukleinsäure: SEQ ID NO: 17, Protein: SEQ ID NO: 18).
In den erfindungsgemäßen bevorzugten transgenen Organismen liegt also in dieser bevorzugten Ausführungsform gegenüber dem Wildtyp mindestens ein weiteres Hydroxylase-Gen und/oder ß-Cyclase-Gen vor.
In dieser bevorzugten Ausführungsform weist der genetisch veränderte Organismus beispielsweise mindestens eine exogene Nukleinsäure, kodierend eine Hydroxylase, oder mindestens zwei endogene Nukleinsäuren, kodierend eine Hydroxylase und/oder mindestens eine exogene Nukleinsäure, kodierend eine ß-Cyclase, oder mindestens zwei endogene Nukleinsäuren, kodierend eine ß-Cyclase, auf.
X
Bevorzugt verwendet man in vorstehend beschriebener bevorzugter Ausführungsform als Hydroxylase-Gene Nukleinsäuren, die Proteine kodieren, -enthaltend die Aminosäu- resequenz SEQ ID NO: 16 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 30 %, vorzugsweise mindestens 50 %, bevorzugter mindestens 70%, noch bevorzugter mindestens 90 %, am bevorzugtesten mindestens 95 % auf Aminosäureebene mit der
Sequenz SEQ ID NO: 16, und die die enzymatische Eigenschaft einer Hydroxylase aufweisen.
Weitere Beispiele für Hydroxylasen und Hydroxylase-Gene lassen sich beispielsweise aus verschiedenen Organismen, deren genomische Sequenz bekannt ist, wie vorstehend beschrieben durch Homologievergleiche der Aminosäuresequenzen oder der entsprechenden rückübersetzten Nukleinsäuresequenzen aus Datenbanken mit der SEQ ID. NO: 16 leicht auffinden.
Weitere Beispiele für Hydroxylasen und Hydroxylase-Gene lassen sich weiterhin beispielsweise ausgehend von der Sequenz SEQ ID NO: 15 aus verschiedenen Organis- men deren genomische Sequenz nicht bekannt ist, wie vorstehend beschrieben, durch Hybridisierungs- und PCR-Techniken in an sich bekannter Weise leicht auffinden.
In einer weiter besonders bevorzugten Ausführungsform werden zur Erhöhung der Hydroxylase-Aktivität Nukleinsäuren in Organismen eingebracht, die Proteine kodieren, enthaltend die Aminosäuresequenz der Hydroxylase der Sequenz SEQ ID NO: 16.
Geeignete Nukleinsäuresequenzen sind beispielsweise durch Rückübersetzung der Polypeptidsequenz gemäß dem genetischen Code erhältlich.
Bevorzugt werden dafür solche Kodons verwendet, die entsprechend des Organismusspezifischen "codon usage" häufig verwendet werden. Dieser "codon usage" lässt sich anhand von Computerauswertungen anderer, bekannter Gene der betreffenden Organismen leicht ermitteln.
In einer besonders bevorzugten Ausführungsform bringt man eine Nukleinsäure, enthaltend die Sequenz SEQ. ID. NO: 15, in den Organismus ein.
X
Bevorzugt verwendet man in vorstehend beschriebener bevorzugter Ausführungsform als ß-Cyclase-Gene Nukleinsäuren, die Proteine kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 18 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 30 %, vorzugsweise mindestens 50 %, bevorzugter mindestens 70 %, noch bevorzugter mindestens 90 %, am bevorzugtesten mindestens 95 % auf Aminosäureebene mit der Sequenz SEQ ID NO: 18, und die die enzymatische Eigenschaft einer ß-Cyclase aufweisen.
Weitere Beispiele für ß-Cyclasen und ß-Cyclase-Gene lassen sich beispielsweise aus verschiedenen Organismen, deren genomische Sequenz bekannt ist, wie vorstehend beschrieben durch Homologievergleiche der Aminosäuresequenzen oder der entsprechenden rückübersetzten Nukleinsäuresequenzen aus Datenbanken mit der SEQ ID NO: 18 leicht auffinden.
Weitere Beispiele für ß-Cyclasen und ß-Cyclase-Gene lassen sich weiterhin beispiels- weise ausgehend von der Sequenz SEQ ID NO: 17 aus verschiedenen Organismen, deren genomische Sequenz nicht bekannt ist, durch Hybridisierungs- und PCR- Techniken in an sich bekannter Weise leicht auffinden.
In einer weiter besonders bevorzugten Ausführungsform werden zur Erhöhung der ß- Cyclase-Aktivität Nukleinsäuren in Organismen eingebracht, die Proteine kodieren, enthaltend die Aminosäuresequenz der ß-Cyclase der Sequenz SEQ. ID. NO: 18.
Geeignete Nukleinsäuresequenzen sind beispielsweise durch Rückübersetzung der Polypeptidsequenz gemäß dem genetischen Code erhältlich.
Bevorzugt werden dafür solche Kodons verwendet, die entsprechend des Organismusspezifischen "codon usage" häufig verwendet werden. Dieser "codon usage" lässt sich anhand von Computerauswertungen anderer, bekannter Gene der betreffenden Organismen leicht ermitteln.
In einer besonders bevorzugten Ausführungsform bringt man eine Nukleinsäure, enthaltend die Sequenz SEQ. ID. NO: 17 in den Organismus ein.
Alle vorstehend erwähnten Hydroxylase-Gene oder ß-Cyclase-Gene sind weiterhin in an sich bekannter Weise durch chemische Synthese aus den Nukleotidbausteinen wie beispielsweise durch Fragmentkondensation einzelner überlappender, komplementärer Nukleinsäurebausteine der Doppelhelix herstellbar. Die chemische Synthese von Oligonukleotiden kann beispielsweise, in bekannter Weise, nach der Phosphoamidit- methode (Voet, Voet, 2. Auflage, Wiley Press New York, Seite 896-897) erfolgen. Die Anlagerung synthetischer Oiigonukleotide und Auffüllen von Lücken mithilfe des Kle- now-Fragmentes der DNA-Polymerase und Ligationsreaktionen sowie allgemeine Klo- nierungsverfahren werden in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, beschrieben.
Besonders bevorzugt werden im erfindungsgemäßen Verfahren genetisch veränderte Organismen mit folgende Kombinationen genetischer Veränderungen verwendet:
Genetisch veränderte Organismen, die im Vergleich zum Wildtyp eine erhöhte oder verursachte Ketolase-Aktivität und eine erhöhte Hydroxylase-Aktivität aufweisen, genetisch veränderte Organismen, die im Vergleich zum Wildtyp eine erhöhte oder verursachte Ketolase-Aktivität und eine erhöhte ß-Cyclase-Aktivität aufweisen und
genetisch veränderte Organismen, die im Vergleich zum Wildtyp eine erhöhte oder verursachte Ketolase-Aktivität und eine erhöhte Hydroxylase-Aktivität und eine erhöhte ß-Cyclase-Aktivität aufweisen.
Die Herstellung dieser genetisch veränderten Organismen kann, wie nachstehend beschrieben, beispielsweise durch Einbringen einzelner Nukleinsäurekonstrukte (Expressionskassetten) oder durch Einbringen von Mehrfachkonstrukten erfolgen, die bis zu zwei oder drei der beschriebenen Aktivitäten enthalten.
Unter Organismen werden erfindungsgemäß vorzugsweise Organismen verstanden, die als Wildtyp- oder Ausgangsorganismen natürlicherweise oder durch genetische Komplementierung und/oder Umregulierung der Stoffwechselwege in der Lage sind, Carotinoide, insbesondere ß-Carotin und/oder Zeaxanthin und/oder Neoxanthin und/oder Violaxanthin und/oder Lutein herzustellen.
X
Weiter bevorzugte Organismen weisen als Wildtyp- oder Ausgangsorganismen bereits eine Hydroxylase-Aktivität auf und sind somit als Wildtyp- oder Ausgangsorganismen in der Lage, Zeaxanthin herzustellen.
Bevorzugte Organismen sind Pflanzen oder Mikroorganismen, wie beispielsweise Bakterien, Hefen, Algen oder Pilze.
Als Bakterien können sowohl Bakterien verwendet werden, die aufgrund des Einbringens von Genen der Carotinoidbiosynthese eines Carotinoid-produzierenden Organismus in der Lage sind, Xanthophylle zu synthetisieren, wie beispielsweise Bakterien der Gattung Escherichia, die beispielsweise crt-Gene aus Erwinia enthalten, als auch Bakterien, die von sich aus in der Lage sind, Xanthophylle zu synthetisieren wie beispiels- weise Bakterien der Gattung Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Paracoccus, Nostoc oder Cyanobakterien der Gattung Synechocystis.
Bevorzugte Bakterien sind Escherichia coli, Erwinia herbicola, Erwinia uredovora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobacterium sp. strain R1534, das Cyanobacterium Synechocystis sp. PCC6803, Paracoccus marcusii oder Paracoc- cus carotinifaciens.
Bevorzugte Hefen sind Candida, Saccharomyces, Hansenula, Pichia oder Phaffia. Be- sonders bevorzugte Hefen sind Xanthophyllomyces dendrorhous oder Phaffia rhodozyma.
Bevorzugte Pilze sind Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phy- comyces, Fusarium oder weitere in Indian Chem. Engr. Section B. Vol. 37, No. 1 , 2 (1995) auf Seite 15, Tabelle 6 beschriebene Pilze.
Bevorzugte Algen sind Grünalgen, wie beispielsweise Algen der Gattung Haematococcus, Phaedactylum tricornatum, Volvox oder Dunaliella. Besonders bevorzugte Algen sind Haematococcus puvialis oder Dunaliella bardawil.
Weitere brauchbare Mikroorganismen und deren Herstellung zur Durchführung des erfindungsgemäßen Verfahrens sind beispielsweise aus der DE-A-199 16 140 bekannt, x worauf hiermit Bezug genommen wird.
Besonders bevorzugte Pflanzen sind Pflanzen ausgewählt aus den Familien Ranuncu-. iaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Lina- ceae, Vitaceae, Brassicaceae, Cucurbitaceae, Primulaceae, Caryophyl Iaceae, Ama- ranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Or- chidaceae, Malvaceae, liliaceae oder Lamiaceae.
Ganz besonders bevorzugte Pflanzen sind ausgewählt aus der Gruppe der Pflanzengattungen Marigold, Tagetes errecta, Tagetes patula, Acacia, Aconitum, Adonis, Arni- ca, Aquilegia, Aster, Astragalus, Bignonia, Calendula, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Gre- villea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kenia, Labumum, Lathyrus, Leontodon, Lili- um, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussi- lago, Ulex, Viola oder Zinnia, besonders bevorzugt ausgewählt aus der Gruppe der Pflanzengattungen Marigold, Tagetes erecta, Tagetes patula, Lycopersicon, Rosa, Calenduia, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium, Tropaeolum oder Adonis.
Im erfindungsgemäßen Verfahren zur Herstellung von Ketocarotinoiden wird vorzugsweise dem Kultivierungsschritt der genetisch veränderten Organismen ein Ernten der Organismen und weiter bevorzugt zusätzlich ein Isolieren von Ketocarotinoiden aus den Organismen angeschlossen.
Das Ernten der Organismen erfolgt in an sich bekannter Weise dem jeweiligen Organismus entsprechend. Mikroorganismen, wie Bakterien, Hefen, Algen oder Pilze oder Pflanzenzellen, die durch Fermentation in flüßigen Nährmedien kultiviert werden, können beispielsweise durch Zentrifugieren, Dekantieren oder Filtrieren abgetrennt werden. Pflanzen werden in an sich bekannter Weise auf Nährböden gezogen und ent-' sprechend geerntet.
Die Kultivierung der genetisch veränderten Mikroorganismen erfolgt bevorzugt in Gegenwart von Sauerstoff bei einer Kultivierungstemperatur von mindestens etwa 20°C, wie z.B. 20°C bis 40 °C, und einem pH-Wert von etwa 6 bis 9. Bei genetisch veränderten Mikroorganismen erfolgt vorzugsweise zunächst die Kultivierung der Mikroorganismen in Gegenwart von Sauerstoff und in einem Komplexmedium, wie z.B. TB- oder LB- Medium bei einer Kultivierungstemperatur von etwa 20 °C oder mehr, und einem pH-Wert von etwa 6 bis 9, bis eine ausreichende Zelldichte erreicht ist. Um die Oxidati- onsreaktion besser steuern zu können, bevorzugt man die Verwendung eines induzierbaren Promotors. Die Kultivierung wird nach Induktion der Ketolaseexpression in Gegenwart von Sauerstoff, z.B. 12 Stunden bis 3 Tage, fortgesetzt.
Die Isolierung der Ketocarotinoide aus der geernteten Biomasse erfolgt in an sich bekannter Weise, beispielsweise durch Extraktion und gegebenenfalls weiterer chemische oder physikalischer Reinigungsprozesse, wie beispielsweise Fällungsmethoden, Kristallographie, thermische Trennverfahren, wie Rektifizierverfahren oder physikali- sehe Trennverfahren, wie beispielsweise Chromatographie. Wie nachstehend erwähnt, können die ketocarotinoide in den erfindungsgemäßen, genetisch veränderten Pflanzen vorzugsweise in verschiedenen Pflanzengeweben, wie beispielsweise Samen, Blätter, Früchte, Blüten, insbesondere in Blütenblättern spezifisch hergestellt werden.
Die Isolierung von Ketocarotinoiden aus den geernteten Blütenblättern erfolgt in an sich bekannter Weise, beispielsweise durch Trocknung und anschließender Extraktion und gegebenenfalls weiterer chemischer oder physikalischer Reinigungsprozesse, wie beispielsweise Fällungsmethoden, Kristallographie, thermische Trennverfahren, wie Rektifizierverfahren oder physikalische Trennverfahren, wie beispielsweise Chromatographie. Die Isolierung von Ketocarotinoiden aus den Blütenblättern erfolgt beispielsweise bevorzugt durch organische Lösungsmittel wie Aceton, Hexan, Ether oder tert.-Methylbutylether.
Weitere Isolierverfahren von Ketocarotinoiden, insbesondere aus Blütenblättern, sind beispielsweise in Egger und Kleinig (Phytochemistry (1967) 6, 437-440) und Egger (Phytochemistry (1965) 4, 609-618) beschrieben.
X
Vorzugsweise sind die Ketocarotinoide ausgewählt aus der .Gruppe Astaxanthin, Canthaxanthin, Echinenon, 3-Hydroxyechinenon, 3'-Hydroxyechinenon, Adonirubin und Adonixanthin.
Ein besonders bevorzugtes Ketocarotinoid ist Astaxanthin.
Je nach verwendetem Organismus fallen die Ketocarotinoide in freier Form oder als Fettsäureester an.
In Blütenblättern von Pflanzen fallen die Ketocarotinlide im erfindungsgemäßen Verfahren in Form ihrer Mono- oder Diester mit Fettsäuren an. Einige nachgewiesene Fett- säuren sind z.B. Myristinsäure, Palmitinsäure, Stearinsäure, Ölsäure, Linolensäure, und Laurinsäure (Kamata und Simpson (1987) Comp. Biochem. Physiol. Vol. 86B(3), 587-591).
Die Herstellung der Ketocarotinoide kann in der ganzen Pflanze oder in einer bevor- zugten Ausführungsform spezifisch in Pflanzengeweben, die Chromoplasten enthalten, erfolgen. Bevorzugte Pflanzengewebe sind beispielsweise Wurzeln, Samen, Blätter, Früchte, Blüten und insbesondere Nektarien und Blütenblätter, die auch Petalen bezeichnet werden.
In einer besonderes bevorzugten Ausführungsform der erfindungsgemäßen Verfahrens verwendet man genetisch veränderte Pflanzen, die in Blüten die höchste Expressionsrate einer Ketolase aufweisen.
Vorzugsweise wird dies dadurch erreicht, dass die Genexpression der Ketolase unter Kontrolle eines blütenspezifischen Promotors erfolgt. Beispielsweise werden dazu die vorstehend beschriebenen Nukleinsäuren, wie nachstehend ausführlich beschrieben, in einem Nukleinsäurekonstrukt funktionell verknüpft mit einem blütenspezifischen Promotor in die Pflanze eingebracht.
In einer weiteren, besonderes bevorzugten Ausführungsform der erfindungsgemäßen Verfahrens verwendet man genetisch veränderte Pflanzen, die in Früchten die höchste Expressionsrate einer Ketolase aufweisen.
Vorzugsweise wird dies dadurch erreicht, dass die Genexpression der Ketolase unter Kontrolle eines fruchtspezifischen Promotors erfolgt. Beispielsweise werden dazu die vorstehend beschriebenen Nukleinsäuren, wie nachstehend ausführlich beschrieben, in einem Nukleinsäurekonstrukt funktionell verknüpft mit einem fruchtspezifischen Promotor in die Pflanze eingebracht.
In einer weiteren, besonderes bevorzugten, Ausführungsform der erfindungsgemäßen Verfahrens verwendet man genetisch veränderte Pflanzen, die in Samen die höchste Expressionsrate einer Ketolase aufweisen.
Vorzugsweise wird dies dadurch erreicht, dass die Genexpression der Ketolase unter Kontrolle eines samenspezifischen Promotors erfolgt. Beispielsweise werden dazu die vorstehend beschriebenen Nukleinsäuren, wie nachstehend ausführlich beschrieben, in einem Nukleinsäurekonstrukt funktionell verknüpft mit einem samenspezifischen Promotor in die Pflanze eingebracht.
Das Targeting in die Chromplasten erfolgt durch ein funktionell verknüpftes plastidäres Transitpeptid. Im folgenden wird exemplarisch die Herstellung genetisch veränderter Pflanzen mit erhöhter oder verursachter Ketolase-Aktivität beschrieben. Die Erhöhung weiterer Aktivitäten, wie beispielsweise der Hydroxylase-Aktivität und/oder der ß-Cyclase-Aktivität kann analog unter Verwendung von Nukleinsäuresequenzen, kodierend eine Hydroxy- läse bzw. ß-Cyclase anstelle von Nukleinsäuresequenzen, kodierend eine Ketolase, erfolgen. Die Transformation kann bei den Kombinationen von genetischen Veränderungen einzeln oder durch Mehrfachkonstrukte erfolgen.
Die Herstellung der transgenen Pflanzen erfolgt vorzugsweise durch Transformation der Ausgangspflanzen, mit einem Nukleinsäurekonstrukt, das die vorstehend beschriebenen Nukleinsäuren, kodierend eine Ketolase enthält, die mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Pflanzen gewährleisten.
Diese Nukleinsäurekonstrukte, in denen die kodierende Nukleinsauresequenz mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Pflanzen gewährleisten, werden im folgenden auch Expressionskassetten genannt.
Vorzugsweise enthalten die Regulationssignale einen oder mehrere Promotoren, die die Transkription und Translation in Pflanzen gewährleisten.
Die Expressionskassetten beinhalten Regulationssignale, also regulative Nukleinsäuresequenzen, welche die Expression der kodierenden Sequenz in der Wirtszelle steu- em. Gemäß einer bevorzugten Ausführungsform umfasst eine Expressionskassette stromaufwärts, d.h. am 5'-Ende der kodierenden Sequenz, einen Promotor und stromabwärts, d.h. am 3'-Ende, ein Polyadenylierungssignal und gegebenenfalls weitere regulatorische Elemente, welche mit der dazwischenliegenden kodierenden Sequenz für mindestens eines der vorstehend beschriebenen Gene operativ verknüpft sind. Un- ter einer operativen Verknüpfung versteht man die sequenzielle Anordnung von Promotor, kodierender Sequenz, Terminator und ggf. weiterer regulativer Elemente derart, das jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann. Im folgenden werden beispielhaft die bevorzugten Nukleinsäurekonstrukte, Expressionskassetten und Vektoren für Pflanzen und Verfahren zur Herstellung von transgenen Pflanzen, sowie die transgenen Pflanzen selbst beschrieben.
Die zur operativen Verknüpfung bevorzugten, aber nicht darauf beschränkten Sequenzen, sind Targeting-Sequenzen zur Gewährleistung der subzellulären Lokalisation im Apoplasten, in der Vakuole, in Piastiden, im Mitochondrium, im Endoplasmatischen Retikulum (ER), im Zellkern, in Ölkörperchen oder anderen Kompartimenten und Translationsverstärkern wie die 5'-Führungssequenz aus dem Tabak-Mosaik- Virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693 -8711 ).
Als Promotor der Expressionskassette ist grundsätzlich jeder Promotor geeignet, der die Expression von Fremdgenen in Pflanzen steuern kann.
"Konstitutiver" Promotor meint solche Promotoren, die eine Expression in zahlreichen, bevorzugt allen, Geweben über einen größeren Zeitraum der Pflanzenentwicklung, bevorzugt zu allen Zeitpunkten der Pflanzenentwicklung, gewährleisten.
X
Vorzugsweise verwendet man insbesondere einen pflanzlichen Promotor oder einen Promotor, der einem Pflanzenvirus entstammt. Insbesondere bevorzugt ist der Promotor des 35S-Transkript.es des CaMV Blumenkohlmosaikvirus (Franck et al. (1980) Cell 21 :285-294; Odell et al. (1985) Nature 313:810-812; Shewmaker et al. (1985) Virology 140:281-288; Gardner et al. (1986) Plant Mol Biol 6:221-228), der 19S CaMV Promotor (US 5,352,605; WO 84/02913; Benfey et al. (1989) EMBO J 8:2195-2202), den Triose- Phosphat Translokator (TPT) Promotor aus Arabidopsis thallana Acc.-No. AB006698 , Basenpaar 53242 bis 55281 ; das Gen beginnend ab bp 55282 ist mit "phos- phate/triose-phosphate translocator" annotiert, oder den 34S Promoter aus Figwort mosaic virus Acc.-No. X16673, Basenpaar 1 bis 554.
