EP1532264A2

EP1532264A2 - Method for the production of ketocarotinoids in flower petals on plants

Info

Publication number: EP1532264A2
Application number: EP03792345A
Authority: EP
Inventors: Christel Renate Schopfer; Ralf Flachmann; Karin Herbers; Irene Kunze; Matt Sauer; Martin Klebsattel
Original assignee: SunGene GmbH
Current assignee: SunGene GmbH
Priority date: 2002-08-20
Filing date: 2003-08-18
Publication date: 2005-05-25
Also published as: US20060253927A1; MXPA05001659A; ZA200602230B; WO2004017749A2; AU2003264062B2; IL166767A0; NO20050704L; IL166507A0; WO2004018694A3; CA2495235A1; AU2003253416A1; EP1542945A2; IL166771A0; AU2003260423A1; MXPA05001899A; US7381541B2; WO2004018695A3; CN1675367A; NO20050755L; CA2495444A1

Abstract

The present invention relates to a process for preparing ketocarotenoids by cultivation of genetically modified organisms which, compared with the wild type, have a modified ketolase activity, to the genetically modified organisms, and to the use thereof as human and animal foods and for producing ketocarotenoid extracts.

Description

I

Process for the production of ketocarotenoids in petals of plants

description

The present invention relates to a process for the production of ketocarotenoids by cultivating plants which have an altered ketolase activity in flower petals compared to the wild type, the genetically modified plants, and their use as food and feed and for the production of ketocarotenoid extracts.

Carotenoids are synthesized de novo in bacteria, algae, fungi and plants. Ketocarotenoids, i.e. carotenoids, which contain at least one keto group, such as astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3'-hydroxyechinenone, adonirubin and adonixant in are natural antioxidants and pigments that are produced by some algae and microorganisms as secondary metabolites ,

Due to their coloring properties, the ketocarotenoids and especially astaxanthin are used as pigmenting aids in animal nutrition, especially in trout, salmon and shrimp farming.

Nowadays, the production of astaxanthin is largely experienced through chemical synthesis. Nowadays, natural ketocarotenoids, such as natural astaxanthin, are obtained in small amounts in biotechnological processes by cultivating algae, for example Haematococcus pluvialis, or by fermentation of microorganisms which have been optimized with regard to technology and subsequent isolation.

An economical biotechnological process for the production of natural ketocarotenoids is therefore of great importance.

From WO 00/32788 it is known to influence certain carotenoid ratios in day tetals by combined overexpression of carotenoid biosynthesis genes and antisense methods.

WO 98/18910 describes the synthesis of ketocarotenoids in nectaries of tobacco flowers by introducing a ketolase gene into tobacco. WO 01/20011 describes a DNA construct for the production of ketocarotenoids, in particular astaxanthin, in seeds of oilseed plants such as oilseed rape, sunflower, soybean and mustard using a seed-specific promoter and a ketolase from Haematococcus.

The methods disclosed in WO 98/18910 and WO 01/20011 provide genetically modified plants which contain ketocarotenoids in specific tissues, but have the disadvantage that the level of the ketocarotenoids and the purity, in particular astaxanthin, are still present is not satisfactory.

The object of the invention was therefore to provide an alternative process for the production of ketocarotenoids by cultivating plants, or to provide further transgenic plants which produce ketocarotenoids which have optimized properties, such as a higher ketocarotenoid content have and do not have the described disadvantage of the prior art.

Accordingly, a method for producing ketocarotenoids has been found by cultivating genetically modified plants which have an altered ketolase activity in petals compared to the wild type.

With a few exceptions, such as the Adonis floret, plants and especially the petals, which are also called petals, contain carotenoids but no ketocarotenoids. ' As a rule, therefore, the petals of wild-type plants have no ketolase activity.

In one embodiment of the method according to the invention, plants are therefore used as starting plants which, as wild type, have ketolase activity in petals, such as Adonis florets. In this embodiment, the genetic modification causes an increase in ketolase activity in petals.

Ketolase activity means the enzyme activity of a ketolase.

A ketolase is understood to mean a protein which has the enzymatic activity of introducing a keto group on the optionally substituted β-ionone ring of carotenoids. In particular, a ketolase is understood to be a protein which has the enzymatic activity to convert β-carotene into canthaxanthin.

Accordingly, ketolase activity is understood to mean the amount of β-carotene or amount of canthaxanthin formed by the protein ketolase in a certain time.

With an increased ketolase activity compared to the wild type, the amount of β-carotene converted or the amount of canthaxanthin formed is increased by the protein ketolase in a certain time compared to the wild type.

This increase in ketolase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the ketolase Wild type activity.

According to the invention, the term “wild type” is understood to mean the corresponding non-genetically modified starting plant.

Depending on the context, the term "plant" can be understood to mean the starting plant (wild type) or a genetically modified plant according to the invention or both.

Preferably and in particular in cases in which the plant or the wild type cannot be clearly assigned, “wild type” is used for increasing or causing ketolase activity, for the increase in hydroxylase activity described below, for the increase described below β-cyclase activity, for the increase in the HMG-CoA reductase activity described below, for the increase in the (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity described below, for the Increase in 1-deoxy-D-xylose-5-phosphate synthase activity described below, for the increase in 1-deoxy-D-xylose-5-phosphate reductoisomerase activity described below, for increase in Isopentenyl diphosphate Δ isomerase activity, for the increase in geranyl diphosphate synthase activity described below, for the increase in farnesyl diphosphine described below at-synthase activity, for the increase in geranyl-geranyl-diphosphate synthase activity described below, for the increase in phytoene synthase activity described below, for the increase in phytoene desaturase activity described below, for the described below Increase in zeta-carotene desaturase activity, for that described below Increase in crtlSO activity, for the increase in FtsZ activity described below, for the increase in MinD activity described below, for the reduction in ε-cyclase activity described below and for the reduction in endogenous β-hydroxylase activity described below and the increase in the content of ketocarotenoids was understood as a reference plant.

This reference plant is for plants which already have a ketolase activity in petals as a wild type, preferably Adonis aestivalis, Adonis flammeus or Adonis annuus, particularly preferably Adonis aestivalis.

This reference plant is for plants which, as a wild type, have no ketolase activity in petals, preferably Tagetes erecta, Tagetes patula, Tagetes lucida, Tagetes pringlei, Tagetes palmeri, Tagetes minuta or Tagetes campanulata, particularly preferably Tagetes erecta.

The ketolase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably determined under the following conditions:

The ketolase activity in plant material is determined using the method of Frazer et al. , (J. Biol. Chem.

272 (10): 6128-6135, 1997). The ketolase activity in plant extracts is determined with the substrates beta-carotene and canthaxanthin in the presence of lipid (soy lecithin) and detergent (sodium cholate). Substrate / product ratios from the ketolase assays are determined by means of HPLC.

The ketolase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms at the translation and protein levels or by increasing the gene expression of a nucleic acid encoding a ketolase compared to the wild type, for example by inducing the ketolase gene by activators or by introducing Nucleic acids encoding a ketolase in the plant.

Increasing the gene expression of a nucleic acid encoding a ketolase is also understood according to the invention in this embodiment to mean the manipulation of the expression of the endogenous ketolases of the plants. This can be achieved, for example, by changing the promoter DNA sequence for genes encoding ketolase. Such a change, which is a changed or preferably increased expression rate of at least one endogenous Ketolase gene results, can be done by deletion or insertion of DNA sequences.

As described above, it is possible to change the expression of at least one endogenous ketolase by applying exogenous stimuli. This can take place through special physiological conditions, ie through the application of foreign substances.

Furthermore, an increased expression of at least one endogenous ketolase gene can be achieved in that a regulator protein which is not found or modified in the wild type plant interacts with the promoter of these genes.

Such a regulator can represent a chimeric protein which consists of a DNA binding domain and a transcription activator domain, as described for example in WO 96/06166.

In a preferred embodiment, the ketolase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a ketolase.

In a further preferred embodiment, the gene expression of a nucleic acid encoding a ketolase is increased by introducing nucleic acids encoding ketolases into the plant.

In this embodiment, the transgenic plants according to the invention therefore have at least one further ketolase gene compared to the wild type. In this embodiment, the genetically modified plant according to the invention accordingly has at least one exogenous (= heterologous) nucleic acid, coding for a ketolase, or at least two endogenous nucleic acids, coding for a ketolase

In another preferred embodiment of the process according to the invention, plants are used as starting plants which, as a wild type in petals, have no ketolase activity, such as, for example, tomato, Marigold, Tagetes erecta, Tagetes lucida, Tagetes minuta, Tagetes pringlei, Tagetes palmeri and Tagetes campanulata.

In this preferred embodiment, the genetic modification causes ketolase activity in petals. In this preferred embodiment, the genetically modified plant according to the invention therefore has a ketolase activity in flower compared to the genetically unmodified wild type. leaf open and is therefore preferably able to transgenically express a ketolase in flower petals.

In this preferred embodiment, the gene expression of a nucleic acid encoding a ketolase is caused analogously to the above-described increase in gene expression of a nucleic acid encoding a ketolase, preferably by introducing nucleic acids which encode ketolases into the starting plant.

In principle, any ketolase gene, that is to say any nucleic acids encoding a ketolase, can be used in both embodiments.

All nucleic acids mentioned in the description can be, for example, an RNA, DNA or cDNA sequence.

In the case of genomic ketolase sequences from eukaryotic sources which contain introns, in the event that the host plant is unable or unable to express the corresponding ketolase, nucleic acid sequences which have already been processed, such as the corresponding cDNAs, are preferred to use.

Examples of nucleic acids encoding a ketolase and the corresponding ketolases that can be used in the method according to the invention are, for example, sequences from

Haematoccus pluvialis, especially from Haematoccus pluvialis Flotow em. Wille (Accession NO: X86782; nucleic acid: SEQ ID NO: 1, protein SEQ ID NO: 2),

Haematoccus pluvialis, NIES-144 (Accession NO: D45881; nucleic acid: SEQ ID NO: 3, protein SEQ ID NO: 4),

Agrobacterium aurantiacum (Accession NO: D58420; nucleic acid: SEQ ID NO: 5, protein SEQ ID NO: 6),

Alicaligenes spec. (Accession NO: D58422; nucleic acid: SEQ ID NO: 7, protein SEQ ID NO: 8),

Paracoccus marcusii (Accession NO: Y15112; nucleic acid: SEQ ID NO: 9, protein SEQ ID NO: 10).

Synechocystis sp. Strain PC6803 (Accession NO: NP442491; nucleic acid: SEQ ID NO: 11, protein SEQ ID NO: 12). Bradyrhizobium sp. (Accession NO: AF218415; nucleic acid: SEQ ID NO: 13, protein SEQ ID NO: 14).

Nostoc sp. Strain PCC7120 (Accession NO: AP003592, BAB74888; nucleic acid: SEQ ID NO: 15, protein SEQ ID NO: 16).

Haematococcus pluvialis

(Accession NO: AF534876, AAN03484; nucleic acid: SEQ ID NO: 81, protein: SEQ ID NO: 82)

Paracoccus sp. MBIC1143

(Accession NO: D58420, P54972; nucleic acid: SEQ ID NO: 83, protein: SEQ ID NO: 84)

Brevundimonas aurantiaca

(Accession NO: AY166610, AAN86030; nucleic acid: SEQ ID NO: 85, protein: SEQ ID NO: 86)

Nodularia spumigena NSOR10

(Accession NO: AY210783, AA064399; nucleic acid: SEQ ID NO: 87, protein: SEQ ID NO: 88)

Nostoc punctiform ATCC 29133

(Accession NO: NZ_AABC01000195, ZP_00111258; nucleic acid: SEQ ID NO: 89, protein: SEQ ID NO: 90)

Nostoc punctiform ATCC 29133

(Accession NO: NZ_AABC01000196; nucleic acid: SEQ ID NO: 91, protein: SEQ ID NO: 92)

Deinococcus radiodurans Rl

(Accession NO: E75561, AE001872; nucleic acid: SEQ ID NO: 93, protein: SEQ ID NO: 94)

Further natural examples of ketolases and ketolase genes which can be used in the method according to the invention can be obtained, for example, from different organisms, the genomic sequence of which is known, by comparing the identity of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the sequences described above and in particular with easily find the sequences SEQ ID NO: 2 and / or 16 and / or 90 and / or 92.

Further natural examples of ketolases and ketolase genes can also be derived from the nucleic acid sequences described above, in particular from the sequences SEQ ID NO: 2 and / or 16 and / or 90 and / or 92 from different organisms, the genomic sequence of which is not known, can easily be found by hybridization techniques in a manner known per se.

The hybridization can take place under moderate (low stringency) or preferably under stringent (high stringency) conditions.

Such hybridization conditions are, for example

Sambrook, J., Fritsch, EF, Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Cold Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6.

For example, the conditions during the washing step can be selected from the range of conditions limited by those with low stringency (with 2X SSC at 50 ° C) and those with high stringency (with 0.2X SSC at 50 ° C, preferably at 65 ° C) (20X SSC: 0.3 M sodium citrate, 3 M sodium chloride, pH 7.0).

In addition, the temperature during the washing step can be raised from moderate conditions at room temperature, 22 ° C, to stringent conditions at 65 ° C.

Both parameters, salt concentration and temperature, can be varied simultaneously, one of the two parameters can be kept constant and only the other can be varied. Denaturing agents such as formamide or SDS can also be used during hybridization. In the presence of 50% formamide, the hybridization is preferably carried out at 42 ° C.

Some exemplary conditions for hybridization and washing step are given as a result:

(1) Hybridization conditions with, for example

(i) 4X SSC at 65 ° C, or

(ii) 6X SSC at 45 ° C, or

(iii) 6X SSC at 68 ° C, 100 mg / ml denatured fish sperm DNA, or (iv) 6X SSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA at 68 ° C, or

(v) 6XSSC, 0.5% SDS, 100 mg / ml denatured, fragmented 5 salmon sperm DNA, 50% formamide at 42 ° C, or

(vi) 50% formamide, 4X SSC at 42 ° C, or

(vii) 50% (vol / vol) formamide, 0.1% bovine serum albumin, 10 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer pH 6.5, 750 mM NaCI, 75 mM sodium citrate at 42 ° C, or

(viii) 2X or 4X SSC at 50 ° C (moderate conditions), or

15

(ix) 30 to 40% formamide, 2X or 4X SSC at 42 ° (moderate conditions).

(2) washing steps for 10 minutes each with, for example, 20

(i) 0.015 M NaCl / 0.0015 M sodium citrate / 0.1% SDS at 50 ° C, or

(ii) 0.1X SSC at 65 ° C, or

25

(iii) 0.1X SSC, 0.5% SDS at 68 ° C, or

(iv) 0.1X SSC, 0.5% SDS, 50% formamide at 42 ° C, or

30 (v) 0.2X SSC, 0.1% SDS at 42 ° C, or

(vi) 2X SSC at 65 ° C (moderate conditions).

In a preferred embodiment of the method according to the invention, nucleic acids are encoded which encode a protein containing the amino acid sequence SEQ ID NO: 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and which have an identity of at least 20 %, preferably at least 30%, more preferably at least 40 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90% at the amino acid level with the sequence SEQ ID NO: 2 and exhibits enzymatic property of a ketolase.

45

This can be a natural ketolase sequence which, as described above, by identity comparison of the Sequences from other organisms can be found or an artificial ketolase sequence that was modified from the sequence SEQ ID NO: 2 by artificial variation, for example by substitution, insertion or deletion of amino acids.

In a further preferred embodiment of the method according to the invention, nucleic acids which encode a protein are introduced, containing the amino acid sequence SEQ ID NO: 16 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90% at the amino acid level with the sequence SEQ ID NO: 16 and the enzymatic property of a Has ketolase.

This can be a natural ketolase sequence which, as described above, can be found by comparing the identity of the sequences from other organisms, or an artificial ketolase sequence which can be derived from the sequence SEQ ID NO: 16 by artificial variation, for example was modified by substitution, insertion or deletion of amino acids.

In a further preferred embodiment of the method according to the invention, nucleic acids which encode a protein are introduced, containing the amino acid sequence SEQ ID NO: 90 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90% at the amino acid level with the sequence SEQ ID NO: 90 and the enzymatic property of a Has ketolase.

This can be a natural ketolase sequence which, as described above, can be found by comparing the identity of the sequences from other organisms, or an artificial ketolase sequence which can be derived from the sequence SEQ ID NO: 90 by artificial variation, for example was modified by substitution, insertion or deletion of amino acids. In a further preferred embodiment of the method according to the invention, nucleic acids which encode a protein are introduced, containing the amino acid sequence SEQ ID NO: 92 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 20 %, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90% at the amino acid level with the sequence SEQ ID NO: 92 and the enzymatic Has property of a ketolase.

This can be a natural ketolase sequence which, as described above, can be found by comparing the identity of the sequences from other organisms or an artificial ketolase sequence which can be derived from the sequence SEQ ID NO: 92 by artificial variation, for example was modified by substitution, insertion or deletion of amino acids.

In the description, the term “substitution” is to be understood as meaning the replacement of one or more amino acids by one or more amino acids. So-called conservative exchanges are preferably carried out, in which the replaced amino acid has a similar property to the original amino acid, for example replacement of Glu by Asp, Gin by Asn, Val by Ile, Leu by Ile, Ser by Thr.

Deletion is the replacement of an amino acid with a direct link. Preferred positions for deletions are the termini of the polypeptide and the links between the individual protein domains.

Inserts are insertions of amino acids into the polypeptide chain, whereby a direct bond is formally replaced by one or more amino acids.

Identity between two proteins is understood to mean the identity of the amino acids over the respective total protein length, in particular the identity obtained by comparison with the aid of the laser genes software from DNASTAR, ine. Madison, Wisconsin (USA) using the Clustal method (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151-1) using the following parameters becomes: Multiple alignment parameters:

Gap penalty 10

Gap length penalty 10

Pairwise alignment parameters:

K-tuple 1

Gap penalty 3

Window 5

Diagonals saved 5

A protein which has an identity of at least 20% at the amino acid level with a specific sequence is accordingly understood to be a protein which has an identity of at least 20% when comparing its sequence with the specific sequence, in particular according to the above-mentioned program logarithm with the above parameter set.

A protein which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 2 or 16 or 90 or 92 is accordingly understood to be a protein which, when its sequence is compared with the sequence SEQ ID

NO: 2 or 16 or 90 or 92, in particular according to the above program logarithm with the above parameter set, has an identity of at least 20%.

Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

Those codons that are frequently used in accordance with the plant-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other, known genes of the organisms in question.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 1 is introduced into the plant.

In a further, particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 15 is introduced into the plant.

In a further, particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 89 is introduced into the plant. In a further, particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 91 is introduced into the plant.

All of the above-mentioned ketolase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897). The addition of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In a particularly preferred embodiment of the method according to the invention, genetically modified plants are used which have the highest expression rate of a ketolase in flowers.

This is preferably achieved in that the gene expression of the ketolase takes place under the control of a flower-specific promoter. For example, the nucleic acids described above, as described in detail below, are introduced into the plant in a nucleic acid construct, functionally linked to a flower-specific promoter.

According to the invention, plants are preferably understood to mean plants which have chromoplasts as the wild type in petals. Further preferred plants have carotenoids as wild type in the petals, in particular β-carotene, zeaxanthin, neoxanthin, violaxanthin or lutein. Plants that are more preferred have a hydroxylase activity in the petals as a wild type.

Hydroxylase activity means the enzyme activity of a hydroxylase.

A hydroxylase is understood to mean a protein which has the enzymatic activity of introducing a hydroxyl group on the optionally substituted β-ionone ring of carotenoids. In particular, a hydroxylase is understood to mean a protein which has the enzymatic activity to convert β-carotene into zeaxanthin or cantaxanthin into astaxanthin.

Accordingly, hydroxylase activity is understood to mean the amount of β-carotene or cantaxanthin or the amount of zeaxanthin or astaxanthin formed in a certain time by the protein hydroxylase.

Particularly preferred plants are plants selected from the families Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Brassicaceae, Cucurbita- ceae, Primulaceae, CaryophylIaceae, Amaranthacee, Geraniaceaeaeae, Gentianaceaeae, Gentianaceaeae, Gentianaceaeae , Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Orchidaceae, Malvaceae, liliaceae or Lamiaceae.

Very particularly preferred plants are selected from the group of the plant genera Marigold, Tagetes erhcta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica-, Aquilegia, Aster, Astragalus, Bignonia, Calenduia, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracle Hisbiscus, Heliopsis, Hypericum, Hypo-choeris, Impatiens, Iris, Jacaranda, Kerria, Laburnum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcissus, Oenothera, Osmanthus, Petunia Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ul ex, viola or zinnia, particularly preferably selected from the group of the plant genera Mariold, Tagetes erecta, Tagetes patula, Lycopersicon, Rosa, Calenduia, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium, Tropaeolum or Adonis.

In a preferred embodiment, plants are cultivated which, in addition to the wild type, have an increased hydroxylase activity and / or β-cyclase activity.

Hydroxylase activity means the enzyme activity of a hydroxylase. A hydroxylase is understood to mean a protein which has the enzymatic activity of introducing a hydroxyl group on the optionally substituted β-ionone ring of carotenoids.

In particular, a hydroxylase is understood to mean a protein which has the enzymatic activity to convert β-carotene into zeaxanthin or cantaxanthin into astaxanthin.

Accordingly, hydroxyase activity is understood to mean the amount of β-carotene or cantaxanthin or the amount of zeaxanthin or astaxanthin formed in a certain time by the protein hydroxylase.

With an increased hydroxylase activity compared to the wild type, the amount of β-carotene or cantaxantin or the amount of zeaxanthin or astaxanthin formed is increased in a certain time by the protein hydroxylase compared to the wild type.

This increase in the hydroxylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the hydroxylase activity of the Wild type.

The "endogenous β-hydroxylase" described below means the plant's own endogenous hydroxylase. The activity is determined analogously.

Β-cyclase activity means the enzyme activity of a β-cyclase.

A ß-cyclase is understood to be a protein which has the enzymatic activity to convert a terminal, linear residue of lycopene into a ß-ionone ring.

In particular, a β-cyclase is understood to be a protein which has the enzymatic activity to convert γ-carotene into β-carotene.

Accordingly, ß-cyclase activity is understood to mean the amount of γ-carotene converted or the amount of ß-carotene formed in a certain time by the protein ß-cyclase. If the β-cyclase activity is higher than that of the wild type, the amount of γ-carotene converted or the amount of β-carotene formed is increased by the protein ß-cyclase in a certain time compared to the wild type.

This increase in the β-cyclase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the β- Wild-type cyclase activity.

The hydroxylase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably determined under the following conditions:

The activity of the hydroxylase is according to Bouvier et al. (Biochim. Biophys. Acta 1391 (1998), 320-328) in vi tro. Ferredoxin, ferredoxin-NADP oxidoreductase, catalase, NADPH and beta-carotene with mono- and digalactosylglycerides are added to a certain amount of plant extract.

The hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, Keller, d'Harlingue and Camara (xanthophyll biosynthesis: molecular and functional characterization of carotenoid hydroxylases from pepper fruits (Capsicum annuum L.; Biochim. Biophys. Acta 1391 (1998 ), 320-328):

The in vitro assay is carried out in a volume of 0.250 ml volume. The mixture contains 50 mM potassium phosphate (pH 7.6), 0.025 mg ferredoxin from spinach, 0.5 units ferredoxin-NADP + oxidoreductase from spinach, 0.25 mM NADPH, 0.010 mg beta-carotene (emulsified in 0.1 mg Tween 80), 0.05 mM a mixture of mono - And digalactosylglycerides (1: 1), 1 unit of catalysis, 200 mono- and digalactosylglycerides, (1: 1), 0.2 mg bovine serum albumin and plant extract in different volumes. The reaction mixture is incubated for 2 hours at 30C. The reaction products are extracted with organic solvent such as acetone or chloroform / methanol (2: 1) and determined by means of HPLC.

The determination of the β-cyclase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably carried out under the following conditions:

The activity of the β-cyclase is according to Fräser and Sandmann

(Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15) in vitro. It becomes a certain amount of plant extract Potassium phosphate as buffer (pH 7.6), lycopene as substrate, stroma protein from paprika, NADP +, NADPH and ATP added.

The hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, d'Harlingue and Camara (Molecular Analysis of carotenoid cyclae inhibition; Arch. Biochem. Biophys. 346 (1) (1997) 53-64):

The in vitro assay is carried out in a volume of 250 1 volume. The mixture contains 50 mM potassium phosphate

(pH 7.6), different amounts of plant extract, 20 nM lycopene, 250 ° = g of chromoplastic paprika stromal protein, 0.2 mM NADP +, 0.2 mM NADPH and 1 mM ATP. NADP / NADPH and ATP are dissolved in 10 μl ethanol with 1 mg Tween 80 immediately before the addition to the incubation medium. After a reaction time of 60 minutes at 30C, the reaction is ended by adding chloroform / methanol (2: 1). The reaction products extracted in chloroform are analyzed by HPLC.

An alternative assay with a radioactive substrate is described in Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15).

The hydroxylase activity and / or β-cyclase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing the gene expression of nucleic acids encoding a hydroxylase and / or of nucleic acids encoding a β- Cyclase versus wild type.

The increase in the gene expression of the nucleic acids encoding a hydroxylase and / or the increase in the gene expression of the nucleic acid encoding a β-cyclase compared to the wild type can also be carried out in various ways, for example by inducing the hydroxylase gene and / or β-cyclase gene by activators or by introducing one or more hydroxylase gene copies and / or β-cyclase gene copies, ie by introducing at least one nucleic acid encoding a hydroxylase and / or at least one nucleic acid encoding an ε-cyclase into the plant.

Increasing the gene expression of a nucleic acid encoding a hydroxylase and / or β-cyclase is also understood according to the invention to mean the manipulation of the expression of the plants' own endogenous hydroxylase and / or β-cyclase. In certain plants in which the focus of biosynthesis is on the α-carotenoid pathway, such as plants of the genus Tagetes, it is advantageous to reduce the endogenous β-hydroxylase activity and to increase the activity of exogenous hydroxylases.

This can be achieved, for example, by changing the promoter DNA sequence for genes encoding hydroxylases and / or β-cyclases. Such a change, which results in an increased expression rate of the gene, can take place, for example, by deleting or inserting DNA sequences.

As described above, it is possible to change the expression of the endogenous hydroxylase and / or β-cyclase by applying exogenous stimuli. This can take place through special physiological conditions, ie through the application of foreign substances.

Furthermore, an altered or increased expression of an endogenous hydroxylase and / or β-cyclase gene can be achieved in that a regulator protein which does not occur in the non-transformed plant interacts with the promoter of this gene.

In a preferred embodiment, the gene expression of a nucleic acid encoding a hydroxylase is increased and / or the gene expression of a nucleic acid encoding a β-cyclase is increased by introducing at least one nucleic acid encoding a hydroxylase and / or by introducing at least one nucleic acid encoding one ß-cyclase into the plant.

In principle, any hydroxylase gene or each β-cyclase gene, that is to say any nucleic acid which codes for a hydroxylase and any nucleic acid which codes for a β-cyclase, can be used for this purpose.

With genomic hydroxylase or. β-cyclase nucleic acid sequences from eukaryotic sources which contain introns are, in the event that the host plant is unable or cannot be able to express the corresponding hydroxylase or β-cyclase, preferably already processed Nucleic acid sequences, how to use the corresponding cDNAs. Examples of a hydroxylase gene are: a nucleic acid encoding a hydroxylase from Haematococcus pluvialis, accession AX038729, WO 0061764); (Nucleic acid: SEQ ID NO: 17, protein: SEQ ID NO: 18),

and hydroxylases of the following accession numbers:

| emb | CAB55626.1, CAA70427.1, CAA70888.1, CAB55625.1, AF499108_1, AF315289_1, AF296158_1, AAC49443.1, NP_194300.1, NP_200070.1, AAG10430.1, CAC06712.1, AAM889519.1 .1, AAL80006.1, AF162276_1, AA053295.1, AAN85601.1, CRTZ_ERWHE, CRTZ_PANAN, BAB79605.1, CRTZ_ALCSP, CRTZ_AGRAU, CAB56060.1, ZP_00094836.1, AAC4483852.1, NPAC745370.144, NPAC745370.144 .1, NP_849490.1, ZP_00087019.1, NP_503072.1, NP_852012.1, NP_115929.1, ZP_00013255.1

A particularly preferred hydroxylase is also the hydroxylase from tomato (Accession Y14809) (nucleic acid: SEQ ID NO: 97; protein: SEQ ID NO. 98). Examples of a β-cyclase gene are: a nucleic acid encoding a β-cyclase from tomato (Accession X86452). (Nucleic acid: SEQ ID NO: 19, protein: SEQ ID O: 20),

As well as ß-cyclases of the following access numbers:

S66350 lycopene beta-cyclase (EC 5.5.1.-) - tomato CAA60119 lycopene synthase [Capsicum annuum] S66349 lycopene beta-cyclase (EC 5.5.1.-) - common tobacco CAA57386 lycopene cyclase [Nicotiana tabacum] AAM21152 lycopene beta-cyclase [Citrus sinensis] AAD38049 lycopene cyclase [Citrus x paradisi] AAN86060 lycopene cyclase [Citrus unshiu] AAF44700 lycopene beta-cyclase [Citrus sinensis] AAK07430 lycopene beta-cyclase [Adonis palaestina] AAG10429 beta cyclase [Tagetes er80ta33] Ly37 cyclase AAL92175 beta-lycopene cyclase [Sandersonia aurantiaca] CAA67331 lycopene cyclase [Narcissus pseudonarcissus] AAM45381 beta cyclase [Tagetes erecta]

AA018661 lycopene beta cyclase [Zea mays]

AAG21133 chromoplast-specific lycopene beta-cyclase

[Lycopersicon esculentum]

AAF18989 lycopene beta-cyclase [Daucus carota] ZP 001140 hypothetical protein [Prochlorococcus marinus str.

MIT9313] ZP_001050 hypothetical protein [Prochlorococcus marinus subsp. pastoris str. CCMP1378]

ZP_001046 hypothetical protein [Prochlorococcus marinus subsp. pastoris str. CCMP1378] ZP_001134 hypothetical protein [Prochlorococcus marinus str.

MIT9313]

ZP_001150 hypothetical protein [Synechococcus sp. WH 8102]

AAF10377 lycopene cyclase [Deinococcus radiodurans]

BAA29250 393aa long hypothetical protein [Pyrococcus horikoshii] BAC77673 lycopene beta-monocyclase [marine bacterium P99-3] AAL01999 lycopene cyclase [Xanthobacter sp. Py2] ZP_000190 hypothetical protein [Chloroflexus aurantiacus] ZP_000941 hypothetical protein [Novosphmgobium aromaticivorans] AAF78200 lycopene cyclase [Bradyrhizobium sp. 0RS278] BAB79602 crtY [Pantoea agglomerans pv. Milletiae] CAA64855 lycopene cyclase [Streptomyces griseus] AAA21262 dycopene cyclase [Pantoea agglomerans] C37802 crtY protein - Erwinia uredovora BAB7960v cryAcopene a4] pantomeaAco4e acylomer [PantoeaAme450] BAA09593 Lycopene cyclase [Paracoccus sp. MBIC1143] ZP_000941 hypothetical protein [Novosphmgobium aromaticivorans] CAB56061 lycopene beta-cyclase [Paracoccus marcusii] BAA20275 lycopene cyclase [Erythrobacter longus] ZP_000570 hypothetical protein [Thermobifida fusca] ZP_000190 hypothetical protein [chloroflexus aurantiacus] AAK07430 lycopene beta-cyclase [Adonis palaestina] CAA67331 lycopene cyclase [Narcissus pseudonarcissus] AAB53337 Lycopene beta cyclase BAC77673 lycopene beta-monocyclase [marine bacterium P99-3]

A particularly preferred b-cyclase is also the chromoplast-specific b-cyclase from tomato (AAG21133) (nucleic acid: SEQ ID No. 95; protein: SEQ ID No. 96)

In this preferred embodiment, the preferred transgenic plants according to the invention therefore have at least one further hydroxylase gene and / or β-cyclase gene compared to the wild type.

In this preferred embodiment, the genetically modified plant has, for example, at least one exogenous nucleic acid encoding a hydroxylase or at least two endogenous nucleic acids encoding a hydroxylase and / or at least one exogenous nucleic acid encoding a β-cyclase or at least two endogenous nucleic acids encoding a β-cyclase.

In the preferred embodiment described above, nucleic acids encoding proteins are preferably used which contain the amino acid sequence SEQ ID NO: 18 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 18, and which have the enzymatic property of a hydroxylase.

Further examples of hydroxylases and hydroxylase genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 18.

Further examples of hydroxylases and hydroxylase genes can also be easily found, for example, starting from the sequence SEQ ID NO: 17 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the hydroxylase activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the hydroxylase of the sequence SEQ ID NO: 18.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 17 is introduced into the organism. In the preferred embodiment described above, nucleic acids which encode proteins are preferably used as the β-cyclase genes, containing the amino acid sequence SEQ ID NO: 20 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30 %, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 20, and which have the enzymatic property of a β-cyclase.

Further examples of β-cyclases and β-cyclase genes can easily be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID NO: 20 find.

Further examples of β-cyclases and β-cyclase genes can also be easily found, for example, starting from the sequence SEQ ID NO: 19 from various organisms whose genomic sequence is not known, using hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, nucleic acids which encode proteins containing the amino acid sequence of the β-cyclase of the sequence SEQ ID NO: 20 are introduced into organisms to increase the β-cyclase activity.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 19 is introduced into the organism.

All of the above-mentioned hydroxylase genes or β-cyclase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical syn The oligonucleotides can be synthesized, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). The attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In a further preferred embodiment of the method, the plants additionally have a reduced ε-cyclase activity compared to the wild type.

Ε-Cyclase activity means the enzyme activity of an ε-cyclase.

An ε-cyclase is understood to mean a protein which has the enzymatic activity to convert a terminal, linear residue of lycopene into an ε-ionone ring.

An ε-cyclase is therefore understood to mean in particular a protein which has the enzymatic activity to convert lycopene to δ-carotene.

Accordingly, ε-cyclase activity is understood to mean the amount of lycopene converted or amount of δ-carotene formed by the protein ε-cyclase in a certain time.

With a reduced ε-cyclase activity compared to the wild type, the amount of lycopene converted or the amount of δ-carotene formed is reduced in a certain time by the protein ε-cyclase compared to the wild type.

Reduced ε-cyclase activity is preferably the partial or essentially complete inhibition or blocking of the functionality of an ε-cyclase in a plant cell, plant or a part, tissue, organ, cells or seeds derived therefrom based on different cell biological mechanisms Roger that.

The ε-cyclase activity in plants can be reduced compared to the wild type, for example by reducing the amount of ε-cyclase protein or the amount of ε-cyclase mRNA in the plant. Accordingly, ε-cyclase activity which is reduced compared to the wild type can be determined directly or via the determination the amount of ε-cyclase protein or the amount of ε-cyclase mRNA of the plant according to the invention in comparison to the wild type.

A reduction in ε-cyclase activity includes a quantitative reduction in ε-cyclase up to an essentially complete absence of ε-cyclase (i.e. lack of detectability of ε-cyclase activity or lack of immunological detectability of ε-cyclase). Preferably, the ε-cyclase activity (or the ε-cyclase protein amount or the ε-cyclase mRNA amount) in the plant, particularly preferably in flowers compared to the wild type by at least 5%, more preferably by at least 20% , more preferably reduced by at least 50%, more preferably by 100%. In particular, "reduction" also means the complete absence of the ε-cyclase activity (or the ε-cyclase protein or the ε-cyclase mRNA).

The determination of the ε-cyclase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably carried out under the following conditions:

According to Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15), the ε-cyclase activity can be determined in vitro if potassium phosphate is used as a buffer for a certain amount of plant extract (pH 7.6 ), Lycopene as substrate, Stromaprotein from Paprika, NADP +, NADPH and ATP are added.

The determination of the ε-cyclase activity in genetically modified plants according to the invention and in wild-type or reference plants is carried out particularly preferably according to Bouvier, d'Harlingue and Camara (Molecular Analysis of Carotenoid Cyclase Inhibition; Arch. Biochem. Biophys. 346 (1) ( 1997) 53-64):

The in vitro assay is carried out in a volume of 0.25 ml. The mixture contains 50 mM potassium phosphate (pH 7.6), different amounts of plant extract, 20 nM lycopene, 0.25 mg of chromoplastic paprika stromal protein, 0.2 mM NADP +, 0.2 mM NADPH and 1 mM ATP. NADP / NADPH and ATP are dissolved in 0.01 ml ethanol with 1 mg Tween 80 immediately before adding to the incubation medium. After a reaction time of 60 minutes at 30C, the reaction is ended by adding chloroform / methanol (2: 1). The reaction products extracted in chloroform are analyzed by HPLC.

An alternative assay with a radioactive substrate is described in Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1)

(1992) 9-15). Another analytical method is described in Beyer, Kröncke and Nievelstein (On the mechanism of the lycopene isomerase / cyclase reaction in Narcissus pseudonarcissus L. chromopast,; J. Biol. Chem. 266 (26) (1991) 17072-17078).

The ε-cyclase activity in plants is preferably reduced by at least one of the following methods:

a) Introduction of at least one double-stranded ε-cyclase ribonucleic acid sequence, hereinafter also called ε-cyclase dsRNA, or an expression cassette or cassettes ensuring expression thereof. These include methods in which the ε-cyclase dsRNA is directed against an ε-cyclase gene (that is to say genomic DNA sequences such as the promoter sequence) or an ε-cyclase transcript (that is to say mRNA sequences),

b) introduction of at least one ε-cyclase antisense-ribonucleic acid sequence, hereinafter also called ε-cyclase-antisenseRNA, or an expression cassette ensuring its expression. These include methods in which the ε-cyclase antisenseRNA is directed against an ε-cyclase gene (ie genomic DNA sequences) or an ε-cyclase gene transcript (ie RNA sequences). Also included are α-anomeric nucleic acid sequences

c) Introduction of at least one ε-cyclase antisenseRNA combined with a ribozyme or an expression cassette ensuring its expression

d) introduction of at least one ε-cyclase sense ribonucleic acid sequence, hereinafter also referred to as ε-cyclase senseRNA, for inducing a co-suppression or an expression cassette ensuring its expression

e) introduction of at least one DNA or protein binding factor against an ε-cyclase gene, RNA or protein or an expression cassette ensuring its expression

f) introduction of at least one viral nucleic acid sequence which effects ε-cyclase RNA degradation or an expression cassette which ensures its expression

g) Introduction of at least one construct for generating a loss of function, such as the generation of stop codons or a shift in the reading frame, on an ε-cyclase gene, for example by generating an insertion, deletion, inversion or mutation in an ε-cyclase gene , Knockout mutants can preferably be introduced by homologous insertion into said ε-cyclase gene Recombination or introduction of sequence-specific nucleases against ε-cyclase gene sequences can be generated.

It is known to the person skilled in the art that further methods for reducing an ε-cyclase or its activity or function can also be used within the scope of the present invention. For example, the introduction of a dominant-negative variant of an ε-cyclase or an expression cassette ensuring its expression can also be advantageous. Each of these methods can reduce the amount of protein, amount of mRNA and / or activity of an ε-cyclase. A combined application is also conceivable. Other methods are known to the person skilled in the art and can hinder or prevent the processing of ε-cyclase, the transport of ε-cyclase or its mRNA, inhibition of ribosome attachment, inhibition of RNA splicing, induction of an ε-cyclase-RNA-degrading enzyme and / or inhibiting translation elongation or termination.

The individual preferred methods are described as a result of exemplary embodiments:

a) Introduction of a double-stranded ε-cyclase-ribonucleic acid sequence (ε-cyclase-dsRNA)

The method of gene regulation using double-stranded RNA (“double-stranded RNA interference”; dsRNAi) is known and is described, for example, in Matzke MA et al. (2000) Plant Mol Biol 43: 401-415; Fire A. et al (1998) Nature 391: 806-811; WO 99/32619; WO 99/53050; WO 00/68374; WO 00/44914; WO 00/44895; WO 00/49035 or WO 00/63364. We hereby expressly refer to the methods and methods described in the quotations given.

According to the invention, “double-stranded ribonucleic acid sequence” means one or more ribonucleic acid sequences which are theoretically double-stranded RNA because of complementary sequences, for example in accordance with the base pair rules of Waston and Crick and / or factually, for example because of hybridization experiments, in vitro and / or in vivo - train structures.

The person skilled in the art is aware that the formation of double-stranded RNA structures represents a state of equilibrium. The ratio of double-stranded molecules to is preferred corresponding dissociated forms at least 1 to 10, preferably 1: 1, particularly preferably 5: 1, most preferably 10: 1.

A double-stranded ε-cyclase-ribonucleic acid sequence or ε-cyclase-dsRNA is preferably understood to mean an RNA molecule which has a region with a double-strand structure and which contains a nucleic acid sequence in this region which

a) is identical to at least part of the plant's own ε-cyclase transcript and / or

b) is identical to at least part of the plant's own ε-cyclase promoter sequence.

In the method according to the invention, an RNA which has an area with a double-strand structure and which contains a nucleic acid sequence in this area is therefore preferably introduced into the plant in order to reduce the ε-cyclase activity

b) is identical to at least part of the plant's own ε ~ cyclase ~ promoter sequence.

The term “ε-cyclase transcript” is understood to mean the transcribed part of an ε-cyclase gene which, in addition to the ε-cyclase coding sequence, also contains, for example, non-coding sequences, such as UTRs.

An RNA which is "identical to at least part of the plant's own ε-cyclase promoter sequence" means preferably that the RNA sequence with at least part of the theoretical transcript of the ε-cyclase promoter sequence, ie the corresponding RNA sequence is identical.

"A part" of the plant's own ε-cyclase transcript or the plant's own ε-cyclase promoter sequence is understood to mean partial sequences which can range from a few base pairs to complete sequences of the transcript or the promoter sequence. The person skilled in the art can easily determine the optimal length of the partial sequences by routine experiments. As a rule, the length of the partial sequences is at least 10 bases and at most 2 kb, preferably at least 25 bases and at most 1.5 kb, particularly preferably at least 50 bases and at most 600 bases, very particularly preferably at least 100 bases and at most 500, most preferably at least 200 bases or at least 300 bases and at most 400 bases.

The partial sequences are preferably selected in such a way that the highest possible specificity is achieved and the activities of other enzymes, the reduction of which is not desired, are not reduced. It is therefore advantageous to select parts of the ε-cyclase transcript and / or partial sequences of the ε-cyclase promoter sequences for the partial sequences of the ε-cyclase dsRNA that do not occur in other activities.

In a particularly preferred embodiment, the ε-cyclase dsRNA therefore contains a sequence which is identical to a part of the plant's own ε-cyclase transcripts and the 5 ^λ end or the 3 ^λ end of the plant's own nucleic acid, coding for an ε -Cyclase contains. In particular, non-translated regions in the 5 or 3 "of the transcript are suitable for producing selective double-strand structures.

Another object of the invention relates to double-stranded RNA molecules (dsRNA molecules) which, when introduced into a plant organism (or a cell, tissue, organ or propagation material derived therefrom), reduce a ε-cyclase.

A double-stranded RNA molecule for reducing the expression of an ε-cyclase (ε-cyclase-dsRNA) preferably comprises

a) a “sense” RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least part of a “sense” RNA ε-cyclase transcript, and

b) an “antisense” R.NA strand which is essentially, preferably completely, complementary to the RNA “sense” strand under a).

A nucleic acid construct which is introduced into the plant and which is transcribed into the ε-cyclase dsRNA in the plant is preferably used to transform the plant with an ε-cyclase dsRNA. The present invention therefore also relates to a nucleic acid construct that can be transcribed into

a) a “sense” RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least part of the “sense” RNA ε-cyclase transcript, and

b) an “antisense” RNA strand which is essentially — preferably completely — complementary to the RNA sense strand under a).

