EP1532265A2

EP1532265A2 - Method for producing ketocarotinoids in genetically modified organisms

Info

Publication number: EP1532265A2
Application number: EP03792348A
Authority: EP
Inventors: Matt Sauer; Ralf Flachmann; Martin Klebsattel; Christel Renate Schopfer
Original assignee: SunGene GmbH
Current assignee: SunGene GmbH
Priority date: 2002-08-20
Filing date: 2003-08-18
Publication date: 2005-05-25
Also published as: EP1531683A2; MXPA05001811A; ATE484198T1; AU2003258623A1; WO2004017749A2; WO2004018694A2; WO2004018385A2; MXPA05001948A; AU2003253416A1; CA2495878A1; EP1542945A2; EP1532266A2; MXPA05001659A; US20050281909A1; IL166770A0; WO2004017749A3; IL166767A0; MXPA05001944A; EP1531683B1; CA2496207A1

Abstract

The present invention relates to a process for preparing ketocarotenoids by cultivation of genetically modified organisms which, compared with the wild type, have a modified ketolase activity, to the genetically modified organisms, and to the use thereof as human and animal foods and for producing ketocarotenoid extracts.

Description

Process for the production of ketocarόtinoids in genetically modified organisms

description

The present invention relates to a process for the preparation of ketocarotenoids by cultivating genetically modified organisms which have a modified ketolase activity compared to the wild type, the genetically modified organisms, and their use as food and feed and for the production of ketocarotenoid extracts.

Carotenoids are synthesized de novo in bacteria, algae, fungi and plants. Ketocarotenoids, i.e. carotenoids that contain at least one keto group, such as astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3'-hydroxyechinenone, adonirubin and adonixanthin are natural antioxidants and pigments that are produced by some algae and microorganisms as secondary metabolites ,

Because of their coloring properties, the ketocarotenoids and especially astaxanthin are used as pigmentation aids in animal nutrition, especially in trout, salmon and shrimp farming.

Nowadays, astaxanthin is mainly produced using chemical synthesis processes. Natural ketocarotenoids, such as natural astaxanthin, are nowadays obtained in small amounts in biotechnological processes by cultivating algae, for example Haematococcus pluvialis or by fermentation of genetically optimized microorganisms and subsequent isolation.

An economical biotechnological process for the production of natural ketocarotenoids is therefore of great importance.

Nucleic acids encoding a ketolase and the corresponding protein sequences have been isolated and annotated from various organisms, such as nucleic acids encoding a ketolase from Agrobacterium aurantiacum (EP 735 137, Accession NO: D58420), from Alcaligenes sp. PC-1 (EP 735137, Accession NO: D58422), Haematococcus pluvialis Flotow em. 7 // e and Haematoccus pluvialis, NIES- 144 (EP 725137, WO 98/18910 and Lotan et al, FEBS Letters 1995, 364, 125-128, Accession NO: X86782 and D45881), Paracoccus marcusii (Accession NO: Y15112), Synechocystis sp. Strain PC6803 (Accession NO: NP_442491), Bradyrhizobium sp. (Accession NO: AF218415) and Nostoc sp. PCC 7120 (Kaneko et al, DNA Res. 2001, 8 (5), 205-213; Accession NO: AP003592, BAB74888).

EP 735 137 describes the production of xanthophylls in microorganisms, such as, for example, E. coli by introducing ketolase genes (crtW) from Agrobacterium aurantiacum or Alcaligenes sp. PC-1 in microorganisms.

From EP 725 137, WO 98/18910, Kajiwara et al. (Plant Mol. Biol. 1995, 29, 343-352) and Hirschberg et al. (FEBS Letters 1995, 364, 125-128) it is known to introduce astaxanthin by introducing ketolase genes from Haematococcus pluvialis (crtW, crtO or bkt ) in E. coli.

Hirschberg et al. (FEBS Letters 1997, 404, 129-134) describe the production of astaxanthin in Synechococcus by introducing ketolase genes (crtO) from Haematococcus pluvialis. Sandmann et al. (Photochemistry and Photobiology 2001, 73 (5), 551-55) describe an analogous method, which however leads to the production of cantaxanthin and only provides traces of astaxanthin.

WO 98/18910 and Hirschberg et al. (Nature Biotechnology 2000, 18 (8), 888-892) describe the synthesis of ketocarotenoids in nectaries of tobacco flowers by introducing the ketolase gene from Haematococcus pluvialis (crtO) into tobacco.

WO 01/20011 describes a DNA construct for the production of ketocarotenoids, in particular astaxanthin, in seeds of oilseed plants such as oilseed rape, sunflower, soybean and mustard using a seed-specific promoter and a ketolase from Haematococcus pluvialis.

All processes described in the prior art for the production of ketocarotenoids and in particular the processes described for the production of astaxanthin have the disadvantage that the transgenic organisms provide a large amount of hydroxylated by-products, such as zeaxanthin and adonixanthin. The invention was therefore based on the object of providing a process for the preparation of ketocarotenoids by cultivating genetically modified organisms, or of providing further genetically modified organisms which produce ketocarotenoids which have the disadvantages of the prior art described above to a lesser extent or no longer.

Accordingly, a method for producing ketocarotenoids has been found by cultivating genetically modified organisms which have an altered ketolase activity compared to the wild type and the altered ketolase activity is caused by a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

The organisms according to the invention, such as, for example, microorganisms or plants, are preferably naturally able, as starting organisms, to produce carotenoids such as, for example, β-carotene or zeaxanthin, or can be put into a position by carotinoids such as, for example, reorganization of metabolic pathways or complementation for example, to produce β-carotene or zeaxanthin.

Some organisms, as starting or wild-type organisms, are already able to produce ketocarotenoids such as astaxanthin or canthaxanthin. These organisms, such as Haematococcus pluvialis, Paracoccus marcusii, Xan- thophyllomyces dendrorhous, Bacillus circulans, Chlorococcum, Phaffia rhodozyma, Adonis, Neochloris wimmeri, vacuolatus Protosiphon botryoides, Scotiellopsis oocystifor- mis, Scenedesmus, Chlorela zofingiensis, braunii Ankistrodesmus, Euglena sanguinea, Bacillus atrophaeus, Blakeslea already have ketolase activity as a starting or wild-type organism.

In one embodiment of the method according to the invention, organisms are therefore used as starting organisms which already have ketolase activity as a wild type or starting organism. In this embodiment, the genetic modification causes an increase in ketolase activity compared to the wild type or parent organism. Ketolase activity means the enzyme activity of a ketolase. A ketolase is understood to mean a protein which has the enzymatic activity of introducing a keto group on the optionally substituted β-ionone ring of carotenoids.

In particular, a ketolase is understood to be a protein which has the enzymatic activity to convert β-carotene into canthaxanthin.

Accordingly, ketolase activity is understood to mean the amount of β-carotene or amount of canthaxanthin formed by the protein ketolase in a certain time.

With an increased ketolase activity compared to the wild type, the amount of β-carotene converted or the amount of canthaxanthin formed is increased in a certain time by the protein ketolase compared to the wild type.

This increase in ketolase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the ketolase activity of the wild type.

According to the invention, the term “wild type” is understood to mean the corresponding starting organism.

Depending on the context, the term organism can be understood to mean the starting organism (wild type) or a genetically modified organism according to the invention, or both.

Preferably and in particular in cases in which the organism or the wild type cannot be clearly assigned, "wild type" is used to increase or cause the ketolase activity, for the increase in hydroxylase activity described below, for the increase described below β-cyclase activity and the increase in the content of ketocarotenoids each understood a reference organism. This reference organism is preferably Haematococcus pluvialis for microorganisms which already have ketolase activity as a wild type.

This reference organism is preferably Blakeslea for microorganisms which, as a wild type, have no ketolase activity.

This reference organism is for plants which already have a ketolase activity as a wild type, preferably Adonis aestivalis, Adonis flammeus or Adonis annuus, particularly preferably Adonis aestivalis.

This reference organism is particularly preferred for plants which have no ketolase activity in petals as a wild type, preferably Tagetes erecta, Tagetes patula, Tagetes lucida, Tagetes pringlei, Tagetes palmeri, Tagetes minuta or Tagetes campanulata, particularly preferably Tagetes erecta.

The ketolase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:

The ketolase activity in plant or microorganism material is determined in accordance with the method of Frazer et al., (J. Biol. Chem. 272 (10): 6128-6135, 1997). The ketolase activity in plant or microorganism extracts is determined with the substrates β-carotene and canthaxanthin in the presence of lipid (soy lecithin) and detergent (sodium cholate). Substrate / product ratios from the ketolase assays are determined by means of HPLC.

The ketolase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms at the translation and protein levels or by increasing the gene expression of a nucleic acid encoding a ketolase compared to the wild type, for example by inducing the ketolase gene by activators or by introducing nucleic acids encoding a ketolase into the organism.

Increasing the gene expression of a nucleic acid encoding a ketolase means, in this embodiment, the manipulation of the expression of the organisms' own endogenous ketolases. For example can be achieved by changing the promoter DNA sequence for genes coding for ketolase. Such a change, which results in a changed or preferably increased expression rate of at least one endogenous ketolase gene, can be carried out by deleting or inserting DNA sequences.

As described above, it is possible to change the expression of at least one endogenous ketolase by applying exogenous stimuli. This can take place through special physiological conditions, ie through the application of foreign substances.

Furthermore, an increased expression of at least one endogenous ketolase gene can be achieved in that a regulatory protein which is not found or modified in the wild-type organism interacts with the promoter of these genes.

Such a regulator can represent a chimeric protein which consists of a DNA binding domain and a transcription activator domain, as described, for example, in WO 96/06166.

In a preferred embodiment, the ketolase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

In a further preferred embodiment, the gene expression of a nucleic acid encoding a ketolase is increased by introducing nucleic acids encoding ketolases into the organisms, the ketolases having the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

In this embodiment, at least one further ketolase gene is present in the transgenic organisms according to the invention in comparison to the wild type, encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or one of these This sequence is derived by substitution, insertion or deletion of amino acids and has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

In this embodiment, the genetically modified organism according to the invention accordingly has at least one exogenous (= heterologous) nucleic acid, coding for a ketolase, or at least two endogenous nucleic acids, coding for a ketolase, the ketolases having the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

In another preferred embodiment of the method according to the invention, organisms are used as the starting organisms which, as a wild type, have no ketase activity.

In this preferred embodiment, the genetic modification causes it. Ketolase activity in organisms. In this preferred embodiment, the genetically modified organism according to the invention thus has a ketolase activity in comparison to the genetically unmodified wild type and is therefore preferred. It is able to transgenically express a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

In this preferred embodiment, the gene expression of a nucleic acid encoding a ketolase is caused analogously to the above-described increase in gene expression of a nucleic acid. Encoding a ketolase, preferably by introducing nucleic acids encoding ketolases containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has, in the starting organism.

In principle, any nucleic acids encoding a ketolase containing the amino acid sequence SEQ can be used in both embodiments. ID. NO. 2 or one of these Sequence derived by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has to be used.

The use of the nucleic acids according to the invention, encoding a ketolase, surprisingly leads to ketocarotenoids with a smaller amount of hydroxylated by-products in the method according to the invention than when using the ketolase genes used in the prior art.

All nucleic acids mentioned in the description can be, for example, an RNA, DNA or cDNA sequence.

In the case of genomic ketolase sequences from eukaryotic sources which contain introns, if the host organism is unable or unable to express the corresponding ketolase, nucleic acid sequences which have already been processed, such as the corresponding cDNAs, are preferred use.

Examples of nucleic acids encoding a ketolase and the corresponding ketolases containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID.

NO. 2, which can be used advantageously in the inventive method, are, for example, sequences from

Nostoc sp. Strain PCC7120 (Accession NO: AP003592, BAB74888; nucleic acid:

SEQ ID NO: 1, protein SEQ ID NO: 2),

Nostoc punctiforme ATTC 29133, nucleic acid: Acc.-No. NZ_AABC01000195, base pair 55.604 to 55.392 (SEQ ID NO: 3); Protein: Acc.-No. ZP_00111258 (SEQ ID NO: 4) (annotated as putative protein) or

Nostoc punctiforme ATTC 29133, nucleic acid: Acc.-No. NZ_AABC01000196, base pair 140.571 to 139.810 (SEQ ID NO: 5), protein: (SEQ ID NO: 6) (not annotated), Synechococcus sp. WH 8102, nucleic acid: Acc.-No. NZ_AABD01000001, base pair 1, 354.725-1, 355.528 (SEQ ID NO: 46), protein: Acc.-No. ZP_00115639 (SEQ ID NO: 47) (annotated as putative protein),

Nodularia spumigena NSOR10, (Accession NO: AY210783, AAO64399; Nucleic acid: SEQ ID NO: 52, Protein: SEQ ID NO: 53)

or ketolase sequences derived from these sequences, for example

the ketolases of the sequence SEQ ID NO: 8 or 10 and the corresponding coding nucleic acid sequences SEQ ID NO: 7 or SEQ ID NO: 9, which result, for example, from the sequence SEQ ID NO: 4 or SEQ ID NO: 3 by variation / mutation .

the ketolases of the sequence SEQ ID NO: 12 or 14 and the corresponding coding nucleic acid sequences SEQ ID NO: 11 or SEQ ID NO: 13, which result, for example, from the sequence SEQ ID NO: 6 or SEQ ID NO: 5 by variation / mutation - go, or

the ketolases of the sequence SEQ ID NO: 49 or 51 and the corresponding coding nucleic acid sequences SEQ ID NO: 48 or SEQ ID NO: 50, for example by variation or mutation from the sequence SEQ ID NO: 47 or SEQ ID NO: 46 emerge.

Further natural examples of ketolases and ketolase genes that can be used in the method according to the invention can be obtained, for example, from different organisms whose genomic sequence is known by comparing the identity of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the sequences SEQ ID NO described above : 2 easy to find.

Further natural examples of ketolases and ketolase genes can also be easily found using hybridization techniques in a manner known per se, starting from the nucleic acid sequences described above, in particular starting from the sequences SEQ ID NO: 1 from various organisms, the genomic sequence of which is not known. The hybridization can take place under moderate (low stringency) or preferably under stringent (high stringency) conditions.

Such hybridization conditions are described, for example, in Sambrook, J., Fritsch, EF, Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Cold Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6.

For example, the conditions during the washing step can be selected from the range of conditions limited by those with low stringency (with 2X SSC at 50_C) and those with high stringency (with 0.2X SSC at 50_C, preferably at 65_C) (20X SSC: 0, 3 M sodium citrate, 3 M sodium chloride, pH 7.0).

In addition, the temperature during the washing step can be raised from moderate conditions at room temperature, 22 ° C, to stringent conditions at 65 ° C. s

Both parameters, salt concentration and temperature, can be varied at the same time, one of the two parameters can also be kept constant and only the other can be varied. Denaturing agents such as formamide or SDS can also be used during hybridization. In the presence of 50% formamide, the hybridization is preferably carried out at 42 ° C.

Some exemplary conditions for hybridization and washing step are given as a result:

(1) Hybridization conditions with, for example

(i) 4X SSC at 65 ° C, or

(ii) 6X SSC at 45 ° C, or

(iii) 6X SSC at 68 ° C, 100 mg / ml denatured fish sperm DNA, or

(iv) 6X SSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA at 68 ° C, or (v) 6XSSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA, 50% formamide at 42 ° C, or

(vi) 50% formamide, 4X SSC at 42_C, or

(vii) 50% (vol / vol) formamide, 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinyl pyrrolidone, 50 mM sodium phosphate buffer pH 6.5, 750 mM NaCI, 75 mM sodium citrate at 42 ° C, or

(viii) 2X or 4X SSC at 50 ° C (moderate conditions), or

(ix) 30 to 40% formamide, 2X or 4X SSC at 42 ° (moderate conditions).

(2) washing steps for 10 minutes each with for example

(i) 0.015 M NaCI / 0.0015 M sodium citrate / 0.1% SDS at 50 ° C, or

(ii) 0.1X SSC at 65 ° C, or

(iii) 0.1 X SSC, 0.5% SDS at 68 ° C, or

(iv) 0.1 X SSC, 0.5% SDS, 50% formamide at 42 ° C, or

(v) 0.2X SSC, 0.1% SDS at 42 ° C, or

(vi) 2X SSC at 65 ° C (moderate conditions).

In a preferred embodiment of the method according to the invention, nucleic acids encoding a ketolase are introduced, containing the amino acid sequence SEQ ID NO: 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which preferably has an identity of at least 50% at least 60%, preferably at least 65%, preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, particularly preferably at least 98% at the amino acid level with the Sequence SEQ ID NO: 2 has. This can be a natural ketolase sequence that can be found as described above by comparing the identity of the sequences from other organisms or an artificial ketolase sequence that can be started from the sequence SEQ ID NO: 2 by artificial variation, for example by Substitution, insertion or deletion of amino acids has been modified.

In the description, the term “substitution” is to be understood as meaning the replacement of one or more amino acids by one or more amino acids. So-called conservative exchanges are preferably carried out, in which the replaced amino acid has a similar property to the original amino acid, for example replacement of Glu by Asp, Gin by Asn, Val by Ile, Leu by Ile, Ser by Thr.

Deletion is the replacement of an amino acid with a direct link. Preferred positions for deletions are the termini of the polypeptide and the links between the individual protein domains.

Inserts are insertions of amino acids into the polypeptide chain, with a direct bond being formally replaced by one or more amino acids.

Identity between two proteins is understood to mean the identity of the amino acids over the respective total protein length, in particular the identity which is obtained by comparison using the Vector NTI Suite 7.1 software from Informax (USA) using the Clustal method (Higgins DG, Sharp PM.Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151-1) is calculated using the following parameters:

Multiple alignment parameters:

Gap opening penalty 10 Gap extension penalty 10

Gap Separation penalty ranks 8th

Gap separation penalty off

% identity for alignment delay 40

Residue specific gaps off Hydrophilic residue gap off

Transition weighing 0 Pairwise alignment parameter: FAST algorithm on K-tuple size 1

Gap penalty 3 window size 5

Number of best diagonals 5

A ketolase which has an identity of at least 42% at the amino acid level with the sequence SEQ ID NO: 2 is accordingly understood to be a ketolase which, when comparing its sequence with the sequence SEQ ID NO: 2, in particular according to the above program logarithm with the above parameter set has an identity of at least 42%.