Ein weiterer geeigneter konstitutiver Promotor ist der pds Promoter (Pecker et al. (1992) Proc. Natl. Acad. Sei USA 89: 4962-4966) oder der "Rubisco small subunit (SSU)"-Promotor (US 4,962,028), der LeguminB-Promotor (GenBank Acc.-Nr. X03677), der Promotor der Nopalinsynthase aus Agrobacterium, der TR- Doppelpromotor, der OCS (Octopin Synthase) Promotor aus Agrobacterium, der Ubi- quitin Promotor (Holtorf S et al. (1995) Plant Mol Biol 29:637-649), der Ubiquitin 1 Promotor (Christensen et al. (1992) Plant Mol Biol 18:675-689; Bruce et al. (1989) Proc Natl Acad Sei USA 86:9692-9696), der'Smas Promotor, der Cinnamylalkoholdehydro- genase-Promotor (US 5,683,439), die Promotoren der vakuolärer ATPase Untereinheiten oder der Promotor eines prolinreichen Proteins aus Weizen (WO 91/13991), der Pnit-Promoter (Y07648.L, Hillebrand et al. (1998), Plant. Mol. Biol. 36, 89-99, Hille- brand et al. (1996), Gene, 170, 197-200) sowie weitere Promotoren von Genen, deren konstitutive Expression in Pflanzen dem Fachmann bekannt ist.
Die Expressionskassetten können auch einen chemisch induzierbaren Promotor enthalten (Übersichtsartikel: Gatz et al. (1997) Annu Rev Plant Physiol Plant Mol Biol 48:89-108), durch den die Expression des Ketolase-Gens in der Pflanze zu einem bestimmten Zeitpunkt gesteuert werden kann. Derartige Promotoren, wie z.B. der PRP1 Promotor (Ward et al. (1993) Plant Mol Biol 22:361-366), ein durch Salicylsäure induzierbarer Promotor (WO 95/19443), ein durch Benzolsulfonamid-induzierbarer Promotor (EP 0388 186), ein durch Tetrazyklin-induzierbarer Promotor (Gatz et al. (1992) Plant J 2:397-404), ein durch Abscisinsäure induzierbarer Promotor (EP 0335 528) bzw. ein durch Ethanol- oder Cyclohexanon-induzierbarer Promotor (WO 93/21334) können ebenfalls verwendet werden. X
Ferner sind Promotoren bevorzugt, die durch biotischen oder abiotischen Stress indu- ziert werden wie beispielsweise der pathogen-induzierbare Promotor des PRP1 -Gens (Ward et al. (1993) Plant Mol Biol 22:361-366), der hitzeinduzierbare hsp70- oder hsp80-Promoter aus Tomate (US 5,187,267), der kälteinduzierbare alpha-Amylase Promoter aus der Kartoffel (WO 96/12814), der licht-induzierbare PPDK Promotor oder der verwundungsinduzierte pinll-Promoter (EP375091).
Pathogen-induzierbare Promotoren umfassen die von Genen, die infolge eines Patho- genbefalls induziert werden wie beispielsweise Gene von PR-Proteinen, SAR- Proteinen, b-1 ,3-Glucanase, Chitinase usw. (beispielsweise Redolfi et al. (1983) Neth J Plant Pathol 89:245-254; Uknes, et al. (1992) The Plant Cell4:645-656; Van Loon (1985) Plant Mol Viral 4:111-116; Marineau et al. (1987) Plant Mol Biol 9:335-342; Mat- ton et al. (1987) Molecular Plant-Microbe Interactions 2:325-342; Somssich et al. (1986) Proc Natl Acad Sei USA 83:2427-2430; Somssich et al. (1988) Mol Gen Genet- ics 2:93-98; Chen et al. (1996) Plant J 10:955-966; Zhang and Sing (1994) Proc Natl Acad Sei USA 91 :2507-2511 ; Warner, et al. (1993) Plant J 3:191 -201 ; Siebertz et al. (1989) Plant Cell 1 :961 -968(1989). Umfasst sind auch verwundungsinduzierbare Promotoren wie der des pinll-Gens (Ryan (1990) Ann Rev Phytopath 28:425-449; Duan et al. (1996) Nat Biotech 14:494-498), des wunl und wun2-Gens (US 5,428,148), des winl- und win2-Gens (Stanford et al. (1989) Mol Gen Genet 215:200-208), des Systemin-Gens (McGurl et al. (1992) Science 225:1570-1573), des WIP1-Gens (Rohmeier et al. (1993) Plant Mol Biol
22:783-792; Ekelkamp et al. (1993) FEBS Letters 323:73-76), des MPI-Gens (Corderok et al. (1994) The Plant J 6(2):141 -150) und dergleichen.
Weitere geeignete Promotoren sind beispielsweise fruchtreifung-spezifische Promoto- ren, wie beispielsweise der fruchtreifung-spezifische Promotor aus Tomate (WO
94/21794, EP 409 625). Entwicklungsabhängige Promotoren schließt zum Teil die gewebespezifischen Promotoren ein, da die Ausbildung einzelner Gewebe naturgemäß entwicklungsabhängig erfolgt.
Weiterhin sind insbesondere solche Promotoren bevorzugt, die die Expression in Geweben oder Pflanzenteilen sicherstellen, in denen beispielsweise die Biosynthese von Ketocarotinoiden bzw. dessen Vorstufen stattfindet. Bevorzugt sind beispielsweise . Promotoren mit Spezifitäten für die Antheren, Ovarien, Petalen, Sepalen, Blüten, Blätter, Stengel, Samen und Wurzeln und Kombinationen hieraus.
Knollen-, Speicherwurzel- oder Wurzel-spezifische Promotoren sind beispielsweise der Patatin-Promotor Klasse I (B33) oder der Promotor des Cathepsin D Inhibitors aus Kartoffel.
Blattspezifische Promotoren sind beispielsweise der Promotor der cytosolischen
FBPase aus Kartoffel (WO 97/05900), der SSU Promotor (small subunit) der Rubisco (Ribulose-1 ,5-bisphosphatcarboxylase) oder der ST-LSI Promotor aus Kartoffel (Stockhaus et al. (1989) EMBO J 8:2445-2451).
Blütenspezifische Promotoren sind beispielsweise der Phytoen-Synthase Promotor (WO 92/16635) oder der Promotor des P-rr Gens (WO 98/22593), der AP3 Promoter aus Arabidopsis thaliana (siehe Beispiel 5), der CHRC-Promoter (Chromoplast-specific carotenoid-associated protein (CHRC) gene promoter aus Cucumis sativus Acc.-No. AF099501 , Basenpaar 1 bis 1532), der EPSP_Synthase Promotor (5-enol- pyruvylshikimate-3-phosphate synthase gene promoter aus Petunia hybrida, Acc.-No. M37029, Basenpaar 1 bis 1788), der PDS Promotor (Phytoene desaturase gene pro- moter aus Solanum lycopersicum, Acc.-No. U46919, Basenpaar 1 bis 2078), der DFR- A Promotor (Dihydroflavonol 4-reductase gene A promoter aus Petunia hybrida, Acc.- No. X79723, Basenpaar 32 bis 1902) oder der FBP1 Promotor (Floral Binding Protein 1 gene promoter aus Petunia hybrida, Acc.-No. L10115, Basenpaar 52 bis 1069).
Antheren-spezifische Promotoren sind beispielsweise der 5126-Promotor (US 5,689,049, US 5,689,051), der glob-l Promotor oder der g-Zein Promotor.
Samen-spezifische Promotoren sind beispielsweise der ACP05-Promotor (Acyl-carrier- Protein Gen, WO9218634), die Promotoren AtS1 und AtS3 von Arabidopsis
(WO 9920775), der LeB4-Promotor von Vicia faba (WO 9729200 und US 06403371), der Napin-Promotor von Brassica napus (US 5608152; EP 255378; US 5420034),der SBP-Promotor von Vicia faba (DE 9903432) oder die Maispromotoren End1 und End2 (WO 0011177).
Weitere zur Expression in Pflanzen geeignete Promotoren sind beschrieben in Rogers et al. (1987) Meth in Enzymol 153:253-277; Schardl et al. (1987) Gene 61 :1-11 und Berger et al. (1989) Proc Natl Acad Sei USA 86:8402-8406).
Besonders bevorzugt im erfindungsgemäßen Verfahren sind konstitutive, samenspezifische, fruchtspezifische, blütenspezifische und insbesondere blütenblattspezifische Promotoren.
Die vorliegende Erfindung betrifft daher insbesondere ein Nukleinsäurekonstrukt, ent- haltend funktionell verknüpft einen blütenspezifischen oder insbesondere einen blüten- blattspezifischen Promotor und eine Nukleinsäure, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
Die Herstellung einer Expressionskassette erfolgt vorzugsweise durch Fusion eines geeigneten Promotors mit einer vorstehend beschriebenen Nukleinsäure, kodierend eine Ketolase, und vorzugsweise einer zwischen Promotor und Nukleinsäure-Sequenz inserierten Nukleinsäure, die für ein plastidenspezifisches Transitpeptid kodiert, sowie einem Polyadenylierungssignal nach gängigen Rekombinations- und Klonierungstech- niken, wie sie beispielsweise in T. Maniatis, E.F. Fritsch und J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) sowie in T.J. Silhavy, M.L. Berman und L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) und in Ausu- bel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987), beschrieben sind.
Die vorzugsweise insertierte Nukleinsäuren, kodierend ein plastidäres Transitpeptid, gewährleisten die Lokalisation in Piastiden und insbesondere in Chromoplasten.
Es können auch Expressionskassetten verwendet werden, deren Nukleinsauresequenz für ein Ketolase-Fusionsprotein kodiert, wobei ein Teil des Fusionsproteins ein Transitpeptid ist, das die Translokation des Polypeptides steuert. Bevorzugt sind für die Chromoplasten spezifische Transitpeptide, welche nach Translokation der Ketolase in die Chromoplasten vom Ketolase-Teil enzymatisch abgespalten werden.
Insbesondere bevorzugt ist das Transitpeptid, das von der plastidären Nicotiana taba- cum Transketolase oder einem anderen Transitpeptid (z.B. dem Transitpeptid der kleinen Untereinheit der Rubisco (rbcS) oder der Ferredoxin NADP Oxidoreduktase als auch der Isopentenylpyrophosphat lsomerase-2) oder dessen funktionellem Äquivalent abgeleitet ist.
Besonders bevorzugt sind Nukleinsäure-Sequenzen von drei Kassetten des Plastiden- Transitpeptids der plastidären Transketolase aus Tabak in drei Leserastern als Kpnl/BamHI Fragmente mit einem ATG-Codon in der Ncol Schnittstelle:
pTP09
Kpnl_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTC GTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CACTTTTTCCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGC- GATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGG- GATCC_BamHI
pTP10 KpnLGGTACCATGGCGTCTTCTTCTtCTCTCACTCTCTCTCAAGCTATCCTCTCTC GTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CACTTTTTCCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGC- GATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGCTG- GATCC_BamHI
pTP11
Kpn LGGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTC GTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CACI I I I I CCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- • TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGC- GATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGG- GATCC_BamHI
Weitere Beispiele für ein plastidäres Transitpeptid sind das Transitpeptid der plastidä-
X ren Isopentenyl-pyrophosphat lsomerase-2 (IPP-2) aus Arabisopsis thaliana und das Transitpeptid der kleinen Untereinheit der Ribulosebisphosphat Carboxylase (rbcS) aus Erbse (Guerineau, F, Woolston, S, Brooks, L, Mullineaux, P (1988) An expression cas- sette for targeting foreign proteins into the chloroplasts. Nucl. Acids Res. 16: 11380).
Die erfindungsgemäßen Nukleinsäuren können synthetisch hergestellt oder natürlich gewonnen sein oder eine Mischung aus synthetischen und natürlichen Nukleinsäure- Bestandteilen enthalten, sowie aus verschiedenen heterologen Genabschnitten verschiedener Organismen bestehen.
Bevorzugt sind, wie vorstehend beschrieben, synthetische Nukleotid-Sequenzen mit Kodons, die von Pflanzen bevorzugt werden. Diese von Pflanzen bevorzugten Kodons können aus Kodons mit der höchsten Proteinhäufigkeit bestimmt werden, die in den meisten interessanten Pflanzenspezies exprimiert werden.
Bei der Präparation einer Expressionskassette können verschiedene DNA-Fragmente manipuliert werden, um eine Nukleotid-Sequenz zu erhalten, die zweckmäßigerweise in der korrekten Richtung liest und die mit einem korrekten Leseraster ausgestattet ist. Für die Verbindung der DNA-Fragmente miteinander können an die Fragmente Adap- toren oder Linker angesetzt werden.
Zweckmäßigerweise können die Promotor- und die Terminator-Regionen in Transkrip- tionsrichtung mit einem Linker oder Polylinker, der eine oder mehrere Restriktionsstellen für die Insertion dieser Sequenz enthält, versehen werden. In der Regel hat der Linker 1 bis 10, meistens 1 bis 8, vorzugsweise 2 bis 6 Restriktionsstellen. Im allgemeinen hat der Linker innerhalb der regulatorischen Bereiche eine Größe von weniger als 100 bp, häufig weniger als 60 bp, mindestens jedoch 5 bp. Der Promotor kann so- wohl nativ bzw. homolog als auch fremdartig bzw. heterolog zur Wirtspflanze sein. Die Expressionskassette beinhaltet vorzugsweise in der 5'-3'-Transkriptionsrichtung den Promotor, eine kodierende Nukleinsauresequenz oder ein Nukleinsäurekonstrukt und eine Region für die transkriptionale Termination. Verschiedene Terminationsbereiche sind gegeneinander beliebig austauschbar.
Beispiele für einen Terminator sind der 35S-Terminator (Guerineau et al. (1988) Nucl Acids Res. 16: 11380), der nos Terminator (Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM. Nopaline synthase: transcript mapping and DNA sequen- ce. J Mol Appl Genet. 1982;1 (6):561-73) oder der ocs Terminator (Gielen, J, de Beu- ckeleer, M, Seurinck, J, Debroek, H, de Greve, H, Lemmers, M, van Montagu, M,
Schell, J (1984) The complete sequence of the TL-DNA of the Agrobacterium tumefa- ciens plasmid pTiAchδ. EMBO J. 3: 835-846).
Ferner können Manipulationen, die passende Restriktionsschnittstellen bereitstellen oder die überflüssige DNA oder Restriktionsschnittstellen entfernen, eingesetzt werden. Wo Insertionen, Deletionen oder Substitutionen wie z.B. Transitionen und Transversionen in Frage kommen, können in w'tro-Mutagenese, "primer-repair", Restriktion oder Ligation verwendet werden.
Bei geeigneten Manipulationen, wie z.B. Restriktion, "chewing-back" oder Auffüllen von Überhängen für "bluntends", können komplementäre Enden der Fragmente für die Ligation zur Verfügung gestellt werden.
Bevorzugte Polyadenylierungssignale sind pflanzliche Polyadenyiierungssignale, vor- zugsweise solche, die im wesentlichen T-DNA-Polyadenylierungssignale aus Agrobacterium tumefaciens, insbesondere des Gens 3 der T-DNA (Octopin Synthase) des Ti- Plasmids pTiACHδ entsprechen (Gielen et al., EMBO J. 3 (1984), 835 ff) oder funktio- nelle Äquivalente.
Die Übertragung von Fremdgenen in das Genom einer Pflanze wird als Transformation bezeichnet.
Dazu können an sich bekannte Methoden zur Transformation und Regeneration von Pflanzen aus Pflanzengeweben oder Pflanzenzellen zur transienten oder stabilen Transformation genutzt werden.
Geeignete Methoden zur Transformation von Pflanzen sind die Protoplastentransfor- mation durch Polyethylenglykol-induzierte DNA-Aufnahme, das biolistische Verfahren mit der Genkanone - die sogenannte "particle bombardment" Methode, die Elektropo- ration, die Inkubation trockener Embryonen in DNA-haltiger Lösung, die Mikroinjektion und der, vorstehend beschriebene, durch Agrobacterium vermittelte Gentransfer. Die genannten Verfahren sind beispielsweise in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, herausgegeben von S.D. Kung und R. Wu, Academic Press (1993), 128-143 sowie in Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225) beschrieben.
Vorzugsweise wird das zu exprimierende Konstrukt in einen Vektor kloniert, der geeignet ist, Agrobacterium tumefaciens zu transformieren, beispielsweise pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711) oder besonders bevorzugt pSUN2, pSUN3, pSUN4 oder pSUN5 (WO 02/00900).
Mit einem Expressionsplasmid transformierte Agrobakterien können in bekannter Weise zur Transformation von Pflanzen verwendet werden, z.B. indem verwundete Blätter oder Blattstücke in einer Agrobakterienlösung gebadet und anschließend in geeigneten Medien kultiviert werden.
Zur bevorzugten Herstellung von genetisch veränderten Pflanzen, im folgenden auch transgene Pflanzen bezeichnet, wird die fusionierte Expressionskassette, die eine Ketolase exprimiert, in einen Vektor, beispielsweise pBin19 oder insbesondere pSUN5 und pSUN3 kloniert, der geeignet ist, in Agrobacterium tumefaciens transformiert zu werden. Mit einem solchen Vektor transformierte Agrobakterien können dann in bekannter Weise zur Transformation von Pflanzen, insbesondere von Kulturpflanzen ver- wendet werden, indem beispielsweise verwundete Blätter oder Blattstücke in einer Agrobakterienlösung gebadet und anschließend in geeigneten Medien kultiviert werden.
Die Transformation von Pflanzen durch Agrobakterien ist unter anderem bekannt aus F.F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1 , Engineering and Utilization, herausgegeben von S.D. Kung und R. Wu, Academic Press, 1993, S. 15-38. Aus den transformierten Zellen der verwundeten Blätter bzw. Blattstücke können in bekannter Weise transgene Pflanzen regeneriert werden, die ein in die Expressionskassette integriertes Gen für die Expression einer Nukleinsäure, kodierend eine Ketolase, enthalten.
Zur Transformation einer Wirtspflanze mit einer für eine Ketolase kodierenden Nukleinsäure wird eine Expressionskassette als Insertion in einen rekombinanten Vektor ein- gebaut, dessen Vektor-DNA zusätzliche funktionelle Regulationssignale, beispielsweise Sequenzen für Replikation oder Integration enthält. Geeignete Vektoren sind unter anderem in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Kap. 6/7, S. 71-119 (1993) beschrieben.
Unter Verwendung der oben zitierten Rekombinations- und Klonierungstechniken können die Expressionskassetten in geeignete Vektoren kloniert werden, die ihre Vermehrung, beispielsweise in E. coli, ermöglichen. Geeignete Klonierungsvektoren sind u.a. PJIT117 (Guerineau et al. (1988) Nucl. Acids Res.16 :11380), pBR332, pUC-Serien, M13mp-Serien und pACYC184. Besonders geeignet sind binäre Vektoren, die sowohl in E. coli als auch in Agrobakterien replizieren können.
Im folgenden wird die Herstellung der erfindungsgemäßen gentisch veränderten Mikroorganismen näher beschrieben:
Die vorstehend beschriebenen Nukleinsäuren, kodierend eine Ketolase oder ß-
Hydroxylase oder ß-Cyclase sind vorzugsweise in Expressionskonstrukte eingebaut, enthaltend unter der genetischen Kontrolle regulativer Nukleinsäuresequenzen eine für ein erfindungsgemäßes Enzym kodierende Nukleinsauresequenz; sowie Vektoren, umfassend wenigstens eines dieser Expressionskonstrukte. Vorzugsweise umfassen solche erfindungsgemäßen Konstrukte 5'-stromaufwärts von der jeweiligen kodierenden Sequenz einen Promotor und 3'-stromabwärts eine Terminatorsequenz sowie gegebenenfalls weitere übliche regulative Elemente, und zwar jeweils operativ verknüpft mit der kodierenden Sequenz. Unter einer "operativen Ver- knüpfung" versteht man die sequentielle Anordnung von Promotor, kodierender Sequenz, Terminator und gegebenenfalls weiterer regulativer Elemente derart, dass jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann.
Beispiele für operativ verknüpfbare Sequenzen sind Targeting-Sequenzen sowie
Translationsverstärker, Enhancer, Polyadenylierungssignale und dergleichen. Weitere regulative Elemente umfassen selektierbare Marker, Amplifikationssignale, Replikati- onsursprünge und dergleichen.
Zusätzlich zu den artifiziellen Regulationssequenzen kann die natürliche Regulationssequenz vor dem eigentlichen Strukturgen noch vorhanden sein. Durch genetische Veränderung kann diese natürliche Regulation gegebenenfalls ausgeschaltet und die
X
Expression der Gene erhöht oder erniedrigt werden. Das Genkonstrukt kann aber auch einfacher aufgebaut sein, das heißt es werden keine zusätzlichen Regulationssignale vor das Strukturgen insertiert und der natürliche Promotor mit seiner Regulation wird nicht entfernt. Statt dessen wird die natürliche Regulationssequenz so mutiert, dass keine Regulation mehr erfolgt und die Genexpression gesteigert oder verringert wird. Die Nukleinsäuresequenzen können in einer oder mehreren Kopien im Genkonstrukt enthalten sein.
Beispiele für brauchbare Promotoren in Mikroorganismen sind: cos-, tac-, trp-, tet-, trp- tet-, Ipp-, lac-, Ipp-lac-, laclq-, T7-, T5-, T3-, gal-, trc-, ara-, SP6-, lambda-PR- oder im lambda-PL-Promotor, die vorteilhafterweise in gram-negativen Bakterien Anwendung finden; sowie die gram-positiven Promotoren amy und SPO2 oder die Hefepromotoren ADC1 , MFa , AC, P-60, CYC1 , GAPDH. Besonders bevorzugt ist die Verwendung induzierbarer Promotoren, wie z.B. licht- und insbesondere temperaturinduzierbarer Promotoren, wie der PrPrPromotor. Prinzipiell können alle natürlichen Prorriotoren mit ihren Regulationssequenzen verwendet werden. Darüber hinaus können auch synthetische Promotoren vorteilhaft verwendet werden.