These nucleic acid constructs are also called expression cassettes or expression vectors below.

With regard to the dsRNA molecules, ε-cyclase nucleic acid sequence, or the corresponding transcript, is preferably understood to be the sequence according to SEQ ID NO: 38 or a tel thereof.

“Essentially identical” means that the dsRNA sequence can also have insertions, deletions and individual point mutations in comparison to the ε-cyclase target sequence and nevertheless brings about an efficient reduction in expression. The homology is preferably at least 75%, preferably at least 80%, very particularly preferably at least 90%, most preferably 100% between the "sense" strand of an inhibitory dsRNA and at least part of the "sense" RNA transcript of an ε-cyclase Gene, or between the "antisense" strand the complementary strand of an ε-cyclase gene.

A 100% sequence identity between dsRNA and an ε-cyclase gene transcript is not absolutely necessary in order to bring about an efficient reduction in ε-cyclase expression. As a result, there is the advantage that the method is tolerant of sequence deviations, such as may occur as a result of genetic mutations, polymorphisms or evolutionary divergences. For example, it is possible to suppress ε-cyclase expression in another organism using the dsRNA that was generated on the basis of the ε-cyclase sequence of one organism. For this purpose, the dsRNA preferably comprises sequence regions of ε-cyclase gene transcripts which correspond to conserved regions. Said conserved areas can easily be derived from sequence comparisons.

Alternatively, an "essentially identical" dsRNA can also be defined as a nucleic acid sequence which is capable of hybridizing with part of an ε-cyclase gene transcript (eg in 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA at 50 ° C or 70 ° C for 12 to 16 h).

“Essentially complementary” means that the “antisense” RNA strand can also have insertions, deletions and individual point mutations in comparison to the complement of the “sense” RNA strand. The homology is preferably at least 80%, preferably at least 90%, very particularly preferably at least 95%, most preferably 100% between the "antisense" RNA strand and the complement of the "sense" RNA strand.

In a further embodiment, the ε-cyclase dsRNA comprises

a) a "sense" RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least part of the "sense" RNA transcript of the promoter region of an ε-cyclase gene, and

b) an “antisense” RNA strand which is essentially — preferably completely — complementary to the RNA “sense” strand under a).

The corresponding nucleic acid construct to be used preferably for transforming the plants comprises

a) a “sense” DNA strand which is essentially identical to at least part of the promoter region of an ε-cyclase gene, and

b) an “antisense” DNA strand which is essentially — preferably completely — complementary to the DNA “sense” strand under a).

The promoter region of an ε-cyclase is preferably understood to mean a sequence according to SEQ ID NO: 47 or a part thereof.

To produce the ε-cyclase dsRNA sequences for reducing the ε-cyclase activity, the following partial sequences are particularly preferably used, in particular for Tagetes erecta:

SEQ ID NO: 40: Sense fragment of the 5'-terminal region of the ε-cyclase

SEQ ID NO: 41: Antisense fragment of the 5 ^λ terminal region of the ε-cyclase SEQ ID NO: 42: Sense fragment of the 3'-terminal region of the ε-cyclase

SEQ ID NO: 43: Antisense fragment of the 3'-terminal region, the ε-cyclase

SEQ ID NO: 47: Sense fragment of the ε-cyclase promoter

SEQ ID NO: 48: Antisense fragment of the ε-cyclase promoter

The dsRNA can consist of one or more strands of polyribonucleotides. Of course, in order to achieve the same purpose, several individual dsRNA molecules, each comprising one of the ribonucleotide sequence sections defined above, can be introduced into the cell or the organism.

The double-stranded dsRNA structure can be formed from two complementary, separate RNA strands or - preferably - from a single, self-complementary RNA strand. In this case, the “sense” RNA strand and the “antisense” RNA strand are preferably covalently linked to one another in the form of an inverted “repeat”.

Such as. described in WO 99/53050, the dsRNA can also comprise a hairpin structure by connecting the “sense” and “antisense” strand by means of a connecting sequence (“linker”; for example an intron). The self-complementary dsRNA structures are preferred since they only require the expression of an RNA sequence and the complementary RNA strands always comprise an equimolar ratio. Preferably the connecting sequence is an intron (e.g. an intron of the ST-LS1 gene from potato; Vancanneyt GF et al. (1990) Mol Gen Genet 220 (2): 245-250).

The nucleic acid sequence coding for a dsRNA can contain further elements, such as, for example, transcription termination signals or polyadenylation signals.

However, if the dsRNA is directed against the promoter sequence of an ε-cyclase, it preferably does not include any transcription termination signals or polyadenylation signals. This enables a retention of the dsRNA in the nucleus of the cell and prevents a distribution of the dsRNA in the whole plant "Spreadinng"). If the two strands of the dsRNA are to be brought together in a cell or plant, this can be done, for example, in the following way:

a) transformation of the cell or plant with a vector which comprises both expression cassettes,

b) Co-transformation of the cell or plant with two vectors, one comprising the expression cassettes with the “sense” strand, the other the expression cassettes with the “antisense” strand.

c) crossing of two individual plant lines, one comprising the expression cassettes with the "sense" strand, the other the expression cassettes with the "antisense" strand.

The formation of the RNA duplex can be initiated either outside the cell or inside it.

The dsRNA can be synthesized either in vivo or in vitro. For this purpose, a DNA sequence coding for a dsRNA can be placed in an expression cassette under the control of at least one genetic control element (such as, for example, a promoter). Polyadenylation is not required, and there is no need for elements to initiate translation. The expression cassette for the MP-dsRNA is preferably contained on the transformation construct or the transformation vector.

In a particularly preferred embodiment, the dsRNA is expressed starting from an expression construct under the functional control of a flower-specific promoter, particularly preferably under the control of the promoter described by SEQ ID NO: 28 or a functionally equivalent part of the same.

The expression cassettes coding for the “antisense” and / or the “sense” strand of an ε-cyclase dsRNA or for the self-complementary strand of the dsRNA are preferred for this purpose in one

Transformation vector inserted and introduced into the plant cell using the methods described below. A stable insertion into the genome is advantageous for the method according to the invention. The dsRNA can be introduced in an amount that enables at least one copy per cell. Larger quantities (e.g. at least 5, 10, 100, 500 or 1000 copies per cell) can possibly result in an efficient reduction.

b) introduction of an antisense ribonucleic acid sequence of an ε-cyclase (ε-cyclase-antisenseRNA)

Methods for the reduction of a certain protein by the "antisense" technology have been described in many cases, including in plants (Sheehy et al. (1988) Proc Natl Acad Sei USA 85: 8805-8809; US 4,801,340; Mol JN et al. (1990 ) FEBS Lett 268 (2): 427-430). The antisense nucleic acid molecule hybridizes or binds with the cellular rnRNA and / or genomic DNA coding for the ε-cyclase to be reduced. This suppresses the transcription and / or translation of the ε-cyclase. Hybridization can occur in a conventional manner via the formation of a stable duplex or - in the case of genomic DNA - by binding of the antisense nucleic acid molecule with the duplex of the genomic DNA through specific interaction in the major groove of the DNA helix.

An ε-cyclase antisenseRNA can be derived using the nucleic acid sequence coding for this ε-cyclase, for example the nucleic acid sequence according to SEQ ID NO: 38 according to the base pair rules of Watson and Crick. The ε-cyclase antisenseRNA can be complementary to the entire transcribed mRNA of the ε-cyclase, limited to the coding region or consist only of an oligonucleotide which is complementary to part of the coding or non-coding sequence of the mRNA. For example, the oligonucleotide can be complementary to the region that comprises the translation start for the ε-cyclase. The ε-cyclase antisenseRNA can have a length of, for example, 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides, but can also be longer and at least 100, 200, 500, 1000, 2000 or comprise 5000 nucleotides. ε-Cyclase antisenseRNAs are preferably recombinantly expressed in the target cell in the context of the method according to the invention.

Another object of the invention relates to transgenic expression cassettes containing a nucleic acid sequence coding for at least part of an ε-cyclase, said nucleic acid sequence being functionally linked to a promoter which is functional in plant organisms in an antisense orientation. In a particularly preferred embodiment, the expression of the antisenseRNA takes place starting from an expression construct under the functional control of a flower-specific promoter, in particular preferably under the control of the promoter described by SEQ ID NO: 28 or a functionally equivalent part thereof.

Said expression cassettes can be part of a transformation construct or transformation vector, or can also be introduced as part of a co-transformation.

In a further preferred embodiment, the expression of an ε-cyclase can be inhibited by nucleotide sequences that are complementary to the regulatory region of an ε-cyclase gene

(e.g. an ε-cyclase promoter and / or enhancer) and form triple-helical structures with the DNA double helix there, so that the transcription of the ε-cyclase gene is reduced. Appropriate methods are described (Helene C (1991) Anticancer Drug Res 6 (6): 569-84; Helene C et al. (1992) Ann NY Acad Sei 660: 27-36; Mower LJ (1992) Bioassays 14 (12) : 807-815).

In a further embodiment, the ε-cyclase antisenseRNA can be an anomeric nucleic acid. Such α-anomeric nucleic acid molecules form specific double-stranded hybrids with complementary RNA in which, in contrast to the conventional β-nucleic acids, the two strands run parallel to one another (Gautier C et al. (1987) Nucleic Acids Res 15: 6625-6641 ).

c) Introduction of an ε-cyclase antisenseRNA combined with a ribozyme

The antisense strategy described above can advantageously be coupled with a ribozyme method. Catalytic RNA molecules or ribozymes can be adapted to any target RNA and cleave the phosphodiester framework at specific positions, whereby the target RNA is functionally deactivated (Tanner NK (1999) FEMS Microbiol Rev 23 (3): 257 -275). This does not modify the ribozyme itself, but is able to cleave further target RNA molecules analogously, which gives it the properties of an enzyme. The incorporation of ribozyme sequences in "antisense" RNAs gives these "antisense" RNAs this enzyme-like, RNA-cleaving property and thus increases their efficiency in inactivating the target RNA. The production and use of corresponding ribozyme “antisense” RNA molecules is described (inter alia in Haseloff et al. (1988) Nature 334: 585-591); Haselhoff and Gerlach (1988) Nature 334: 585-591; Steinecke P et al. (1992) EMBO J 11 (4): 1525-1530; de Feyter R et al. (1996) Mol Gen Genet. 250 (3): 329-338). In this way, ribozymes (for example "Hammerhead"ribozymes; Haselhoff and Gerlach (1988) Nature 334: 585-591) can be used to catalytically cleave the mRNA of an ε-cyclase to be reduced and thus to prevent translation. Ribozyme technology can increase the efficiency of an antisense strategy. Methods for the expression of ribozymes for the reduction of certain proteins are described in (EP 0 291 533, EP 0 321 201, EP 0 360 257). Ribozyme expression is also described in plant cells (Steinecke P et al. (1992) EMBO J 11 (4): 1525-1530; de Feyter R et al. (1996) Mol Gen Genet. 250 (3): 329- 338). Suitable target sequences and ribozymes can, for example, as described in "Steinecke P, Ribozymes, Methods in Cell Biology 50, Galbraith et al. Eds, Academic Press, Inc. (1995), pp. 449-460", by secondary structure calculations of ribozyme and Target RNA and their interaction can be determined (Bayley CC et al. (1992) Plant Mol Biol. 18 (2): 353-361; Lloyd AM and Davis RW et al. (1994) Mol Gen Genet. 242 (6) : 653-657). For example, derivatives of Tetrahymena L-19 IVS RNA can be constructed which have regions complementary to the mRNA of the ε-cyclase to be suppressed (see also US 4,987,071 and US 5,116,742). Alternatively, such ribozymes can also be identified via a selection process from a library of diverse ribozymes (Bartel D and Szostak JW (1993) Science 261: 1411-1418).

d) introduction of a sense ribonucleic acid sequence of an ε-cyclase (ε-cyclase-senseRNA) to induce co-suppression

The expression of an ε-cyclase ribonucleic acid sequence (or a part thereof) in sense orientation can lead to a co-repression of the corresponding ε-cyclase gene. The expression of sense RNA with homology to an endogenous ε-cyclase gene can reduce or switch off the expression of the same, similarly as has been described for antisense approaches (Jorgensen et al. (1996) Plant Mol Biol 31 (5): 957-973; Goring et al. (1991) Proc Natl Acad Sei USA 88: 1770-1774; Smith et al. (1990) Mol Gen Genet 224: 447-481; Napoli et al. (1990) Plant Cell 2: 279-289; Van Krol et al. (1990) Plant Cell 2: 291-99). The construct introduced can represent the homologous gene to be reduced in whole or in part. The possibility of translation is not necessary. The application of this technology to plants is described (e.g. Napoli et al. (1990) Plant Cell 2: 279-289; in US 5,034,323.

The cosuppression is preferably implemented using a sequence which is essentially identical to at least part of the nucleic acid sequence coding for an ε-cyclase, for example the nucleic acid sequence according to SEQ ID NO: 38. The ε-cyclase senseRNA is preferably selected such that translation of the ε-cyclase or a part thereof cannot occur. For this purpose, for example, the 5 'untranslated or 3' untranslated region can be selected or the ATG start codon can be deleted or mutated.

e) Introduction of DNA or protein binding factors against ε-cyclase genes, RNAs or proteins

10 A decrease in ε-cyclase expression is also due to specific DNA binding factors e.g. possible with factors of the type of zinc finger transcription factors. These factors attach themselves to the genomic sequence of the endogenous target gene, preferably in the regulatory areas, and

15 expression. Appropriate processes for the production of such factors are described (Dreier B et al. (2001) J Biol Chem 276 (31): 29466-78; Dreier B et al. (2000) J Mol Biol 303 (4): 489-502; Beerli RR et al. (2000) Proc Natl Acad Sei USA 97 (4): 1495-1500; Beerli RR et al. (2000) J Biol Chem

20 275 (42): 32617-32627; Segal DJ and Barbas CF 3rd. (2000) Curr Opin Chem Biol 4 (l): 34-39; Kang JS and Kim JS (2000) J Biol Chem 275 (12): 8742-8748; Beerli RR et al. (1998) Proc Natl Acad Sei USA 95 (25): 14628-14633; Kim JS et al. (1997) Proc Natl Acad Sei USA 94 (8): 3616-3620; Klug A (1999) J Mol Biol 293 (2): 215-218; Tsai

25 SY et al. (1998) Adv Drug Deliv Rev 30 (1-3): 23-31; Mapp AK et al. (2000) Proc Natl Acad Sei USA 97 (8): 3930-3935; Sharrocks AD et al. (1997) Int J Biochem Cell Biol 29 (12): 1371-1387; Zhang L et al. (2000) J Biol Chem 275 (43): 33850-33860).

30 These factors can be selected using any piece of an ε-cyclase gene. This section is preferably in the region of the promoter region. For gene suppression, however, it can also lie in the area of the coding exons or introns.

35

In addition, factors can be introduced into a cell that inhibit the ε-cyclase itself. These protein binding factors can e.g. Aptamers (Famulok M and Mayer G (1999) Curr Top Microbiol Immunol 243: 123-36) or antibodies or antibody fragments

40 or single chain antibodies. The extraction of these factors has been described (Owen M et al. (1992) Biotechnology (NY) 10 (7) -.790-794; Franken E et al. (1997) Curr Opin Biotechnol 8 (4): 411-416; Whitelam (1996) Trend Plant Be 1: 286-272).

45 f) introduction of the ε-cyclase RNA degradation causing viral nucleic acid sequences and expression constructs

The ε-cyclase expression can also be effectively achieved by induction of the specific ε-cyclase RNA degradation by the plant using a viral expression system (Amplikon; Angell SM et al. (1999) Plant J 20 (3): 357-362) , These systems - also referred to as "VIGS" (viral induced gene silencing) - bring nucleic acid sequences with homology to the transcript of an ε-cyclase to be reduced by means of viral vectors into the

Plant one. The transcription is then switched off - presumably mediated by plant defense mechanisms against viruses. Appropriate techniques and processes are described (Ratcliff F et al. (2001) Plant J 25 (2): 237-45; Fagard M and Vaucheret H (2000) Plant Mol Biol 43 (2-3): 285-93; Anandalakshmi R et al. (1998) Proc Natl Acad Sei USA 95 (22): 13079-84; Ruiz MT (1998) Plant Cell 10 (6): 937-46).

The VIGS-mediated reduction is preferably implemented using a sequence which is essentially identical to at least part of the nucleic acid sequence coding for an ε-cyclase, for example the nucleic acid sequence according to SEQ ID NO: 38.

g) Introduction of constructs for generating a loss of function or a loss of function on ε-cyclase genes

Numerous methods are known to the person skilled in the art of how genomic sequences can be modified in a targeted manner. These include in particular methods such as the generation of knockout mutants by means of targeted homologous recombination e.g. by generating stop codons, shifts in the reading frame etc. (Hohn B and Puchta H (1999) Proc Natl Acad Sei USA 96: 8321-8323) or the targeted deletion or inversion of sequences using e.g. sequence-specific recombinases or nucleases (see below)

The reduction in the ε-cyclase amount, function and / or activity can also be achieved by a targeted insertion of nucleic acid sequences (for example the nucleic acid sequence to be inserted in the process according to the invention) into the sequence coding for an ε-cyclase (for example by means of intermolecular homologous recombination). In the context of this embodiment, a DNA construct is preferably used which comprises at least part of the sequence of an ε-cyclase gene or neighboring sequences, and can thus be recombined in a targeted manner in the target cell, so that deletion, addition or Substitution of at least one nucleotide so the ε-cyclase gene is changed that the functionality of the ε-cyclase gene is reduced or completely eliminated. The change can also affect the regulatory elements (for example the promoter) of the ε-cyclase gene, so that the coding sequence remains unchanged, but expression (transcription and / or translation) is omitted and reduced. In conventional homologous recombination, the sequence to be inserted is flanked at its 5 'and / or 3' end by further nucleic acid sequences (A 'or B') which are of sufficient length and homology to the corresponding sequences of the ε-cyclase Gene (A or B) to enable homologous recombination. The length is usually in the range from several hundred bases to several kilobases (Thomas KR and Capecchi MR (1987) Cell 51: 503; Strepp et al. (1998) Proc Natl Acad Sei USA 95 (8): 4368- 4373). For the homologous recombination, the plant cell with the recombination construct is transformed using the methods described below and successfully recombined clones are selected based on the ε-cyclase which is inactivated as a result.

In a further preferred embodiment, the efficiency of the recombination is increased by combination with methods which promote homologous recombination. Such methods are described and include, for example, the expression of proteins such as RecA or the treatment with PARP inhibitors. It could be shown that the intrachromosomal homologous recombination in tobacco plants can be increased by using PARP inhibitors (Puchta H et al. (1995) Plant J 7: 203-210). By using these inhibitors, the rate of homologous recombination in the recombination constructs after induction of the sequence-specific DNA double-strand break and thus the efficiency of the deletion of the transgene sequences can be increased further. Various PARP inhibitors can be used. Inhibitors such as 3-aminobenzamide, 8-hydroxy-2-methylquinazolin-4-one (NU1025), 1, 11b-dihydro- [2H] benzopyrano- [4, 3, 2-de] isoquinolin-3- are preferably included. on (GPI 6150), 5-aminoisoquinolinone, 3,4-dihydro-5- [4- (1-piperidinyl) butoxy] -1 (2H) -isoquinolinone or those described in WO 00/26192, WO 00/29384, WO 00 / 32579, WO 00/64878, WO 00/68206, WO 00/67734, WO 01/23386 and WO 01/23390.

Other suitable methods are the introduction of nonsense mutations into endogenous marker protein genes, for example by introducing RNA / DNA oligonucleotides into the plant (Zhu et al. (2000) Nat Biotechnol 18 (5): 555-558) or the Generation of knockout mutants with the help of, for example, T-DNA mutagenesis (Koncz et al., Plant Mol. Biol. 1992, 20 (5): 963-976). Point mutations can also be generated using DNA-RNA hybrids, which are also known as "chimeraplasty" are known (Cole-Strauss et al. (1999) Nucl Acids Res 27 (5): 1323-1330; Kmiec (1999) Gene therapy American Scientist 87 (3): 240-247).

The methods of dsRNAi, cosuppression using sense RNA and "VIGS" ("virus induced gene silencing") are also referred to as "post-transcriptional gene silencing" (PTGS) or transcriptional gene silencing "(TGS). PTGS / TGS -Procedures are particularly advantageous because the requirements on the homology between the marker protein gene to be reduced and the transgenically expressed sense or dsRNA nucleic acid sequence are lower than, for example, in the case of a classic antisense approach Marker protein nucleic acid sequences from one species also effectively reduce the expression of homologous marker protein proteins in other species, without the isolation and structural elucidation of the marker protein homologs occurring there being absolutely necessary, which considerably simplifies the workload.

In a particularly preferred embodiment of the method according to the invention, the ε-cyclase activity is reduced compared to the wild type by:

a) introducing at least one double-stranded ε-cyclase ribonucleic acid sequence or an expression cassette or expression cassettes ensuring its expression into plants and / or b) introducing at least one ε-cyclase antisense-ribonucleic acid sequence or an expression cassette ensuring its expression in plants.

In a very particularly preferred embodiment, the ε-cyclase activity is reduced compared to the wild type by introducing at least one double-stranded ε-cyclase ribonucleic acid sequence or an expression cassette or expression cassettes ensuring its expression in plants.

In a preferred embodiment, genetically modified plants are used which have the lowest expression rate of an ε-cyclase in flowers.

This is preferably achieved in that the reduction of the ε-cyclase activity is flower-specific, particularly preferably flower-leaf-specific. In the particularly preferred embodiment described above, this is achieved in that the transcription of the ε-cyclase dsRNA sequences is carried out under the control of a flower-specific promoter or, even more preferably, under the control of a petal-specific promoter.

In a further preferred embodiment, plants are cultivated which, in addition to the wild type, have an increased activity of at least one of the activities selected from the group HMG-CoA reductase activity, (E) -4-hydroxy-3-methylbut-2- enyl-diphosphate reductase activity, 1-deoxy-D-xylose-5-phosphate synthase activity, l-deoxy-D-xylose-5-phosphate reductantisomerase activity, isopentenyl-diphosphate-Δ-isomerase- Activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity, geranyl geranyl diphosphate synthase activity, phytoene synthase activity, phytoene desaturase activity, zeta-carotene desaturase activity Activity, crtlSO activity, FtsZ activity and MinD activity.

HMG-CoA reductase activity is understood to mean the enzyme activity of an HMG-CoA reductase (3-hydroxy-3-methyl-glutaryl-coenzyme A reductase).

An HMG-CoA reductase is understood to mean a protein which has the enzymatic activity to convert 3-hydroxy-3-methyl-glutaryl-coenzyme-A into mevalonate.

Accordingly, HMG-CoA reductase activity is understood to mean the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme-A or the amount of mevalonate formed in a certain time by the protein HMG-CoA reductase.

In the case of an increased HMG-CoA reductase activity compared to the wild type, the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme-A or the is converted by the protein HMG-CoA reductase in a certain time compared to the wild type formed amount of mevalonate increased.

This increase in the HMG-CoA reductase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600 % of the HMG-CoA reductase activity of the wild type. HMG-CoA reductase activity means the enzyme activity of an HMG-CoA reductase. The HMG-CoA reductase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably determined under the following conditions:

5 Frozen plant material is homogenized by intensive Mosern in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available plant material, so that a determination and quantification

10 of the enzyme activities is possible within the linear measuring range. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgC12, 10 mM KC1, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε-aminocaproic acid, 10% glycerin, 5mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM

15 PMSF added.

The activity of the HMG-CoA reductase can be measured according to published descriptions (e.g. Schaller, Grausem, Benveniste, Chye, Tan, Song and Chua, Plant Physiol. 109 (1995), 761-770;

20 Chappell, Wolf, Proulx, Cuellar and Saunders, Plant Physiol. 109 (1995) 1337-1343). Plant tissue can be homogenized and extracted in cold buffer (100 mM potassium phosphate (pH 7.0), 4 mM MgCl, 5 mM DTT). The homogenate is centrifuged at 10,000 g at 4C for 15 minutes. The supernatant is then at

25 100,000g centrifuged again for 45-60 minutes. The activity of the HMG-CoA reductase is determined in the supernatant and in the pellet of the microsomal fraction (after resuspending in 100 mM potassium phosphate (pH 7.0) and 50 mM DTT). Aliquots of the solution and the suspension (the protein content of the suspension corresponds

30 approximately 1-10 μg) in 100 mM potassium phosphate buffer (pH 7.0 with 3 mM NADPH and 20 μM ( ¹⁴ C) HMG-CoA (58 μCi / μM) ideally in a volume of 26 μl for 15-60 Incubated for minutes at 30 ° C. The reaction is terminated by adding 5 μl of mevalonate acetone (1 mg / ml) and 6 N HCl

35 room temperature incubated for 15 minutes. The ( ¹ C) -evalonate formed in the reaction is quantified by adding 125 μl of a saturated potassium phosphate solution (pH 6.0) and 300 μl of ethyl acetate. The mixture is mixed well and centrifuged. Radioactivity can be measured by scintillation

40 are correct.

The (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, also called lytB or IspH, describes the enzyme activity of an (E) -4-hydroxy-3-methylbut-2-enyl -Diphosphate reductase 45 understood. An (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase means a protein which has the enzymatic activity, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate in Convert isopentenyl diphosphate and dimethyl allyl diphosphate.

Accordingly, under (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity the protein (E) -4-hydroxy-3-methylbut-2-enyl- Diphosphate reductase converted amount (E) -4-hydroxy-3-methylbut-2-enyl diphosphate or amount formed isopentenyl diphosphate and / or dimethyl allyl diphosphate understood.

With an increased (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity compared to the wild type, the protein (E) -4-hydroxy- 3-methylbut-2-enyl diphosphate reductase increases the amount of (E) -4-hydroxy-3-methylbut-2-enyl diphosphate converted or the amount of isopentenyl diphosphate and / or dimethylallyldiphosphate formed.

This increase in the (E) -4-hydroxy-3-methylbut-2-enyldiphosphate reductase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate ~ reductase activity of the wild type.

The (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably determined under the following conditions:

Frozen plant material is homogenized by intensive Mosern in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available plant material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 M MgC12, 10 M KC1, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε-aminocaproic acid, 10% glycerin, 5mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added. The (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity can be determined by immunological detection. The production of specific antibodies is by Rohdich and colleagues (Rohdich, Hecht, Gärtner, Adam, Krieger, Amslinger, Arigoni, Bacher and Eisenreich: Studies on the non-mevalonate terpene biosynthetic pathway: metabolic role of IspH (LytB) protein, Natl. Acad Nat. Sci. USA 99 (2002), 1158-1163). To determine the catalytic activity, Altincicek and colleagues (Altincicek, Duin, Reichenberg, Hedderich, Kollas, Hintz, Wagner, Wiesner, Beck and Jomaa write: LytB protein catalyzes the terminal step of the 2-C-methyl-D-erythritol- 4-phosphate pathway of isoprenoid biosynthesis; FEBS Letters 532 (2002,) 437-440) an in vitro system which reduces the reduction of (E) -4-hydroxy-3-methyl-but-2-enyl diphosphate into the isopentenyl diphosphate and dimethyl allyl diphosphate.

By l-deoxy-D-xylose-5-phosphate synthase activity is meant the enzyme activity of an l-deoxy-D-xylose-5-phosphate synthase.

An l-deoxy-D-xylose-5-phosphate synthase is understood to mean a protein which has the enzymatic activity to convert hydroxyethyl-ThPP and glyceraldehyde-3-phosphate into 1-deoxy-D-xylose-5-phosphate.

Accordingly, l-deoxy-D-xylose-5-phosphate synthase activity is the amount of hydroxyethyl-ThPP and / or glyceraldehyde-3 converted by the protein l-deoxy-D-xylose-5-phosphate synthase in a certain time Phosphate or the amount of deoxy-D-xylose-5-phosphate formed.

With an increased l-deoxy-D-xylose-5-phosphate synthase activity compared to the wild type, the amount converted by the protein 1-deoxy-D-xylose-5-phosphate synthase in a certain time compared to the wild type Hydroxyethyl-ThPP and / or glyceraldehyde-3-phosphate or the amount formed -deoxy-D-xylose-5-phosphate increased.

This increase in l-deoxy-D-xylose-5-phosphate synthase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300% more preferably at least 500%, especially at least 600% of the wild-type 1-deoxy-D-xylose-5-phosphate synthase activity. The determination of the l-deoxy-D-xylose-5-phosphate synthase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably carried out under the following conditions:

Frozen plant material is homogenized by intensive Mosern in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available plant material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgC12, 10 mM KC1, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε- Aminocaproic acid, 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added.

The reaction solution (50-200 ul) for the determination of D-1-deoxy-xylulose-5-phosphate synthase activity (DXS) consists of 100 mM Tris-HCl (pH 8.0), 3 mM MgCl, 3 mM MnCl ₂ , 3 mM ATP, 1 mM thiamine diphosphate, 0.1% Tween-60, 1 mM potassium fluoride, 30 uM (2- ¹⁴ C) -Pyru- vat (0.5 uCi), 0.6 mM DL-Glyerinaldehyd-3-phosphate. The plant extract is incubated for 1 to 2 hours in the reaction solution at 37C. Then the reaction is stopped by heating at 80C for 3 minutes. After centrifugation at 13,000 revolutions / minute for 5 minutes, the supernatant is evaporated, the rest is resuspended in 50 μl of methanol, applied to a TLC plate for thin-layer chromatography (silica gel 60, Merck, Darmstadt) and in N-propyl alcohol / ethyl acetate / water (6: 1: 3; v / v / v). In this case, labeled D-1-deoxyxylulose-5-phosphate separates radioactively (or D-1-deoxyxylulose) of (2- ¹⁴ C) pyruvate. The quantification is carried out using a scintillation counter. The method was described in Harker and Bramley (FEBS Letters 448 (1999) 115-119). Alternatively, a fluorometric assay to determine the DXS synthase activity was described by Querol and colleagues (Analytical Biochemistry 296 (2001) 101-105).

Under l-deoxy-D-xylose-5-phosphate reductoisomerase activity is the enzyme activity of an l-deoxy-D-xylose-5-phosphate reductoisomerase, also l-deoxy-D-xylulose-5-phosphate reductoisomerase called, understood.

An l-deoxy-D-xylose-5-phosphate reductoisomerase means a protein which has the enzymatic activity to convert l-deoxy-D-xylose-5-phosphate into β-carotene. Accordingly, l-deoxy-D-xylose-5-phosphate reductoisomerase activity is the amount of l-deoxy-D-xylose converted by the protein l-deoxy-D-xylose-5-phosphate reductoisomerase in a certain time -5-phosphate or the amount of isopentenyl diphosphate formed.

With an increased l-deoxy-D-xylose-5-phosphate reductoisomerase activity compared to the wild type, the protein 1-deoxy-D-xylose-5-phosphate reductoisomerase thus converts the amount converted in a certain time compared to the wild type 1-Deoxy-D-xylose-5-phosphate or the amount of isopentenyl diphosphate formed is increased.

This increase in l-deoxy-D-xylose-5-phosphate reductoisomerase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300% more preferably at least 500%, especially at least 600% 1-deoxy-D-xylose-5-phosphate reductoisomerase activity of the wild type.

The determination of the l-deoxy-D-xylose-5-phosphate reductoisomerase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably carried out under the following conditions:

Frozen plant material is homogenized by intensive Mosern in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available plant material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgC12, 10 mM KC1, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε-aminocaproic acid, 10% glycerol, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added.

The activity of the DI-deoxyxylulose-5-phosphate reductoisomerase (DXR) is measured in a buffer of 100 mM Tris-HCl (pH 7.5), 1 mM MnCl ₂ , 0, 3 mM NADPH and 0.3 mM L- Deoxy-D-xylulose-4-phosphate, which can, for example, be synthesized enzymatically (Kuzuyama, Takahashi, Watanabe and Seto: Tetrahedon letters 39 (1998) 4509-4512). The reaction is started by adding the plant extract. The reaction volume can typically be 0.2 to 0.5 mL; incubation takes place at 37C for 30-60 minutes. During this time, the oxidation of NADPH is monitored photometrically at 340 nm.

Isopentenyl diphosphate Δ isomerase activity is understood to mean the enzyme activity of an isopentenyl diphosphate Δ isomerase.

An isopentenyl diphosphate D-isomerase is understood to mean a protein which has the enzymatic activity to convert isopentenyl diphosphate to dimethylallyl phosphate.

Accordingly, isopentenyl diphosphate D isomerase activity is understood to mean the amount of isopentenyl diphosphate or dimethylallyl phosphate formed in a certain time by the protein isopentenyl diphosphate D isomerase.

If the isopentenyl-diphosphate-D-isomerase activity is higher than that of the wild type, the amount of isopentenyl-diphosphate converted or the amount of dimethylallylphosphate formed is increased in a certain time by the protein isopentenyl-diphosphate-D-isomerase compared to the wild type.

This increase in the isopentenyl diphosphate Δ-isomerase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the isopentenyl diphosphate Δ isomerase activity of the wild type.

The determination of the isopentenyl diphosphate Δ isomerase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably carried out under the following conditions:

Frozen plant material is homogenized by intensive Mosern in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available plant material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer may consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgCl2, 10 mM KC1, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε-aminocaproic acid, 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added. Activity determinations of isopentenyl diphosphate isomerase (IPP isomerase) can be carried out using the method presented by Fräser and colleagues (Fräser, Römer, Shipton, Mills, Kiano, Misawa, Drake, Schuch and Bramley: Evaluation of transgenic tomato plants expressing) additional phytoene synthase in a fruit-specific manner; Proc. Natl. Acad. Sci. USA 99 (2002), 1092-1097, based on Fraser, Pinto, Holloway and Bramley, Plant Journal 24 (2000), 551-558) become. For enzyme assays, incubations with 0.5 uCi (1- ¹⁴ C) IPP (isopentenyl pyrophosphate) (56 Ci / mmol, Amersham ple) as substrate in 0.4 M Tris-HCl (pH 8.0) containing 1 mM DTT, 4 mM MgCl, 6 M Mn Cl ₂ , 3 mM ATP, 0.1% Tween 60, 1 mM potassium fluoride in a volume of about 150-500 ul. Extracts are mixed with buffer (eg in a ratio of 1: 1) and incubated for at least 5 hours at 28 ° C. Then about 200 μl of methanol is added and acid hydrolysis is carried out for about 1 hour at 37 ° C. by adding concentrated hydrochloric acid (final concentration 25%). This is followed by a double extraction (500 μl each) with petroleum ether (mixed with 10% diethyl ether). The radioactivity in an aliquot of the hyperphase is determined using a scillation counter. The specific enzyme activity can be determined with a short incubation of 5 minutes, since short reaction times suppress the formation of reaction by-products (see Lützow and Beyer: The isopentenyl-diphosphate Δ-isomerase and its relation to the phytoene synthase complex in daffodil chromoplasts; Biochim. Biophys. Acta 959 (1988) 118-126)

Geranyl diphosphate synthase activity means the enzyme activity of a geranyl diphosphate synthase.

A geranyl diphosphate synthase is understood to mean a protein which has the enzymatic activity to convert isopentenyl diphosphate and dimethylallyl phosphate into geranyl diphosphate.

Accordingly, geranyl diphosphate synthase activity is understood to mean the amount of isopentenyl diphosphate and / or dimethylallyl phosphate or amount of geranyl diphosphate formed in a certain time by the protein geranyl diphosphate synthase.

If the geranyl diphosphate synthase activity is increased compared to the wild type, the amount of isopentenyl diphosphate and / or dimethylallyl phosphate or the amount of geranyl diphosphate formed is increased by the protein geranyl diphosphate synthase in a certain time compared to the wild type , This increase in geranyl diphosphate synthase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably 5 at least 500%, in particular at least 600% the wild-type geranyl diphosphate synthase activity.

The geranyl diphosphate synthase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably determined under the following conditions:

Frozen plant material is homogenized by intensive Moser in liquid nitrogen and with an extraction buffer

15 extracted in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available plant material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of

20 50mM HEPES-KOH (pH 7.4), 10M MgC12, 10mM KCl, 1mM EDTA, 1mM EGTA, 0.1% (v / v) Triton X-100, 2mM ε-aminocaproic acid, 10% glycerin , 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added.

25 The activity of geranyl diphosphate synthase (GPP synthase) can be expressed in 50 mM Tris-HCl (pH 7.6), 10 mM MgCl ₂ , 5 mM MnCl ₂ , 2 mM DTT, 1 mM ATP, 0.2% Tween-20, 5 μM ( ^{1 C} ) IPP and 50 μM DMAPP (dimethyl allyl pyrophosphate) can be determined after adding plant extract (according to Bouvier, Suire, d'Harlingue, Backhaus and Camara:

30 Meolcular cloning of geranyl diphosphate synthase and compartmentation of monoterpene synthesis in plant cells, Plant Journal 24 (2000,) 241-252). After the incubation of e.g. The reaction products are dephosphyrylated for 2 hours at 37C (according to Koyama, Fuji and Ogura: Enzymatic hydrolysis of polyprenyl pyrophosphates,

35 Methods Enzymol. 110 (1985), 153-155) and analyzed by thin layer chromatography and measurement of the incorporated radioactivity (Dogbo, Bardat, Quennemet and Camara: Metabolism of plastid terpenoids: In vitrp inhibition of phytoene synthesis by phenethyl pyrophosphate derivates, FEBS Letters 219 (1987)

40 211-215).

Farnesyl diphosphate synthase activity means the enzyme activity of a farnesyl diphosphate synthase.

45 A farnesyl diphosphate synthase is understood to mean a protein which has the enzymatic activity to convert dimethylallyl diphosphate and isopentenyl diphosphate into farnesyl diphosphate. 5

Accordingly, farnesyl diphosphate synthase activity is understood to mean the amount of dimethylallyl diphosphate and / or isopentenyl diphosphate or amount of farnesyl diphosphate 10 converted in a certain time by the protein farnesyl diphosphate synthase.

With an increased farnesyl diphosphate synthase activity compared to the wild type, the amount of dimethylallyl diphosphate and / or isopentenyl diphosphate or the amount of farnesyl formed is thus converted in a certain time by the protein farnesyl diphosphate synthase compared to the wild type -Diphosphate increased.

This increase in the farnesyl diphosphate synthase activity is preferably at least 5%, more preferably at least 20 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% the wild-type farnesyl diphosphate synthase activity.

25 The determination of farnesyl diphosphate synthase activity in genetically modified plants according to the invention and in wild type or Reference plants are preferably made under the following conditions:

30 Frozen plant material is homogenized by intensive Mosern in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available plant material, so that a determination and quantification

35 enzyme activity within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgC12, 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 M ε- Aminocaproic acid, 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and

40 0.5 mM PMSF added.

The activity of franesyl pyrophosphate snthase (FPP synthase) can be determined according to a protocol by Joly and Edwards (Journal of Biological Chemistry 268 (1993), 26983-26989). Then the enzyme activity is measured in a buffer of 10 mM HEPES (pH 7.2), 1 mM MgCl, 1 mM dithiothreitol, 20 μM geranyl pyrophosphate and 40 μM (1- ¹ C) isopentenyl pyrophosphate (4 Ci / mmol). The reaction mixture is incubated at 37 ° C; the reaction is stopped by adding 2.5 N HCl (in 70% ethanol with 19 μg / ml farnesol). The reaction products are thus hydrolyzed within 30 minutes by acid hydrolysis at 37C. The mixture is neutralized by adding 10% NaOH and extracted with hexane. An aliquot of the hexane phase can be measured using a scintillation counter to determine the built-in radioactivity.

Alternatively, after incubation of plant extract and radioactively labeled IPP, the reaction products can be separated into benzene / methanol (9: 1) using thin layer chromatography (silica gel SE60, Merck). Radioactively labeled products are eluted and radioactivity determined (according to Gaffe, Bru, Causse, Vidal, Stamitti-Bert, Carde and Gallusci: LEFPS1, a tomato farnesyl pyrophosphate gene highly expressed during early fruit development; Plant Physiology 123 (2000) 1351-1362 ).

Geranyl-geranyl diphosphate synthase activity is understood to mean the enzyme activity of a geranyl-geranyl diphosphate synthase.

A geranyl-geranyl-diphosphate synthase is understood to mean a protein which has the enzymatic activity to convert farnesyl-diphosphate and isopentenyl-diphosphate into geranyl-geranyl-diphosphate.

Accordingly, geranyl-geranyl diphosphate synthase activity is understood to mean the amount of farnesyl diphosphate and / or isopentenyl diphosphate or the amount of geranyl geranyl diphosphate formed in a certain time by the protein geranyl-geranyl diphosphate synthase.

If the geranyl-geranyl-diphosphate synthase activity is higher than that of the wild type, the amount of farnesyl diphosphate and / or isopentenyl diphosphate and / or isopentenyl diphosphate or the amount of geranyl-geranyl diphosphate formed is increased.

This increase in geranyl-geranyl diphosphate synthase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the wild-type geranyl-geranyl-piphosphate synthase activity. The geranyl-geranyl diphosphate synthase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably determined under the following conditions:

Frozen plant material is homogenized by intensive Mosern in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available plant material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 M HEPES-KOH (pH 7.4), 10 mM MgCl2, 10 M KCl, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε-aminocaproic acid, 10% glycerol, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added.

Activity measurements of geranylgeranyl pyrophosphate synthase (GGPP synthase) can be carried out by the method described by Dogbo and Camara (in Biochim. Biophys. Acta 920 (1987), 140-148: Purification of isopentenyl pyrophosphate isomerase and geranylgeranyl pyrophosphate synthase from Capsicum chromoplasts by affinity chromatography). A buffer (50 mM Tris-HCl (pH 7.6), 2 mM MgCl ₂ , 1 mM MnCl ₂ , 2 mM dithiothreitol, (1- ¹ C) IPP (0.1 μCi, 10 μM), 15 μM DMAPP, GPP or FPP) with a total volume of about 200 ul plant extract added. Incubation can be for 1-2 hours (or longer) at 30C. The reaction is carried out by adding 0.5 ml of ethanol and 0.1 ml of 6N HCl. After incubation at 37 ° C. for 10 minutes, the reaction mixture is neutralized with 6N NaOH, mixed with 1 ml of water and extracted with 4 ml of diethyl ether. The amount of radioactivity is determined in an aliquot (for example 0.2 ml) of the ether phase by means of scintillation counting. Alternatively, after acid hydrolysis, the radioactively labeled prenyl alcohols can be shaken out in ether and treated with HPLC (25 cm column Spherisorb ODS-1,

5 .mu.m; Elution with methanol / water (90:10; v / v) at a flow rate of 1 ml / min) and quantified using a radioactivity monitor (according to Wiedemann, Misawa and Sandmann: Purification and enzymatic characterization of the geranylgeranyl pyrophosphate synthase from Erwinia uredovora after expression in Escherichia coli;

Phytoene synthase activity means the enzyme activity of a phytoene synthase. In particular, a phytoene synthase is understood to mean a protein which has the enzymatic activity to convert geranyl-geranyl diphosphate into phytoene.

Accordingly, phytoene synthase activity is understood to mean the amount of geranyl-geranyl diphosphate or amount of phytoene formed in a certain time by the protein phytoene synthase.

With an increased phytoene synthase activity compared to the wild type, the amount of geranyl-geranyl diphosphate or the amount of phytoene formed is increased in a certain time by the protein phytoene synthase compared to the wild type.

This increase in phytoene synthase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the phytoene Wild-type synthase activity.