For example, according to the above program logarithm with the above set of parameters, the sequence of the ketolase from Nostoc punctiform ATTC 29133 (SEQ ID NO: 4) with the sequence of the ketolase from Nostoc sp. Strain PCC7120 (SEQ ID NO: 2) has an identity of 65%.

The sequence of the second ketolase from Nostoc punctiform ATTC 29133 (SEQ ID NO: 6) with the sequence of the ketolase from Nostoc sp. Strain PCC7120 (SEQ ID NO: 2), for example, has an identity of 58%.

The sequence of the ketolase from Synechococcus sp. WH 8102 (SEQ ID NO: 47) with the sequence of the ketolase from Nostoc sp. Strain PCC7120 (SEQ ID NO: 2), for example, has an identity of 44%.

Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

Those codons are preferably used for this which are frequently used in accordance with the organism-specific "codon usage". The "codon usage" can easily be determined on the basis of computer evaluations of other, known genes of the organisms in question.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 1 is introduced into the organism. All of the above-mentioned ketolase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897). The attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

The sequence of the ketolase from Nostoc sp. Strain PCC7120 (SEQ ID NO: 2) has an identity of 39% (Agrobacterium aurantiacum (EP 735 137, Accession NO: D58420), 40% (Alcaligenes) with the sequences of the ketolases used in the methods of the prior art sp. PC-1 (EP 735137, Accession NO: D58422) and 20 to 21% (Haematococcus pluvialis Flotow em. Wille and Haematoccus pluvialis ,: NIES-144 (EP 725137, WO 98/18910 and Lotan et al, FEBS Letters 1995 , 364, 125-128, Accession NO: X86782 and D45881).

In a preferred embodiment, organisms are cultivated which, in addition to the increased ketolase activity, have an increased hydroxylase activity and / or β-cyclase activity compared to the wild type.

Hydroxylase activity means the enzyme activity of a hydroxylase.

A hydroxylase is understood to mean a protein which has the enzymatic activity of introducing a hydroxyl group on the optionally substituted β-ionone ring of carotenoids.

In particular, a hydroxylase is understood to mean a protein which has the enzymatic activity, β-carotene in zeaxanthin or canthaxanthin in

Convert astaxanthin. Accordingly, hydroxylase activity is understood to mean the amount of β-carotene or canthaxanthin converted or the amount of zeaxanthin or astaxanthin formed in a certain time by the protein hydroxylase.

If the hydroxylase activity is higher than that of the wild type, the amount of β-carotene or canthaxantine or the amount of zeaxanthin or astaxanthin formed is increased by the protein hydroxylase in a certain time compared to the wild type.

This increase is preferably the hydroxylase activity of at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, more preferably at least ^• 500%, especially at least 600% of the hydroxylase activity of the wild type.

Β-cyclase activity means the enzyme activity of a β-cyclase.

A β-cyclase is understood to mean a protein which has the enzymatic activity to convert a terminal, linear residue of lycopene into a β-ionone ring.

In particular, a β-cyclase is understood to be a protein which has the enzymatic activity to convert γ-carotene into β-carotene.

Accordingly, ß-cyclase activity is understood to mean the amount of γ-carotene converted or the amount of ß-carotene formed in a certain time by the protein ß-cyclase.

With an increased ß-cyclase activity compared to the wild type, the amount of lycopene or γ-carotene converted or the amount of γ-carotene formed from lycopene or the formed amount of ß-carotene from γ-carotene increased.

This increase in the β-cyclase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably min. at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the β-cyclase activity of the wild type.

The hydroxylase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:

The activity of the hydroxylase is according to Bouvier et al. (Biochim. Biophys. Acta 1391 (1998), 320-328) in vitro. Ferredoxin, ferredoxin-NADP oxidoreductase, catalase, NADPH and β-carotene with mono- and digalactosylglycerides are added to a certain amount of organism extract.

The hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, Keller, d'Harlingue and Camara (Xanthophyll bio-synthesis: molecular and functional identification of carotenoid hydroxylases for rom pepper fruits (Capsicum annuum L; Biochim. Biophys. Acta 1391 (1998), 320-328):

The in vitro assay is carried out in a volume of 0.250 ml. The mixture contains 50 mM potassium phosphate (pH 7.6), 0.025 mg ferredoxin from spinach, 0.5 units ferredoxin-NADP + oxidoreductase from spinach, 0.25 mM NADPH, 0.010 mg beta

Carotene (emulsified in 0.1 mg Tween 80), 0.05 mM of a mixture of mono- and digalactosylglycerides (1: 1), 1 unit of catalysis, 200 mono- and digalactosylglycerides (1: 1), 0.2 mg bovine serum albumin and organism extract in different volumes. The reaction mixture is incubated at 30 ° C for 2 hours. The reaction products are extracted with organic solvent such as acetone or chloroform / methanol (2: 1) and determined by HPLC.

The β-cyclase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:

The activity of the β-cyclase is determined according to Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15) / n vitro. Potassium phosphate as a buffer (pH 7.6), lycopene as a substrate, stomaprotein from paprika, NADP +, NADPH and ATP are added to a certain amount of organism extract. The β-cyclase activity is particularly preferably determined under the following conditions according to Bouvier, d'Harlingue and Camara (Molecular Analysis of carotenoid cyclae inhibition; Arch. Biochem. Biophys. 346 (1) (1997) 53-64):

The in vitro assay is carried out in a volume of 250 μl volume. The mixture contains 50 mM potassium phosphate (pH 7.6), different amounts of organism extract, 20 nM lycopene, 250 μg of chromoplastid stromal protein from paprika, 0.2 mM NADP +, 0.2 mM NADPH and 1 mM ATP. NADP / NADPH and ATP are dissolved in 10 ml ethanol with 1 mg Tween 80 immediately before adding to the incubation medium. After a reaction time of 60 minutes at 30 ° C., the reaction is terminated by adding chloroform / methanol (2: 1). The reaction products extracted in chloroform are analyzed by HPLC.

An alternative assay with a radioactive substrate is described in Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15).

The hydroxylase activity and / or β-cyclase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing the gene expression of nucleic acids encoding a hydroxylase and / or of nucleic acids , encoding a β-cyclase, compared to the wild type.

The increase in the gene expression of the nucleic acids encoding a hydroxylase and / or the increase in the gene expression of the nucleic acid encoding a β-cyclase compared to the wild type can also be achieved in various ways, for example by inducing the hydroxylase gene and / or β-cyclase Gene by activators or by introducing one or more hydroxylase gene copies and / or β-cyclase gene copies, ie by introducing at least one nucleic acid encoding a hydroxylase and / or at least one nucleic acid encoding a β-cyclase into the organism ,

Increasing the gene expression of a nucleic acid encoding a hydroxylase and / or β-cyclase means according to the invention the manipulation of the expression of the organism's own endogenous hydroxylase and / or β-cyclase. This can be achieved, for example, by changing the promoter DNA sequence for genes encoding hydroxylases and / or β-cyclases. Such a change, which results in an increased expression rate of the gene, can take place, for example, by deleting or inserting DNA sequences.

As described above, it is possible to change the expression of the endogenous hydroxylase and / or β-cyclase by applying exogenous stimuli. This can take place through special physiological conditions, ie through the application of foreign substances.

Furthermore, an altered or increased expression of an endogenous hydroxylase and / or β-cyclase gene can be achieved in that a regulator protein which does not occur in the non-transformed organism interacts with the promoter of this gene.

Such a regulator can represent a chimeric protein which consists of a DNA binding domain and a transcription activator domain, as for example in

WO 96/06166.

In a preferred embodiment, the gene expression of a nucleic acid encoding a hydroxylase is increased and / or the gene expression of a nucleic acid encoding a β-cyclase is increased by introducing at least one nucleic acid encoding a hydroxylase and / or by introducing at least one a nucleic acid encoding a β-cyclase in the organism.

In principle, any hydroxylase gene or each β-cyclase gene, that is to say any nucleic acid which codes for a hydroxylase and any nucleic acid which codes for a β-cyclase, can be used for this purpose.

With genomic hydroxylase or. β-cyclase nucleic acid sequences from eukaryotic sources which contain introns are, in the event that the host organism is unable or cannot be able to express the corresponding hydroxylase or β-cyclase, preferably to use already processed nucleic acid sequences, such as the corresponding cDNAs. An example of a hydroxylase gene is a nucleic acid encoding a hydroxylase from Haematococcus pluvialis, accession AX038729, WO 0061764); (Nucleic acid: SEQ ID NO: 15, protein: SEQ ID NO: 16).

An example of a β-cyclase gene is a nucleic acid encoding a β-cyclase from tomato (Accession X86452) (nucleic acid: SEQ ID NO: 17, protein: SEQ ID NO: 18).

In this preferred embodiment, the preferred transgenic organisms according to the invention therefore have at least one further hydroxylase gene and / or β-cyclase gene compared to the wild type.

In this preferred embodiment, the genetically modified organism has, for example, at least one exogenous nucleic acid encoding a hydroxylase, or at least two endogenous nucleic acids encoding a hydroxylase and / or at least one exogenous nucleic acid encoding a β-cyclase, or at least two endogenous nucleic acids encoding one β-cyclase.

X

In the preferred embodiment described above, nucleic acids encoding proteins are preferably used as the hydroxylase genes, containing the amino acid sequence SEQ ID NO: 16 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the

Sequence SEQ ID NO: 16, and which have the enzymatic property of a hydroxylase.

Further examples of hydroxylases and hydroxylase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID. NO: 16 easy to find.

Further examples of hydroxylases and hydroxylase genes can also be found, for example, starting from the sequence SEQ ID NO: 15 from various organisms. whose genomic sequence is not known, as described above, can easily be found by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the hydroxylase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the hydroxylase of the sequence SEQ ID NO: 16.

Those codons which are frequently used in accordance with the organism-specific "codon usage" are preferably used for this. This "codon usage" can easily be determined on the basis of computer evaluations of other known genes of the organisms in question.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ is brought. ID. NO: 15, in the organism.

X

In the preferred embodiment described above, nucleic acids which encode proteins are preferably used as the β-cyclase genes, comprising the amino acid sequence SEQ ID NO: 18 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30 %, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 18, and which have the enzymatic property of a β-cyclase.

Further examples of β-cyclases and β-cyclase genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with SEQ ID NO: 18.

Further examples of β-cyclases and β-cyclase genes can also be derived, for example, from the sequence SEQ ID NO: 17 from different organisms, whose genomic sequence is not known can easily be found by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the β-cyclase activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the β-cyclase of the sequence SEQ. ID. NO: 18.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ is brought. ID. NO: 17 in the organism.

All of the above-mentioned hydroxylase genes or β-cyclase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). The attachment of synthetic oligonucleotides and the filling of gaps using the Kleenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

Genetically modified organisms with the following combinations of genetic changes are particularly preferably used in the method according to the invention:

Genetically modified organisms that have an increased or caused ketolase activity and an increased hydroxylase activity compared to the wild type, genetically modified organisms which have an increased or caused ketolase activity and an increased ß-cyclase activity compared to the wild type and

genetically modified organisms that have an increased or caused ketolase activity and an increased hydroxylase activity and an increased ß-cyclase activity compared to the wild type.

As described below, these genetically modified organisms can be produced, for example, by introducing individual nucleic acid constructs (expression cassettes) or by introducing multiple constructs which contain up to two or three of the activities described.

According to the invention, organisms are preferably understood to mean organisms which, as wild-type or starting organisms, naturally or by genetic complementation and / or reorganization of the metabolic pathways, are capable of producing carotenoids, in particular β-carotene and / or zeaxanthin and / or neoxanthine and / or violaxanthin and / or to produce lutein.

X

Further preferred organisms already have hydroxylase activity as wild-type or starting organisms and are therefore capable of producing zeaxanthin as wild-type or starting organisms.

Preferred organisms are plants or microorganisms, such as bacteria, yeasts, algae or fungi.

Both bacteria can be used as bacteria that are able to synthesize xanthophylls due to the introduction of genes of the carotenoid biosynthesis of a carotenoid-producing organism, such as bacteria of the genus Escherichia, which contain, for example, crt genes from Erwinia, as well as bacteria. which are capable of synthesizing xanthophylls, such as, for example, bacteria of the genus Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Paracoccus, Nostoc or cyanobacteria of the genus Synechocystis.

Preferred bacteria are Escherichia coli, Erwinia herbicola, Erwinia uredovora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobacterium sp. strain R1534, the Cyanobacterium Synechocystis sp. PCC6803, Paracoccus marcusii or Paracoccus carotinifaciens.

Preferred yeasts are Candida, Saccharomyces, Hansenula, Pichia or Phaffia. Particularly preferred yeasts are Xanthophyllomyces dendrorhous or Phaffia rhodozyma.

Preferred fungi are Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium or others in Indian Chem. Engr. Section B. Vol. 37, No. 1, 2 (1995) on page 15, table 6 described mushrooms.

Preferred algae are green algae, such as algae of the genus Haematococcus, Phaedactylum tricornatum, Volvox or Dunaliella. Particularly preferred algae are Haematococcus puvialis or Dunaliella bardawil.

Further usable microorganisms and their production for carrying out the method according to the invention are known, for example, from DE-A-199 16 140, to which reference is hereby made.

Plants selected from the Ranuncu families are particularly preferred plants. iaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Lina- ceae, Vitaceae, Brassicaceae, Cucurbitaceae, Primulaceae, Caryophyl Iaceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae , Poaceae, Orchidaceae, Malvaceae, liliaceae or Lamiaceae.

Very particularly preferred plants are selected from the group of the plant genera Marigold, Tagetes errecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aquilegia, Aster, Astragalus, Bignonia, Calendula, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum , Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillaea, Helenium, Helianthus, Hepatica , Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kenya, Labumum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcissus, Oenothera, Osiaanthus , Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ulex, Viola or Zinnia, particularly preferably selected from the group of the plant genera Marigold, Tagetes erecta, Tagetes patula, Lycopersicon, Rosa, Calenduia, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium, Tropaeolum or Adonis.

In the process according to the invention for the production of ketocarotenoids, the cultivation step of the genetically modified organisms is preferably followed by harvesting the organisms and, more preferably, additionally isolating ketocarotenoids from the organisms.

The organisms are harvested in a manner known per se in accordance with the respective organism. Microorganisms, such as bacteria, yeast, algae or fungi or plant cells, which are cultivated by fermentation in liquid nutrient media, can be separated off, for example, by centrifuging, decanting or filtering. Plants are grown in a conventional manner on nutrient media and ^corresponds' speaking harvested.

The cultivation of the genetically modified microorganisms is preferably carried out in the presence of oxygen at a cultivation temperature of at least about 20 ° C, e.g. 20 ° C to 40 ° C, and a pH of about 6 to 9. In the case of genetically modified microorganisms, the microorganisms are preferably first cultivated in the presence of oxygen and in a complex medium, such as e.g. TB or LB medium at a cultivation temperature of about 20 ° C or more, and a pH of about 6 to 9 until a sufficient cell density is reached. In order to better control the oxidation reaction, the use of an inducible promoter is preferred. The cultivation is carried out after induction of ketolase expression in the presence of oxygen, e.g. 12 hours to 3 days continued.

The ketocarotenoids are isolated from the harvested biomass in a manner known per se, for example by extraction and, if appropriate, further chemical or physical purification processes, such as, for example, precipitation methods, crystallography, thermal separation processes, such as rectification processes or physical separation processes, such as, for example, chromatography. As mentioned below, the ketocarotenoids in the genetically modified plants according to the invention can preferably be produced specifically in various plant tissues, such as, for example, seeds, leaves, fruits, flowers, in particular in petals.

Ketocarotenoids are isolated from the harvested petals in a manner known per se, for example by drying and subsequent extraction and, if appropriate, further chemical or physical purification processes, such as, for example, precipitation methods, crystallography, thermal separation processes, such as rectification processes or physical separation processes, such as chromatography. Ketocarotenoids are isolated from the petals, for example, preferably using organic solvents such as acetone, hexane, ether or tert-methylbutyl ether.

Further isolation processes for ketocarotenoids, in particular from petals, are described, for example, in Egger and Kleinig (Phytochemistry (1967) 6, 437-440) and Egger (Phytochemistry (1965) 4, 609-618).

X

The ketocarotenoids are preferably selected from the group consisting of astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3'-hydroxyechinenone, adonirubin and adonixanthin.

A particularly preferred ketocarotenoid is astaxanthin.

Depending on the organism used, the ketocarotenoids are obtained in free form or as fatty acid esters.

In the petals of plants, the ketocarotenoids are obtained in the process according to the invention in the form of their mono- or diesters with fatty acids. Some proven fatty acids are e.g. Myristic acid, palmitic acid, stearic acid, oleic acid, linolenic acid, and lauric acid (Kamata and Simpson (1987) Comp. Biochem. Physiol. Vol. 86B (3), 587-591).

The ketocarotenoids can be produced in the whole plant or, in a preferred embodiment, specifically in plant tissues which contain chromoplasts. Preferred plant tissues are, for example, roots, seeds, leaves, Fruits, flowers and especially nectaries and petals, which are also called petals.

In a particularly preferred embodiment of the method according to the invention, genetically modified plants are used which have the highest expression rate of a ketolase in flowers.

This is preferably achieved in that the gene expression of the ketolase takes place under the control of a flower-specific promoter. For example, the nucleic acids described above, as described in detail below, are introduced into the plant in a nucleic acid construct functionally linked with a flower-specific promoter.

In a further, particularly preferred embodiment of the method according to the invention, genetically modified plants are used which have the highest expression rate of a ketolase in fruits.

This is preferably achieved in that the gene expression of the ketolase takes place under the control of a fruit-specific promoter. For example, the nucleic acids described above, as described in detail below, are introduced into the plant in a nucleic acid construct functionally linked with a fruit-specific promoter.

In a further, particularly preferred, embodiment of the method according to the invention, genetically modified plants are used which have the highest expression rate of a ketolase in seeds.

This is preferably achieved in that the gene expression of the ketolase takes place under the control of a seed-specific promoter. For example, the nucleic acids described above, as described in detail below, are introduced into the plant in a nucleic acid construct functionally linked with a seed-specific promoter.