Die genannten regulatorischen Sequenzen sollen die gezielte Expression der Nukleinsäuresequenzen und die Proteinexpression ermöglichen. Dies kann beispielsweise je nach Wirtsorganismus bedeuten, dass das Gen erst nach Induktion exprimiert oder überexprimiert wird, oder dass es sofort exprimiert und/oder überexprimiert wird.
Die regulatorischen Sequenzen bzw. Faktoren können dabei vorzugsweise die Expression positiv beeinflussen und dadurch erhöhen oder erniedrigen. So kann eine Verstärkung der regulatorischen Elemente vorteilhafterweise auf der Transkriptionsebene erfolgen, indem starke Transkriptionssignale wie Promotoren und/oder "Enhancer" verwendet werden. Daneben ist aber auch eine Verstärkung der Translation möglich, in- dem beispielsweise die Stabilität der mRNA verbessert wird.
Die Herstellung einer Expressionskassette erfolgt durch Fusion eines geeigneten Promotors mit den vorstehend beschriebenen Nukleinsäuresequenzen, kodierend eine Ketolase, ß-Hydroxylase oder ß-Cyclase sowie einem Terminator- oder Polyadenylie- rungssignal. Dazu verwendet man gängige Rekombinations- und Klonierungstechniken, wie sie beispielsweise in T. Maniatis, E.F. Fritsch und J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) sowie in T.J. Silhavy, M.L. Berman und L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) und in Ausu- bei, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987) beschrieben sind.
Das rekombinante Nukleinsäurekonstrukt bzw. Genkonstrukt wird zur Expression in einem geeigneten Wirtsorganismus vorteilhafterweise in einen wirtsspezifischen Vektor insertiert, der eine optimale Expression der Gene im Wirt ermöglicht. Vektoren sind dem Fachmann wohl bekannt und können beispielsweise aus "Cloning Vectors" (Pou- wels P. H. et al., Hrsg, Elsevier, Amsterdam-New York-Oxford, 1985) entnommen werden. Unter Vektoren sind außer Plasmiden auch alle anderen dem Fachmann bekannte Vektoren, wie beispielsweise Phagen, Viren, wie SV40, CMV, Baculovirus und Ade- novirus, Transposons, IS-Elemente, Phasmide, Cosmide, und lineare oder zirkuläre DNA zu verstehen. Diese Vektoren körinen autonom im Wirtsorganismus repliziert oder chromosomal repliziert werden.
Als Beispiele für geeignete Expressionsvektoren können genannt werden:
Übliche Fusionsexpressionsvektoren, wie pGEX (Pharmacia Biotech ine; Smith, D.B. und Johnson, K.S. (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) und pRIT 5 (Pharmacia, Piscataway, NJ), bei denen Glutathion-S-Transferase (GST), Maltose E-bindendes Protein bzw. Protein A an das rekombinante Zielprotein fusioniert wird.
Nicht-Fusionsprotein-Expressionsvektoren wie pTrc (Amann et al., (1988) Gene 69:301-315) und pET 11d (Studier et al. Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Kalifornien (19gθ) 60-89) oder pBluesc- ript und pUC- Vektoren.
Hefe-Expressionsvektor zur Expression in der Hefe S. cerevisiae , wie pYepSed (Bal- dari et al., (1987) Embo J. 6:229-234), pMFa (Kurjan und Herskowitz (1982) Cell 30:933-943), pJRY88 (Schultz et al. (1987) Gene 54:113-123) sowie pYES2 (Invitrogen Corporation, San Diego, CA).
Vektoren und Verfahren zur Konstruktion von Vektoren, die sich zur Verwendung in anderen Pilzen, wie filamentösen Pilzen, eignen, umfassen diejenigen, die eingehend beschrieben sind in: van den Hondel, C.A.M.J.J. & Punt, P.J. (1991) "Gene transfer Systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, J.F. Peberdy et al., Hrsg., S. 1-28, Cambridge University Press: Cambridge.
Baculovirus-Vektoren, die zur Expression von Proteinen in gezüchteten Insektenzellen (bspw. Sf9-Zellen) verfügbar sind, umfassen die pAc-Reihe (Smith et al., (1983) Mol. Cell Biol.. 3:2156-2165) und die pVL-Reihe (Lucklow und Summers (1989) Virology 170:31-39).
Weitere geeignete Expressionssysteme für prokaryontische und eukaryotische Zellen sind in Kapitel 16 und 17 von Sambrook, J., Fritsch, E.F. und Maniatis, T., Molecular cloning: A Laboratory Manual, 2. Auflage, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989 beschrieben. Mit Hilfe der erfindungsgemäßen Expressionskonstrukte bzw. Vektoren sind genetisch veränderte Mikroorganismen herstellbar, welche beispielsweise mit wenigstens einem erfindungsgemäßen Vektor transformiert sind.
Vorteilhafterweise werden die oben beschriebenen erfindungsgemäßen rekombinanten Konstrukte in ein geeignetes Wirtssystem eingebracht und exprimiert. Dabei werden vorzugsweise dem Fachmann bekannte geläufige Klonierungs- und Transfektions- methoden, wie beispielsweise Co-Präzipitation, Protoplastenfusion, Elektroporation, retrovirale Transfektion und dergleichen, verwendet, um die genannten Nukleinsäuren im jeweiligen Expressionssystem zur Expression zu bringen. Geeignete Systeme werden beispielsweise in Current Protocols in Molecular Biology, F. Ausubel et al., Hrsg., Wiley Interscience, New York 1997, beschrieben.
Die Selektion erfolgreich transformierter Organismen kann durch Markergene erfolgen, die ebenfalls im Vektor oder in der Expressionskassette enthalten sind. Beispiele für solche Markergene sind Gene für Antibiotikaresistenz und für Enzyme, die eine farb- gebende Reaktion katalysieren, die ein Anfärben der transformierten Zelle bewirkt. Diese können dann mittels automatischer Zellsortierung selektiert werden.
Erfolgreich mit einem Vektor transformierte Mikroorganismen, die ein entsprechendes Antibiotikaresistenzgen (z.B. G418 oder Hygromycin) tragen, lassen sich durch entsprechende Antibiotika-enthaltende Medien oder Nährböden selektieren. Markerproteine, die an der Zelloberfläche präsentiert werden, können zur Selektion mittels Affinitätschromatographie genutzt werden.
Die Kombination aus den Wirtsorganismen und den zu den Organismen passenden Vektoren, wie Plasmide, Viren oder Phagen, wie beispielsweise Plasmide mit dem RNA-Polymerase/Promoter-System, die Phagen 8 oder andere temperente Phagen oder Transposons und/oder weiteren vorteilhaften regulatorischen Sequenzen bildet ein Expressionssystem.
Die Erfindung betrifft ferner ein Verfahren zur Herstellung von genetisch veränderten Organismen, dadurch gekennzeichnet, das man ein Nukleinsäurekonstrukt, enthaltend funktionell verknüpft einen Promotor und Nukleinsäuren, kodierend eine Ketolase, ent- haltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Amiήosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, und gegebenenfalls einen Terminator in das Genom des Ausgangsorganismus oder extrachromosomal in den Ausgangsorganismus einführt.
Die Erfindung betrifft ferner die genetisch veränderten Organismen, wobei die genetische Veränderung die Aktivität einer Ketolase
A für den Fall, dass der Wildtyporganismus bereits eine Ketolase-Aktivität aufweist, gegenüber dem Wildtyp erhöht und
B für den Fall, dass der Wildtyporganismus keine Ketolase-Aktivitätaufweist, gegenüber dem Wildtyp verursacht
und die nach A erhöhte oder nach B verursachte Ketolase-Aktivität durch eine Ketolase verursacht wird, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
Wie vorstehend ausgeführt erfolgt die Erhöhung oder Verursachung der Ketolase- Aktivität gegenüber dem Wildtyp vorzugsweise durch eine Erhöhung oder Verursachung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
In einer weiter bevorzugten Ausführungsform erfolgt, wie vorstehend ausgeführt, die Erhöhung oder Verursachung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, durch Einbringen von Nukleinsäuren, kodierend eine Ketolase, in die Pflan- zen und damit vorzugsweise durch Überexpression oder transgene Expression von Nukleinsäuren, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist. Die Erfindung betrifft ferner einen genetisch veränderten Organismus, enthaltend mindestens eine transgene Nukleinsäure, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von min- destens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist. Dies ist der Fall, wenn der Ausgangsorganismus keine Ketolase oder eine endogen Ketolase aufweist und eine transgene Ketolase überexprimiert wird.
Die Erfindung betrifft ferner einen genetisch veränderten Organismus, enthaltend min- destens zwei endogene Nukleinsäuren, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist. Dies ist der Fall, wenn der Ausgangsorganismus eine endogen Ketolase aufweist und die endogene Ketolase überexprimiert wird.
Besonders bevorzugte, genetisch veränderte Organismen weisen, wie vorstehend er- x wähnt, zusätzlich eine erhöhte Hydroxlase-Aktivität und/oder ß-Cyclase-Aktivität gegenüber einem Wildtyporganismus auf. Weiter bevorzugte Ausführungsformen sind vorstehend im erfindungsgemäßen Verfahren beschrieben.
Unter Organismen werden erfindungsgemäß vorzugsweise Organismen verstanden, die als Wildtyp- oder Ausgangsorganismen natürlicherweise oder durch genetische Komplementierung und/oder Umregulierung der Stoffwechselwege in der Lage sind, Carotinoide, insbesondere ß-Carotin und/oder Zeaxanthin und/oder Neoxanthin und/oder Violaxanthin und/oder Lutein herzustellen.
Weiter bevorzugte Organismen weisen als Wildtyp- oder Ausgangsorganismen bereits eine Hydroxylase-Aktivität auf und sind somit als Wildtyp- oder Ausgangsorganismen in der Lage, Zeaxanthin herzustellen.
Bevorzugte Organismen sind Pflanzen oder Mikroorganismen, wie beispielsweise Bakterien, Hefen, Algen oder Pilze.
Als Bakterien können sowohl Bakterien verwendet werden, die aufgrund des Einbringens von Genen der Carotinoidbiosynthese eines Carotinoid-produzierenden Organis- mus in der Lage sind, Xanthophylle zu synthetisieren, wie beispielsweise Bakterien der Gattung Escherichia, die beispielsweise crt-Gene aus Erwinia enthalten, als auch Bakterien, die von sich aus in der Lage sind, Xanthophylle zu synthetisieren wie beispielsweise Bakterien der Gattung Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Paracoccus, Nostoc oder Cyanobakterien der Gattung Synechocystis.
Bevorzugte Bakterien sind Escherichia coli, .Erwinia herbicola, Erwinia uredovora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1 , Flavobacterium sp. strain R1534, das Cyanobacterium Synechocystis sp. PCC6803, Paracoccus marcusii oder Paracoc- cus carotinifaciens.
Bevorzugte Hefen sind Candida, Saccharomyces, Hansenula, Pichia oder Phaffia. Besonders bevorzugte Hefen sind Xanthophyllomyces dendrorhous oder Phaffia rhodozyma.
Bevorzugte Pilze sind Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phy- comyces, Fusarium oder weitere in Indian Chem. Engr. Section B. Vol. 37, No. 1, 2
X
(1995) auf Seite 15, Tabelle 6 beschriebene Pilze.
Bevorzugte Algen sind Grünalgen, wie beispielsweise Algen der Gattung Haematococcus, Phaedactylum tricornatum, Volvox oder Dunaliella. Besonders bevorzugte Algen sind Haematococcus puvialis oder Dunaliella bardawil.
Weitere brauchbare Mikroorganismen und deren Herstellung zur Durchführung des erfindungsgemäßen Verfahrens sind beispielsweise aus der DE-A-199 16 140 bekannt, worauf hiermit Bezug genommen wird.
Besonders bevorzugte Pflanzen sind Pflanzen ausgewählt aus den Familien Ranuncu- laceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Lina- ceae, Vitaceae, Brassicaceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Ama- ranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, •Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Or- chidaceae, Malvaceae, liliaceae oder Lamiaceae.
Ganz besonders bevorzugte Pflanzen sind ausgewählt aus der Gruppe der Pflanzengattungen Mangold, Tagetes errecta, Tagetes patula, Acacia, Aconitum, Adonis, Ami- ca, Aquilegia, Aster, Astragalus, Bignonia, Calenduia, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Gre- villea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Laburnum, Lathyrus, Leontodon, Lili- um, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussi- lago, Ulex, Viola oder Zinnia, besonders bevorzugt ausgewählt aus der Gruppe der Pflanzengattungen Marigold, Tagetes erecta, Tagetes patula, Lycopersicon, Rosa, " Calenduia, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium, Tropaeolum oder Adonis.
Ganz besonders bevorzugte genetisch veränderte Pflanzen sind ausgewählt aus den Pflanzengattungen Marigold, Tagetes erecta, Tagetes patula, Adonis, Lycopersicon; Rosa, Calenduia, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium oder Tropaeolum, wobei die genetisch veränderte Pflanze mindestens eine transgene Nukleinsäure, kodierend eine Ketolase, enthält.
Die transgenen Pflanzen, deren Vermehrungsgut, sowie deren Pflanzenzellen, - gewebe oder -teile, insbesondere deren Früchte, Samen, Blüten und Blütenblätter sind ein weiterer Gegenstand der vorliegenden Erfindung.
Die genetisch veränderten Pflanzen können, wie vorstehend beschrieben, zur Herstellung von Ketocarotinoiden, insbesondere Astaxanthin verwendet werden.
Von Menschen und Tieren verzehrbare erfindungsgemäße, genetisch veränderte Or- ganismen, insbesondere Pflanzen oder Pflanzenteile, wie insbesondere Blütenblätter mit erhöhtem Gehalt an Ketocarotinoiden, insbesondere Astaxanthin können auch beispielsweise direkt oder nach an sich bekannter Prozessierung als Nahrungsmittel oder Futtermittel oder als Futter- und Nahrungsergänzungsmittel verwendet werden. Ferner können die genetisch veränderten Organismen zur Herstellung von Ketocaroti- noid-haltigen Extrakten der Organismen und/oder zur Herstellung von Futter- und Nah- rungsergänzungsmitteln verwendet werden.
Die genetisch veränderten Organismen weisen im Vergleich zum Wildtyp einen erhöhten Gehalt an Ketocarotinoiden auf.
Unter einem erhöhten Gehalt an Ketocarotinoiden wird in der Regel ein erhöhter Gehalt an Gesamt-Ketocarotinoid verstanden.
Unter einem erhöhten Gehalt an Ketocarotinoiden wird aber auch insbesondere ein veränderter Gehalt der bevorzugten Ketocarotinoide verstanden, ohne dass zwangsläufig der Gesamt-Carotinoidgehalt erhöht sein muss.
In einer besonders bevorzugten Ausführungsform weisen die erfindungsgemäßen, genetisch veränderten Pflanzen im Vergleich zum Wildtyp einen erhöhten Gehalt an Astaxanthin auf.
X
Unter einem erhöhten Gehalt wird in diesem Fall auch ein verursachter Gehalt an Ke- tocarotinoiden, bzw. Astaxanthin verstanden.
Die Erfindung betrifft ferner die neuen Ketolasen sowie die neuen Nukleinsäuren, die diese kodieren.
Insbesondere betrifft die Erfindung Ketolasen, enthaltend die Aminosäuresequenz SEQ. ID. NO. 8 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 %, vorzugsweise mindestens 75%, besonders bevorzugt mindestens 80%, bevorzugter mindestens 85%, bevorzugter mindestens 90%, bevorzugter mindestens 95% auf Ami- nosäureebene mit der Sequenz SEQ. ID. NO. 8 aufweist, mit der Maßgabe, dass die Aminosäuresequenzen SEQ ID NO: 4 nicht enthalten ist. Die Sequenz SEQ ID NO: 4 ist, wie vorstehend erwähnt, als putatives Protein in Datenbanken annotiert.
Ferner betrifft die Erfindung Ketolasen, enthaltend die Aminosäuresequenz SEQ. ID. NO. 6 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 % auf Amino- säureebene mit der Sequenz SEQ. ID. NO. 6 aufweist. Die Sequenz SEQ ID NO: 6 ist, wie vorstehend erwähnt, in Datenbanken nicht annotiert.
In einer weiteren Ausführungsform betrifft die Erfindung Ketolasen, enthaltend die Ami- nosäuresequenz SEQ. ID. NO. 12 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 %, vorzugsweise mindestens 75%, besonders bevorzugt mindestens 80%, bevorzugter mindestens 85%, bevorzugter mindestens 90%, bevorzugter mindestens 95% auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 12 aufweist, mit der Maßgabe, dass die Aminosäuresequenzen SEQ ID NO: 6 nicht enthalten ist.
Ferner betrifft die Erfindung Ketolasen, enthaltend die Aminosäuresequenz SEQ. ID. NO. 49 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 50 %, vorzugs- weise mindestens 60%, besonders bevorzugt mindestens 70%, bevorzugter mindestens 80%, bevorzugter mindestens 90%, bevorzugter mindestens 95% auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 49 aufweist, mit der Maßgabe, dass die Aminosäuresequenzen SEQ ID NO: 47 nicht enthalten ist. Die Sequenz SEQ ID NO: 47 ist, wie vorstehend erwähnt, als putatives Protein in Datenbanken annotiert.
Die Erfindung betrifft ferner Nukleinsäuren, kodierend ein vorstehend beschriebenes Protein, mit der Maßgabe, dass die Nukleinsäure nicht die Sequenz SEQ ID NO: 5 enthält.
Überraschenderweise wurde gefunden, dass ein Protein enthaltend die Aminosäuresequenz SEQ. ID. NO. 4 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 %, vorzugsweise mindestens 75%, besonders bevorzugt mindestens 80%, bevorzugter mindestens 85%, bevorzugter mindestens 90%, bevorzugter mindestens 95% auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 4 und die Eigenschaft einer Ketolase aufweist, eine Eigenschaft als Ketolase aufweist.
Die Erfindung betrifft daher auch die Verwendung eines Proteins, enthaltend die Aminosäuresequenz SEQ. ID. NO. 4 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 %, vorzugsweise mindestens 75%, besonders bevorzugt mindestens 80%, bevorzugter mindestens 85%, bevorzugter mindestens 90%, bevorzugter mindestens 95% auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 4 und die Eigenschaft einer Ketolase aufweist, als Ketolase.
Ferner wurde überraschenderweise gefunden, dass ein Protein enthaltend die Aminosäuresequenz SEQ. ID. NO. 6 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 65%, vorzugsweise mindestens 70 %, vorzugsweise mindestens 75%, besonders bevorzugt mindestens 80%, bevorzugter mindestens 85%, bevorzugter mindes- tens 90%, bevorzugter mindestens 95% auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 6 und die Eigenschaft einer Ketolase aufweist, eine Egenschaft als Ketolase aufweist.
Die Erfindung betrifft daher auch die Verwendung eines Proteins, enthaltend die Ami- nosäuresequenz SEQ. ID. NO. 6 oder eine von dieser Sequenz durch Substitution,
Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 65%, vorzugsweise mindestens 70 %, vorzugsweise mindestens 75%, x besonders bevorzugt mindestens 80%, bevorzugter mindestens 85%, bevorzugter mindestens 90%, bevorzugter mindestens 95%auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 6 und die Eigenschaft einer Ketolase aufweist, als Ketolase.
Ferner wurde überraschenderweise gefunden, dass ein Protein enthaltend die Aminosäuresequenz SEQ. ID. NO. 47 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 50%, vorzugsweise mindestens 60 %, vorzugsweise mindestens 70%, besonders bevorzugt mindestens 80%, bevorzugter mindestens 85%, bevorzugter mindestens 90%, bevorzugter mindestens 95% auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 47 und die Eigenschaft einer Ketolase aufweist, eine Egenschaft als Ketolase aufweist.
Die Erfindung betrifft daher auch die Verwendung eines Proteins, enthaltend die Aminosäuresequenz SEQ. ID. NO. 47 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 50%, vorzugsweise mindestens 60 %, vorzugsweise mindestens 70%, besonders bevorzugt mindestens 80%, bevorzugter mindestens 85%, bevorzugter mindestens 90%, bevorzugter mindestens 95%auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 47 und die Eigenschaft einer Ketolase aufweist, als Ketolase.
