EP1532256A1

EP1532256A1 - Method for the production of $g(b)-carotinoids

Info

Publication number: EP1532256A1
Application number: EP03792344A
Authority: EP
Inventors: Martin Klebsattel; Matt Sauer; Ralf Flachmann; Christel Renate Schopfer
Original assignee: SunGene GmbH
Current assignee: SunGene GmbH
Priority date: 2002-08-20
Filing date: 2003-08-18
Publication date: 2005-05-25
Also published as: WO2004018688A1; AU2003258622A1; NO20050600L; US20060059584A1

Abstract

The invention relates to a method for the production of β-carotinoids by the cultivation of genetically-modified plants, the genetically-modified plants and the use thereof as human and animal foodstuffs and for the production of β-carotinoid extracts.

Description

Process for the preparation of ß-carotenoids

description

The present invention relates to a method for producing β-carotenoids by cultivating genetically modified plants, the genetically modified plants, and their use as food and feed and for producing β-carotenoid extracts.

Carotenoids are synthesized de novo in bacteria, algae, fungi and plants. ß-Carotenoids, i.e. carotenoids of the ß-carotene pathway, such as ß-carotene, ß-cryptoxanthine, zeaxanthine, antheraxanthine, violaxanthine and neoxanthine are natural antioxidants and pigments that are produced by microorganisms, algae, fungi and plants as secondary metabolites. . ß-Carotene is a vitamin A precursor and therefore an important component in food, feed and cosmetic applications. It is also used as a pigment in many areas, such as the beverage industry.

Zeaxanthin is one of the main pigments in the macula of the human eye and protects the sensitive visual cells with its special light absorption spectrum. Zeaxanthin is degraded by the light and must be replenished with the food in order to obtain efficient protection of the macula and to prevent long-term damage, such as age-related macular degeneration (ADM). Zeaxanthin also serves as a pigment for animal products, in particular for pigmenting egg yolk, skin and meat of chicken birds by oral administration.

Many ß-carotenoids are also of great economic interest because they are used as color pigments and antioxidants as food additives, dyes, preservatives, animal feed and food supplements.

The production of ß-carotenoids such as ß-carotene and zeaxanthin is nowadays mostly carried out by chemical synthesis processes.

Natural ß-carotenoids, such as natural ß-carotene, are obtained in small amounts in biotechnological processes by cultivating microorganisms, algae or fungi or by fermentation of genetically optimized microorganisms and subsequent isolation. Natural zeaxanthin is a component of so-called oleoresin, an extract from dried petals of the Tagetes errecta plant. However, the content of zeaxanthin in oleoresin is low, since the carotenoids in the Petaleή of Tagetesrerecta predominantly consist of carotenoids of the α-carotene pathway, such as lutein.

Increasing the ß-carotenoid content in plants or in the corresponding plant tissues is therefore an important goal of the biotechnological optimization of plants.

Carlo Rosati et al. describe the overexpression of a ß-cyclase from Arabidopsis thaliana with a fruit-specific promoter in tomato (Rosati C, Aquilani R, Dharmapuri S, Pallara P, Marusic C, Tavazza R, Bouvier F, Camara B, Giuliano G. Metabolie engineering of beta-carotene and lycopene content in tomato fruit. Plant J. 2000 Nov; 24 (3): 413-9.). As a result, the lycopene present in the wild-type fruit is increasingly converted into β-carotene.

Sridhar Dharmapuri et al. describe the overexpression of a ß cyclase and the combination with the overexpression of a ß hydroxylase in the fruit of tomato (Dharmapuri S, Rosati C, Pallara P, Aquilani R, Bouvier F, Camara B, Giuliano G. Metabolie engineering of xanthophyll content in tomato fruits , FEBS Lett. 2002 May 22; 519 (1-3): 30-4). The carotenoid content, here lutein, is numbered. In all cases, the lutein amounts are between 1.0 and 2.0 μg / mg fresh weight (wild type: 1.9 μg / mg) and the proportion of lutein in the total carotenoids is between 1, 4 and 2 in all the cases described , 9% (wild type: 2.8%). The content of lutein is not significantly reduced in any fruit of these transgenic plants.