The targeting in the chrome peaks is carried out by a functionally linked plastid transit peptide. In the following, the production of genetically modified plants with increased or caused ketolase activity is described as an example. Other activities, such as the hydroxylase activity and / or the β-cyclase activity, can be increased analogously using nucleic acid sequences encoding a hydroxylase or β-cyclase instead of nucleic acid sequences encoding a ketolase. In the combination of genetic changes, the transformation can take place individually or through multiple constructs.

The transgenic plants are preferably produced by transforming the starting plants, using a nucleic acid construct which contains the nucleic acids described above, encoding a ketolase, which are functionally linked to one or more regulation signals which ensure transcription and translation in plants.

These nucleic acid constructs, in which the coding nucleic acid sequence is functionally linked to one or more regulatory signals which ensure transcription and translation in plants, are also called expression cassettes below.

The regulation signals preferably contain one or more promoters which ensure transcription and translation in plants.

The expression cassettes contain regulation signals, that is to say regulative nucleic acid sequences, which control the expression of the coding sequence in the host cell. According to a preferred embodiment, an expression cassette upstream, ie at the 5 'end of the coding sequence, a promoter and downstream, ie at the 3' end, a polyadenylation signal and, if appropriate, further regulatory elements which match the coding sequence for at least one of the above genes described are operatively linked. An operative link is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended when expressing the coding sequence. The preferred nucleic acid constructs, expression cassettes and vectors for plants and methods for producing transgenic plants and the transgenic plants themselves are described below by way of example.

The sequences which are preferred, but not limited to, for operative linking, are targeting sequences to ensure subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochondrion, in the endoplasmic reticulum (ER), in the cell nucleus, in oil bodies or other compartments and Translation enhancers such as the 5 'leader sequence from the tobacco mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711).

In principle, any promoter which can control the expression of foreign genes in plants is suitable as the promoter of the expression cassette.

“Constitutive” promoter means those promoters which ensure expression in numerous, preferably all, tissues over a relatively long period of plant development, preferably at all times during plant development.

X

In particular, a plant promoter or a plant virus-derived promoter is preferably used. Particularly preferred is the promoter of the 35S transcript of the CaMV cauliflower mosaic virus (Franck et al. (1980) Cell 21: 285-294; Odell et al. (1985) Nature 313: 810-812; Shewmaker et al. (1985) Virology 140: 281-288; Gardner et al. (1986) Plant Mol Biol 6: 221-228), the 19S CaMV promoter (US 5,352,605; WO 84/02913; Benfey et al. (1989) EMBO J 8: 2195- 2202), the triose phosphate translocator (TPT) promoter from Arabidopsis thallana Acc.-No. AB006698, base pair 53242 to 55281; the gene starting from bp 55282 is annotated with "phosphate / triose-phosphate translocator", or the 34S promoter from Figwort mosaic virus Acc.-No. X16673, base pair 1 to 554.

Another suitable constitutive promoter is the pds promoter (Pecker et al. (1992) Proc. Natl. Acad. Be USA 89: 4962-4966) or the "Rubisco small subunit (SSU)" promoter (US 4,962,028), the LeguminB Promoter (GenBank Acc. No. X03677), the promoter of nopaline synthase from Agrobacterium, the TR double promoter, the OCS (octopine synthase) promoter from Agrobacterium, the ubiquitin promoter (Holtorf S et al. (1995) Plant Mol Biol 29: 637-649), the ubiquitin 1 promoter (Christensen et al. (1992) Plant Mol Biol 18: 675-689; Bruce et al. (1989) Proc Natl Acad Sei USA 86: 9692-9696), the ^' Smas promoter, the cinnamyl alcohol dehydrogenase promoter (US 5,683,439), the promoters of the vacuolar ATPase subunits or the promoter of a proline-rich protein from wheat (WO 91/13991), the Pnit Promoter (Y07648.L, Hillebrand et al. (1998), Plant. Mol. Biol. 36, 89-99, Hillebrand et al. (1996), Gene, 170, 197-200) and further promoters of genes whose constitutive expression in plants is known to the person skilled in the art.

The expression cassettes can also contain a chemically inducible promoter (review article: Gatz et al. (1997) Annu Rev Plant Physiol Plant Mol Biol 48: 89-108), by means of which the expression of the ketolase gene in the plant is controlled at a specific point in time can. Such promoters, e.g. the PRP1 promoter (Ward et al. (1993) Plant Mol Biol 22: 361-366), a salicylic acid-inducible promoter (WO 95/19443), a benzenesulfonamide-inducible promoter (EP 0388 186), a tetracycline-inducible promoter Promoter (Gatz et al. (1992) Plant J 2: 397-404), a promoter inducible by abscisic acid (EP 0335 528) or a promoter inducible by ethanol or cyclohexanone (WO 93/21334) can also be used. X

Also preferred are promoters that are induced by biotic or abiotic stress, such as the pathogen-inducible promoter of the PRP1 gene (Ward et al. (1993) Plant Mol Biol 22: 361-366), the heat-inducible hsp70 or hsp80 Promoter from tomato (US 5,187,267), the cold-inducible alpha-amylase promoter from the potato (WO 96/12814), the light-inducible PPDK promoter or the wound-induced pinII promoter (EP375091).

Pathogen-inducible promoters include those of genes that are induced as a result of a pathogen attack, such as, for example, genes from PR proteins, SAR proteins, b-1, 3-glucanase, chitinase etc. (for example Redolfi et al. (1983) Neth J Plant Pathol 89: 245-254; Uknes, et al. (1992) The Plant Cell 4: 645-656; Van Loon (1985) Plant Mol Viral 4: 111-116; Marineau et al. (1987) Plant Mol Biol 9 : 335-342; Matton et al. (1987) Molecular Plant-Microbe Interactions 2: 325-342; Somssich et al. (1986) Proc Natl Acad Sei USA 83: 2427-2430; Somssich et al. (1988) Mol Gen Genetics 2: 93-98; Chen et al. (1996) Plant J 10: 955-966; Zhang and Sing (1994) Proc Natl Acad Sei USA 91: 2507-2511; Warner, et al. (1993 Plant J 3: 191-201; Siebertz et al. (1989) Plant Cell 1: 961-968 (1989). Also included are wound inducible promoters such as that of the pinll gene (Ryan (1990) Ann Rev Phytopath 28: 425-449; Duan et al. (1996) Nat Biotech 14: 494-498), the wunl and wun2 gene (US 5,428,148 ), the winl and win2 genes (Stanford et al. (1989) Mol Gen Genet 215: 200-208), the systemin gene (McGurl et al. (1992) Science 225: 1570-1573), the WIP1 Gens (Rohmeier et al. (1993) Plant Mol Biol

22: 783-792; Ekelkamp et al. (1993) FEBS Letters 323: 73-76), the MPI gene (Corderok et al. (1994) The Plant J 6 (2): 141-150) and the like.

Further suitable promoters are, for example, fruit ripening-specific promoters, such as the fruit ripening-specific promoter from tomato (WO

94/21794, EP 409 625). Development-dependent promoters partly include the tissue-specific promoters, since the formation of individual tissues is naturally development-dependent.

Furthermore, promoters are particularly preferred which ensure expression in tissues or parts of plants in which, for example, the biosynthesis of ketocarotenoids or their precursors takes place. For example, are preferred. Promoters with specificities for the anthers, ovaries, petals, sepals, flowers, leaves, stems, seeds and roots and combinations thereof.

Tuber, storage root or root-specific promoters are, for example, the patatin class I (B33) promoter or the potato cathepsin D inhibitor promoter.

Leaf-specific promoters are, for example, the cytosolic promoter

FBPase from potato (WO 97/05900), the SSU promoter (small subunit) of Rubisco (ribulose-1, 5-bisphosphate carboxylase) or the ST-LSI promoter from potato (Stockhaus et al. (1989) EMBO J 8: 2445- 2451).

Flower-specific promoters are, for example, the phytoene synthase promoter (WO 92/16635) or the promoter of the P-rr gene (WO 98/22593), the AP3 promoter from Arabidopsis thaliana (see Example 5), the CHRC promoter (chromoplast-specific carotenoid-associated protein (CHRC) gene promoter from Cucumis sativus Acc.-No. AF099501, base pair 1 to 1532), the EPSP_Synthase promoter (5-enol-pyruvylshikimate-3-phosphate synthase gene promoter from Petunia hybrida, Acc.-No. M37029, base pair 1 to 1788), the PDS promoter (Phytoene desaturase gene pro- moter from Solanum lycopersicum, Acc.-No. U46919, base pair 1 to 2078), the DFR-A promoter (dihydroflavonol 4-reductase gene A promoter from Petunia hybrida, Acc.- No. X79723, base pair 32 to 1902) or the FBP1 promoter (Floral Binding Protein 1 gene promoter from Petunia hybrida, Acc.-No. L10115, base pair 52 to 1069).

Anther-specific promoters are, for example, the 5126 promoter (US 5,689,049, US 5,689,051), the glob-1 promoter or the g-zein promoter.

Seed-specific promoters are, for example, the ACP05 promoter (acyl carrier protein gene, WO9218634), the promoters AtS1 and AtS3 from Arabidopsis

(WO 9920775), the LeB4 promoter from Vicia faba (WO 9729200 and US 06403371), the napin promoter from Brassica napus (US 5608152; EP 255378; US 5420034), the SBP promoter from Vicia faba (DE 9903432) or the corn promoters End1 and End2 (WO 0011177).

Further promoters suitable for expression in plants are described in Rogers et al. (1987) Meth in Enzymol 153: 253-277; Schardl et al. (1987) Gene 61: 1-11 and Berger et al. (1989) Proc Natl Acad Sei USA 86: 8402-8406).

In the method according to the invention, particular preference is given to constitutive, seed-specific, fruit-specific, flower-specific and in particular flower-leaf-specific promoters.

The present invention therefore relates in particular to a nucleic acid construct containing functionally linked a flower-specific or in particular a petal-specific promoter and a nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

An expression cassette is preferably produced by fusing a suitable promoter with a nucleic acid described above, encoding a ketolase, and preferably a nucleic acid inserted between promoter and nucleic acid sequence, which codes for a plastid-specific transit peptide, and a polyadenylation signal according to common recombination and cloning technology. techniques such as those described in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) as well as in TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausuble, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).

The preferably inserted nucleic acids encoding a plastid transit peptide ensure localization in plastids and in particular in chromoplasts.

Expression cassettes can also be used, the nucleic acid sequence of which codes for a ketolase fusion protein, part of the fusion protein being a transit peptide which controls the translocation of the polypeptide. Preferred transit peptides are preferred for the chromoplasts, which are cleaved enzymatically from the ketolase part after translocation of the ketolase into the chromoplasts.

The transit peptide which is derived from the plastid Nicotiana tabacum transketolase or another transit peptide (for example the transit peptide of the small subunit of the Rubisco (rbcS) or the ferredoxin NADP oxidoreductase as well as the isopentenyl pyrophosphate isomerase-2) or its functional equivalent is particularly preferred ,

Nucleic acid sequences of three cassettes of the plastid transit peptide of plastid transketolase from tobacco in three reading frames are particularly preferred as Kpnl / BamHI fragments with an ATG codon in the Ncol interface:

pTP09

Kpnl_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTC GTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CACTTTTTCCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGC- GATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGG- GATCC_BamHI

PTP10 KpnLGGTACCATGGCGTCTTCTTCTtCTCTCACTCTCTCTCAAGCTATCCTCTCTC GTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CACTTTTTCCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGC- GATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGCTG- GATCC_BamHI

pTP11

Kpn LGGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTC GTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CACI IIII CCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- ^• TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGC- GATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGG- GATCC_BamHI

Further examples of a plastid transit peptide are the transit peptide of the plastid

X ren isopentenyl pyrophosphate isomerase-2 (IPP-2) from Arabisopsis thaliana and the transit peptide of the small subunit of ribulose bisphosphate carboxylase (rbcS) from pea (Guerineau, F, Woolston, S, Brooks, L, Mullineaux, P (1988) An expression casette for targeting foreign proteins into the chloroplasts. Nucl. Acids Res. 16: 11380).

The nucleic acids according to the invention can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural nucleic acid constituents, and can consist of different heterologous gene segments from different organisms.

As described above, preference is given to synthetic nucleotide sequences with codons which are preferred by plants. These plant-preferred codons can be determined from the highest protein frequency codons expressed in most interesting plant species.

When preparing an expression cassette, various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame. To connect the DNA fragments to one another, adapters or linkers can be attached to the fragments.

The promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction sites for the insertion of this sequence. As a rule, the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. In general, the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges. The promoter can be native or homologous as well as foreign or heterologous to the host plant. The expression cassette preferably contains the promoter, a coding nucleic acid sequence or a nucleic acid construct and a region for the transcriptional termination in the 5'-3 'transcription direction. Different termination areas are interchangeable.

Examples of a terminator are the 35S terminator (Guerineau et al. (1988) Nucl Acids Res. 16: 11380), the nos terminator (Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM. Nopaline synthase: transcript mapping and DNA sequence. J Mol Appl Genet. 1982; 1 (6): 561-73) or the ocs terminator (Gielen, J, de Beuckeleer, M, Seurinck, J, Debroek, H, de Greve, H , Lemmers, M, van Montagu, M,

Schell, J (1984) The complete sequence of the TL-DNA of the Agrobacterium tumefaciens plasmid pTiAchδ. EMBO J. 3: 835-846).

Manipulations which provide suitable restriction sites or which remove superfluous DNA or restriction sites can also be used. Where insertions, deletions or substitutions such as, for example, transitions and transversions come into question, w ^' tro mutagenesis, "primer repair", restriction or ligation can be used.

With suitable manipulations, e.g. Restriction, "chewing-back" or filling of overhangs for "bluntends", complementary ends of the fragments can be made available for the ligation.

Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially contain T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) from Ti Plasmids correspond to pTiACHδ (Gielen et al., EMBO J. 3 (1984), 835 ff) or functional equivalents.

The transfer of foreign genes into the genome of a plant is called transformation.

Methods known per se for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation can be used for this purpose.

Suitable methods for the transformation of plants are protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene gun - the so-called "particle bombardment" method, electroporation, the incubation of dry embryos in DNA-containing solution, the Microinjection and the Agrobacterium-mediated gene transfer described above. The methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, published by S.D. Kung and R. Wu, Academic Press (1993), 128-143 and in Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225).

The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711) or particularly preferably pSUN2, pSUN3, pSUN4 or pSUN5 (WO 02/00900).

Agrobacteria transformed with an expression plasmid can be used in a known manner to transform plants, e.g. by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

For the preferred production of genetically modified plants, hereinafter also referred to as transgenic plants, the fused expression cassette which expresses a ketolase is cloned into a vector, for example pBin19 or in particular pSUN5 and pSUN3, which is suitable for being transformed into Agrobacterium tumefaciens. Agrobacteria transformed with such a vector can then be used in a known manner to transform plants, in particular cultivated plants. are used, for example, by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

The transformation of plants by agrobacteria is known, among other things, from F.F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S.D. Kung and R. Wu, Academic Press, 1993, pp. 15-38. From the transformed cells of the wounded leaves or leaf pieces, transgenic plants can be regenerated in a known manner which contain a gene integrated into the expression cassette for the expression of a nucleic acid encoding a ketolase.

To transform a host plant with a nucleic acid coding for a ketolase, an expression cassette is inserted as an insert in a recombinant vector whose vector DNA contains additional functional regulation signals, for example sequences for replication or integration. Suitable vectors are inter alia in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, pp. 71-119 (1993).

Using the recombination and cloning techniques cited above, the expression cassettes can be cloned into suitable vectors that allow their proliferation, for example in E. coli. Suitable cloning vectors include PJIT117 (Guerineau et al. (1988) Nucl. Acids Res. 16: 11380), pBR332, pUC series, M13mp series and pACYC184. Binary vectors which can replicate both in E. coli and in agrobacteria are particularly suitable.

The production of the genetically modified microorganisms according to the invention is described in more detail below:

The nucleic acids described above, coding for a ketolase or β-

Hydroxylase or β-cyclase are preferably incorporated into expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for an enzyme according to the invention; and vectors comprising at least one of these expression constructs. Such constructs according to the invention preferably comprise a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream and, if appropriate, further customary regulatory elements, in each case operatively linked to the coding sequence. An “operative linkage” is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can perform its function as intended when expressing the coding sequence.

Examples of sequences which can be linked operatively are targeting sequences as well

Translation enhancers, enhancers, polyadenylation signals and the like. Further regulatory elements include selectable markers, amplification signals, origins of replication and the like.

In addition to the artificial regulatory sequences, the natural regulatory sequence can still be present before the actual structural gene. This natural regulation can possibly be switched off by genetic modification and the

X

Expression of the genes can be increased or decreased. However, the gene construct can also have a simpler structure, ie no additional regulation signals are inserted in front of the structural gene and the natural promoter with its regulation is not removed. Instead, the natural regulatory sequence is mutated so that regulation no longer takes place and gene expression is increased or decreased. The nucleic acid sequences can be contained in one or more copies in the gene construct.

Examples of useful promoters in microorganisms are: cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac-, Ipp-lac-, laclq-, T7-, T5-, T3-, gal- , trc, ara, SP6, lambda PR or in the lambda PL promoter, which are advantageously used in gram-negative bacteria; as well as the gram-positive promoters amy and SPO2 or the yeast promoters ADC1, MFa, AC, P-60, CYC1, GAPDH. The use of inducible promoters, such as, for example, light and in particular temperature-inducible promoters, such as the P _r P _r promoter, is particularly preferred. In principle, all natural prorriotors with their regulatory sequences can be used. In addition, synthetic promoters can also be used advantageously.

The regulatory sequences mentioned are intended to enable the targeted expression of the nucleic acid sequences and the protein expression. Depending on the host organism, this can mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.

The regulatory sequences or factors can preferably have a positive influence on the expression and thereby increase or decrease it. Thus, the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or "enhancers". In addition, an increase in translation is also possible, for example, by improving the stability of the mRNA.

An expression cassette is produced by fusing a suitable promoter with the nucleic acid sequences described above, encoding a ketolase, β-hydroxylase or β-cyclase and a terminator or polyadenylation signal. Common recombination and cloning techniques are used, such as those described in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in T.J. Silhavy, M.L. Berman and L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausu, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).

For expression in a suitable host organism, the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector which enables optimal expression of the genes in the host. Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels PH et al., Ed., Elsevier, Amsterdam-New York-Oxford, 1985). In addition to plasmids, vectors also include all other vectors known to the person skilled in the art, such as, for example, phages, viruses such as SV40, CMV, baculovirus and adevirus, transposons, IS elements, phasmids, cosmids, and linear or circular Understand DNA. These vectors can be replicated autonomously in the host organism or replicated chromosomally.