Im Vergleich zu den Verfahren des Standes der Technik, liefert das erfindungsgemäße Verfahren eine höhere Menge an Ketocarotinoide, insbesondere Astaxanthin mit einer geringeren Menge an hydroxylierten Nebenprodukten.
Die Erfindung wird durch die nun folgenden Beispiele erläutert, ist aber nicht auf diese beschränkt:
Allgemeine Experimentelle Bedingungen: Sequenzanalyse rekombinanter DNA
Die Sequenzierung rekombinanter DNA-Moleküle erfolgte mit einem Laserfluoreszenz- DNA-Sequenzierer der Firma Licor (Vertrieb durch MWG Biotech, Ebersbach) nach der
Methode von Sanger (Sanger et al., Proc. Natl. Acad. Sei. USA 74 (1977), 5463-5467).
Beispiel 1 :
Amplifikation einer DNA, die die gesamte Primärsequenz der NOST-Ketolase aus Nostoc sp. PCC 7120 codiert
Die DNA, die für die NOST-Ketolase aus Nostoc sp. PCC 7120 kodiert, wurde mittels PCR aus Nostoc sp. PCC 7120 (Stamm der "Pasteur Culture Collection of Cyanobac- terium") amplifiziert.
Für die Präparation von genomischer DNA aus einer Suspensionskultur von Nostoc sp. PCC 7120, die 1 Woche mit Dauerlicht und konstantem Schütteln (150 rpm) at 25°C in BG 77-Medium (1.5 g/l NaN03, 0.04 g/l K2P04x3H2O, 0.075 g/l MgSO4xH2O, 0.036 g/l CaCI2x2H2O, 0.006 g/l citric aeid, 0.006 g/l Ferric ammonium citrate, 0.001 g/l ED- TA disodium magnesium, 0.04 g/l Na2CO3, 1 ml trace metal mix A5+Co (2.86 g/l
H3BO3, 1.81 g/l MnCI2x4H2o, 0.222 g/i ZnSO4x7H2o,0.39 g/l NaMoO4X2H2o, 0.079 g/l CuSO4x5H2O, 0.0494 g/l Co(NO3)2x6H2O) gewachsen war, wurden die Zellen durch Zentrifugation geerntet, in flüssigem Stickstoff eingefroren und im Mörser pulverisiert. Protokoll für DNA Isolation aus Nostoc PCC7120:
Aus einer 10 ml Flüssigkultur wurden die Bakterienzellen durch 10minütige Zentrifuga- tion bei 8 000 rpm pelletiert. Anschließend wurden die Bakterienzellen in flüssigem Stickstoff mit einem Mörser zerstoßen und gemahlen. Das Zellmaterial wurde in 1 ml 10mM Tris HCI (pH 7.5) resuspendiert und in ein Eppendorf Reaktionsgefäß (2ml Volumen) überführt. Nach Zugabe von 100 μl Proteinase K (Konzentration: 20 mg/ml) wurde die Zellsuspension für 3 Stunden bei 37°C inkubiert. Anschließend wurde die Suspension mit 500 μl Phenol extrahiert. Nach δminütiger Zentrifugation bei 13 000 upm wurde die obere, wässrige Phase in ein neues 2 ml-Eppendorf Reaktionsgefäß überführt. Die Extraktion mit Phenol wurde 3mal wiederholt. Die DNA wurde durch Zugabe von 1/10 Volumen 3 M Natriumacetat (pH 5.2) und 0.6 Volumen Isopropanol gefällt und anschließend mit 70% Ethanol gewaschen. Das DNA-Pellet wurde bei Raumtemperatur getrocknet, in 25 μl Wasser aufgenommen und unter Erhitzung auf 65°C gelöst.
Die Nukleinsäure, kodierend eine Ketolase aus Nostoc PCC 7120, wurde mittels "po- lymerase chain reaction" (PCR) aus Nostoc sp. PCC 7120 unter Verwendung eines sense-spezifischen Primers (NOSTF, SEQ ID No. 19) und eines antisense- spezifischen Primers (NOSTG SEQ ID No. 20) amplifiziert.
Die PCR-Bedingungen waren die folgenden:
Die PCR zur Amplifikation der DNA, die für ein Ketolase Protein bestehend aus der gesamten Primärsequenz kodiert, erfolgte in einem 50 ul Reaktionsansatz, in dem enthalten war:
1 ul einer Nostoc sp. PCC 7120 DNA (hergestellt wie oben beschrieben) 0.25 mM dNTPs - 0.2 mM NOSTF (SEQ ID No. 19) 0.2 mM NOSTG (SEQ ID No. 20) 5 ul 10X PCR-Puffer (TAKARA) 0.25 ul R Taq Polymerase (TAKARA) 25.8 ul Aq. Dest.
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt: 1X 94°C 2 Minuten 35X 94°C 1 Minute 55°C 1 Minuten 72°C 3 Minuten
1X 72°C 10 Minuten
Die PCR-Amplifikation mit SEQ ID No. 19 und SEQ ID No. 20 resultierte in einem 805 Bp-Fragment, das für ein Protein bestehend aus der gesamten Primärsequenz kodiert (SEQ ID No. 21). Unter Verwendung von Standardmethoden wurde das Amplifikat in den PCR-Klonierungsvektor pGEM-T (Promega) kloniert und der Klon pNOSTF-G erhalten.
Sequenzierung des Klons pNOSTF-G mit dem M13F- und dem M13R-Primer bestätig- te eine Sequenz, weiche mit der DNA-Sequenz von 88,886-89,662 des Datenbankeintrages AP003592 identisch ist. Diese Nukleotidsequenz wurde in einem unabhängigem Amplifikationsexperiment reproduziert und repräsentiert somit die Nukleotidsequenz im verwendeten Nostoc sp. PCC 7120.
Dieser Klon pNOSTF-G wurde daher für die Klonierung in den Expressionsvektor pJIT117 (Guerineau et al. i g88, Nucl. Acids Res. 16: 11380) verwendet. Die Klonierung erfolgte durch Isolierung des 799 Bp Sphl-Fragmentes aus pNOSTF-G und Ligie- rung in den Sphl geschnittenen Vektor pJIT117. Der Klon, der die Ketolase von Nostoc sp. PCC 7120 in der korrekten Orientierung als N-terminale translationale Fusion mit dem rbcS Transitpeptid enthält, heisst pJNOST.
Beispiel 2:
Konstruktion des Plasmides pMCL-CrtYlBZ/idi/gps für die Synthese von Zeaxanthin in
E. coli
Die Konstruktion von pMCL-CrtYlBZ/idi/gps erfolgte in drei Schritten über die Zwischenstufen pMCL-CrtYlBZ und pMCL-CrtYlBZ/idi. Als Vektor wurde das mit high- copy-number Vektoren kompatible Plasmid pMCL200 verwendet (Nakano, Y., Yoshida, Y., Yamashita, Y. und Koga, T.; Construction of a series of pACYC-derived plasmid vectors; Gene 162 (1995), 157-158). Beispiel 2.1. : Konstruktion von pMCL-CrtYlBZ
Die Biosynthesegene crtY, crtB, crtl und crtZ entstammen dem Bakterium Erwinia ure- dovora und wurden mittels PCR amplifiziert. Genomische DNA von Erwinia uredovora (DSM 30080) wurde von der Deutschen Sammlung von Mikroorganismen und Zellkutu- ren (DSMZ, Braunschweig) innerhalb eines Service-Dienstes präpariert. Die PCR- Reaktion wurde entsprechend den Angaben des Herstellers durchgeführt (Röche, Long Template PCR: Procedure for amplification of 5-20 kb targets with the expand long template PCR System). Die PCR-Bedingungen für die Amplifikation des Biosynthesec- lusters von Erwinia uredovora waren die folgenden:
Master Mix 1 :
1.75 ul dNTPs (Endkonzentration 350 μM) 0.3 μM Primer Crt1 (SEQ ID No. 22) - 0.3 μM Primer Crt2 (SEQ ID No. 23)
250 - 500 ng genomische DNA von DSM 30080 Aq. Dest. bis zu einem Gesamtvolumen von 50 μl x
Master Mix 2:
5 ul 10x PCR Puffer 1 (Endkonzentration 1x, mit 1.75 mM Mg2+) 10x PCR Puffer 2 (Endkonzentration 1 x, mit 2.25 mM Mg2+) 10x PCR Puffer 3 (Endkonzentration 1 x, mit 2.25 mM Mg2+) 0.75 ul Expand Long Template Enzyme Mix (Endkonzentration 2.6 Units) Aq. Dest. bis zu einem Gesamtvolumen von 50 μl
Die beiden Ansätze "Master Mix 1" und "Master Mix 2" wurden zusammenpipetiert. Die PCR wurde in einem Gesamtvolumen von 50 ul unter folgenden Zyklusbedingungen durchgeführt:
1X 94°C 2 Minuten 30X 94°C 30 Sekunden 58°C 1 Minute 68°C 4 Minuten 1 X 72°C 10 Minuten Die PCR-Amplifikation mit SEQ ID No. 22 und SEQ ID No. 23 resultierte in einem Fragment (SEQ ID NO: 24), das für die Gene CrtY (Protein: SEQ ID NO: 25), CrtI (Protein: SEQ ID NO: 26), crtB (Protein: SEQ ID NO: 27) und CrtZ(iDNA) kodiert. Unter Verwendung von Standardmethoden wurde das Amplifikat in den PCR- Klonierungsvektor pCR2.1 (Invitrogen) kloniert und der Klon pCR2.1-CrtYIBZ erhalten.
Das Plasmid pCR2.1-CrtYIBZ wurde Sall und Hindill geschnitten, das resultierende Sall/Hindlll-Fragment isoliert und durch Ligierung in den Sall/Hindlll geschnittenen Vektor pMCL200 transferiert. Das in pMCL 200 klonierte Sall/Hindlll Fragment aus pCR2.1-CrtYIBZ ist 4624 Bp lang, kodiert für die Gene CrtY, CrtI, crtB und CrtZ und entspricht der Sequenz von Position 2295 bis 6918 in D90087 (SEQ ID No. 24). Der resultierende Klon heisst pMCL-CrtYlBZ.
Beispiel 2.2.: Konstruktion von pMCL-CrtYlBZ/idi Das Gen /d/' (lsopentenyldiphosphat-lsomerase; IPP-lsomerase) wurde aus E coli mittels PCR amplifiziert. Die Nukleinsäure, kodierend das gesamte /cf Gen mit idi- Promotor und Ribosomenbindestelle, wurde aus E. coli mittels "polymerase chain reac- tion" (PCR) unter Verwendung eines sense-spezifischen Primers (5'-idi SEQ ID No. 28) und eines antisense-spezifischen Primers (3'-idi SEQ ID No.29) amplifiziert.
Die PCR-Bedingungen waren die folgenden:
Die PCR zur Amplifikation der DNA erfolgte in einem 50 μl Reaktionsansatz, in dem enthalten war:
1 ul einer E. coli TOP10- Suspension 0.25 mM dNTPs 0.2 mM 5'-idi (SEQ ID No. 28) 0.2 mM 3'-idi (SEQ ID No. 29) - 5 ul 10X PCR-Puffer (TAKARA)
0.25 ul R Taq Polymerase (TAKARA) 28.8 ul Aq. Dest
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt: 1X 94°C 2 Minuten 20X 94°C 1 Minute
62 °C1 Minute
72°C 1 Minute 1 X 72°C 10 Minuten
Die PCR-Amplifikation mit SEQ ID No. 28 und SEQ ID No. 29 resultierte in einem 679 Bp-Fragment, das für ein Protein bestehend aus der gesamten Primärsequenz kodiert (SEQ ID No. 30). Unter Verwendung von Standardmethoden wurde das Amplifikat in den PCR-Klonierungsvektor pCR2.1 (Invitrogen) kloniert und der Klon pCR2.1-idi erhalten.
Sequenzierung des Klons pCR2.1-idi bestätigte eine Sequenz, die sich nicht von der publizierten Sequenz AE000372 in Position 8774 bis Position 9440 unterscheidet. Die- se Region umfaßt die Promotor-Region, die potentielle Ribosomenbindestelle und den gesamten "open reading frame" für die IPP-lsomerase. Das in pCR2.1-idi klonierte Fragment hat durch das Einfügen einer Xhol-Schnittstelle am 5'-Ende und eine Sall- Schnittstelle am 3'-Ende des -Gens eine Gesamtlänge von 679 Bp.
Dieser Klon wurde daher für die Klonierung des /oY-Gens in den Vektor pMCL-CrtYlBZ verwendet. Die Klonierung erfolgte durch Isolierung des Xhol/Sall-Fragmentes aus pCR2.1-idi und Ligierung in den Xhol/Sall geschnittenen Vektor pMCL-CrtYlBZ. Der resultierende Klon heisst pMCL-CrtYlBZ/idi.
Beispiel 2.3.: Konstruktion von pMCL-CrtYlBZ/idi/gps
Das Gen gps (Geranylgeranylpyrophosphat-Synthase; ; GGPP-Synthase) wurde aus Archaeoglobus fulgidus mittels PCR amplifiziert. Die Nukleinsäure, kodierend gps aus Archaeoglobus fulgidus, wurde mittels "polymerase chain reaction" (PCR) unter Verwendung eines sense-spezifischen Primers (5'-gps SEQ ID No. 32) und eines anti- sense-spezifischen Primers (3'-gps SEQ ID No. 33) amplifiziert.
Die DNA von Archaeoglobus fulgidus wurde von der Deutschen Sammlung von Mikroorganismen und Zellkulturen (DSMZ, Braunschweig) innerhalb eines Service-Dienstes präpariert. Die PCR-Bedingungen waren die folgenden: Die PCR zur Amplifikation der DNA, die für ein GGPP-Synthase Protein bestehend aus der gesamten Primärsequenz kodiert, erfolgte in einem 50 μl Reaktionsansatz, in dem enthalten war:
- 1 ul einer Archaeoglobus fulgidus-DNA 0.25 mM dNTPs 0.2 mM 5'-gps (SEQ ID No. 32) 0.2 mM 3'-gps (SEQ ID No. 33) 5 ul 10X PCR-Puffer (TAKARA) - 0.25 ul R Taq Polymerase (TAKARA) 28.8 ul Aq. Dest.
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt:
1X 94°C 2 Minuten 20X 94°C 1 Minute
56°C 1 Minute
72°C 1 Minute 1 X 72°C 10 Minuten
Das mittels PCR und den Primern SEQ ID No. 32 und SEQ ID No. 33 amplifizierte DNA-Fragment wurde mit an sich bekannten Methoden aus dem Agarosegel eluiert und mit den Restriktionsenzymen Ncol und Hindill geschnitten. Daraus resultiert ein 962 Bp-Fragment, das für ein Protein bestehend aus der gesamten Primärsequenz kodiert (SEQ ID No. 34). Unter Verwendung von Standardmethoden wurde das Ncol/Hindlll geschnittene Amplifikat in den Vektor pCB97-30 kloniert und der Klon pCB-gps erhalten.
Sequenzierung des Klons pCB-gps bestätigte eine Sequenz für die GGPP-Synthase aus A. fulgidus, die sich von der publizierten Sequenz AF120272 in einem Nukleotid unterscheidet. Durch das Einfügen einer Ncol-Schnittstelle im gps-Gen wurde das zweite Kodon der GGPP-Synthase verändert. In der publizierten Sequenz AF120272 kodiert CTG (Position 4-6) für Leucin. Durch die Amplifikation mit den beiden Primern SEQ ID No. 32 und SEQ ID No. 33 wurde dieses zweite Kodon in GTG verändert, wel- ches für Valin kodiert. Der Klon pCB-gps wurde daher für die Klonierung des gps-Gens in den Vektor pMCL- CrtYlBZ/idi verwendet. Die Klonierung erfolgte durch Isolierung des Kpnl/Xhol- Fragmentes aus pCB-gps und Ligierung in den Kpnl und Xhol geschnittenen Vektor pMCL-CrtYlBZ/idi. Das Monierte Kpnl/Xhol-Fragment (SEQ ID No. 34) trägt den Prm16-Promotor zusammen mit einer minimalen 5'-UTR-Sequenz von rbcL, den ersten 6 Kodons von rbcL, die die GGPP-Synthase N-terminal verlängern, und 3' vom gps-Gen die psbA-Sequenz. Der N-Terminus der GGPP-Synthase hat somit anstelle der natürlichen Aminosäure-Abfolge mit Met-Leu-Lys-Glu (Aminosäure 1 bis 4 aus AF120272) die veränderte Aminosäure-Abfolge Met-Thr-Pro-Gln-Thr-Ala-Met-Val-Lys- GIu. Daraus resultiert, dass die rekombinante GGPP-Synthase, beginnend mit Lys in Position 3 (in AF120272) identisch ist und keine weiteren Änderungen in der Aminosäuresequenz aufweist. Die rbcL- und psbA-Sequenzen wurden gemäß einer Referenz nach Eibl et al. (Plant J. 1 . (i 99), 1-13) verwendet. Der resultierende Klon heisst pMCL-CrtYlBZ/idi/gps.
Beispiel 3:
Biotransformation von Zeaxanthin in rekombinanten E. coli-Stämmen
X
Zur Zeaxanthin-Biotransformation wurden rekombinante E. co//-Stämme hergestellt, welche durch heterologe Komplementation zur Zeaxanthin-Produktion befähigt sind. Stämme von E. coli TOP10 wurden als Wirtszellen für die Komplementations- Experimente mit den Plasmiden pNOSTF-G und pMCL-CrtYlBZ/idi/gps verwendet.
Um E. co//-Stämme herzustellen, die die Synthese von Zeaxanthin in hoher Konzentra- tion ermöglichen, wurde das Plasmid pMCL-CrtYlBZ/idi/gps konstruiert. Das Plasmid trägt die Bioynthesegene crtY, crtB, crtl und crtY von Erwinia uredovora, das Gen gps (für Geranylgeranylpyrophoshat-Synthastase) aus Archaeoglobus fulgidus und das Gen /^/(Isopentenyldiphosphat-Isomerase) aus E. coli. Mit diesem Konstrukt wurden limitierende Schritte für eine hohe Akkumulation von Carotinoiden und deren bio- synthtischen Vorstufen beseitigt. Dies wurde zuvor von Wang et al. in ähnlicher Weise mit mehreren Plasmiden beschrieben (Wang, C.-W., Oh, M.-K. und Liao, J.C.; Engi- neered isoprenoid pathway enhances astaxanthin production in Escherichia coli, Bio- technology and Bioengineering 62 (1999), 235-241). Kulturen von E.coli TOP 10 wurden in ah sich bekannter Weise mit den beiden Plasmiden pNOSTF-G und pMCL-CrtYlBZ/idi/gps transformiert und in LB-Medium bei 30°C bzw. 37°C über Nacht kultiviert. Ampicillin (50 μg/ml), Chloramphenicol (50 μg/ml) und Isopropyl-ß-thiogalactosid (1 mmol) wurden in an sich üblicher Weise ebenfalls über Nacht zugegeben.
Zur Isolierung der Carotinoide aus den rekombinanten Stämmen wurden die Zellen mit Aceton extrahiert, das organische Lösungsmittel zur Trockne eingedampft und die Carotinoide mittels HPLC über eine C30-Säule aufgetrennt. Folgende Verfahrensbedin- gungen wurden eingestellt.
Trennsäule: Prontosil C30-Säule, 250 x 4,6 mm, (Bischoff, Leonberg)
Flussrate: 1.0 ml/min
Eluenten: Laufmittel A - 100% Methanol
Laufmittel B - 80% Methanol, 0.2% Ammoniumacetat
Laufmittel C - 100% t-Butyl-methylether
Detektion: 300 - 500 nm
Die Spektren wurden direkt aus den Elutionspeaks unter Verwendung eines Photodio- denarraydetektors bestimmt. Die isolierten Substanzen wurden über ihre Absorptions- spektren und ihre Retentionszeiten im Vergleich zu Standardproben identifiziert.
Abbildung 1 zeigt die chromatographische Analyse einer Probe erhalten aus einem mit pNOSTF-G und pMCL-CrtYlBZ/idi/gps transformierten E. co//-Stamm. Es zeigt sich, daß dieser Stamm aufgrund der heterologen Komplementation verschiedene Ketocarotinoide synthetisieren kann. Mit zunehmender Retentionszeit werden Astaxanthin (Peak 1), Adonirubin (Peak 2) und Canthaxanthin (Peak 3) eluiert.
Beispiel 3.1
Vergleichsbeispiel
Analog zu den vorhergehenden Beispielen wurde als Vergleichsbeispiel ein E.coli- Stamm hergestellt, der eine Ketolase aus Haematococcus pluvialis Flotow em. Wille exprimiert. Dazu wurde die cDNA die für die gesamte Primärsequenz der Ketolase aus Haematococcus pluvialis Flotow em. Wille codiert amplifiziert und gemäß Beispiel 1 in den gleichen Expressionsvektor kloniert.
Die cDNA, die für die Ketolase aus Haematococcus pluvialis codiert, wurde mittels PCR aus Haematococcus pluvialis (Stamm 192.80 der "Sammlung von Algenkulturen der Universität Göttingen")Suspensionskultur amplifiziert. Für die Präparation von To- tal-RNA aus einer Suspensionskultur von Haematococcus pluvialis (Stamm 192.80), die 2 Wochen mit indirektem Tageslicht bei Raumtemperatur in Haematococcus- Medium (1.2 g/l Natriumacetat, 2 g/l Hefeextrakt, 0.2 g/l MgCI2x6H2O, 0.02 CaCI2x2H2O; pH 6.8; nach Autoklavieren Zugabe von 400 mg/l L-Asparagin, 10 mg/l FeSO4xH2O) gewachsen war, wurden die Zellen geerntet, in flüssigem Stickstoff eingefroren und im Mörser pulverisiert. Anschließend wurden 100 mg der gefrorenen, pulverisierten Algenzellen in ein Reaktionsgefäß überführt und in 0.8 ml Trizol-Puffer (LifeTechnolo- gies) aufgenommen. Die Suspension wurde mit 0.2 ml Chloroform extrahiert. Nach 15 minütiger Zentrifugation bei 12000 g wurde der wässrige Überstand abgenommen und in ein neues Reaktionsgefäß überführt und mit einem Volumen Ethanol extrahiert. Die RNA wurde mit einem Volumen Isopropanol gefällt, mit 75% Ethanol gewaschen und das Pellet in DEPC Wasser (über Nacht Inkubation von Wasser mit 1/1000 Volumen Diethylpyrocarbonat bei Raumtemperatur, anschließend autoklaviert) gelöst. Die RNA- Konzentration wurde photometrisch bestimmt.
Für die cDNA-Synthese wurden 2.5 ug Gesamt-RNA für 10 min bei 60_C denaturiert, für 2 min auf Eis abgekühlt und mittels eines cDNA-Kits (Ready-to-go-you-prime- beads, Pharmacia Biotech) nach Herstellerangaben unter Verwendung eines antisense spezifischen Primers PR1 (gcaagctcga cagctacaaa cc) in cDNA umgeschrieben. Die Nukleinsäure codierend eine Ketolase aus Haematococcus pluvialis (Stamm 192.80) wurde mittels polymerase chain reaction (PCR) aus Haematococcus pluvialis unter Verwendung eines sense spezifischen Primers PR2 (gaagcatgca gctagcagcg acag) und eines antisense spezifischen Primers PR1 amplifiziert.
Die PCR-Bedingungen waren die folgenden:
Die PCR zur Amplifikation der cDNA, die für ein Ketolase Protein bestehend aus der gesamten Primärsequenz codiert, erfolgte in einem 50 ml Reaktionsansatz, in dem enthalten war:
4 ml einer Haematococcus pluvialis cDNA (hergestellt wie oben beschrieben). 0.25 mM dNTPs
0.2 mM PR1 - 0.2 mM PR2
5 ml 10X PCR-Puffer (TAKARA) 0.25 ml R Taq Polymerase (TAKARA)
25.8 ml Aq. Dest. x
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt:
1X 94_C 2 Minuten 35X 94_C 1 Minute
53_C 2 Minuten 72_C 3 Minuten
1X 72 C 10 Minuten
Die PCR-Amplifikation mit PR1 und PR2 resultierte in einem 1155 Bp-Fragment, das für ein Protein bestehend aus der gesamten Primärsequenz codiert: gaagcatgca gctagcagcg acagtaatgt tggagcagct taccggaagc gctgaggcac 60 tcaaggagaa ggagaaggag gttgcaggca gctctgacgt gttgcgtaca tgggcgaccc 120 agtactcgct tccgtcagag gagtcagacg cggcccgccc gggactgaag aatgcctaca 180 agccaccacc ttccgacaca aagggcatca caatggcgct agctgtcatc ggctcctggg 240 ccgcagtgtt cctccacgcc atttttcaaa tcaagcttcc gacctccttg gaccagctgc 300 actggctgcc cgtgtcagat gccacagctc agctggttag cggcagcagc agcctgctgc 360 acatcgtcgt agtattcttt gtcctggagt tcctgtacac aggccttttt atcaccacgc 420 atgatgctat gcatggcacc atcgccatga gaaacaggca gcttaatgac ttcttgggca 480 gagtatgcat ctccttgtac gcctggtttg attacaacat gctgcaccgc aagcattggg 540 agcaccacaa ccacactggc gaggtgggca aggaccctga cttccacagg ggaaaccctg 600 gcattgtgcc ctggtttgcc agcttcatgt ccagctacat gtcgatgtgg cagtttgcgc 660 gcctcgcatg gtggacggtg gtcatgcagc tgctgggtgc gccaatggcg aacctgctgg 720 tgttcatggc ggccgcgccc atcctgtccg ccttccgctt gttctacttt ggcacgtaca 780 tgccccacaa gcctgagcct ggcgccgcgt caggctcttc accagccgtc atgaactggt 840 ggaagtcgcg cactagccag gcgtccgacc tggtcagctt tctgacctgc taccacttcg 900 acctgcactg ggagcaccac cgctggccct ttgccccctg gtgggagctg cccaactgcc 960 gccgcctgtc tggccgaggt ctggttcctg cctagctgga cacactgcag tgggccctgc 1020 tgccagctgg gcatgcaggt tgtggcagga ctgggtgagg tgaaaagctg caggcgctgc 1080 tgccggacac gctgcatggg ctaccctgtg tagctgccgc cactagggga gggggtttgt 1140 agctgtcgag cttgc