The phytoene synthase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably determined under the following conditions:

Frozen plant material is homogenized by intensive Mosern in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available plant material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgCl2, 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε-aminocaproic acid, 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 M PMSF are added.

Activity determinations of phytoene synthase (PSY) can be carried out using the method presented by Fräser and colleagues (Fräser, Romer,

Shipton, Mills, Kiano, Misawa, Drake, Schuch and Bramley: Evaluation of transgenic tomato plants expressing an additional phytoene synthase in a fruit-specific manner; Proc. Natl. Acad. Be. USA 99 (2002), 1092-1097, based on milling cutters, Pinto, Holloway and Bramley, Plant Journal 24 (2000) 551-558). Incubations with ( ³ H) geranylgeranyl pyrophosphate (15 mCi / mM, American Radiolabeled Chemicals, St. Louis) as substrate in 0.4 M Tris-HCl (pH 8.0) with 1 mM DTT, 4 mM MgCl, 6 mM Mn Cl ₂ , 3 mM ATP, 0.1% Tween 60, 1 mM potassium fluoride , Plant extracts are mixed with buffer, e.g. 295 μl buffer with extract in a total volume of 500 μl. Incubate for at least 5 hours at 28C. The phytoene is then extracted by shaking twice (500 μl each) with chloroform. The radioactively labeled phytoene formed during the reaction is separated by thin layer chromatography on silica plates in methanol / water (95: 5; v / v). Phytoene can be found in an iodine-enriched atmosphere

(by heating fewer iodine crystals) on the silica plates. A phytoene standard serves as a reference. The amount of radioactively labeled product is determined by measurement in the scintillation counter. Alternatively, phytoene can also be quantified using HPLC, which is equipped with a radioactivity detector (Fräser, Albrecht and Sandmann: Development of high Performance liquid Chromatographie Systems for the Separation of radiolabeled carotenes and precursors formed in specific enzymatic reactions; J. Chromatogr. 645 (1993) 265-272).

Phytoene desaturase activity means the enzyme activity of a phytoene desaturase.

A phytoene desaturase is understood to mean a protein which has the enzymatic activity to convert phytoene into phytofluene and / or phytofluene into ζ-carotene (zeta-carotene).

Accordingly, phytoene desaturase activity is understood to mean the amount of phytoene or phytofluene or amount of phytofluene or ζ-carotene converted in a certain time by the protein phytoene desaturase.

With an increased phytoene desaturase activity compared to the wild type, the amount of phytoene or phytofluene or the amount of phytofluene or bzw.-carotene formed is increased in a certain time by the protein phytoen desaturase compared to the wild type.

This increase in phytoene desaturase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the phytoene Wild-type desaturase activity. The phytoene desaturase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably determined under the following conditions:

Frozen plant material is homogenized by intensive Mosern in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available plant material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgCl2, 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε-aminocaproic acid, 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added.

The activity of phytoene desaturase (PDS) can be measured by incorporating radioactively labeled ( ¹ C) phytoene in unsaturated carotenes (according to Römer, Fraser, Kiano, Shipton, Misawa, Schuch and Bramley: Elevation of the provitamin A content of transgenic tomato plants; Nature Biotechnology 18 (2000) 666-669). Radioactively labeled phytoenes can be synthesized according to Fr ser (Fräser, De la Rivas, Mackenzie, Bramley: Phycomyces blakesleanus CarB mutants: their use in assays of phytoene desaturase; Phytochemistry 30 (1991), 3971-3976). Membranes from plastids of the target tissue can be incubated with 100 mM MES buffer (pH 6.0) with 10 mM MgCl ₂ and 1 mM dithiothreitol in a total volume of 1 mL. ( ¹ C) -Pytoene dissolved in acetone (about 100,000 decays / minute for one incubation each) is added, the acetone concentration not exceeding 5% (v / v). This mixture is incubated at 28C for about 6 to 7 hours in the dark with shaking. Then pigments are extracted three times with about 5 mL petroleum ether (mixed with 10% diethyl ether) and separated and quantified by HPLC.

Alternatively, the activity of phytoene desaturase according to Fräser et al. (Fräser, Misawa, Linden, Yamano, Kobayashi and Sandmann: Expression in Escherichia coli, purification, and reactivation of the recombinant Erwinia uredovora phytoene desaturase, Journal of Biological Chemistry 267 (1992), 19891-9895).

Zeta-carotene desaturase activity means the enzyme activity of a zeta-carotene desaturase. A zeta-carotene desaturase is understood to mean a protein which has the enzymatic activity to convert ot-carotene into neurosporin and / or neurosporin into lycopene.

5 Accordingly, zeta-carotene desaturase activity means the amount of ζ-carotene or neurosporin or the amount of neurosporin or lycopene formed in a certain time by the protein zeta-carotene desaturase.

10 With an increased zeta-carotene desaturase activity compared to the wild type, the amount of Z-carotene or neurosporin or the amount of neurosporin or lycopene formed is increased in a certain time by the protein zeta-carotene desaturase compared to the wild type.

15

This increase in the zeta-carotene desaturase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%,

20 in particular at least 600% of the zeta-carotene desaturase activity of the wild type.

The zeta-carotene desaturase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably determined under the following conditions:

30 extracted in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available plant material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of

35 50 mM HEPES-KOH (pH 7.4), 10 mM MgCl2, 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 M ε-aminocaproic acid, 10 % Glycerin, 5mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added.

40 analyzes for the determination of ξ-carotene desaturase (ZDS desaturase) can be carried out in 0.2 M potassium phosphate (pH 7.8, buffer volume of about 1 ml). The 7 analysis method for this was developed by Breitenbach and colleagues (Breitenbach, Kuntz, Takaichi and Sandmann: Catalytic properties of an expressed and purified higher plant

45 type ξ-carotene desaturase from Capsicum annuum; European Journal of Bioche istry. 265 (1): 376-383, 1999 Oct). Each analytical approach contains 3 mg phosphytidylcholine, which in 0.4 M potassium umphosphate buffer (pH 7.8), 5 μg g-carotene or neurosporene, 0.02% butylated hydroxytoluene, 10 μl decyl plastoquinone (1 mM methanolic stock solution) and plant extract. The volume of the plant extract must be adapted to the amount of ZDS desaturase activity present in order to enable quantifications in a linear measuring range. Incubations typically take place for about 17 hours with vigorous shaking (200 revolutions / minute) at about 28 ° C in the dark. Carotenoids are extracted by adding 4 ml acetone at 50 ° C for 10 minutes with shaking. The carotenoids are transferred from this mixture into a petroleum ether phase (with 10% diethyl ether). The ethyl ether / petroleum ether phase is evaporated under nitrogen, the carotenoids are redissolved in 20 μl and separated and quantified by HPLC.

CrtlSO activity means the enzyme activity of a crtlSO protein.

A crtlSO protein is understood to mean a protein which has the enzymatic activity to convert 7, 9, 7 ', 9' -tetra-cis-lycopene into all-trans-lycopene.

Accordingly, crtlSO activity is understood to mean the amount 7, 9, 7 ', 9' -tetra-cis-lycopene or amount of all-trans-lycopene formed in a certain time by the protein crtlSO.

With an increased crtlSO activity compared to the wild type, the converted amount 7, 9, 7 ', 9' -tetra-cis-lycopene or the amount formed all-trans is thus in a certain time compared to the wild type by the crtlSO protein - Lycopene increased.

This increase in crtlSO activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the crtlSO activity of the Wild type.

FtsZ activity is understood to mean the physiological activity of an FtsZ protein.

An FtsZ protein is understood to be a protein which has a cell division and plastid division-promoting effect and has homologies to tubulin proteins. MinD activity is understood to mean the physiological activity of a MinD protein.

A MinD protein is understood to be a protein that has a multifunctional role in cell division. It is a membrane-associated ATPase and can show an oscillating movement from pole to pole within the cell.

Furthermore, the increase in the activity of enzymes of the non-mevalonate pathway can lead to a further increase in the desired keto-carotenoid end product. Examples include the 4-diphosphocytidyl-2-C-methyl-D-erythritol synthase, the 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase and the 2-C-methyl-D- Erythritol-2,4-cyclodiphoshate synthase. The activity of the enzymes mentioned can be increased by changing the gene expression of the corresponding genes. The changed concentrations of the relevant proteins can be detected using antibodies and corresponding blotting techniques as standard. The increase in HMG-CoA reductase activity and / or (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity and / or l-deoxy-D-xylose-5-phosphate synthase Activity and / or l-deoxy-D-xylose-5-phosphate reductoisomerase activity and / or isopentenyl diphosphate Δ isomerase activity and / or geranyl diphosphate synthase activity and / or farnesyl diphosphate syn - thase activity and / or geranyl-geranyl diphosphate synthase activity and / or phytoene synthase activity and / or phytoene desaturase activity and / or zeta-carotene desaturase activity and / or crtISO activity and / or FtsZ activity and / or MinD activity can take place in various ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing the gene expression of nucleic acids encoding an HMG-CoA reductase and / or nucleic acids encoding an ( E) -4-hydroxy-3-methyl-but-2-enyl-diphosphate reductase and / or nuc linseed acids encoding an l-deoxy-D-xylose-5-phosphate synthase and / or nucleic acids encoding an l-deoxy-D-xylose-5-phosphate reductoisomerase and / or nucleic acids encoding an isopentenyl-diphosphate-Δ-isomerase and / or nucleic acids encoding a geranyl diphosphate synthase and / or nucleic acids encoding a fernsyl diphosphate synthase and / or nucleic acids encoding a geranyl geranyl diphosphate synthase and / or nucleic acids encoding a phytoene synthase and / or nucleic acids encoding one Phytoene desaturase and / or nucleic acids encoding a zeta-carotene desaturase and / or nucleic acids encoding a crtlSO protein and / or nucleic acids encoding an FtsZ protein and / or nucleic acids encoding a MinD protein compared to the wild type.

Increasing the gene expression of the nucleic acids encoding an HMG-CoA reductase and / or nucleic acids encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or nucleic acids encoding an l-deoxy-D- Xylose-5-phosphate synthase and / or nucleic acids encoding an 1-deoxy-D-xylose-5-phosphate reductoisomerase and / or nucleic acids encoding an isopentenyl diphosphate Δ isomerase and / or nucleic acids encoding a geranyl diphosphate -Synthase and / or nucleic acids encoding a farnesyl diphosphate synthase and / or nucleic acids encoding a geranyl-geranyl diphosphate synthase and / or nucleic acids encoding a phytoene synthase and / or nucleic acids encoding a phytoene desaturase and / or nucleic acids encoding one Zeta-carotene desaturase and / or nucleic acids encoding an ertISO protein and / or nucleic acids encoding an FtsZ protein and / or nucleic acids encoding a MinD protein compared to the wild type can also be Various routes are used, for example by inducing the HMG-CoA reductase gene and / or (E) -4-hydroxy-3-methylbut-2-enyldiphosphate reductase gene and / or l-deoxy-D -Xylose-5-phosphate synthase gene and / or 1-deoxy-D-xylose-5-phosphate reductoisomerase gene and / or isopentenyl-diphosphate-Δ-isomerase gene and / or geranyl diphosphate synthase Gene and / or farnesyl diphosphate synthase gene and / or geranyl geranyl diphosphate synthase gene and / or phytoene synthase gene and / or phytoene desaturase gene and / or zeta-carotene desaturase gene and / or crtlSO gene and / or FtsZ gene and / or MinD gene by activators or by introducing one or more copies of the HMG-CoA reductase gene and / or (E) -4-hydroxy-3-methylbut -2-enyl-diphosphate reductase gene and / or l-deoxy-D-xylose-5-phosphate synthase gene and / or l-deoxy-D-xylose-5-phosphate reductoisomerase gene and / or isopentenyl diphosphate Δ isomerase gene and / or geranyl diphosphate synthase gene and / or farnesyl diphosphate synthase gene and / or geranyl geranyl diphosphate synthase gene and / or phytoene synthase gene and / or phytoene desaturase gene and / or zeta-carotene desaturase gene and / or crtlSO gene and / or FtsZ gene and / or MinD gene, ie by introducing at least one nucleic acid encoding an HMG-CoA reductase and / or at least one nucleic acid encoding an (E) -4-hydroxy-3-methylbut-2 -enyl-diphosphate reductase and / or at least one nucleic acid encoding a 1-deoxy-D-xylose-5-phosphate synthase and / or at least one nucleic acid encoding an l-deoxy-D-xylose-5-phosphate reductoisomerase and / or at least one nucleic acid encoding an isopentenyl diphosphate Δ isomerase and / or at least one nucleic acid encoding a geranyl diphosphate synthase and / or at least one nucleic acid encoding a farnesyl diphosphate synthase and / or at least one nucleic acid encoding a geranyl geranyl diphosphate synthase and / or at least one nucleic acid encoding a phytoene synthase and / or at least one nucleic acid encoding a phytoene desaturase and / or at least one nucleic acid encoding a zeta-carotene desaturase and / or at least one nucleic acid encoding a crtISO protein and / or at least one nucleic acid encoding an FtsZ protein and / or at least one nucleic acid encoding a MinD protein into the plant.

Enhancing gene expression of a nucleic acid encoding an HMG-CoA reductase and / or (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or l-deoxy-D-xylose-5-phosphate

Synthase and / or l-deoxy-D-xylose-5-phosphate reductoisomerase and / or isopentenyl diphosphate Δ isomerase and / or geranyl diphosphate synthase and / or farnesyl diphosphate synthase and / or geranyl geranyl Diphosphate synthase and / or phytoene synthase and / or phytoene desaturase and / or zeta-carotene desaturase and / or a crtlSO protein and / or FtsZ protein and / or MinD protein, the manipulation of the expression of the Plants own endogenous HMG-CoA reductase and / or (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or l-deoxy-D-xylose-5-phosphate synthase and / or 1-deoxy-D-xylose-5-phosphate reductoisomerase and / or isopentenyl-di-phosphate-Δ-isomerase and / or geranyl-diphosphate-synthase and / or farnesyl-diphosphate-synthase and / or geranyl-geranyl-diphosphate- Synthase and / or phytoene synthase and / or phytoene desaturase and / or zeta-carotene desaturase and / or des

Plants own crtlSO protein and / or FtsZ protein and / or MinD protein understood.

This can be achieved, for example, by changing the corresponding promoter DNA sequence. Such a change, which results in an increased expression rate of the gene, can take place, for example, by deleting or inserting DNA sequences.

In a preferred embodiment, the

Gene expression of a nucleic acid encoding an HMG-CoA reductase and / or increasing the gene expression of a nucleic acid encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or increasing the gene expression of a nuc linseic acid encoding an 1-deoxy-D-xylose-5-phosphate synthase and / or increasing the gene expression of a nucleic acid encoding an 1-deoxy-D-xylose-5-phosphate reductoisomerase and / or the increase in the gene expression of a nucleic acid encoding an isopentenyl diphosphate Δ isomerase and / or the increase in the gene expression of a nucleic acid encoding a geranyl diphosphate synthase and / or the increase in the gene expression of a nucleic acid encoding a farnesyl diphosphate synthase and / or increasing the gene expression of a nucleic acid encoding a geranyl-geranyl diphosphate synthase and / or increasing the gene expression of a nucleic acid encoding a phytoene synthase and / or increasing the gene expression of a nucleic acid encoding a phytoene desaturase and / or increasing the Gene expression of a nucleic acid encoding a zeta-carotene desaturase and / or the increase in gene expression of a nucleic acid encoding a crtlSO protein and / or the increase in gene expression of a nucleic acid encoding an FtsZ protein and / or the increase in gene expression of a nucleic acid encoding a MinD -Protein by contribution s of at least one nucleic acid encoding an HMG-CoA reductase and / or by introducing at least one nucleic acid encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or by introducing at least one Nucleic acid encoding a 1-deoxy-D-xylose-5-phosphate synthase and / or by introducing at least one nucleic acid encoding an 1-deoxy-D-xylose-5-phosphate reductoisomerase and / or by introducing at least one nucleic acid an isopentenyl diphosphate Δ isomerase and / or by introducing at least one nucleic acid encoding a geranyl diphosphate synthase and / or by introducing at least one nucleic acid encoding a farnesyl diphosphate synthase and / or by introducing at least one Nucleic acid encoding a geranyl-geranyl diphosphate synthase and / or by introducing at least one nucleic acid encoding a phytoene synthase and / or by introducing mi at least one nucleic acid encoding a phytoene desaturase and / or by introducing at least one nucleic acid encoding a zeta-carotene desaturase and / or by introducing at least one nucleic acid encoding a crtlSO protein and / or by introducing at least one nucleic acid encoding an FtsZ -Protein and / or by introducing at least one nucleic acid encoding a MinD protein into the plant.

In principle, any HMG-CoA reductase gene or (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase gene or l-deoxy-D-xylose-5-phosphate synthase- Gene or 1-deoxy-D-xylose-5-phosphate reductoisomerase gene or isopentenyl diphosphate Δ Δ isomerase gene or geranyl diposphate synthase gene or

Farnesyl diphosphate synthase gene or geranyl geranyl diphosphate synthase gene or phytoene synthase gene or phytoene desaturase gene Gene or zeta-carotene desaturase gene or crtlSO gene or FtsZ gene or MinD gene can be used.

With genomic HMG-CoA reductase sequences or (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase sequences or 1-deoxy-D-xylose-5-phosphate synthase sequences or 1-Deoxy-D-xylose-5-phosphate reductoisomerase sequences or isopentenyl diphosphate Δ isomerase sequences or geranyl diphosphate synthase sequences or farnesyl diphosphate synthase sequences or geranyl geranyl diphosphate synthase sequences or phytoene

Synthase sequences or phytoene desaturase sequences or zeta-carotene desaturase sequences or crtlSO sequences or FtsZ sequences or MinD sequences from eukaryotic sources which contain introns are not in the event that the host plant is able or cannot be enabled to express the corresponding proteins, preferably to use already processed nucleic acid sequences, such as the corresponding cDNAs.

In this preferred embodiment, the preferred transgenic plants according to the invention therefore have at least one further HMG-CoA reductase gene and / or (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase gene and compared to the wild type / or l-deoxy-D-xylose ~ 5-phosphate synthase gene and / or 1-deoxy-D-xylose-5-phosphate reductoisomerase gene and / or isopentenyl-diphosphate-Δ-isomerase gene and / or Geranyl diphosphate synthase gene and / or farnesyl diphosphate synthase gene and / or geranyl geranyl diphosphate synthase gene and / or phytoene synthase gene and / or phytoene desaturase gene and / or zeta Carotene desaturase gene and / or crtlSO gene and / or FtsZ gene and / or MinD gene.

In this preferred embodiment, the genetically modified plant has, for example, at least one exogenous nucleic acid, coding for an HMG-CoA reductase or at least two endogenous nucleic acids, coding for an HMG-CoA reductase and / or at least one exogenous nucleic acid, coding for an (E) -4 -Hydroxy-3-methylbut-2-enyl-diphosphate reductase or at least two endogenous nucleic acids encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or at least one exogenous nucleic acid a 1-deoxy-D-xylose-5-phosphate synthase or at least two endogenous nucleic acids encoding an l-deoxy-D-xylose-5-phosphate synthase and / or at least one exogenous nucleic acid encoding an l-deoxy-D -Xylose-5-phosphate reductoisomerase or at least two endogenous nucleic acids encoding a 1-deoxy-D-xylose 5-phosphate reductoisomerase and / or at least one exogenous nucleic acid encoding an isopentenyl diphosphate Δ isomerase or at least two endogenous nucleic acids encoding an isopentenyl diphosphate Δ isomerase and / or at least one exogenous nucleic acid encoding a geranyl diphosphate synthase or at least two endogenous nucleic acids encoding a geranyl diphosphate synthase and / or at least one exogenous nucleic acid encoding a farnesyl diphosphate synthase or at least two endogenous nucleic acids encoding a farnesyl diphosphate synthase and / or at least one exogenous nucleic acid encoding a geranyl geranyl diphosphate synthase or at least two endogenous nucleic acids encoding one Geranyl-geranyl diphosphate synthase and / or at least one exogenous nucleic acid encoding a phytoene synthase or at least two endogenous nucleic acids encoding a phytoene synthase and / or at least one exogenous nucleic acid encoding a phytoene desaturase or at least two endogenous Nucleic acids encoding a phytoene desaturase and / or at least s an exogenous nucleic acid encoding a zeta-carotene desaturase or at least two endogenous nucleic acids, encoding a zeta-carotene desaturase and / or at least one exogenous nucleic acid encoding a crtlSO protein or at least two endogenous nucleic acids encoding a crtISO protein and / or at least one exogenous nucleic acid encoding an FtsZ protein or at least two endogenous nucleic acids encoding an FtsZ protein and / or at least one exogenous nucleic acid encoding a MinD protein or at least two endogenous nucleic acids encoding a MinD protein.

Examples of HMG-CoA reductase genes are:

A nucleic acid encoding an Arabidopsis thallana HMG-CoA reductase, Accession NM_106299; (Nucleic acid: SEQ ID NO: 99, protein: SEQ ID NO: 100),

as well as other HMG-CoA reductase genes from other organisms with the following accession numbers:

P54961, P54870, P54868, P54869, 002734, P22791, P54873, P54871, P23228, P13704, P54872, Q01581, P17425, P54874, P54839, P14891, P34135, 064966, P29057, P480436, P480436, P480436, P480196, P48043, P480196 064967, P29058, P48022, Q41437, P12684, Q00583, Q9XHL5, Q41438, Q9YAS4, 076819, 028538, Q9Y7D2, P54960, 051628, P48021, Q03163, P00347, P14773, Q12577594, P03404, P12577, Q6, P680, Q0516, Q6, P6806, Q0516, Q6, P6, Q0516, Q6, P6806, Q0516, Q6, P6806 Q01237, Q01559, Q12649, 074164, 059469, P51639, Q10283, 008424, P20715, P13703, P13702, Q96UG4, Q8SQZ9, 015888, Q9TUM4, P93514, Q39628, P93040, P9T09M9, Q9T09M9, Q9684M, Q9T09M9, Q9309, Q9309, Q9309, Q9309, Q9309, Q9309M04 Examples of (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase genes are:

A nucleic acid encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase from Arabidopsis thaliana (lytB / ISPH), ACCESSION AY168881, (nucleic acid: SEQ ID NO: 101, protein: SEQ ID NO : 102),

as well as other (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase genes from other organisms with the following accession numbers:

T04781, AF270978_1, NP_485028.1, NP_442089.1, NP_681832.1, ZP_00110421.1, ZP_00071594.1, ZP_00114706.1, ISPH_SYNY3, ZP_00114087.1, ZP_00104269.1, AF3981455141_161, AF3981455141_161. 1, NP_348471.1, NP_562001.1, NP_223698.1, NP_781941.1, ZP_00080042.1, NP_859669.1, NP_214191.1, ZP_00086191.1, ISPH_VIBCH, NP_230334.1, NP_742768.1, NP_30230Y.1.1, ISPH NP_602581.1, ZP_00026966.1, NP_520563.1, NP_253247.1, NP_282047.1, ZP_00038210.1, ZP_00064913.1, CAA61555.1, ZP_00125365.1, ISPH_ACICA, EAA24703.1, ZP_00013029.1.1, ZP_00013067.1, ZAA NP_790656.1, NP_217899.1, NP_641592.1, NP_636532.1, NP_719076.1, NP_660497.1, NP_422155.1, NP_715446.1, ZP_00090692.1, NP_759496.1, ISPH_BURPS, ZP_00122156.1, NP NP__335584.1, ZP_00135016.1, NP 789585.1, NP_787770.1, NP__769647.1, ZP_00043336.1, NP_242248.1, ZP_00008555.1, NP_246603.1, ZP_00030951.1, NP_670994.1, NP_40403737.1 , NP_733653.1, NP_697503.1, NP_840730.1, NP_274828.1, NP_796916.1, ZP_00123390.1, NP_824386.1, NP_737689.1, ZP_00021222.1, NP_757521.1, NP_390395.1,

ZP_00133322.1, CAD76178.1, NP_600249.1, NP_454660.1, NP_712601.1, NP_385018.1, NP_751989.1

Examples of l-deoxy-D-xylose-5-phosphate synthase genes are:

A nucleic acid encoding an I-deoxy-D-xylose-5-phosphate synthase from Lycopersicon esculentum, ACCESSION # AF143812 (nucleic acid: SEQ ID NO: 103, protein: SEQ ID NO: 104),

as well as further l-deoxy-D-xylose-5-phosphate synthase genes from other organisms with the following accession numbers: AF143812_1, DXS_CAPAN, CAD22530.1, AF182286_1, NP_193291.1, T52289, AAC49368.1, AAP14353.1, D71420, DXS_ORYSA, AF443590_1, BAB02345.1, CAA09804.2, NP_850620.1, CAD22155.2, AAM65798.1, NP_566686.1, CAD22531.1, AAC33513.1, CAC08458.1, AAG10432.1, T044040, AAP14. 1, AF428463_1, ZP_00010537.1, NP_769291.1, AAK59424.1, NP_107784.1, NP_697464.1, NP_540415.1, NP_196699.1, NP_384986.1, ZP_00096461.1, ZP_00013656.1, NP_353769.1, BAA83576.1, ZP_00005919.1, ZP_00006273.1, NP_420871.1, AAM48660.1, DXS_RHOCA, ZP_00045608.1, ZP_00031686.1 ZP_00022174.1, ZP_00086851.1, NP_742690.1, NP_520342.1, ZP_00082120.1, NP_790545.1, ZP_00125266.1, CAC17468.1, NP_252733.1, ZP_00092466.1, NP_439591.1, NP_414954. 1, NP_622918.1, NP_286162.1, NP_836085.1, NP_706308.1, ZP_00081148.1, NP_797065.1, NP_213598.1, NP_245469.1, ZP_00075029.1, NP_455016.1, NP_230536.1, NP_459417.1, NP_274863.1, NP_283402.1, NP_759318.1, NP_406652.1, DXS_SYNLE, DXS_SYNP7, NP_440409.1, ZP_00067331.1, ZP_00122853.1, NP_717142.1, ZP_00104889.1, NP_243612.1, DX6841212.1EL, NP_637787.1, DXS_CHLTE, ZP_00129863.1, NP_661241.1, DXS_XANCP, NP_470738.1, NP_484643.1, ZP_00108360.1, NP_833890.1, NP_846629.1, NP_658213.1, NP_642839.147, ZP

ZP_00060584.1, ZP_00041364.1, ZP_00117779.1, NP_299528.1 Examples of l-deoxy-D-xylose-5-phosphate reductoisomerase genes are:

A nucleic acid encoding an l-deoxy-D-xylose-5-phosphate reductoisomerase from Arabidopsis thaliana, ACCESSION # AF148852, (nucleic acid: SEQ ID NO: 105, protein: SEQ ID NO: 106),

as well as further l-deoxy-D-xylose-5-phosphate reductoisomerase genes from other organisms with the following accession numbers:

AF148852, AY084775, AY054682, AY050802, AY045634, AY081453, AY091405, AY098952, AJ242588, AB009053, AY202991, NP_201085.1, T52570, AF331705_1, AFAB3671501501A, AFB167155221 ZP_00071219.1, NP_488391.1, ZP_00111307.1, DXR_SYNLE, AAP56260.1, NP_681831.1, NP_442113.1, ZP_00115071.1, ZP_00105106.1, ZP_0011348 .1, NP_833540.1, NP_657789.1 DXR_BACHD, NP_833080.1, NP_845693.1, NP_562610.1, NP_623020.1, NP_810915.1, NP_243287.1, ZP_00118743.1, NP_464842.1, NP_470690.1, ZP_00082201.1, NP_781898.1, ZP_00123667 NP_348420.1, NP_604221.1, ZP_00053349.1, ZP_00064941.1, NP_246927.1, NP_389537.1, ZP_00102576.1, NP_519531.1, AF124757_19, DXR_ZYMMO, NP_713472.1, NP_45924827.1, NP_459248.1.1. 1, NP_743754.1, DXR_PSEPK, ZP_00130352.1, NP_702530.1, NP_841744.1, NP_438967.1, AF514841_1, NP_706118.1, ZP_00125845.1, NP_404661.1, NP_285867.1, NP_24006415.1, NP_4006415.1 ZP_00094058.1, NP_791365.1, ZP_00012448.1, ZP_00015132.1, ZP_000915 45.1, NP_629822.1, NP_771495.1, NP_798691.1, NP_231885.1, NP_252340.1, ZP_00022353.1, NP_355549.1, NP_420724.1, ZP_00085169.1,

EAA17616.1, NP_273242.1, NP_219574.1, NP_387094.1, NP_296721.1, ZP_00004209.1, NP_823739.1, NP_282934.1, BAA77848.1, NP_660577.1, NP_760741.1, NP_641750.1, NP_636741.1, NP_829309.1, NP_298338.1, NP_444964.1, NP_717246.1, NP_224545.1, ZP_00038451.1, DXR_KITGR, NP_778563.1.

Examples of isopentenyl diphosphate Δ isomerase genes are:

A nucleic acid encoding an isopentenyl diphosphate Δ isomerase from Adonis palaestina clone ApIPI28, (ipiAal), ACCESSION # AF188060, published by Cunningham, F.X. Jr. and Gantt, E .: Identification of multi-gene families encoding isopentenyl diphosphate isomerase in plants by heterologous complementation in Escherichia coli, Plant Cell Physiol. 41 (1), 119-123 (2000) (nucleic acid: SEQ ID NO: 107, protein: SEQ ID NO: 108),

as well as other isopentenyl diphosphate Δ isomerase genes from other organisms with the following accession numbers:

Q38929, 048964, Q39472, Q13907, 035586, P58044, 042641, 035760, Q10132, P15496, Q9YB30, Q8YNH4, Q42553, 027997, P50740, 051627, 048965, Q8KFR5, Q39471F926, Q39471F926 Q9CIF5, Q88WB6, Q92BX2, Q8Y7A5, Q8TT35 Q9KK75, Q8NN99, Q8XD58, Q8FE75, Q46822, Q9HP40, P72002, P26173, Q9Z5D3, Q8Z3X9, Q8ZM82, Q9X7Q6, 013504, Q9HFW8, Q8NJL9, Q9UUQ1, Q9NH02, Q9M6K9, Q9M6K5, Q9FXR6, 081,691 , Q9S7C4, Q8S3L8, Q9M592, Q9M6K3, Q9M6K7, Q9FV48, Q9LLB6, Q9AVJ1, Q9AVG8, Q9M6K6, Q9AVJ5, Q9M6K2, Q9AYS5, Q9M6K8, Q9AVG7, Q8S3L7, Q8W250, Q94IE1, Q9AVI8, Q9AYS6, Q9SAY0, Q9M6K4, Q8GVZ0, Q84RZ8, Q8KZ12 , Q8KZ66, Q8FND7, Q88QC9, Q8BFZ6, BAC26382, CAD94476.

Examples of geranyl diphosphate synthase genes are:

A nucleic acid encoding a geranyl diphosphate synthase from Arabidopsis thaliana, ACCESSION # Y17376, Bouvier, F., Suire, C, d'Harlingue, A., Backhaus, R.A. and Camara, B.; Molecular cloning of geranyl diphosphate synthase and compartmentation of monoterpen synthesis in plant cells, Plant J. 24 (2), 241-252 (2000) (nucleic acid: SEQ ID NO: 109, protein: SEQ ID NO: 110),

as well as other geranyl diphosphate synthase genes from other organisms with the following accession numbers:

Q9FT89, Q8LKJ2, Q9FSW8, Q8LKJ3, Q9SBR3, Q9SBR4, Q9FET8, Q8LKJ1, Q84LG1, Q9JK86 Examples of farnesyl diphosphate synthase genes are:

A nucleic acid encoding a Farnesyl diphosphate synthase from Arabidopsis thaliana (FPS1), ACCESSION # U80605, published by Cunillera, N. , Arro, M., Delourme, D., Karst, F., Boronat, A. and Ferrer, A. : Arabidopsis thaliana contains two differentially expressed farnesyl-diphosphate synthase genes, J. Biol. Chem. 271 (13), 7774-7780 (1996), (nucleic acid: SEQ ID O: 111, protein: SEQ ID O: 112) .

as well as other farnesyl diphosphate synthase genes from other organisms with the following accession numbers:

P53799, P37268, Q02769, Q09152, P49351, 024241, Q43315, P49352, 024242, P49350, P08836, P14324, P49349, P08524, 066952, Q08291,

P54383, Q45220, P57537, Q8K9A0, P22939, P45204, 066126, P55539,

Q9SWH9, Q9AVI7, Q9FRX2, Q9AYS7, Q94IE8, Q9FXR9, Q9ZWF6, Q9FXR8,

Q9AR37, 050009, Q94IE9, Q8RVK7, Q8RVQ7, 004882, Q93RA8, Q93RB0,

Q93RB4, Q93RB5, Q93RB3, Q93RB1, Q93RB2, Q920E5.

Examples of geranyl-geranyl diphosphate synthase genes are:

A nucleic acid encoding a geranyl-geranyl diphosphate synthase from Sinaps alba, ACCESSION # X98795, published by Bonk, M. , Hoffmann, B., Von Lintig, J., Schledz, M., Al-Babili, S. , Hobeika, E., Kleinig, H. and Beyer, P .: Chloroplast import of four carotenoid biosynthetic enzymes in vitro reveals differential fates prior to membrane binding and oligomeric assembly, Eur. J. Biochem. 247 (3), 942-950 (1997), (nucleic acid: SEQ ID NO: 113, protein: SEQ ID N0: 114),

as well as other geranyl-geranyl-diphosphate synthase genes from other organisms with the following accession numbers:

P22873, P34802, P56966, P80042, Q42698 Q92236, 095749, Q9WTN0,

Q50727, P24322, P39464, Q9FXR3, Q9AYN2 Q9FXR2, Q9AVG6, Q9FRW4,

Q9SXZ5, Q9AVJ7, Q9AYN1, Q9AVJ4, Q9FXR7 Q8LSC5, Q9AVJ6, Q8LSC4,

Q9AVJ3, Q9SSU0, Q9SXZ6, Q9SST9, Q9AVJ0 Q9AVI9, Q9FRW3, Q9FXR5,

Q94IF0, Q9FRX1, Q9K567, Q93RA9, Q93QX8 CAD95619, EAA31459

Examples of phytoene synthase genes are:

A nucleic acid encoding a phytoene synthase from Erwinia uredovora, ACCESSION # D90087; published by Misawa, N., Nakagawa, M. , Kobayashi, K., Yamano, S., Izawa, Y., Nakamura, K. and Harashima, K. : Elucidation of the Erwinia uredovora carotenoid biosynthetic pathway by functional analysis of gene products expressed in Escherichia coli; J. Bacteriol. 172 (12), 6704-6712 (1990), (nucleic acid: SEQ ID NO: 115, protein: SEQ ID NO: 116),

as well as other phytoene synthase genes from other organisms with the following accession numbers:

CAB39693, BAC69364, AAF10440, CAA45350, BAA20384, AAM72615, BAC09112, CAA48922, P_001091, CAB84588, AAF41518, CAA48155, AAD38051, AAF33237, AAG10427, AAA34187, BAB73532, CAC19567, AAM62787, CAA55391, AAB65697, AAM45379, CAC27383, AAA32836, AAK07735, BAA84763, P_000205, AAB60314, P_001163, P_000718, AAB71428, AAA34153, AAK07734, CAA42969, CAD76176, CAA68575, P_000130, P_001142, CAA476, A07992, A1499457, A247A7507A, A995

Examples of phytoene desaturase genes are:

A nucleic acid encoding a phytoene desaturase from Erwinia uredovora, ACCESSION # D90087; published by Misawa, N. , Nakagawa, M., Kobayashi, K., Yamano, S. , Izawa, Y., akamura, K. and Harashima, K.: Elucidation of the Erwinia uredovora carotenoid biosynthetic pathway by functional analysis of gene products expressed in Escherichia coli; J. Bacteriol. 172 (12), 6704-6712 (1990), (nucleic acid: SEQ ID NO: 117, protein: SEQ ID NO: 118),

as well as other phytoene desaturase genes from other organisms with the following accession numbers:

AAL15300, A39597, CAA42573, AAK51545, BAB08179, CAA48195, BAB82461, AAK92625, CAA55392, AAG10426, AAD02489, AA024235, AAC12846, AAA99519, AAL38046, CAA60479, CAA75094, ZP_001041, ZP_001163, CAA39004, CAA44452, ZP_001142, ZP_000718, BAB82462, AAM45380, CAB56040, ZP_001091, BAC09113, AAP79175, AAL80005, AAM72642, AAM72043, ZP_000745, ZP_001141, BAC07889, CAD55814, ZP_001041, CAD27442, CAE00192, ZP_001163, ZP_000197, B7AA18400, AAG10425, ZP_001119, AAF13698, 2121278A, AAB35386, AAD02462, BAB68552, CAC85667, AAK51557, CAA12062, AAG51402, AAM63349, AAF85796, BAB74081, AAA91161, CAB56041, AAC48983, AAG14399, CAB65434, BAB73487, ZP_001117, ZP_000448, CAB39695, CAD76175, BAC69363, BAA17934, ZP_000171, AAF65586, ZP_000748, BAC07074, ZP_001133 CAA64853, BAB74484, ZP_001156 , AAF23289, AAG28703, AAP09348, AAM71569, BAB69140, ZP_000130, AAF41516, AAG18866, CAD95940, NP_656310, AAG10645, ZP_000276, ZP_000192, ZP_000186, AAM94364, ZA656000, EAA756 Examples of zeta-carotene desaturase genes are:

A nucleic acid encoding a Narcissus pseudonarcissus zeta-carotene desaturase, ACCESSION # AJ224683, published by Al-Babili, S. , Oelschlegel, J. and Beyer, P .: A cDNA encoding for beta carotene desaturase (Accession NO.AJ224683) from Narcissus pseudonarcissus L .. (PGR98-103), Plant Physiol. 117, 719-719 (1998), (nucleic acid: SEQ ID NO: 119, protein: SEQ ID NO: 120),

as well as other zeta-carotene desaturase genes from other organisms with the following accession numbers:

Q9R6X4, Q38893, Q9SMJ3, Q9SE20, Q9ZTP4, 049901, P74306, Q9FV46, Q9RCT2, ZDS_NARPS, BAB68552.1, CAC85667.1, AF372617_1, ZDS_TARER, CAD55814_1, CAD12787A3.1, CAD12787A3.1, CAD12787A3.1, CAD27787AN.1, CAD2778A4.1, CAD27787AN2, CAD27787AN2, CAD2778A13.1, CAD2778A13.1, CAD1278C7141.1, CAD2778A13.1, CAD1278C7141.1, CAD2778A13.1, CAD1278C7142.2 AAM63349.1, ZDS_ARATH, AAA91161.1, ZDS_MAIZE, AAG14399.1, NP_441720.1, NP_486422.1, ZP_00111920.1, CAB56041.1, ZP_00074512.1, ZP_00116357.1, NP_681127_00, ZP.14006. 1, CAB65434.1, NP_662300.1

Examples of crtISO genes are:

A nucleic acid encoding a crtlSO from Lycopersicon esculentum; ACCESSION # AF416727, published by Isaacson, T., Ronen, G., Zamir, D. and Hirschberg, J.: Cloning of tangerine from tomato reveals a carotenoid isomerase essential for the production of beta-carotene and xanthophylls in plants; Plant Cell 14 (2), 333-342 (2002), (nucleic acid: SEQ ID NO: 121, protein: SEQ ID NO: 122),

as well as other crtlSO genes from other organisms with the following accession numbers:

AAM53952

Examples of FtsZ genes are:

A nucleic acid encoding an FtsZ from Tagetes erecta, ACCESSION # AF251346, published by Moehs, CP, Tian, L., Osteryoung, KW and Dellapenna, D.: Analysis of carotenoid biosynthetic gene expression during marigold petal development Plant Mol. Biol. 45 (3), 281-293 (2001), (nucleic acid: SEQ ID NO: 123, protein: SEQ ID NO: 124), as well as other FtsZ genes from other organisms with the following accession numbers:

CAB89286.1, AF205858_1, NP_200339.1, CAB89287.1, CAB41987.1, AAA82068.1, T06774, AF383876_1, BAC57986.1, CAD22047.1,

BAB91150.1, ZP_00072546.1, NP_440816.1, T51092, NP_683172.1, BAA85116.1, NP_487898.1, JC4289, BAA82871.1, NP_781763.1, BAC57987.1, ZP_00111461.1, T51088, NP_190843 ZP_00060035.1, NP_846285.1, AAL07180.1, NP_243424.1, NP_833626.1, AAN04561.1, AAN04557.1, CAD22048.1, T51089, NP_692394.1, NP_623237.1,

NP_565839.1, T51090, CAA07676.1, NP_113397.1, T51087, CAC44257.1, E84778, ZP_00105267.1, BAA82091.1, ZP_00112790.1, BAA96782.1, NP_348319.1, NP_471472.1, ZP_0000 NP_465556.1, NP_389412.1, BAA82090.1, NP_562681.1, AAM22891.1, NP_371710.1, NP_764416.1, CAB95028.1, FTSZ_STRGR, AF120117_1, NP_827300.1, JE0282, NP_626341.1, AAC45639.1 NP_785689.1, NP_336679.1, NP_738660.1, ZP_00057764.1, AAC32265.1, NP__814733.1, FTSZ_MYCKA, NP_216666.1, CAA75616.1, NP_301700.1, NP_601357.1, ZP_00046159.1, CAA ZP_00037834.1, NP_268026.1, FTSZ_ENTHR, NP_787643.1, NP_346105.1, AAC32264.1, JC5548, AAC95440.1, NP_710793.1,

NP_687509.1, NP_269594.1, AAC32266.1, NP_720988.1, NP_657875.1, ZP_00094865.1, ZP_00080499.1, ZP_00043589.1, JC7087, NP_660559.1, AAC46069.1, AF179611_14, NPAC44404.1.1. 1.

Examples of MinD genes are:

A nucleic acid encoding a MinD from Tagetes erecta, ACCESSION # AF251019, published by Moehs, C. P., Tian, L., Osteryoung, K.W. and Dellapenna, D. : Analysis of carotenoid bio-synthetic gene expression during marigold petal development; Plant Mol. Biol. 45 (3), 281-293 (2001), (nucleic acid: SEQ ID NO: 125, protein: SEQ ID O: 126),

as well as other MinD genes with the following accession numbers:

NP_197790.1, BAA90628.1, NP_038435.1, NP_045875.1, AAN33031.1, NP_050910.1, CAB53105.1, NP_050687.1, NP_682807.1, NP_487496.1, ZP_00111708.1, ZP_000711092.1. 1, NP_603083.1, NP_782631.1, ZP_00097367.1, ZP_00104319.1, NP_294476.1, NP_622555.1, NP_563054.1, NP_347881.1, ZP_00113908.1, NP_834154.1, NP_658480.1, ZP_00059858.1, NP_470915.1, NP_243893.1, NP_465069.1, ZP_00116155.1, NP_390677.1, NP_692970.1, NP_298610.1, NP_207129.1, ZP_00038874.1, NP_778791.1, NP_223033.1, NP_641599.1, NP_63636.1. 1, ZP_00088714.1, NP_213595.1, NP_743889.1, NP_231594.1, ZP_00085067.1, NP_797252.1, ZP_00136593.1, NP_251934.1, NP_405629.1, NP_759144.1, ZP_00102939.1, NP_793645.1 NP_699517.1, NP_460771.1, NP_860754.1, NP_456322.1, NP_718163.1, NP_229666.1, NP_357356.1, NP_541904.1, NP_287414.1, NP_660660.1, ZP_00128273.1, NP_785117.1,. 1, NP_715361.1, AF149810_1, NP_841854.1, NP_437893.1, ZP_00022726.1, E7AA24844.1, ZP_00029547.1, NP_521484.1, NP_240148.1, NP_770852.1, AF345908_2, NP_7700023.1, Z NP_579340.1, NP_143455.1, NP_126254.1, NP_142573.1, NP_613505.1, NP_127112.1, NP_712786.1, NP_578214.1, NP_069530.1, NP_247526.1, AAA85593.1, NP_212403.1, NP_78225. 1, ZP_00058694.1, NP_247137.1, NP_219149.1, NP_276946.1, NP_614522.1, ZP_00019288.1, CAD78330.1

In the preferred embodiment described above, nucleic acids encoding proteins are preferably used as HMG-CoA reductase genes, containing the amino acid sequence SEQ ID NO: 100 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which have an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 100, and which have the enzymatic property of an HMG-CoA reductase.