The following may be mentioned as examples of suitable expression vectors:

Common fusion expression vectors such as pGEX (Pharmacia Biotech ine; Smith, DB and Johnson, KS (1988) Gene 67: 31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT 5 (Pharmacia, Piscataway, NJ) which glutathione-S-transferase (GST), maltose E-binding protein or protein A is fused to the recombinant target protein.

Non-fusion protein expression vectors such as pTrc (Amann et al., (1988) Gene 69: 301-315) and pET 11d (Studier et al. Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (19gθ) 60-89) or pBluescript and pUC vectors.

Yeast expression vector for expression in the yeast S. cerevisiae, such as pYepSed (Baldari et al., (1987) Embo J. 6: 229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30: 933-943) , pJRY88 (Schultz et al. (1987) Gene 54: 113-123) and pYES2 (Invitrogen Corporation, San Diego, CA).

Vectors and methods of constructing vectors suitable for use in other fungi such as filamentous fungi include those described in detail in: van den Hondel, C.A.M.J.J. & Punt, P.J. (1991) "Gene transfer Systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, J.F. Peberdy et al., Eds., Pp. 1-28, Cambridge University Press: Cambridge.

Baculovirus vectors available for expression of proteins in cultured insect cells (e.g. Sf9 cells) include the pAc series (Smith et al., (1983) Mol. Cell Biol .. 3: 2156-2165) and pVL series (Lucklow and Summers (1989) Virology 170: 31-39).

Further suitable expression systems for prokaryotic and eukaryotic cells are in chapters 16 and 17 of Sambrook, J., Fritsch, EF and Maniatis, T., Molecular cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press , Cold Spring Harbor, NY, 1989. The expression constructs or vectors according to the invention can be used to produce genetically modified microorganisms which have been transformed, for example, with at least one vector according to the invention.

The recombinant constructs according to the invention described above are advantageously introduced and expressed in a suitable host system. Common cloning and transfection methods known to the person skilled in the art, such as, for example, co-precipitation, protoplast fusion, electroporation, retroviral transfection and the like, are preferably used to bring the nucleic acids mentioned into expression in the respective expression system. Suitable systems are described, for example, in Current Protocols in Molecular Biology, F. Ausubel et al., Ed., Wiley Interscience, New York 1997.

Successfully transformed organisms can be selected using marker genes, which are also contained in the vector or in the expression cassette. Examples of such marker genes are genes for antibiotic resistance and for enzymes which catalyze a coloring reaction which stains the transformed cell. These can then be selected using automatic cell sorting.

Microorganisms successfully transformed with a vector and carrying an appropriate antibiotic resistance gene (e.g. G418 or hygromycin) can be selected using appropriate antibiotic-containing media or nutrient media. Marker proteins that are presented on the cell surface can be used for selection by means of affinity chromatography.

The combination of the host organisms and the vectors which match the organisms, such as plasmids, viruses or phages, such as, for example, plasmids with the RNA polymerase / promoter system, which forms phages 8 or other temperate phages or transposons and / or further advantageous regulatory sequences an expression system.

The invention further relates to a method for producing genetically modified organisms, characterized in that a nucleic acid construct comprising functionally linked a promoter and nucleic acids encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which a Identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2, and optionally introduces a terminator into the genome of the starting organism or extrachromosomally into the starting organism.

The invention further relates to the genetically modified organisms, the genetic modification being the activity of a ketolase

A in the event that the wild-type organism already has ketolase activity, increased compared to the wild-type and

B in the event that the wild-type organism has no ketolase activity against the wild-type

and the ketolase activity increased after A or caused after B is caused by a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

As stated above, the ketolase activity is increased or caused compared to the wild type, preferably by increasing or causing the gene expression of a nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

In a further preferred embodiment, as stated above, the gene expression of a nucleic acid, coding for a ketolase, is increased or caused by introducing nucleic acids, coding for a ketolase, into the plants and thus preferably for overexpression or transgenic expression of nucleic acids, coding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has. The invention further relates to a genetically modified organism containing at least one transgenic nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has. This is the case if the starting organism has no ketolase or an endogenous ketolase and a transgenic ketolase is overexpressed.

The invention further relates to a genetically modified organism containing at least two endogenous nucleic acids encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has. This is the case if the starting organism has an endogenous ketolase and the endogenous ketolase is overexpressed.

Particularly preferred, genetically modified organisms, as mentioned above, additionally have an increased hydroxlase activity and / or β-cyclase activity compared to a wild-type organism. Further preferred embodiments are described above in the method according to the invention.

Both bacteria can be used as bacteria which, due to the introduction of genes of the carotenoid biosynthesis of a carotenoid-producing organism, must be able to synthesize xanthophylls, such as, for example, bacteria of the genus Escherichia, which, for example, contain crt genes from Erwinia, and also bacteria which are capable of synthesizing xanthophylls, such as, for example, bacteria of the genus Erwinia, Agrobacterium , Flavobacterium, Alcaligenes, Paracoccus, Nostoc or cyanobacteria of the genus Synechocystis.

Preferred bacteria are Escherichia coli, .Erwinia herbicola, Erwinia uredovora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobacterium sp. strain R1534, the Cyanobacterium Synechocystis sp. PCC6803, Paracoccus marcusii or Paracoccus carotinifaciens.

Preferred fungi are Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium or others in Indian Chem. Engr. Section B. Vol. 37, No. 1, 2

X

(1995) on page 15, table 6 described mushrooms.

Further useful microorganisms and their preparation for carrying out the method according to the invention are known, for example, from DE-A-199 16 140, to which reference is hereby made.

Particularly preferred plants are plants selected from the Ranuncu-laceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Lina- ceae, Vitaceae, Brassicaceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Amaranthaceae, Geraniaceaeaceae, Gentianaceaeaea, Gentianaceae , • Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Orchidaceae, Malvaceae, liliaceae or Lamiaceae.

Very particularly preferred plants are selected from the group of the plant species chard, tagetes errectta, tagetes patula, acacia, aconite, adonis, ami ca, Aquilegia, Aster, Astragalus, Bignonia, Calenduia, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Foria, Forsy Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Laburnum, Lathyrus, Leontodon, Lili- um, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ulex, Viola or Zinnia, particularly preferably selected from the group of the plant genera Marigold, Tagetes erecta, Tagetes patula, Lycopersicon, Rosa, ^" Calend uia, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium, Tropaeolum or Adonis.

Very particularly preferred genetically modified plants are selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Adonis, Lycopersicon; Rosa, Calenduia, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium or Tropaeolum, the genetically modified plant containing at least one transgenic nucleic acid, coding for a ketolase.

The present invention further relates to the transgenic plants, their reproductive material and their plant cells, tissue or parts, in particular their fruits, seeds, flowers and petals.

As described above, the genetically modified plants can be used to produce ketocarotenoids, in particular astaxanthin.

Genetically modified organisms according to the invention which can be consumed by humans and animals, in particular plants or parts of plants, such as in particular petals with an increased content of ketocarotenoids, in particular astaxanthin, can also be used, for example, directly or after processing known per se as foods or feeds or as feed and food supplements become. Furthermore, the genetically modified organisms can be used for the production of ketocarotenoid-containing extracts of the organisms and / or for the production of feed and food supplements.

The genetically modified organisms have an increased ketocarotenoid content compared to the wild type.

An increased ketocarotenoid content is generally understood to mean an increased total ketocarotenoid content.

An increased content of ketocarotenoids is also understood to mean, in particular, a changed content of the preferred ketocarotenoids, without the total carotenoid content necessarily having to be increased.

In a particularly preferred embodiment, the genetically modified plants according to the invention have an increased astaxanthin content compared to the wild type.

X

In this case, an increased content is also understood to mean a caused content of ketocarotenoids or astaxanthin.

The invention further relates to the new ketolases and the new nucleic acids encoding them.

In particular, the invention relates to ketolases containing the amino acid sequence SEQ. ID. NO. 8 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 8, with the proviso that the amino acid sequences SEQ ID NO: 4 is not included. The sequence SEQ ID NO: 4, as mentioned above, is annotated as a putative protein in databases.

The invention further relates to ketolases containing the amino acid sequence SEQ. ID. NO. 6 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% on amino acid level with the sequence SEQ. ID. NO. 6 has. The sequence SEQ ID NO: 6, as mentioned above, is not annotated in databases.

In a further embodiment, the invention relates to ketolases containing the amino acid sequence SEQ. ID. NO. 12 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 12, with the proviso that the amino acid sequences SEQ ID NO: 6 is not included.

The invention further relates to ketolases containing the amino acid sequence SEQ. ID. NO. 49 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 50%, preferably at least 60%, particularly preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 49, with the proviso that the amino acid sequences SEQ ID NO: 47 is not included. The sequence SEQ ID NO: 47 is, as mentioned above, annotated as a putative protein in databases.

The invention further relates to nucleic acids encoding a protein described above, with the proviso that the nucleic acid does not contain the sequence SEQ ID NO: 5.

Surprisingly, it was found that a protein containing the amino acid sequence SEQ. ID. NO. 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 4 and has the property of a ketolase, has a property as a ketolase.

The invention therefore also relates to the use of a protein containing the amino acid sequence SEQ. ID. NO. 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the SEQ sequence. ID. NO. 4 and has the property of a ketolase as a ketolase.

Furthermore, it was surprisingly found that a protein containing the amino acid sequence SEQ. ID. NO. 6 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 65%, preferably at least 70%, preferably at least 75%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level with the SEQ sequence. ID. NO. 6 and has the property of a ketolase, has a property as a ketolase.

The invention therefore also relates to the use of a protein containing the amino acid sequence SEQ. ID. NO. 6 or one of this sequence by substitution,

Insertion or deletion of amino acid-derived sequence which has an identity of at least 65%, preferably at least 70%, preferably at least 75%, x particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95% at the amino acid level the sequence SEQ. ID. NO. 6 and has the property of a ketolase as a ketolase.

Furthermore, it was surprisingly found that a protein containing the amino acid sequence SEQ. ID. NO. 47 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 50%, preferably at least 60%, preferably at least 70%, particularly preferably at least 80%, more preferably at least 85%, more preferably at least 90% , more preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO. 47 and has the property of a ketolase, has a property as a ketolase.

The invention therefore also relates to the use of a protein containing the amino acid sequence SEQ. ID. NO. 47 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 50%, preferably at least 60%, preferably at least 70%, particularly preferably at least 80%, more preferably at least 85% at least 90%, more preferably at least 95% at the amino acid level with the SEQ sequence. ID. NO. 47 and has the property of a ketolase as ketolase.

In comparison to the processes of the prior art, the process according to the invention provides a higher amount of ketocarotenoids, in particular astaxanthin with a lower amount of hydroxylated by-products.

The invention is illustrated by the following examples, but is not limited to these:

General experimental conditions: Sequence analysis of recombinant DNA

The sequencing of recombinant DNA molecules was carried out using a laser fluorescence DNA sequencer from Licor (distributed by MWG Biotech, Ebersbach) according to the

Sanger's method (Sanger et al., Proc. Natl. Acad. Sci. USA 74 (1977), 5463-5467).

Example 1 :

Amplification of a DNA that contains the entire primary sequence of the NOST ketolase from Nostoc sp. PCC 7120 coded

The DNA required for the NOST ketolase from Nostoc sp. PCC 7120 coded, was by means of PCR from Nostoc sp. PCC 7120 (strain of the "Pasteur Culture Collection of Cyanobacterium") amplified.

For the preparation of genomic DNA from a suspension culture from Nostoc sp. PCC 7120, the 1 week with continuous light and constant shaking (150 rpm) at 25 ° C in BG 77 medium (1.5 g / l NaN03, 0.04 g / l K2P04x3H2O, 0.075 g / l MgSO4xH2O, 0.036 g / l CaCI2x2H2O, 0.006 g / l citric aeid, 0.006 g / l ferric ammonium citrate, 0.001 g / l EDTA disodium magnesium, 0.04 g / l Na2CO3, 1 ml trace metal mix A5 + Co (2.86 g / l

H3BO3, 1.81 g / l MnCI2x4H2o, 0.222 g / i ZnSO4x7H2o, 0.39 g / l NaMoO4X2H2o, 0.079 g / l CuSO4x5H2O, 0.0494 g / l Co (NO3) 2x6H2O), the cells were harvested by centrifugation, nitrogen was harvested, by centrifugation and powdered in a mortar. Protocol for DNA isolation from Nostoc PCC7120:

The bacterial cells were pelleted from a 10 ml liquid culture by centrifugation at 8,000 rpm for 10 minutes. The bacterial cells were then crushed and ground in liquid nitrogen using a mortar. The cell material was resuspended in 1 ml of 10 mM Tris HCl (pH 7.5) and transferred to an Eppendorf reaction vessel (2 ml volume). After adding 100 μl Proteinase K (concentration: 20 mg / ml), the cell suspension was incubated for 3 hours at 37 ° C. The suspension was then extracted with 500 μl of phenol. After centrifugation at 13,000 rpm for δ minutes, the upper, aqueous phase was transferred to a new 2 ml Eppendorf reaction vessel. The extraction with phenol was repeated 3 times. The DNA was precipitated by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 0.6 volume of isopropanol and then washed with 70% ethanol. The DNA pellet was dried at room temperature, taken up in 25 μl of water and dissolved with heating to 65 ° C.

The nucleic acid encoding a ketolase from Nostoc PCC 7120 was determined by means of a "polymerase chain reaction" (PCR) from Nostoc sp. PCC 7120 was amplified using a sense-specific primer (NOSTF, SEQ ID No. 19) and an antisense-specific primer (NOSTG SEQ ID No. 20).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture which contained:

1 ul of a Nostoc sp. PCC 7120 DNA (prepared as described above) 0.25 mM dNTPs - 0.2 mM NOSTF (SEQ ID No. 19) 0.2 mM NOSTG (SEQ ID No. 20) 5 ul 10X PCR buffer (TAKARA) 0.25 ul R Taq polymerase (TAKARA) 25.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions: 1X 94 ° C 2 minutes 35X 94 ° C 1 minute 55 ° C 1 minutes 72 ° C 3 minutes

1X 72 ° C 10 minutes

PCR amplification with SEQ ID No. 19 and SEQ ID No. 20 resulted in an 805 bp fragment that codes for a protein consisting of the entire primary sequence (SEQ ID No. 21). Using standard methods, the amplificate was cloned into the PCR cloning vector pGEM-T (Promega) and the clone pNOSTF-G was obtained.

Sequencing of the clone pNOSTF-G with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence from 88.886-89.662 of the database entry AP003592. This nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nostoc sp. PCC 7120.

This clone pNOSTF-G was therefore used for the cloning into the expression vector pJIT117 (Guerineau et al. I g88, Nucl. Acids Res. 16: 11380). Cloning was carried out by isolating the 799 bp Sphl fragment from pNOSTF-G and ligation into the Sphl cut vector pJIT117. The clone that is the ketolase from Nostoc sp. PCC 7120, in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide, is called pJNOST.

Example 2:

Construction of the plasmid pMCL-CrtYlBZ / idi / gps for the synthesis of zeaxanthin in

E. coli

PMCL-CrtYlBZ / idi / gps was constructed in three steps using the intermediate stages pMCL-CrtYlBZ and pMCL-CrtYlBZ / idi. The plasmid pMCL200 compatible with high-copy-number vectors was used as the vector (Nakano, Y., Yoshida, Y., Yamashita, Y. and Koga, T .; Construction of a series of pACYC-derived plasmid vectors; Gene 162 ( 1995), 157-158). Example 2.1. : Construction of pMCL-CrtYlBZ

The biosynthetic genes crtY, crtB, crtl and crtZ come from the bacterium Erwinia ure- dovora and were amplified by PCR. Erwinia uredovora genomic DNA (DSM 30080) was prepared by the German Collection of Microorganisms and Cell Culture (DSMZ, Braunschweig) as part of a service. The PCR reaction was carried out according to the manufacturer's instructions (Röche, Long Template PCR: Procedure for amplification of 5-20 kb targets with the expand long template PCR system). The PCR conditions for the amplification of the Erwinia uredovora biosynthesis cluster were as follows:

Master Mix 1:

1.75 ul dNTPs (final concentration 350 μM) 0.3 μM Primer Crt1 (SEQ ID No. 22) - 0.3 μM Primer Crt2 (SEQ ID No. 23)

250-500ng genomic DNA from DSM 30080 Aq. Dest. Up to a total volume of 50 ul x

Master Mix 2:

5 ul 10x PCR buffer 1 (final concentration 1x, with 1.75 mM Mg2 +) 10x PCR buffer 2 (final concentration 1 x, with 2.25 mM Mg2 +) 10x PCR buffer 3 (final concentration 1 x, with 2.25 mM Mg2 +) 0.75 ul Expand Long Template Enzyme Mix (Final concentration 2.6 units) Aq. Dest. Up to a total volume of 50 μl

The two approaches "Master Mix 1" and "Master Mix 2" were pipetted together. The PCR was carried out in a total volume of 50 μl under the following cycle conditions:

1X 94 ° C 2 minutes 30X 94 ° C 30 seconds 58 ° C 1 minute 68 ° C 4 minutes 1 X 72 ° C 10 minutes PCR amplification with SEQ ID No. 22 and SEQ ID No. 23 resulted in a fragment (SEQ ID NO: 24), which for the genes CrtY (protein: SEQ ID NO: 25), CrtI (protein: SEQ ID NO: 26), crtB (protein: SEQ ID NO: 27) and CrtZ (iDNA) encoded. Using standard methods, the amplificate was cloned into the PCR cloning vector pCR2.1 (Invitrogen) and the clone pCR2.1-CrtYIBZ was obtained.

The plasmid pCR2.1-CrtYIBZ was cut Sall and Hindill, the resulting Sall / Hindlll fragment isolated and transferred by ligation into the Sall / Hindlll cut vector pMCL200. The Sall / Hindlll fragment from pCR2.1-CrtYIBZ cloned in pMCL 200 is 4624 bp long, codes for the genes CrtY, CrtI, crtB and CrtZ and corresponds to the sequence from positions 2295 to 6918 in D90087 (SEQ ID No. 24). The resulting clone is called pMCL-CrtYlBZ.