Unter Verwendung von Standardmethoden wurde das Amplifikat in den PCR- Klonierungsvektor pGEM-Teasy (Promega) kloniert und der Klon pGKETO2 erhalten.
Sequenzierung des Klons pGKETO2 mit dem T7- und dem SP6-Primer bestätigte eine Sequenz, die sich lediglich in den drei Codons 73, 114 und 119 in je einer Base von der publizierten Sequenz X86782 unterscheidet. Diese Nukleotidaustausche wurden in einem unabhängigem Amplifikationsexperiment reproduziert und repräsentieren sornit die Nukleotidsequenz im verwendeten Haematococcus pluvialis Stamm 192.80.
Dieser Klon wurde für die Klonierung in den unter Beispiel 1 beschriebenen Expressionsvektor verwendet. Die Klonierung erfolgte analog wie in Beispiel 1 beschrieben. Die Transformation der E.coli Stämme, deren Kultivierung und die Analyse des Caroti- noidprofils erfolgte wie in Beispiel 3 beschrieben.
Abbildung 2 zeigt die chromatographische Analyse einer Probe erhalten aus einem mit diesem Expressionsvektor und pMCL-CrtYlBZ/idi/gps transformierten E. co//-Stamm. Unter Verwendung einer Ketolase aus Haematococcus pluvialis, wie beispielsweise in EP 725137 beschrieben, eluieren mit zunehmender Retentionszeit Astaxanthin (Peak 1), Adonixanthin (Peak 2) und nicht umgesetztes Zeaxanthin (Peak 3). Dieses Caroti- noidprofil wurde bereits in EP 0725137 beschrieben.
Tabelle 1 zeigt einen Vergleich der bakteriell produzierten Carotinoidmengen:
Tablelle 1 : Vergleich der bakteriellen Ketocarotinoid-Synthese bei Verwendung zweier verschiedener Ketolasen, der erfindungsgemäßen NOST-Ketolase aus Nostoc sp. PCC7120 (Beispiel 3) und der Ketolase aus Haematococcus pluvialis als Vergleichsbeispiel (Beispiel 3.1). Carotinoidmengen sind in ng/ ml Kulturflüssigkeit angegeben.
Die erfindungsgemäße Expression der Ketolase aus Nostoc sp. Strain PCC7120 führt zu einem Carotinoidmuster, welches sich von dem Carotinoidmuster nach Expression einer Ketolase aus Haematococcus pluvialis deutlich unterscheidet. Während die Keto- läse aus dem Stand der Technik nur sehr unvollständig das gewünschte Ketocarotinoid Astaxanthin liefert, ist Astaxanthin bei der Verwendung der erfindungsgemäßen Ketolase das Hauptprodukt. Im erfindungsgemäßen Verfahren treten hydroxylierte Nebenprodukte in einer deutlich geringeren Menge auf.
Beispiel 4:
Herstellung von Expressionsvektoren zur konstitutiven Expression der Nostoc sp. PCC 7120 NOST-Ketolase in Lycopersicon esculentum und Tagetes erecta. /
Die Expression der NOST-Ketolase aus Nostoc sp. PCC7120 in L esculentum und in Tagetes erecta erfolgte unter Kontrolle des konstitutiven Promoters FNR (Ferredoxin- NADPH- Oxidoreductase, Datenbankeintrag AB011474 Position 70127 bis 69493; WO03/006660), aus Arabidopsis thallana. Das FNR-Gen beginnt bei Basenpaar 69492 und ist mit "Ferredoxin-NADP+ Reductase" annotiert. Die Expression erfolgte mit dem Transitpeptid rbcS aus Erbse (Anderson et al. 1986, Biochem J. 240:709-715).
Das DNA Fragment, das die FNR Promotorregion aus Arabidopsis thallana beinhaltet, wurde mittels PCR unter Verwendung genomischer DNA (nach Standardmethoden aus Arabidopsis thallana isoliert) sowie der Primer FNR-A (SEQ ID No.38) und FNR-B (SEQ ID No. 39) hergestellt.
Die PCR-Bedingungen waren die folgenden:
Die PCR zur Amplifikation der DNA, die das FNR-Promotorfragment FNR#1 ) beinhaltet, erfolgte in einem 50 ul Reaktionsansatz, in dem enthalten war: 100 ng genomischer DNA aus A.thaliana 0.25 mM dNTPs 0.2 mM FNR-A (SEQ ID No. 38) 0.2 mM FNR-B (SEQ ID No. 39) - 5 ul IOX PCR-Puffer (Stratagene)
0.25 ul Pfu Polymerase (Stratagene) 28.8 ul Aq. Dest.
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt:
1X 94°C 2 Minuten 35X g4°C 1 Minute 50°C 1 Minute 72°C 1 Minute 1 X 72°C 10 Minuten
Das 647 bp Amplifikat wurde unter Verwendung von Standardmethoden in den PCR-
X
Klonierungsvektor pCR 2.1 (Invitrogen) kloniert und das Plasmid pFNR#1 erhalten.
Sequenzierung des Klons pFNR#1 bestätigte eine Sequenz,die mit einem Sequenzabschnitt auf Chromosom 5 von Arabidopsis thaliana (Datenbankeintrag AB011474; WO03/006660) von Position 70127 bis 6g4g3 übereinstimmt. Das FNR-Gen beginnt - bei Basenpaar 6g4 2 und ist mit "Ferredoxin-NADP+ Reductase" annotiert.
pFNR wurde daher für die Klonierung in den Expressionsvektor pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380) verwendet.
Die Klonierung erfolgte durch Isolierung des 637 bp Sacl-Hindlll Fragmentes aus pFNR#1 (partialle Sacl Hydrolyse) und Ligierung in den Sacl-Hindlll geschnittenen Vektor pJIT117. Der Klon, der den Promoter FNR#1 anstelle des ursprünglichen Promoters d35S enthält, heisst pJITFNR.
Zur Herstellung einer Expressionskassette pJFNRNOST wurde das 799 bp SpHI- Fragment NOSTF-G (in Beispiel 1 beschrieben) in den SpHI geschnittenen Vektor pJITFNR kloniert. Der Klon, der das Fragment NOSTF-G in der korrekten Orientierung als N-terminale Fusion mit dem rbcS Transitpeptid enthält, heisst pJFNRNOST.
Die Herstellung einer Expressionskassette für die Agrobacterium vermittelte Transfor- mation der Ketolase aus Nostoc in L esculentum erfolgte unter der Verwendung des binären Vektors pSUN3 (WO0200900).
Zur Herstellung des Expressionsvektors pS3FNR:NOST (MSP101) wurde das 2.425 bp Sacl-Xhol Fragment (partialle Sacl Hydrolyse) aus pJFNRNOST mit dem Sacl-Xhol geschnittenen Vektor pSUN3 ligiert (Abbildung 3, Konstruktkarte). In der Abbildung 3 beinhaltet Fragment FNR-Promotor den FNR Promotor (635 bp), Fragment rbcS TP Fragment das rbcS Transitpeptid aus Erbse (194 bp), Fragment Nost Ketolase CDS (777 bp) die gesamte Primärsequenz, kodierend für die Nostoc Ketolase, Fragment 35S Term (746 bp) das Polyadenylierungssignal von CaMV.
Die Herstellung einer Expressionskassette für die Agrobacterium-vet rMeWe Transformation des Expressionsvektor mit der Ketolase aus Nostoc in Tagetes erecta erfolgte unter der Verwendung des binären Vektors pSUN5 (WO02/00900).
Zur Herstellung des Tagetes-Expressionsvektors pS5FNR:NOST (MSP102) wurde das 2.425 bp Sacl-Xhol Fragment (partielle Sacl Hydrolyse) aus pJFNRNOST mit dem Sacl-Xhol geschnittenen Vektor pSUN5 ligiert (Abbildung 4, Konstruktkarte). In der Abbildung 4 beinhaltet Fragment FNR Promotor den FNR Promotor (635 bp), Fragment rbcS Transit Peptide das rbcS Transitpeptid aus Erbse (1 g4 bp), Fragment Nost Ketolase (777 bp) die gesamte Primärsequenz, kodierend für die Nostoc Ketolase, Fragment 35S Terminator (746 bp) das Polyadenylierungssignal von CaMV.
Beispiel 5:
Herstellung von Expressionsvektoren zur blütenspezifischen Expression der Nostoc sp. PCC 7120 NOST-Ketolase in Lycopersicon esculentum und Tagetes erecta.
Die Expression der Ketolase aus Nostoc in L. esculentum und Tagetes erecta erfolgte mit dem Transitpeptid rbcS aus Erbse (Anderson et al. 1986, Biochem J. 240:709-715). Die Expression erfolgte unter Kontrolle einer modifizierten Version AP3P des blüten- spezifischen Promoters AP3 aus Arabidopsis thaliana (AL132971 : Nukleotidregion 9298-10200; Hill et al. (1998) Development 125: 1711-1721). Das DNA Fragment, das die AP3 Promoterregion -902 bis +15 aus Arabidopsis thalia- na beinhaltet, wurde mittels PCR unter Verwendung genomischer DNA (nach Standardmethoden aus Arabidopsis thaliana isoliert) sowie der Primer AP3-1 (SEQ ID No.41) und AP3-2 (SEQ ID No. 42) hergestellt.
Die PCR-Bedingungen waren die folgenden:
Die PCR zur Amplifikation der DNA, die das AP3-Promoterfragment (-902 bis +15) beinhaltet, erfolgte in einem 50 μl Reaktionsansatz, in dem enthalten war:
100 ng genomischer DNA aus A.thaliana
0.25 mM dNTPs
0.2 mM AP3-1 (SEQ ID No. 41 )
0.2 mM AP3-2 (SEQ ID No. 42) - 5 ul IOX PCR-Puffer (Stratagene)
0.25 ul Pfu Polymerase (Stratagene)
28.8 ul Aq. Dest.
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt:
1 X 94°C 2 Minuten 35X 94°C 1 Minute 50°C 1 Minute 72°C 1 Minute 1X 72°C 10 Minuten
Das 2 Bp Amplifikat wurde unter Verwendung von Standardmethoden in den PCR- Klonierungsvektor pCR 2.1 (Invitrogen) kloniert und das Plasmid pAP3 erhalten.
Sequenzierung des Klons pAP3 bestätigte eine Sequenz, die sich lediglich in durch eine Insertion (ein G in Position g765 der Sequenz AL132g71) und einen Basenaustausch (ein G statt ein A in Position g726 der Sequenz AL132971) von der publizierten AP3 Sequenz (AL132g71 , Nukleotidregion g2g8-10200) unterscheidet. Diese Nukleoti- dunterschiede wurden in einem unabhängigen Amplifikationsexperiment reproduziert und repräsentieren somit die tatsächliche Nukleotidsequenz in den verwendeten Arabidopsis thaliana Pflanzen.
Die modifizierte Version AP3P wurde mittels rekombinanter PCR unter Verwendung des Plasmids pAP3 hergestellt. Die Region 10200 - g771 wurde mit den Primern AP3-1 (SEQ ID No. 41) und Primern AP3-4 (SEQ ID No. 44) amplifiziert (Amplifikat A1/4), die Region g526-g285 wurde mit den AP3-3 (SEQ ID No. 43) und AP3-2 (SEQ ID No. 42) amplifiziert (Amplifikat A2/3).
Die PCR-Bedingungen waren die folgenden:
Die PCR-Reaktionen zur Amplifikation der DNA- Fragmente, die die Regionen Region 10200 - 9771 und Region 9526-9285 des AP3 Promoters beinhalten, erfolgte in 50 ul Reaktionsansätzen, in denen enthalten war:
100 ng AP3 Amplifikat (oben beschrieben) 0.25 mM dNTPs
0.2 mM sense Primer (AP3-1 SEQ ID No. 41 bzw. AP3-3 SEQ ID No. 43) 0.2 mM antisense Primer (AP3-4 SEQ ID No. 44 bzw. AP3-2 SEQ ID No. 42) - 5 ul IOX PCR-Puffer (Stratagene)
0.25 ul Pfu Taq Polymerase (Stratagene) 28.8 ul Aq. Dest.
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt:
1X 94°C 2 Minuten 35X g4°C 1 Minute
50°C 1 Minute
72°C 1 Minute 1 X 72°C 10 Minuten
Die rekombinante PCR beinhaltet Annealing der sich über eine Sequenz von 25 Nukleotiden überlappenden Amplifikate A1/4 und A2/3, Vervollständigung zu einem Doppelstrang und anschließende Amplifizierung. Dadurch entsteht eine modifizierte Version des AP3 Promoters, AP3P, in dem die Positionen g670 - 9526 deletiert sind. Die Denaturierung (5 min bei 95°C) und Annealing (langsame Abkühlung bei Raumtemperatur auf 40°C) beider Amplifikate A1/4 und A2/3 erfolgte in einem 17.6 ul Reaktionsansatz, in dem enthalten war:
0.5 ug A1/4 Amplifikat 0.25 ug A2/3 Amplifikat
Das Auffüllen der 3'-Enden (30 min bei 30°C) erfolgte in einem 20 ul Reaktionsansatz, in dem enthalten war:
17.6 ul A1/4 und A2/3-Annealingsreaktion (hergestellt wie oben beschrieben)
50 uM dNTPs
2 ul IX KIenow Puffer
2U Klenow Enzym
Die Nukleinsäure kodierend für die modifizierte Promoterversion AP3P wurde mittels PCR unter Verwendung eines sense spezifischen Primers (AP3-1 SEQ ID No. 41) und eines antisense spezifischen Primers (AP3-2 SEQ ID No. 42) amplifiziert.
Die PCR-Bedingungen waren die folgenden:
Die PCR zur Amplifikation des AP3P Fragmentes erfolgte in einem 50 ul Reaktionsansatz, in dem enthalten war:
- 1 ul Annealingsreaktion (hergestellt wie oben beschrieben)
0.25 mM dNTPs
0.2 mM AP3-1(SEQ ID No. 41)
0.2 mM AP3-2 (SEQ ID No. 42)
5 ul IOX PCR-Puffer (Stratagene) - 0.25 ul Pfu Taq Polymerase (Stratagene)
28.8 ul Aq. Dest.
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt:
1X 94°C 2 Minuten 35X g4°C 1 Minute 50°C 1 Minute 72°C 1 Minute 1X 72°C 10 Minuten
Die PCR-Amplifikation mit SEQ ID No. 41 (AP3-1) und SEQ ID No. 42 (AP3-2) resultierte in einem 777 Bp Fragment, das für die modifizierte Promoterversion AP3P kodiert. Das Amplifikat wurde in den Klonierungsvektor pCR2.1 (Invitrogen) kloniert und das Plasmid pAP3P erhalten. Sequenzierungen mit den Primern T7 und M13 bestätigten eine zur Sequenz AL132971 , Region 10200-92g8 identische Sequenz, wobei die interne Region g285 - g526 deletiert wurde. Diese Klon wurde daher für die Klonierung in den Expressionsvektor pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380) verwendet.
Die Klonierung erfolgte durch Isolierung des 767 Bp Sacl-Hindlll Fragmentes aus pAP3P und Ligierung in den Sacl-Hindlll geschnittenen Vektor pJIT117. Der Klon, der den Promoter AP3P anstelle des ursprünglichen Promoters d35S enthält, heisst pJI- TAP3P. Zur Herstellung einer Expressionskassette pJAP3NOST wurde das 79g Bp SpHI-Fragment NOSTF-G (in Beispiel 1 beschrieben) in den SpHI geschnittenen Vektor pJITAP3P kloniert. Der Klon, der das Fragment NOSTF-G in der korrekten Orientie- rung als N-terminale Fusion mit dem rbcS Transitpeptid enthält, heisst pJAP3PNOST.
Die Herstellung eines Expressionsvektors für die Agrobacterium-vermittelte Transformation der AP3P-kontrollierten Ketolase aus Nostoc in L esculentum erfolgte unter der Verwendung des binären Vektors pSUN3 (WO02/00900).
Zur Herstellung des Expressionsvektors pS3AP3:NOST (MSP103) wurde das 2.555 bp Sacl-Xhol Fragment aus pJAP3NOST mit dem Sacl-Xhol geschnittenen Vektor pSUN3 ligiert (Abbildung 5, Konstruktkarte). In der Abbildung 5 beinhaltet Fragment AP3P PROMOTER den modifizierten AP3P Promoter ( 765 bp), Fragment rbcS TP FRAGMENT das rbcS Transitpeptid aus Erbse (194 bp), Fragment NOST KETOLASE CDS (777bp) die gesamte Primärsequenz kodierend für die Nostoc Ketolase, Fragment 35S TERM (746 bp) das Polyadenylierungssignal von CaMV. Die Herstellung einer Expressionsvektors für die Agrobacterium-vermittelte Transformation der AP3P-kontrollierten Ketolase aus Nostoc in Tagetes erecta erfolgte unter der Verwendung des binären Vektors pSUN5 (WO02/00900).
Zur Herstellung des Expressionsvektors pS5AP3:NOST (MSP104) wurde das 2.555 bp Sacl-Xhol Fragment aus pS5AP3PNOST mit dem Sacl-Xhol geschnittenen Vektor pSUN5 ligiert (Abbildung 6, Konstruktkarte). In der Abbildung 6 beinhaltet Fragment AP3P PROMOTER den modifizierten AP3P Promoter (765 bp), Fragment rbcS TP FRAGMENT das rbcS Transitpeptid aus Erbse (207 bp), Fragment NOST KETOLASE CDS (777 bp) die gesamte Primärsequenz codierend für die Nostoc Ketolase, Fragment 35S TERM (746 bp) das Polyadenylierungssignal von CaMV.
Beispiel 6
Amplifikation einer DNA, die die gesamte Primärsequenz der NPigβ-Ketolase aus Nostoc punctiforme A TCC 29133 kodiert
Die DNA, die für die NPigβ-Ketolase aus Nostoc punctiforme ATCC 29133 kodiert,-
X wurde mittels PCR aus Nostoc punctiforme ATCC 29133 (Stamm der "American Type Culture Collection") amplifiziert.
Für die Präparation von genomischer DNA aus einer Suspensionskultur von Nostoc punctiforme ATCC 29133, die 1 Woche mit Dauerlicht und konstantem Schütteln (150 rpm) at 25°C in BG 17-Medium (1.5 g/l NaNO3, 0.04 g/l K2PO4x3H2O, 0.075 g/l MgSO4xH O, 0.036 g/l CaCI2x2H2O, 0.006 g/l citric acid, 0.006 g/l Ferric ammonium citrate, 0.001 g/l EDTA disodium magnesium, 0.04 g/l Na2CO3, 1ml Trace Metal Mix "A5+Co" (2.86 g/l H3BO3, 1.81 g/l MnCI2x4H2o, 0.222 g/l ZnSO4x7H20, 0.3g g/l Na- MoO4X2H2o, 0.07g g/l CuSO4x5H2O, 0.04g4 g/l Co(NO3)2x6H2O) gewachsen war, wurden die Zellen durch Zentrifugation geerntet, in flüssigem Stickstoff eingefroren und im Mörser pulverisiert.
Protokoll für die DNA-Isolation aus Nostoc punctiforme ATCC 29133:
Aus einer 10 ml Flüssigkultur wurden die Bakterienzellen durch 10 minütige Zentrifugation bei 8000 rpm pelletiert. Anschließend wurden die Bakterienzellen in flüssigem Stickstoff mit einem Mörser zerstoßen und gemahlen. Das Zellmaterial wurde in 1 ml 10mM Tris_HCI (pH 7.5) resuspendiert und in ein Eppendorf-Reaktionsgefäß (2ml Vo- lumen) überführt. Nach Zugabe von 100 μl Proteinase K (Konzentration: 20 mg/ml) wurde die Zellsuspension für 3 Stunden bei 37°C inkubiert. Anschließend wurde die Suspension mit 500 μl Phenol extrahiert. Nach δminütiger Zentrifugation bei 13 000 upm wurde die obere, wässrige Phase in ein neues 2 ml-Eppendorf-Reaktionsgefäß i überführt. Die Extraktion mit Phenol wurde 3mal wiederholt. Die DNA wurde durch Zugabe von 1/10 Volumen 3 M Natriumacetat (pH 5.2) und 0.6 Volumen Isopropanol gefällt und anschließend mit 70% Ethanol gewaschen. Das DNA-Pellet wurde bei Raumtemperatur getrocknet, in 25 μl Wasser aufgenommen und unter Erhitzung auf 65°C gelöst.
Die Nukleinsäure, kodierend eine Ketolase aus Nostoc punctiforme ATCC 29133, wurde mittels "polymerase chain reaction" (PCR) aus Nostoc punctiforme ATCC 29133 unter Verwendung eines sense-spezifischen Primers (NP196-1 , SEQ ID No. 54) und eines antisense-spezifischen Primers (NP196-2 SEQ ID No. 55) amplifiziert.
Die PCR-Bedingungen waren die folgenden:
X
Die PCR zur Amplifikation der DNA, die für ein Ketolase Protein bestehend aus der gesamten Primärsequenz kodiert, erfolgte in einem 50 ul Reaktionsansatz, in dem ent- halten war
1 ul einer Nostoc punctiforme ATCC 29133 DNA (hergestellt wie oben beschrieben)
0.25 mM dNTPs - 0.2 mM NPig6-1 (SEQ ID No. 54)
0.2 mM NP196-2 (SEQ ID No. 55)
5 ul 10X PCR-Puffer (TAKARA)
0.25 ul R Taq Polymerase (TAKARA)
25.8 ul Aq. Dest.
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt:
1X 94°C 2 Minuten
35X 94°C 1 Minute
55°C 1 Minuten 72°C 3 Minuten
1X 72°C 10 Minuten
Die PCR-Amplifikation mit SEQ ID No. 54 und SEQ ID No. 55 resultierte in einem 792 Bp-Fragment, das für ein Protein bestehend aus der gesamten Primärsequenz kodiert (NPigβ, SEQ ID No. 56). Unter Verwendung von Standardmethoden wurde das Amplifikat in den PCR-Klonierungsvektor pCR 2.1 (Invitrogen) kloniert und der Klon pNP196 erhalten.
Sequenzierung des Klons pNP196 mit dem M13F- und dem M13R-Primer bestätigte eine Sequenz, welche mit der DNA-Sequenz von 140.571 -13g.810 des Datenbankeintrages NZ_AABC01000196 identisch ist (inverse orientiert zum veröffentlichen Datenbankeintrag) mit der Ausnahme, daß G in Position 140.571 durch A ersetzt wurde, um ein Standard-Startkodon ATG zu erzeugen. Diese Nukleotidsequenz wurde in ei- nem unabhängigem Amplif ikationsexperiment reproduziert und repräsentiert somit die Nukleotidsequenz im verwendeten Nostoc punctiforme ATCC 29133. x Dieser Klon pNP196 wurde daher für die Klonierung in den Expressionsvektor pJIT117(Guerineau et al. ig88, Nucl. Acids Res. 16: 11380) verwendet.
pJIT117 wurde modifiziert, indem der 35S-Terminator durch den OCS-Terminator (Oc- topine Synthase) des Ti-Plasmides pTi15g55 von Agrobacterium tumefaciens (Datenbankeintrag X004g3 von Position 12,541-12,350, Gielen et al. (ig84) EMBO J. 3835- 846) ersetzt wurde.
Das DNA-Fragment, das die OCS-Terminatorregion beinhaltet, wurde mittels PCR unter Verwendung des Plasmides pHELLSGATE (Datenbankeintrag AJ311874, Wesley et al. (2001) Plant J. 27581-590, nach Standardmethoden aus E.coli isoliert) sowie der Primer OCS-1 (SEQ ID No. 58) und OCS-2 (SEQ ID No. 59) hergestellt.
Die PCR-Bedingungen waren die folgenden:
Die PCR zur Amplifikation der DNA, die die Octopin Synthase (OCS) Terminatorregion (SEQ ID No. 60) beinhaltet, erfolgte in einem 50 ul Reaktionsansatz, in dem enthalten waren: 100 ng pHELLSGATE plasmid DNA 0.25 mM dNTPs 0.2 mM OCS-1 (SEQ ID No. 58) 0.2 mM OCS-2 (SEQ ID No. 5 ) 5 ul IOX PCR-Puffer (Stratagene) 0.25 ul Pfu Polymerase (Stratagene) 28.8 ul Aq. Dest.