Further examples of HMG-CoA reductases and HMG-CoA reductase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 100 easy to find.

Further examples of HMG-CoA reductases and HMG-CoA reductase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 99 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques easy to find in a manner known per se.

In a further particularly preferred embodiment, to increase the HMG-CoA reductase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the HMG-CoA reductase of the sequence SEQ ID NO: 100.

Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code. Those codons that are frequently used in accordance with the plant-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other known genes of the organisms concerned.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 99 is introduced into the organism.

In the preferred embodiment described above, use is preferably made of (N) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase genes as nucleic acids which encode proteins containing the amino acid sequence SEQ ID NO: 102 or one of these sequences Substitution, insertion or deletion of a sequence derived from amino acids, which has an identity of at least 30%, preferably at least 50%, more preferably at least 70%, more preferably at least 90%, most preferably at least 95% at the 7 amino acid level with the sequence SEQ ID NO: 102, and which have the enzymatic property of an (E) -4-hydroxy-3-methylbut-2-enyl-di-phosphate reductase.

Further examples of (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductases and (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase genes can be cited, for example various organisms, the genomic sequence of which is known, as described above, can easily be found by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 102.

Further examples of (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductases and (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase genes can also be found, for example starting from the sequence SEQ ID NO: 101 from various organisms, the genomic sequence of which is not known, as described above, can be easily found in a manner known per se by hybridization and PCR techniques.

In a further particularly preferred embodiment, to increase the (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the (E) -4- Hydroxy-3-methylbut-2-enyl diphosphate reductase of sequence SEQ ID NO: 102. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 101 is introduced into the organism.

In the preferred embodiment described above, nucleic acids which encode proteins containing the amino acid sequence SEQ ID NO: 104 or one of these sequences by substitution, insertion or deletion are preferably used as (1-deoxy-D-xylose-5-phosphate synthase genes sequence derived from amino acids, which has an identity of at least 30%, preferably at least 50%, more preferably at least 70%, more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 104, and which has the enzymatic property a (l-deoxy-D-xylose-5-phosphate synthase.

Further examples of (1-deoxy-D-xylose-5-phosphate synthase and (1-deoxy-D-xylose-5-phosphate synthase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above , easy to find by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 104.

Further examples of (1-deoxy-D-xylose-5-phosphate synthase and (1-deoxy-D-xylose-5-phosphate synthase genes can also be obtained from different organisms, for example, starting from the sequence SEQ ID NO: 103 whose genomic sequence is not known, as described above, can easily be found by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the (1-deoxy-D-xylose-5-phosphate synthase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the (1-deoxy-D-xylose-5 Phosphate synthase of sequence SEQ ID NO: 104. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 103 is introduced into the organism.

In the preferred embodiment described above, nucleic acids which encode proteins containing the amino acid sequence SEQ ID NO: 106 or one of these sequences by substitution, insertion or deletion of are used as l-deoxy-D-xylose-5-phosphate reductoisomerase genes Amino acid-derived sequence which has an identity of at least 30%, preferably at least 50%, more preferably at least 70%, more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 106 and which has the enzymatic property of a Have l-deoxy-D-xylose-5-phosphate reductoisomerase.

Further examples of l-deoxy-D-xylose-5-phosphate reductoisomerase and l-deoxy-D-xylose-5-phosphate reductoisomerase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above , easily found by homology comparisons of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 106.

Further examples of l-deoxy-D-xylose-5-phosphate reductoisomerase and l-deoxy-D-xylose-5-phosphate reductoisomerase genes can also be found, for example, starting from the sequence SEQ ID NO: 105 from different organisms whose genomic sequence is not known, as described above, can easily be found by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the l-deoxy-D-xylose-5-phosphate reductoisomerase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the 1-deoxy-D-

Xylose-5-phosphate reductoisomerase of sequence SEQ ID NO: 106. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 105 is introduced into the organism.

In the preferred embodiment described above, nucleic acids which encode proteins are preferably used as isopentenyl-D-isomerase genes, containing the amino acid sequence SEQ ID NO: 108 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 108 and which have the enzymatic property of an isopentenyl-D-isomerase.

Further examples of isopentenyl-D-isomerases and isopentenyl-D-isomerase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 108 easy to find.

Further examples of isopentenyl-D-isomerases and isopentenyl-D-isomerase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 107 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques easy to find in a manner known per se.

In a further particularly preferred embodiment, in order to increase the isopentenyl-D-isomerase activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the isopentenyl-D-isomerase of the sequence SEQ ID NO: 108. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 107 is introduced into the organism.

In a preferred embodiment described above, the geranyl diphosphate synthase genes used are preferably nucleic acids which encode proteins, containing the amino acid sequence SEQ ID NO: 110 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and which have an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 110, and which have the enzymatic property of a geranyl diphosphate synthase.

Further examples of geranyl diphosphate synthases and geranyl diphosphate synthase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 110 easy to find.

Further examples of geranyl diphosphate synthases and geranyl diphosphate synthase genes can also be found, for example, starting from the sequence SEQ ID NO: 109 from various

Organisms whose genomic sequence is not known, as described above, can easily be found by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the geranyl diphosphate synthase activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the geranyl diphosphate synthase of the sequence SEQ ID NO: 110. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 109 is introduced into the organism.

In the preferred embodiment described above, preference is given to using, as farnesyl diphosphate synthase genes, nucleic acids which encode proteins, containing the amino acid sequence SEQ ID NO: 112 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and which have an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 112, and which have the enzymatic property of a farnesyl diphosphate synthase.

Further examples of farnesyl diphosphate synthases and farnesyl diphosphate synthase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 112 easy to find.

Further examples of farnesyl diphosphate synthases and farnesyl diphosphate synthase genes can also be found, for example, from the sequence SEQ ID NO: 111

In a further particularly preferred embodiment, to increase the farnesyl diphosphate synthase activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the farnesyl diphosphate synthase of the sequence SEQ ID NO: 112. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 111 is introduced into the organism.

In the preferred embodiment described above, geranyl-geranyl-diphosphate synthase genes are preferably used

Nucleic acids encoding proteins containing the amino acid sequence SEQ ID NO: 114 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which have an identity of at least 30%, preferably at least 50%, more preferably at least 70%, more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 114, and which have the enzymatic property of a geranyl-geranyl-diphosphate synthase.

Further examples of geranyl-geranyl-diphosphate synthases and geranyl-geranyl-diphosphate synthase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the Easily find SeQ ID NO: 114.

Further examples of geranyl-geranyl-diphosphate synthases and geranyl-geranyl-diphosphate synthase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 113 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques can be easily found in a manner known per se.

In a further particularly preferred embodiment, in order to increase the geranyl-geranyl-diphosphate synthase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the geranyl-geranyl-diphosphate synthase of the sequence SEQ ID NO: 114. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 113 is introduced into the organism.

In the preferred embodiment described above, nucleic acids encoding proteins are preferably used as phytoene synthase genes, containing the amino acid sequence SEQ ID NO: 116 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 116, and which have the enzymatic property of a phytoene synthase.

Further examples of phytoene synthases and phytoene synthase genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 116.

Further examples of phytoene synthases and phytoene synthase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 115 from various organisms whose genomic sequence is not known, as described above, by means of hybridization and PCR techniques in a manner known per se Easy to find.

In a further particularly preferred embodiment, in order to increase the phytoene synthase activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the phytoene synthase of the sequence SEQ ID NO: 116. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 115 is introduced into the organism.

In the preferred embodiment described above, the phytoene desaturase genes used are preferably nucleic acids which encode proteins containing the amino acid sequence SEQ ID NO: 118 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30 %, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 118, and which have the enzymatic property of a phytoene desaturase.

Further examples of phytoene desaturases and phytoene desaturase genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 118.

Further examples of phytoene desaturases and phytoene desaturase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 117 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se Easy to find.

In a further particularly preferred embodiment, in order to increase the phytoene desaturase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the phytoene desaturase of the sequence SEQ ID NO: 118. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 117 is introduced into the organism.

In the preferred embodiment described above, the zeta-carotene desaturase genes used are preferably nucleic acids which encode proteins containing the amino acid sequence SEQ ID NO: 120 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and which have an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 120, and which have the enzymatic property of a zeta-carotene desaturase.

Further examples of zeta-carotene desaturases and zeta-carotene desaturase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID NO: 120 easy to find.

Further examples of zeta-carotene desaturases and zeta-carotene desaturase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 119 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques easy to find in a manner known per se.

In a further particularly preferred embodiment, in order to increase the zeta-carotene desaturase activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the zeta-carotene desaturase of the sequence SEQ ID NO: 120. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 119 is introduced into the organism.

In a preferred embodiment described above, nucleic acids which encode proteins are preferably used as CrtlSO genes, containing the amino acid sequence SEQ ID NO: 122 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 122, and which have the enzymatic property of a Crtlso.

Other examples of CrtlSO and CrtlSO genes can be found, for example, from different organisms, their genomic

Sequence is known, as described above, easily found by homology comparisons of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 122.

Further examples of CrtlSO and CrtlSO genes can also be easily found, for example, starting from the sequence SEQ ID NO: 121 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the CrtlSO activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the CrtlSO of the sequence SEQ ID NO: 122.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 121 is introduced into the organism.

In the preferred embodiment described above, the FtsZ genes used are preferably nucleic acids which encode proteins, containing the amino acid sequence SEQ ID NO: 124 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 124 and which have the enzymatic property of an FtsZ.

Further examples of FtsZn and FtsZ genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 124.

Further examples of FtsZn and FtsZ genes can also easily be obtained, for example, starting from the sequence SEQ ID NO: 123 from different organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se find.

In a further particularly preferred embodiment, nucleic acids which encode proteins containing the amino acid sequence of the FtsZ of the sequence SEQ ID NO: 124 are introduced into organisms to increase the FtsZ activity

Those codons that are frequently used in accordance with the plant-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other known genes of the organisms concerned. In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 123 is introduced into the organism.

In the preferred embodiment described above, the preferred MinD genes are nucleic acids encoding proteins containing the amino acid sequence SEQ ID NO: 126 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 126, and which have the enzymatic property of a MinD.

Further examples of MinDn and MinD genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 126.

Further examples of MinDn and MinD genes can also easily be obtained, for example, starting from the sequence SEQ ID NO: 125 from different organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se find.

In a further particularly preferred embodiment, to increase the MinD activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the MinD of the sequence SEQ ID NO: 126.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 125 is introduced into the organism. All of the above-mentioned HMG-CoA reductase genes, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase genes, 1-deoxy-D-xylose-5-phosphate synthase genes, l Deoxy-D-xylose-5-phosphate reductoisomerase genes, isopentenyl diphosphate Δ isomerase genes, geranyl diphosphate synthase genes, farnesyl diphosphate synthase genes, geranyl geranyl diphosphate synthase Genes, phytoene synthase genes, phytoene desaturase genes, zeta-carotene desaturase genes, crtlSO genes, FtsZ genes or MinD genes are also known per se by chemical synthesis from the nucleotide building blocks, for example by Fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix can be produced. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). The addition of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions, as well as general cloning methods, are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In a further preferred embodiment of the method, the plants additionally have a reduced endogenous β-hydroxylase activity compared to the wild type.

A reduced activity, as mentioned above, is preferably understood to mean the partial or essentially complete inhibition or blocking of the functionality of an enzyme in a plant cell, plant or a part, tissue, organ, cells or seeds derived therefrom based on different cell biological mechanisms ,

Activity in plants can be reduced compared to the wild type, for example by reducing the amount of protein or the amount of mRNA in the plant. Accordingly, an activity reduced compared to the wild type can be determined directly or by determining the amount of protein or the mRNA amount of the plant according to the invention in comparison to the wild type.

A reduction in an activity comprises a quantitative reduction of a protein up to an essentially complete absence of the protein (ie a lack of detectability of the corresponding activity or a lack of immunological detectability of the corresponding protein). Endogenous β-hydroxylase activity is understood to mean the enzyme activity of the endogenous, plant-specific β-hydroxylase.

An endogenous β-hydroxylase is understood to mean an endogenous, plant-specific hydroxylase as described above. For example, if Tagetes errectta is the target plant to be genetically modified, the endogenous β-hydroxylase is understood to mean the ß-hydroxylase of Tagetes errecta.

An endogenous β-hydroxylase is accordingly understood to mean, in particular, a plant's own protein which has the enzymatic activity to convert β-carotene into zeaxanthin.

Accordingly, endogenous β-hydroxylase activity is understood to mean the amount of ß-carotene or the amount of zeaxanthin formed by the protein endogenous ß-hydroxylase.

With a reduced endogenous β-hydroxylase activity compared to the wild type, the amount of β-carotene converted or the amount of zeaxanthin formed by the protein endogenous β-hydroxylase is thus reduced in a certain time.

This reduction in endogenous β-hydroxylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, further preferably 100%. The endogenous β-hydroxylase activity is particularly preferably completely switched off.

It has surprisingly been found that it is advantageous in plants which produce the majority of the carotenoids of the α-carotene pathway, such as, for example, lutein, such as plants of the genus Tagetes, to reduce the activity of the endogenous β-hydroxylase and, if appropriate, the activity a heterogeneous hydroxylase. Hydroxylases or functional equivalents thereof are particularly preferably used which come from plants which predominantly produce carotenoids of the β-carotene pathway, such as, for example, the above-described β-hydroxylase from tomato (nucleic acid: SEQ ID No. 97, protein: SEQ ID No. 98).

The endogenous β-hydroxylase activity is determined as described above analogously to the determination of the hydroxylase activity. The endogenous β-hydroxylase activity in plants is preferably reduced by at least one of the following methods:

a) Introduction of at least one double-stranded endogenous β-hydroxylase ribonucleic acid sequence, hereinafter also called endogenous β-hydroxylase dsRNA, or an expression cassette or cassettes ensuring expression thereof.

These include methods in which the endogenous β-hydroxylase dsRNA is directed against an endogenous β-hydroxylase gene (ie genomic DNA sequences such as the promoter sequence) or an endogenous β-hydroxylase transcript (ie mRNA sequences),

b) introduction of at least one endogenous β-hydroxylase antisense ribonucleic acid sequence, hereinafter also called endogenous β-hydroxylase antisenseRNA, or an expression cassette ensuring its expression. These include methods in which the endogenous β-hydroxylase antisenseRNA is directed against an endogenous β-hydroxylase gene (ie genomic DNA sequences) or an endogenous β-hydroxylase gene transcript (ie RNA sequences). Also included are α-anomeric nucleic acid sequences

c) introduction of at least one endogenous β-hydroxylase antisenseRNA combined with a ribozyme or an expression cassette ensuring its expression

d) introduction of at least one endogenous β-hydroxylase sense ribonucleic acid sequence, hereinafter also referred to as endogenous β-hydroxylase sense RNA, for inducing a suppression or an expression cassette ensuring its expression

e) introduction of at least one DNA or protein binding factor against an endogenous β-hydroxylase gene, RNA or protein or an expression cassette ensuring its expression

f) introduction of at least one viral nucleic acid sequence which brings about the endogenous β-hydroxylase RNA degradation or an expression cassette ensuring its expression

g) introduction of at least one construct to generate a loss of function, such as the generation of stop codons or a shift in the reading frame, on an endogenous β-hydroxylase gene, for example by generating an insertion, deletion, inversion or mutation in an endogenous β-hydroxylase gene. Knockout mutants can preferably be introduced by means of targeted insertion into said endogenous β-hydroxylase gene by homologous recombination or

Introduction of sequence-specific nucleases against endogenous ß-hydroxylase gene sequences can be generated.

It is known to the person skilled in the art that further methods for reducing an endogenous β-hydroxylase or its activity or function can also be used within the scope of the present invention. For example, the introduction of a dominant-negative variant of an endogenous β-hydroxylase or an expression cassette ensuring its expression can also be advantageous. Each of these methods can reduce the amount of protein, amount of mRNA and / or activity of an endogenous β-hydroxylase. A combined application is also conceivable. Other methods are known to the person skilled in the art and can hinder or prevent the processing of the endogenous β-hydroxylase, the transport of the endogenous β-hydroxylase or its mRNA, inhibition of ribosome attachment, inhibition of RNA splicing, induction of an endogenous β-hydroxylase RNA Enzyme and / or inhibit translation elongation or termination.

a) Introduction of a double-stranded, endogenous β-hydroxylase ribonucleic acid sequence (endogenous β-hydroxylase dsRNA)

The method of gene regulation using double-stranded RNA has been described in detail above for the reduction of the ε-cyclase activity. This method can be carried out analogously for reducing the endogenous β-hydroxylase activity.

A double-stranded endogenous β-hydroxylase ribonucleic acid sequence or also endogenous β-hydroxylase dsRNA is preferably understood to mean an RNA molecule which has one

Has region with double-strand structure and in this region contains a nucleic acid sequence which

a) is identical to at least a part of the plant's own endogenous β-hydroxylase transcript and / or b) is identical to at least part of the plant's own endogenous β-hydroxylase promoter sequence.

In the process according to the invention, an RNA which has an area with a double-strand structure and which contains a nucleic acid sequence in this area is therefore preferably introduced into the plant to reduce the endogenous β-hydroxylase activity

a) is identical to at least a part of the plant's own endogenous β-hydroxylase transcript and / or

b) is identical to at least part of the plant's own endogenous β-hydroxylase promoter sequence.

The term “endogenous β-hydroxylase transcript” is understood to mean the transcribed part of an endogenous β-hydroxylase gene which, in addition to the endogenous β-hydroxylase coding sequence, also contains, for example, non-coding sequences, such as UTRs.

An RNA "which is identical to at least a part of the plant's own endogenous β-hydroxylase promoter sequence" means preferably that the RNA sequence with at least part of the theoretical transcript of the endogenous β-hydroxylase promoter Sequence, ie the corresponding RNA sequence, is identical.

"A part" of the plant's own endogenous β-hydroxylase transcript or of the plant's own endogenous β-hydroxylase promoter sequence means partial sequences which can range from a few base pairs to complete sequences of the transcript or the promoter sequence , The person skilled in the art can easily determine the optimal length of the partial sequences by routine experiments.

As a rule, the length of the partial sequences is at least 10 bases and at most 2 kb, preferably at least 25 bases and at most 1.5 kb, particularly preferably at least 50 bases and at most 600 bases, very particularly preferably at least 100 bases and at most 500, most preferably at least 200 bases or at least 300 bases and at most 400 bases.

The partial sequences are preferably selected in such a way that the highest possible specificity is achieved and activities of other enzymes, the reduction of which is not desired, are not reduced. It is therefore advantageous for the partial sequences of the parts of the endogenous β-hydroxylase dsRNA parts of the endogenous β-hydroxy select transcripts and / or partial sequences of the endogenous β-hydroxylase promoter sequences which do not occur in other activities.

In a particularly preferred embodiment, the endogenous β-hydroxylase dsRNA therefore contains a sequence which is identical to a part of the plant's own endogenous β-hydroxylase transcript and which codes for the 5 ^V end or the 3 'end of the plant's own nucleic acid contains an endogenous ß-hydroxylase. In particular, non-translated regions in the ^5λ or ^{3x of} the transcript are suitable for producing selective double-strand structures.

Another object of the invention relates to double-stranded RNA molecules (dsRNA molecules) which, when introduced into a plant organism (or a cell, tissue, organ or propagation material derived therefrom) bring about the reduction of an endogenous β-hydroxylase.

Furthermore, the invention relates to a double-stranded RNA molecule for reducing the expression of an endogenous β-hydroxylase (endogenous β-hydroxylase dsRNA) preferably comprising

a) a “sense” RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least part of a “sense” RNA endogenous β-hydroxylase transcript, and

b) an “antisense” RNA strand which is essentially, preferably completely, complementary to the RNA “sense” strand under a).

A nucleic acid construct is preferably used to transform the plant with an endogenous β-hydroxylase dsRNA, which is introduced into the plant and which is transcribed in the plant into the endogenous β-hydroxylase dsRNA.

Furthermore, the present invention also relates to a nucleic acid construct that can be transcribed into

a) a “sense” RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least part of the “sense” RNA endogenous β-hydroxylase transcript, and

b) an “antisense” RNA strand which is essentially — preferably completely — complementary to the RNA sense strand under a). These nucleic acid constructs are also called expression cassettes or expression vectors below.

With regard to the dsRNA molecules, the endogenous 5β-hydroxylase nucleic acid sequence, or the corresponding transcript, is preferably understood to mean the sequence according to SEQ ID NO: 127 or a part thereof.

"Essentially identical" means that the dsRNA sequence too

10 insertions, deletions as well as individual point mutations compared to the endogenous β-hydroxylase target sequence can still have an efficient reduction in expression. The homology is preferably at least 75%, preferably at least 80%, very particularly preferably at least 90% most

15 preferably 100% between the "sense" strand of an inhibitory dsRNA and at least part of the "sense" RNA transcript of an endogenous β-hydroxylase gene, or between the "antisense" strand the complementary strand of an endogenous β- Hydroxylase gene.

20

A 100% sequence identity between dsRNA and an endogenous ß-hydroxylase gene transcript is not absolutely necessary in order to bring about an efficient reduction in endogenous ß-hydroxylase expression. As a result, there is an advantage that

The process is tolerant of sequence deviations, such as those that may arise as a result of genetic mutations, polymorphisms or evolutionary divergences. For example, it is possible with the dsRNA, which was generated on the basis of the endogenous β-hydroxylase sequence of the one organism, the endogenous

30 suppress β-hydroxylase expression in another organism. For this purpose, the dsRNA preferably comprises sequence regions of endogenous β-hydroxylase gene transcripts which correspond to conserved regions. Said conserved areas can easily be derived from sequence comparisons.

35

Alternatively, an "essentially identical" dsRNA can also be defined as a nucleic acid sequence capable of hybridizing with part of an endogenous β-hydroxylase gene transcript (e.g. in 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA)

40 50 ° C or 70 ° C for 12 to 16 h).

“Essentially complementary” means that the “antisense” RNA strand can also have insertions, deletions and individual point mutations in comparison to the complement of the “sense” RNA strand 45. The homology is preferably at least 80%, preferably at least 90%, very particularly preferably at least 95%, most preferably 100% between the "antisense" RNA strand and the complement of the "sense" RNA strand.

In a further embodiment, the endogenous β-hydroxylase dsRNA comprises

a) a “sense” RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least part of the “sense” RNA transcript of the promoter region of an endogenous β-hydroxylase gene, and

a) a “sense” DNA strand which is essentially identical to at least part of the promoter region of an endogenous β-hydroxylase gene, and

The following partial sequences are particularly preferably used to produce the endogenous β-hydroxylase sequences for reducing the endogenous β-hydroxylase activity, in particular for Tagetes erecta:

SEQ ID NO: 163: Sense fragment of the 5 terminal region of the endogenous β-hydroxylase

SEQ ID NO: 164: Antisense fragment of the 5'-terminal region of the endogenous β-hydroxylase

The double-stranded dsRNA structure can be formed from two complementary, separate RNA strands or - preferably - from a single, self-complementary RNA strand. In this case, "sense" RNA strand and "anti sense "RNA strand preferably covalently linked together in the form of an inverted" repeat ".

Such as. described in WO 99/53050, the dsRNA can also comprise a hairpin structure, in that the “sense” and “antisense” strand are connected by a connecting sequence (“linker”; for example an intron). The self-complementary dsRNA structures are preferred since they only require the expression of an RNA sequence and the complementary RNA strands always comprise an equimolar ratio. Preferably the connecting sequence is an intron (e.g. an intron of the ST-LS1 gene from potato; Vancanneyt GF et al. (1990) Mol Gen Genet 220 (2): 245-250).

Further preferred embodiments for reducing the endogenous β-hydroxylase activity result analogously to the above-described preferred embodiments of reducing the ε-cyclase activity by replacing the ε-cyclase with endogenous β-hydroxylase.

Genetically modified plants with the following combinations of genetic changes are particularly preferably used in the method according to the invention:

Genetically modified plants that have an increased or caused ketolase activity in petals and an increased hydroxylase activity compared to the wild type,

genetically modified plants that have an increased or caused ketolase activity in petals and an increased ß-cyclase activity compared to the wild type,

genetically modified plants that have an increased or caused ketolase activity in petals and a reduced ε-cyclase activity compared to the wild type,

genetically modified plants which have an increased or caused ketolase activity in petals and an increased hydroxylase activity and an increased ß-cyclase activity compared to the wild type, genetically modified plants which have an increased or caused ketolase activity in petals and an increased hydroxylase activity and a reduced ε-cyclase activity compared to the wild type,

genetically modified plants which, compared to the wild type, have an increased or caused ketolase activity in petals and an increased β-cyclase activity and a reduced ε-cyclase activity, and

genetically modified plants that have an increased or caused ketolase activity in petals and an increased hydroxylase activity and an increased ß-cyclase activity and a reduced ε-cyclase activity compared to the wild type.

genetically modified plants which, compared to the wild type, have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity and an increased ß-cyclase activity,

genetically modified plants that have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity and a reduced endogenous ß-hydroxylase activity compared to the wild type,

genetically modified plants that have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity and an increased hydroxylase activity compared to the wild type,

genetically modified plants which have an increased or caused ketolase activity in petals, an increased β-cyclase activity and an increased hydroxylase activity compared to the wild type,

genetically modified plants which have an increased or caused ketolase activity in petals, an increased ß-cyclase activity and a reduced endogenous ß-hydroxylase activity compared to the wild type,

genetically modified plants that have an increased or caused ketolase activity in petals, a reduced e-cyclase activity and at least one more compared to the wild type increased activity, selected from the group HMG-CoA reductase activity, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, l-deoxy-D-xylose-5-phosphate synthase Activity, l-deoxy-D-xylose-5-phosphate reductoisomerase activity, isopentenyl diphosphate D isomerase activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity, geranyl geranyl -Diphosphate synthase activity, phytoene synthase activity, phytoene desaturase activity, zeta-carotene desaturase activity, crtlSO activity, FtsZ activity and MinD activity.

genetically modified plants which, compared to the wild type, have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity, an increased ß-cyclase activity and an increased hydroxylase activity,

genetically modified plants that have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity, an increased ß-cyclase activity and a reduced endogenous ß-hydroxylase activity compared to the wild type,

genetically modified plants that have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity and a reduced endogenous ß-hydroxylase activity compared to the wild type.

genetically modified plants which, compared to the wild type, have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity, an increased hydroxylase activity and a reduced endogenous ß-hydroxylase activity,

genetically modified plants which, compared to the wild type, have an increased or caused ketolase activity in petals, an increased ß-cyclase activity, an increased hydroxylase Have activity and a reduced endogenous β-hydroxylase activity,

genetically modified plants which, compared to the wild type, have an increased or caused ketolase activity in petals, a reduced e-cyclase activity, an increased b-cyclase activity and at least one further increased activity, selected from the group HMG-CoA reductase -Activity, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, 1-deoxy-D-xylose-5-phosphate synthase activity, l-deoxy-D-xylose-5 -Phosphate-reductoisomerase activity, isopentenyl-diphosphate-D-isomerase activity, geranyl-diphosphate-synthase activity, fernsyl-diphosphate-synthase activity, geranyl-geranyl-diphosphate-synthase activity, phytoene Synthase activity, phytoene desaturase activity, zeta-carotene desaturase activity, crtlSO activity, FtsZ activity and MinD activity.

genetically modified plants that have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity, an increased ß-cyclase activity, an increased hydroxylase activity and a reduced endogenous ß-hydroxylase activity compared to the wild type .

genetically modified plants which, compared to the wild type, have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity, an increased hydroxylase activity and at least one further increased activity, selected from the group HMG-CoA reductase activity , (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, 1-deoxy-D-xylose-5-phosphate synthase activity, l-deoxy-D-xylose-5-phos - phate reductoisomerase activity, isopentenyl diphosphate D-isomerase activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity, geranyl geranyl diphosphate synthase activity, phytoene synthase activity , Phytoen Desatu have rase activity, zeta-carotene desaturase activity, crtlSO activity, FtsZ activity and MinD activity,

genetically modified plants which, compared to the wild type, have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity, a reduced endogenous b-hydroxylase activity and at least one further increased activity, selected from the group HMG-CoA- Reductase activity, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, l-deoxy-D-xylose-5-phosphate synthase activity, 1-deoxy-D-xylose - 5-phosphate reductoisomerase activity, isopentenyl diphosphate D isomerase activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity, geranyl geranyl diphosphate synthase activity, phytoene synthase activity, Have phytoene desaturase activity, zeta-carotene desaturase activity, crtlSO activity, FtsZ activity and MinD activity,

genetically modified plants which, compared to the wild type, have an increased or caused ketolase activity in petals, an increased β-cyclase activity, an increased hydroxylase activity and at least one further increased activity, selected from the group HMG-CoA reductase activity , (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, 1-deoxy-D-xylose-5-phosphate synthase activity, l-deoxy-D-xylose-5-phosphate -Reductoisomerase activity, isopentenyl diphosphate- Δ isomerase activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity, geranyl geranyl diphosphate synthase activity, phytoene synthase activity, phytoene desaturase -Activity, zeta-carotene desaturase activity, crtlSO activity, FtsZ activity and MinD activity,

genetically modified plants that have an increased or caused ketolase activity in petals, an increased ß-cyclase activity, a reduced endogenous ß-hydroxylase activity and at least one other increased compared to the wild type

Activity selected from the group HMG-CoA reductase activity, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, l-deoxy-D-xylose-5-phosphate synthase- Activity, 1-deoxy-D-xylose-5-phosphate reductoisomerase activity, isopentenyl diphosphate D isomerase activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity, geranyl geranyl diphosphate activity Synthase activity, phytoene synthase activity, phytoene desaturase activity, zeta-carotene desaturase activity, crtlSO activity, FtsZ activity and MinD activity, genetically modified plants that have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity, an increased ß-cyclase activity and an increased hydroxylase activity and a reduced ß-hydroxylase activity compared to the wild type exhibit,

genetically modified plants which, compared to the wild type, have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity, an increased ß-cyclase activity, an increased hydroxylase activity and at least one further increased activity, selected from the group Group HMG-CoA reductase activity, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, l-deoxy-D-xylose-5-phosphate synthase activity, l -Deoxy-D-xylose-5-phosphate reductoisomerase activity, isopentenyl diphosphate D isomerase activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity, geranyl geranyl diphosphate synthase -Activity, phytoene synthase activity, phytoene desaturase activity, zeta-carotene desaturase activity, crtlSO activity, FtsZ activity and MinD activity,

genetically modified plants which, compared to the wild type, have an increased or caused ketolase activity in petals, a reduced ε-cyclase activity, an increased ß-cyclase activity, a reduced endogenous ß-hydroxylase activity and at least one further increased activity, selected from the group HMG-CoA reductase activity, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, 1-deoxy-D-xylose-5-phosphate synthase- Activity, l-deoxy-D-xylose-5-phosphate reductoisomerase activity, isopentenyl diphosphate D isomerase activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity! Geranyl-geranyl-diphosphate synthase activity, phytoene synthase activity, phytoene desaturase activity, zeta-carotene desaturase activity, crtlSO activity, FtsZ activity and MinD activity.

Particularly preferred, genetically modified plants have, compared to the wild type, an increased or caused ketolase activity in petals, an increased β-cyclase activity and an increased hydroxylase activity, wherein

the increased ketolase activity is caused by introducing nucleic acids encoding a protein containing the amino acid sequence SEQ ID NO: 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which have an identity of at least 20% Amino acid- plane with the sequence SEQ ID NO: 2 and has the enzymatic property of a ketolase,

the increased ß-cyclase activity is caused by introducing nucleic acid encoding a ß-cyclase, containing the amino acid sequence SEQ ID NO: 96 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of has at least 20% at the amino acid level with the sequence SEQ ID NO: 20

and the increased hydroxylase activity is caused by introducing nucleic acids encoding a hydroxylase containing the amino acid sequence SEQ ID NO: 98 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which have an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 18.

Particularly preferred, genetically modified plants have, compared to the wild type, an increased or caused ketolase activity in petals, a reduced ε-cyclase activity, an increased ß-cyclase activity, an increased hydroxylase activity and a reduced endogenous ß-hydroxylase -Activity on where

the increased ketolase activity is caused by introducing nucleic acids encoding a protein containing the amino acid sequence SEQ ID NO: 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which have an identity of at least 20% Amino acid level with the sequence SEQ ID NO: 2 and has the enzymatic property of a ketolase,

the increased ß-cyclase activity is caused by introducing nucleic acid encoding a ß-cyclase, containing the amino acid sequence SEQ ID NO: 96 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of has at least 20% at the amino acid level with the sequence SEQ ID NO: 20,

the increased hydroxylase activity is caused by introducing nucleic acids encoding a hydroxylase containing the amino acid sequence SEQ ID NO: 98 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 20 % at the amino acid level with the sequence SEQ ID NO: 18, and the reduced ε-cyclase activity and a reduced endo- gene β-hydroxylase activity according to the preferred embodiments described above.

These genetically modified plants can be produced, as described below, for example by introducing individual nucleic acid constructs (expression cassettes) or by introducing multiple constructs which contain up to two, three or four of the activities described.

In the process according to the invention for producing ketocarotenoids, the cultivation step of the genetically modified plants, hereinafter also referred to as transgenic plants, is preferably followed by harvesting the plants and isolating ketocarotenoids from the petals of the plants.

15

The transgenic plants are grown on nutrient media in a manner known per se and harvested accordingly.

The isolation of ketocarotenoids from the harvested blossom ² 0 scroll is carried out in manner known per se, for example by drying and subsequent extraction and gegebenenf lls further chemical or physical purification processes such as, for example, precipitation methods, crystallography, thermal separation methods such as rectification methods or physical 25 separation method, such as chromatography. Ketocarotenoids are isolated from the petals, for example, preferably using organic solvents such as acetone, hexane, ether or tert. Methyl butyl ether.

30 Further isolation processes for ketocarotenoids, in particular from petals, are described, for example, in Egger and Kleinig (Phytochemistry (1967) 6, 437-440) and Egger (Phytochemistry (1965) 4, 609-618).

The ketocarotenoids are preferably selected from the group consisting of astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3'-hydroxyechinenone, adonirubin and adonixanthin.

A particularly preferred ketocarotenoid is astaxanthin. 40

In the process according to the invention, the ketocarotenoids are obtained in petals in the form of their mono- or diesters with fatty acids. Some detected fatty acids are, for example, myristic acid, palmitic acid, stearic acid, oleic acid, linolenic acid and lauric acid (Kamata and Simpson (1987) Co p. Biochem. Physiol. Vol. 86B (3), 587-591). In the following, the production of genetically modified plants with increased or caused ketolase activity in flower petals is described as an example. The increase in further activities, such as, for example, the hydroxylase activity and / or the β-cyclase activity and / or the HMG-CoA reductase activity and / or the (E) -4-hydroxy-3-methylbut-2 -enyl-diphosphate reductase activity and / or the l-deoxy-D-xylose-5-phosphate synthase activity and / or the l-deoxy-D-xylose-5-phosphate reductoisomerase activity and / or the isopentenyl diphosphate Δ isomerase activity and / or the granyl diphosphate synthase activity and / or the farnesyl diphosphate synthase activity and / or the geranyl geranyl diphosphate synthase activity and / or the phytoene synthase activity and / or the phytoene desaturase activity and / or the zeta-carotene desaturase activity and / or the crtlSO activity and / or the FtsZ activity and / or the MinD activity can be analogous using nucleic acid sequences encoding a hydroxylase or β-cyclase or nucleic acids encoding an HMG-CoA reductase and / or nucleic acids k encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or nucleic acids encoding an l-deoxy-D-xylose-5-phosphate synthase and / or nucleic acids encoding an l-deoxy D-xylose-5-phosphate reductoisomerase and / or nucleic acids encoding an isopentenyl diphosphate Δ isomerase and / or nucleic acids encoding a geranyl diphosphate synthase and / or nucleic acids encoding a farnesyl diphosphate synthase and / or nucleic acids encoding a geranyl-geranyl diphosphate synthase and / or nucleic acids encoding a phytoene synthase and / or nucleic acids encoding a phytoene desaturase and / or nucleic acids encoding a zeta-carotene desaturase and / or nucleic acids encoding a crtlso protein and / or nucleic acids encoding an FtsZ protein and / or nucleic acids encoding a MinD protein instead of nucleic acid sequences encoding a ketolase. The reduction of further activities, such as, for example, the reduction of the ε-cyclase activity or the endogenous β-hydroxylase activity, can be carried out analogously using anti-ε-cyclase nucleic acid sequences or ε-cyclase-inverted repeat nucleic acid sequence or using anti-endogenous ß-hydroxylase nucleic acid sequences or endogenous ß-hydroxylase inverted repeat nucleic acid sequences instead of nucleic acid sequences encoding a ketolase. In the combination of genetic changes, the transformation can take place individually or through multiple constructs.

The transgenic plants are preferably produced by transforming the starting plants, using a nucleic acid construct which contains the above-described nucleic acids encoding a ketolase, which comprises one or more Regulation signals are functionally linked, which ensure transcription and translation in plants.

These nucleic acid constructs, in which the coding nucleic acid sequence is functionally linked to one or more regulatory signals which ensure transcription and translation in plants, are also called expression cassettes below.

The invention further relates to nucleic acid constructs containing at least one nucleic acid encoding a ketolase and additionally at least one further nucleic acid selected from the group a) nucleic acids encoding a β-cyclase, b) nucleic acids encoding a β-hydroxylase, c) nucleic acids encoding an HMG-CoA Reductase, d) nucleic acids encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase e) nucleic acids encoding an l-deoxy-D-xylose-5-phosphate synthase, f) nucleic acids encoding a 1-deoxy-D-xylose

5-phosphate reductoisomerase, g) nucleic acids encoding an isopentenyl diphosphate Δ isomerase, h) nucleic acids encoding a geranyl diphosphate synthase, i) nucleic acids encoding a farnesyl diphosphate synthase, j) nucleic acids encoding a geranyl geranyl diphosphate

Synthase, k) nucleic acids encoding a phytoene synthase, 1) nucleic acids encoding a phytoene desaturase, m) nucleic acids encoding a zeta-carotene desaturase, n) nucleic acids encoding a crtlSO protein, o) nucleic acids encoding an FtsZ protein, p) nucleic acids encoding a MinD protein, q) double-stranded endogenous ß-hydroxylase ribonucleic acid sequence and / or endogenous ß-hydroxylase antisense-ribonucleic acid sequences and r) double-stranded ε-cyclase-ribonucleic acid sequence and / or ε-cyclase antisense-ribonucleic acid sequence, where the are functionally linked to one or more regulatory signals which ensure transcription and translation in plants.

It is technically difficult to implement, especially in plants, to increase or decrease more than four activities with a nucleic acid construct. Combinations of nucleic acid constructs are therefore preferably used in order to activate in particular to increase or decrease more than 4 activities in the organism.

However, it is also possible to cross genetically modified organisms that already contain modified activities. For example, by crossing genetically modified organisms that each contain two modified activities, it is possible to produce organisms with four modified activities. The same can also be achieved by introducing a combination of two nucleic acid constructs that change 2 activities into the organism.

In a preferred embodiment, the preferred genetically modified organisms are produced by introducing combinations of nucleic acid constructs.

Preferred nucleic acid constructs according to the invention contain the following combinations of nucleic acids functionally linked to one or more regulation signals which ensure transcription and translation in plants:

Ketolase + epsilon

Ketolase + beta

Ketolase + hydro (OEX) ketolase + epsilon + beta

Ketolase + epsilon + hydro (RNAi)

Ketolase + epsilon + hydro (OEX)

Ketolase + beta + hydro (RNAi)

Ketolase + beta + hydro (OEX) Ketolase + epsilon + (xxx)

Ketolase + epsilon + beta + hydro (OEX)

Ketolase + epsilon + beta + hydro (RNAi)

Ketolase + epsilon + beta

Ketolase + epsilon + hydro (OEX) Ketolase + epsilon + hydro (RNAi)

Ketolase + epsilon + hydro (OEX) + hydro (RNAi)

Ketolase + beta + hydro (OEX) + hydro (RNAi)

Ketolase epsilon + beta + (xxx)

Ketolase + epsilon + beta + hydro (OEX) + hydro (RNAi) Ketolase + epsilon + beta + hydro (OEX)

Ketolase + epsilon + beta + hydro (RNAi)

Ketolase + epsilon + hydro (RNAi) + (xxx)

Ketolase + epsilon + hydro (OEX) + (xxx)

Ketolase + beta + hydro (RNAi) + (xxx) Ketolase + beta + hydro (OEX) + (xxx)

Ketolase + epsilon + beta + hydro (OEX) + hydro (RNAi)

Ketolase + epsilon + beta + hydro (OEX) + (xxx) Ketolase + epsilon + beta + hydro (RNAi) + (xxx),

the abbreviations have the following meaning:

Ketolase: nucleic acids encoding a ketolase beta: nucleic acids encoding a β-cyclase hxdro (OEX): expression of nucleic acids encoding a β-hydroxylase hydro (RNAi): double-stranded endogenous β-hydroxylase ribonucleic acid sequence and / or endogenous β-hydroxylase antisense sequence epsilon: double-stranded ε-cyclase ribonucleic acid sequence and / or ε-cyclase antisense ribonucleic acid sequence (xxx): at least one nucleic acid selected from the group

Nucleic acids encoding an HMG-CoA reductase, nucleic acids encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase, nucleic acids encoding an l-deoxy-D-xylose-5-phosphate synthase, nucleic acids encoding a 1-deoxy

D-xylose-5-phosphate reductoisomerase, nucleic acids encoding an isopentenyl diphosphate Δ isomerase, nucleic acids encoding a geranyl diphosphate synthase, nucleic acids encoding a farnesyl diphosphate synthase, nucleic acids encoding a geranyl geranyl synthase diphosphate Nucleic acids encoding a phytoene synthase, nucleic acids encoding a phytoene desaturase, nucleic acids encoding a zeta-carotene desaturase, nucleic acids encoding a crtlSO

Protein encoding an FtsZ protein and nucleic acids encoding a MinD protein.

The regulation signals preferably contain one or more promoters which ensure transcription and translation in plants.

The expression cassettes contain regulatory signals, that is to say regulatory nucleic acid sequences which control the expression of the coding sequence in the host cell. According to a preferred embodiment, an expression cassette comprises upstream, ie at the 5 'end of the coding sequence, a promoter and downstream, ie at the 3' end, a polyadenylation signal and optionally further regulatory elements which match the coding sequence for at least one of the above genes described are operatively linked. An operational link is understood to mean the sequential arrangement tion of promoter, coding sequence, terminator and possibly other regulatory elements such that each of the regulatory elements can perform its function as intended in the expression of the coding sequence. 5

The preferred nucleic acid constructs, expression cassettes and vectors for plants and methods for producing transgenic plants and the transgenic plants themselves are described below by way of example.

10

The sequences preferred but not limited to the operative linkage are targeting sequences to ensure subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochondrion, in the endoplasmic reticulum (ER),

15 in the cell nucleus, in oil corpuscles or other compartments and

Translation enhancers such as the 5 'guiding sequence from the tobacco mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711).