EP 393690 B1, WO91 / 13078 A1, EP 735137 A1, EP 747483 A1 and WO 97/36998 A1 describe β-cyclase genes. ^• . ^•

EP 393690 describes a process for the preparation of carotenoids by using at least one of the genes coding for phytoene synthase, phytoene dehydrogenase, β-cyclase and β-hydroxylase obtained from Erwinia uredovora.

WO91 / 13078 A1 describes a process for the preparation of carotenoids by using the genes selected from GGPP synthase, phytoene synthase, phytoene dehydrogenase, β-cyclase and β-hydroxylase obtained from Erwinia herbicola.

WO 96/36717 describes a process for the preparation of carotenoids by using genes coding for β-cyclase obtained from Capsicum annum. EP 747483 A1 describes a process for the preparation of carotenoids by using the genes coding for GGPP synthase, phytoene synthase, phytoene dehydrogenase, β-cyclase and β-hydroxylase obtained from flavobacterium.

WO 96/28014 describes and claims DNA sequences coding for a β cyclase from Synechococcus sp. PCC7942, tobacco and tomato.

WO 00/08920 describes a new β-cyclase gene from tomato (Bgene), the use of the regulation signals of the gene for the chromoplast-specific expression of foreign genes and the use of the antisense DNA from Bgene for reducing the β-carotenoid content in tomato. WO 00/08920 also describes that the gene for the production of carotenoids can be overexpressed in higher plants.

WO 00/32788 describes a method for manipulating the carotenoid content in plants using β-cyclase genes from Marigold. WO 00/32788 also describes genetically modified Marigold plants that overexpress a β-cyclase. WO 00/32788 also describes genetically modified Marigold plants with a reduced ε-cyclase activity.

All of the prior art processes do in some cases provide a higher β-carotenoid content in the total carotenoid content, but without significantly reducing the amount of -carotenoids. However, the targeted lowering of the α-carotenoid content by the methods of the prior art, such as, for example, the reduction in the ε-cyclase activity, leads to a decrease in the total carotenoid content.

The invention was therefore based on the object to provide an alternative process for the production of β-carotenoids by cultivating genetically modified plants, or to provide other transgenic plants which produce β-carotenoids which have the disadvantages described Not have prior art and provide a high content of β-carotenoids, with a simultaneously lower amount of α-carotenoids.

Accordingly, a process for the production of ß-carotenoids was found by cultivating genetically modified plants which, compared to the wild type, have an increased ß-cyclase activity in plant tissues containing photosynthetically inactive plastids, and the increased ß-cyclase activity by β-cyclase is caused, containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the SEQ sequence. ID. NO. 2, with the proviso that tomato is excluded as a plant.

Surprisingly, it was found that the increase in the β-cyclase activity in plant tissues containing photosynthetically inactive plastids caused by a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 has, in genetically modified plants with the exception of tomato, an increase in the content of β-carotenoids and a decrease in the content of α-carotenoids.

Β-cyclase activity means the enzyme activity of a β-cyclase.

A ß-cyclase is understood to be a protein which has the enzymatic activity to convert a terminal, linear residue of lycopene into a ß-ionone ring.

In particular, a β-cyclase is understood to mean a protein which has the enzymatic activity, lycopene in γ-carotene, γ-carotene in β-carotene or lycopene _. convert to ß-carotene.

Accordingly, ß-cyclase activity is understood to mean the amount of lycopene or γ-carotene converted or the amount of γ-carotene or ß-carotene formed in a certain time by the ß-cyclase protein.

If the ß-cyclase activity is higher than that of the wild type, the amount of lycopene or γ-carotene converted or the amount of γ-carotene or ß-carotene formed is increased by the protein ß-cyclase in a certain time compared to the wild type.