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt:
1X 94°C 2 Minuten 35X 94°C 1 Minute
50°C 1 Minute
72°C 1 Minute 1X 72°C 10 Minuten
Das 210 bp Amplifikat wurde unter Verwendung von Standardmethoden in den, PCR- Klonierungsvektor pCR 2.1 (Invitrogen) kloniert und das Plasmid pOCS erhalten.
Sequenzierung des Klons pOCS bestätigte eine Sequenz, die mit einem Sequenzab- schnitt auf dem Ti-Plasmid pTi15955 von Agrobacterium tumefaciens (Datenbankeintrag X00493) von Position 12.541 bis 12.350 übereinstimmt.
Die Klonierung erfolgte durch Isolierung des 210 bp Sall-Xhol Fragmentes aus pOCS und Ligierung in den Sall-Xhol geschnittenen Vektor pJIT117.
Dieser Klon heisst pJO und wurde daher für die Klonierung in den Expressionsvektor pJONP196 verwendet.
Die Klonierung erfolgte durch Isolierung des 782 Bp Sphl-Fragmentes aus pNP196 und Ligierung in den SphI geschnittenen Vektor pJO. Der Klon, der die NPig6-Ketolase von Nostoc punctiforme in der korrekten Orientierung als N-terminale translationale Fusion mit dem rbcS Transitpeptid enthält, heisst pJONP196. Beispiel 7:
Herstellung von Expressionsvektoren zur konstitutiven Expression der NP1 gβ-Ketolase aus Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum und Tagetes erecta.
Die Expression der NP196-Ketolase aus Nostoc punctiforme in L. esculentum und in Tagetes erecta erfolgte unter Kontrolle des konstitutiven Promoters FNR (Ferredoxin- NADPH- Oxidoreductase, Datenbankeintrag AB011474 Position 70127 bis 694g3; WO03/006660), aus Arabidopsis thallana. Das FNR-Gen beginnt bei Basenpaar 69492 und ist mit "Ferredoxin-NADP+ Reductase" annotiert. Die Expression erfolgte mit dem Transitpeptid rbcS aus Erbse (Anderson et al. 1986, Biochem J. 240:709-715).
Das DNA Fragment, das die FNR Promotorregion aus Arabidopsis thallana beinhaltet, wurde mittels PCR unter Verwendung genomischer DNA (nach Standardmethoden aus Arabidopsis thaliana isoliert) sowie der Primer FNR-1 (SEQ ID No. 61 ) und FNR-2 (SEQ ID No. 62) hergestellt.
Die PCR-Bedingungen waren die folgenden:
X
Die PCR zur Amplifikation der DNA, die das FNR-Promotorfragment FNR (SEQ ID No. 63) beinhaltet, erfolgte in einem 50 ul Reaktionsansatz, in dem enthalten war:
100 ng genomischer DNA aus A.thaliana 0.25 mM dNTPs 0.2 mM FNR-1 (SEQ ID No. 61) - 0.2 mM FNR-2 (SEQ ID No. 62) 5 ul IOX PCR-Puffer (Stratagene) 0.25 ul Pfu Polymerase (Stratagene) 28.8 ul Aq. Dest.
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt:
1X 94°C 2 Minuten 35X g4°C 1 Minute 50°C 1 Minute 72°C 1 Minute 1X 72°C 10 Minuten
Das 652 bp Amplifikat wurde unter Verwendung von Standardmethoden in den PCR- Klonierungsvektor pCR 2.1 (Jnvitrogen) kloniert und das Plasmid pFNR erhalten.
Sequenzierung des Klons pFNR bestätigte eine Sequenz, die mit einem Sequenzabschnitt auf Chromosom 5 von Arabidopsis thaliana (Datenbankeintrag AB011474) von Position 70127 bis 6g493 übereinstimmt.
Dieser Klon heisst pFNR und wurde daher für die Klonierung in den Expressionsvektor pJONP196 (in Beispiel 6 beschrieben) verwendet.
Die Klonierung erfolgte durch Isolierung des 644 bp Smal-Hindlll Fragmentes aus pFNR und Ligierung in den Ecl136ll-Hindlll geschnittenen Vektor pJONP196. Der Klon, der den Promoter FNR anstelle des ursprünglichen Promoters d35S und das Fragment NP196 in der korrekten Orientierung als N-terminale Fusion mit dem rbcS Transitpeptid enthält, heisst pJOFNR:NP196.
X
Die Herstellung einer Expressionskassette für die Agrobacterium vermittelte Transfor- mation der NP196-Ketolase aus Nostoc in L esculentum erfolgte unter der Verwendung des binären Vektors pSUN3 (WO02/00g00).
Zur Herstellung des Expressionsvektors MSP105 wurde das 1.83g bp EcoRI-Xhol Fragment aus pJOFNR:NPig6 mit dem EcoRI-Xhol geschnittenen Vektor pSUN3 li- giert (Abbildung 7, Konstruktkarte). In der Abbildung 7 beinhaltet Fragment FNR Promotor den FNR Promotor (635 bp), Fragment rbcS TP FRAGMENTdas rbcS Transitpeptid aus Erbse (ig4 bp), Fragment NP196 KETO CDS (761 bp), kodierend für die Nostoc punctiforme NPigβ-Ketolase , Fragment OCS Terminator W2 bp) das Polyadenylierungssignal von der Octopin- Synthase.
Die Herstellung einer Expressionskassette für die ,4groöacter/'um-vermittelte Transformation des Expressionsvektor mit der NPi β-Ketolase aus Nostoc punctiforme in Tagetes erecta erfolgte unter der Verwendung des binären Vektors pSUN5 (WO 02/00900). Zur Herstellung des Tagetes-Expressionsvektors MSP106 wurde das 1.839 bp EcoRI- Xhol Fragment aus pJOFNR:NP196 mit dem EcoRI-Xhol geschnittenen Vektor pSUN5 ligiert (Abbildung 8, Konstruktkarte). In der Abbildung 8 beinhaltet Fragment FNR Promotor den FNR Promotor (635 bp), Fragment rbcS TP FRAGMENT das rbcS Transit- peptid aus Erbse (194 bp), Fragment NP196 KETO CDS (761 bp), kodierend für die Nostoc punctiforme NP196-Ketolase , Fragment OCS Terminator (192 bp) das Polyadenylierungssignal von Octopin-Synthase.
Beispiel 8: Herstellung von Expressionsvektoren zur blütenspezifischen Expression der NP196- Ketolase aus Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum und Tagetes erecta
Die Expression der NPigβ-Ketolase aus Nostoc punctiforme in L esculentum und Ta- getes erecta erfolgte mit dem Transitpeptid rbcS aus Erbse (Anderson et al. 1986, Biochem J. 240:709-715). Die Expression erfolgte unter Kontrolle des blütenspezifischen Promoters EPSPS aus Petunia hybrida (Datenbankeintrag M37029: Nukleotidregion 7- 1787; Benfey et al. (1990) Plant Cell 2: 849-856).
Das DNA Fragment, das die EPSPS Promoterregion (SEQ ID No. 66) aus Petunia hybrida beinhaltet, wurde mittels PCR unter Verwendung genomischer DNA (nach Standardmethoden aus Petunia hybrida isoliert) sowie der Primer EPSPS-1 (SEQ ID No. 64) und EPSPS-2 (SEQ ID No. 65) hergestellt.
Die PCR-Bedingungen waren die folgenden:
Die PCR zur Amplifikation der DNA, die das EPSPS-Promoterfragment (Datenbankeintrag M37029: Nukleotidregion 7-1787) beinhaltet, erfolgte in einem 50 μl Reaktionsansatz, in dem enthalten war:
100 ng genomischer DNA aus A.thaliana
0.25 mM dNTPs
0.2 mM EPSPS-1 (SEQ ID No. 64)
0.2 mM EPSPS-2 (SEQ ID No. 65) - 5 ul IOX PCR-Puffer (Stratagene)
0.25 ul Pfu Polymerase (Stratagene) 28.8 ul Aq. Dest.
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt:
1X g4°C 2 Minuten 35X g4°C 1 Minute
50°C 1 Minute
72°C 2 Minute 1X 72°C 10 Minuten
Das 1773 Bp Amplifikat wurde unter Verwendung von Standardmethoden in den PCR- Klonierungsvektor pCR 2.1 (Invitrogen) kloniert und das Plasmid pEPSPS erhalten.
Sequenzierung des Klons pEPSPS bestätigte eine Sequenz, die sich lediglich durch zwei Deletion (Basen ctaagtttcagga in Position 46-58 der Sequenz M3702g; Basen aaaaatat in Position 1422-142g der Sequenz M3702g) und die Basenaustausche (T statt G in Position 1447 der Sequenz M3702g; A statt C in Position 1525 der Sequenz M3702g; A statt G in Position 1627 der Sequenz M3702g) von der publizierten EPSPS- Sequenz (Datenbankeintrag M3702g: Nukleotidregion 7-1787) unterscheidet. Die zwei Deletionen and die zwei Basenaustausche an den Positionen 1447 und 1627 der Sequenz M3702g wurden in einem unabhängigen Amplifikationsexperiment reproduziert und repräsentieren somit die tatsächliche Nukleotidsequenz in den verwendeten Petunia hybrida Pflanzen.
Der Klon pEPSPS wurde daher für die Klonierung in den Expressionsvektor pJONPI g6 (in Beispiel 6 beschrieben) verwendet.
Die Klonierung erfolgte durch Isolierung des 1763 Bp Sacl-Hindlll Fragmentes aus pEPSPS und Ligierung in den Sacl-Hindlll geschnittenen Vektor pJONPI 6. Der Klon, der den Promoter EPSPS anstelle des ursprünglichen Promoters d35S enthält, heisst pJOESP:NP196. Diese Expressionskassette enthält das Fragment NP196 in der korrekten Orientierung als N-terminale Fusion mit dem rbcS-Transitpeptid.
Die Herstellung eines Expressionsvektors für die Agrobacterium-vermittelte Transfor- mation der EPSPS-kontroilierten NP196-Ketolase aus Nostoc punctiforme ATCC 29133 in L. esculentum erfolgte unter der Verwendung des binären Vektors pSUN3 (WO02/00900).
Zur Herstellung des Expressionsvektors MSP107 wurde das 2.g61 KB bp Sacl-Xhol Fragment aus pJOESP:NP1 gβ mit dem Sacl-Xhol geschnittenen Vektor pSUN3 ligiert (Abbildung g, Konstruktkarte). In der Abbildung beinhaltet Fragment EPSPS den EPSPS Promoter (1761 bp), Fragment rbcS TP FRAGMENT das rbcS Transitpeptid aus Erbse (1 g4 bp), Fragment NP196 KETO CDS (761 bp), kodierend für die Nostoc punctiforme NPigβ-Ketolase, Fragment OCS Terminator (ig2 bp) das Polyadenylie- rungssignal von Octopin-Synthase.
Die Herstellung einer Expressionsvektors für die Agrobacterium-vermittelte Transformation der EPSPS-kontrollierten NP196-Ketolase aus Nostoc punctiforme in Tagetes erecta erfolgte unter der Verwendung des binären Vektors pSUN5 (WO02/00g00).
Zur Herstellung des Expressionsvektors MSP108 wurde das 2.g61 KB bp Sacl-Xhol Fragment aus pJOESP:NPig6 mit dem Sacl-Xhol geschnittenen Vektor pSUN5 ligiert
X
(Abbildung 10, Konstruktkarte). In der Abbildung 10 beinhaltet Fragment EPSPS den EPSPS Promoter (1761 bp), Fragment rbcS TP FRAGMENTdas rbcS Transitpeptid aus Erbse (1 4 bp), Fragment NP196 KETO CDS (761 bp), kodierend für die Nostoc punctiforme NPigβ-Ketolase , Fragment OCS Terminator (192 bp) das Polyadenylierungssignal von Octopin-Synthase.
Beispiel g: Amplifikation einer DNA, die die gesamte Primärsequenz der NP1 g5-Ketolase aus Nostoc punctiforme ATCC 29133 kodiert
Die DNA, die für die NPi δ-Ketolase aus Nostoc punctiforme ATCC 29133 ' kodiert, wurde mittels PCR aus Nostoc punctiforme ATCC 29133 (Stamm der "American Type Culture Collection") amplifiziert. Die Präparation von genomischer DNA aus einer Suspensionskultur von Nostoc punctiforme ATCC 29133 wurde in Beispiel 19 beschrieben.
Die Nukleinsäure, kodierend eine Ketolase aus Nostoc punctiforme ATCC 29133, wurde mittels "polymerase chain reaction" (PCR) aus Nostoc punctiforme ATCC 29133 unter Verwendung eines sense-spezifischen Primers (NP195-1 , SEQ ID No. 67) und eines antisense-spezifischen Primers (NPig5-2 SEQ ID No. 68) amplifiziert. Die PCR-Bedingungen waren die folgenden:
Die PCR zur Amplifikation der DNA, die für ein Ketolase Protein bestehend aus der gesamten Primärsequenz kodiert, erfolgte in einem 50 ul Reaktionsansatz, in dem ent- halten war:
1 ul einer Nostoc punctiforme ATCC 29133 DNA (hergestellt wie oben beschrieben)
0.25 mM dNTPs - 0.2 mM NPig5-1 (SEQ ID No. 67) 0.2 mM NP105-2 (SEQ ID No. 68) 5 ul 10X PCR-Puffer (TAKARA) 0.25 ul R Taq Polymerase (TAKARA) 25.8 ul Aq. Dest.
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt:
1X g4°C 2 Minuten
35X 94°C 1 Minute 55°C 1 Minuten
72°C 3 Minuten 1 X 72°C 10 Minuten
Die PCR-Amplifikation mit SEQ ID No. 67 und SEQ ID No. 68 resultierte in einem 819 Bp-Fragment, das für ein Protein bestehend aus der gesamten Primärsequenz kodiert (NP195, SEQ ID No. 69). Unter Verwendung von Standardmethoden wurde das Amplifikat in den PCR-Klonierungsvektor pCR 2.1 (Invitrogen) kloniert und der Klon pNP195 erhalten.
Sequenzierung des Klons pNPi δ mit dem M13F- und dem M13R-Primer bestätigte eine Sequenz, welche mit der DNA-Sequenz von 55,604-56,3g2 des Datenbankeintrages NZ_AABC010001065 identisch ist, mit der Ausnahme, daß T in Position 55.604 durch A ersetzt wurde, um ein Standard-Startkodon ATG zu erzeugen. Diese Nukleotidsequenz wurde in einem unabhängigem Amplifikationsexperiment reprodu- ziert und repräsentiert somit die Nukleotidsequenz im verwendeten Nostoc punctiforme ATCC 29133.
Dieser Klon pNP105 wurde daher für die Klonierung in den Expressionsvektor pJO (in Beispiel 6 beschrieben) verwendet. Die Klonierung erfolgte durch Isolierung des 800 Bp Sphl-Fragmentes aus pNPigs und Ligierung in den SphI geschnittenen Vektor pJO. Der Klon, der die NPigδ-Ketolase von Nostoc punctiforme in der korrekten Orientierung als N-terminale translationale Fusion mit dem rbcS Transitpeptid enthält, heisst pJONPI 95.
Beispiel 10:
Herstellung von Expressionsvektoren zur konstitutiven Expression der NP195-Ketolase aus Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum und Tagetes erecta.
Die Expression der NP195-Ketolase aus Nostoc punctiforme in L. esculentum und in Tagetes erecta erfolgte unter Kontrolle des konstitutiven Promoters FNR (Ferredoxin- NADPH-Oxidoreductase, Datenbankeintrag AB011474 Position 70127 bis 69493; WO03/006660), aus Arabidopsis thallana. Das FNR-Gen beginnt bei Basenpaar 694g2 und ist mit "Ferredoxin-NADP+ Reductase" annotiert. Die Expression erfolgte mit dem Transitpeptid rbcS aus Erbse (Anderson et al. 1086, Biochem J. 240:700-715).
Der Klon pFNR (in Beispiel 7 beschrieben) wurde daher für die Klonierung in den Expressionsvektor pJONPI 05 (in Beispiel 10 beschrieben) verwendet.
Die Klonierung erfolgte durch Isolierung des 644 bp Sma-Hindlll Fragmentes aus pFNR und Ligierung in den Ecl136ll-Hindlll geschnittenen Vektor pJONPI 05. Der Klon, der den Promoter FNR anstelle des ursprünglichen Promoters d35S und das Fragment NPi δ in der korrekten Orientierung als N-terminale Fusion mit dem rbcS Transitpeptid enthält, heisst pJOFNR:NP195.
Die Herstellung einer Expressionskassette für die Agrobacterium vermittelte Transformation der NP195-Ketolase aus Nostoc punctiforme in L esculentum erfolgte unter der Verwendung des binären Vektors pSUN3 (WO02/00000).
Zur Herstellung des Expressionsvektors MSP100 wurde das 1.866 bp EcoRI-Xhol Fragment aus pJOFNR:NPi 5 mit dem EcoRI-Xhol geschnittenen Vektor pSUN3 li- giert (Abbildung 11 , Konstruktkarte). In "der Abbildung 11 beinhaltet Fragment FNR Promotor den FNR Promotor (635 bp), Fragment rbcS TP FRAGMENT das rbcS Transitpeptid aus Erbse (104 bp), Fragment NP195 KETO CDS (78g bp), kodierend für die Nostoc punctiforme NPi δ-Ketolase, Fragment OCS Terminator (192 bp) das Polya- denylierungssignal von der Octopin- Synthase.
Die Herstellung einer Expressionskassette für die /.grobacfer/um-vermittelte Transformation des Expressionsvektor mit der NPigδ-Ketolase aus Nostoc punctiforme punctiforme in Tagetes erecta erfolgte unter der Verwendung des binären Vektors pSUN5 (WO 02/00000).
Zur Herstellung des Tagetes-Expressionsvektors MSP110 wurde das 1.866 bp EcoRI- Xhol Fragment aus pJOFNR:NP105 mit dem EcoRI-Xhol geschnittenen Vektor pSUN5 ligiert (Abbildung 12, Konstruktkarte). In der Abbildung 12 beinhaltet Fragment FNR Promotor den FNR Promotor (635 bp), Fragment rbcS TP FRAGMENT das rbcS Transitpeptid aus Erbse (194 bp), Fragment NP195 KETO CDS (78g bp), kodierend für die Nostoc punctiforme NPi gδ-Ketolase, Fragment OCS Terminator (ig2 bp) das Polyadenylierungssignal von Octopin-Synthase.
Beispiel 11 :
Herstellung von Expressionsvektoren zur blütenspezifischen Expression der NP195- Ketolase aus Nostoc punctiforme ATCC 2gi33 in Lycopersicon esculentum und Tagetes erecta.
Die Expression der NP1 g5-Ketolase aus Nostoc punctiforme in L. esculentum und Tagetes erecta erfolgte mit dem Transitpeptid rbcS aus Erbse (Anderson et al. ig86, Biochem J. 240:700-715). Die Expression erfolgte unter Kontrolle des blütenspezifischen Promoters EPSPS aus Petunia hybrida (Datenbankeintrag M37020: Nukleotidregion 7- 1787; Benfey et al. (1990) Plant Cell 2: 840-856).
Der Klon pEPSPS (in Beispiel 8 beschrieben) wurde daher für die Klonierung in den Expressionsvektor pJONPI 95 (in Beispiel 10 beschrieben) verwendet.
Die Klonierung erfolgte durch Isolierung des 1763 Bp Sacl-Hindlll Fragmentes aus pEPSPS und Ligierung in den Sacl-Hindlll geschnittenen Vektor pJONPI 05. Der Klon, der den Promoter EPSPS anstelle des ursprünglichen Promoters d35S enthält, heisst pJOESP:NPig5. Diese Expressionskassette enthält das Fragment NPi δ in der korrekten Orientierung als N-terminale Fusion mit dem rbcS-Transitpeptid.
Die Herstellung eines Expressionsvektors für die Agrobacterium-vermittelte Transfor- mation der EPSPS-kontrollierten NP195-Ketolase aus Nostoc punctiforme ATCC 2gi33 in L. esculentum erfolgte unter der Verwendung des binären Vektors pSUN3 (WO 02/00000).
Zur Herstellung des Expressionsvektors MSP111 wurde das 2.088 KB bp Sacl-Xhol Fragment aus pJOESP:NP105 mit dem Sacl-Xhol geschnittenen Vektor pSUN3 ligiert (Abbildung 13, Konstruktkarte). In der Abbildung 13 beinhaltet Fragment EPSPS den EPSPS Promoter (1761 bp), Fragment rbcS TP FRAGMENT das rbcS Transitpeptid aus Erbse (194 bp), Fragment NP195 KETO CDS (789 bp), kodierend für die Nostoc punctiforme NPigδ-Ketolase, Fragment OCS Terminator (192 bp) das Polyadenylie- rungssignal von Octopin-Synthase.
Die Herstellung einer Expressionsvektors für die Agrobacterium-vermittelte Transformation der EPSPS-kontrollierten NPigδ-Ketolase aus Nostoc punctiforme in Tagetes erecta erfolgte unter der Verwendung des binären Vektors pSUN5 (WO02/00Θ00).
Zur Herstellung des Expressionsvektors MSP112 wurde das 2.088 KB bp Sacl-Xhol Fragment aus pJOESP:NP195 mit dem Sacl-Xhol geschnittenen Vektor pSUN5 ligiert (Abbildung 14, Konstruktkarte). In der Abbildung 14 beinhaltet Fragment EPSPS den EPSPS Promoter (1761 bp), Fragment rbcS TP FRAGMENT das rbcS Transitpeptid aus Erbse (1 g4 bp), Fragment NP195 KETO CDS (78g bp), kodierend für die Nostoc punctiforme NPigδ-Ketolase, Fragment OCS Terminator (192 bp) das Polyadenylierungssignal von Octopin-Synthase.
Beispiel 12: Amplifikation einer DNA, die die gesamte Primärsequenz der NODK-Ketolase aus No- dularia spumignea Λ/SOft 70 codiert.
Die DNA, die für die Ketolase aus Nodularia spumignea NSOR 10 kodiert, wurde mittels PCR aus Nodularia spumignea NSOR10 amplifiziert. Für die Präparation von genomischer DNA aus einer Suspensionskultur von Nodularia spumignea NSOR10 , d\e 1 Woche mit Dauerlicht und konstantem Schütteln (150 rpm) at 25°C in BG 77-Medium (1.5 g/l NaN03, 0.04 g/l K2P04x3H20, 0.075 g/l MgS04xH2O, 0.036 g/l CaCI2x2H2O, 0.006 g/l citric acid, 0.006 g/l Ferric ammonium citrate, 0.001 g/l EDTA disodium magnesium, 0.04 g/l Na2CO3, 1ml Trace Metal Mix "A5+Co" (2.86 g/l H3BO3, 1.81 g/l MnCI2x4H2o, 0.222 g/l ZnSO4x7H20, 0.30 g/l NaMoO4X2H2o, 0.070 g/l CuSO4x5H2O, 0.0404 g/l Co(NO3)2x6H2O) gewachsen war, wurden die Zellen durch Zentrifugation geerntet, in flüssigem Stickstoff eingefroren und im Mörser pulverisiert.
Protokoll für die DNA-Isolation aus Nodularia spumignea NSOR10 :
Aus einer 10 ml Flüssigkultur wurden die Bakterienzellen durch 10 minütige Zentrifugation bei 8000 rpm pelletiert. Anschließend wurden die Bakterienzellen in flüssigem Stickstoff mit einem Mörser zerstoßen und gemahlen. Das Zellmaterial wurde in 1 ml 10mM Tris HCI (pH 7.5) resuspendiert und in ein Eppendorf-Reaktionsgefäß (2ml Volumen) überführt. Nach Zugabe von 100 μl Proteinase K (Konzentration: 20 mg/ml) wurde die Zellsuspension für 3 Stunden bei 37°C inkubiert. Anschließend wurde die
X
Suspension mit 500 μl Phenol extrahiert. Nach δminütiger Zentrifugation bei 13000 upm wurde die obere, wässrige Phase in ein neues 2 ml-Eppendorf-Reaktionsgefäß überführt. Die Extraktion mit Phenol wurde 3mal wiederholt. Die DNA wurde durch Zugabe von 1/10 Volumen 3 M Natriumacetat (pH 5.2) und 0.6 Volumen Isopropanol gefällt und anschließend mit 70% Ethanol gewaschen. Das DNA-Pellet wurde bei Raumtemperatur getrocknet, in 25 μl Wasser aufgenommen und unter Erhitzung auf 65°C gelöst.