In principle, any promoter that can control the expression of foreign genes in plants is suitable as promoters of the expression cassette.

“Constitutive” promoter means those promoters which ensure expression in numerous, preferably all, tissues over a relatively long period of plant development, preferably at all times during plant development.

A plant promoter or a promoter derived from a plant virus is preferably used in particular. Particularly preferred is the promoter of the 35S transcript of the CaMV cauliflower mosaic virus (Franck et al. (1980) Cell 21: 285-294; Odell et al. (1985) Nature 313: 810-812; Shewmaker et al. (1985) Virology 140 : 281-288; Gardner et al. (1986) Plant Mol Biol 35 6: 221-228) or the 19S CaMV promoter (US 5,352,605; WO 84/02913; Benfey et al. (1989) EMBO J 8: 2195-2202 ).

Another suitable constitutive promoter is the pds promoter (Pecker et al. (1992) Proc. Natl. Acad. Be USA 89:

40 4962-4966) or the "Rubisco small subunit (SSU)" promoter

(US 4,962,028), the LeguminB promoter (GenBank Acc. No. X03677), the promoter of nopaline synthase from Agrobacterium, the TR double promoter, the OCS (octopine synthase) promoter from Agrobacterium, the ubiquitin promoter (Holtorf S et al. (1995) Plant

45 mol Biol 29: 637-649), the ubiquitin 1 promoter (Christensen et al. (1992) Plant Mol Biol 18: 675-689; Bruce et al. (1989) Proc Natl Acad Sei USA 86: 9692-9696), the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (US 5,683,439), the promoters of the vacuolar ATPase subunits or the promoter of a proline-rich protein from wheat (WO 91/13991), the Pnit promoter (Y07648.L, Hillebrand et al. (1998), Plant. Mol. Biol. 36, 89-99, Hillebrand et al. (1996), Gene, 170, 197-200, the ferredoxin NADPH oxidoreductase promoter (database entry AB011474, positions 70127 to 69493), the TPT promoter (WO 03006660 ), the "super promoter" (US patent 5955646), the 34S promoter (US patent 6051753) and further promoters of genes whose constitutive expression in plants is known to the person skilled in the art.

The expression cassettes can also contain a chemically inducible promoter (review article: Gatz et al. (1997) Annu Rev Plant Physiol Plant Mol Biol 48: 89-108), by which the expression of the ketolase gene in the plant at a certain point in time can be controlled. Such promoters, e.g. the PRP1 promoter (Ward et al. (1993) Plant Mol Biol 22: 361-366), a salicylic acid-inducible promoter (WO 95/19443), a benzenesulfonamide-inducible promoter (EP 0 388 186), a tetracycline-inducible promoter Promoter (Gatz et al. (1992) Plant J 2: 397-404), a promoter inducible by abscisic acid (EP 0 335 528) or a promoter inducible by ethanol or cyclohexanone (WO 93/21334) can also be used be used.

Also preferred are promoters that are induced by biotic or abiotic stress, such as the pathogen-inducible promoter of the PRPL gene (Ward et al. (1993) Plant Mol Biol 22: 361-366), the heat-inducible hsp70 or hsp80 promoter from tomato (US 5,187,267), the cold-inducible alpha-amylase promoter from the potato (WO 96/12814), the light-inducible PPDK promoter or the wound-induced pinII promoter (EP375091).

Pathogen-inducible promoters include those of genes induced by pathogen attack such as genes from PR proteins, SAR proteins, b-1, 3-glucanase, chitinase etc. (e.g. Redolfi et al. (1983) Neth J Plant Pathol 89: 245-254; Uknes, et al. (1992) The Plant Cell 4: 645-656; Van Loon (1985) Plant Mol Viral 4: 111-116; Marineau et al. (1987) Plant Mol Biol 9: 335-342; Matton et al. (1987) Molecular Plant-Microbe Interactions 2: 325-342; Somssich et al. (1986) Proc Natl Acad Sei USA 83: 2427-2430; Somssich et al. (1988) Mol Gen Genetics 2: 93-98; Chen et al. (1996) Plant J 10: 955-966; Zhang and Sing (1994) Proc Natl Acad Sei USA 91: 2507-2511; Warner, et al. (1993) Plant J 3: 191-201; Siebertz et al. (1989) Plant Cell 1: 961-968 (1989).

Also included are wound-inducible promoters such as that of the pinll gene (Ryan (1990) Ann Rev Phytopath 28: 425-449; Duan et al. (1996) Nat Biotech 14: 494-498), the wunl and wun2 gene (US 5,428,148), the winl and win2 genes (Stanford et al. (1989) Mol Gen Genet 215: 200-208), the systemin (McGurl et al. (1992) Science 225: 1570-1573), the WIPl gene (Rohmeier et al. (1993) Plant Mol Biol 22: 783-792; Ekelkamp et al. (1993) FEBS Letters 323: 73-76), the MPI gene (Corderok et al. (1994) The Plant J 6 ( 2): 141-150) and the like.

Further suitable promoters are, for example, fruit-ripening-specific promoters, such as the fruit-ripening-specific promoter from tomato (WO 94/21794, EP 409 625). Development-dependent promoters partly include the tissue-specific promoters, since the formation of individual tissues is naturally development-dependent.

Furthermore, promoters are particularly preferred which ensure expression in tissues or parts of plants in which, for example, the biosynthesis of ketocarotenoids or their precursors takes place. For example, promoters with specificities for the anthers, ovaries, petals, sepals, flowers, leaves, stems and roots and combinations thereof are preferred.

Tuber-, storage root- or root-specific promoters are, for example, the patatin class I promoter (B33) or the potato cathepsin D inhibitor promoter.

Leaf-specific promoters are, for example, the promoter of the cytosolic FBPase from potato (WO 97/05900), the SSU promoter (small subunit) of Rubisco (ribulose-1, 5-bisphosphate carboxylase) or the ST-LSI promoter from potato (Stockhaus et al (1989) EMBO J 8: 2445-2451).

Flower-specific promoters are, for example, the phytoene synthase promoter (WO 92/16635), the promoter of the P-rr gene (WO 98/22593), the EPSPS promoter (database entry M37029), the DFR-A promoter (database entry X79723), the B Gene promoter (WO 0008920) and the CHRC promoter (WO 98/24300; Vishnevetsky et al. (1996) Plant J. 10, 1111-1118) and the promoters of the Arabidopsis gene loci At5g33370 (as a result of MI promoter), At5g22430 (as a result of M2 promoter) and Atlg26630 (as a result of M3 promoter). Anther-specific promoters are, for example, the 5126 promoter (US 5,689,049, US 5,689,051), the glob-1 promoter or the g-zein promoter.

Further promoters suitable for expression in plants are described in Rogers et al. (1987) Methods in Enzymol 153: 253-277; Schardl et al. (1987) Gene 61: 1-11 and Berger et al. (1989) Proc Natl Acad Sei USA 86: 8402-8406).

All promoters described in the present application generally enable expression of the ketolase in petals of the plants according to the invention.

In the process according to the invention, particular preference is given to constitutive, flower-specific and in particular flower-leaf-specific promoters.

The present invention therefore relates in particular to a nucleic acid construct comprising functionally linked a flower-specific or in particular a petal-specific promoter and a nucleic acid encoding a ketolase.

An expression cassette is preferably produced by fusing a suitable promoter with a nucleic acid described above encoding a ketolase and preferably a nucleic acid inserted between promoter and nucleic acid sequence, which codes for a plastid-specific transit peptide, and a polyadenylation signal according to common recombination and cloning techniques, as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in T.J. Silhavy, M.L. Berman and L.W. Inquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F.M. et al. , Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).

The preferably inserted nucleic acids encoding a plastic transit peptide ensure localization in plastids and in particular in chromoplasts.

Expression cassettes, the nucleic acid sequence of which codes for a ketolase fusion protein, can also be used, part of the fusion protein being a transit peptide which controls the translocation of the polypeptide. Transit peptides specific for the chromoplasts are preferred which, according to transit location of the ketolase in the chromoplasts from the ketolase part can be cleaved enzymatically.

The transit peptide which is derived from the plastic Nicotiana tabacum Transketolase or another transit peptide (for example the transit peptide of the small subunit of rubisco (rbcS) or the ferredoxin NADP oxidoreductase and also the isopentenyl pyrophosphate isomerase-2) or its functional equivalent is particularly preferred is derived.

Nucleic acid sequences of three cassettes of the plastid transit peptide of plastid transketolase from tobacco in three reading frames are particularly preferred as Kpnl / BamHI fragments with an ATG codon in the Ncol interface:

pTP09

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGA TCC_BamHI

pTPlO

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGCTG GATCC_BamHI

pTPll

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGG ATCC_BamHI

Further examples of a plastid transit peptide are the transit peptide of the plastid isopentenyl pyrophosphate isomerase-2 (IPP-2) from Arabisopsis thaliana and the transit peptide of the small subunit of ribulose bisphosphate carboxylase (rbcS) from pea (Guerineau, F, Woolston, S Brooks, L, Mullineaux, P (1988) An expression cassette for targeting foreign proteins into the chloroplasts. Nucl. Acids Res. 16: 11380). The nucleic acids according to the invention can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural nucleic acid constituents, and can consist of different heterologous gene segments from different organisms.

As described above, preference is given to synthetic nucleotide sequences with codons which are preferred by plants. These plant-preferred codons can be determined from the highest protein frequency codons expressed in most interesting plant species.

When preparing an expression cassette, various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame. To connect the DNA fragments to one another, adapters or linkers can be attached to the fragments.

The promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction sites for the insertion of this sequence. As a rule, the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. In general, the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges. The promoter can be native or homologous as well as foreign or heterologous to the host plant. The expression cassette preferably contains in the 5 '-3' transcription direction the promoter, a coding nucleic acid sequence or a nucleic acid construct and a region for the transcriptional termination. Different termination areas are interchangeable.

Examples of a terminator are the 35S terminator (Guerineau et al. (1988) Nucl Acids Res. 16: 11380), the nos terminator (Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM. Nopeline synthase: transcript mapping and DNA sequence. J Mol Appl Genet. 1982; 1 (6): 561-73) or the ocs terminator (Gielen, J, de Beuckeleer, M, Seurinck, J, Debroek, H, de Greve, H, Lemmers , M, van Montagu, M, Schell, J (1984) The complete sequence of the TL-DNA of the Agrobacterium tumefaciens plasmid pTiAch5. EMBO J. 3: 835-846).

Manipulations which provide suitable restriction sites or which remove superfluous DNA or restriction sites can also be used. Where insertions, Deletions or substitutions such as, for example, transitions and transversions, can be used in vi-mutagenesis, "primer repair", restriction or ligation.

With suitable manipulations, e.g. Restriction, "chewing-back" or filling of overhangs for "bluntends", complementary ends of the fragments can be made available for the ligation.

Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) of the Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 ( 1984), 835 ff) or functional equivalents.

The transfer of foreign genes into the genome of a plant is called transformation.

Methods known per se for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation can be used for this purpose.

Suitable methods for the transformation of plants are protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene cannon - the so-called particle bombardment method, electroporation, the incubation of dry embryos in DNA-containing solution, microinjection and the Agrobacterium -mediated gene transfer described above. The methods mentioned are described, for example, in B. Jenes et al. , Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S.D. Kung and R. Wu, Academic Press (1993), 128-143 and in Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225).

The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711) or particularly preferably pSUN2, pSUN3, pSUN4 or pSUN5 (WO 02/00900).

Agrobacteria transformed with an expression plasmid can be used in a known manner for the transformation of plants, for example by placing wounded leaves or leaf pieces in one Agrobacteria solution are bathed and then cultivated in suitable media.

For the preferred production of genetically modified plants, 5 also referred to below as transgenic plants, the fused expression cassette, which expresses a ketolase, is cloned into a vector, for example pBinl9 or in particular pSUN2, which is suitable for being transformed into Λgrro-acterium tumefaciens with such a vector transformed Agrobak

10 teries can then be used in a known manner to transform

Plants, in particular cultivated plants, are used, for example, by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

15

The transformation of plants by agrobacteria is known, among other things, from F.F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S.D. Kung and R. Wu, Academic Press,

20 1993, pp. 15-38. In a known manner, transgenic plants can be regenerated from the transformed cells of the wounded leaves or leaf pieces, which plants contain a gene encoding the expression cassette for the expression of a nucleic acid encoding a ketolase.

25

To transform a host plant with a nucleic acid coding for a ketolase, an expression cassette is inserted as an insert into a recombinant vector whose vector DNA contains additional functional regulation signals, for example Se-

Contains 30 sequences for replication or integration. Suitable vectors are inter alia in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, pp. 71-119 (1993).

35 Using the recombination and

Cloning techniques can be used to clone the expression cassettes into suitable vectors which enable them to multiply, for example in E. coli. Suitable cloning vectors include PJIT117 (Guerineau et al. (1988) Nucl. Acids Res. 16: 11380),

40 pBR332, pUC series, M13mp series and pACYCl84. Binary vectors which can replicate both in E. coli and in agrobacteria are particularly suitable.

Depending on the choice of promoter, the expression can be constitutive 45 or preferably specific in the petals. Accordingly, the invention further relates to a method for producing genetically modified plants, characterized in that a nucleic acid construct containing functionally linked, a flower-specific promoter and nucleic acids encoding a ketolase is introduced into the genome of the starting plant.

The invention further relates to the genetically modified plants, the genetic modification being the activity of a ketolase in petals,

A in the event that the wild type plant already has ketolase activity in petals, is increased compared to the wild type and

B in the event that the wild type plant has no ketolase activity in petals, compared to the wild type.

As stated above, the ketolase activity is increased or caused compared to the wild type, preferably by increasing or causing the gene expression of a nucleic acid encoding a ketolase.

In a further preferred embodiment, as stated above, the gene expression of a nucleic acid encoding a ketolase is increased or caused by introducing nucleic acids encoding a ketolase into the plants and thus preferably by overexpression or transgenic expression of nucleic acids encoding a ketolase.

Preferred transgenic plants which, as a wild type, have no ketola activity in the petals contain, as mentioned above, at least one transgenic nucleic acid encoding a ketolase.

Particularly preferred, genetically modified plants, as mentioned above, additionally have an increased hydroxlase activity and / or β-cyclase activity compared to a wild type plant. Further preferred embodiments are described above in the method according to the invention.

Further preferred, genetically modified plants, as mentioned above, additionally have a reduced ε-cyclase activity compared to a wild type plant. Further preferred embodiments are described above in the method according to the invention. As mentioned above, further particularly preferred genetically modified plants additionally have at least one further increased activity compared to the wild type, selected from the group HMG-CoA reductase activity, (E) -4-hydroxy-3-methylbut-2-enyl -Diphosphate reductase activity, l-deoxy-D-xylose-5-phosphate synthase activity, l-deoxy-D-xylose-5-phosphate reductoisomerase activity, isopentenyl-diphosphate-Δ-isomerase Activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity, geranyl geranyl diphosphate synthase activity, phytoene synthase activity, phytoene desaturase activity,

Zeta-carotene desaturase activity, crtlSO activity, FtsZ activity and MinD activity. Further preferred embodiments are described above in the method according to the invention.

Further particularly preferred, genetically modified plants, as mentioned above, additionally have a reduced endogenous β-hydroxylase activity compared to the wild type. Further preferred embodiments are described above in the method according to the invention.

According to the invention, plants are preferably understood to mean plants which have chromoplasts as the wild type in petals. Further preferred plants have, as wild type, carotenoids, in particular β-carotene, zeaxanthin, violaxanthin or lutein, in the petals. As a wild type, further preferred plants additionally have a β-cyclase activity in the petals. Further preferred plants have a hydroxylase activity in the petals as a wild type.

Plants selected from the Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Brassicaceae, Cucurbita- ceae, Primulaceae, Caryophyllaceae, Amaranthaceae, Geraniaceae, Gentianaceae , Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Orchidaceae, Malvaceae, liliaceae or Lamiaceae.

The invention therefore relates in particular to genetically modified plants selected from the families Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Brassiceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Amaranthaceae, Gerifoleaaceaea, Gerianceaeaea, Gerianceaeae, Gentianeaeaeae, Gentianaceae Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Orchidaceae, Malvaceae, Illiaceaae, or Lamiaceae, containing at least one transgenic nucleic acid encoding a ketolase.

Very particularly preferred genetically modified plants are selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Adonis, Lycopersicon, Rosa, Calenduia, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium or Tropaeolum, whereby the genetically modified plant contains at least one transgenic nucleic acid encoding a ketolase.

As mentioned above, in preferred transgenic plants the ketolase is expressed in petals, particularly preferably the expression of the ketolase is highest in petals.

The present invention further relates to the transgenic plants, their reproductive material and their plant cells, tissue or parts, in particular their petals.

As described above, the genetically modified plants can be used to produce ketocarotenoids, in particular astaxanthin.

Genetically modified plants according to the invention with an increased content of ketocarotenoids which can be consumed by humans and animals can also be used, for example, directly or after processing known per se as food or feed or as feed and food supplements. Furthermore, the genetically modified plants can be used for the production of extracts of the plants containing ketocarotenoid and / or for the production of feed and food supplements.

The genetically modified plants can also be used as ornamental plants in the horticulture area.

The genetically modified plants have an increased ketocarotenoid content compared to the wild type.

An increased ketocarotenoid content is generally understood to mean an increased total ketocarotenoid content.

An increased content of ketocarotenoids is also understood to mean, in particular, an altered content of the preferred ketocarotenoids, without the total carotenoid content necessarily having to be increased. In a particularly preferred embodiment, the genetically modified plants according to the invention have an increased astaxanthin content compared to the wild type.

5 In this case, an increased content is also understood to mean a caused content of ketocarotenoids or astaxanthin.

The invention is illustrated by the following examples, but is not limited to these: 10

General experimental conditions: Sequence analysis of recombinant DNA

The sequencing of recombinant DNA molecules was carried out with a laser fluorescence DNA sequencer from Licor (sold by MWG Biotech, Ebersbach) according to the method of Sanger (Sanger et al., Proc. Natl. Acad. Sci. USA 74 (1977) , 5463-5467).

Example 1: 20 Amplification of a cDNA which contains the entire primary sequence of the ketolase from Haematococcus pluvialis Flotow em. Will encodes

The cDNA which codes for the ketolase from Haematococcus pluvialis was amplified by means of PCR from Haematococcus pluvialis (strain 25 192.80 from the "Collection of algal cultures of the University of Göttingen") suspension culture.

For the preparation of total RNA from a suspension culture of Haematococcus pluvialis (strain 192.80), which was used for 2 weeks with indirect

30 daylight at room temperature in iϊaematococcus medium

(1.2 g / l sodium acetate, 2 g / l yeast extract, 0.2 g / l MgC12x6H20, 0.02 CaC12x2H20; pH 6.8; after autoclaving adding 400 mg / l L-asparagine, 10 mg / l FeS04xH20), the cells were harvested , frozen in liquid nitrogen and powdered in a mortar

35 verified. Then 100 mg of the frozen, pulverized algae cells were transferred to a reaction vessel and taken up in 0.8 ml of Trizol buffer (LifeTechnologies). The suspension was extracted with 0.2 ml chloroform. After centrifugation at 12,000 g for 15 minutes, the aqueous supernatant was removed

40 and transferred to a new reaction vessel and extracted with a volume of ethanol. The RNA was precipitated with a volume of isopropanol, washed with 75% ethanol and the pellet dissolved in DEPC water (overnight incubation of water with 1/1000 volume of diethyl pyrocarbonate at room temperature, then autoclaved).

45 The RNA concentration was determined photometrically. For the cDNA synthesis, 2.5 μg of total RNA were denatured for 10 min at 60 ° C., cooled on ice for 2 min and using a cDNA kit (ready-to-go-you-prime beads, Pharmacia Biotech) according to the manufacturer's instructions rewritten into cDNA using an antisense specific primer (PRI SEQ ID NO: 29).

The nucleic acid encoding a kematolase from Haematococcus pluvialis (strain 192.80) was determined by means of a polymerase chain reaction (PCR) from Haematococcus pluvialis using a sense-specific primer (PR2 SEQ ID NO: 30) and an antisense-specific primer (PRI SEQ ID NO: 29) amplified.

The PCR conditions were as follows:

The PCR for the amplification of the cDNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture which contained:

4 μl of a Haematococcus pluvialis cDNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 mM PRI (SEQ ID NO: 29)

- 0.2 mM PR2 (SEQ ID NO: 30)

- 5 μl 10X PCR buffer (TAKARA) - 0.25 μl R Taq polymerase (TAKARA)

- 25.8 μl Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

53 ° C for 2 minutes

72 ° C for 3 minutes

IX 72 ° C 10 minutes

The PCR amplification with SEQ ID NO: 29 and SEQ ID NO: 30 resulted in an 1155 bp fragment which codes for a protein consisting of the entire primary sequence (SEQ ID NO: 22). The amplificate was cloned into the PCR cloning vector pGEM-Teasy (Promega) using standard methods and the clone PGKET02 was obtained.

Sequencing of the clone pGKET02 with the T7 and the SP6 primer confirmed a sequence which differs from the published sequence X86782 only in the three codons 73, 114 and 119 in one base each. These nucleotide changes were reproduced and represented in an independent amplification experiment. the nucleotide sequence in the Haematococcus pluvialis strain 192.80 used (Figures 3 and 4, sequence comparisons).

This clone was therefore used for the cloning into the expression vector pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380). The cloning was carried out by isolating the 1027 bp SpHI fragment from pGEM-Teasy and ligation into the SpHI-cut vector pJITH7. The clone that contains the Haematococcus pluvialis ketolase in the correct orientation as an N-terminal translational fusion with the rbcs transit peptide is called PJKET02.

Example 2:

Amplification of a cDNA which contains the ketolase from Haematococcus pluvialis Flotow em. Will encoded with an N-terminus shortened by 14 amino acids

The cDNA, which codes for the ketolase from Haematococcus pluvialis (strain 192.80) with an N-terminus shortened by 14 amino acids, was amplified by means of PCR from Haematococcus pluvialis suspension culture (strain 192.80 from the "Collection of algal cultures of the University of Göttingen").

Total RNA was prepared from a suspension culture of Haematococcus pluvialis (strain 192.80) as described in Example 1.

The cDNA synthesis was carried out as described in Example 1.

The nucleic acid encoding a ketolase from Haematococcus pluvialis (strain 192.80) with an N-terminus shortened by 14 amino acids was determined by polymerase chain reaction (PCR) from Haematococcus pluvialis using a sense-specific primer (PR3 SEQ ID NO: 31) and an antisense-specific Primers (PRI SEQ ID NO: 29) amplified.

The PCR conditions were as follows:

The PCR for the amplification of the cDNA, which codes for a ketolase protein with an N-terminus shortened by 14 amino acids, was carried out in a 50 μl reaction mixture which contained:

- 4 ul of a Haematococcus pluvialis cDNA (prepared as described above) - 0.25 mM dNTPs

0.2 mM PRI (SEQ ID NO: 29) 0.2 mM PR3 (SEQ ID NO: 31) 5 μl 10X PCR buffer (TAKARA) 0.25 μl R Taq Polymerase (TAKARA) 25.8 μl Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

53 ° C for 2 minutes

72 ° C for 3 minutes

IX 72 ° C 10 minutes

PCR amplification with SEQ ID NO: 29 and SEQ ID NO: 31 resulted in an 1111 bp fragment coding for a ketolase protein in which the N-terminal amino acids (position 2-16) were replaced by a single amino acid (leucine) are.

The amplificate was cloned into the PCR cloning vector pGEM-Teasy (Promega) using standard methods. Sequencing with primers T7 and SP6 confirmed a sequence identical to the sequence SEQ ID NO: 22, the 5 'region (position 1-53) of SEQ ID NO: 22 in the amplificate SEQ ID NO: 24 by an in the sequence differing nonamer sequence was replaced. This clone was therefore used for the cloning into the expression vector pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380).

The cloning was carried out by isolating the 985 bp SpHI fragment from pGEM-Teasy and ligation with the SpHI-cut vector pJIT117. The clone that contains the Haematococcus pluvialis ketolase with an N-terminus shortened by 14 amino acids in the correct orientation as an N-terminal translational fusion with the rbcs transit peptide is called pJKET03.

Example 3:

Amplification of a cDNA which contains the ketolase from Haematococcus pluvialis Flotow em. Wille (strain 192.80 of the "Collection of algal cultures of the University of Göttingen") consisting of the entire primary sequence and fused C-terminal myc tag.

The cDNA coding for the ketolase from Haematococcus pluvialis (strain 192.80) consisting of the entire primary sequence and fused C-terminal myc tag was PCR-analyzed using the plasmid pGKET02 (described in Example 1) and the primer PR15 (SEQ ID NO: 32). The PR15 primer is composed of an antisense-specific 3 ^λ region (nucleotides 40 to 59) and a 5 'region coding for myc-tag (nucleotides 1 to 39).

The denaturation (5 min at 95 ° C) and annealing (slow cooling at room temperature to 40 ° C) of pGKET02 and PR15 was carried out in an 11.5 μl reaction mixture, which contained:

- 1 µg pGKET02 plasmid DNA

- 0.1 μg PR15 (SEQ ID NO: 32)

The 3 'ends were filled in (30 min at 30 ° C.) in a 20 μl reaction mixture which contained:

- 11.5 μl pGKET02 / PRl5 annealing reaction (prepared as described above)

- 50 µM dNTPs

- 2 ul IX Klenow buffer

- 2U Klenow enzyme

The nucleic acid encoding a ketolase from Haematococcus pluvialis (strain 192.80) consisting of the entire primary sequence and fused C-terminal myc tag was determined using a polymerase chain reaction (PCR) from Haematococcus pluvialis using a sense-specific primer (PR2 SEQ ID NO: 30) and an antisense specific primer (PR15 SEQ ID NO: 32).

The PCR conditions were as follows:

The PCR for the amplification of the cDNA, which codes for a ketolase protein with a fused C-terminal myc tag, was carried out in a 50 μl reaction mixture which contained:

- 1 μl of an annealing reaction (prepared as described above)

- 0.25 mM dNTPs - 0.2 mM PR15 (SEQ ID NO: 32)

- 0.2 mM PR2 (SEQ ID NO: 30)

- 5 μl 10X PCR buffer (TAKARA)

- 0.25 μl R Taq polymerase (TAKARA)

- 28.8 μl Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

53 ° C for 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes The PCR amplification with SEQ ID NO: 32 and SEQ ID NO: 30 resulted in a 1032 bp fragment which codes for a protein consisting of the entire primary sequence of the ketolase from Haematococcus pluvialis as a double translational fusion with the rbcS transit peptide on the N Term and the myc tag at the C terminus.

The amplificate was cloned into the PCR cloning vector pGEM-Teasy (Promega) using standard methods. Sequencing with primers T7 and SP6 confirmed a sequence identical to the sequence SEQ ID NO: 22, the 3 ′ region (positions 993 to 1155) of SEQ ID NO: 22 in the amplificate SEQ ID NO: 26 by an in the different sequence from 39 bp was replaced. This clone was therefore used for the cloning into the expression vector pJITH7 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380).

The cloning was carried out by isolating the 1038 bp EcoRI-SpHI fragment from pGEM-Teasy and ligation with the EcoRI-SpHI cut vector pJITH7. The ligation creates a translational fusion between the C-terminus of the rbcS transit peptide sequence and the N-terminus of the ketolase sequence. The clone that contains the Haematococcus pluvialis ketolase with the fused C-terminal myc tag in the correct orientation as a translational N-terminal fusion with the rbcs transit peptide is called pJKET04.

Example 4:

Production of expression vectors for the constitutive expression of the Haematococcus pluvialis ketolase in Lycopersicon esculentum and Tagetes erecta.

The expression of the ketolase from Haematococcus pluvialis in L. esculentum and in Tagetes erecta was carried out under the control of the constitutive promoter d35S from CaMV (Franck et al. 1980, Cell 21: 285-294). Expression was carried out using the pea transit peptide rbcS (Anderson et al. 1986, Biochem J. 240: 709-715).

The production of an expression cassette for the Agrobacterium -mediated transformation of ketolase from Haematococcus pluvialis into L. esculentum was carried out using the binary vector pSUN3 (WO02 / 00900).

- To produce the expression vector pS3KET02, the 2.8 Kb Sacl-Xhol fragment from pJKET02 was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 5A, construct map). In Figure 5A, fragment d35S contains the duplicated 35S promoter (747 bp), fragment rbcS the rbcS transit peptide from pea (204 bp), fragment KET02 (1027 bp) the whole Primary sequence coding for the Haematococcus pluvialis ketolase, fragment term (761 bp) the polyadenylation signal of CaMV.

- For the production of the expression vector pS3KET03 the

2.7 Kb bp Sacl-Xhol fragment from pJKET03 ligated with the Sacl-Xhol cut vector pSUN3. (Figure 6, construct card). In Figure 6, fragment d35S contains the duplicated 35S promoter (747 bp), fragment rbcS the rbcS transit peptide from pea (204 bp), fragment KET03 (985 bp) the primary sequence shortened by 14 N-terminal amino acids coding for the Haematococcus pluvialis Ketolase, fragment term (761 bp) the polyadenylation signal of CaMV.

- For the production of the expression vector pS3KET04 the

2.8 Kb Sacl-Xhol fragment from pJKET04 ligated with the Sacl-Xhol cut vector pSUN3. (Figure 7, construct card). In Figure 7, fragment d35S contains the duplicated 35S promoter ((747 bp), fragment rbcS the rbcS transpeptide from pea (204 bp), fragment KET04 (1038 bp) the entire primary sequence coding for the Haematococcus pluvialis ketolase with C-terminal myc tag, fragment term (761 bp) the polyadenylation signal of CaMV.

An expression cassette for the Agrobacterium -mediated transformation of the ketolase from Haematococcus pluvialis into Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).

- To produce the Tagetes expression vector pS5KET02, the 2.8 Kb Sacl-Xhol fragment from pJKET02 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 5B, construct map). In Figure 5B, fragment d35S contains the duplicated 35S promoter (747 bp), fragment rbcS the rbcS transit peptide from pea (204 bp), fragment KET02 (1027 bp) the entire primary sequence coding for the Haematococcus pluvialis ketolase, fragment term (761 bp) the polyadenylation signal of CaMV.

Example 5A

Production of expression vectors for the flower-specific expression of Haematococcus pluvialis ketolase in Lycopersicon esculentum and Tagetes erecta.

Expression of Haematococcus pluvialis ketolase in. esculentum and Tagetes erecta took place with the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715). The Expression was carried out under the control of a modified version AP3P of the flower-specific promoter AP3 from Arabidopsis thaliana (AL132971: nucleotide region 9298 to 10200; Hill et al. (1998) Development 125: 1711-1721).

The DNA fragment, which contains the AP3 promoter region -902 to +15 from Arabidopsis thaliana, was PCR-analyzed using genomic DNA (isolated from Arabidopsis thaliana according to standard methods) and the primers PR7 (SEQ ID NO: 33) and PR10 (SEQ ID NO : 36).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which contains the AP3 promoter fragment (-902 to +15), was carried out in a 50 μl reaction mixture, which contained:

100 ng of genomic DNA from A. thaliana

- 0.25 mM dNTPs - 0.2 mM PR7 (SEQ ID NO: 33)

- 0.2 mM PR10 (SEQ ID NO: 36)

- 5 μl 10X PCR buffer (Stratagene)

- 0.25 μl Pfu polymerase (Stratagene)

- 28.8 μl Aq. Dest. The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

50 ° C for 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes

The 922 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pTAP3 was obtained.

Sequencing of clone pTAP3 confirmed a sequence consisting only of an insertion (a G in position 9765 of sequence AL132971) and a base exchange (a G instead of an A in position 9726 of sequence AL132971) from the published AP3 sequence (AL132971, nucleotide region 9298 to 10200). These nucleotide differences were reproduced in an independent amplification experiment and thus represent the actual nucleotide sequence in the Arabidopsis thaliana plants used. The modified version AP3P was produced by recombinant PCR using the plasmid pTAP3. The region 10200 to 9771 was amplified with the primers PR7 (SEQ ID NO: 33) and primers PR9 (SEQ ID NO: 35) (amplificate A7 / 9), the region 9526 to 9285 with the PR8 (SEQ ID NO: 34) ) and PR10 (SEQ ID NO: 36) amplified (amplificate A8 / 10).

The PCR conditions were as follows:

The PCR reactions for the amplification of the DNA fragments, which contain the regions region 10200-9771 and region 9526 to 9285 of the AP3 promoter, were carried out in 50 αl reaction batches, which contained:

- 100 ng AP3 amplificate (described above)

- 0.25 mM dNTPs

- 0.2 mM sense primer (PR7 SEQ ID NO: 33 or PR8 SEQ ID NO: 34)

- 0.2 mM antisense primer (PR9 SEQ ID NO: 35 or PR10 SEQ ID NO: 36) - 5 μl 10X PCR buffer (Stratagene)

- 0.25 μl Pfu Taq polymerase (Stratagene)

- 28.8 μl Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

50 ° C for 1 minute

72 ° C 1 minute IX 72 ° C 10 minutes]

The recombinant PCR includes annealing of the amplificates A7 / 9 and A8 / 10, which overlap over a sequence of 25 nucleotides, completion into a double strand and subsequent amplification. This creates a modified version of the AP3 promoter, AP3P, in which positions 9670 to 9526 are deleted. The denaturation (5 min at 95 ° C.) and annealing (slow cooling at room temperature to 40 ° C.) of both amplificates A7 / 9 and A8 / 10 was carried out in a 17.6 μl reaction mixture, which contained:

- 0.5 μg A7 / 9 amplificate

- 0.25 μg A8 / 10 amplificate The 3 'ends were filled in (30 min at 30 ° C.) in a 20 μl reaction mixture which contained:

- 17.6 μgA7 / 9 and A8 / 10 annealing reaction (prepared as described above)

- 50 µM dNTPs

- 2 ul IX Klenow buffer

- 2U Klenow enzyme

The nucleic acid coding for the modified promoter version AP3P was amplified by means of PCR using a sense-specific primer (PR7 SEQ ID NO: 33) and an antisense-specific primer (PR10 SEQ ID NO: 36).

The PCR conditions were as follows:

The PCR for the amplification of the AP3P fragment was carried out in a 50 μl reaction mixture, which contained:

- 1 μl annealing reaction (prepared as described above)

- 0.25 mM dNTPs

- 0.2 mM PR7 (SEQ ID NO: 33)

- 0.2 mM PR10 (SEQ ID NO: 36)

- 5 μl 10X PCR buffer (Stratagene) - 0.25 μl Pfu Taq Polymerase (Stratagene)

- 28.8 μl Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

50 ° C for 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes

The PCR amplification with SEQ ID NO: 33 and SEQ ID NO: 36 resulted in a 778 bp fragment which codes for the modified promoter version AP3P. The amplificate was cloned into the cloning vector pCR2.1 (Invitrogen). Sequencing with the primers T7 and Ml3 confirmed a sequence identical to the sequence AL132971, region 10200 to 9298, the internal region 9285 to 9526 being deleted. This clone was therefore used for the cloning into the expression vector pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380). The cloning was carried out by isolating the 771 bp SacI-HindIII fragment from pTAP3P and ligating into the SacI-HindIII cut vector pJITH7. The clone that contains the promoter AP3P instead of the original promoter d35S is called pJAP3P.

To produce an expression cassette pJAP3PKET02, the 1027 bp SpHI fragment KET02 (described in Example 1) was cloned into the SpHI-cut vector pJAP3P. The clone which contains the fragment KET02 in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJAP3PKET02.

To produce an expression cassette pJAP3PKET04, the 1032 bp SpHI-EcoRI fragment KET04 (described in Example 3) was cloned into the SpHI-EcoRI cut vector pJAP3P. The clone that contains the fragment KET04 in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called PJAP3PKET04.

An expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled ketolase from Haematococcus pluvialis into L. esculentum was produced using the binary vector pSUN3 (WO02 / 00900).

- To produce the expression vector pS3AP3PKET02, the 2.8 KB bp Sacl-Xhol fragment from pJAP3PKET02 was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 8A, construct map). In Figure 8A, fragment AP3P contains the modified AP3P promoter (771 bp), fragment rbcS the rbcS transit peptide from pea (204 bp), fragment KET02 (1027 bp) the entire primary sequence coding for the Haematococcus pluvialis ketolase, fragment term (761 Bp) the polyadenylation signal from CaMV.

- To produce the expression vector pS3AP3PKET04, the 2.8 KB Sacl-Xhol fragment from pJAP3PKET04 was ligated with the Sacl-Xhol cut vector pSUN3. (Figure 9, construct card). In Figure 9, fragment AP3P contains the modified AP3P promoter (771 bp), fragment rbcS the rbcS transit peptide from pea (204 bp), fragment KET04 (1038 bp) the entire primary sequence coding for the Haematococcus pluvialis ketolase with C-terminal myc tag , Fragment term (761 bp) the polyadenylation signal of CaMV. An expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled ketolase from Haematococcus pluvialis in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900). 5

To produce the expression vector pS5AP3PKET02, the 2.8 KB bp Sacl-Xhol fragment from pJAP3PKET02 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 8B, construct map). In Figure 8B, fragment AP3P contains the

10 modified AP3P promoters (771 bp), fragment rbcS the rbcS transit peptide from pea (204 bp), fragment KET02 (1027 bp) the entire primary sequence coding for the Haematococcus pluvialis ketolase, fragment term (761 Bp) the polyadenylation signal from CaMV

15

Example 5B

Amplification of a chimeric cDNA which contains the ketolase from Haematococcus pluvialis Flotow em. Will with a heterologous 5 'untranslated region (5'UTR), and producing one

20 expression vectors for flower-specific expression of Haematococcus pluvialis ketolase without using a heterologous transit peptide in Lycopersicon esculentum.

The cDNA containing the Haematococcus pluvialis ketolase (strain 25 192.80) following a heterologous "5 'untranslated region" (5'UTR) was prepared by PCR.

The nucleic acid encoding a ketolase from Haematococcus pluvialis (strain 192.80) with a "5 'untranslated region" 30 (5'UTR) was obtained from the

Plasmid pGKET02 was amplified using a sense-specific primer (PR142 SEQ ID NO: 78) and an antisense-specific primer (PRI SEQ ID NO: 29). The PCR conditions were as follows:

35

The PCR for the amplification of the fragment, which both codes for a ketolase protein and contains a heterologous 5 'UTR region, was carried out in a 50 μl reaction mixture which contained:

40

10 ng of plasmid pGKET02 (described in Example 1)

- 0.25 mM dNTPs

- 0.2 mM PRI (SEQ ID NO: 29)

- 0.2 mM PR142 (SEQ ID NO: 78) 45 - 5 μl 10X PCR buffer (TAKARA)

- 0.25 μl R Taq polymerase (TAKARA)

- 25.8 μl Aq. Least. The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

53 ° C for 2 minutes

72 ° C for 3 minutes

IX 72 ° C 10 minutes

PCR amplification with PRl and PR142 resulted in a 1.1 KB fragment containing a heterologous 5'UTR region followed by the coding region for a ketolase (SEQ ID NO: 79)

The amplificate was cloned into the PCR cloning vector pCR2.1 (Invitrogen) using standard methods. Sequencing of the resulting clone pTA-KET05 with the primers T7 and Ml3 confirmed a sequence (SEQ ID NO: 79) which [apart from the 5 'terminus, which is identical to pJITH7 (Guerineau et al. 1988, Nucl. Acids Res 16: 11380)], is identical to the sequence SEQ ID NO: 22. This clone was therefore used for the cloning into the expression vector pJAP3PKET02 (example 5A).

The cloning was carried out by isolating the 0.3 KB HindIII fragment from pTA-KET05 and ligating into the HindIII-cut vector pJAP3PKET02. The clone that contains the AP3P promoter, followed by the 5'UTR from pJIT117 and the complete coding sequence for the Haematococcus pluvialis ketolase is called pJAP3PKET05.

The expression of the ketolase from Haematococcus pluvialis in L. esculentum was carried out under the control of the promoter AP3P (see Example 5A) and the 5'UTR from pJITH7. The production of an expression cassette for the Agrobacterium -mediated transformation of the ketolase from Haematococcus pluvialis into L. esculentum was carried out using the binary vector pSUN3 (WO 02/00900).

To produce the expression vector pS3AP3PKET05, the 2.8 Kb Sacl-Xhol fragment from pJAP3PKET05 was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 21, construct map). In Figure 21, fragment AP3P contains the AP3P promoter (747 bp), fragment 5 'UTR the 5'UTR sequence from pJITH7 (30 bp), fragment KET05 (1.0 kb) the entire primary sequence coding for the Haematococcus pluvialis ketolase, fragment term (761 bp) the polyadenylation signal of CaMV. Example 6:

Production and analysis of transgenic Lycopersicon esculentum

plants

Transformation and regeneration of tomato plants was carried out according to the published method by Ling and co-workers (Plant Cell Reports (1998), 17: 843-847). For the microtome variety, higher kanamycin concentrations (100 mg / L) were selected.

The starting explant for the transformation was cotyledons and hypocotyls, seven to ten day old seedlings of the Microtome line. The culture medium according to Murashige and Skoog (1962: Murashige and Skoog, 1962, Physiol. Plant 15, 473-) with 2% sucrose, pH 6.1 was used for germination. Germination took place at 21 ° C with little light (20 to 100 μE). After seven to ten days, the cotyledons were divided transversely and the hypocotyls were cut into sections about 5 to 10 mm long and placed on the medium MSBN (MS, pH 6.1, 3% sucrose + 1 mg / l BAP, 0.1 mg / l NAA), which was loaded with suspension-cultivated tomato cells the day before. The tomato cells were covered with sterile filter paper without air bubbles. The explants were precultured on the medium described for three to five days. Cells from the Agrobacterium tumefaciens LBA4404 strain were individually transformed with the plasmids pS3KET02, pS3KET03, pS3AP3PKET05 and pS3AP3KET02. An overnight culture of the individual agrobacterium strains transformed with the binary vectors pS3KET02, pS3KET03 or pS3KET02 was cultivated in YEB medium with kanamycin (20 mg / l) at 28 ° C. and the cells were centrifuged % Sucrose, pH 6.1) and adjusted to an optical density of 0.3 (at 600 nm). The precultivated explants were transferred to the suspension and incubated for 30 minutes at room temperature with gentle shaking. The explants were then dried with sterile filter paper and placed back on their preculture medium for the three-day co-culture (21 ° C.).

After the co-culture, the explants were transferred to MSZ2 medium (MS pH 6.1 + 3% sucrose, 2 mg / l zeatin, 100 mg / l kanamycin, 160 mg / l timentin) and for selective regeneration at 21 ° C stored under low light conditions (20 to 100 μE, light rhythm 16 h / 8 h). The explants were transferred every two to three weeks until shoots formed. Small shoots could be separated from the explant and on MS (pH 6.1 + 3% sucrose) 160 mg / l timentin, 30 mg / l kanamycin, 0.1 mg / l IAA can be rooted. Rooted plants were transferred to the greenhouse.

According to the transformation method described above, the following lines were obtained with the following expression constructs:

With pS3KET02 was obtained: csl3-8, csl3-24, csl3-30, csl3-40.

With pS3KET03 it was obtained: csl4-2, csl4-3, csl4-9, csl4-19

With pS3AP3PKET02 was obtained: csl6-15, cslδ-34, csl6-35, csl6-40.

Table la shows the appearance of the petals of the tomato plants genetically modified according to the invention. The

Analysis of the ketocarotenoids was carried out as described below.