Example 2.2 .: Construction of pMCL-CrtYlBZ / idi The gene / d / ^' (isopentenyl diphosphate isomerase; IPP isomerase) was amplified from E coli by means of PCR. The nucleic acid encoding the entire / cf gene with idi promoter and ribosome binding site was extracted from E. coli by means of "polymerase chain reaction" (PCR) using a sense-specific primer (5'-idi SEQ ID No. 28) and an antisense-specific primer (3'-idi SEQ ID No.29).

The PCR conditions were as follows:

The PCR for the amplification of the DNA was carried out in a 50 μl reaction mixture, which contained:

1 ul of an E. coli TOP10 suspension 0.25 mM dNTPs 0.2 mM 5'-idi (SEQ ID No. 28) 0.2 mM 3'-idi (SEQ ID No. 29) - 5 ul 10X PCR buffer (TAKARA)

0.25 ul R Taq Polymerase (TAKARA) 28.8 ul Aq. least

The PCR was carried out under the following cycle conditions: 1X 94 ° C 2 minutes 20X 94 ° C 1 minute

62 ° C1 minute

72 ° C 1 minute 1 X 72 ° C 10 minutes

PCR amplification with SEQ ID No. 28 and SEQ ID No. 29 resulted in a 679 bp fragment coding for a protein consisting of the entire primary sequence (SEQ ID No. 30). Using standard methods, the amplificate was cloned into the PCR cloning vector pCR2.1 (Invitrogen) and the clone pCR2.1-idi was obtained.

Sequencing of the clone pCR2.1-idi confirmed a sequence that does not differ from the published sequence AE000372 in position 8774 to position 9440. This region comprises the promoter region, the potential ribosome binding site and the entire "open reading frame" for the IPP isomerase. The fragment cloned into pCR2.1-idi has a total length of 679 bp by inserting an Xhol site at the 5 'end and a SalI site at the 3' end of the gene.

This clone was therefore used for the cloning of the / oY gene in the vector pMCL-CrtYlBZ. The cloning was carried out by isolating the Xhol / Sall fragment from pCR2.1-idi and ligating into the Xhol / Sall cut vector pMCL-CrtYlBZ. The resulting clone is called pMCL-CrtYlBZ / idi.

Example 2.3 .: Construction of pMCL-CrtYlBZ / idi / gps

The gene gps (geranylgeranyl pyrophosphate synthase; GGPP synthase) was amplified from Archaeoglobus fulgidus by means of PCR. The nucleic acid, encoding gps from Archaeoglobus fulgidus, was determined by means of "polymerase chain reaction" (PCR) using a sense-specific primer (5'-gps SEQ ID No. 32) and an anti-sense-specific primer (3'-gps SEQ ID No. 33).

The DNA of Archaeoglobus fulgidus was prepared by the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig) as part of a service. The PCR conditions were as follows: The PCR for the amplification of the DNA, which codes for a GGPP synthase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture which contained:

- 1 µl of Archaeoglobus fulgidus DNA 0.25 mM dNTPs 0.2 mM 5'-gps (SEQ ID No. 32) 0.2 mM 3'-gps (SEQ ID No. 33) 5 µl 10X PCR buffer (TAKARA) - 0.25 µl R Taq Polymerase (TAKARA) 28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X 94 ° C 2 minutes 20X 94 ° C 1 minute

56 ° C for 1 minute

72 ° C 1 minute 1 X 72 ° C 10 minutes

Using PCR and the primers SEQ ID No. 32 and SEQ ID No. 33 amplified DNA fragments were eluted from the agarose gel using methods known per se and cut with the restriction enzymes Ncol and Hindill. This results in a 962 bp fragment which codes for a protein consisting of the entire primary sequence (SEQ ID No. 34). Using standard methods, the Ncol / HindIII cut amplificate was cloned into the vector pCB97-30 and the clone pCB-gps was obtained.

Sequencing of the clone pCB-gps confirmed a sequence for the GGPP synthase from A. fulgidus, which differs from the published sequence AF120272 in one nucleotide. The second codon of the GGPP synthase was changed by inserting an Ncol site in the gps gene. In the published sequence AF120272, CTG (position 4-6) codes for leucine. By amplification with the two primers SEQ ID No. 32 and SEQ ID No. In 33 this second codon was changed to GTG, which codes for valine. The clone pCB-gps was therefore used for the cloning of the gps gene into the vector pMCL-CrtYlBZ / idi. The cloning was carried out by isolating the Kpnl / Xhol fragment from pCB-gps and ligation into the Kpnl and Xhol cut vector pMCL-CrtYlBZ / idi. The cloned Kpnl / Xhol fragment (SEQ ID No. 34) carries the Prm16 promoter together with a minimal 5 'UTR sequence of rbcL, the first 6 codons of rbcL, which extend the GGPP synthase N-terminally, and 3 'from the gps gene the psbA sequence. The N-terminus of the GGPP synthase thus has the changed amino acid sequence Met-Thr-Pro-Gln-Thr-Ala-Met instead of the natural amino acid sequence with Met-Leu-Lys-Glu (amino acid 1 to 4 from AF120272) -Val-Lys- GIu. As a result, the recombinant GGPP synthase, starting with Lys in position 3 (in AF120272), is identical and has no further changes in the amino acid sequence. The rbcL and psbA sequences were based on a reference according to Eibl et al. (Plant J. 1. (I 99), 1-13). The resulting clone is called pMCL-CrtYlBZ / idi / gps.

Example 3:

Biotransformation of zeaxanthin in recombinant E. coli strains

X

For zeaxanthin biotransformation, recombinant E. co // strains were produced which are capable of producing zeaxanthin by heterologous complementation. Strains of E. coli TOP10 were used as host cells for the complementation experiments with the plasmids pNOSTF-G and pMCL-CrtYlBZ / idi / gps.

The plasmid pMCL-CrtYlBZ / idi / gps was constructed in order to produce E. co // strains which enable the synthesis of zeaxanthin in high concentrations. The plasmid carries the genes crtY, crtB, crtl and crtY from Erwinia uredovora, the gene gps (for geranylgeranyl pyrophoshate synthastase) from Archaeoglobus fulgidus and the gene / ^ / (isopentenyl diphosphate isomerase) from E. coli. Limiting steps for a high accumulation of carotenoids and their biosynthetic precursors were eliminated with this construct. This was previously reported by Wang et al. similarly described with several plasmids (Wang, C.-W., Oh, M.-K. and Liao, JC; engineered isoprenoid pathway enhancements astaxanthin production in Escherichia coli, Biotechnology and Bioengineering 62 (1999), 235-241). Cultures of E. coli TOP 10 were transformed in a known manner with the two plasmids pNOSTF-G and pMCL-CrtYlBZ / idi / gps and cultured in LB medium at 30 ° C. and 37 ° C. overnight. Ampicillin (50 μg / ml), chloramphenicol (50 μg / ml) and isopropyl-β-thiogalactoside (1 mmol) were also added overnight in a conventional manner.

To isolate the carotenoids from the recombinant strains, the cells were extracted with acetone, the organic solvent was evaporated to dryness and the carotenoids were separated by means of HPLC on a C30 column. The following procedural conditions were set.

Separation column: Prontosil C30 column, 250 x 4.6 mm, (Bischoff, Leonberg)

Flow rate: 1.0 ml / min

Eluents: mobile phase A - 100% methanol

Mobile solvent B - 80% methanol, 0.2% ammonium acetate

Mobile phase C - 100% t-butyl methyl ether

Detection: 300 - 500 nm

The spectra were determined directly from the elution peaks using a photodiode array detector. The isolated substances were identified by their absorption spectra and their retention times in comparison to standard samples.

Figure 1 shows the chromatographic analysis of a sample obtained from an E. co // strain transformed with pNOSTF-G and pMCL-CrtYlBZ / idi / gps. It appears, that this strain can synthesize various ketocarotenoids due to the heterologous complementation. With increasing retention time, astaxanthin (peak 1), adonirubin (peak 2) and canthaxanthin (peak 3) are eluted.

Example 3.1

Comparative example

Analogously to the previous examples, a E. coli strain was produced as a comparative example, which contains a ketolase from Haematococcus pluvialis Flotow em. Will expressed. For this purpose, the cDNA was used for the entire primary sequence of the ketolase from Haematococcus pluvialis Flotow em. Wille coded amplified and cloned into the same expression vector according to Example 1.

The cDNA coding for the ketolase from Haematococcus pluvialis was amplified by means of PCR from Haematococcus pluvialis (strain 192.80 from the "Collection of algal cultures of the University of Göttingen") suspension culture. For the preparation of total RNA from a suspension culture of Haematococcus pluvialis (strain 192.80), which with indirect daylight at room temperature for 2 weeks in Haematococcus medium (1.2 g / l sodium acetate, 2 g / l yeast extract, 0.2 g / l MgCI2x6H2O , 0.02 CaCI2x2H2O; pH 6.8; after autoclaving 400 mg / l L-Asparagine, 10 mg / l FeSO4xH2O) had been grown, the cells were harvested, frozen in liquid nitrogen and pulverized in a mortar. Then 100 mg of the frozen, pulverized algae cells were transferred to a reaction vessel and taken up in 0.8 ml of Trizol buffer (Life Technologies). The suspension was extracted with 0.2 ml chloroform. After centrifugation at 12,000 g for 15 minutes, the aqueous supernatant was removed and transferred to a new reaction vessel and extracted with a volume of ethanol. The RNA was precipitated with a volume of isopropanol, washed with 75% ethanol and the pellet dissolved in DEPC water (overnight incubation of water with 1/1000 volume of diethyl pyrocarbonate at room temperature, then autoclaved). The RNA concentration was determined photometrically.

For the cDNA synthesis, 2.5 μg of total RNA were denatured for 10 min at 60_C, cooled on ice for 2 min and used using a cDNA kit (ready-to-go-you-prime-beads, Pharmacia Biotech) according to the manufacturer's instructions of an antisense-specific primer PR1 (gcaagctcga cagctacaaa cc) was rewritten in cDNA. The nucleic acid encoding a kematolase from Haematococcus pluvialis (strain 192.80) was amplified by means of a polymerase chain reaction (PCR) from Haematococcus pluvialis using a sense-specific primer PR2 (gaagcatgca gctagcagcg acag) and an antisense-specific primer PR1.

The PCR conditions were as follows:

The PCR for the amplification of the cDNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 ml reaction mixture which contained:

4 ml of a Haematococcus pluvialis cDNA (prepared as described above). 0.25 mM dNTPs

0.2 mM PR1 - 0.2 mM PR2

5 ml 10X PCR buffer (TAKARA) 0.25 ml R Taq Polymerase (TAKARA)

25.8 ml Aq. Dest. ^X

The PCR was carried out under the following cycle conditions:

1X 94_C 2 minutes 35X 94_C 1 minute

53_C 2 minutes 72_C 3 minutes

1X 72 C 10 minutes

The PCR amplification with PR1 and PR2 resulted in a 1155 bp fragment consisting encodes a protein consisting of the entire primary sequence: gaagcatgca gctagcagcg acagtaatgt tggagcagct taccggaagc gctgaggcac 60 tcaaggagaa ggagaaggag gttgcaggca gctctgacgt gttgcgtaca tgggcgaccc 120 agtactcgct tccgtcagag gagtcagacg cggcccgccc gggactgaag aatgcctaca 180 agccaccacc ttccgacaca aagggcatca caatggcgct agctgtcatc ggctcctggg 240 ccgcagtgtt cctccacgcc atttttcaaa tcaagcttcc gacctccttg gaccagctgc 300 actggctgcc cgtgtcagat gccacagctc agctggttag cggcagcagc agcctgctgc 360 acatcgtcgt agtattcttt gtcctggagt tcctgtacac aggccttttt atcaccacgc 420 atgatgctat gcatggcacc atcgccatga gaaacaggca gcttaatgac ttcttgggca 480 gagtatgcat ctccttgtac gcctggtttg attacaacat gctgcaccgc aagcattggg 540 agcaccacaa ccacactggc gaggtgggca aggaccctga cttccacagg ggaaaccctg 600 gcattgtgcc ctggtttgcc agcttcatgt ccagctacat gtcgatgtgg cagtttgcgc 660 gcctcgcatg gtggacggtg gtcatgcagc tgctgggtgc gccaatggcg aacctgctgg 720 tgttcatggc ggccgcgccc atcctgtccg ccttccgctt gttctacttt ggcacgtaca 780 tgccccacaa gcctgagcct ggcgccgcgt caggctcttc accagccgtc atgaactggt 840 ggaagtcgcg cactagccag gcgtccgacc tggtcagctt tctgacctgc taccacttcg 900 acctgcactg ggagcaccac cgctggccct ttgccccctg gtgggagctg cccaactgcc 960 gccgcctgtc tggccgaggt ctggttcctg cctagctgga cacactgcag tgggccctgc 1020 tgccagctgg gcatgcaggt tgtggcagga ctgggtgagg tgaaaagctg caggcgctgc 1080 tgccggacac gctgcatggg ctaccctgtg tagctgccgc cactagggga gggggtttgt 1140 agctgtcgag cttgc

Using standard methods, the amplificate was cloned into the PCR cloning vector pGEM-Teasy (Promega) and the clone pGKETO2 was obtained.

Sequencing of the clone pGKETO2 with the T7 and SP6 primers confirmed a sequence which differs from the published sequence X86782 only in the three codons 73, 114 and 119 in one base each. These nucleotide changes were reproduced in an independent amplification experiment and now represent the nucleotide sequence in the Haematococcus pluvialis strain 192.80 used.

This clone was used for the cloning in the expression vector described in Example 1. The cloning was carried out analogously to that described in Example 1. The transformation of the E. coli strains, their cultivation and the analysis of the carotenoid profile were carried out as described in Example 3.

Figure 2 shows the chromatographic analysis of a sample obtained from an E. co // strain transformed with this expression vector and pMCL-CrtYlBZ / idi / gps. Using a ketolase from Haematococcus pluvialis, as described for example in EP 725137, elute with increasing retention time astaxanthin (peak 1), adonixanthin (peak 2) and unreacted zeaxanthin (peak 3). This carotenoid profile has already been described in EP 0725137.

Table 1 shows a comparison of the bacterially produced amounts of carotenoids:

Table 1: Comparison of the bacterial ketocarotenoid synthesis using two different ketolases, the NOST ketolase from Nostoc sp. PCC7120 (Example 3) and the ketolase from Haematococcus pluvialis as a comparative example (Example 3.1). Amounts of carotenoids are given in ng / ml culture fluid.

The expression of the ketolase from Nostoc sp. Strain PCC7120 leads to a carotenoid pattern, which differs significantly from the carotenoid pattern after expression of a ketolase from Haematococcus pluvialis. While the keto lens from the prior art provides the desired ketocarotenoid astaxanthin only incompletely, astaxanthin is the main product when using the ketolase according to the invention. In the process according to the invention, hydroxylated by-products occur in a significantly smaller amount.

Example 4:

Production of expression vectors for the constitutive expression of Nostoc sp. PCC 7120 NOST-Ketolase in Lycopersicon esculentum and Tagetes erecta. ^/

The expression of the NOST ketolase from Nostoc sp. PCC7120 in Lesculentum and in Tagetes erecta was carried out under control of the constitutive promoter FNR (ferredoxin-NADPH-oxidoreductase, database entry AB011474 position 70127 to 69493; WO03 / 006660) from Arabidopsis thallana. The FNR gene begins at base pair 69492 and is annotated with "ferredoxin-NADP + reductase". Expression was carried out using the pea transit peptide rbcS (Anderson et al. 1986, Biochem J. 240: 709-715).

The DNA fragment containing the FNR promoter region from Arabidopsis thallana was PCR-analyzed using genomic DNA (isolated from Arabidopsis thallana according to standard methods) as well as the primers FNR-A (SEQ ID No.38) and FNR-B (SEQ ID No. 39).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which contains the FNR promoter fragment FNR # 1), was carried out in a 50 μl reaction mixture which contained: 100 ng genomic DNA from A.thaliana 0.25 mM dNTPs 0.2 mM FNR-A (SEQ ID No. 38) 0.2 mM FNR-B (SEQ ID No. 39) - 5 μl IOX PCR buffer (Stratagene)

0.25 µl Pfu Polymerase (Stratagene) 28.8 µl Aq. Least.

The PCR was carried out under the following cycle conditions:

1X 94 ° C 2 minutes 35X g4 ° C 1 minute 50 ° C 1 minute 72 ° C 1 minute 1 X 72 ° C 10 minutes

The 647 bp amplificate was determined using standard methods in the PCR

X

Cloning vector pCR 2.1 (Invitrogen) cloned and the plasmid pFNR # 1 obtained.

Sequencing of clone pFNR # 1 confirmed a sequence which corresponds to a sequence section on chromosome 5 of Arabidopsis thaliana (database entry AB011474; WO03 / 006660) from position 70127 to 6g4g3. The FNR gene begins - at base pair 6g4 2 and is annotated with "ferredoxin-NADP + reductase".

pFNR was therefore used for cloning into the expression vector pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380).

The cloning was carried out by isolating the 637 bp Sacl-Hindlll fragment from pFNR # 1 (partial Sacl hydrolysis) and ligating into the Sacl-Hindlll cut vector pJIT117. The clone that contains the promoter FNR # 1 instead of the original promoter d35S is called pJITFNR.

To produce an expression cassette pJFNRNOST, the 799 bp SpHI fragment NOSTF-G (described in Example 1) was cut into the SpHI vector pJITFNR cloned. The clone that contains the fragment NOSTF-G in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJFNRNOST.

An expression cassette for the Agrobacterium -mediated transformation of the ketolase from Nostoc into lesculentum was produced using the binary vector pSUN3 (WO0200900).

To produce the expression vector pS3FNR: NOST (MSP101), the 2,425 bp Sacl-Xhol fragment (partial Sacl hydrolysis) from pJFNRNOST was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 3, construct map). In Figure 3 fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP fragment the rbcS transit peptide from pea (194 bp), fragment Nost Ketolase CDS (777 bp) the entire primary sequence coding for the Nostoc Ketolase, fragment 35S Term (746 bp) the polyadenylation signal of CaMV.

An expression cassette for the Agrobacterium-vet rMeWe transformation of the expression vector with the ketolase from Nostoc in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).