This increase in the β-cyclase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the β- Wild-type cyclase activity.

The determination of the β-cyclase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably carried out under the following conditions: The activity of the β-cyclase is determined according to Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15) / π vitro. Potassium phosphate as a buffer (pH 7.6), lycopene as a substrate, stroma protein from paprika, NADP +, NADPH and ATP are added to a certain amount of plant extract.

The in vitro assay is carried out in a volume of 250 μl volume. The mixture contains 50 mM potassium phosphate (pH 7.6), different amounts of plant extract, 20 nM lycopene, 250 g of chromoplastidic stromal protein from paprika, 0.2 mM NADP +, 0.2 mM NADPH and 1 mM ATP. NADP / NADPH and ATP are in _. 10 ml ethanol dissolved with 1 mg Tween 80 immediately before adding to the incubation medium. After a reaction time of 60 minutes at 30C, the reaction is ended by adding chloroform / methanol (2: 1). The reaction products extracted in chloroform are analyzed by HPLC.

An alternative assay with a radioactive substrate is described in Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15).

The term “photosynthetically inactive plastids” is understood to mean plastids in which no photosynthesis takes place, such as, for example, chromoplasts, leucoplasts or amyloplasts.

Accordingly, the term “plant tissue containing photosynthetically inactive plastids” is understood to mean plant tissue or parts of plants which contain plastids in which no photosynthesis takes place, that is to say, for example, plant tissue or parts of plants which contain chromoplasts, leucoplasts or amyloplasts, such as flowers, fruits or tubers.

In an embodiment described in detail below, the plant tissues containing photosynthetically inactive plastids are selected from the group consisting of flower, fruit and tuber.

Depending on the starting plant used or a corresponding genetically modified plant, the plant in this preferred embodiment has an increased β-cyclase activity in flowers, fruits or tubers compared to the wild type.

It is advantageous for each plant to choose the plant tissue containing photosynthetically inactive plastids, ie preferably flower, fruit or tuber, in which the highest total carotenoid content is already present in the wild type. According to the invention, the term “wild type” is understood to mean the corresponding non-genetically modified starting plant.

Depending on the context, the term "plant" can mean the starting plant (wild type) or a genetically modified plant according to the invention or both.

Preferably and in particular in cases in which the plant or the wild type cannot be clearly assigned, “wild type” is used to increase the β-cyclase activity, to increase the hydroxylase activity described below, to reduce the described below endogenous ß-hydroxylase activity, for the reduction of ε-cyclase activity described below and the increase in the ß-carotenoid content each understood a reference plant.

This reference plant is particularly preferred for plants which have the highest carotenoid content in flowers as flowers, Tagetes erecta, Tagetes patula, Tagetes lucida, Tagetes pringlei, Tagetes palmeri, Tagetes minuta or Tagetes campanulata, particularly preferably Tagetes erecta.

This reference plant is for plants which, as a wild type, have the highest carotenoid content in fruits, preferably maize.

This reference plant is for plants which, as a wild type, have the highest carotenoid content in tubers, preferably Solanum tuberosum.

The β-cyclase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms at the translation and protein levels or by increasing the gene expression of a nucleic acid encoding a β-cyclase compared to the wild type, for example by inducing the β-cyclase gene by activators or strong promoters or by introducing nucleic acids encoding a β-cyclase into the plant.

In a preferred embodiment, the β-cyclase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 compared to the wild type. In a further preferred embodiment, the gene expression of a nucleic acid encoding a β-cyclase is increased by introducing nucleic acids which encode β-cyclases containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 has in the plant.

In this embodiment, in the transgenic plants according to the invention, there is at least one further β-cyclase gene under the control of a promoter which guarantees the expression of the β-cyclase gene in plant tissues containing photosynthetically inactive plastids, coding for a β- Cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 has. In this embodiment, the genetically modified plant according to the invention has in plant tissues containing photosynthetically inactive plastids, accordingly at least one exogenous (= heterologous) β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the

SEQ sequence. ID. NO. 2 has, on or at least two endogenous nucleic acids, coding for a β-cyclase, containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 has on.