Table la

The carotenoids were quantified by extracting the pigments in acetone, enzymatically hydrolysing the carotenoid esters and separating the released carotenoids by means of HPLC. Experimental details and running conditions of the HPLC separations are described in detail in Example 9. Table 1b shows the carotenoid profile in petals of the transgenic tomato plants produced according to the examples described above, including controls. Carotenoid concentrations are mean values of different lines and as a percentage of the total carotenoid content. Table lb

Tomato viola-anthera- lutein zea-crypto-beta asta-adoni-adon 3'-hydroxy- xanxanthine xanxanthine zeta-xananthine irubin echinenone thin thin carotenes thin

10 control 70.6 14 13.2 1 0.2 0.95

CS16 0.5 1 3.2 0.3 15.3 61 4.1 15.2 plans

Cs l3 9.7 0.4 0.05 9 68 1.3 12.3 0.2 plans

15

Example 7:

Production of transgenic tagetes plants

20 daily seeds are sterilized and placed on germination medium (MS medium; Murashige and Skoog, Physiol. Plant. 15 (1962), 473-497) pH 5.8, 2% sucrose). Germination takes place in a temperature / light / time interval of 18 to 28 ° C / 20-200 μE / 3 to 16 weeks, but preferably at 21 ° C, 20 to 70 μE, for 4 to

25 8 weeks.

All leaves of the in vitro plants that had developed up to that point are harvested and cut across the midrib. The resulting leaf explants with a size of 10 to 60 mm ² 3 are kept in the course of the preparation in liquid MS medium at room temperature for a maximum of 2 h.

Any Agrobacterium tumefaciens strain, but prefers a supervirulent strain, e.g. EHA105 with a corresponding

35 the binary plasmid, which can carry a selection marker gene (preferably bar or pat) and one or more trait or reporter genes (for example pS5KET02 and pS5AP3PKET02), grown overnight and used for the co-cultivation with the leaf material. The bacterial strain can be grown as follows:

40 gen: A single colony of the corresponding strain is in YEB

(0.1% yeast extract, 0.5% beef extract, 0.5% peptone, 0.5% sucrose, 0.5% magnesium sulfate x 7 H0) inoculated with 25 mg / l kanamycin and at 28 ° C for 16 to 20 h dressed. The bacterial suspension is then centrifuged at 6000 g for

45 harvested for 10 min and resuspended in this way in liquid MS medium, that an OD ₆ oo of approx. 0.1 to 0.8 arose. This suspension is used for C cultivation with the leaf material.

Immediately before the co-cultivation, the MS medium in which the leaves have been kept is replaced by the bacterial suspension. The leaflets were incubated in the agrobacterial suspension for 30 min with gentle shaking at room temperature. The infected explants are then placed on an MS medium solidified with agar (for example 0.8% Plant Agar (Duchefa, NL) with growth regulators, such as 3 mg / l benzylamino-purine (BAP) and 1 mg / l indolylacetic acid (IAA) The orientation of the leaves on the medium is insignificant. The explants are cultivated for 1 to 8 days, but preferably for 6 days, the following conditions being able to be used: Light intensity: 30 to 80 μmol / m ² x sec , Temperature: 22 to 24 ° C., light / dark change of 16/8 hours, after which the co-cultivated explants are transferred to fresh MS medium, preferably with the same growth regulators, this second medium additionally containing an antibiotic for suppression Timentin in a concentration of 200 to 500 mg / l is very suitable for this purpose, the second selective component being one for the selection of the transformation success Phosphinothricin in a concentration of 1 to 5 mg / l selects very efficiently, but other selective components according to the method to be used are also conceivable.

After one to three weeks, the explants are transferred to fresh medium until shoot buds and small shoots develop, which are then on the same basal medium including timentin and PPT or alternative components with growth regulators, namely, for example, 0.5 mg / l indolylbutyric acid (IBA) and 0.5 mg / l gibberillic acid GA ₃ , are transferred for rooting. Rooted shoots can be transferred to the greenhouse.

In addition to the described method, the following advantageous modifications are possible:

Before the explants are infected with the bacteria, they can be preincubated for 1 to 12 days, preferably 3 to 4, on the medium described above for the co-culture. The infection, co-culture and selective regeneration then take place as described above. • The pH value for regeneration (normally 5.8) can be lowered to pH 5.2. This improves the control of agrobacterial growth.

• The addition of AgN0 ₃ (3 to 10 mg / l) to the regeneration medium improves the condition of the culture, including the regeneration itself.

Components that reduce phenol formation and are known to those skilled in the art, such as Citric acid, ascorbic acid, PVP and many more have a positive effect on the culture.

• Liquid culture medium can also be used for the entire process. The culture can also be incubated on commercially available carriers which are positioned on the liquid medium.

With pS5KET02, for example, was obtained: csl8-l and csl8-2, with pS5AP3PKET02, for example, was obtained: csl9-l, csl9-2 and csl9-3.

Example 8

Characterization of the transgenic plant flowers

Example 8.1

Separation of carotenoid esters in petals of transgenic plants

General working instructions:

The petals of the transgenic plants are mortarized in liquid nitrogen and the petalen powder (about 40 mg) extracted with 100% acetone (three times 500 μl each). The solvent is evaporated and the carotenoids are resuspended in 100 to 200 μl of petroleum ether / acetone (5: 1, v / v).

The carotenoids are separated in concentrated form using thin layer chromatography (TLC) on Silica60 F254 plates (Merck) in an organic solvent (petroleum ether / acetone; 5: 1) according to their phobicity. Yellow (xanthophyll ester), red (ketocarotenoid ester) and orange bands (mixture of xanthophyll and ketocarotenoid esters) are scraped out on the TLC. The carotenoids bound to silica are eluted three times with 500 μl acetone, the solvent evaporated and the carotenoids separated and identified by HPLC.

A C30 reverse phase column can be used to differentiate between mono- and diesters of carotenoids. HPLC running conditions were almost identical to a published method (Frazer et al. (2000), Plant Journal 24 (4): 551-558). The carotenoids can be identified on the basis of the UV-VIS spectra.

Petal material from the transgenic tomato plants CS13-8, csl3-24, csl3-30, csl3-40, csl4-2, csl4-3, csl4-9, csl4-19 were ground and extracted with acetone. Extracted carotenoids were separated by TLC. Mono and diesters of ketocarotenoids could be detected in both lines; the monoesters were present in a significantly lower concentration than the diesters.

HPLC analyzes showed that the diesters of the xanthophylls (yellow band) and the ketocarotenoids (red band) were present; the diesters of the ketocarotenoids were approximately 10 times higher than the monoesters (Figure 10).

Petal material from the transgenic tomato plants csl6-15, csl6-34, csl6-35, csl6-40, which carry the AP3 promoter, were ground and extracted with acetone. Extracted carotenoids were separated by TLC. Monoesters of ketocarotenoids could not be detected or only in extremely low concentrations. Diesters of the ketocarotenoids were present in the same amount as in lines CS13 and CS14. In terms of quantity, diesters of the xanthophylls were little changed compared to control plants.

Figure 9A shows a thin layer chromatogram. The carotenoids from tomato petals were extracted with acetone and separated by means of thin layer chromatography. Compared to control extracts, additional carotenoid bands f (l), (2) and (3)] could be detected in petals of transgenic tomato plants.

Figure 10 shows an HPLC diagram. The additional carotenoid bands in petals of transgenic tomato fruits (see (1-3) in Figure 9A) were extracted, eluted with acetone and analyzed by HPLC. (1) was identified as a monoester, (2) and (3) were identified as a diester. Example 9

Enzymatic hydrolysis of carotenoid esters and identification of the carotenoids

General working instructions

Mortar petal material (50 to 100 mg fresh weight) is extracted with 100% acetone (three times 500 μl; shake for about 15 minutes each). The solvent is evaporated. Carotenoids are then taken up in 400 μl acetone (absorption at 475 nm between 0.75 and 1.25) and treated in an ultrasonic bath for 5 min. The carotenoid extract is mixed with 300 μl of 50 mM Tris-HCl buffer (pH 7.0) and incubated for 5 to 10 minutes at 37C. Then 100 to 200 μl of cholesterol esterase are added (stock solution: 6.8 units / ml of a cholesterol esterase from Pseudomonas spec.). After 8 to 12 hours, another 100 to 200 μl of enzyme are added; Hydrolysis of the esters takes place within 24 hours when incubated at 37C. After adding 0.35 g of Na2S04xl0H20 and 500 μl of petroleum ether, the mixture is mixed well and centrifuged (3 minutes; 4500 g). Petroleum ether phase is drawn off and mixed again with 0.35 g Na2S04xlOH20 (anhydrous). Centrifugation for 1 minute at 10,000 g. Petroleum ether is evaporated and free carotenoids are taken up in 100 to 120 μl acetone. Free carotenoids can be identified on the basis of retention time and UV-VIS spectra using HPLC and a C30 reverse phase column.

Isolated ketocarotenoid esters (mono- and diesters) of lines CS13, CS14 and CS16 were hydrolyzed with cholesterol esterase and the carotenoids released were separated by means of HPLC. Carotenoids were identified based on retention time and spectrum compared to carotenoid standards. Mono- and diesters contain astaxanthin in high concentration (90%) and adonixanthin in low concentration (10%). (see table and illustrations)

Figure 11 shows an HPLC diagram. The eluted esters from Example 9 (Figure 10) were hydrolyzed enzymatically and the hydrolysis products were analyzed by HPLC. Both mono- and diesters contain astaxanthin as the main carotenoid and adonixanthin in low concentrations. Example 10:

Production of a cloning vector for the production of inverted repeat expression cassettes for the flower-specific expression of epsilon-cyclase dsRNAs in Tagetes erecta 5

The expression of inverted repeat transcripts consisting of fragments of the epsilon cyclase in Tagetes erecta was carried out under the control of a modified version AP3P of the flower-specific promoter AP3 from Arabidopsis thaliana (AL132971: nucleotide region 10 9298 to 10200; Hill et al. (1998) Development 125: 1711 to 1721).

The inverted-repeat transcript contains a fragment in the correct orientation (sense fragment) and a sequence-identical fragment in the opposite orientation (antisense fragment), which is generated by a functional intron, the PIV2 intron of the ST-LH1 gene from potato ( Vancanneyt G. et al. (1990) Mol Gen Genet 220: 245-50).

20 The cDNA coding for the AP3 promoter (-902 to +15) from Arabidopsis thaliana was PCR-analyzed using genomic DNA (isolated from Arabidopsis thaliana according to the standard method) and the primers PR7 (SEQ ID NO: 49) and PR10 ( SEQ ID NO: 52).

25

The PCR conditions were as follows:

The PCR for the amplification of the DNA encoding the AP3 promoter fragment (-902 to +15) was carried out in a 50 μl reaction mixture, 30 which contained:

1 μl genomic DNA from A. thaliana (1: 100 dil prepared as described above) 0.25 mM dNTPs 35 - 0.2 mM PR7 (SEQ ID NO: 49) 0.2 mM PR10 (SEQ ID NO: 52) 5 μl 10X PCR buffer ( Stratagene) 0.25 μl Pfu polymerase (Stratagene) 28.8 μl Aq. Least.

40

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

45 50 ° C for 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes The 922 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pTAP3 was obtained. Sequencing of clone pTAP3 confirmed a sequence consisting only of an insertion (a G in position 9765 of sequence AL132971) and a base exchange (a G instead of an A in position 9726 of sequence AL132971) from the published AP3 sequence (AL132971, nucleotide region 9298 to 10200) (position 33: T instead of G, position 55: T instead of G). These nucleotide differences were reproduced in an independent amplification experiment and thus represent the nucleotide sequence in the Arabidopsis thaliana plant used.

The modified version AP3P was produced by recombinant PCR using the plasmid pTAP3. The regions 10200 to 9771 were amplified with the primers PR7 (SEQ ID NO: 49) and primers PR9 (SEQ ID NO: 51) (amplificate Kl / 9), the region 9526 to 9285 with the PR8 (SEQ ID NO: 50 ) and PR10 (SEQ ID NO: 52) amplified (amplificate A8 / 10).

The PCR conditions were as follows:

The PCR reactions for the amplification of the DNA fragments which code for the regions region 10200 to 9771 and 9526 to 9285 of the AP3 promoter were carried out in 50 μl reaction batches which contained:

- 100 ng AP3 amplificate (described above)

- 0.25 mM dNTPs - 0.2 mM PR7 (SEQ ID NO: 49) or PR8 (SEQ ID NO: 50)

- 0.2 mM PR9 (SEQ ID NO: 51) or PR10 (SEQ ID NO: 52)

- 5 μl 10X PCR buffer (Stratagene)

- 0.25 μl Pfu Taq polymerase (Stratagene)

- 28.8 μl Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

50 ° C for 2 minutes

72 ° C for 3 minutes

IX 72 ° C 10 minutes

The recombinant PCR includes annealing of the amplificates A7 / 9 and A8 / 10, which overlap over a sequence of 25 nucleotides, completion into a double strand and subsequent amplification. This creates a modified version of the AP3 Promoters, AP3P in which positions 9670 to 9526 are deleted. The denaturation (5 min at 95 ° C.) and annealing (slow cooling at room temperature to 40 ° C.) of both amplifiers A7 / 9 and A8 / 10 was carried out in a 17.6 μl reaction mixture, which contained:

- 0.5 μg A7 / 9

- 0.25 μg A8 / 10

- 17.6 μl A7 / 9 and A8 / 10 annealing reaction (prepared as described above) - 50 μM dNTPs

- 2 ul IX Klenow buffer

- 2U Klenow enzyme

The nucleic acid coding for the modified promoter version AP3P was amplified by means of PCR using a sense-specific primer (PR7 SEQ ID NO: 49) and an antisense-specific primer (PR10 SEQ ID NO: 52).

The PCR conditions were as follows:

- 1 μl annealing reaction (prepared as described above) - 0.25 mM dNTPs

- 0.2 mM PR7 (SEQ ID NO: 49)

- 0.2 mM PR10 (SEQ ID NO: 52)

- 5 μl 10X PCR buffer (Stratagene)

- 0.25 μl Pfu Taq polymerase (Stratagene) - 28.8 μl Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

50 ° C for 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes

The PCR amplification with PR7, SEQ ID NO: 49 and PR10 SEQ ID NO: 52 resulted in a 778 bp fragment which codes for the modified promoter version AP3P. The amplificate was cloned into the cloning vector pCR 2.1 (Invitrogen). sequencing Adornments with the primers T7 and Ml3 confirmed a sequence identical to the sequence AL132971, region 10200 to 9298, the internal region 9285 to 9526 being deleted. This clone was therefore used for the cloning into the expression vector pJITH7 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380).

The cloning was carried out by isolating the 771 bp SacI-HindIII fragment from pTAP3P and ligating into the SacI-HindIII cut vector pJIT117. The clone that contains the promoter AP3P instead of the original promoter d35S is called pJAP3P.

A DNA fragment containing the PIV2 intron of the ST-LSI gene was PCR-analyzed using plasmid DNA p35SGUS INT (Vancanneyt G. et al. (1990) Mol Gen Genet 220: 245-50) and the primer PR40 ( Seq ID NO: 54) and primer PR41 (Seq ID NO: 55).

The PCR conditions were as follows:

The PCR for the amplification of the sequence of the intron PIV2 of the ST-LSI gene was carried out in a 50 μl reaction mixture which contained:

- 1 ul p35SGUS INT - 0.25 mM dNTPs

- 0.2 μM PR40 (SEQ ID NO: 54)

- 0.2 μM PR41 (SEQ ID NO: 55)

- 5 μl 10X PCR buffer (TAKARA)

- 0.25 μl R Taq polymerase (TAKARA) - 28.8 μl Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes 35X 94 ° C 1 minute

53 ° C for 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes

PCR amplification with PR40 and PR41 resulted in one

206 bp fragment. Using standard methods, the amplificate was cloned into the PCR cloning vector pBluntII (Invitrogen) and the clone pBluntII-40-41 was obtained. Sequencing of this clone with the primer SP6 confirmed a sequence which is identical to the corresponding sequence from the vector p35SGUS INT. This clone was therefore used for cloning into the vector pJAP3P (described above).

The cloning was carried out by isolating the 206 bp Sall-BamHI 5 fragment from pBluntII-40-41 and ligation with the Sall-BamHI cut vector pJAP3P. The clone which contains the intron PIV2 of the ST-LSI gene in the correct orientation after the 3 'end of the rbcs transit peptide is called pJAII and is suitable for producing expression cassettes for the flower-specific expression 10 of inverted repeat transcripts.

In Figure 12, fragment AP3P contains the modified AP3P promoter (771 bp), fragment rbcs the rbcS transit peptide from pea (204 bp), fragment intron the intron PIV2 of the potato 15 gene ST-LSl, and fragment term (761 bp) that Polyadenylation signal from CaMV.

Example 11

Production of inverted repeat expression cassettes for the 20 flower-specific expression of epsilon-cyclase dsRNAs in

Tagetes erecta (directed against the 5 'region of the epsilon cyclase cDNA)

The nucleic acid containing the 5 'terminal 435bp region of the epsilon-25 cyclase cDNA (Genbank accession NO: AF251016) was extracted from Tagetes erecta cDNA using a polymerase chain reaction (PCR) using a sense-specific primer (PR42 SEQ ID NO: 56 ) and an antisense-specific primer (PR43 SEQ ID NO: 57). The 5 'terminal 435 bp region of the 30 epsilon cyclase cDNA from Tagetes erecta is composed of 138 bp 5' untranslated sequence (5'UTR) and 297 bp of the coding region corresponding to the N-terminus.

For the preparation of total RNA from Tagetes flowers, 35 100 mg of the frozen, powdered flowers were transferred to a reaction vessel and taken up in 0.8 ml of Trizol buffer (LifeTechnologies). The suspension was extracted with 0.2 ml of chloroform. After centrifugation at 12,000 g for 15 minutes, the aqueous supernatant was removed and transferred to a new reaction vessel 40 and extracted with a volume of ethanol. The RNA was precipitated with a volume of isopropanol, washed with 75% ethanol and the pellet dissolved in DEPC water (overnight incubation of water with 1/1000 volume of diethyl pyrocarbonate at room temperature, then autoclaved). The RNA concentration was determined photometrically. For the cDNA synthesis, 2.5 μg of total RNA were denatured for 10 min at 60 ° C., cooled on ice for 2 min and using a cDNA kit (Ready-to-go-you-prime beads, Pharmacia Biotech) according to the manufacturer's instructions using an antisense-specific primer (PR17 SEQ ID NO: 53) in cDNA.

The conditions of the subsequent PCR reactions were as follows:

The PCR for the amplification of the PR42-PR43 DNA fragment, which contains the 5 'terminal 435bp region of the epsilon cyclase, was carried out in a 50 μl reaction mixture, which contained:

- 1 ul cDNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 μM PR42 (SEQ ID NO: 56)

- 0.2 μM PR43 (SEQ ID NO: 57) - 5 μl 10X PCR buffer (TAKARA)

- 0.25 μl R Taq polymerase (TAKARA)

- 28.8 μl Aq. Least.

The PCR for the amplification of the PR44-PR45 DNA fragment, which contains the 5 'terminal 435 bp region of the epsilon cyclase, was carried out in a 50 μl reaction mixture which contained:

- 1 ul cDNA (prepared as described above)

- 0.25 mM dNTPs - 0.2 μM PR44 (SEQ ID NO: 58)

- 0.2 μM PR45 (SEQ ID NO: 59)

- 5 μl 10X PCR buffer (TAKARA)

- 0.25 μl R Taq polymerase (TAKARA)

- 28.8 μl Aq. Least.

The PCR reactions were carried out under the following cycle conditions:

IX 94 ° C 2 minutes 35X 94 ° C 1 minute

58 ° C for 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes

The PCR amplification with primers PR42 and PR43 resulted in a 443 bp fragment, the PCR amplification with primers PR44 and PR45 resulted in a 444 bp fragment.

The two certificates, the PR42-PR43 (HindIII-Sall sense) fragment and the PR44-PR45 (EcoRI-BamHI antisense) fragment, were cloned into the PCR cloning vector pCR-BluntII (Invitrogen) using standard methods. Sequencing with the Primers SP6 each confirmed a sequence identical to the published sequence AF251016 (SEQ ID NO: 38), apart from the restriction sites introduced. These clones were therefore used for the production of an inverted repeat construct in the cloning vector pJAII (see example 10).

The first cloning step was carried out by isolating the 444 bp PR44-PR45 BamHI-EcoRI fragment from the cloning vector pCR-BluntII (Invitrogen) and ligation with the BamHI-EcoRI cut vector pJAIl. The clone which contains the 5 'terminal region of the epsilon cyclase in the antisense orientation is called pJAI2. The ligation results in a transcriptional fusion between the antisense fragment of the 5'-terminal region of the epsilon cyclase and the polyadenylation signal from CaMV.

The second cloning step was carried out by isolating the 443 bp PR42-PR43 Hindlll-Sall fragment from the cloning vector pCR-BluntII (Invitrogen) and ligation with the Hindlll-Sall cut vector pJAl2. The clone that contains the 435 bp 5 'terminal region of the epsilon cyclase cDNA in the sense orientation is called pJAl3. The ligation creates a transcriptional fusion between the AP3P and the sense fragment of the 5'-terminal region of the epsilon cyclase.

For the production of an inverted repeat expression cassette under the control of the CHRC promoter, a CHRC promoter fragment using genomic DNA from petunia (produced according to standard methods) and the primers PRCHRC5 (SEQ ID NO: 76) and PRCHRC3 (SEQ ID NO: 77) amplified. The amplificate was cloned into the cloning vector pCR2.1 (Invitrogen). Sequencing of the resulting clone pCR2.1-CHRC with the primers M13 and T7 confirmed a sequence identical to the sequence AF099501. This clone was therefore used for the cloning into the expression vector PJAI3.

The cloning was carried out by isolating the 1537 bp SacI-HindIII fragment from pCR2.1-CHRC and ligating into the SacI-HindIII cut vector pJAI3. The clone that contains the CHRC promoter instead of the original AP3P promoter is called pJCI3.

The expression vectors for the Agrobacterium -mediated transformation of the AP3P or CHRC-controlled inverted repeat transcripts in Tagetes erecta were produced using the binary vector pSUN5 (WO02 / 00900). To produce the expression vector pS5Al3, the 2622 bp Sacl-Xhol fragment from pJAl3 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 13, construct map).

In Figure 13 fragment AP3P contains the modified AP3P promoter (771 bp), fragment 5sense the 5 'region of the Epsilon cyclase from Tagetes erecta (435 bp) in sense orientation, fragment intron the intron PIV2 of the potato gene ST-LSI Fragment 5anti the 5 'region of the epsilon cyclase from Tagetes erecta (435 bp) in an antisense orientation, and fragment term (761 bp) the polyadenylation signal of CaMV.

To produce the expression vector pS5Cl3, the 3394 bp Sacl-Xhol fragment from pJCl3 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 14, construct map).

In Figure 14 fragment CHRC contains the promoter (1537 bp), fragment 5sense the 5 'region of the Epsilon cyclase from Tagetes erecta (435 bp) in sense orientation, fragment intron the intron PIV2 of the potato gene ST-LSI, fragment 5anti the 5 'region of the Epsilon cyclase from Tagetes erecta (435 bp) in antisense orientation, and fragment term (761 bp) the polyadenylation signal of CaMV.

Example 12

Production of an inverted repeat expression cassette for the flower-specific expression of epsilon cyclase dsRNAs in Tagetes erecta (directed against the 3 ′ region of the epsilon cyclase cDNA)

The nucleic acid containing the 3 'terminal region (384 bp) of the epsilon cyclase cDNA (Genbank accession NO: AF251016) was obtained from Tagetes erecta cDNA using a polymerase chain reaction (PCR) using a sense-specific primer (PR46 SEQ ID NO: 60) and an antisense specific primer (PR47

SEQ ID NO: 61). The 3 'terminal region (384 bp) of the Epsilon cyclase cDNA from Tagetes erecta is composed of 140 bp 3' untranslated sequence (3'UTR) and 244 bp of the coding region corresponding to the C-terminus.

Total RNA was prepared from Tagetes flowers as described in Example 11.

The cDNA synthesis was carried out as described in Example 11 using the antisense-specific primer PR17 (SEQ ID NO: 53). The conditions of the subsequent PCR reactions were as follows:

The PCR for the amplification of the PR46-PR457 DNA fragment, which contains the 3 'terminal 384 bp region of the epsilon cyclase, was carried out in a 50 μl reaction mixture which contained:

- 1 ul cDNA (prepared as described above)

- 0.25 mM dNTPs - 0.2 μM PR46 (SEQ ID NO: 60)

- 0.2 μM PR47 (SEQ ID NO: 61)

- 5 μl 10X PCR buffer (TAKARA)

- 0.25 μl R Taq polymerase (TAKARA)

- 28.8 μl Aq. Least.

The PCR for the amplification of the PR48-PR49 DNA fragment, which contains the 5 'terminal 384 bp region of the epsilon cyclase, was carried out in a 50 μl reaction mixture which contained:

- 1 ul cDNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 μM PR48 (SEQ ID NO: 62)

- 0.2 μM PR49 (SEQ ID NO: 63)

- 5 μl 10X PCR buffer (TAKARA) - 0.25 μl R Taq polymerase (TAKARA)

- 28.8 μl Aq. Least.

The PCR reactions were carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

58 ° C for 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes

The PCR amplification with SEQ ID NO: 60 and SEQ ID NO: 61 resulted in a 392 bp fragment, the PCR amplification with SEQ ID NO: 62 and SEQ ID NO: 63 resulted in a 396 bp fragment.

The two amplicons, the PR46-PR47 fragment and the PR48-PR49 fragment, were cloned into the PCR cloning vector pCR-BluntII (Invitrogen) using standard methods. Sequences with the primer SP6 each confirmed a sequence identical to the published sequence AF251016 (SEQ ID NO: 38) apart from the restriction sites introduced. These clones were therefore used for the production of an inverted repeat construct in the cloning vector pJAII (see example 10).

The first cloning step was carried out by isolating the 396 bp PR48-PR49 BamHI-EcoRI fragment from the cloning vector pCR-BluntII (Invitrogen) and ligation with the BamHI-EcoRI cut vector pJAIl. The clone that contains the 3 'terminal region of the epsilon cyclase in the antisense orientation is called pJAl4. The ligation produces a transcriptional fusion between the antisense fragment of the 3 'terminal region of the epsilon cyclase and the polyadenylation signal from CaMV.

The second cloning step was carried out by isolating the 392 bp PR46-PR47 Hindlll-Sall fragment from the cloning vector pCR-BluntII (Invitrogen) and ligation with the Hindlll-Sall cut vector pJAl4. The clone that contains 392 bp 3 'terminal region of the epsilon cyclase cDNA in the sense orientation is called pJAI5. The ligation results in a transcriptional fusion between the AP3P and the sense fragment 3 'terminal region of the epsilon cyclase.

An expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled inverted repeat transcript in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900). To produce the expression vector pS5AI5, the 2523 bp Sacl-Xhol fragment from pJAI5 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 15, construct map).

In Figure 15, fragment AP3P contains the modified AP3P promoter (771 bp), fragment 3sense the 3 'region of the Epsilon cyclase from Tagetes erecta (435 bp) in sense orientation, fragment intron the intron IV2 of the potato gene ST-LSI, fragment 3anti the 3 'region of the Epsilon cyclase from Tagetes erecta (435 bp) in antisense orientation, and fragment term (761 bp) the polyadenylation signal of CaMV.

Example 13

Cloning of the epsilon cyclase promoter

A 199 bp fragment or the 312 bp fragment of the epsilon cyclase promoter was determined by two independent cloning strategies, inverse PCR (adapted from Long et al. Proc. Natl. Acad. Sei USA 90: 10370) and TAIL-PCR (Liu YG . et al. (1995) Plant J. 8: 457-463) using genomic DNA (isolated according to the standard method from Tagetes erecta, Orange Prince line, isolated). For the inverse PCR approach, 2 μg of genomic DNA were digested in a 25 μl reaction mixture with EcoRV and Rsal, then diluted to 300 μl and religated with 3U ligase at 16 ° C. overnight. Using the primers PR50 (SEQ ID NO: 64) and PR51 (SEQ ID NO: 65), a fragment was produced by PCR amplification which, in each sense orientation, 354 bp of the epsilon cyclase cDNA (Genbank Accession AF251016), ligated to 300 bp of the epsilon cyclase promoter and 70 bp of the 5'terminal region of the cDNA containing epsilon cyclase (see Figure 16).

The conditions of the PCR reactions were as follows:

The PCR for the amplification of the PR50-PR51 DNA fragment, which contains, among other things, the 312 bp promoter fragment of epsilon cyclase, was carried out in a 50 μl reaction mixture which contained:

- 1 μl ligation mixture (prepared as described above)

- 0.25 mM dNTPs

- 0.2 μM PR50 (SEQ ID NO: 64) - 0.2 μM PR51 (SEQ ID NO: 65)

- 5 μl 10X PCR buffer (TAKARA)

- 0.25 μl R Taq polymerase (TAKARA)

- 28.8 μl Aq. Least.

The PCR reactions were carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute 53 ° C 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes

PCR amplification with primers PR50 and PR51 resulted in a 734 bp fragment that contains, among other things, the 312 bp promoter fragment of epsilon cyclase (Figure 16).

The amplificate was cloned into the PCR cloning vector pCR2.1 (Invitrogen) using standard methods. Sequencing with the primers Ml3 and T7 resulted in the sequence SEQ ID NO: 45. This sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Tagetes erecta line Orange Prince used. For the TAIL-PCR approach, three successive PCR reactions were carried out, each with different gene-specific primers (nested primers).

The TAILl-PCR was carried out in a 20 μl reaction mixture, which contained:

1ng of genomic DNA (prepared as described above) 0.2mM each dNTP

0.2 μM PR60 (SEQ ID NO: 66) 0.2 μM AD1 (SEQ ID NO: 69)

2 μl 10X PCR buffer (TAKARA) 0.5 U R Taq polymerase (TAKARA) with Aq. Destilled to 20 μl

- AD1 initially represented a mixture of primers of the sequences (a / c / g / t) tcga (g / c) t (a / t) t (g / c) g (a / t) gtt.

The PCR reaction TAIL1 was carried out under the following cycle conditions:

IX 93 ° C 1 minute, 95 ° C: 1 minute

5X 94 ° C 30 seconds, 62 ° C: 1 minute, 72 ° C: 2.5 minutes

IX 94 ° C 30 seconds, 25 ° C: 3 minutes, ramp to 72 ° C in 3 minutes,

72 ° C 2.5 minutes

15X 94 ° C 10 seconds, 68 ° C 1 minute, 72 ° C: 2.5 minutes;

94 ° C 10 seconds, 68 ° C 1 minute, 72 ° C: 2.5 minutes;

94 ° C 10 seconds, 29 ° C 1 minute, 72 ° C: 2.5 minutes

IX 72 ° C 5 minutes

The TAIL2-PCR was carried out in a 21 μl reaction mixture, which contained:

- 1 μl of a 1:50 dilution of the TAILl reaction mixture (prepared as described above)

- 0.8 mM dNTP

- 0.2 μM PR61 (SEQ ID NO: 67)

- 0.2 μM ADl (SEQ ID NO: 69)

- 2 μl 10X PCR buffer (TAKARA) - 0.5 U R Taq polymerase (TAKARA)

- with Aq. Destilled to 21 μl The PCR reaction TAIL2 was carried out under the following cycle conditions:

12X 94 ° C: 10 seconds, 64 ° C 1 minute, 72 ° C 2.5 minutes; 94 ° C: 10 seconds, 64 ° C for 1 minute, 72 ° C for 2.5 minutes;

94 ° C: 10 seconds, 29 ° C 1 minute, 72 ° C 2.5 minutes

IX 72 ° C: 5 minutes

The TAIL3-PCR was carried out in a 100 μl reaction mixture, which included:

- 1 μl of a 1:10 dilution of the TAIL2 reaction mixture (prepared as described above)

- 0.8 mM dNTP

- 0.2 μM PR63 (SEQ ID NO: 68)

- 0.2 μM ADl (SEQ ID NO: 69)

- 10 μl 10X PCR buffer (TAKARA)

- 0.5 U R Taq polymerase (TAKARA) - with Aq. Filled to 100 μl

The PCR reaction TAIL3 was carried out under the following cycle conditions:

20X 94 ° C: 15 seconds, 29 ° C: 30 seconds, 72 ° C: 2 minutes IX 72 ° C: 5 minutes

The PCR amplification with primer PR63 and ADl resulted in a 280 bp fragment which contains, among other things, the 199 bp promoter fragment of the epsilon cyclase (Figure 17).

The amplificate was cloned into the PCR cloning vector pCR2.1 (Invitrogen) using standard methods. Sequencing with the primers M13 and T7 resulted in the sequence SEQ ID NO: 46. This sequence is identical to the sequence SEQ ID NO: 45, which was isolated using the IPCR strategy and thus represents the nucleotide sequence in the Tagetes erecta line Orange Prince used.

The pCR2.1 clone that contains the 312 bp fragment (SEQ ID NO: 45) of the

Epsilon cyclase promoter, which was isolated by the IPCR strategy, is called pTA-ecycP and was used for the production of the IR constructs. Example 14

Production of an inverted repeat expression cassette for the flower-specific expression of epsilon cyclase dsRNAs in Tagetes erecta (directed against the promoter region of the epsilon cyclase cDNA).

The expression of inverted repeat transcripts consisting of promoter fragments of the epsilon cyclase in Tagetes erecta was carried out under the control of a modified version AP3P of the flower-specific promoter AP3 from Arabidopsis (see Example 10) or the flower-specific promoter CHRC (gene bank accession NO: AF099501). The inverted repeat transcript contains an epsilon cyclase promoter fragment in the correct orientation (sense fragment) and a sequence-identical epsilon cyclase promoter fragment in the opposite orientation (antisense fragment), which are linked together by a functional intron (see Example 10) are connected.

The promoter fragments were analyzed by means of PCR using plasmid DNA (clone pTA-ecycP, see Example 13) and the primers PR124 (SEQ ID NO: 70) and PR126 (SEQ ID NO: 72) and the primer PR125 (SEQ ID NO : 71) and PR127 (SEQ ID NO: 73).

The conditions of the PCR reactions were as follows:

The PCR for the amplification of the PR124-PR126 DNA fragment, which contains the promoter fragment of epsilon cyclase, was carried out in a 50 μl reaction mixture, which contained:

- 1 ul cDNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 μM PR124 (SEQ ID NO: 70)

- 0.2 μM PR126 (SEQ ID NO: 72)

- 5 μl 10X PCR buffer (TAKARA) - 0.25 μl R Taq polymerase (TAKARA)

- 28.8 uμl Aq. Least.

The PCR for the amplification of the PR125-PR127 DNA fragment, which contains the 312bp promoter fragment of epsilon cyclase, was carried out in a 50 μl reaction mixture which contained:

- 1 ul cDNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 μM PR125 (SEQ ID NO: 71) - 0.2 μM PR127 (SEQ ID NO: 73)

- 5 μl 10X PCR buffer (TAKARA)

- 0.25 μl R Taq polymerase (TAKARA) - 28 8 ul Aq. Dest.

The PCR reactions were carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

53 ° C for 1 minute

72 ° C 1 minutes IX 72 ° C 10 minutes

PCR amplification with primers PR124 and PR126 resulted in a 358 bp fragment, PCR amplification with primers PR125 and PR127 resulted in a 361 bp fragment.

The two certificates, the PR124-PR126 (HindIII-Sall sense) fragment and the PR125-PR127 (EcoRI-BamHI antisense) fragment, were cloned into the PCR cloning vector pCR-BluntII (Invitrogen) using standard methods. Sequencing with the primer SP6 each confirmed a sequence which, apart from the restriction sites introduced, is identical to SEQ ID NO: 45. These clones were therefore used for the production of an inverted repeat construct in the cloning vector pJAII (see Example 10).

The first cloning step was carried out by isolating the 358 bp PR124-PR126 HindIII-SalI fragment from the cloning vector pCR-BluntII (Invitrogen) and ligation with the BamHI-EcoRI cut vector pJAII. The clone that contains epsilon cyclase pro oter fragment in the sense orientation is called cs43. The sense fragment of the epsilon cyclase promoter is inserted between the AP3P promoter and the intron by the ligation.

The second cloning step was carried out by isolating the 36 lbp PR125-PR127 BamHI-EcoRI fragment from the cloning vector pCR-BluntII (Invitrogen) and ligation with BamHI-EcoRI cut vector cs43. The clone that contains the epsilon cyclase promoter fragment in the antisense orientation is called cs44. The ligation creates a transcriptional fusion between the intron and the antisense fragment of the epsilon cyclase promoter.

For the production of an inverted repeat expression cassette under the control of the CHRC promoter, a CHRC promoter fragment using genomic DNA from petunia (produced according to standard methods) and the primers PRCHRC3 '(SEQ ID NO: 77) and PRCHRC5' ( SEQ ID NO: 76). The amplificate was cloned into the cloning vector pCR2.1 (Invitrogen). sequencing The resulting clone pCR2.1-CHRC with the primers Ml3 and T7 confirmed a sequence identical to the sequence AF099501. This clone was therefore used for the cloning into the expression vector cs44.

The cloning was carried out by isolating the 1537 bp Sacl-Hindlll fragment from pCR2.1-CHRC and ligation into the Sacl-Hindlll cut vector cs44. The clone that contains the promoter CHRC instead of the original promoter AP3P is called cs45.

For the production of an inverted repeat expression cassette under the control of two promoters, the CHRC promoter and the AP3P promoter, the AP3P promoter was cloned in cs45 in antisense orientation at the 3 'terminus of the epsilon-cyclase antisense fragment. The AP3P promoter fragment from pJAII was amplified using the primers PR128 and PR129. The amplificate was cloned into the cloning vector pCR2.1 (Invitrogen). The sequencing with the primers Ml3 and T7 confirmed a sequence identical to the sequence SEQ ID NO: 28 (AL132971). This clone pCR2.1-AP3PSX was used to produce an inverted repeat expression cassette under the control of two promoters.

The cloning was carried out by isolating the 771 bp Sal-Xhol fragment from pCR2.1-AP3PSX and ligation into the Xhol-cut vector cs45. The clone that contains the promoter AP3P in the antisense orientation on three sides of the inverted repeat is called cs46.

The expression vectors for the Agrobacterium -mediated transformation of the AP3P-controlled inverted-repeat transcript in Tagetes erecta were produced using the binary vector pSUN5 (WO02 / 00900).

To produce the expression vector pS5AI7, the 1685bp Sacl-Xhol fragment from cs44 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 18, construct map). In Figure 18, fragment AP3P contains the modified AP3P promoter (771 bp), fragment P-sense the 312 bp promoter fragment of the epsilon cyclase in sense orientation, fragment intron the intron IV2 of the potato gene ST-LSI), and fragment P- anti the 312 bp promoter fragment of the epsilon cyclase in antisense orientation.

To produce the expression vector pS5CI7, the 2445bp Sacl-Xhol fragment from cs45 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 19, construct map). In Figure 19, fragment CHRC contains the CHRC promoter (1537 bp), fragment P-sense the 312 bp promoter fragment of epsilon cyclase in sense orientation, fragment intron the intron IV2 of the potato gene ST-LSI), and fragment P- anti the 312 bp promoter fragment of the epsilon cyclase in antisense orientation.

To produce the expression vector pS5CAI7, the 3219bp Sacl-Xhol fragment from cs46 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 20, construct map)

In Figure 20, fragment CHRC contains the CHRC promoter (1537 bp), fragment P-sense the 312 bp promoter fragment of epsilon cyclase in sense orientation, fragment intron the intron IV2 of the potato gene ST-LSI), fragment P ~ anti the 312 bp promoter fragment of the epsilon cyclase in antisense orientation and the fragment AP3P the 771 bp AP3P promoter fragment in antisense orientation.

Example 15 Production of transgenic tagetes plants with reduced ε-cyclase activity

Day tea seeds are sterilized and placed on germination medium (MS medium; Murashige and Skoog, Physiol. Plant. 15 (1962), 473-497) pH 5.8, 2% sucrose). Germination takes place in a temperature / light / time interval of 18 to 28 ° C / 20 to 200 μE /

3 to 16 weeks, but preferably at 21 ° C, 20 to 70 μE, for

4 to 8 weeks.

All leaves of the in vitro plants that had developed up to that point are harvested and cut across the midrib. The resulting leaf explants with a size of 10 to 60 mm ² are kept in the course of the preparation in liquid MS medium at room temperature for a maximum of 2 h.

The Agrobacterium tumefaciens strain EHA105 was transformed with the binary plasmid pS5AI3. The transformed A. tumefaciens strain EHA105 was grown overnight under the following conditions: A single colony was grown in YEB (0.1% yeast extract, 0.5% beef extract, 0.5% peptone, 0.5% sucrose, 0.5% Magnesium sulfate x 7 H 0) inoculated with 25 mg / l kanamycin and tightened at 28 ° C for 16 to 20 h. The bacterial suspension was then harvested by centrifugation at 6000 g for 10 min and resuspended in liquid MS medium which gave an OD ₅₀₀ of approximately 0.1 to 0.8. This suspension was used for the co-cultivation with the leaf material. Immediately before the co-cultivation, the MS medium in which the leaves have been kept is replaced by the bacterial suspension. The leaves were incubated in the agrobacterial suspension for 30 min with gentle shaking at room temperature. The infected explants are then placed on an MS medium solidified with agar (for example 0.8% Plant Agar (Duchefa, NL) with growth regulators, such as 3 mg / l benzylamino-purine (BAP) and 1 mg / l indolylacetic acid (IAA) The orientation of the leaves on the medium is insignificant. The explants are cultivated for 1 to 8 days, but preferably for 6 days, the following conditions can be used: light intensity: 30 to 80 μmol / m ² x sec, temperature : 22 to 24 ° C., light / dark change of 16/8 hours, after which the co-cultivated explants are transferred to fresh MS medium, preferably with the same growth regulators, this second medium additionally containing an antibiotic to suppress bacterial growth Timentin in a concentration of 200 to 500 mg / l is very suitable for this purpose, as a second selective component one is used for the selection of the transformation success Phosphinothricin in a concentration of 1 to 5 mg / l selects very efficiently, but other selective components according to the method to be used are also conceivable.

After one to three weeks, the transfer takes place

Explants on fresh medium until shoot buds and small shoots develop, which then on the same basal medium including timentin and PPT or alternative components with growth regulators, e.g. 0.5 mg / l indolylbutyric acid (IBA) and 0.5 mg / l gibberillic acid GA, can be transferred for rooting. Rooted shoots can be transferred to the greenhouse.

Before the explants are infected with the bacteria, they can be preincubated for 1 to 12 days, preferably 3 to 4, on the medium described above for the co-culture. The infection, co-culture and selective regeneration then take place as described above.

• The pH value for regeneration (normally 5.8) can be lowered to pH 5.2. This improves the control of agrobacterial growth. • The addition of AgN0 ₃ (3 - 10 mg / l) to the regeneration medium improves the condition of the culture including the regeneration itself.

5 • Components that reduce phenol formation and the

Are known to those skilled in the art, e.g. Citric acid, ascorbic acid, PVP and many more have a positive effect on the culture.

Liquid culture medium 10 can also be used for the entire process. The culture can also be found on commercial

Carriers that are positioned on the liquid medium are incubated.

According to the transformation method described above, the following lines were obtained with the expression construct pS5Al3:

CS30-1, CS30-3 and CS30-4

_ ₀ Example 16:

Characterization of the transgenic Tagetes plants with reduced ε-cyclase activity

The flower material of the transgenic Tagetes erecta plants from "_ Example 15 was ground in liquid nitrogen and that

Powder (about 250 to 500 mg) extracted with 100% acetone (three times 500 μl each). The solvent was evaporated and the carotenoids resuspended in 100 ul acetone.