To produce the Tagetes expression vector pS5FNR: NOST (MSP102), the 2,425 bp Sacl-Xhol fragment (partial Sacl hydrolysis) from pJFNRNOST was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 4, construct map). In Figure 4, fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS transit peptide the rbcS transit peptide from pea (1 g4 bp), fragment Nost ketolase (777 bp) the entire primary sequence, coding for the nostoc ketolase, fragment 35S Terminator (746 bp) the CaMV polyadenylation signal.

Example 5:

Production of expression vectors for the flower-specific expression of Nostoc sp. PCC 7120 NOST-Ketolase in Lycopersicon esculentum and Tagetes erecta.

The expression of the ketolase from Nostoc in L. esculentum and Tagetes erecta was carried out with the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715). The expression was carried out under the control of a modified version AP3P of the flower-specific promoter AP3 from Arabidopsis thaliana (AL132971: nucleotide region 9298-10200; Hill et al. (1998) Development 125: 1711-1721). The DNA fragment, which contains the AP3 promoter region -902 to +15 from Arabidopsis thalia- na, was PCR-analyzed using genomic DNA (isolated from Arabidopsis thaliana according to standard methods) and the primers AP3-1 (SEQ ID No.41) and AP3 -2 (SEQ ID No. 42).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which contains the AP3 promoter fragment (-902 to +15), was carried out in a 50 μl reaction mixture, which contained:

100ng of A. thaliana genomic DNA

0.25 mM dNTPs

0.2 mM AP3-1 (SEQ ID No. 41)

0.2 mM AP3-2 (SEQ ID No. 42) - 5 ul IOX PCR buffer (Stratagene)

0.25 µl Pfu polymerase (Stratagene)

28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1 X 94 ° C 2 minutes 35X 94 ° C 1 minute 50 ° C 1 minute 72 ° C 1 minute 1X 72 ° C 10 minutes

The 2 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pAP3 was obtained.

Sequencing of the clone pAP3 confirmed a sequence consisting only of an insertion (a G in position g765 of the sequence AL132g71) and a base exchange (a G instead of an A in position g726 of the sequence AL132971) of the published AP3 sequence (AL132g71, nucleotide region g2g8-10200) differs. These nucleotide differences were reproduced in an independent amplification experiment and thus represent the actual nucleotide sequence in the Arabidopsis thaliana plants used.

The modified version AP3P was produced by means of recombinant PCR using the plasmid pAP3. The region 10200 - g771 was amplified with the primers AP3-1 (SEQ ID No. 41) and primers AP3-4 (SEQ ID No. 44) (amplificate A1 / 4), the region g526-g285 with the AP3-3 (SEQ ID No. 43) and AP3-2 (SEQ ID No. 42) amplified (amplificate A2 / 3).

The PCR conditions were as follows:

The PCR reactions for the amplification of the DNA fragments, which contain the regions region 10200-9771 and region 9526-9285 of the AP3 promoter, were carried out in 50 μl reaction batches which contained:

100ng AP3 amplificate (described above) 0.25mM dNTPs

0.2 mM sense primer (AP3-1 SEQ ID No. 41 or AP3-3 SEQ ID No. 43) 0.2 mM antisense primer (AP3-4 SEQ ID No. 44 or AP3-2 SEQ ID No. 42) - 5 ul IOX PCR buffer (Stratagene)

0.25 µl Pfu Taq Polymerase (Stratagene) 28.8 µl Aq. Least.

The PCR was carried out under the following cycle conditions:

1X 94 ° C 2 minutes 35X g4 ° C 1 minute

50 ° C for 1 minute

72 ° C 1 minute 1 X 72 ° C 10 minutes

The recombinant PCR includes annealing of the amplificates A1 / 4 and A2 / 3, which overlap over a sequence of 25 nucleotides, completion into a double strand and subsequent amplification. This creates a modified version of the AP3 promoter, AP3P, in which positions g670 - 9526 are deleted. The denaturation (5 min at 95 ° C.) and annealing (slow cooling at room temperature to 40 ° C.) of both amplicons A1 / 4 and A2 / 3 was carried out in a 17.6 μl reaction mixture which contained:

0.5 ug A1 / 4 amplificate 0.25 ug A2 / 3 amplificate

The 3 'ends were filled in (30 min at 30 ° C.) in a 20 μl reaction mixture which contained:

17.6 ul A1 / 4 and A2 / 3 annealing reaction (prepared as described above)

50 µM dNTPs

2 ul IX KIenow buffer

2U Klenow enzyme

The nucleic acid coding for the modified promoter version AP3P was amplified by means of PCR using a sense-specific primer (AP3-1 SEQ ID No. 41) and an antisense-specific primer (AP3-2 SEQ ID No. 42).

The PCR conditions were as follows:

The PCR for the amplification of the AP3P fragment was carried out in a 50 μl reaction mixture, which contained:

- 1 ul annealing reaction (prepared as described above)

0.25 mM dNTPs

0.2 mM AP3-1 (SEQ ID No. 41)

0.2 mM AP3-2 (SEQ ID No. 42)

5 µl IOX PCR buffer (Stratagene) - 0.25 µl Pfu Taq Polymerase (Stratagene)

28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X 94 ° C 2 minutes 35X g4 ° C 1 minute 50 ° C 1 minute 72 ° C 1 minute 1X 72 ° C 10 minutes

PCR amplification with SEQ ID No. 41 (AP3-1) and SEQ ID No. 42 (AP3-2) resulted in a 777 bp fragment which codes for the modified promoter version AP3P. The amplificate was cloned into the cloning vector pCR2.1 (Invitrogen) and the plasmid pAP3P was obtained. Sequencing with the primers T7 and M13 confirmed a sequence identical to the sequence AL132971, region 10200-92g8, the internal region g285-g526 being deleted. This clone was therefore used for the cloning into the expression vector pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380).

The cloning was carried out by isolating the 767 bp SacI-HindIII fragment from pAP3P and ligating into the SacI-HindIII cut vector pJIT117. The clone that contains the promoter AP3P instead of the original promoter d35S is called pJITAP3P. To produce an expression cassette pJAP3NOST, the 79 g bp SpHI fragment NOSTF-G (described in Example 1) was cloned into the SpHI-cut vector pJITAP3P. The clone that contains the fragment NOSTF-G in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJAP3PNOST.

An expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled ketolase from Nostoc to Lesculentum was produced using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector pS3AP3: NOST (MSP103), the 2,555 bp Sacl-Xhol fragment from pJAP3NOST was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 5, construct map). In Figure 5 fragment AP3P PROMOTER contains the modified AP3P promoter (765 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NOST KETOLASE CDS (777bp) the entire primary sequence coding for the nostoc ketolase, fragment 35S TERM (746 bp) the polyadenylation signal of CaMV. An expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled ketolase from Nostoc into Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).

To produce the expression vector pS5AP3: NOST (MSP104), the 2,555 bp Sacl-Xhol fragment from pS5AP3PNOST was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 6, construct map). In Figure 6 fragment AP3P PROMOTER contains the modified AP3P promoter (765 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (207 bp), fragment NOST KETOLASE CDS (777 bp) the entire primary sequence coding for the nostoc ketolase, fragment 35S TERM (746 bp) the polyadenylation signal of CaMV.

Example 6

Amplification of a DNA encoding the entire primary sequence of NPigβ ketolase from Nostoc punctiforme A TCC 29133

The DNA coding for the NPigβ ketolase from Nostoc punctiforme ATCC 29133,

X was amplified by PCR from Nostoc punctiform ATCC 29133 (strain of the "American Type Culture Collection").

For the preparation of genomic DNA from a suspension culture of Nostoc punctiforme ATCC 29133, which is maintained for 1 week with continuous light and constant shaking (150 rpm) at 25 ° C in BG 17 medium (1.5 g / l NaNO ₃ , 0.04 g / l K ₂ PO ₄ x3H ₂ O, 0.075 g / l MgSO ₄ xH O, 0.036 g / l CaCI ₂ x2H ₂ O, 0.006 g / l citric acid, 0.006 g / l Ferric ammonium citrate, 0.001 g / l EDTA disodium magnesium, 0.04 g / l Na ₂ CO ₃ , 1ml trace metal mix "A5 + Co" (2.86 g / l H ₃ BO ₃ , 1.81 g / l MnCI ₂ x4H ₂ o, 0.222 g / l ZnSO ₄ x7H ₂ 0, 0.3gg / l Na-MoO ₄ X2H ₂ o, 0.07gg / l CuSO ₄ x5H ₂ O, 0.04g4 g / l Co (NO ₃ ) ₂ x6H ₂ O), the cells were harvested by centrifugation, frozen in liquid nitrogen and in a mortar pulverized.

Protocol for DNA isolation from Nostoc punctiform ATCC 29133:

The bacterial cells were pelleted from a 10 ml liquid culture by centrifugation at 8000 rpm for 10 minutes. The bacterial cells were then crushed and ground in liquid nitrogen using a mortar. The cell material was resuspended in 1 ml of 10 mM Tris_HCI (pH 7.5) and placed in an Eppendorf reaction vessel (2 ml of lumen) transferred. After adding 100 μl Proteinase K (concentration: 20 mg / ml), the cell suspension was incubated for 3 hours at 37 ° C. The suspension was then extracted with 500 μl of phenol. After centrifugation at 13,000 rpm for δ minutes, the upper, aqueous phase was transferred to a new 2 ml Eppendorf reaction vessel i. The extraction with phenol was repeated 3 times. The DNA was precipitated by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 0.6 volume of isopropanol and then washed with 70% ethanol. The DNA pellet was dried at room temperature, taken up in 25 μl of water and dissolved with heating to 65 ° C.

The nucleic acid encoding a ketolase from Nostoc punctiform ATCC 29133 was determined by means of a "polymerase chain reaction" (PCR) from Nostoc punctiform ATCC 29133 using a sense-specific primer (NP196-1, SEQ ID No. 54) and an antisense-specific Primers (NP196-2 SEQ ID No. 55) amplified.

The PCR conditions were as follows:

X

The PCR for the amplification of the DNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture which contained

1 µl of a Nostoc punctiform ATCC 29133 DNA (prepared as described above)

0.25 mM dNTPs - 0.2 mM NPig6-1 (SEQ ID No. 54)

0.2 mM NP196-2 (SEQ ID No. 55)

5 ul 10X PCR buffer (TAKARA)

0.25 ul R Taq polymerase (TAKARA)

25.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X 94 ° C for 2 minutes

35X 94 ° C 1 minute

55 ° C for 1 minute 72 ° C for 3 minutes

1X 72 ° C 10 minutes

PCR amplification with SEQ ID No. 54 and SEQ ID No. 55 resulted in a 792 bp fragment that codes for a protein consisting of the entire primary sequence (NPigβ, SEQ ID No. 56). Using standard methods, the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNP196 was obtained.

Sequencing of the clone pNP196 with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence from 140.571 -13g.810 of the database entry NZ_AABC01000196 (inverse oriented to the published database entry) with the exception that G in position 140.571 was replaced by A to create a standard start codon ATG. This nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nostoc punctiform ATCC 29133 used. X This clone pNP196 was therefore used for cloning into the expression vector pJIT117 (Guerineau et al. Ig88, Nucl. Acids Res. 16: 11380) is used.

pJIT117 was modified by using the 35S terminator through the OCS terminator (octopine synthase) of the Ti plasmid pTi15g55 from Agrobacterium tumefaciens (database entry X004g3 from position 12.541-12.350, Gielen et al. (ig84) EMBO J. 3835-846 ) was replaced.

The DNA fragment which contains the OCS terminator region was PCR-isolated using the plasmid pHELLSGATE (database entry AJ311874, Wesley et al. (2001) Plant J. 27581-590, isolated from E. coli by standard methods) and the primer OCS -1 (SEQ ID No. 58) and OCS-2 (SEQ ID No. 59).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which contains the octopine synthase (OCS) terminator region (SEQ ID No. 60), was carried out in a 50 μl reaction mixture, which contained: 100 ng pHELLSGATE plasmid DNA 0.25 mM dNTPs 0.2 mM OCS-1 (SEQ ID No. 58) 0.2 mM OCS-2 (SEQ ID No. 5) 5 ul IOX PCR buffer (Stratagene) 0.25 ul Pfu polymerase (Stratagene) 28.8 ul aq. Least.

The PCR was carried out under the following cycle conditions:

1X 94 ° C 2 minutes 35X 94 ° C 1 minute

50 ° C for 1 minute

72 ° C 1 minute 1X 72 ° C 10 minutes

The 210 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pOCS was obtained.

Sequencing of the clone pOCS confirmed a sequence which corresponds to a sequence section on the Ti plasmid pTi15955 from Agrobacterium tumefaciens (database entry X00493) from positions 12,541 to 12,350.

The cloning was carried out by isolating the 210 bp Sall-Xhol fragment from pOCS and ligation into the Sall-Xhol cut vector pJIT117.

This clone is called pJO and was therefore used for the cloning into the expression vector pJONP196.

The cloning was carried out by isolating the 782 bp Sphl fragment from pNP196 and ligating into the SphI cut vector pJO. The clone that contains the Nostoc punctiforme NPig6 ketolase in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJONP196. Example 7:

Production of expression vectors for the constitutive expression of NP1 gβ-ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum and Tagetes erecta.

The expression of the NP196 ketolase from Nostoc punctiforme in L. esculentum and in Tagetes erecta was carried out under the control of the constitutive promoter FNR (ferredoxin NADPH oxidoreductase, database entry AB011474 position 70127 to 694g3; WO03 / 006660), from Arabidopsis thallana. The FNR gene begins at base pair 69492 and is annotated with "ferredoxin-NADP + reductase". Expression was carried out using the pea transit peptide rbcS (Anderson et al. 1986, Biochem J. 240: 709-715).

The DNA fragment containing the FNR promoter region from Arabidopsis thallana was PCR-analyzed using genomic DNA (isolated from Arabidopsis thaliana according to standard methods) and the primers FNR-1 (SEQ ID No. 61) and FNR-2 (SEQ ID No. 62).

The PCR conditions were as follows:

X

The PCR for the amplification of the DNA, which contains the FNR promoter fragment FNR (SEQ ID No. 63), was carried out in a 50 μl reaction mixture which contained:

100 ng genomic DNA from A.thaliana 0.25 mM dNTPs 0.2 mM FNR-1 (SEQ ID No. 61) - 0.2 mM FNR-2 (SEQ ID No. 62) 5 μl IOX PCR buffer (Stratagene) 0.25 μl Pfu polymerase ( Stratagene) 28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

The 652 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Jnvitrogen) using standard methods and the plasmid pFNR was obtained.

Sequencing of the clone pFNR confirmed a sequence which corresponds to a sequence section on chromosome 5 of Arabidopsis thaliana (database entry AB011474) from position 70127 to 6g493.

This clone is called pFNR and was therefore used for the cloning into the expression vector pJONP196 (described in Example 6).

The cloning was carried out by isolating the 644 bp Smal-Hindlll fragment from pFNR and ligating into the Ecl136ll-Hindlll cut vector pJONP196. The clone which contains the promoter FNR instead of the original promoter d35S and the fragment NP196 in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJOFNR: NP196.

X

An expression cassette for the Agrobacterium -mediated transformation of the NP196-ketolase from Nostoc in Lesculentum was produced using the binary vector pSUN3 (WO02 / 00g00).

To produce the expression vector MSP105, the 1.83g bp EcoRI-Xhol fragment from pJOFNR: NPig6 was ligated with the EcoRI-Xhol cut vector pSUN3 (Figure 7, construct map). In Figure 7 fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (ig4 bp), fragment NP196 KETO CDS (761 bp), coding for the nostoc punctiform NPigβ ketolase, fragment OCS W2 bp) the polyadenylation signal from the octopine synthase.

An expression cassette for the '4groöacter / ^' um-mediated transformation of the expression vector with the NPi β-ketolase from Nostoc punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO 02/00900). To produce the Tagetes expression vector MSP106, the 1,839 bp EcoRI-Xhol fragment from pJOFNR: NP196 was ligated with the EcoRI-Xhol cut vector pSUN5 (Figure 8, construct map). In Figure 8, fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP196 KETO CDS (761 bp), coding for the nostoc punctiform NP196 ketolase, Fragment OCS terminator (192 bp) the octopine synthase polyadenylation signal.

Example 8: Production of expression vectors for the flower-specific expression of the NP196 ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum and Tagetes erecta

The expression of the NPigβ-ketolase from Nostoc punctiforme in Lesculentum and Tageses erecta was carried out with the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715). Expression was carried out under the control of the flower-specific promoter EPSPS from Petunia hybrida (database entry M37029: nucleotide region 7-1787; Benfey et al. (1990) Plant Cell 2: 849-856).

The DNA fragment, which contains the EPSPS promoter region (SEQ ID No. 66) from Petunia hybrida, was PCR-analyzed using genomic DNA (isolated from Petunia hybrida according to standard methods) and the primers EPSPS-1 (SEQ ID No. 64) and EPSPS -2 (SEQ ID No. 65).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which contains the EPSPS promoter fragment (database entry M37029: nucleotide region 7-1787), was carried out in a 50 μl reaction mixture which contained:

100ng of A. thaliana genomic DNA

0.25 mM dNTPs

0.2 mM EPSPS-1 (SEQ ID No. 64)

0.2 mM EPSPS-2 (SEQ ID No. 65) - 5 µl IOX PCR buffer (Stratagene)

0.25 µl Pfu polymerase (Stratagene) 28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X g4 ° C 2 minutes 35X g4 ° C 1 minute

50 ° C for 1 minute

72 ° C 2 minutes 1X 72 ° C 10 minutes

The 1773 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pEPSPS was obtained.

Sequencing of the clone pEPSPS confirmed a sequence consisting only of two deletions (bases ctaagtttcagga in position 46-58 of sequence M3702g; bases aaaaatat in positions 1422-142g of sequence M3702g) and the base exchanges (T instead of G in position 1447 of sequence M3702g ; A instead of C in position 1525 of sequence M3702g; A instead of G in position 1627 of sequence M3702g) differs from the published EPSPS sequence (database entry M3702g: nucleotide region 7-1787). The two deletions and the two base changes at positions 1447 and 1627 of the sequence M3702g were reproduced in an independent amplification experiment and thus represent the actual nucleotide sequence in the Petunia hybrida plants used.

The clone pEPSPS was therefore used for the cloning into the expression vector pJONPI g6 (described in Example 6).