For this purpose, in principle any β-cyclase gene according to the invention, that is to say any nucleic acids containing a β-cyclase, containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2, can be used coded.

All nucleic acids mentioned in the description can be, for example, an RNA, DNA or cDNA sequence.

In the case of genomic β-cyclase sequences from eukaryotic sources which contain introns, in the event that the host plant is unable or unable to express the corresponding β-cyclase, preference is given to nucleic acid sequences which have already been processed, such as to use the corresponding cDNAs. Examples of nucleic acids encoding a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2, and the corresponding β-cyclases containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 that can be used in the method according to the invention are, for example, sequences from

Tomato (Bgene; WO 00/08920; nucleic acid: SEQ ID NO: 1, protein SEQ ID NO: 2).

Further natural examples of β-cyclases and β-cyclase genes which can be used in the process according to the invention can be obtained, for example, from various organisms whose genomic sequence is known by comparing the identity of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the Sequences described above and in particular with the sequence SEQ ID NO: 2 are easy to find.

Further natural examples of β-cyclases and β-cyclase genes can also be obtained from the nucleic acid sequences described above, in particular from SEQ ID NO: 1, from various organisms, the genomic sequence of which is not known, by hybridization techniques in a manner known per se Easy to find.

The parameters and conditions used below for identity comparisons and hybridization techniques also apply analogously to all other nucleic acids and proteins described below which are used in preferred embodiments of the method according to the invention or of the genetically modified plants.

The hybridization can take place under moderate (low stringency) or preferably under stringent (high stringency) conditions.

Such hybridization conditions are described, for example, in Sambrook, J., Fritsch, EF, Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Cold Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6. For example, the conditions during the washing step can be selected from the range of conditions limited by those with low stringency (with 2X SSC at 50 ° C) and those with high stringency (with 0.2X SSC at 50 ° C, preferably at 65 ° C) (20X SSC: 0.3 M sodium citrate, 3 M sodium chloride, pH 7.0).

In addition, the temperature during the washing step can be raised from moderate conditions at room temperature, 22 ° C, to stringent conditions at 65 ° C.

Both parameters, salt concentration and temperature, can be varied simultaneously, one of the two parameters can be kept constant and only the other can be varied. Denaturing agents such as formamide or SDS can also be used during hybridization. In the presence of 50% formamide, the hybridization is preferably carried out at 42 ° C.

Some exemplary conditions for hybridization and washing step are given as a result:

(1) Hybridization conditions with, for example

(i) 4X SSC at 65 ° C, or

(ii) 6X SSC at 45 ° C, or

(iii) 6X SSC at 68 ° C, 100 mg / ml denatured fish sperm DNA, or

(iv) 6X SSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA at 68 ° C, or

(v) 6XSSC, ^' 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm

DNA, 50% formamide at 42 ° C, or

(vi) 50% formamide, 4X SSC at 42 ° C, or

(vii) 50% (vol / vol) formamide, 0.1% bovine serum albumin, 0.1% Ficoll, 0.1%

Polyvinylpyrrolidone, 50 mM sodium phosphate buffer pH 6.5, 750 mM NaCI, 75 mM sodium citrate at 42 ° C, or

(viii) 2X or 4X SSC at 50 ° C (moderate conditions), or (ix) 30 to 40% formamide, 2X or 4X SSC at 42 ° (moderate conditions).

(2) washing steps for 10 minutes each with for example

(i) 0.015 M NaCI / 0.0015 M sodium citrate / 0.1% SDS at 50 ° C, or

(ii) 0.1X SSC at 65 ° C, or

(iii) 0.1 X SSC, 0.5% SDS at 68 ° C, or

(iv) 0.1X SSC, 0.5% SDS, 50% formamide at 42 ° C, or

: (v) 0.2X SSC, 0.1% SDS at 42 ° C, or

(vi) 2X SSC at 65 ° C (moderate conditions).