Using a C30 reverse phase column, the individual

30 carotenoids can be quantified. The HPLC running conditions were almost identical to a published method (Frazer et al. (2000), Plant Journal 24 (4): 551-558). Identification of the carotenoids was possible on the basis of the UV-VIS spectra.

35

Table 2 shows the carotenoid profile in day tetals of the transgenic tagetes and control day plants produced according to the examples described above. All carotenoid amounts are given in [µg / g] fresh weight, percentage changes

40 compared to the control plant are given in brackets.

Compared to the genetically unmodified control plant, the genetically modified plants with reduced epsilon cyclase activity have a significantly higher content

45 carotenoids of the "ß-carotene pathway", such as ß-carotene and zeaxanthin and a significantly reduced content of Carotenoids of the "carotene pathway", such as lutein.

Table 2

Example 17:

Characterization of transgenic daytime plants that accumulate astaxanthin in petals

The flower material of the transgenic Tagetes erecta plants (from example 7 with plasmid pS5AP3PKET02) is ground in liquid nitrogen and the powder (about 30-100 mg) extracted with 100% acetone (three times 500 ul each). The solvent is evaporated, the carotenoids are resuspended in 30 μl of petroleum ether: acetone (ratio 5: 1) and separated on a silica thin-layer plate. Day tea plants with additional red carotenoid bands, which do not occur in control plants, were selected for preparative-analytical analyzes. See Example 9 for analytical details.

The individual carotenoids were quantified using a C30 reverse phase column. See Example 9 for analytical details.

Table 3 shows the carotenoid profile in day tetals of the transgenic tagetes and control day plants produced according to the examples described above. Carotenoid concentrations are based on the total carotenoid content.

Compared to the genetically unmodified control plants, the genetically modified plants that express a ketolase have an astaxanthin content. Table 3: Percentage of carotenoids in astaxanthin-synthesizing tagetes and control plants

Beta / 3'- 3- _τ , Ant- ^Ta £ j ^s hera- ZeaCrypto- zeta- Asta- Adoni-Hydroxy-Hydroxy-

Lutein xanthine xanthine caroxanthine ruby echine-echine- "xanthine tene none none control 1.5 93.6 1.2 0.3 3.8 es 19-3 1.3 94.2 1.1 0.3 3, 5 0.1 0.05 0.01 CHRC ::

1.3-1.5 93.5-94.4 0.9-1.7 0.01-0.02 2-3.1 0.3-0.9 0.03-0.2 0.2 0-0.01 Ketolase DFR-A: keto4.5 91.8 1.1 2.4 0.2 0.02 0.07 lase

Example 18:

Characterization of transgenic daily plants that have a reduced lutein concentration and accumulate astaxanthin in petals

Tagetes plants that synthesize astaxanthin by using the AP3P promoter and ketolase from Haematococcus in petals (see experimental details on pS5AP3PKET02 in Example 5A) and Tagetes plants that by using the RNAi construct pS5AI3 (see Example 11, Figure 13) using AP3P Promoters accumulating lower amounts of lutein were crossed. Seeds were sprouted and the offspring analyzed on a molecular biological and biochemical basis.

The presence of the corresponding expression cassettes is examined by genomic PCR. For this purpose, young leaf material is harvested and used to isolate genomic DNA.

The integrity of the DNA preparation is determined by amplifying an endogenous gene segment from the Tagetes ecyclase, which is not contained in any of the expression cassettes, using forward primer PR29 (PR29: 5 '-cccattctcataggtcgtgc-3') and reverse primer PR78 (PR78: 5 '-gcaagcctgcatggaattgtg -3 ') checked. With intact genomic DNA, this PCR reaction results in a 0.6 kb fragment.

The ketolase expression cassette can be detected by genomic PCR using forward primer PR7 (PR7: 5 '-gagctcactcactgatttc-cattgcttg-3') and reverse primer PR185 (PR185: 5 '-cattaagetgt-ctgtttctca-3'). This PCR reaction leads to the production of a 0.4 kb fragment in the presence, not in the absence, of the ketolase expression cassette. The ecyclase downregulation cassette can be detected by genomic PCR using forward primer PR7 and reverse primer PR41 (PR41: 5 '-ggatccggtgatacctgcacatcaac-3'). This PCR reaction results in the production of a 1.4 kb fragment when the 5 ecyclase downregulation cassette is present / not in the absence.

The conditions of the PCR reactions are as follows:

10 The PCR for amplification of the described fragments is carried out in a 50 ul? Reaction approach, which includes:

1 ul? cDNA (prepared as described above) 0.25 mM dNTPs 15 - 0.2 uM respective forward primer - 0.2 uM respective forward primer 5 ul? 10X PCR buffer (TAKARA) 0.25 ul? R Taq Polymerase (TAKARA) 28.8 ul? Aq. Least.

20

The PCR reactions are carried out under the following cycle conditions and then agarose gel electrophoresis is analyzed.

25 IX 94 ^a C 2 minutes

35X 94 ² C 1 minute

58 ² C 1 minutes

72 ^a C 1 minutes

IX 72 ^a C 10 minutes

30

For the biochemical screening, the flower material of the Tagetes erecta plants is ground in liquid nitrogen and the powder (about 30 to 100 mg) extracted with 100% acetone (three times 500 ul each). The solvent is evaporated, the carotenoids in

35 30 μl of petroleum ether-acetone (ratio 5: 1) and resuspended on a silica thin-layer plate. Day tea plants with red carotenoid bands that suggest astaxanthine synthesis and at the same time less intense bands for lutein esters (one of the most mobile bands near the solvent front)

40 were selected for preparative-analytical analyzes. The individual carotenoids could be quantified by means of ester hydrolysis by lipase treatment and separation of the carotenoid mixture by means of HPLC. See Example 9 for analytical details.

45 Table 4 shows the carotenoid profile in day tetals of the transgenic day plants produced by crossing according to the examples described above. Carotenoid concentrations are based on the total carotenoid content.

Compared to the genetically unmodified control plants, the genetically modified plants with reduced epsilon cyclase activity and simultaneous synthesis of astaxanthin i) have a significantly increased content of carotenoids of the “β-carotene pathway”, such as, for example, β-carotene and zeaxanthin, ii ) a significantly reduced content of carotenoids of the "carotene pathway", such as lutein, and iii) accumulation of astaxanthin.

Table 4: Percent carotenoid concentrations in transgenic Tagetes and control plants

Viola ZeaBeta / 3'- 3-

Tagetes anthera- crypto- astaxan-lutein xanzeta-hydroxy-hydroxy- plant xanthine xanthine xanthine thin thin carotenes echinenone echinenone control 1.5 93.6 1.2 0.3 3.8

T109-26 0.6 2.1 65.9 10.4 0.1 19.9 0.3 0.7 0.08

T 105-8 3 67.3 8.2 0.1 20.7 0.05 0.4

T112-5 2.1 48.4 43.6 0.08 5.3 0.05 0.5

Example 19:

Amplification of a DNA that contains the entire primary sequence of the

NP196 ketolase encoded from Nostoc punctiform ATCC 29133

The DNA coding for the NPl96 ketolase from Nostoc punctiform ATCC 29133 was amplified by means of PCR from Nostoc punctiform ATCC 29133 (strain of the "American Type Culture Collection").

For the preparation of genomic DNA from a suspension culture of Nostoc punctiforme ATCC 29133, which is 1 week with continuous light and constant shaking (150 rpm) at 25 ° C in BG 22 medium (1.5 g / l NaN0 ₃ , 0.04 g / l K ₂ P0 ₄ x3H ₂ 0, 0.075 g / l MgS0 ₄ xH ₂ 0, 0.036 g / l CaClx2H0, 0.006 g / l citric acid, 0.006 g / l Ferric ammonium citrate, 0.001 g / l EDTA disodium magnesium, 0 , 04 g / l Na ₂ C0 ₃ , 1 ml Trace Metal Mix "A5 + Co" (2.86 g / l H ₃ B0 ₃ , 1.81 g / l MnCl ₂ x4H ₂ o, 0.222 g / l ZnSO ₄ x7H ₂ 0, 0.39 g / l NaMo0 ₄ X2H ₂ o, 0.079 g / l CuS0 ₄ x5H ₂ 0, 0.0494 g / l Co (N0) ₂ x6H0), the cells were harvested by centrifugation, in frozen liquid nitrogen and pulverized in a mortar. Protocol for DNA isolation from Nostoc punctiform ATCC 29133:

The bacterial cells were pelleted from a 10 ml liquid culture by centrifugation at 8000 rpm for 10 minutes. The bacterial cells were then crushed and ground in liquid nitrogen using a mortar. The cell material was resuspended in 1 ml 10 mM Tris_HCl (pH 7.5) and transferred into an Eppendorf reaction vessel (2 ml volume). After adding 100 μl proteinase K (concentration: 20 mg / ml), the cell suspension was incubated for 3 hours at 37 ° C. The suspension was then extracted with 500 μl of phenol. After centrifugation at 13,000 rpm for 5 minutes, the upper, aqueous phase was transferred to a new 2 ml Eppendorf reaction vessel. The extraction with phenol was repeated 3 times. The DNA was precipitated by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 0.6 volume of isopropanol and then washed with 70% ethanol. The DNA pellet was dried at room temperature, taken up in 25 μl of water and dissolved with heating to 65 ° C.

The nucleic acid encoding a ketolase from Nostoc punctiform ATCC 29133 was determined by means of a "polymerase chain reaction" (PCR) from Nostoc punctiform ATCC 29133 using a sense-specific primer (NP196-1, SEQ ID No. 129) and an antisense-specific Primers (NP196-2 SEQ ID No. 130) amplified.

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture which contained:

1 µl of a Nostoc punctiform ATCC 29133 DNA (prepared as described above) - 0.25 mM dNTPs

0.2 mM NP196-1 (SEQ ID No. 129)

0.2 mM NP196-2 (SEQ ID No. 130)

5 ul 10X PCR buffer (TAKARA)

0.25 ul R Taq polymerase (TAKARA) - 25.8 ul Aq. Least. The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute 55 ° C 1 minute

72 ° C for 3 minutes

IX 72 ° C 10 minutes

PCR amplification with SEQ ID No. 129 and SEQ ID No. 130 resulted in a 792 bp fragment which codes for a protein consisting of the entire primary sequence (NP196, SEQ ID No. 131). Using standard methods, the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNP196 was obtained.

Sequencing of the clone pNPl96 with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence from 140.571-139.810 of the database entry NZ_AABC01000196 (inverse to the published database entry) with the exception that G in position 140.571 was replaced by A to create a standard start codon ATG. This nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nostoc punctiforme ATCC 29133 used.

This clone pNPl96 was therefore used for the cloning into the expression vector pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380).

pJITH7 was modified by the 35S terminator through the OCS terminator (octopine synthase) of the Ti plasmid pTil5955 from Agrobacterium tumefaciens (database entry X00493 from position 12.541-12.350, Gielen et al. (1984) EMBO J. 3 835-846) was replaced.

The DNA fragment containing the OCS terminator region was PCR-isolated using the plasmid pHELLSGATE (database entry AJ311874, Wesley et al. (2001) Plant J. 27 581-590, isolated from E. coli by standard methods) and the primer OCS-1 (SEQ ID No. 133) and OCS-2 (SEQ ID No. 134).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which contains the octopine synthase (OCS) terminator region (SEQ ID No. 135), was carried out in a 50 μl reaction mixture, which contained: 100ng pHELLSGATE plasmid DNA 0.25mM dNTPs

0.2 mM OCS-1 (SEQ ID No. 133) 0.2 mM OCS-2 (SEQ ID No. 134) - 5 ul? 10X PCR buffer (Stratagene) - 0.25 ul? Pfu Polymerase (Stratagene) 28.8 ul? Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

50 ° C for 1 minute

72 ° C 1 minute IX 72 ° C 10 minutes

The 210 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pOCS was obtained.

Sequencing of the clone pOCS confirmed a sequence which corresponds to a sequence section on the Ti plasmid pTil5955 from Agrobacterium tumefaciens (database entry X00493) from positions 12,541 to 12,350.

The cloning was carried out by isolating the 210 bp Sall-Xhol fragment from pOCS and ligation into the Sall-Xhol cut vector pJIT117.

This clone is called pJO and was therefore used for the cloning into the expression vector pJONPl96.

The cloning was carried out by isolating the 782 bp Sphl fragment from pNPl96 and ligating into the SphI cut vector pJO. The clone which contains the NPl96 ketσlase from Nostoc punctiforme in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJONPl96.

Example 20: Production of expression vectors for the constitutive expression of the NPl96 ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum and Tagetes erecta.

The expression of the NP196 ketolase from Nostoc punctiforme in L. esculentum and in Tagetes erecta was carried out under the control of the constitutive promoter FNR (ferredoxin-NADPH oxidoreductase, database entry AB011474 position 70127 to 69493; WO03 / 006660), from Arabidopsis thaliana. The FNR gene begins at base pair 69492 and is annotated with "ferredoxin-NADP + reductase". Expression was carried out using the pea transit peptide rbcS (Anderson et al. 1986, Biochem J. 240: 709-715).

The DNA fragment containing the FNR promoter region from Arabidopsis thaliana was PCR-analyzed using genomic DNA (isolated from Arabidopsis thaliana according to standard methods) and the primers FNR-1 (SEQ ID No. 136) and FNR-2 (SEQ ID No. 137).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which contains the FNR promoter fragment FNR (SEQ ID No. 138), was carried out in a 50 μl reaction mixture which contained:

100 ng of genomic DNA from A. thaliana 0.25 mM dNTPs - 0.2 mM FNR-1 (SEQ ID No. 136) 0.2 mM FNR-2 (SEQ ID No. 137) 5 ul? 10X PCR buffer (Stratagene)

- 0.25 ul? Pfu Polymerase (Stratagene) 28.8 ul? Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute 50 ° C 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes

The 652 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pFNR was obtained.

Sequencing of the clone pFNR confirmed a sequence which corresponds to a sequence section on chromosome 5 of Arabidopsis thaliana (database entry AB011474) from position 70127 to 69493.

This clone is called pFNR and was therefore used for the cloning into the expression vector pJONPl96 (described in Example 19). The cloning was carried out by isolating the 644 bp Smal-HindIII fragment from pFNR and ligating into the vector pJONPl96 cut from Ecll36II-HindIII. The clone which contains the promoter FNR instead of the original promoter d35S and the fragment NP196 in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJOFNR: NP196.

The production of an expression cassette for the Agrobacterium-mediated transformation of the NPl96 ketolase from Nostoc into L. esculentum was carried out using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector MSP105, the 1,839 bp EcoRI-Xhol fragment from pJOFNR: NPl96 was ligated with the EcoRI-Xhol cut vector pSUN3 (Figure 22, construct map). In Figure 22, fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP196 KETO CDS (761 bp), coding for the nostoc punctiform NP196 ketolase, fragment OCS Terminator (192 bp) the polyadenylation signal from the octopine synthase.

An expression cassette for the Agrobacterium -mediated transformation of the expression vector with the NPl96 ketolase from Nostoc punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).

The 1,839 bp EcoRI-Xhol fragment from pJOFNR: NPl96 was ligated with the EcoRI-Xhol cut vector pSUN5 to generate the Tagetes expression vector MSP106 (Figure 23, construct map). In Figure 23, fragment FNR promoter contains the FΝR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP196 KETO CDS (761 bp), coding for the nostoc punctiform ΝPl96 ketolase, fragment OCS Terminator (192 bp) the polyadenylation signal of octopine synthase.

Example 21:

Production of expression vectors for the flower-specific expression of the NPl96 ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum and Tagetes erecta

The NPl96 ketolase from Nostoc punctiforme in L. esculentum and Tagetes erecta was expressed using the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715). The expression was carried out under the control of the flower-specific promoter EPSPS from Petunia hybrida (database entry M37029: Nucleotide region 7-1787; Benfey et al. (1990) Plant Cell 2: 849-856).

The DNA fragment, which contains the EPSPS promoter region (SEQ ID No. 141) from Petunia hybrida, was PCR-analyzed using genomic DNA (isolated from Petunia hybrida according to standard methods) as well as the primer EPSPS-1 (SEQ ID No. 139) and EPSPS -2 (SEQ ID No. 140).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which contains the EPSPS promoter fragment (database entry M37029: nucleotide region 7-1787), was carried out in a 50 μl reaction mixture which contained:

100 ng genomic DNA from A. thaliana 0.25 mM dNTPs

0.2 mM EPSPS-1 (SEQ ID No. 139) 0.2 mM EPSPS-2 (SEQ ID No. 140) - 5 ul? 10X PCR buffer (Stratagene)

0.25 ul? Pfu Polymerase (Stratagene) 28.8 ul? Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

50 ° C for 1 minute

72 ° C 2 minutes IX 72 ° C 10 minutes

The 1773 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pEPSPS was obtained.

Sequencing of the clone pEPSPS confirmed a sequence which can only be distinguished by two deletions (bases ctaagtttcagga in position 46-58 of sequence M37029; bases aaaaatat in positions 1422-1429 of sequence M37029) and the base changes (T instead of G in position 1447) Sequence M37029; A instead of C in position 1525 of sequence M37029; A instead of G in position 1627 of sequence M37029) differs from the published EPSPS sequence (database entry M37029: nucleotide region 7-1787). The two deletions and the two base changes at positions 1447 and 1627 of sequence M37029 were carried out in an independent amplification experiment reproduces and thus represents the actual nucleotide sequence in the Petunia hybrida plants used.

The clone pEPSPS was therefore used for the cloning into the expression vector pJONP196 (described in Example 19).

The cloning was carried out by isolating the 1763 bp SacI-HindIII fragment from pEPSPS and ligation into the SacI-HindIII cut vector pJ0NPl96. The clone that contains the promoter EPSPS instead of the original promoter d35S is called pJOESP: NP196. This expression cassette contains the fragment NP196 in the correct orientation as an N-terminal fusion with the rbcS transit peptide.

The production of an expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NPigδ-ketolase from Nostoc punctiforme ATCC 29133 in L. esculentum was carried out using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector MSP107, the 2,961 KB bp Sacl-Xhol fragment from pJOESP: NP196 was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 24, construct map). In Figure 24, fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP196 KETO CDS (761 bp), coding for the Nostoc punctiform NP196 ketolase, fragment OCS terminator (192 bp) the polyadenylation signal of octopine synthase.

An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NPl96 ketolase from Nostoc punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).

To produce the expression vector MSP108, the 2,961 KB bp Sacl-Xhol fragment from pJOESP: NP196 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 25, construct map). In Figure 25, fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP196 KETO CDS (761 bp), coding for the Nostoc punctiform NPl96 ketolase, fragment OCS terminator (192 bp) the polyadenylation signal of octopine synthase. Example 22:

Amplification of a DNA that contains the entire primary sequence of the

NPl95 ketolase from Nostoc punctiform ATCC 29133 coded

5 The DNA coding for the NPl95 ketolase from Nostoc punctiform ATCC 29133 was amplified by means of PCR from Nostoc punctiform ATCC 29133 (strain of the "American Type Culture Collection"). The preparation of genomic DNA from a suspension culture of Nostoc punctiforme ATCC 29133 was described in Example 10 19.

The nucleic acid encoding a ketolase from Nostoc punctiform ATCC 29133 was determined by means of a "polymerase chain reaction" (PCR) from Nostoc punctiform ATCC 29133 using a sense-specific primer (NP195-1, SEQ ID No. 142) and one antisense-specific primers (NP195-2 SEQ ID No. 143) amplified.

The PCR conditions were as follows:

20 The PCR for the amplification of the DNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture which contained:

1 µl of a Nostoc punctiform ATCC 29133 DNA (prepared as described above 25)

0.25 M dNTPs

0.2 mM NP195-1 (SEQ ID No. 142)

0.2 mM NP195-2 (SEQ ID No. 143)

5 ul 10X PCR buffer (TAKARA) 30-0.25 ul R Taq polymerase (TAKARA)

25.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

35 IX 94 ° C 2 minutes

35X 94 ° C 1 minute

55 ° C for 1 minute

72 ° C for 3 minutes

IX 72 ° C 10 minutes

40

PCR amplification with SEQ ID No. 142 and SEQ ID No. 143 resulted in an 819 bp fragment which codes for a protein consisting of the entire primary sequence (NP195, SEQ ID No. 144). Using standard methods, the amplificate was cloned into the 45 PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNP195 was obtained. Sequencing of clone pNPl95 with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence from 55.604-56.392 of database entry NZ_AABC010001965, with the exception that T in position 55.604 was replaced by A. to create a standard start codon ATG. This

Nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nostoc punctiforme ATCC 29133 used.

This clone pNPl95 was therefore used for the cloning into the expression vector pJO (described in Example 19). The cloning was carried out by isolating the 809 bp Sphl fragment from pNPl95 and ligation into the SphI-cut vector pJO. The clone that contains the NPl95 ketolase from Nostoc punctiforme in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJONPl95.

Example 23:

Production of expression vectors for the constitutive expression of the NPl95 ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum and Tagetes erecta.

Expression of NPl95 ketolase from Nostoc punctiforme in

L. esculentum and in Tagetes erecta took place under the control of the constitutive promoter FNR (ferredoxin-NADPH-oxidoreductase,

Database entry AB011474 position 70127 to 69493; WO03 / 006660), from Arabidopsis thaliana. The FNR gene begins at base pair 69492 and is annotated with "ferredoxin-NADP-t reductase". Expression was carried out using the pea transit peptide rbcS (Anderson et al. 1986, Biochem J. 240: 709-715).

The clone pFNR (described in Example 20) was therefore used for the cloning into the expression vector pJONPl95 (described in Example 22).

The cloning was carried out by isolating the 644 bp Sma-Hindlll fragment from pFNR and ligating into the Ecll36ll-Hindlll cut vector pJONPl95. The clone which contains the promoter FNR instead of the original promoter d35S and the fragment NP195 in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJOFNR: NPl95.

An expression cassette for the Agrobacterium-mediated transformation of the NPl95 ketolase from Nostoc puncti-form in L. esculentum was produced using the binary vector pSUN3 (WO02 / 00900). To produce the expression vector MSP109, the 1,866 bp EcoRI-Xhol fragment from pJOFNR: NPl95 was ligated with the EcoRI-Xhol cut vector pSUN3 (Figure 26, construct map). In Figure 26, fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (789 bp), coding for the nostoc punctiform NPl95 ketolase, fragment OCS Terminator (192 bp) the polyadenylation signal from the octopine synthase.

An expression cassette for the Agrobacterium -mediated transformation of the expression vector with the NP195 ketolase from Nostoc punctiforme punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO 02/00900).

To generate the Tagetes expression vector MSP110, the 1,866 bp EcoRI-Xhol fragment from pJOFNR: NPl95 was ligated with the EcoRI-Xhol cut vector pSUN5 (Figure 27, construct map). In Figure 27 fragment FNR promoter contains the FΝR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (789 bp), coding for the nostoc punctiform NPl95 ketolase, fragment OCS Terminator (192 bp) the polyadenylation signal of octopine synthase.

Example 24:

Production of expression vectors for the flower-specific expression of the NPl95 ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum and Tagetes erecta.

The expression of the NP195 ketolase from Nostoc punctiforme in L. esculentum and Tagetes erecta was carried out with the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715). The expression was carried out under the control of the flower-specific promoter EPSPS from Petunia hybrida (database entry M37029: nucleotide region 7-1787; Benfey et al. (1990) Plant Cell 2: 849-856).

The clone pEPSPS (described in Example 21) was therefore used for the cloning into the expression vector pJONPl95 (described in Example 22).

The cloning was carried out by isolating the 1763 bp SacI-HindIII fragment from pEPSPS and ligation into the SacI-HindIII cut vector pJ0NPl95. The clone that contains the promoter EPSPS instead of the original promoter d35S is called pJOESP: NPl95. This expression cassette contains the fragment NP195 in the correct orientation as an N-terminal fusion with the rbcS transit peptide.

The production of an expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NPl95 ketolase from Nostoc punctiforme ATCC 29133 in L. esculentum was carried out using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector MSPlll, the 2,988 KB bp Sacl-Xhol fragment from pJOESP: NPl95 was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 28, construct map). In Figure 28, fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (789 bp), coding for the Nostoc punctiform NPl95 ketolase, fragment OCS terminator (192 bp) the polyadenylation signal of octopine synthase.

An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NPl95 ketoilase from Nostoc punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).

To produce the expression vector MSP112, the 2,988 KB bp Sacl-Xhol fragment from pJOESP: NPl95 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 29, construct map). In Figure 29, fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (789 bp), coding for the Nostoc punctiform NPl95 ketolase, fragment OCS terminator (192 bp) the polyadenylation signal of octopine synthase.

Example 25:

Amplification of a DNA encoding the entire primary sequence of the NODK ketolase from Nodularia spumignea NSOR10.

The DNA encoding the ketolase from Nodularia spumignea NSOR10 was amplified by PCR from Nodularia spumignea NSOR10.

For the preparation of genomic DNA from a suspension culture of Nodularia spumignea NSOR10, which is kept for 1 week with continuous light and constant shaking (150 rpm) at 25 ° C in BG 21 medium (1.5 g / l NaN0 ₃ , 0.04 g / l K ₂ P0 ₄ x3H ₂ 0, 0.075 g / l MgS0 ₄ xH ₂ 0, 0.036 g / l CaClx2H0, 0.006 g / l citric acid, 0.006 g / l Ferric ammonium citrates, 0.001 g / l EDTA disodium magnesium, 0.04 g / l Na ₂ C0 ₃ , 1 ml Trace Metal Mix "A5 + Co" (2.86 g / l H ₃ B0 ₃ , 1.81 g / l MnCl ₂ x4Ho, 0.222 g / l ZnSO ₄ x7H ₂ 0, 0.39 g / l NaMo0X2H ₂ o, 0.079 g / l CuS0 ₄ x5H ₂ 0, 0.0494 g / l Co (N0 ₃ ) x6H0) had been grown, the cells were harvested by centrifugation, frozen in liquid nitrogen and pulverized in a mortar.

Protocol for DNA isolation from Nodularia spumignea NSORI O:

The bacterial cells were pelleted from a 10 ml liquid culture by centrifugation at 8000 rpm for 10 minutes. The bacterial cells were then crushed and ground in liquid nitrogen using a mortar. The cell material was resuspended in 1 ml of 10 mM Tris_HCl (pH 7.5) and transferred to an Eppendorf reaction vessel (2 ml volume). After adding 100 μl Proteinase K (concentration: 20 mg / ml), the cell suspension was incubated for 3 hours at 37 ° C. The suspension was then extracted with 500 μl of phenol. After 5 minutes

Centrifugation at 13,000 rpm, the upper, aqueous phase was transferred to a new 2 ml Eppendorf reaction vessel. The extraction with phenol was repeated 3 times. The DNA was precipitated by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 0.6 volume of isopropanol and then washed with 70% ethanol. The DNA pellet was dried at room temperature, taken up in 25 μl of water and dissolved with heating to 65 ° C.

The nucleic acid encoding a ketolase from Nodularia spumignea NSORIO was determined by means of a "polymerase chain reaction" (PCR) from Nodularia spumignea NSORIO using a sense-specific primer (NODK-1, SEQ ID No. 146) and an antisense-specific primer ( NODK-2 SEQ ID No. 147).

The PCR conditions were as follows:

1 ul of a Nodularia spumignea NSORI O DNA (prepared as described above)

0.25 mM dNTPs

0.2 mM NODK-1 (SEQ ID No. 146) - 0.2 mM NODK-2 (SEQ ID No. 147)

5 ul 10X PCR buffer (TAKARA)

0.25 ul R Taq polymerase (TAKARA)

25.8 ul Aq. Least. The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute 55 ° C 1 minute

72 ° C for 3 minutes

IX 72 ° C 10 minutes

PCR amplification with SEQ ID No. 146 and SEQ ID No. 147 resulted in a 720 bp fragment which codes for a protein consisting of the entire primary sequence (NODK, SEQ ID No. 148). Using standard methods, the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNODK was obtained.

Sequencing of the clone pNODK with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence from 2130-2819 of the database entry AY210783 (inverse oriented to the published database entry). This nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nodularia spumignea NSORIO used.

This clone pNODK was therefore used for the cloning into the expression vector pJO (described in Example 19). The

Cloning was carried out by isolating the 710 bp Sphl fragment from pNODK and ligation into the SphI-cut vector pJO. The clone that contains the NODKia ketolase from Nodularia spumignea in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJONODK.

Example 26:

Production of expression vectors for the constitutive expression of the NODK ketolase from Nodularia spumignea NSORIO in Lycopersicon esculentum and Tagetes erecta.

The expression of the NODK ketolase from Nodularia spumignea NSORIO in L. esculentum and in Tagetes erecta was carried out under control of the constitutive promoter FNR (ferredoxin-NADPH oxidoreductase, database entry AB011474 position 70127 to 69493; WO03 / 006660) from Arabidopsis thaliana. The FNR gene begins at base pair 69492 and is annotated with "ferredoxin-NADP + reductase". Expression was carried out using the pea transit peptide rbcS (Anderson et al. 1986, Biochem J. 240: 709-715). The clone pFNR (described in Example 20) was therefore used for the cloning into the expression vector pJONODK (described in Example 25).

The cloning was carried out by isolating the 644 bp Sma-HindIII fragment from pFNR and ligating into the Ecll36II-HindIII cut vector pJONODK. The clone which contains the promoter FNR instead of the original promoter d35S and the fragment NODK in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJOFNR: NODK.

An expression cassette for the Agrobacterium-mediated transformation of the NODK ketolase from Nodularia spumignea NSORI O into L. esculentum was produced using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector MSP113, the 1,767 bp EcoRI-Xhol fragment from pJ0FNR: N0DK was ligated with the EcoRI-Xhol cut vector pSUN3 (Figure 30, construct map). In Figure 30 fragment FNR promoter contains the FΝR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NODK KETO CDS (690 bp), coding for the Nodularia spumignea NSORIO ΝODK ketolase, fragment OCS terminator (192 bp) the polyadenylation signal from the octopine synthase.

An expression cassette for the Agrobacterium -mediated transformation of the expression vector with the ΝODK ketolase from Nodularia spumignea NSORI O punctiforme in Tagetes erecta was produced using the binary vector pSUΝ5 (WO02 / 00900).

To produce the Tagetes expression vector MSP114, the 1,767 bp EcoRI-Xhol fragment from pJ0FNR: N0DK was ligated with the EcoRI-Xhol cut vector pSUN5 (Figure 31, construct map). In Figure 31, fragment FNR promoter contains the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NODK KETO CDS (690 bp), coding for the Nodularia spumignea NSORIO NODK ketolase, Frag - ment OCS terminator (192 bp) the polyadenylation signal of octopine synthase. Example 27:

Production of expression vectors for the flower-specific expression of the NODK ketolase from Nodularia spumignea NSORI O in Lycopersicon esculentum and Tagetes erecta.

The NODK ketolase from Nodularia spumignea NSORIO was expressed in L. esculentum and Tagetes erecta with the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715). The expression was carried out under the control of the flower-specific promoter EPSPS from Petunia hybrida (database entry M37029: nucleotide region 7-1787; Benfey et al. (1990) Plant Cell 2: 849-856).

The clone pEPSPS (described in Example 21) was therefore used for the cloning into the expression vector pJONODK (described in Example 25).

The cloning was carried out by isolating the 1763 bp SacI-HindIII fragment from pEPSPS and ligating into the vector pJONODK cut in the SacI-HindIII. The clone that contains the promoter EPSPS instead of the original promoter d35S is called pJOESP: NODK. This expression cassette contains the fragment NODK in the correct orientation as an N-terminal fusion with the rbcS transit peptide.

The production of an expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NODK ketolase from Nodularia spumignea NSORI O into L. esculentum was carried out using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector MSP115, the 2,889 KB bp Sacl-Xhol fragment from pJOESP: NODK was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 32, construct map). In Figure 32, fragment EPSPS contains the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NODK KETO CDS (690 bp), coding for the Nodularia spumignea NSORIO NODK ketolase, fragment OCS Terminator (192 bp) the polyadenylation signal of octopine synthase.

An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NODK ketolase from Nodularia spumignea NSORI O in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).

To produce the expression vector MSP116, the 2,889 KB bp Sacl-Xhol fragment from pJ0ESP: N0DK was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 33, construct map). In Figure 33 contains fragment EPSPS the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NODK KETO CDS (690 bp), coding for the Nodularia spumignea NSORI O NODK ketolase, fragment OCS Terminator (192 bp) the polyadenylation signal of octopine synthase.

Example 28:

Production of transgenic Lycopersicon esculentum plants

Transformation and regeneration of tomato plants was carried out as described in Example 6.

According to the transformation method described in Example 6, the following lines were obtained with the following expression constructs:

With MSP105 the following was obtained: mspl05-l, mspl05-2, mspl05-3

With MSP107 we got: mspl07-l, mspl07-2, mspl07-3 With MSP109 we got: mspl09-l, mspl09-2, mspl09-3

With MSPlll was obtained: msplll-1, msplll-2, msplll-3

With MSP113 we got: mspll3-l, mspll3-2, mspll3-3 With MSP115 we got: mspll5-l, mspll5-2, mspll5-3

The characterization and analysis of the transgenic Lycopersicon esculentum plants is carried out as described in Example 6.

Example 29: Production of transgenic Tagetes plants

The transformation and regeneration of Tagetes plants was carried out as described in Example 7.

According to the transformation method described in Example 7, the following lines were obtained with the following expression constructs:

With MSP106 we got: mspl06-l, mspl06-2, mspl06-3

MSP108 received mspl08-l, mspl08-2, mspl08-3 MSP110 received mspllO-1, mspll0-2, mspllO-3 With MSP112 received mspll2-l, mspll2-2, mspll2-3

With MSP114 we got: mspll4-l, mspll4-2, mspll4-3 With MSP116 we got: mspll6-l, mspll6-2, mspll6-3 The transgenic Tagetes plants are characterized as described in Examples 8 and 9 and as described in Example 17.

Example 30: Production of a double expression vector for down-regulation of the Epsilon-Cyclase transcript amounts and the expression of the Nostoc punctiform ketolase NP196-1 in flower-specific manner in Tagetes erecta.

The cloning was carried out by isolating the 2963 bp Ecll36II-Xhol fragment from MSP107 (see Example 21) and ligation with the Xhol-Smally cut vector pS5AI7 (Example 14). The ligation creates a T-DNA that contains two expression cassettes: firstly, the inverted repeat cassette directed against the ecyclase from Tagetes erecta and secondly a cassette for overexpressing the ketolase NP196-1 from Nostoc punctiforme. This clone is called pCSPOl (Figure 34, construct map). In Figure 34, fragment AP3P (776 bp) contains the AP3P promoter, fragment ecycS (439 bp) the 5 'region of the Tagetes ecyclase sequence from pJITH7, fragment intron (207 bp) the intron PIV2 of the potato gene ST-LSI, Fragment ecycAS (440 bp) the 5 'region of the Epsilon cyclase from Tagetes erecta in antisense orientation, fragment 35T (763 bp) the polyadenylation signal from CaMV. Fragment ocs (191 bp) also contains the polyadenylation signal of the octopine synthase gene, fragment NP196 (762 bp) the

Ketolase from Nostoc punctiforme, fragment TP (183 bp) the transit peptide of the rbcS gene from pea, fragment EPSPS (1761 bp) the EPSPS promoter.

Example 31:

Production of an expression cassette for the flower-specific overexpression of the chromoplast-specific B-hydroxylase from Lycopersicon esculentum.

The expression of the chromoplast-specific B-hydroxylase from Lycopersicon esculentum in Tagetes erecta takes place under the control of the flower-specific promoter EPSPS from Petunia (Example 21). LB3 from Vicia faba is used as the terminator element. The sequence of the chromoplast-specific B-hydroxylase was produced by RNA isolation, reverse transcription and PCR.

For the production of the LB3 terminator sequence from Vicia faba, genomic DNA from Vicia faba antlers is isolated according to standard methods and used by genomic PCR using the primers PR206 and PR207. The PCR to amplify this LB3 DNA fragment is carried out in a 50 μl reaction mixture which contains:

- 1 µl cDNA (prepared as described above) - 0.25 mM dNTPs

0.2 uM PR206 (SEQ ID No. 150) 0.2 uM PR207 (SEQ ID No. 151) 5 ul 10X PCR buffer (TAKARA) 0.25 ul R Taq Polymerase (TAKARA) - 28.8 ul Aq. Least.

PCR amplification with PR206 and PR207 results in a 0.3 kb fragment which contains the LB terminator. The amplificate is cloned into the cloning vector pCR-BluntII (Invitrogen). Sequencing with the primers T7 and M13 confirm a sequence identical to the sequence SEQ ID: 160. This clone is called pTA-LB3 and is therefore used for cloning into the vector pJITH7 (see below).

Total RNA from tomato is prepared for the production of the b-hydroxylase sequence. For this purpose, 100 mg of the frozen, powdered flowers are transferred to a reaction vessel and taken up in 0.8 ml of trizole buffer (LifeTechnologies). The suspension is extracted with 0.2 ml of chloroform. After centrifugation at 12,000 g for 15 minutes, the aqueous supernatant is removed and transferred to a new reaction vessel and extracted with a volume of ethanol. The RNA is precipitated with a volume of isopropanol, washed with 75% ethanol and the pellet is dissolved in DEPC water (incubation of water overnight with 1/1000 volume of diethyl pyrocarbonate at room temperature, then autoclaved). The RNA concentration is determined photometrically. For the cDNA synthesis, 2.5 μg of total RNA are denatured for 10 min at 60 ° C., cooled on ice for 2 min and using a cDNA kit (ready-to-go-you-prime-beads, Pharmacia Biotech) rewritten to cDNA according to the manufacturer's instructions using an antisense-specific primer (PR215 SEQ ID No. 152).

The conditions of the subsequent PCR reactions are as follows:

The PCR for the amplification of the VPR203-PR215 DNA fragment, which codes for the B-hydroxylase, is carried out in a 50 μl reaction mixture, which contained:

1 µl cDNA (prepared as described above) 0.25 mM dNTPs 0.2 µM VPR203 (SEQ ID No. 159) 0. 2 uM PR215 (SEQ ID No. 152)

5 ul 10X PCR buffer (TAKARA)

0.25 ul R Taq polymerase (TAKARA)

28.8 ul Aq. Least.

The PCR amplification with VPR203 and PR215 results in a 0.9 kb fragment which codes for the b-hydroxylase. The amplificate is cloned into the cloning vector pCR-BluntII (Invitrogen). Sequencing with primers T7 and M13 confirms a sequence SEQ ID No. 161 identical sequence. This clone is called pTA-CrtR-b2 and is therefore used for cloning into the vector pCSP02 (see below).

The EPSPS promoter sequence from petunia is produced by PCR amplification using the plasmid MSP107 (see Example 21) and the primers VPR001 and VPR002. The PCR for the amplification of this EPSPS-DNA fragment is carried out in a 50 μl reaction mixture, which contains:

1 ul cDNA (prepared as described above)

0.25 mM dNTPs

0.2 uM VPR001 (SEQ ID No. 157)

0.2 uM VPR002 (SEQ ID No. 158)

5 ul 10X PCR buffer (TAKARA) - 0.25 ul R Taq polymerase (TAKARA)

28.8 ul Aq. Least.

The PCR amplification with VPR001 and VPR002 results in a 1.8 kb fragment which encodes the EPSPS promoter. The amplificate is cloned into the cloning vector pCR-BluntII (Invitrogen). Sequencing with the primers T7 and Ml3 confirm a sequence identical to the sequence SEQ ID: 162. This clone is called pTA-EPSPS and is therefore used for cloning into the vector pCSP03 (see below).

The first cloning step is carried out by isolating the 0.3 kb PR206-PR207 EcoRI-Xhol fragment from pTA-LB3, derived from the cloning vector pCR-BluntII (Invitrogen), and ligation with the EcoRI-Xhol cut vector pJITl! 7. The clone that contains the 0.3 kb terminator LB3 is called pCSP02.

The second cloning step is carried out by isolating the 0.9 kb VPR003-PR215 EcoRI-Hindlll fragment from pTA-CrtR-b2, derived from the cloning vector pCR-BluntII (Invitrogen), and ligation with the EcoRI-Hindlll cut vector pcsp02. The clone that contains the 0.9 kb B-hydroxylase fragment CrtR-b2 is called pCSP03. The ligation creates a transcriptional fusion between the terminator LB3 and the B-hydroxylase fragment CrtR-b2.

The third cloning step is carried out by isolating the 1.8 kb VPR001-VPR002 Ncol-Sacl fragment from pTA-EPSPS, derived from the cloning vector pCR-BluntII (Invitrogen), and ligation with the Ncol-Sacl cut vector pCSP03. The clone that contains the 1.8 kb EPSPS promoter fragment is called pCSP04. The ligation creates a transcriptional fusion between the EPSPS promoter and the β-hydroxylase fragment CrtR-b2. (Figure 35, construct card). In Figure 35, fragment fragment EPSPS (1792 bp) contains the EPSPS promoter, fragment crtRb2 (929 bp) the B-hydroxylase CrtRb2, fragment LB3 (301 bp) the LB3 terminator.

To clone this β-hydroxylase overexpression cassette in expression vectors for the Agrobacterium-mediated transformation of Tagetes erecta, the β-hydroxylase cassette is isolated as a 3103 bp Ecll36lI-XhoI fragment. The 3 ^λ ends are filled (30 min at 30 ° C) using standard methods (Klenow fill-in).

Example 32:

Production of inverted repeat expression cassettes for the flower-specific expression of b-hydroxylase dsRNA in Tagetes erecta (directed against the 5 ′ region of the b-hydroxylase cDNA)

The nucleic acid which contains the 5 "terminal bp region of the b-hydroxylase cDNA (Genbank accession no. AF251018) is isolated from Tagetes erecta cDNA using a polymerase chain reaction (PCR) using a sense-specific primer (PR217 SEQ ID

No. 153) and an antisense-specific primer (PR218 SEQ ID No. 154).

For the preparation of total RNA from Tagetes flowers, 100 mg of the frozen, powdered flowers are transferred to a reaction vessel and taken up in 0.8 ml Trizol buffer (LifeTechnologies). The suspension is extracted with 0.2 ml of chloroform. After centrifugation at 12,000 g for 15 minutes, the aqueous supernatant was removed and transferred to a new reaction vessel and extracted with a volume of ethanol. The RNA is precipitated with a volume of isopropanol, washed with 75% ethanol and the pellet is dissolved in DEPC water (overnight incubation of water with 1/1000 volume of diethyl pyrocarbonate at room temperature, then autoclaved). The RNA concentration is determined photometrically. For the cDNA synthesis, 2.5 μg of total RNA are denatured for 10 min at 60 ° C., cooled on ice for 2 min and cDNA kit (ready-to-go-you-prime) beads, Pharmacia Biotech) according to the manufacturer's instructions using an antisense-specific primer (PR218 SEQ ID No. 154) in cDNA.

The conditions of the subsequent PCR reactions are as follows:

The PCR for the amplification of the PR217-PR218 DNA fragment, which contains the 5 'terminal 0.3 kb region of the b-hydroxylase, is carried out in a 50 ul? Reaction approach, which includes:

- 1 ul? cDNA (prepared as described above) 0.25 mM dNTPs

0.2 uM PR217 (SEQ ID No. 153) - 0.2 uM PR218 (SEQ ID No. 154) 5 ul? 10X PCR buffer (TAKARA) 0.25 ul? R Taq Polymerase (TAKARA) 28.8 ul? Aq. Least.

The PCR for the amplification of the PR220-PR219 DNA fragment, which contains the 5 'terminal 0.3 kb region of the b-hydroxylase, is carried out in a 50 μl reaction mixture which contains:

- 1 µl cDNA (prepared as described above) - 0.25 mM dNTPs

0.2 µM PR220 (SEQ ID No. 156) 0.2 µM PR219 (SEQ ID No. 155) 5 ul 10X PCR buffer (TAKARA) 0.25 ul R Taq Polymerase (TAKARA) - 28.8 ul Aq. Least.