The cloning was carried out by isolating the 1763 bp SacI-HindIII fragment from pEPSPS and ligation into the SacI-HindIII cut vector pJONPI 6. The clone which contains the promoter EPSPS instead of the original promoter d35S is called pJOESP: NP196. This expression cassette contains the fragment NP196 in the correct orientation as an N-terminal fusion with the rbcS transit peptide.

The production of an expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NP196 ketolase from Nostoc punctiforme ATCC 29133 in L. esculentum was carried out using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector MSP107, the 2.g61 KB bp Sacl-Xhol fragment from pJOESP: NP1 gβ was ligated with the Sacl-Xhol cut vector pSUN3 (Figure g, construct map). In the figure, fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (1 g4 bp), fragment NP196 KETO CDS (761 bp), coding for the Nostoc punctiform NPigβ-ketolase, fragment OCS terminator (ig2 bp) the polyadenylation signal of octopine synthase.

An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NP196 ketolase from Nostoc punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00g00).

To produce the expression vector MSP108, the 2.g61 KB bp Sacl-Xhol fragment from pJOESP: NPig6 was ligated to the Sacl-Xhol cut vector pSUN5

X

(Figure 10, construct card). In Figure 10, fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (1 4 bp), fragment NP196 KETO CDS (761 bp), coding for the Nostoc punctiform NPigβ ketolase, fragment OCS terminator (192 bp) the polyadenylation signal of octopine synthase.

Example g: Amplification of a DNA encoding the entire primary sequence of the NP1 g5 ketolase from Nostoc punctiforme ATCC 29133

The DNA coding for the NPi δ-ketolase from Nostoc punctiform ATCC 29133 'was amplified by PCR from Nostoc punctiform ATCC 29133 (strain of the "American Type Culture Collection"). The preparation of genomic DNA from a suspension culture of Nostoc punctiforme ATCC 29133 was described in Example 19.

The nucleic acid encoding a Nostoc punctiform ATCC 29133 ketolase was synthesized by means of a "polymerase chain reaction" (PCR) from Nostoc punctiform ATCC 29133 using a sense-specific primer (NP195-1, SEQ ID No. 67) and an antisense-specific one Primers (NPig5-2 SEQ ID No. 68) amplified. The PCR conditions were as follows:

The PCR for the amplification of the DNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture, which contained:

1 µl of a Nostoc punctiform ATCC 29133 DNA (prepared as described above)

0.25 mM dNTPs - 0.2 mM NPig5-1 (SEQ ID No. 67) 0.2 mM NP105-2 (SEQ ID No. 68) 5 ul 10X PCR buffer (TAKARA) 0.25 ul R Taq Polymerase (TAKARA) 25.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X g4 ° C 2 minutes

35X 94 ° C 1 minute 55 ° C 1 minute

72 ° C 3 minutes 1 X 72 ° C 10 minutes

PCR amplification with SEQ ID No. 67 and SEQ ID No. 68 resulted in an 819 bp fragment coding for a protein consisting of the entire primary sequence (NP195, SEQ ID No. 69). Using standard methods, the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNP195 was obtained.

Sequencing of the clone pNPi δ with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence of 55.604-56.3g2 of the database entry NZ_AABC010001065, with the exception that T in position 55.604 was replaced by A, to create a standard start codon ATG. This nucleotide sequence was reproduced in an independent amplification experiment. graces and represents the nucleotide sequence in the used Nostoc punctiform ATCC 29133.

This clone pNP105 was therefore used for the cloning into the expression vector pJO (described in Example 6). The cloning was carried out by isolating the 800 bp Sphl fragment from pNPigs and ligation into the SphI cut vector pJO. The clone which contains the NPigδ ketolase from Nostoc punctiforme in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJONPI 95.

Example 10:

Production of expression vectors for the constitutive expression of NP195-ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum and Tagetes erecta.

The expression of the NP195 ketolase from Nostoc punctiforme in L. esculentum and in Tagetes erecta was carried out under the control of the constitutive promoter FNR (ferredoxin NADPH oxidoreductase, database entry AB011474 position 70127 to 69493; WO03 / 006660), from Arabidopsis thallana. The FNR gene begins at base pair 694g2 and is annotated with "ferredoxin-NADP + reductase". Expression was carried out using the pea transit peptide rbcS (Anderson et al. 1086, Biochem J. 240: 700-715).

The clone pFNR (described in Example 7) was therefore used for the cloning into the expression vector pJONPI 05 (described in Example 10).

The cloning was carried out by isolating the 644 bp Sma-Hindlll fragment from pFNR and ligating into the Ecl136ll-Hindlll cut vector pJONPI 05. The clone which contained the promoter FNR instead of the original promoter d35S and the fragment NPi δ in the correct orientation as contains terminal fusion with the rbcS transit peptide is called pJOFNR: NP195.

An expression cassette for the Agrobacterium-mediated transformation of the NP195 ketolase from Nostoc punctiforme into lesculentum was produced using the binary vector pSUN3 (WO02 / 00000).

To produce the expression vector MSP100, the 1,866 bp EcoRI-Xhol fragment from pJOFNR: NPi 5 was cut with the EcoRI-Xhol vector pSUN3 li greed (Figure 11, construct card). In ^"Figure 11 fragment FNR promoter the FNR promoter (635 bp) fragment rbcS TP FRAGMENT the rbcS transit peptide of pea (104 bp) fragment NP195 KETO CDS (78g bp), coding for the Nostoc punctiforme NPi δ-ketolase Fragment OCS terminator (192 bp) the polyadenylation signal from the octopine synthase.

An expression cassette for the /.grobacfer/um -mediated transformation of the expression vector with the NPigδ-ketolase from Nostoc punctiforme punctiforme in Tagetes erecta was carried out using the binary vector pSUN5 (WO 02/00000).

To produce the Tagetes expression vector MSP110, the 1,866 bp EcoRI-Xhol fragment from pJOFNR: NP105 was ligated with the EcoRI-Xhol cut vector pSUN5 (Figure 12, construct map). In Figure 12 fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (78g bp), coding for the nostoc punctiform NPi gδ-ketolase, fragment OCS terminator (ig2 bp) the polyadenylation signal of octopine synthase.

Example 11:

Production of expression vectors for the flower-specific expression of the NP195 ketolase from Nostoc punctiform ATCC 2gi33 in Lycopersicon esculentum and Tagetes erecta.

The expression of the NP1 g5 ketolase from Nostoc punctiforme in L. esculentum and Tagetes erecta was carried out with the transit peptide rbcS from pea (Anderson et al. Ig86, Biochem J. 240: 700-715). The expression was carried out under the control of the flower-specific promoter EPSPS from Petunia hybrida (database entry M37020: nucleotide region 7-1787; Benfey et al. (1990) Plant Cell 2: 840-856).

The clone pEPSPS (described in Example 8) was therefore used for the cloning into the expression vector pJONPI 95 (described in Example 10).

The cloning was carried out by isolating the 1763 bp SacI-HindIII fragment from pEPSPS and ligation into the SacI-HindIII cut vector pJONPI 05. The clone, which contains the promoter EPSPS instead of the original promoter d35S, is called pJOESP: NPig5. This expression cassette contains the fragment NPi δ in the correct orientation as an N-terminal fusion with the rbcS transit peptide.

An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NP195 ketolase from Nostoc punctiforme ATCC 2gi33 in L. esculentum was produced using the binary vector pSUN3 (WO 02/00000).

To produce the expression vector MSP111, the 2,088 KB bp Sacl-Xhol fragment from pJOESP: NP105 was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 13, construct map). In Figure 13, fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (789 bp), coding for the Nostoc punctiform NPigδ-ketolase, fragment OCS terminator (192 bp) the polyadenylation signal of octopine synthase.

An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NPigδ-ketolase from Nostoc punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00Θ00).

To produce the expression vector MSP112, the 2,088 KB bp Sacl-Xhol fragment from pJOESP: NP195 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 14, construct map). In Figure 14 fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (1 g4 bp), fragment NP195 KETO CDS (78g bp), coding for the Nostoc punctiform NPigδ-ketolase, fragment OCS Terminator (192 bp) the polyadenylation signal of octopine synthase.

Example 12: Amplification of a DNA encoding the entire primary sequence of the NODK ketolase from Noularia spumignea Λ / SOft 70.

The DNA encoding the ketolase from Nodularia spumignea NSOR 10 was amplified by PCR from Nodularia spumignea NSOR10. For the preparation of genomic DNA from a suspension culture of Nodularia spumignea NSOR10, d \ e 1 week with continuous light and constant shaking (150 rpm) at 25 ° C in BG 77 medium (1.5 g / l NaN0 ₃ , 0.04 g / l K ₂ P0 ₄ x3H ₂ 0, 0.075 g / l MgS0 ₄ xH ₂ O, 0.036 g / l CaCI ₂ x2H ₂ O, 0.006 g / l citric acid, 0.006 g / l Ferric ammonium citrate, 0.001 g / l EDTA disodium magnesium, 0.04 g / l Na ₂ CO ₃ , 1 ml trace metal mix "A5 + Co" (2.86 g / l H ₃ BO ₃ , 1.81 g / l MnCI ₂ x4H ₂ o, 0.222 g / l ZnSO ₄ x7H ₂ 0, 0.30 g / l NaMoO ₄ X2H ₂ o, 0.070 g / l CuSO ₄ x5H ₂ O, 0.0404 g / l Co (NO ₃ ) ₂ x6H ₂ O), the cells were harvested by centrifugation, frozen in liquid nitrogen and pulverized in a mortar ,

Protocol for DNA isolation from Nodularia spumignea NSOR10:

The bacterial cells were pelleted from a 10 ml liquid culture by centrifugation at 8000 rpm for 10 minutes. The bacterial cells were then crushed and ground in liquid nitrogen using a mortar. The cell material was resuspended in 1 ml of 10 mM Tris HCl (pH 7.5) and transferred to an Eppendorf reaction vessel (2 ml volume). After adding 100 μl Proteinase K (concentration: 20 mg / ml), the cell suspension was incubated for 3 hours at 37 ° C. Then the

X

Suspension extracted with 500 ul phenol. After centrifugation at 13,000 rpm for δ minutes, the upper, aqueous phase was transferred to a new 2 ml Eppendorf reaction vessel. The extraction with phenol was repeated 3 times. The DNA was precipitated by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 0.6 volume of isopropanol and then washed with 70% ethanol. The DNA pellet was dried at room temperature, taken up in 25 μl of water and dissolved with heating to 65 ° C.

The nucleic acid encoding a ketolase from Nodularia spumignea NSOR10 was determined by means of a "polymerase chain reaction" (PCR) from Nodularia spumignea NSOR10 using a sense-specific primer (NODK-1, SEQ ID No. 71) and an antisense-specific primer ( NODK-2 SEQ ID No. 72).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture, which contained: 1 ul of a Nodularia spumignea NSOR10 DNA (prepared as described above)

0.25 mM dNTPs

0.2 mM NODK-1 (SEQ ID No. 71) - 0.2 mM NODK-2 (SEQ ID No. 72) 5 ul 10X PCR buffer (TAKARA) 0.25 ul R Taq polymerase (TAKARA) 25.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X 04 ° C 2 minutes 35X g4 ° C 1 minute 55 ° C 1 minutes 72 ° C 3 minutes

1 X 72 ° C 10 minutes

X

PCR amplification with SEQ ID No. 71 and SEQ ID No. 72 resulted in a 720 bp fragment coding for a protein consisting of the entire primary sequence (NODK, SEQ ID No. 73). Using standard methods, the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNODK was obtained.

Sequencing of the clone pNODK with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence from 2130-2810 of the database entry AY210783 (inverse to the published database entry). This nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nodularia spumignea NSOR10 used.

This clone pNODK was therefore used for the cloning into the expression vector pJO (described in Example 6). The cloning was carried out by isolating the 710 bp Sphl fragment from pNODK and ligation into the SphI-cut vector pJO. The clone that shows the NODK ketolase from Nodularia spumignea in the correct orientation contains as an N-terminal translational fusion with the rbcS transit peptide is called pJONODK.

Example 13: Production of expression vectors for the constitutive expression of the NODK ketolase from Nodularia spumignea NSOR10 in Lycopersicon esculentum and Tagetes erecta.

The expression of the NODK ketolase from Nodularia spumignea NSOR10 in L. esculentum and in Tagetes erecta was carried out under the control of the constitutive promoter FNR (ferredoxin-NADPH-oxidoreductase, database entry AB011474 position 70127 to 60403; WO03 / 006660) from Arabidopsis thall. The FNR gene begins at base pair 604g2 and is annotated with "ferredoxin-NADP + reductase". Expression was carried out using the pea transit peptide rbcS (Anderson et al. Ig86, Biochem J. 240: 700-715).

The clone pFNR (described in Example 7) was therefore used for the cloning into the expression vector pJONODK (described in Example 12).

X

The cloning was carried out by isolating the 644 bp Sma-HindIII fragment from pFNR and ligating into the Ecl136II-HindIII cut vector pJONODK. The clone which contains the promoter FNR instead of the original promoter d35S and the fragment NODK in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJOFNR: NODK.

An expression cassette for the Agrobacterium-mediated transformation of the NODK ketolase from Nodularia spumignea NSOR10 into L. esculentum was produced using the binary vector pSUN3 (WO02 / 00Θ00).

To produce the expression vector MSP113, the 1,767 bp EcoRI-Xhol fragment from pJOFNR: NODK was ligated with the EcoRI-Xhol cut vector pSUN3 (Figure 15, construct map). In Figure 15, fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (104 bp), fragment NODK KETO CDS (600 bp), coding for the Nodularia spumignea NSOR10 NODK ketolase, fragment OCS terminator (102 bp) the polyadenylation signal from the octopine synthase. An expression cassette for the / 4grobactet / um-mediated transformation of the expression vector with the NODK ketolase from Nodularia spumignea NSOR10 punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).

To produce the Tagetes expression vector MSP114, the 1,767 bp EcoRI-Xhol fragment from pJOFNR: NODK was ligated with the EcoRI-Xhol cut vector pSUN5 (Figure 16, construct map). In Figure 16, fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NODK KETO CDS (6gθ bp), coding for the Nodularia spumignea NSOR10 NODK ketolase , Fragment OCS terminator (102 bp) the polyadenylation signal of octopine synthase.

Example 14: Production of expression vectors for the flower-specific expression of the NODK ketolase from Nodularia spumignea NSORW in Lycopersicon esculentum and Tagetes erecta.

The NODK ketolase from Nodularia spumignea NSOR10 \ n L. esculenum and Tagetes erecta was expressed with the transit peptide rbcS from pea (Anderson et al: 1086, Biochem J. 240: 709-715). The expression was carried out under the control of the flower-specific promoter EPSPS from Petunia hybrida (database entry M37029: nucleotide region 7-1787; Benfey et al. (1990) Plant Cell 2: 840-856).

The clone pEPSPS (described in Example 8) was therefore used for the cloning into the expression vector pJONODK (described in Example 12).

The cloning was carried out by isolating the 1763 bp SacI-HindIII fragment from pEPSPS and ligation into the SacI-HindIII cut vector pJONODK. The clone that contains the promoter EPSPS instead of the original promoter d35S is called pJOESP: NODK. This expression cassette contains the fragment NODK in the correct orientation as an N-terminal fusion with the rbcS transit peptide.

The production of an expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NODK ketolase from Nodularia spumignea NSOR10 in L. esculentum was carried out using the binary vector pSUN3 (WO 02/00000).

To produce the expression vector MSP115, the 2,889 KB bp Sacl-Xhol fragment from pJOESP: NODK was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 17, construct map). In Figure 17, fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NODK KETO CDS (690 bp), coding for the Nodularia spumignea NSOR 10 NODK ketolase, fragment OCS terminator (102 bp) the polyadenylation signal of octopine synthase.

An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NODK ketolase from Nodularia spumignea NSOR10 in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00Θ00).

The 2,880 KB bp Sacl-Xhol was used to produce the expression vector MSP116

X

Fragment from pJOESP: NODK ligated with the Sacl-Xhol cut vector pSUN5 (Figure 18, construct map). In Figure 18 fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT ^' the rbcS transit peptide from pea (104 bp), fragment NODK KETO CDS (600 bp), coding for the Nodularia spumignea NSOR10 NODK-Ketolase, fragment OCS terminator (102 bp) the polyadenylation signal of octopine synthase.

Example 15:

Production of transgenic Lycopersicon esculentum plants

Transformation and regeneration of tomato plants was carried out according to the published method by Ling and co-workers (Plant Cell Reports (1998), 17: 843-847). For the Microtome variety, higher kanamycin concentrations (100 mg / L) were selected.

The starting explant for the transformation was cotyledons and hypocotyls, seven to ten day old seedlings of the Microtome line. The culture medium according to Murashige and Skoog (1062: Murashige and Skoog, 1062, Physiol. Plant 15, 473-) with 2% sucrose, pH 6.1 was used for the germination. Germination took place at 21 ° C in low light (20 - 100 μE). After seven to ten days, the cotyledons became divided transversely and the hypocotyls cut into sections about 5 to 10 mm long and placed on the medium MSBN (MS, pH 6.1, 3% sucrose + 1 mg / l BAP, 0.1 mg / l NAA), which on The previous day was loaded with suspension-cultivated tomato cells. The tomato cells were covered with sterile filter paper without air bubbles. The explants were precultured on the medium described for three to five days. Cells from the Agrobacterium tumefaciens LBA4404 strain were individually transformed with the plasmids pS3FNR: NOST, pS3AP3: NOST, pS3FNR: NP106, pS3EPS: NP106, pS3FNR: NP105, pS3EPS: NP105, pS3FNR: NODK and pS3FNR: NODK and pS3FNR: NODK and pS3FNR: NODK and pS3FNR: NODK and pS3FNR: transform. Agrobacterium B-20 strains / agonacteria B l) cultivated at 28 ° C and the cells centrifuged. The bacterial pellet was resuspended with liquid MS medium (3% sucrose, pH 6.1) and adjusted to an optical density of 0.3 (at 600 nm). The precultivated explants were transferred to the suspension and incubated for 30 minutes at room temperature with gentle shaking. The explants were then dried with sterile filter paper and placed back on their preculture medium for the three-day co-culture (21 ° C.).