In a preferred embodiment of the method according to the invention, nucleic acids are encoded which encode a protein containing the amino acid sequence SEQ ID NO: 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which preferably has an identity of at least 65% at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, particularly preferably at least 97% at the amino acid level with the sequence SEQ ID NO: 2 and the enzymatic property of a Cyclase.

This can be a natural β-cyclase sequence which, as described above, can be found by comparing the identity of the sequences or using hybridization techniques from other organisms, or an artificial β-cyclase sequence which is based on the sequence SEQ ID NO : 2 was modified by artificial variation, for example by substitution, insertion or deletion of amino acids.

In the description, the term “substitution” is to be understood as meaning the replacement of one or more amino acids by one or more amino acids. So-called conservative exchanges are preferably carried out, in which the replaced amino acid has a similar property to the original amino acid, with for example exchange of GIu by Asp, Gin by Asn, Val by lle, Leu by lle, Ser by Thr.

Deletion is the replacement of an amino acid with a direct link. Preferred positions for deietions are the termini of the polypeptide and the links between the individual protein domains.

Inserts are insertions of amino acids into the polypeptide chain, with a direct bond being formally replaced by one or more amino acids.

Identity between two proteins is understood to mean the identity of the amino acids over the respective total protein length, in particular the identity obtained by comparison with the aid of the laser genes software from DNASTAR, ine. Madison, Wisconsin (USA) using the Clustal method (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microeomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151 -1) using the following parameters becomes:

Multiple alignment parameter: gap penalty 10 gap length penalty 10

Pairwise alignment parameter: K-tuple 1

Gap penalty 3 window 5

Diagonals saved 5

A protein which has an identity of at least 20% at the amino acid level with a specific sequence is accordingly understood to mean a protein which, when comparing its sequence with the specific sequence, in particular according to the above program logarithm with the above parameter set, has an identity of at least 20%.

A protein which has an identity of at least 60% at the amino acid level with the sequence SEQ ID NO: 2 is accordingly understood to be a protein which, when comparing its sequence with the sequence SEQ ID NO: 2, in particular according to the above program logarithm with the above parameter set has an identity of at least 60%. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

Those codons which are frequently used in accordance with the plant-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other, known genes of the organisms in question.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 1 is introduced into the plant.

All of the above-mentioned β-cyclase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897). The attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

The β-cyclase containing the amino acid sequence SEQ is expressed in the process according to the invention. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2, under the control of regulatory signals, preferably a promoter and plastid transit peptides, which ensure the expression of the β-cyclase in the plant tissues, containing photosynthetically inactive plastids.

In a preferred embodiment, genetically modified plants are used which, in plant tissues containing photosynthetically inactive plastids, have the highest expression rate of the β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

This is preferably achieved in that the expression of the β-cyclase according to the invention takes place under the control of a promoter specific for the plant tissue. In the case described above in which the expression is to take place in flowers, it is advantageous for the β-cyclase according to the invention to be expressed under the control of a flower-specific or preferred petal-specific promoter.

In the case described above in which the expression is to take place in fruits, it is advantageous for the β-cyclase according to the invention to be expressed under the control of a fruit-specific promoter.

In the case described above that the expression is to be carried out in tubers, it is advantageous for the β-cyclase according to the invention to be expressed under the control of a bulb-specific promoter.

In a preferred embodiment, genetically modified plants are cultivated which additionally have an increased hydroxylase activity compared to the wild type.

Hydroxylase activity is understood to mean the enzyme activity of a β-carotene hydroxylase, which is referred to below as hydroxylase.

A hydroxylase is understood to mean a protein which has the enzymatic activity of introducing a hydroxyl group on the optionally substituted β-ionone ring of carotenoids.

In particular, a hydroxylase is understood to mean a protein which has the enzymatic activity to convert β-carotene into zeaxanthin.

Accordingly, hydroxyase activity means the amount of β-carotene or amount of zeaxanthin formed by the protein hydroxylase in a certain time.