Die Nukleinsäure, kodierend eine Ketolase aus Nodularia spumignea NSOR10, wurde mittels "polymerase chain reaction" (PCR) aus Nodularia spumignea NSOR10 unter Verwendung eines sense-spezifischen Primers (NODK-1, SEQ ID No. 71) und eines antisense-spezifischen Primers (NODK-2 SEQ ID No. 72) amplifiziert.
Die PCR-Bedingungen waren die folgenden:
Die PCR zur Amplifikation der DNA, die für ein Ketolase Protein bestehend aus der gesamten Primärsequenz kodiert, erfolgte in einem 50 ul Reaktionsansatz, in dem ent- halten war: 1 ul einer Nodularia spumignea NSOR10 DNA (hergestellt wie oben beschrieben)
0.25 mM dNTPs
0.2 mM NODK-1 (SEQ ID No. 71) - 0.2 mM NODK-2 (SEQ ID No. 72) 5 ul 10X PCR-Puffer (TAKARA) 0.25 ul R Taq Polymerase (TAKARA) 25.8 ul Aq. Dest.
Die PCR wurde unter folgenden Zyklusbedingungen durchgeführt:
1X 04°C 2 Minuten 35X g4°C 1 Minute 55°C 1 Minuten 72°C 3 Minuten
1 X 72°C 10 Minuten
X
Die PCR-Amplifikation mit SEQ ID No. 71 und SEQ ID No. 72 resultierte in einem 720 Bp-Fragment, das für ein Protein bestehend aus der gesamten Primärsequenz kodiert (NODK, SEQ ID No. 73). Unter Verwendung von Standardmethoden wurde das Amplifikat in den PCR-Klonierungsvektor pCR 2.1 (Invitrogen) kloniert und der Klon pNODK erhalten.
Sequenzierung des Klons pNODK mit dem M13F- und dem M13R-Primer bestätigte eine Sequenz, welche mit der DNA-Sequenz von 2130-2810 des Datenbank-eintrages AY210783 identisch ist (inverse orientiert zum veröffentlichen Datenbankeintrag). Diese Nukleotidsequenz wurde in einem unabhängigem Amplifikationsexperiment reproduziert und repräsentiert somit die Nukleotidsequenz im verwendeten Nodularia spumignea NSOR10.
Dieser Klon pNODK wurde daher für die Klonierung in den Expressionsvektor pJO (in Beispiel 6 beschrieben) verwendet. Die Klonierung erfolgte durch Isolierung des 710 Bp Sphl-Fragmentes aus pNODK und Ligierung in den SphI geschnittenen Vektor pJO. Der Klon, der die NODK-Ketolase von Nodularia spumignea in der korrekten Orientie- rung als N-terminale translationale Fusion mit dem rbcS Transitpeptid enthält, heisst pJONODK.
Beispiel 13: Herstellung von Expressionsvektoren zur konstitutiven Expression der NODK-Ketolase aus Nodularia spumignea NSOR10 in Lycopersicon esculentum und Tagetes erecta.
Die Expression der NODK-Ketolase aus Nodularia spumignea NSOR10 in L. esculentum und in Tagetes erecta erfolgte unter Kontrolle des konstitutiven Promoters FNR (Ferredoxin-NADPH- Oxidoreductase, Datenbankeintrag AB011474 Position 70127 bis 60403; WO03/006660), aus Arabidopsis thallana. Das FNR-Gen beginnt bei Basenpaar 604g2 und ist mit "Ferredoxin-NADP+ Reductase" annotiert. Die Expression erfolgte mit dem Transitpeptid rbcS aus Erbse (Anderson et al. ig86, Biochem J. 240:700-715).
Der Klon pFNR (in Beispiel 7 beschrieben) wurde daher für die Klonierung in den Expressionsvektor pJONODK (in Beispiel 12 beschrieben) verwendet.
X
Die Klonierung erfolgte durch Isolierung des 644 bp Sma-Hindlll Fragmentes aus pFNR und Ligierung in den Ecl136ll-Hindlll geschnittenen Vektor pJONODK. Der Klon, der den Promoter FNR anstelle des ursprünglichen Promoters d35S und das Fragment NODK in der korrekten Orientierung als N-terminale Fusion mit dem rbcS Transitpeptid enthält, heisst pJOFNR:NODK.
Die Herstellung einer Expressionskassette für die Agrobacterium vermittelte Transformation der NODK-Ketolase aus Nodularia spumignea NSOR10 in L. esculentum erfolgte unter der Verwendung des binären Vektors pSUN3 (WO02/00Θ00).
Zur Herstellung des Expressionsvektors MSP113 wurde das 1.767 bp EcoRI-Xhol Fragment aus pJOFNR:NODK mit dem EcoRI-Xhol geschnittenen Vektor pSUN3 ligiert (Abbildung 15, Konstruktkarte). In der Abbildung 15 beinhaltet Fragment FNR Promotor den FNR Promotor (635 bp), Fragment rbcS TP FRAGMENT das rbcS Transitpeptid aus Erbse (104 bp), Fragment NODK KETO CDS (600 bp), kodierend für die Nodularia spumignea NSOR10 NODK-Ketolase, Fragment OCS Terminator (102 bp) das Polya- denylierungssignal von der Octopin- Synthase. Die Herstellung einer Expressionskassette für die /4grobactet/um-vermittelte Transformation des Expressionsvektor mit der NODK-Ketolase aus Nodularia spumignea NSOR10 punctiforme in Tagetes erecta erfolgte unter der Verwendung des binären Vektors pSUN5 (WO02/00900).
Zur Herstellung des Tagetes- Expressionsvektors MSP114 wurde das 1.767 bp EcoRI- Xhol Fragment aus pJOFNR:NODK mit dem EcoRI-Xhol geschnittenen Vektor pSUN5 ligiert (Abbildung 16, Konstruktkarte). In der Abbildung 16 beinhaltet Fragment FNR Promotor den FNR Promotor (635 bp), Fragment rbcS TP FRAGMENT das rbcS Tran- sitpeptid aus Erbse (194 bp), Fragment NODK KETO CDS (6gθ bp), kodierend für die Nodularia spumignea NSOR10 NODK-Ketolase, Fragment OCS Terminator (102 bp) das Polyadenylierungssignal von Octopin-Synthase.
Beispiel 14: Herstellung von Expressionsvektoren zur blütenspezifischen Expression der NODK- Ketolase aus Nodularia spumignea NSORW ln Lycopersicon esculentum und Tagetes erecta.
Die Expression der NODK-Ketolase aus Nodularia spumignea NSOR10 \n L. esculen- tum und Tagetes erecta erfolgte mit dem Transitpeptid rbcS aus Erbse (Anderson et al: 1086, Biochem J. 240:709-715). Die Expression erfolgte unter Kontrolle des blütenspezifischen Promoters EPSPS aus Petunia hybrida (Datenbankeintrag M37029: Nukleotidregion 7-1787; Benfey et al. (1990) Plant Cell 2: 840-856).
Der Klon pEPSPS (in Beispiel 8 beschrieben) wurde daher für die Klonierung in den Expressionsvektor pJONODK (in Beispiel 12 beschrieben) verwendet.
Die Klonierung erfolgte durch Isolierung des 1763 Bp Sacl-Hindlll Fragmentes aus pEPSPS und Ligierung in den Sacl-Hindlll geschnittenen Vektor pJONODK. Der Klon, der den Promoter EPSPS anstelle des ursprünglichen Promoters d35S enthält, heisst pJOESP:NODK. Diese Expressionskassette enthält das Fragment NODK in der korrekten Orientierung als N-terminale Fusion mit dem rbcS-Transitpeptid.
Die Herstellung eines Expressionsvektors für die Agrobacterium-vermittelte Transfor- mation der EPSPS-kontrollierten NODK-Ketolase aus Nodularia spumignea NSOR10 in L. esculentum erfolgte unter der Verwendung des binären Vektors pSUN3 (WO 02/00000).
Zur Herstellung des Expressionsvektors MSP115 wurde das 2.889 KB bp Sacl-Xhol Fragment aus pJOESP:NODK mit dem Sacl-Xhol geschnittenen Vektor pSUN3 ligiert (Abbildung 17, Konstruktkarte). In der Abbildung 17 beinhaltet Fragment EPSPS den EPSPS Promoter (1761 bp), Fragment rbcS TP FRAGMENT das rbcS Transitpeptid aus Erbse (194 bp), Fragment NODK KETO CDS (690 bp), kodierend für die Nodularia spumignea NSOR 10 NODK-Ketolase, Fragment OCS Terminator (102 bp) das Polya- denylierungssignal von Octopin-Synthase.
Die Herstellung einer Expressionsvektors für die Agrobacterium-vermittelte Transformation der EPSPS-kontrollierten NODK-Ketolase aus Nodularia spumignea NSOR10 in Tagetes erecta erfolgte unter der Verwendung des binären Vektors pSUN5 (WO02/00Θ00).
Zur Herstellung des Expressionsvektors MSP116 wurde das 2.880 KB bp Sacl-Xhol
X
Fragment aus pJOESP:NODK mit dem Sacl-Xhol geschnittenen Vektor pSUN5 ligiert (Abbildung 18, Konstruktkarte). In der Abbildung 18 beinhaltet Fragment EPSPS den EPSPS Promoter (1761 bp), Fragment rbcS TP FRAGMENT 'das rbcS Transitpeptid aus Erbse (104 bp), Fragment NODK KETO CDS (600 bp), kodierend für die Nodularia spumignea NSOR10 NODK-Ketolase, Fragment OCS Terminator (102 bp) das Polyadenylierungssignal von Octopin-Synthase.
Beispiel 15:
Herstellung transgener Lycopersicon esculentum Pflanzen
Transformation und Regeneration von Tomatenpflanzen erfolgte nach der publizierten Methode von Ling und Mitarbeitern (Plant Cell Reports (1998), 17:843-847). Für die Varietät Microtom wurde mit höherer Kanamycin-Konzentration (100mg/L) selektioniert.
Als Ausgangsexplantat für die Transformation dienten Kotyledonen und Hypokotyle sieben bis zehn Tage alter Keimlinge der Linie Microtom. Für die Keimung wurde das Kulturmedium nach Murashige und Skoog (1062: Murashige and Skoog, 1062, Physiol. Plant 15, 473-) mit 2% Saccharose, pH 6,-1 verwendet. Die Keimung fand bei 21 °C bei wenig Licht (20 - 100 μE) statt. Nach sieben bis zehn Tagen wurden die Kotyledonen quer geteilt und die Hypokotyle in ca. 5 - 10 mm lange Abschnitte geschnitten und auf das Medium MSBN (MS, pH 6,1, 3% Saccharose + 1 mg/l BAP, 0,1 mg/l NAA) gelegt, das am Vortag mit suspensionskultivierten Tomatenzellen beschickt wurde. Die Tomatenzellen wurden luftblasenfrei mit sterilem Filterpapier abgedeckt. Die Vorkultur der Explantate auf dem beschriebenen Medium erfolgte für drei bis fünf Tage. Zellen des Stammes Agrobakterium tumefaciens LBA4404 wurden einzeln mit den Plasmiden pS3FNR:NOST,pS3AP3:NOST, pS3FNR:NP106, pS3EPS:NP106, pS3FNR:NP105, pS3EPS:NP105, pS3FNR:NODK und pS3EPS:NODK transformiert. Von den einzelnen mit den Binärvektoren pS3FNRNOST,pS3AP3NOST, pS3FNR:NP106, pS3EPS:NP106, pS3FNR:NP195, pS3EPS:NP195, pS3FNR:NODK und pS3EPS:NODK transformierten Agrobakterium-Stämmen wurde jeweils eine Übernachtkultur in YEB Medium mit Kanamycin (20 mg/l) bei 28 °C kultiviert und die Zellen zentrifugiert.Das Bakterienpellet wurde mit flüssigem MS Medium (3% Saccharose, pH 6,1 ) resuspendiert und auf eine optische Dichte von 0,3 (bei 600 nm) eingestellt. Die vorkultivierten Explantate wurden in die Suspension überführt und für 30 Minuten bei Zimmertemperatur unter leichtem Schütteln inkubiert. Anschließend wurden die Explantate mit sterilem Filterpapier getrocknet und für die dreitägige Co-Kultur (21 °C) auf ihr Vorkulturmedium zurück gelegt.
Nach der Co-kultur wurden die Explantate auf MSZ2 Medium (MS pH 6,1 + 3% Saccharose, 2 mg/l Zeatin, 100 mg/l Kanamycin, 160 mg/l Timentin) transferiert und für die selektive Regeneration bei 21 °C unter Schwachlicht Bedingungen (20 - 100 μE, Lichtrhythmus 16h/8h) aufbewahrt. Aller zwei bis drei Wochen erfolgte der Transfer der Explantate bis sich Sprosse bilden. Kleine Sprosse konnten vom Explantat abgetrennt werden und auf MS (pH 6,1 + 3% Saccharose) 160 mg/l Timentin, 30 mg/l Kanamycin, 0,1 mg/l IAA bewurzelt werden. Bewurzelte Pflanzen wurden ins Gewächshaus überführt.
Gemäß der oben beschriebenen Transformationsmethode wurden mit folgenden Ex- pressionskonstrukten folgende Linien erhalten:
Mit pS3FNR:NOST wurde erhalten: MSP101-1 , MSP101-2, MSP101-3
Mit pS3AP3:NOST wurde erhalten: MSP103-1 , MSP103-2, MSP103-3 Mit pS3FNR:NP106 wurde erhalten: MSP105-1 , MSP105-2, MSP105-3
Mit pS3EPS:NP196 wurde erhalten: MSP107-1 , MSP107-2, MSP107-3
Mit pS3FNR:NP105 wurde erhalten: MSP100-1 , MSP100-2, MSP100-3
Mit pS3EPS:NP105 wurde erhalten: MSP111-1 , MSP111 -2, MSP111 -3
Mit pS3FNR:NODK wurde erhalten: MSP113-1 , MSP113-2, MSP113-3
Mit pS3EPS:NODK wurde erhalten: MSP115-1 , MSP115-2, MSP115-3
Beispiel 16:
Herstellung transgener Tagetes Pflanzen
Tagetessamen werden sterilisiert und auf Keimungsmedium (MS-Medium; Murashige and Skoog, Physiol. Plant. 15(1062), 473-407) pH 5,8, 2% Saccharose) aufgelegt. Die Keimung erfolgt in einem Temperatur/Licht/Zeitintervall von 18-28°C/20-200 μE/3 - 16 Wochen, bevorzugt jedoch bei 21 °C, 20-70 μE, für 4-8 Wochen.
Alle Blätter der sich bis dahin entwickelten in vitro Pflanzen werden geerntet und quer zur Mittelrippe geschnitten. Die dadurch entstehenden Blattexplantate mit einer Größe von 10 - 60 mm2 werden im Verlaufe der Präparation in flüssigem MS - Medium bei Raumtemperatur für maximal 2 h aufbewahrt.
Ein beliebiger Agrobakterium tumefaciens Stamm, bevorzugt aber ein supervirulenter Stamm, wie z.B. EHA105 mit einem entsprechenden Binärplasmid, das ein Selekti- onsmarkergen (bevorzugt bar oder pat) sowie ein oder mehrere Trait- oder Reportergene tragen kann wird (pS5FNR:NOST,pS5AP3:NOST pS5FNR:NP106, pS5EPS:NP196, pS5FNR:NP1 5, pS5EPS:NP1 g5, pS5FNR:NODK und pS5EPS:NODK), über Nacht angezogen und für die Co-Kultivierung mit dem Blattmaterial verwendet. Die Anzucht des Bakterienstammes kann wie folgt erfolgen: Eine Einzelkolonie des entsprechenden Stammes wird in YEB (0,1 % Hefeextrakt, 0,5 % Rindfleischextrakt, 0,5 % Pepton, 0,5 % Saccharose, 0,5 % Magnesiumsulfat x 7 H20) mit 25 mg/l Kanamycin angeimpft und bei 28°C für 16 bis 20 h angezogen. Anschließend wird die Bakteriensuspension durch Zentrifugation bei 6000 g für 10 min geerntet und derart in flüssigem MS Medium resuspendiert, daß eine OD600 von ca. 0,1 bis 0,8 entstand. Diese Suspension wird fuer die C-Kultivierung mit dem Blattmateria! verwendet.
Unmittelbar vor der Co-Kultivierung wird das MS-Medium, in dem die Blätter aufbe- wahrt worden sind, durch die Bakteriensuspension ersetzt. Die Inkubation der Blättchen in der Agrobakteriensuspension erfolgte für 30 min unter leichtem Schütteln bei Raumtemperatur. Anschließend werden die infizierten Explantate auf ein mit Agar (z.B. 0,8 % Plant Agar (Duchefa, NL) verfestigtes MS-Medium mit Wachstumsregulatoren, wie beispielsweise 3 mg/l Benzylaminopurin (BAP) sowie 1 mg/l Indolylessigsäure (IAA) aufgelegt. Die Orientierung der Blätter auf dem Medium ist bedeutungslos. Die Kultivierung der Explantate findet für 1 bis 8 Tage, bevorzugt aber für 6 Tage statt, dabei können folgende Bedingungen angewendet werden: Lichtintensität: 30 - 80 - μMol/m2 x sec, Temperatur: 22 - 24°C, hell/dunkel Wechsel von 16/8 Stunden. Anschließend werden die co-kultivierten Explantate auf frisches MS-Medium, bevorzugt mit den gleichen Wachstumsregulatoren übertragen, wobei dieses zweite Medium zusätzlich ein Antibiotikum zur Unterdrückung des Bakterienwachstums enthält. Timentin in einer Konzentration von 200 bis 500 mg/l ist für diesen Zweck sehr geeignet. Als zweite selektive Komponente wird eine für die Selektion des Transformationserfolges eingesetzt. Phosphinothricin in einer Konzentration von 1 bis'5 mg/l selektiert sehr effi- zient, aber auch andere selektive Komponenten gemäß des zu verwendenden Verfahrens sind denkbar.
Nach jeweils ein bis drei Wochen erfolgt der Transfer der Explantate auf frisches Medium bis sich Sproßknospen und kleine Sprosse entwickeln, die dann auf das gleiche Basalmedium einschließlich Timentin und PPT oder alternative Komponenten mit Wachstumsregulatoren, nämlich z.B. 0,5 mg/l Indolylbuttersäure (IBA) und 0,5 mg/l Gibberillinsäure GA3, zur Bewurzelung übertragen werden. Bewurzelte Sprosse können ins Gewächshaus überführt werden.
Zusätzlich zu der beschriebenen Methode sind folgende vorteilhafte Modifikationen möglich:
Bevor die Explantate mit den Bakterien infiziert werden, können sie für 1 bis 12 Tage, bevorzugt 3 - 4, auf das oben beschriebene Medium für die Co-Kultur vorinkubiert werden. Anschließend erfolgt die Infektion, Co-Kultur und selektive Regeneration wie oben beschrieben.
Der pH Wert für die Regeneration (normalerweise 5,8) kann auf pH 5,2 gesenkt wer- den. Dadurch wird die Kontrolle des Agrobakterienwachstums verbessert.
Die Zugabe von AgNO3 (3 - 10 mg/l) zum Regenerationsmedium verbessert den Zustand der Kultur einschließlich der Regeneration selbst.
Komponenten, die die Phenolbildung reduzieren und dem Fachmann bekannt sind, wie z.B. Zitronensäure, Ascorbinsäure, PVP u.v.a.m., wirken sich positiv auf die Kultur aus.
Für das gesamte Verfahren kann auch flüssiges Kulturmedium Verwendung finden. Die Kultur kann auch auf handelsüblichen Trägern, die auf dem flüssigen Medium positio- niert werden inkubiert werden.
Gemäß der oben beschriebenen Transformationsmethode wurden mit folgenden Ex- pressionskonstrukten folgende Linien erhalten:
Mit pS5FNR:NOST wurde beispielsweise erhalten: MSP102-1 , MSP102-2, MSP102-3,
Mit pS5AP3:NOST wurde beispielsweise erhalten: MSP104-1 , MSP104-2, MSP104-3
Mit pS5FNR:NP106 wurde erhalten: MSP106-1 , MSP106-2, MSP106-3
Mit pS5EPS:NP106 wurde erhalten: MSP108-1 , MSP108-2, MSP108-3
Mit pS5FNR:NP105 wurde erhalten: MSP110-1 , MSP110-2, MSP110-3
Mit pS5EPS:NP105 wurde erhalten: MSP112-1 , MSP1 12-2, MSP112-3
Mit pS5FNR:NODK wurde erhalten: MSP114-1 , MSP114-2, MSP114-3
Mit pS5EPS:NODK wurde erhalten: MSP116-1 , MSP116-2, MSP116-3 Beispiel 17
Charakterisierung der transgenen Pflanzenblüten
Beispiel 9.1 Trennung von Carotinoidestem in Blütenblättern transgener Pflanzen
Allgemeine Arbeitsvorschrift:
Die Blütenblätter der transgenen Pflanzen werden in flüssigem Stickstoff gemörsert und das Petalenpulver (etwa 40 mg) mit 100% Aceton extrahiert (dreimal je 500 ul). Das Lösungsmittel wird evaporiert und die Carotinoide in 100-200 ul Petrolether/Aceton (5:1 , v/v) resuspendiert.
Die Carotinoide werden in konzentrierter Form mittels Dünnschicht-Chromatographie (TLC) auf SilicaβO F254- Platten (Merck) in einem organischen Lauf mittel (Petrolether/Aceton; 5:1) entsprechend ihrer Phobizität aufgetrennt. Gelbe (Xanthophyllester), rote (Ketocarotinoidester) und orange Banden (Mischung aus Xanthophyll- und Ketoca- rotinoidestern)auf der TLC werden ausgekratzt.
Die an Silica gebundenen Carotinoide werden dreimal mit 500 ul Aceton eluiert, das Lösungsmittel evaporiert und die Carotinoide mittels HPLC aufgetrennt und identifiziert.
Mittels einer C30-reverse phase-Säule kann zwischen Mono- und Diestem der Carotinoide unterschieden werden. HPLC-Laufbedingungen waren nahezu identisch mit ei- ner publizierten Methode (Frazer et al.(2000), Plant Journal 24(4): 551-558). Folgende Verfahrensbedingungen wurden eingestellt.
Trennsäule: Prontosil C30-Säule, 250 x 4,6 mm, (Bischoff, Leonberg) Flussrate: 1.0 ml/min Eluenten: Lauf mittel A - 100% Methanol
Laufmittel B - 80% Methanol, 0.2% Ammoniumacetat Lauf mittel C - 100% t-Butyl-methylether Gradientprofil:
Detektion: 300 - 500 nm
Eine Identifizierung der Carotinoide ist aufgrund der UV-VIS-Spektren möglich.
Petalenmaterial der transgenen Tomatenpflanzen wird gemörsert und mit Aceton extrahiert. Extrahierte Carotinoide werden mittels TLC aufgetrennt. In den Linien können
X
Mono- und Diester von Ketocarotinoiden detektiert werden; die Monoester sind in deut- lieh geringerer Konzentration als die Diester vorhanden.
Beispiel 18
Enzymatische Hydrolyse von Carotinoidestem und Identifizierung der Carotinoide
Allgemeine Arbeitsvorschrift
Gemörsertes Petalenmaterial (30-100 mg Frischgewicht) wird mit 100% Aceton (dreimal 500ul; jeweils etwa 15 Minuten schütteln) extrahiert. Das Lösungsmittel wird evaporiert. Carotinoide werden anschließend in 405 ul Aceton aufgenommen, 4,95 ml Ka- lium-phosphatpuffer (100 mM, pH7.4) zugegeben und gut gemischt. Danach erfolgt die Zugabe von ca. 17 mg Bile-Salze (Sigma) und 140 μl einer NaCI/CaCI2-Lösung (3M NaCI und 75 mM CaCI2). Die Suspension wird für 30 Minuten bei 37C inkubiert. Für die enzymatische Hydrolyse der Carotinoidester wird 505 μl einer Lipaselösung (50 mg/ml Lipase Typ7 von Candida rugosa(Sigma)) zugegeben und unter Schütteln bei 37C inkubiert. Nach etwa 21 Stunden erfolgte nochmals eine Zugabe von 595 μl Lipase mit erneuter Inkubation von mindestens 5 Stunden bei 37C. Anschließend werden etwa ca. 700 mg Na2SO4x10H20 in der Lösung gelöst. Nach Zugabe von 1800 μl Petrolether werden die Carotinoide durch kräftig Mischen in die organische Phase extrahiert. Dieses Ausschütteln wird solange wiederholt, bis die organische Phase frablos bleibt. Die Petroletherfraktionen werden vereinigt und der Petrolether evaporiert. Freie Carotinoide werden in 100-120 ul Aceton aufgenommen. Mittels HPLC und C30- reverse phase-Säuie können freie Carotinoide aufgrund von Retentionszeit und UV- VlS-Spektren identifiziert werden.