The PCR reactions are carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

58 ° C for 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes

PCR amplification with primers PR217 and PR218 results in a 332 bp fragment (SEQ ID NO: 163), PCR amplification with primers PR219 and PR220 results in a 332 bp fragment (SEQ ID NO: 164). The two amplicons, the PR217-PR218 (HindIII-Sall sense) fragment and the PR220-PR219 (EcoRI-BamHI antisense) fragment, are cloned into the PCR cloning vector pCR-BluntII (Invitrogen) using standard methods. The resulting clones are called pCR-BluntII-bhydrS (PR217-PR218 fragment) or pCR-BluntII-bhydrAS (PR220-PR219 fragment). Sequencing with the primer SP6 confirms a sequence identical to the published sequence AF251018 (SEQ ID No. 165), apart from the restriction sites introduced. These clones are therefore used for the production of an inverted repeat construct in the cloning vector pJAII (see example 10).

The first cloning step is carried out by isolating the 332 bp PR217-PR218 HindIII-SalI fragment from the cloning vector pCR-BluntII-bhydrS (Invitrogen) and ligation with the HindII-SalI cut vector pJAII. The clone that contains the 5 'terminal region of the P-hydroxylase in the sense orientation is called pCSP05. The ligation results in a transcriptional fusion between the AP3P and the sense fragment of the 5'-terminal region of the β-hydroxylase and the intron on the other hand.

The second cloning step is carried out by isolating the 332 bp PR220-PR219 BamHI-EcoRI fragment from the cloning vector pCR-BluntII-bhydrAS (Invitrogen) and ligation with the BamHI-EcoRI cut vector pCSP05. The clone which contains the 332 bp 5 'terminal region of the β-hydroxylase cDNA in the antisense orientation is called pCSP06. The ligation results in a transcriptional fusion between the antisense fragment of the 5'-terminal region of the β-hydroxylase and the polyadenylation signal from CaMV on the one hand and the intron on the other.

To clone this downregulation cassette into expression vectors for the Agrobacterium-mediated transformation of Tagetes erecta, the inverted repeat cassette is isolated as a 2394 bp Ecll36lI-XhoI fragment. The 3 "ends (30 min at 30 ° C) are filled using standard methods (Klenow fill-in).

In Figure 36, fragment AP3P (767 bp) contains the AP3P promoter, fragment 5 'bhydrS (291 bp) the 5 "region of the B-hydroxylase from Tagetes erecta in sense orientation, fragment intron (206 bp) the intron PIV2 des Potato gene ST-LSI, fragment 5 'bhydrS (326 bp) the 5' region of the B-hydroxylase from Tagetes erecta in antisense orientation, and fragment 35T (761 bp) the polyadenylation signal of CaMV. To clone this downregulation cassette into expression vectors for the Agrobacterium-mediated transformation of Tagetes erecta, the inverted repeat cassette is isolated as a 2392 bp Ecll36II-XhoI fragment. The 3 'ends (30 min at 30 ° C) are filled using standard methods (Klenow fill-in).

Example 33:

Production of a triple expression vector for down-regulation of the epsilon cyclase, the expression of the Nostoc punctiform ketolase NP196-1, and the overexpression of the chromoplast-specific B-hydroxylase from Lycopersicon esculentum in a flower-specific manner in Tagetes erecta.

This triple expression vector is cloned by isolating the 3103 bp Ecll36lI-XhoI fragment from pCSP04 (see Example 31), subsequently filling in the Klenow 5 'overhang of the Xhol interface (carried out according to standard methods) and finally ligating in the Ecll36ll-cut vector pCSPOl (Example 30). The ligation results in a T-DNA containing three expression cassettes: firstly the inverted repeat cassette directed against the ecyclase from Tagetes erecta, secondly a cassette for overexpressing the ketolase NP196-1 from Nostoc punctiforme, and thirdly a cassette for the chromoplast-specific one Overexpression of B-hydroxylase from Lycopersicon esculentum. The β-hydroxylase overexpression cassette can ligate into the vector in two orientations. The example pCSP07 described here includes both resulting versions pCSP07F and pCSP07R of the triple expression vector.

The construct card for version pCSP07F of the example pCSP07 is representative here (Figure 37, construct card).

In Figure 37 fragment AP3P (773 bp) contains the AP3P promoter, fragment ecycS (439 bp) the 5 'region of the ecyclase sequence from Tagetes erecta in sense orientation, fragment intron (207 bp) the intron PIV2 of the potato gene ST-LSI, fragment ecy-cAS (440 bp) the 5 'region of the Epsilon cyclase from Tagetes erecta in antisense orientation, fragment 35T (763 bp) the polyadenylation signal from CaMV.

Furthermore fragment ocs (191 bp) contains the polyadenylation signal of the octopine synthase gene, fragment NP196 (762 bp) the ketolase from Nostoc punctiforme, fragment TP (183 bp) the transit peptide of the rbcS gene from pea, fragment EPSPS (1761 bp) EPSPS promoter. Fragment EPSPS (1792 bp) also contains the EPSPS promoter, fragment crtRb2 (929 bp) the B-hydroxylase CrtRb2, fragment LB3 (301 bp) the LB3 terminator.

Transformation and regeneration of Tagetes plants was described in Example 7.

Example 34:

Production of a four-fold expression vector for down-regulation of the Epsilon cyclase, the expression of the Nostoc punctiform ketolase NP196-1, the overexpression of the chromoplast-specific B-hydroxylase from Lycopersicon esculentum as well as the down-regulation of the B-hydroxylase from Tagetes erecta in specific flowers in Tagetes erecta ,

This quadruple expression vector is cloned by isolating the 2392 bp Ecll36lI-XhoI fragment from pCSPOδ (see Example 32), subsequently filling in the Klenow 5 'overhang of the Xhol interface (carried out according to standard methods) and finally ligating in the Ecll36II-cut vector pCSP07 (Example 33). The ligation results in a T-DNA which contains four expression cassettes: firstly the inverted repeat cassette directed against the ecyclase from Tagetes erecta, secondly a cassette for overexpressing the ketolase NP196-1 from Nostoc punctiforme, thirdly a cassette for chromoplast-specific overexpression the B-hydroxylase from Lycopersicon esculentum, and fourthly an inverted repeat cassette directed against the B-hydroxylase from Tagetes erecta. The B-hydroxylase downregulation cassette can ligate into the vector in two orientations. The example pCSP08 described here includes both resulting versions pCSP08F and pCSP08R of the four-fold expression vector.

The construct card for version pCSP08F of the example pCSP08 is representative here (Figure 38, construct card).

In Figure 38, fragment AP3P (773 bp) contains the AP3P promoter, fragment ecycS (439 bp) the 5 'region of the ecyclase sequence from Tagetes erecta in sense orientation, fragment intron (207 bp) the intron PIV2 of the potato gene ST-LSI, fragment ecycAS (440 bp) the 5 'region of the Epsilon cyclase from Tagetes erecta in antisense orientation, fragment 35T (763 bp) the polyadenylation signal from CaMV.

Fragment ocs (191 bp) also contains the polyadenylation signal of the octopine synthase gene, fragment NP196 (762 bp) the ketolase from Nostoc punctiforme, fragment TP (183 bp) that Transit peptide of the rbcS gene from pea, fragment EPSPS (1761 bp) the EPSPS promoter.

Fragment EPSPS (1792 bp) also contains the EPSPS promoter, fragment crtRb2 (929 bp) the B-hydroxylase CrtRb2, fragment LB3 (301 bp) the LB3 terminator.

Fragment AP3P (767 bp) also contains the AP3P promoter, fragment 5 'bhydrS (291 bp) the 5' region of the B-hydroxylase from Tagetes erecta in sense orientation, fragment intron (206 bp) the intron PIV2 of the potato gene ST-LSI, fragment 5 'bhydrS (326 bp) the 5' region of the B-hydroxylase from Tagetes erecta in antisense orientation, and fragment 35T (761 bp) the polyadenylation signal of CaMV.

Example 35:

Production of a five-fold expression vector for down-regulation of the epsilon cyclase, the expression of the Nostoc punctiform ketolase NP196-1, the overexpression of the chromoplast-specific B-hydroxylase from Lycopersicon esculentum, the down-regulation of the B-hydroxylase from Tagetes erectaes and the overexpression of the B flower-specific in Tagetes erecta.

This five-fold expression vector is cloned by isolating the 2679 bp Pmel-Sspl fragment from pMKPl (see Example 37) and ligation in the Ecll36ll-cut vector pCSP08 (Example 34). The ligation results in a T-DNA containing five expression cassettes: firstly the inverted repeat cassette directed against the ecyclase from Tagetes erecta, secondly a cassette for overexpressing the ketolase NP196-1 from Nostoc punctiforme, thirdly a cassette for overexpressing the chromoplast-specific ß -Hydroxylase from Lycopersicon esculentum, fourth an inverted repeat cassette directed against the B-hydroxylase from Tagetes erecta, and fifth a cassette for overexpression of the bow from Lycopersicon esculentum. The B-hydroxylase down-regulation cassette can ligate into the vector pCSP08 in two orientations. The example pCSP09 described here includes both resulting versions pCSP09F and pCSP09R of the quadruple expression vector.

The construct card for version pCSP09F of the example pCSP09 is representative here (Figure 39, construct card). In Figure 39, fragment AP3P (773 bp) contains the AP3P promoter, fragment ecycS (439 bp) the 5 'region of the ecyclase

Sequence from Tagetes erecta in sense orientation, fragment intron (207 bp) the intron PIV2 of the potato gene ST-LSI, fragment ecycAS (440 bp) the 5 'region of the Epsilon cyclase from Tagetes erecta in antisense orientation, fragment 35T (763 bp) the polyadenylation signal from CaMV.

i Furthermore, fragment ocs (191 bp) contains the polyadenylation signal of the octopine synthase gene, fragment NP196 (762 bp) the ketolase from Nostoc punctiforme, fragment TP (183 bp) the transit peptide of the rbcS gene from pea, fragment EPSPS (1761 bp) the EPSPS Promoter.

Fragment AP3P (767 bp) also contains the AP3P promoter, fragment 5 'bhydrS (291 bp) the 5' region of the B-hydroxylase from Tagetes erecta in sense orientation, fragment intron (206 bp) the intron PIV2 of the potato gene ST-LSI, fragment 5 'bhydrS (326 bp) the 5' region of the B-hydroxylase from Tagetes erecta in antisense orientation, and fragment 35T (761 bp) the polyadenylation signal of CaMV. .

Furthermore, the fragment P76 (1033 bp) contains the P76 promoter, the fragment Bgene (1666 bp) the bgene from Lycopersicon esculenum, and the fragment 35ST (970 Bp) the polyadenylation signal of CaMV.

Example 36:

Production of a fourfold expression vector for the expression of the Nostoc punctiform ketolase NP196-1, the overexpression of the chromoplast-specific B-hydroxylase from Lycopersicon esculentum, the downregulation of the B-hydroxylase from Tagetes erecta and the overexpression of the bgenes from tomato in blossom-specific manner in Tagetes erecta.

The first cloning step is carried out by isolating the 3103 bp Ecll36lI-XhoI fragment from pCSP04, then Klenow filling in the 5'overhang of the Xhol interface (carried out according to standard methods) and finally ligating into the Ecll36ll-cut vector pMSP107. The ligation results in a T-DNA which contains two expression cassettes: firstly the cassette for overexpressing the ketolase NP196-1 from Nostoc punctiforme, and secondly the cassette for overexpressing the chromoplast-specific ß-hydroxylase from Lycopersicon esculenum. The ß-hydroxylase overexpression cassette can be divided into two

Ligate orientations in the vector pMSP107. This described The example pCSPOlO contains both resulting versions pCSPlOF and pCSPlOR of the double expression vector.

The second cloning step is carried out by isolating the 2392 bp Ecll36lI-XhoI fragment from pCSP06, subsequently filling in the Klenow 5 'overhang of the Xhol interface (carried out according to standard methods) and finally ligating into the Ecll36II-cut vector pCSPlO. The B-hydroxylase down-regulation cassette can ligate into the vector pCSP10 in two orientations. The example pCSPll described here contains both resulting versions pCSPllF and pCSPllR of the triple expression vector.

The third cloning step is carried out by isolating the 3679 bp Pmel-Sspl fragment from pMKPOl (see Example 37) and ligation into the Ecll36II-cut vector pCSPll. The Bgene overexpression cassette can ligate into the vector pCSPll in two orientations. The example pCSP12 described here includes both resulting versions pCSPl2F and pCSP12R of the quadruple expression vector.

The construct card for version pCSPl2F of the example pCSPl2 is representative here (Figure 40, construct card).

In Figure 40, fragment ocs (191 bp) contains the polyadenylation signal of the octopine synthase gene, fragment NP196 (762 bp) the ketolase from Nostoc punctiforme, fragment TP (183 bp) the transit peptide of the rbcS gene from pea, fragment EPSPS (1761 bp) the EPSPS promoter.

Fragment EPSPS (1792 bp) also contains the EPSPS promoter, fragment crtR-b2 (929 bp) B-hydroxylase CrtRb2, fragment LB3 (301 bp) LB3 terminator.

Furthermore, the fragment P76 (1033 bp) contains the P76 promoter, the fragment Bgene (1666 bp) the bgene from Lycopersicon esculenum, and the fragment 35ST (970 Bp) the polyadenylation signal of CaMV. Example 37:

Production of expression vectors for the flower-specific expression of the chromoplast-specific lycopene beta cyclase from Lycopersicon esculentum under the control of the promoter P76 and for the flower-specific expression of the ketolase NP196 from Nostoc punctiforme ATCC 29133 under the control of the EPSPS promoter

Isolation of promoter P76 (SEQ ID NO. 168) by means of PCR using genomic DNA from Arabidopsis thaliana as a template.

For this, the oligonucleotide primers P76for (SEQ ID NO. 166) and P76rev (SEQ ID NO. 167) were used. The oligonucleotides were provided with a 5 'phosphate residue during the synthesis.

The genomic DNA was isolated from Arabidopsis thaliana as described (Galbiati M et al. Funct. Integr. Geno ics 2000, 20 1: 25-34).

The PCR amplification was carried out as follows:

80 ng genomic DNA lx Expand Long Template PCR buffer

2.5 mM MgC12 each 350 μM dATP, dCTP, dGTP, dTTp each 300 nM of each primer

2.5 units expand long template polymerase in a final volume of 25 μl

The following temperature program is used:

1 cycle with 120 sec at 94 ° C

35 cycles with 94 ° C for 10 sec, 48 ° C for 30 sec and 68 ° C for 3 min

1 cycle at 68 ° C for 10 min

The PCR product is purified by agarose gel electrophoresis and the 1032 bp fragment is isolated by gel elution.

The vector pSun5 is digested with the restriction endonuclease EcoRV and also purified by agarose gel electrophoresis and obtained by gel elution.

The purified PCR product is cloned into the vector treated in this way. In order to check the orientation of the promoter in the vector, BamHI is digested with the restriction endonuclease. If this results in a 628 bp fragment, the orientation is as shown in Fig. 43.

This construct is called p76.

The 35ST is obtained from pJIT 117 by digestion with the restriction endonucleases Kpnl and Smal. The resulting 969 bp fragment is purified by agarose gel electrophoresis and isolated by gel elution. The vector p76 is also digested with the restriction endonucleases Kpnl and Smal. The resulting 7276bp fragment is purified by agarose gel electrophoresis and isolated by gel elution. The 35ST fragment obtained in this way is cloned into the p76 treated in this way. The resulting vector is called p76_35ST.

Isolation of Bgene (SEQ ID NO. 171) by means of PCR using genomic DNA from Lycopersicon esculentum as a template.

For this, the oligonucleotide primers BgeneFor (SEQ ID NO. 169) and BgeneRev (SEQ ID NO. 170) were used. The oligonucleotides were provided with a 5 'phosphate residue during the synthesis.

The genomic DNA was isolated from Lycopersicon esculentum as described (Galbiati M et al. Funct. Integr. Genomics 2000, 20 1: 25-34).

The PCR amplification was carried out as follows:

80ng genomic DNA lx Expand Long Template PCR buffer 2.5 mM MgC12 each 350 μM dATP, dCTP, dGTP, dTTp each 300 nM each primer 2.5 units Expand Long Template Polymerase in a final volume of 25 μl

The following temperature program was used:

1 cycle with 120 sec at 94 ° C

35 cycles at 94 ° C for 10 sec, 48 ° C for 30 sec and 68 ° C for 3 min 1 cycle at 68 ° C for 10 min The PCR product was purified by agarose gel electrophoresis and the 1665 bp fragment isolated by gel elution.

The vector p76_35ST is digested with the restriction endonuclease Smal and also purified by agarose gel electrophoresis and obtained by gel elution.

The purified PCR product is cloned into the vector treated in this way. To check the orientation of Bgene in the vector is digested with the restriction endonuclease EcoRI. If a 2216 bp fragment is formed, the orientation is as shown in Fig. 43. This construct is referred to as pB. pB is digested with the restriction endonucleases Pmel and Sspl and the 3906bp fragment containing the promoter P76, Bgene and the 35ST is purified by agarose gel electrophoresis and obtained by gel elution

MSP108 (Example 21, Fig. 25) is digested with the restriction endonuclease Ecll26II, purified by agarose gel electrophoresis and obtained by gel elution

The purified 3906bp fragment containing the promoter P76, Bgene and the 35ST from pB is cloned into the Vector MSP108 treated in this way.

The orientation of the insert is determined by restriction digestion with Ncol. If a fragment of size 5268bp is created, the orientation is as shown in Fig. XX. This construct is called pMKPl (Fig.44).

Example 38:

Production of expression vectors for the flower-specific expression of the chromoplast-specific lycopene beta cyclase from Lycopersicon esculentum under the control of the promoter P76, for the flower-specific expression of the ketolase NP196 from Nostoc punctiform ATCC 29133 under the control of the EPSPS promoter and for the flower-specific production of dsRNA transcripts containing fragments 5 ' Epsilon cyclase cDNA (AF251016) under the control of the AP3P promoter

Vector cspl (Fig. 34, Example 30) is digested with Ecll36ll and purified by agarose gel electrophoresis and obtained by gel elution.

The 3906bp Sspl, Pmel fragment containing the promoter P76, Bgene and the 35ST from pB (see Example 37) is cloned into the vector cspl treated in this way. The orientation of the insert is determined by restriction digestion with Sacl. If this results in a fragment of size 3170bp, the orientation is as in Fig. 7Abb. XX shown.

This construct is called pMKP2 (Fig. 44).

Example 39:

Production and characterization of transgenic Tagetes plants

The transformation and regeneration of Tagetes plants using the nucleic acid constructs according to Examples 30 to 38 was carried out as described in Example 7.

The transgenic Tagetes plants are characterized as described in Examples 8 and 9 and as described in Example 17.

Claims

patent claims

1. Process for the production of ketocarotenoids by cultivating genetically modified plants which have an altered ketolase activity in petals compared to the wild type.

2. The method according to claim 1, characterized in that -0 plants are used whose petals as wild type already have ketolase activity and the genetic change brings about an increase in ketolase activity in petals compared to the wild type.

3. The method according to claim 2, characterized in that to increase the ketolase activity, the gene expression of a nucleic acid encoding a ketolase is increased compared to the wild type.

4. The method according to claim 3, characterized in that nucleic acids which encode ketolases are introduced into the plant to increase gene expression.

5. The method according to claim 1, characterized in that 5 plants are used, the petals of which are wild type

Have ketolase activity and the genetic modification causes ketolase activity in petals compared to the wild type.

° 6. The method according to claim 5, characterized in that one uses genetically modified plants that transgenically express a ketolase in petals.

7. The method according to claim 5 or 6, characterized in that in order to cause the gene expression nucleic acids are introduced into the plant, which encode ketolases.

8. The method according to claim 4 or 7, characterized in that introducing nucleic acids encoding a protein, ° containing the amino acid sequence SEQ ID NO: 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which have an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 2 and the enzymatic property of a ketolase 5.

9. The method according to claim 8, characterized in that nucleic acids containing the sequence SEQ ID NO: 1 are introduced.

10. The method according to claim 4 or 7, characterized in

5 that nucleic acids are encoded which encode a protein containing the amino acid sequence SEQ ID NO: 16 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which have an identity of at least 20% at the amino acid level with the sequence 10 SEQ ID NO: 16 and has the enzymatic property of a ketolase.

11. The method according to claim 10, characterized in that nucleic acids containing the sequence SEQ ID NO: 15

15 brings.

12. The method according to any one of claims 1 to 11, characterized in that genetically modified plants are used which have the highest expression rate of a ketolase in flowers.

20 points.

13. The method according to claim 12, characterized in that the gene expression of the ketolase takes place under the control of a flower-specific promoter.

25

14. The method according to any one of claims 1 to 13, characterized in that the plants in addition to the wild type, an increased activity of at least one of the activities selected from the group hydroxylase activity and β-cyclase

Have 30 activity.

15. The method according to claim 14, characterized in that for additional increase of at least one of the activities, the gene expression of at least one nucleic acid is selected

35 from the group encoding a hydroxylase and nucleic acids encoding a β-cyclase increased compared to the wild type.

16. The method according to claim 15, characterized in that 40 to increase the gene expression of at least one of the nucleic acids, at least one nucleic acid selected from the group encoding nucleic acids a hydroxylase and nucleic acids encoding a β-cyclase is introduced into the plant.

45 17. The method according to claim 16, characterized in that a nucleic acid encoding a hydroxylase, nucleic acids encoding a hydroxylase containing the Amino acid sequence SEQ ID NO: 18 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 18. 5

18. The method according to claim 17, characterized in that nucleic acids containing the sequence SEQ ID NO: 17 are introduced.

10. The method according to claim 16, characterized in that a nucleic acid encoding a β-cyclase, nucleic acids which encode a β-cyclase, containing the amino acid sequence SEQ ID NO: 20 or one of these sequences by substitution, insertion or deletion of Amino acids removed

15 directed sequence that has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 20.

20. The method according to claim 19, characterized in that nucleic acids containing the sequence SEQ ID NO: 19

20 brings.

21. The method according to any one of claims 14 to 20, characterized in that one uses genetically modified plants that have the highest expression rate of a hydroxylase in flowers

25 and / or have β-cyclase.

22. The method according to claim 21, characterized in that the gene expression of the hydroxylase and / or β-cyclase takes place under the control of a flower-specific promoter.

30

23. The method according to any one of claims 1 to 22, characterized in that the plants additionally have a reduced ε-cyclase activity compared to the wild type.

24. The method according to claim 23, characterized in that the reduction of the ε-cyclase activity in plants is achieved by at least one of the following methods:

a) introducing at least one double-stranded ε-cyclase 40 ribonucleic acid sequence or an expression cassette or expression cassettes ensuring its expression into plants, b) introducing at least one ε-cyclase antisense ribonucleic acid sequence or an expression thereof

45 performing expression cassette in plants, c) introducing at least one ε-cyclase antisense-ribonucleic acid sequence in combination with a ribozyme or an expression cassette or expression cassette ensuring its expression, d) introducing at least one ε-cyclase sense-ribonucleic acid sequence to induce co-suppression or expression thereof Expression cassette in plants, e) introduction of at least one DNA or protein binding factor against an ε-cyclase gene, RNA or protein or an expression cassette ensuring its expression in plants, f) introduction of at least one ε-cyclase RNA degradation effecting viral nucleic acid sequence or an expression cassette ensuring its expression in

Plants, g) introducing at least one construct for producing an insertion, deletion, inversion or mutation in a ε-cyclase gene in plants.

25. The method according to claim 24, embodiment a), characterized in that an RNA is introduced into the plant, which has a region with a double-strand structure and in this region contains a nucleic acid sequence which

26. The method according to claim 25, characterized in that the region with double-strand structure contains a nucleic acid sequence which is identical to at least a part of the plant's own ε-cyclase transcript and the 5 'end or the 3' end the plant's own nucleic acid encoding an ε-cyclase.

27. The method according to claim 23 to 26, characterized in that one uses genetically modified plants which in

Flowers have the lowest expression rate of an ε-cyclase.

28. The method according to claim 27, characterized in that the transcription of the double-stranded ε-cyclase ribonucleic acid sequence according to claim 24, embodiment a) and / or the antisense sequences according to claim 24, embodiment b) is carried out under the control of a flower-specific promoter.

29. The method according to any one of claims 5 to 28, characterized in that the plants additionally have an increased activity compared to the wild type of at least one of the activities selected from the group HMG-CoA reductase activity, (E) -4-hydroxy -3-methylbut-2-enyl-diphosphate reductase activity, l-deoxy-D-xylose-5-phosphate synthase activity, 1-deoxy-D-xylose-5-phosphate reductoisomerase activity, isopentenyl - Diphosphate-Δ-isomerase activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity, geranyl geranyl diphosphate synthase activity, phytoene synthase activity, phytoene desaturase activity, zeta Carotene desaturase activity, crtlSO activity, FtsZ activity and MinD activity.

30. The method according to claim 29, characterized in that for additional increase of at least one of the activities, the gene expression of at least one nucleic acid selected from the group encoding an HMG-CoA reductase nucleic acids, encoding an (E) -4-hydroxy nucleic acids 3-methyl-but-2-enyl-diphosphate reductase, nucleic acids encoding an l-deoxy-D-xylose-5-phosphate synthase, nucleic acids encoding an l-deoxy-D-xylose-5-phosphate reductoisomerase, encoding nucleic acids an isopentenyl diphosphate Δ isomerase, encoding nucleic acids a geranyl diphosphate synthase, nucleic acids encoding a farnesyl diphosphate synthase, nucleic acids encoding a geranyl geranyl diphosphate synthase, nucleic acids encoding a phytoene synthase, nucleic acids Desaturase, nucleic acids encoding a zeta-carotene desaturase, nucleic acids encoding a crtlSO protein, nucleic acids encoding an FtsZ protein and nucleic acids k or a MinD protein increased compared to the wild type.

31. The method according to claim 30, characterized in that to increase the gene expression at least one of the nucleic acids, at least one nucleic acid selected from the group encoding an HMG-CoA reductase, nucleic acids encoding an (E) -4-hydroxy-3 -Methylbut- 2-enyl-diphosphate reductase, nucleic acids encoding an l-deoxy-D-xylose-5-phosphate synthase, nucleic acids encoding an l-deoxy-D-xylose-5-phosphate reductoisomerase, nucleic acids encoding one Isopentenyl diphosphate Δ isomerase, nucleic acids encoding a geranyl diphosphate synthase, nucleic acids encoding a farnesyl diphosphate synthase, Nucleic acids encoding a geranyl-geranyl diphosphate synthase, nucleic acids encoding a phytoene synthase, nucleic acids encoding a phytoene desaturase, nucleic acids encoding a zeta-carotene desaturase, nucleic acids 5 encoding a crtlSO protein, nucleic acids encoding a nucleic acid FtsZ protein Introduces MinD protein into the plant.

32. The method according to claim 31, characterized in that 10 nucleic acids encoding an HMG-CoA reductase are introduced, nucleic acids encoding an HMG-CoA reductase containing the amino acid sequence SEQ ID NO: 100 or one of these sequences by substitution, Insertion or deletion of amino acid-derived sequence that has an identity

15 of at least 20% at the amino acid level with the sequence SEQ ID NO: 100.

33. The method according to claim 32, characterized in that nucleic acids containing the sequence SEQ ID NO: 99

20 brings.

34. The method according to claim 31, characterized in that the nucleic acid encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase, nucleic acids is introduced

25 encode an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase containing the amino acid sequence SEQ ID NO: 102 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the

30 has sequence SEQ ID NO: 102.

35. The method according to claim 34, characterized in that nucleic acids containing the sequence SEQ ID NO: 101 are introduced.

35

36. The method according to claim 31, characterized in that the nucleic acid encoding is an l-deoxy-D-xylose-5-phosphate synthase, nucleic acids which encode a 1-deoxy-D-xylose-5-phosphate synthase containing the amino acid

40 sequence SEQ ID NO: 104 or one of this sequence

Substitution, insertion or deletion of amino acid-derived sequence which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 104.

45 37. The method according to claim 36, characterized in that nucleic acids containing the sequence SEQ ID NO: 103 are introduced.

38. The method according to claim 31, characterized in that the nucleic acid coding is an l-deoxy-D-xylose-5-phosphate-reductoisomerase, nucleic acids which encode a 1-deoxy-D-xylose-5-phosphate-reductoisomerase are introduced, containing the 5 amino acid sequence SEQ ID NO: 106 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 106.

39. The method according to claim 38, characterized in that nucleic acids containing the sequence SEQ ID NO: 105 are introduced.

40. The method according to claim 31, characterized in that 15 nucleic acids encoding an isopentenyl diphosphate Δ isomerase are introduced, nucleic acids encoding an isopentenyl diphosphate Δ isomerase containing the amino acid sequence SEQ ID NO: 108 or one of these Sequence derived by substitution, insertion or deletion of amino acids

20 sequence that has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 108.

41. The method according to claim 40, characterized in that nucleic acids containing the sequence SEQ ID NO: 107

25 brings.

42. The method according to claim 31, characterized in that a nucleic acid encoding a geranyl diphosphate synthase, nucleic acids are introduced which is a geranyl diphosphate synthase

30 encode, containing the amino acid sequence SEQ ID NO: 110 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 110.

35

43. The method according to claim 42, characterized in that nucleic acids containing the sequence SEQ ID NO: 106 are introduced.

44. The method according to claim 31, characterized in that a nucleic acid encoding a farnesyl diphosphate synthase is introduced, nucleic acids encoding a farnesyl diphosphate synthase containing the amino acid sequence SEQ ID NO: 112 or one of these sequences by substitution, insertion

45 or deletion of amino acid-derived sequence which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 112.

45. The method according to claim 44, characterized in that nucleic acids containing the sequence SEQ ID NO: 111 are introduced.

46. The method according to claim 31, characterized in that the nucleic acid encoding a geranyl-geranyl diphosphate synthase is introduced, nucleic acids encoding a geranyl-geranyl diphosphate synthase containing the amino acid sequence SEQ ID NO: 114 or one of these Sequence derived by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 114.

47. The method according to claim 46, characterized in that 15 nucleic acids containing the sequence SEQ ID NO: 113 are introduced.

48. The method according to claim 31, characterized in that a nucleic acid encoding a phytoene synthase, nucleic acid

Introduces 20 acids encoding a phytoene synthase, containing the amino acid sequence SEQ ID NO: 116 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence

25 SEQ ID NO: 116.

49. The method according to claim 48, characterized in that nucleic acids containing the sequence SEQ ID NO: 115 are introduced.

30

50. The method according to claim 31, characterized in that a nucleic acid encoding a phytoene desaturase, nucleic acids are introduced which encode a phytoene desaturase, containing the amino acid sequence SEQ ID NO: 118 or one of

35 of this sequence derived by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 118.

40 51. The method according to claim 50, characterized in that nucleic acids containing the sequence SEQ ID NO: 117 are introduced.

52. The method according to claim 31, characterized in that a nucleic acid encoding a zeta-carotene desaturase is introduced, nucleic acids encoding a zeta-carotene desaturase containing the amino acid sequence SEQ ID NO: 120 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 120. 5

53. The method according to claim 52, characterized in that nucleic acids containing the sequence SEQ ID NO: 119 are introduced.

54. The method according to claim 31, characterized in that the nucleic acid coding is a crtlSO protein, nucleic acids which encode a crtlSO protein are introduced, containing the amino acid sequence SEQ ID NO: 122 or one of these sequences by substitution, insertion or deletion of amino acids

15 derived sequence, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 122.

55. The method according to claim 54, characterized in that nucleic acids containing the sequence SEQ ID NO: 121 are introduced.

56. The method according to claim 31, characterized in that the nucleic acid encoding an FtsZ protein is introduced, nucleic acids encoding an FtsZ protein containing the

25 amino acid sequence SEQ ID NO: 124 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 124.

30 57. The method according to claim 56, characterized in that nucleic acids containing the sequence SEQ ID NO: 123 are introduced.

58. The method according to claim 31, characterized in that 35 a nucleic acid encoding a MinD protein, nucleic acids which encode a MinD protein are introduced, containing the amino acid sequence SEQ ID NO: 126 or one derived from this sequence by substitution, insertion or deletion of amino acids Sequence which has an identity of at least 20% 40 at the amino acid level with the sequence SEQ ID NO: 126.

59. The method according to claim 58, characterized in that nucleic acids containing the sequence SEQ ID NO: 125 are introduced.

45

60. The method according to any one of claims 29 to 59, characterized in that genetically modified plants are used which in flowers have the highest expression rate of an HMG-CoA reductase and / or (E) -4-hydroxy-3-methylbut-2- enyl-diphosphate reductase and / or l-deoxy-D-xylose-5-phosphate synthase and / or l-deoxy-D-xylose-5-phosphate reductoisomerase and / or isopentenyl-diphosphate-Δ-isomerase and / or geranyl diphosphate synthase and / or farnesyl diphosphate synthase and / or geranyl geranyl diphosphate synthase and / or phytoene synthase and / or phytoene desaturase and / or zeta-carotene desaturase and / or a crtlSO Have protein and / or an FtsZ protein and / or a MinD protein.

61. The method according to claim 60, characterized in that the gene expression of the HMG-CoA reductase and / or (E) -4-

Hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or l-deoxy-D-xylose-5-phosphate synthase and / or 1-deoxy-D-xylose-5-phosphate reductoisomerase and / or isopentenyl Diphosphate Δ isomerase and / or geranyl diphosphate synthase and / or farnesyl diphosphate synthase and / or geranyl geranyl diphosphate synthase and / or phytoene synthase and / or phytoene desaturase and / or zeta-carotene Desaturase and / or the crtlSO protein and / or the FtsZ protein and / or the MinD protein takes place under the control of a bleeding-specific promoter.

62. The method according to any one of claims 5 to 61, characterized in that the plants additionally have a reduced endogenous β-hydroxylase activity compared to the wild type.

63. The method according to claim 62, characterized in that the reduction of the endogenous β-hydroxylase activity in plants is achieved by at least one of the following methods:

a) introducing at least one double-stranded endogenous β-hydroxylase ribonucleic acid sequence or an expression cassette or expression cassettes guaranteeing its expression in plants, b) introducing at least one endogenous β-hydroxylase antisense ribonucleic acid sequence or an expression cassette ensuring its expression, c) introducing at least one endogenous β-hydroxylase antisense ribonucleic acid segment in combination with a ribozyme or an expression cassette or expression cassettes ensuring its expression in

5 plants, d) introducing at least one endogenous β-hydroxylase sense ribonucleic acid sequences into plants to induce co-suppression or an expression cassette ensuring their expression,

10 e) introduction of at least one DNA or protein binding

Factor against an endogenous β-hydroxylase gene, RNA or protein or an expression cassette ensuring its expression in plants, f) introducing at least one viral nucleic acid sequence causing the endogenous β-hydroxylase 15 RNA degradation or an expression cassette ensuring its expression in plants , g) introducing at least one construct for generating an insertion, deletion, inversion or mutation in

20 an endogenous β-hydroxylase gene in plants.

64. The method according to claim 63, embodiment a), characterized in that an RNA is introduced into the plant which has an area with a double-strand structure and

25 contains in this area a nucleic acid sequence which

30 b) is identical to at least a part of the plant's own endogenous β-hydroxylase promoter sequence.

65. The method according to claim 64, characterized in that the region with double-strand structure has a nucleic acid sequence

35, which is identical to at least a part of the plant's own, endogenous β-hydroxylase transcript and contains the 5 'end or the 3' end of the plant's own nucleic acid, coding for an endogenous β-hydroxylase.

40 66. The method according to claim 62 to 65, characterized in that genetically modified plants are used which have the lowest expression rate of an endogenous β-hydroxylase in flowers.

45

67. The method according to claim 66, characterized in that the transcription of the double-stranded endogenous β-hydroxylase ribonucleic acid sequence according to claim 63, embodiment a) and / or the antisense sequences according to claim 63, embodiment b) is carried out under the control of a flower-specific promoter.

68. The method according to any one of claims 5 to 67, characterized in that the plant used is a plant which has chromoplasts in petals.

69. The method according to any one of claims 5 to 68, characterized in that the plant is a plant selected from the Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae families,

Brassiceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllaceaeae, Malate.

70. The method according to claim 65, characterized in that the plant is a plant selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus,

Bignonia, Calenduia, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemiana Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Laburnum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysimachia Medicago, Mimulus, Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trio Tropaeolum, Tulipa, Tussilago, Ulex, Viola or Zinnia are used.

71. The method according to any one of claims 1 to 70, characterized in that after the cultivation, the genetically modified plants are harvested and the ketocarotenoids are then isolated from the petals of the plants.

72. The method according to any one of claims 1 to 71, characterized in that the ketocarotenoids are selected from the group astaxanthin, canthaxanthin, echinenone, 3-hydroxy-echinenone, 3 '-hydroxyechinenone, adonirubin and adonixanthin.

5

73. Nucleic acid construct containing functionally linked a flower-specific promoter and a nucleic acid encoding a ketolase.

74. Nucleic acid construct containing functionally linked a petal-specific promoter and a nucleic acid encoding a ketolase.

75. Nucleic acid construct containing at least one nucleic acid encoding a ketolase and additionally at least one further nucleic acid selected from the group a) nucleic acids encoding a β-cyclase, b) nucleic acids encoding a β-hydroxylase, c) nucleic acids encoding an HMG CoA reductase,

20 d) nucleic acids encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase e) nucleic acids encoding an l-deoxy-D-xylose-5-phosphate synthase, f) encoding nucleic acids an l-deoxy-D-xylose-5-phosphate 25 reductoisomerase, g) nucleic acids encoding an isopentenyl diphosphate Δ isomerase, h) nucleic acids encoding a geranyl diphosphate synthase, i) nucleic acids encoding a farnesyl diphosphate syn -

30 thase, j) nucleic acids encoding a geranyl-geranyl diphosphate synthase, k) nucleic acids encoding a phytoene synthase, 1) nucleic acids encoding a phytoene desaturase,

35 m) nucleic acids encoding a zeta-carotene desaturase, n) nucleic acids encoding a crtlSO protein, o) nucleic acids encoding an FtsZ protein, p) nucleic acids encoding a MinD protein, q) double-stranded endogenous β-hydroxylase ribonucleic acid

40 sequence and / or endogenous β-hydroxylase antisense ribonucleic acid sequences and r) double-stranded ε-cyclase ribonucleic acid sequence and / or ε-cyclase antisense ribonucleic acid sequence, the nucleic acids having one or more regulatory

45 signals are functionally linked that ensure transcription and translation in plants.

76. Including double-stranded RNA molecule

a) a “sense” RNA strand comprising at least one ribonucleotide sequence which is essentially identical

5 to at least part of the “sense” RNA ε cyclase transcript, and

b) an “antisense” RNA strand which is essentially complementary to the RNA sense strand under a).

10

77. Including double-stranded RNA molecule

a) a “sense” RNA strand comprising at least one ribonucleotide sequence which is essentially identical to

15 at least part of the "sense" RNA transcript of the

Promoter region of an ε-cyclase gene, and

b) an “antisense” RNA strand which is essentially complementary to the RNA “sense” strand under a).

20

78. Double-stranded RNA molecule according to claim 76, wherein the cDNA sequence which can be derived from the ε-cyclase transcript is described by SEQ ID NO: 38.

25 79. Double-stranded RNA molecule according to claim 77, wherein the

Nucleic acid sequence of the promoter region of the ε-cyclase gene is described by SEQ ID NO: 47.

80. Double-stranded RNA molecule according to one of claims 76

30 to 79, the “sense” RNA strand and the “antisense” RNA strand being covalently linked to one another in the form of an inverted repeat.

81. Double-stranded RNA molecule comprising 35 a) a “sense” RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least part of the “sense” RNA transcript of the endogenous β-hydroxylase, and

40 b) an “antisense” RNA strand which is essentially complementary to the RNA sense strand under a).

45

82. Including double-stranded RNA molecule

5 at least part of the "sense" RNA transcript of the

Promoter region of the endogenous β-hydroxylase gene, and

10

83. Double-stranded RNA molecule according to claim 83, wherein the cDNA sequence which can be derived from the endogenous β-hydroxylase transcript is described by SEQ ID NO: 103.

84. Transgenic expression cassette containing, in functional linkage with a promoter functional in plant organisms, transcribing a nucleic acid sequence a double-stranded RNA molecule according to one of claims 76 to 83.

20

85. The transgenic expression cassette according to claim 84, wherein the promoter is a flower-specific promoter.

86. Genetically modified plant, the genetic modification 25 the activity of a ketolase in petals,

A in the event that the wild type plant already has ketolase activity in petals, increased compared to the wild type and 30

35 87. Genetically modified plant according to claim 86, characterized in that the increase or causation of the ketolase activity is brought about by an increase or causation of the gene expression of a nucleic acid encoding a ketolase compared to the wild type.

40

Genetically modified plant according to claim 87, characterized in that nucleic acids which encode ketolases are introduced into the plant in order to increase or cause the gene expression.

45

89. Genetically modified plant which has chromoplasts in the petals, characterized in that the genetically modified plant contains at least one transgenic nucleic acid, coding for a ketolase.

90. Genetically modified plant according to one of claims 86 to

89, characterized in that the genetic modification additionally increases at least one of the activities selected from the group hydroxlase activity and β-cyclase activity compared to a wild type plant.

91. Genetically modified plant according to one of claims 86 to

90, characterized in that the genetic modification additionally reduces the ε-cyclase activity compared to a wild-type plant.

92. Genetically modified plant according to one of claims 86 to

91, characterized in that the genetic change additionally at least one of the activities selected from the group HMG-CoA reductase activity, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, 1 -Deoxy- D-xylose-5-phosphate synthase activity, 1-deoxy-D-xylose-5-phosphate reductoisomerase activity, isopentenyl-diphosp- has-Δ-isomerase activity, geranyl-diphosphate synthase activity , Farnesyl diphosphate synthase activity, geranyl geranyl diphosphate synthase activity, phytoene synthase activity, phytoene desaturase activity, zeta-carotene desaturase activity, crtlSO activity, FtsZ activity and MinD activity increased compared to a wild type plant.

93. Genetically modified plant according to one of claims 86 to

92, characterized in that the genetic modification additionally reduces the endogenous β-hydroxylase activity compared to a wild type plant.

94. Genetically modified plant according to one of claims 86 to 93, characterized in that the plant is selected from the plant families Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Brassiceae, Cucurbitaceae, Primulaceae, Caryophyleae, Caryophyl Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Orchidaceae, Malvaceae, liliaceaeae or Lamiac.

95. Genetically modified plant according to claim 94, selected from the group of the plant genera Marigold, Tagetes erecta, Tagetes patula, Lycopersicon, Rosa, Calenduia, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa,

5 Narcissus, Petunia, Geranium, or Tropaeolum or Adonis.

96. Genetically modified plant according to one of claims 86 to 95, characterized in that the ketolase is expressed in petals.

10

97. Genetically modified plant according to one of claims 86 to 96, characterized in that the expression rate of a ketolase is highest in petals.

15 98. Use of the genetically modified plants according to one of claims 86 to 97 as ornamental plants or as feed and food.

99. Use of the petals of the genetically modified

20 plants according to any one of claims 86 to 97 for the production of ketocarotenoid-containing extracts or for the production of feed and food supplements.

100. A method for producing genetically modified plants 25 according to claim 97, characterized in that one

Nucleic acid construct containing functionally linked a flower-specific promoter and encoding nucleic acids introduces a ketolase into the genome of the starting plant.

30

35

40

45