If the hydroxylase activity is higher than that of the wild type, the amount of β-carotene or the amount of zeaxanthin formed is increased in a certain time by the protein hydroxylase compared to the wild type.

This increase in the hydroxylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the hydroxylase activity of the wild type. The "endogenous β-hydroxylase" described below means the plant's own endogenous hydroxylase. The activity is determined analogously.

5 The hydroxylase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably determined under the following conditions:

The activity of the hydroxylase is according to Bouvier et al. (Biochim. Biophys. Acta 1391 10 (1998), 320-328) in vitro. Ferredoxin, ferredoxin-NADP oxidoreductase, catalase, NADPH and beta-carotene with mono- and digalactosylglycerides are added to a certain amount of plant extract.

The hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, Keller, d'Harlingue and Camara (xanthophyll bio-synthesis: molecular and functional characterization of carotenoid hydroxylases from pepper fruits (Capsicum annuum L .; Biochim. Biophys. Acta 1391 (1998) 320-328):

The in vitro assay is carried out in a volume of 0.250 ml volume. The 0 approach contains 50 mM potassium phosphate (pH 7.6), 0.025 mg ferredoxin from spinach, 0.5 units ferredoxin-NADP + oxidoreductase from spinach, 0.25 mM NADPH, 0.010 mg beta-carotene (emulsified in 0.1 mg Tween 80), 0.05 mM a mixture of Mono- and digalactosylglycerides (1: 1), 1 unit of catalysis, 200 mono- and digalactosylglycerides, (1: 1), 0.2 mg bovine serum albumin and plant extract in 5 different volumes. The reaction mixture is incubated for 2 hours at 30C. The reaction products are extracted with organic solvent such as acetone or chloroform / methanol (2: 1) and determined by means of HPLC.

The hydroxylase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing the gene expression of nucleic acids encoding a hydroxylase compared to the Wiid type.

The increase in the gene expression of the nucleic acids encoding a hydroxylase 5 compared to the wild type can also be achieved in various ways, for example by inducing the hydroxylase gene by activators or by introducing one or more hydroxylase gene copies, i.e. by introducing at least one nucleic acid encoding a hydroxylase into the plant. Increasing the gene expression of a nucleic acid encoding a hydroxylase is also understood according to the invention to mean the manipulation of the expression of the plants' own endogenous hydroxylase.

This can be achieved, for example, by changing the promoter DNA sequence for genes encoding hydroxylases. Such a change, which results in an increased expression rate of the gene, can take place, for example, by deleting or inserting DNA sequences.

As described above, it is possible to change the expression of the endogenous hydroxylase by applying exogenous stimuli. This can take place through special physiological conditions, ie through the application of foreign substances.

Furthermore, an altered or increased expression of an endogenous hydroxylase gene can be achieved in that a regulator protein which does not occur in the non-transformed plant interacts with the promoter of this gene.

Such a regulator can represent a chimeric protein which consists of a DNA binding domain and a transcription activator domain, as described, for example, in WO 96/06166.

In certain preferred plants in which the focus of biosynthesis is on the α-carotenoid path, such as plants of the genus Tagetes, it is advantageous to reduce the endogenous β-hydroxylase activity and to increase the activity of exogenous hydroxylases.

In a preferred embodiment, the gene expression of a nucleic acid encoding a hydroxylase is increased by introducing at least one nucleic acid encoding a hydroxylase into the plant.

In principle, any hydroxylase gene, that is to say any nucleic acid which codes for a hydroxylase, can be used for this purpose.