Claims

Patentansprüche
1. Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen, die im Vergleich zum Wildtyp eine veränderte Ketolase-Aktivität aufweisen, und die veränderte Ketolase-Aktivität durch eine Ketolase verursacht wird, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
2. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass man Organismen - verwendet, die als Wildtyp bereits eine Ketolase-Aktivität aufweisen, und die genetische Veränderung eine Erhöhung der Ketolase-Aktivität im Vergleich zum Wildtyp bewirkt.
3. Verfahren nach Anspruch 2, dadurch gekennzeichnet, dass man zur Erhöhung der Ketolase-Aktivität die Genexpression einer Nukleinsäure, kodierend'eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf
Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, gegenüber dem Wildtyp erhöht.
4. Verfahren nach Anspruch 3, dadurch gekennzeichnet, dass man zur Erhöhung der Genexpression Nukleinsäuren in den Organismus einbringt, die Ketolasen kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
5. Verfahren nach Anspruch 1 , dadurch gekennzeichnet, dass man Organismen verwendet, die als Wildtyp keine Ketolase-Aktivität aufweisen und die genetische Veränderung eine Ketolase-Aktivität im Vergleich zum Wildtyp verursacht.
6. Verfahren nach Anspruch 5, dadurch gekennzeichnet, dass man genetisch ver- änderte Organismen verwendet, die transgen eine Ketolase, enthaltend die Ami-
Fig/Seq nosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, exprimieren.
7. Verfahren nach Anspruch 5 oder 6, dadurch gekennzeichnet, dass man zur Verursachung der Genexpression Nukleinsäuren in die Organismen einbringt, die Ketolasen kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Amino- säuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
8. Verfahren nach Anspruch 5 oder 7, dadurch gekennzeichnet, dass man Nukleinsäuren, enthaltend die Sequenz SEQ. ID. NO. 1 einbringt.
0. Verfahren nach einem der Ansprüche 1 bis 8, dadurch gekennzeichnet, dass die Organismen zusätzlich gegenüber dem Wildtyp eine erhöhte Aktivität mindestens einer der Aktivitäten, ausgewählt aus der Gruppe Hydroxylase-Aktivität und ß-Cyclase-Aktivität, aufweisen.
10. Verfahren nach Anspruch 0, dadurch gekennzeichnet, dass man zur zusätzlichen Erhöhung mindestens einer der Aktivitäten, die Genexpression mindestens einer Nukleinsäure ausgewählt aus der Gruppe Nukleinsäuren, kodierend eine Hydroxylase, und Nukleinsäuren, kodierend eine ß-Cyclase, gegenüber dem Wildtyp erhöht.
11. Verfahren nach Anspruch 10, dadurch gekennzeichnet, dass man zur Erhöhung der Genexpression mindestens eine Nukleinsäure ausgewählt aus der Gruppe, Nukleinsäuren kodierend eine Hydroxylase und Nukleinsäuren kodierend eine ß- Cyclase in den Organismus einbringt.
12. Verfahren nach Anspruch 11 , dadurch gekennzeichnet, dass man als Nukleinsäure, kodierend eine Hydroxylase, Nukleinsäuren einbringt, die eine Hydroxylase kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 16 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 20 % auf Aminosäureebene mit der Sequenz SEQ ID NO: 16 aufweist.
13. Verfahren nach Anspruch 12, dadurch gekennzeichnet, dass man Nukleinsäuren, enthaltend die Sequenz SEQ ID NO: 15 einbringt.
14. Verfahren nach Anspruch 11, dadurch gekennzeichnet, dass man als Nukleinsäure, kodierend eine ß-Cyclase, Nukleinsäuren einbringt, die eine ß-Cyclase kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 18 oder eine von die- ser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 20 % auf Aminosäureebene mit der Sequenz SEQ ID NO: 18 aufweist.
15. Verfahren nach Anspruch 14, dadurch gekennzeichnet, dass man Nukleinsäuren, enthaltend die Sequenz SEQ ID NO: 17 einbringt.
16. Verfahren nach einem der Ansprüche 1 bis 15, dadurch gekennzeichnet, dass man nach dem Kultivieren die genetisch veränderten Organismen erntet und anschließend die Ketocarotinoide aus den Organismen isoliert.
17. Verfahren nach einem der Ansprüche 1 bis 16, dadurch gekennzeichnet daß man als Organismus einen Organismus verwendet, der als Ausgangsorganismus natürlicherweise oder durch genetische Komplementierung oder Umregulie- rung von Stoffwecheselwegen in der Lage ist, Carotinoide herzustellen.
18. Verfahren nach einem der Ansprüche 1 bis 17, dadurch gekennzeichnet, daß man als Organismen Mikroorganismen oder Pflanzen verwendet.
10. Verfahren nach Anspruch 18, dadurch gekennzeichnet, daß man als Mikroorga- nismen Bakterien, Hefen, Algen oder Pilze verwendet.
20. Verfahren nach Anspruch 10, dadurchgekennzeichnet, daß die Mikroorganismen ausgwählt sind aus der Gruppe Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Paracoccus, Nostoc, Cyanobakterien der Gattung Synecho- cystis, Candida, Saccharomyces, Hansenula, Phaffia, Pichia, Aspergillus, Tri- choderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium, Haematococcus, Phaedactylum tricornatum, Volvox oder Dunaliella.
21. Verfahren nach Anspruch 18, dadurch gekennzeichnet, daß man als Organis- mus Pflanzen verwendet.
22. Verfahren nach Anspruch 21 , dadurch gekennzeichnet, dass man als Pflanze eine Pflanze, ausgewählt aus den Familien Ranunculaceae, Berberidaceae, Pa- paveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Brassi- ceae, Cucurbitaceae, Pri ulaceae, Caryophyllaceae, Amaranthaceae, Gentia- naceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Orchida- ceae, Malvaceae, liliaceae oder Lamiaceae verwendet.
23. Verfahren nach Anspruch 22, dadurch gekennzeichnet, dass man als Pflanze eine Pflanze, ausgewählt aus den Pflanzengattungen Marigold, Tagetes erecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus, Bignonia, Calenduia, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphini- um, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia,
Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Laburnum, Lathyrus, Leonto- don, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimu- lus, Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma,
Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ulex, Viola oder Zinnia verwendet.
24. Verfahren nach einem der Ansprüche 1 bis 23, dadurch gekennzeichnet, dass die Ketocarotinoide ausgewählt sind aus der Gruppe Astaxanthin, Canthaxanthin, Echinenon, 3-Hydroxyechinenon, 3'-Hydroxyechinenon, Adonirubin und Adonixanthin.
25. Genetisch veränderter Organismus, wobei die genetische Veränderung die Aktivität einer Ketolase
A für den Fall, dass der Wildtyporganismus bereits eine Ketolase-Aktivität auf- weist, gegenüber dem Wildtyp erhöht und
B für den Fall, dass der Wildtyporganismus keine Ketolase-Aktivitätaufweist, gegenüber dem Wildtyp verursacht
und die nach A erhöhte oder nach B verursachte Ketolase-Aktivität durch eine
Ketolase verursacht wird, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
26. Genetisch veränderter Organismus nach Anspruch 25, dadurch gekennzeichnet, dass die Erhöhung oder Verursachung der Ketolase-Aktivität durch eine Erhöhung oder Verursachung der Genexpression einer Nukleinsäure, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von die- ser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, gegenüber dem Wildtyp bewirkt wird.
27. Genetisch veränderter Organismuse nach Anspruch 26, dadurch gekennzeich- net, dass man zur Erhöhung oder Verursachung der Genexpression Nukleinsäuren in den Organismus einbringt, die Ketolasen kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
28. Genetisch veränderter Organismus, enthaltend mindestens eine transgene Nukleinsäure, kodierend eine Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
29. Genetisch veränderter Organismus, enthaltend mindestens zwei endogene Nuk- leinsäuren, kodierend eine Ketolase, enthaltend die Aminosäuresequenz
SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 42 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist.
30. Genetisch veränderter Organismus nach einem der Ansprüche 25 bis 20, dadurch gekennzeichnet, dass die genetische Veränderung zusätzlich mindestens eine der Aktivitäten, ausgewählt aus der Gruppe Hydroxlase-Aktivität und ß- Cyclase-Aktivität gegenüber dem Wildtypp erhöht.
31. Genetisch veränderter Organismus nach einem der Ansprüche 25 bis 30, dadurch gekennzeichnet daß er als Ausgangsorganismus natürlicherweise ode durch genetische Komplementierung in der Lage ist, Carotinoide herzustellen.
32. Genetisch veränderter Organismus nach einem der Ansprüche 25 bis 31 , aus- gewählt aus der Gruppe Mikroorganismen oder Pflanzen.
33. Genetisch veränderter Mikroorganismus nach Anspruch 32, dadurch gekennzeichnet, daß die Mikroorganismen ausgewählt sind aus der Gruppe Bakterien, Hefen, Algen oder Pilze.
34. Genetisch veränderter Mikroorganismus nach Anspruch 33, dadurch gekennzeichnet, daß die Mikroorganismen ausgwählt sind aus der Gruppe Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Paracoccus, Nostoc, Cya- nobakterien der Gattung Synechocystis, Candida, Saccharomyces, Hansenula, Pichia, Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces,
Fusahum, Haematococcus, Phaedactylum tricomatum, Volvox oder Dunaliella.
35. Genetisch veränderte Pflanze nach Anspruch 32, dadurch gekennzeichnet, dass die Pflanzen ausgewählt sind aus den Familien Ranuncuiaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Bras- siceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Orchidaceae, Malvaceae, liliaceae oder Lamiaceae verwendet.
36. Genetisch veränderte Pflanze nach Anspruch 35, dadurch gekennzeichnet, dass Pflanzen ausgewählt sind aus den Pflanzengattungen Marigold, Tagetes erecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus, Bignonia, Calenduia, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphini- um, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Labumum, Lathyrus, Leonto- don, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma,
X'
Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Siiphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ulex, Viola oder Zinnia verwendet.
37. Verwendung der genetisch veränderten Organismen nach einem der Ansprüche 25 bis 36 als Futter- oder Nahrungsmittel.
38. Verwendung der genetisch veränderten Organismen nach einem der Ansprüche 25 bis 36 zur Herstellung von Ketocarotinoid-haltigen Extrakten oder zur Herstellung von Futter- und Nahrungsergänzungsmittel.
30. Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 8 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abge- leitete Sequenz, die eine Identität von mindestens 70 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 8 aufweist, mit der Maßgabe, dass die Aminosäuresequenzen SEQ ID NO: 4 nicht enthalten ist.
40. Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 6 oder eine von die- ser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abge- leitete Sequenz, die eine Identität von mindestens 70 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 6 aufweist.
41. Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 12 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 12 aufweist, mit der Maßgabe, dass die Aminosäuresequenzen SEQ ID NO: 6 nicht enthalten ist.
42. Ketolase, enthaltend die Aminosäuresequenz SEQ. ID. NO. 40 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren, abgeleitete Sequenz, die eine Identität von mindestens 50 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 40 aufweist, mit der Maßgabe, dass die Aminosäuresequenzen SEQ ID NO: 47 nicht enthalten ist.
43. Nukleinsäure, kodierend ein Protein gemäß einem der Ansprüche 30 bis 42, mit
X der Maßgabe, dass die Sequenz SEQ ID NO: 5 nicht enthalten ist.
44. Verwendung eines Proteins, enthaltend die Aminosäuresequenz SEQ. ID. NO. 4 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von
Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 70 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 4 und die Eigenschaft einer Ketolase aufweist, als Ketolase.
45. Verwendung eines Proteins, enthaltend die Aminosäuresequenz SEQ. ID. NO. 6 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 65 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 6 und die Eigenschaft einer Ketolase aufweist, als Ketolase.
46. Verwendung eines Proteins, enthaltend die Aminosäuresequenz SEQ. ID. NO. 47 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 50 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 47 und die Eigenschaft einer Ketolase aufweist, als Ketolase.
EP03792348A 2002-08-20 2003-08-18 Verfahren zur herstellung von ketocarotinoiden in genetisch veränderten organismen Withdrawn EP1532265A2 (de)

Applications Claiming Priority (11)

Application Number Priority Date Filing Date Title
DE10238979 2002-08-20
DE10238979A DE10238979A1 (de) 2002-08-20 2002-08-20 Verfahren zur Herstellung von Zeaxanthin und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten
DE10238978A DE10238978A1 (de) 2002-08-20 2002-08-20 Verfahren zur Herstellung von Ketocarotinoiden in Früchten von Pflanzen
DE2002138980 DE10238980A1 (de) 2002-08-20 2002-08-20 Verfahren zur Herstellung von Ketocarotinoiden in Blütenblättern von Pflanzen
DE10238978 2002-08-20
DE10238980 2002-08-20
DE2002153112 DE10253112A1 (de) 2002-11-13 2002-11-13 Verfahren zur Herstellung von Ketocarotinoiden in genetisch veränderten Organismen
DE10253112 2002-11-13
DE2002158971 DE10258971A1 (de) 2002-12-16 2002-12-16 Verwendung von astaxanthinhaltigen Pflanzen oder Pflanzenteilen der Gattung Tagetes als Futtermittel
DE10258971 2002-12-16
PCT/EP2003/009106 WO2004018694A2 (de) 2002-08-20 2003-08-18 Verfahren zur herstellung von ketocarotinoiden in genetisch veränderten organismen

Publications (1)

Publication Number Publication Date
EP1532265A2 true EP1532265A2 (de) 2005-05-25

Family

ID=31950810

Family Applications (5)

Application Number Title Priority Date Filing Date
EP03792350A Expired - Lifetime EP1531683B1 (de) 2002-08-20 2003-08-18 Verwendung von astaxanthinhaltigen pflanzen oder pflanzenteilen der gattung tagetes als futtermittel
EP03792349A Withdrawn EP1532266A2 (de) 2002-08-20 2003-08-18 Verfahren zur herstellung von ketocarotinoiden in früchten von pflanzen
EP03792347A Withdrawn EP1542945A2 (de) 2002-08-20 2003-08-18 Verfahren zur herstellung von zeaxanthin und/oder dessen biosynthetischen zwischen- und/oder folgeprodukten
EP03792348A Withdrawn EP1532265A2 (de) 2002-08-20 2003-08-18 Verfahren zur herstellung von ketocarotinoiden in genetisch veränderten organismen
EP03792345A Withdrawn EP1532264A2 (de) 2002-08-20 2003-08-18 Verfahren zur herstellung von ketocarotinoiden in blütenblättern von pflanzen

Family Applications Before (3)

Application Number Title Priority Date Filing Date
EP03792350A Expired - Lifetime EP1531683B1 (de) 2002-08-20 2003-08-18 Verwendung von astaxanthinhaltigen pflanzen oder pflanzenteilen der gattung tagetes als futtermittel
EP03792349A Withdrawn EP1532266A2 (de) 2002-08-20 2003-08-18 Verfahren zur herstellung von ketocarotinoiden in früchten von pflanzen
EP03792347A Withdrawn EP1542945A2 (de) 2002-08-20 2003-08-18 Verfahren zur herstellung von zeaxanthin und/oder dessen biosynthetischen zwischen- und/oder folgeprodukten

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP03792345A Withdrawn EP1532264A2 (de) 2002-08-20 2003-08-18 Verfahren zur herstellung von ketocarotinoiden in blütenblättern von pflanzen

Country Status (12)

Country Link
US (5) US20060031963A1 (de)
EP (5) EP1531683B1 (de)
CN (1) CN1675367A (de)
AT (1) ATE484198T1 (de)
AU (5) AU2003258623A1 (de)
CA (5) CA2496133A1 (de)
DE (1) DE50313184D1 (de)
IL (4) IL166507A0 (de)
MX (5) MXPA05001659A (de)
NO (5) NO20050598L (de)
WO (5) WO2004018695A2 (de)
ZA (1) ZA200602230B (de)

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060107352A1 (en) * 2002-08-20 2006-05-18 Sungene Gmbh & Co. Kgaa Transgenic expression cassettes for expression of nucleic acids in the plant blooms
CA2496133A1 (en) * 2002-08-20 2004-03-04 Sungene Gmbh & Co. Kgaa Method for the production of ketocarotinoids in flower petals on plants
EP1532256A1 (de) * 2002-08-20 2005-05-25 Sungene GmbH & Co. KGaA VERFAHREN ZUR HERSTELLUNG VON &bgr;-CAROTINOIDEN
EP1554388A1 (de) * 2002-10-11 2005-07-20 Sungene GmbH & Co. KGaA Transgene expressionskassetten zur expression von nukleinsäuren in der pflanzlichen blüte
DE10300649A1 (de) * 2003-01-09 2004-07-22 Basf Ag Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen
EP1780281B1 (de) * 2004-06-04 2013-12-11 Kirin Holdings Kabushiki Kaisha Verfahren zur herstellung von astaxanthin oder einem stoffwechselprodukt davon unter verwendung von carotinketolase und carotinketolase-genen
EP2371967B1 (de) 2005-03-18 2015-06-03 DSM IP Assets B.V. Produktion von Carotenoiden in Ölhaltigen Hefen und Pilzen
AU2006269823B2 (en) * 2005-07-11 2012-08-02 Commonwealth Scientific And Industrial Research Organisation Wheat pigment
EP2078092A2 (de) 2006-09-28 2009-07-15 Microbia, Inc. Herstellung von carotenoiden in öliger hefe und pilzen
US8753840B2 (en) * 2006-10-20 2014-06-17 Arizona Board Of Regents On Behalf Of Arizona State University Modified cyanobacteria
BRPI0806029A2 (pt) * 2007-07-19 2009-11-10 Biosigma Sa plasmìdeos para transformação de bactérias do gênero aciditiobacillus spp. e método de transformação
US20090093015A1 (en) * 2007-10-09 2009-04-09 Kemin Foods, L.C. Beta-cryptoxanthin production using a novel lycopene beta-monocyclase gene
EP2199399A1 (de) 2008-12-17 2010-06-23 BASF Plant Science GmbH Ketokarotinoidproduktion in Pflanzen
WO2010079032A1 (en) * 2008-12-17 2010-07-15 Basf Plant Science Gmbh Production of ketocarotenoids in plants
KR101983115B1 (ko) * 2011-08-08 2019-05-29 에볼바 에스아 사프란 화합물의 재조합 생성을 위한 방법 및 물질
CN114748605A (zh) 2011-11-29 2022-07-15 普罗克拉拉生物科学股份有限公司 噬菌体基因3蛋白组合物及作为淀粉样蛋白结合剂的用途
ES2558953B1 (es) * 2015-11-23 2016-11-18 Universitat De Lleida Maíz enriquecido en antioxidantes para mejorar la calidad nutricional del huevo
JP2019165635A (ja) * 2016-08-10 2019-10-03 味の素株式会社 Ｌ−アミノ酸の製造法
US10004253B1 (en) * 2017-09-05 2018-06-26 Jose-Odon Torres-Quiroga Method for increasing the health condition of crustaceans in aquaculture, survival rate and pigmentation
CN112458103B (zh) * 2021-01-28 2022-09-30 青岛农业大学 一种调控辣椒红素积累的基因CaBBX20及其应用

Family Cites Families (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9016012D0 (en) 1990-07-20 1990-09-05 Unilever Plc Pigments
EP0735137B1 (de) * 1993-12-27 2004-08-25 Kirin Beer Kabushiki Kaisha Dna - kette zur synthese von xanthophyll und prozess zur herstellung von xanthophyll
US5916791A (en) * 1995-11-24 1999-06-29 Hirschberg; Joseph Polynucleotide molecule from Haematococcus pluvialis encoding a polypeptide having a β--C--4--oxygenase activity for biotechnological production of (3S,3S)astaxanthin
US6429356B1 (en) * 1996-08-09 2002-08-06 Calgene Llc Methods for producing carotenoid compounds, and specialty oils in plant seeds
JP2001505409A (ja) * 1996-08-09 2001-04-24 カルジーン エルエルシー 植物種子中のカロチノイド化合物と特殊油の製造方法
US6221417B1 (en) * 1997-05-14 2001-04-24 Kemin Industries, Inc. Conversion of xanthophylls in plant material for use as a food colorant
US5876782A (en) * 1997-05-14 1999-03-02 Kemin Industries, Inc. Method for the conversion of xanthophylls in plant material
JP2002516117A (ja) * 1998-05-22 2002-06-04 ユニバーシティ オブ メリーランド カロチノイド・ケトラーゼ遺伝子及び遺伝子生成物、ケトカロチノイドの生成及び遺伝子を用いてカロチノイドを変成する方法
BR0007128A (pt) * 1998-06-02 2001-07-17 Univ Maryland Genes para a biossìntese e metabolismo de carotenoides e método de aplicação dos mesmos
US6232530B1 (en) 1998-11-30 2001-05-15 University Of Nevada Marigold DNA encoding beta-cyclase
DE19916140A1 (de) * 1999-04-09 2000-10-12 Basf Ag Carotinhydroxylase und Verfahren zur Herstellung von Xanthophyllderivaten
SE9903336D0 (sv) 1999-09-17 1999-09-17 Astacarotene Ab DNA construct and its use
US20050003474A1 (en) * 2001-01-26 2005-01-06 Desouza Mervyn L. Carotenoid biosynthesis
DE10201458A1 (de) * 2001-04-11 2002-10-17 Adelbert Bacher Intermediate und Enzyme des Mevalonat-unabhängigen Isoprenoidbiosyntheseweg
US6784351B2 (en) * 2001-06-29 2004-08-31 Ball Horticultural Company Targetes erecta marigolds with altered carotenoid compositions and ratios
US7575766B2 (en) * 2001-06-29 2009-08-18 Ball Horticultural Company Tagetes erecta with altered carotenoid compositions and ratios
US6372946B1 (en) * 2001-09-13 2002-04-16 Prodemex, S.A. De C.V. Preparation of 4,4′-diketo-β-carotene derivatives
WO2003077950A1 (en) 2002-03-11 2003-09-25 Prodemex, S.A. De C.V. Enhanced feeding and growth rates of aquatic animals fed an astaxanthin product derived from marigold extract
US7223909B2 (en) 2002-03-21 2007-05-29 Ball Horticultural 4-ketocarotenoids in flower petals
CA2496133A1 (en) * 2002-08-20 2004-03-04 Sungene Gmbh & Co. Kgaa Method for the production of ketocarotinoids in flower petals on plants
DE10300649A1 (de) * 2003-01-09 2004-07-22 Basf Ag Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen
DE102004007623A1 (de) * 2004-02-17 2005-08-25 Sungene Gmbh & Co. Kgaa Promotoren zur Expression von Genen in Tagetes

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2004018694A2 *

Also Published As

Publication number Publication date
MXPA05001948A (es) 2005-09-08
MXPA05001899A (es) 2005-08-29
WO2004018693A3 (de) 2004-12-09
WO2004018695A3 (de) 2004-10-14
ATE484198T1 (de) 2010-10-15
US20060112451A1 (en) 2006-05-25
WO2004017749A3 (de) 2004-10-14
ZA200602230B (en) 2007-05-30
AU2003264062A1 (en) 2004-03-11
WO2004018693A2 (de) 2004-03-04
EP1531683B1 (de) 2010-10-13
MXPA05001659A (es) 2005-07-22
US7385123B2 (en) 2008-06-10
US7381541B2 (en) 2008-06-03
AU2003260424A1 (en) 2004-03-11
NO20050703L (no) 2005-05-09
CA2495235A1 (en) 2004-03-04
EP1532266A2 (de) 2005-05-25
CN1675367A (zh) 2005-09-28
DE50313184D1 (de) 2010-11-25
EP1531683A2 (de) 2005-05-25
WO2004018695A2 (de) 2004-03-04
MXPA05001944A (es) 2005-06-22
IL166771A0 (en) 2006-01-15
EP1542945A2 (de) 2005-06-22
AU2003260423A1 (en) 2004-03-11
WO2004018694A2 (de) 2004-03-04
WO2004017749A2 (de) 2004-03-04
MXPA05001811A (es) 2005-10-19
EP1532264A2 (de) 2005-05-25
WO2004018694A3 (de) 2004-09-10
NO20050598L (no) 2005-04-07
NO20050705L (no) 2005-05-18
US20070094749A1 (en) 2007-04-26
CA2495444A1 (en) 2004-03-04
WO2004018385A3 (de) 2004-10-21
NO20050755L (no) 2005-05-19
NO20050704L (no) 2005-05-13
US20050281909A1 (en) 2005-12-22
AU2003253416A1 (en) 2004-03-11
CA2496133A1 (en) 2004-03-04
AU2003258623A1 (en) 2004-03-11
IL166507A0 (en) 2006-01-15
AU2003264062B2 (en) 2008-01-03
CA2496207A1 (en) 2004-03-04
CA2495878A1 (en) 2004-03-04
IL166770A0 (en) 2006-01-15
IL166767A0 (en) 2006-01-15
US20060031963A1 (en) 2006-02-09
US20060253927A1 (en) 2006-11-09
WO2004018385A2 (de) 2004-03-04

Similar Documents

Publication Publication Date Title
US7385123B2 (en) Process for preparing ketocarotenoids in genetically modified organisms
WO2004063366A1 (de) Verfahren zur herstellung von ketocarotinoiden durch kultivierung von genetisch veränderten organismen
WO2005019467A1 (de) Verfahren zur herstellung von ketocarotinoiden in genetisch veränderten, nichthumanen organismen
JP2007502605A6 (ja) 遺伝子的に改変された非ヒト生物におけるケトカロテノイドの製造方法
DE10238980A1 (de) Verfahren zur Herstellung von Ketocarotinoiden in Blütenblättern von Pflanzen
DE10253112A1 (de) Verfahren zur Herstellung von Ketocarotinoiden in genetisch veränderten Organismen
WO2005019461A2 (de) Ketolasen und verfaren zur herstellung von ketocarotinoiden
EP1532256A1 (de) VERFAHREN ZUR HERSTELLUNG VON &bgr;-CAROTINOIDEN
DE10238978A1 (de) Verfahren zur Herstellung von Ketocarotinoiden in Früchten von Pflanzen
EP1658372A2 (de) Ketolasen und verfahren zur herstellung von ketocarotinoiden
EP1658377A1 (de) VERFAHREN ZUR HERSTELLUNG VON KETOCAROTINOIDEN IN GENETISCH VERÄNDERTEN, NICHTHUMANEN ORGANISMEN
DE10238979A1 (de) Verfahren zur Herstellung von Zeaxanthin und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten
AU2004267196A1 (en) Method for producing ketocarotinoids in genetically modified, non-human organisms

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050321

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20070426

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20070828