After the co-culture, the explants were transferred to MSZ2 medium (MS pH 6.1 + 3% sucrose, 2 mg / l zeatin, 100 mg / l kanamycin, 160 mg / l timentin) and for selective regeneration at 21 ° C stored under low light conditions (20 - 100 μE, light rhythm 16h / 8h). The explants were transferred every two to three weeks until shoots formed. Small shoots could be separated from the explant and rooted on MS (pH 6.1 + 3% sucrose) 160 mg / l timentin, 30 mg / l kanamycin, 0.1 mg / l IAA. Rooted plants were transferred to the greenhouse.

According to the transformation method described above, the following lines were obtained with the following expression constructs:

With pS3FNR: NOST was obtained: MSP101-1, MSP101-2, MSP101-3

With pS3AP3: NOST was obtained: MSP103-1, MSP103-2, MSP103-3 With pS3FNR: NP106 was obtained: MSP105-1, MSP105-2, MSP105-3

With pS3EPS: NP196 was obtained: MSP107-1, MSP107-2, MSP107-3

With pS3FNR: NP105 was obtained: MSP100-1, MSP100-2, MSP100-3

With pS3EPS: NP105 it was obtained: MSP111-1, MSP111 -2, MSP111 -3

With pS3FNR: NODK was obtained: MSP113-1, MSP113-2, MSP113-3

With pS3EPS: NODK was obtained: MSP115-1, MSP115-2, MSP115-3

Example 16:

Production of transgenic tagetes plants

Day tea seeds are sterilized and placed on germination medium (MS medium; Murashige and Skoog, Physiol. Plant. 15 (1062), 473-407) pH 5.8, 2% sucrose). Germination takes place in a temperature / light / time interval of 18-28 ° C / 20-200 μE / 3-16 weeks, but preferably at 21 ° C, 20-70 μE, for 4-8 weeks.

All leaves of the in vitro plants that had developed up to that point are harvested and cut across the midrib. The resulting leaf explants with a size of 10 - 60 mm ² are kept in the course of the preparation in liquid MS medium at room temperature for a maximum of 2 h.

Any Agrobacterium tumefaciens strain, but preferably a supervirulent strain, such as EHA105 with a corresponding binary plasmid, which can carry a selection marker gene (preferably bar or pat) and one or more trait or reporter genes (pS5FNR: NOST, pS5AP3: NOST pS5FNR: NP106, pS5EPS: NP196, pS5FNR: NP1 5, pS5EPS: NP1 g5, pS5FNR: NODK and pS5EPS: NODK), grown overnight and used for the co-cultivation with the leaf material. The bacterial strain can be grown as follows: A single colony of the corresponding strain is in YEB (0.1% yeast extract, 0.5% beef extract, 0.5% peptone, 0.5% sucrose, 0.5% magnesium sulfate x 7 H) ₂ 0) inoculated with 25 mg / l kanamycin and dressed at 28 ° C for 16 to 20 h. The bacterial suspension is then harvested by centrifugation at 6000 g for 10 min and resuspended in liquid MS medium such that an OD ₆₀₀ of approximately 0.1 to 0.8 was formed. This suspension is used for C cultivation with the leaf matter! used.

Immediately before the co-cultivation, the MS medium in which the leaves have been kept is replaced by the bacterial suspension. The leaflets were incubated in the agrobacterial suspension for 30 min with gentle shaking at room temperature. The infected explants are then placed on an MS medium solidified with agar (for example 0.8% plant agar (Duchefa, NL) with growth regulators, such as 3 mg / l benzylaminopurine (BAP) and 1 mg / l indolylacetic acid (IAA). The orientation of the leaves on the medium is irrelevant: the explants are cultivated for 1 to 8 days, but preferably for 6 days, the following conditions can be used: light intensity: 30-80 μmol / m ² x sec, temperature: 22-24 ° C., light / dark change of 16/8 hours, after which the co-cultivated explants are transferred to fresh MS medium, preferably with the same growth regulators, this second medium additionally containing an antibiotic to suppress bacterial growth A concentration of 200 to 500 mg / l is very suitable for this purpose, and the second selective component is one used to select the success of the transformation. Phosphinothricin in a concentration of 1 to 5 mg / l selects very efficiently, but other selective components according to the method to be used are also conceivable.

After one to three weeks, the explants are transferred to fresh medium until shoot buds and small shoots develop, which are then on the same basal medium including timentin and PPT or alternative components with growth regulators, namely, for example, 0.5 mg / l indolylbutyric acid (IBA) and 0.5 mg / l gibberillic acid GA ₃ , are transferred for rooting. Rooted shoots can be transferred to the greenhouse.

In addition to the described method, the following advantageous modifications are possible:

Before the explants are infected with the bacteria, they can be pre-incubated for 1 to 12 days, preferably 3-4, on the medium described above for the co-culture become. The infection, co-culture and selective regeneration then take place as described above.

The pH value for regeneration (normally 5.8) can be lowered to pH 5.2. This improves the control of agrobacterial growth.

The addition of AgNO ₃ (3 - 10 mg / l) to the regeneration medium improves the condition of the culture including the regeneration itself.

Components that reduce phenol formation and are known to those skilled in the art, e.g. Citric acid, ascorbic acid, PVP and many more have a positive effect on the culture.

Liquid culture medium can also be used for the entire process. The culture can also be incubated on commercially available carriers which are positioned on the liquid medium.

With pS5FNR: NOST, for example, the following was obtained: MSP102-1, MSP102-2, MSP102-3,

With pS5AP3: NOST, for example, the following was obtained: MSP104-1, MSP104-2, MSP104-3

With pS5FNR: NP106 was obtained: MSP106-1, MSP106-2, MSP106-3

With pS5EPS: NP106 was obtained: MSP108-1, MSP108-2, MSP108-3

With pS5FNR: NP105 was obtained: MSP110-1, MSP110-2, MSP110-3

With pS5EPS: NP105 it was obtained: MSP112-1, MSP1 12-2, MSP112-3

With pS5FNR: NODK was obtained: MSP114-1, MSP114-2, MSP114-3

With pS5EPS: NODK, the following was obtained: MSP116-1, MSP116-2, MSP116-3 Example 17

Characterization of the transgenic plant flowers

Example 9.1 Separation of Carotenoid Esters in Petals of Transgenic Plants

General working instructions:

The petals of the transgenic plants are mortarized in liquid nitrogen and the petalen powder (about 40 mg) extracted with 100% acetone (three times 500 ul). The solvent is evaporated and the carotenoids are resuspended in 100-200 ul of petroleum ether / acetone (5: 1, v / v).

The carotenoids are separated in concentrated form by means of thin layer chromatography (TLC) on SilicaβO F254 plates (Merck) in an organic solvent (petroleum ether / acetone; 5: 1) according to their phobicity. Yellow (xanthophyll esters), red (ketocarotenoid esters) and orange bands (mixture of xanthophyll and ketocarotenoid esters) are scraped out on the TLC.

The carotenoids bound to silica are eluted three times with 500 μl of acetone, the solvent is evaporated and the carotenoids are separated and identified by means of HPLC.

A C30 reverse phase column can be used to differentiate between mono- and diesters of carotenoids. HPLC running conditions were almost identical to a published method (Frazer et al. (2000), Plant Journal 24 (4): 551-558). The following process conditions were set.

Separation column: Prontosil C30 column, 250 x 4.6 mm, (Bischoff, Leonberg) Flow rate: 1.0 ml / min Eluents: mobile phase A - 100% methanol

Solvent B - 80% methanol, 0.2% ammonium acetate solvent C - 100% t-butyl methyl ether gradient profile:

Detection: 300 - 500 nm

The carotenoids can be identified on the basis of the UV-VIS spectra.

Petal material from the transgenic tomato plants is ground and extracted with acetone. Extracted carotenoids are separated by means of TLC. In the lines can

X

Mono and diesters of ketocarotenoids can be detected; the monoesters are present in a significantly lower concentration than the diesters.

Example 18

Enzymatic hydrolysis of carotenoid esters and identification of carotenoids

General working instructions

Mortar petal material (30-100 mg fresh weight) is extracted with 100% acetone (three times 500 ul; shake for about 15 minutes each). The solvent is evaporated. Carotenoids are then taken up in 405 μl of acetone, 4.95 ml of potassium phosphate buffer (100 mM, pH 7.4) are added and mixed well. Then about 17 mg of Bile salts (Sigma) and 140 μl of a NaCI / CaCI2 solution (3M NaCI and 75 mM CaCI2) are added. The suspension is incubated for 30 minutes at 37C. For the enzymatic hydrolysis of the carotenoid esters, 505 μl of a lipase solution (50 mg / ml lipase type 7 from Candida rugosa (Sigma)) is added and incubated with shaking at 37C. After about 21 hours, 595 μl of lipase was added again and incubation was continued for at least 5 hours at 37C. Then be about 700 mg of Na2SO4x10H20 dissolved in the solution. After adding 1800 μl of petroleum ether, the carotenoids are extracted into the organic phase by vigorous mixing. This shaking is repeated until the organic phase remains indolent. The petroleum ether fractions are combined and the petroleum ether evaporated. Free carotenoids are taken up in 100-120 ul acetone. Free carotenoids can be identified on the basis of retention time and UV-VlS spectra by means of HPLC and C30 reverse phase acid.

Claims

Patent claims

1. Process for the production of ketocarotenoids by culturing genetically modified organisms which have an altered ketolase activity compared to the wild type, and the altered ketolase activity is caused by a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has at least 42% identity at the amino acid level with the sequence SEQ. ID. NO. 2 has.

2. The method according to claim 1, characterized in that organisms are used which, as wild type, already have ketolase activity, and the genetic modification causes an increase in ketolase activity compared to the wild type.

3. The method according to claim 2, characterized in that to increase the ketolase activity, the gene expression of a nucleic acid, encoding a ketolase, containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42%

Amino acid level with the sequence SEQ. ID. NO. 2 has increased compared to the wild type.

4. The method according to claim 3, characterized in that, in order to increase gene expression, nucleic acids which encode ketolases and contain the amino acid sequence SEQ are introduced into the organism. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has at least 42% identity at the amino acid level with the sequence SEQ. ID. NO. 2 has.

5. The method according to claim 1, characterized in that organisms are used which, as wild type, have no ketolase activity and the genetic modification causes ketolase activity compared to the wild type.

6. The method according to claim 5, characterized in that genetically modified organisms are used which transgenically produce a ketolase containing the amino acids.

Fig/Seq noacid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids that has at least 42% identity at the amino acid level with the sequence SEQ. ID. NO. 2 has, express.

7. The method according to claim 5 or 6, characterized in that to cause gene expression, nucleic acids which encode ketolases containing the amino acid sequence SEQ are introduced into the organisms. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

8. The method according to claim 5 or 7, characterized in that nucleic acids containing the sequence SEQ. ID. NO. 1 brings in.

0. The method according to any one of claims 1 to 8, characterized in that the organisms additionally have an increased activity compared to the wild type of at least one of the activities selected from the group of hydroxylase activity and ß-cyclase activity.

10. The method according to claim 0, characterized in that to additionally increase at least one of the activities, the gene expression of at least one nucleic acid selected from the group of nucleic acids encoding a hydroxylase and nucleic acids encoding a ß-cyclase is increased compared to the wild type.

11. The method according to claim 10, characterized in that to increase gene expression, at least one nucleic acid selected from the group consisting of nucleic acids encoding a hydroxylase and nucleic acids encoding a ß-cyclase is introduced into the organism.

12. The method according to claim 11, characterized in that as nucleic acid encoding a hydroxylase, nucleic acids are introduced which encode a hydroxylase containing the amino acid sequence SEQ ID NO: 16 or one of this sequence by substitution, insertion or deletion of amino acids derived sequence that has at least 20% identity at the amino acid level with the sequence SEQ ID NO: 16.

13. The method according to claim 12, characterized in that nucleic acids containing the sequence SEQ ID NO: 15 are introduced.

14. The method according to claim 11, characterized in that, as nucleic acid encoding a ß-cyclase, nucleic acids are introduced which encode a ß-cyclase, containing the amino acid sequence SEQ ID NO: 18 or one of this sequence by substitution, insertion or deletion of amino acids derived sequence that has at least 20% identity at the amino acid level with the sequence SEQ ID NO: 18.

15. The method according to claim 14, characterized in that nucleic acids containing the sequence SEQ ID NO: 17 are introduced.

16. The method according to any one of claims 1 to 15, characterized in that after cultivation the genetically modified organisms are harvested and the ketocarotenoids are then isolated from the organisms.

17. The method according to one of claims 1 to 16, characterized in that the organism used is an organism which, as the starting organism, is capable of producing carotenoids naturally or through genetic complementation or reregulation of metabolic pathways.

18. The method according to any one of claims 1 to 17, characterized in that microorganisms or plants are used as organisms.

10. The method according to claim 18, characterized in that bacteria, yeasts, algae or fungi are used as microorganisms.

20. The method according to claim 10, characterized in that the microorganisms are selected from the group Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Paracoccus, Nostoc, cyanobacteria of the genus Synechocystis, Candida, Saccharomyces, Hansenula, Phaffia, Pichia, Aspergillus, Tri- choderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium, Haematococcus, Phaedactylum tricornatum, Volvox or Dunaliella.

21. The method according to claim 18, characterized in that plants are used as the organism.

22. The method according to claim 21, characterized in that the plant is a plant selected from the families Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Brassiceae, Cucurbitaceae, Priulaceae, Caryophyllaceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Orchida-ceae, Malvaceae, liliaceae or Lamiaceae.

23. The method according to claim 22, characterized in that the plant is a plant selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus, Bignonia, Calenduia, Caltha, Campanula , Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia,

Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Laburnum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma,

Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ulex, Viola or Zinnia.

24. The method according to any one of claims 1 to 23, characterized in that the ketocarotenoids are selected from the group astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3'-hydroxyequinenone, adonirubin and adonixanthin.

25. Genetically modified organism, where the genetic modification affects the activity of a ketolase

A in the event that the wild-type organism already has ketolase activity, increased compared to the wild type and

B in the event that the wild-type organism has no ketolase activity compared to the wild type

and the ketolase activity increased after A or caused after B by a

Ketolase is caused, containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has at least 42% identity at the amino acid level with the sequence SEQ. ID. NO. 2 has.

26. Genetically modified organism according to claim 25, characterized in that increasing or causing ketolase activity by increasing or causing gene expression of a nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 42% at the amino acid level with the sequence SEQ. ID. NO. 2 compared to the wild type.

27. Genetically modified organisms according to claim 26, characterized in that in order to increase or cause gene expression, nucleic acids which encode ketolases and which contain the amino acid sequence SEQ are introduced into the organism. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has at least 42% identity at the amino acid level with the sequence SEQ. ID. NO. 2 has.

28. Genetically modified organism containing at least one transgenic nucleic acid encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 2 or any of this sequence by substitution, insertion or deletion amino acid derived sequence that has at least 42% identity at the amino acid level with the sequence SEQ. ID. NO. 2 has.

29. Genetically modified organism containing at least two endogenous nucleic acids encoding a ketolase containing the amino acid sequence

SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has at least 42% identity at the amino acid level with the sequence SEQ. ID. NO. 2 has.

30. Genetically modified organism according to one of claims 25 to 20, characterized in that the genetic modification additionally increases at least one of the activities selected from the group of hydroxlase activity and ß-cyclase activity compared to the wild type.

31. Genetically modified organism according to one of claims 25 to 30, characterized in that as a starting organism it is naturally capable of producing carotenoids or through genetic complementation.

32. Genetically modified organism according to one of claims 25 to 31, selected from the group of microorganisms or plants.

33. Genetically modified microorganism according to claim 32, characterized in that the microorganisms are selected from the group of bacteria, yeasts, algae or fungi.

34. Genetically modified microorganism according to claim 33, characterized in that the microorganisms are selected from the group Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Paracoccus, Nostoc, cyanobacteria of the genus Synechocystis, Candida, Saccharomyces, Hansenula, Pichia, Aspergillus , Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces,

Fusahum, Haematococcus, Phaedactylum tricomatum, Volvox or Dunaliella.

35. Genetically modified plant according to claim 32, characterized in that the plants are selected from the families Ranuncuiaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Bras- siceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Orchidaceae, Malvaceae, liliaceae or Lamiaceae.

36. Genetically modified plant according to claim 35, characterized in that plants are selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus, Bignonia, Calenduia, Caltha, Campanula, Canna , Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillea , Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Labumum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcissus , Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma,

X ^'

Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Siiphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ulex, Viola or Zinnia.

37. Use of the genetically modified organisms according to one of claims 25 to 36 as feed or food.

38. Use of the genetically modified organisms according to one of claims 25 to 36 for the production of ketocarotenoid-containing extracts or for the production of feed and nutritional supplements.

30. Ketolase containing the amino acid sequence SEQ. ID. NO. 8 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 8, with the proviso that the amino acid sequences SEQ ID NO: 4 is not included.

40. Ketolase containing the amino acid sequence SEQ. ID. NO. 6 or one of this sequence by substitution, insertion or deletion of amino acids derived sequence that has at least 70% identity at the amino acid level with the sequence SEQ. ID. NO. 6 has.

41. Ketolase containing the amino acid sequence SEQ. ID. NO. 12 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has at least 70% identity at the amino acid level with the sequence SEQ. ID. NO. 12, with the proviso that the amino acid sequences SEQ ID NO: 6 is not included.

42. Ketolase containing the amino acid sequence SEQ. ID. NO. 40 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has at least 50% identity at the amino acid level with the sequence SEQ. ID. NO. 40, with the proviso that the amino acid sequences SEQ ID NO: 47 is not included.

43. Nucleic acid encoding a protein according to one of claims 30 to 42

X with the proviso that the sequence SEQ ID NO: 5 is not included.

44. Use of a protein containing the amino acid sequence SEQ. ID. NO. 4 or any of this sequence by substitution, insertion or deletion of

Amino acid derived sequence that has at least 70% identity at the amino acid level with the sequence SEQ. ID. NO. 4 and has the property of a ketolase, as ketolase.

45. Use of a protein containing the amino acid sequence SEQ. ID. NO. 6 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has at least 65% identity at the amino acid level with the sequence SEQ. ID. NO. 6 and has the property of a ketolase, as ketolase.

46. Use of a protein containing the amino acid sequence SEQ. ID. NO. 47 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has at least 50% identity at the amino acid level with the sequence SEQ. ID. NO. 47 and has the property of a ketolase, as ketolase.