In the case of genomic hydroxylase sequences from eukaryotic sources which contain introns, in the event that the host plant is unable or unable to express the corresponding hydroxylase, nucleic acid sequences which have already been processed, such as the corresponding cDNAs, are preferred use. Examples of a hydroxylase gene are:

a nucleic acid encoding a hydroxylase from Haematococcus pluvialis, Access AX038729, WO 0061764); (Nucleic acid: SEQ ID NO: 3, protein: SEQ ID NO: 4),

and hydroxylases of the following accession numbers:

lemblCAB55626.1, CAA70427.1, CAA70888.1, CAB55625.1, AF499108_1, AF315289_1, AF296158_1, AAC49443.1, NP_194300.1, NP_200070.1, AAG10430.1, CAC06712.1, AAM889530.1.1 AAL80006.1, AF162276.1, AAO53295.1, AAN85601.1, CRTZ_ERWHE, CRTZ_PANAN, BAB79605.1, CRTZ_ALCSP, CRTZ_AGRAU, CAB56060.1, ZP_00094836.1, AAC44852.1, BAC745370.12, NP_745370.12, NP_745370.12. 1, NP_849490.1, ZP_00087019.1, NP_503072.1, NP_852012.1, NP_115929.1, ZP_00013255.1

A particularly preferred hydroxylase is also the hydroxylase from tomato (Acc.No. LEY14810) (nucleic acid: SEQ ID NO: 5; protein: SEQ ID NO. 6).

In this preferred embodiment, at least one further hydroxylase gene is thus present in the preferred transgenic plants according to the invention compared to the wild type.

In this preferred embodiment, the genetically modified plant has, for example, at least one exogenous nucleic acid encoding a hydroxylase or at least two endogenous nucleic acids encoding a hydroxylase.

In the preferred embodiment described above, nucleic acids encoding proteins are preferably used as the hydroxylase genes, containing the amino acid sequence SEQ ID NO: 6 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 20 %, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 6, and which have the enzymatic property of a hydroxylase.

Further examples of hydroxylases and hydroxylase genes can be obtained, for example, from different organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or Find the corresponding back-translated nucleic acid sequences from databases with SeQ ID NO: 6.

Further examples of hydroxylases and hydroxylase genes can also easily be obtained, for example, starting from the sequence SEQ ID NO: 5 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se find.

In a further particularly preferred embodiment, to increase the hydroxylase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the hydroxylase of the sequence SEQ ID NO: 6.

Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

Those codons that are frequently used in accordance with the plant-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other, known genes of the organisms in question.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 5 is introduced into the organism.

All of the above-mentioned hydroxylase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). The attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

The expression of the hydroxylase in the process according to the invention is preferably carried out under the control of regulation signals, preferably a promoter and plastid transit peptides, which ensure the expression of the hydroxylase in the plant tissues containing photosynthetically inactive plastids. In a particularly preferred embodiment, genetically modified plants are used which, in plant tissues containing photosynthetically inactive plastids, have the highest expression rate of the hydroxylase.

This is preferably achieved in that the expression of the hydroxylase takes place under the control of a promoter specific for the plant tissue.

In the case described above in which the expression is to take place in flowers, it is advantageous for the additional expression of the hydroxylase to take place under the control of a flower-specific or preferred petal-specific promoter.

In the case described above that the expression should take place in fruits, it is advantageous for the additional expression of the hydroxylase to take place under the control of a fruit-specific promoter.

In the case described above in which the expression is to take place in tubers, it is advantageous for the additional expression of the hydroxylase to take place under the control of a tuber-specific promoter.

In a further preferred embodiment of the method, the genetically modified plants have, in addition to the wild type, a reduced activity of at least one of the activities selected from the group ε-cyclase activity and endogenous ß-hydroxylase activity.

Ε-Cyclase activity means the enzyme activity of an ε-cyclase.

An ε-cyclase is understood to mean a protein which has the enzymatic activity of converting a terminal, linear residue of lycopene into an ε-ionone ring.

An ε-cyclase is therefore understood to mean in particular a protein which has the enzymatic activity to convert lycopene to δ-carotene.

Accordingly, ε-cyclase activity is understood to mean the amount of lycopene converted or amount of δ-carotene formed by the protein ε-cyclase in a certain time.

With a reduced ε-cyclase activity compared to the wild type, the amount of lycopene converted or the amount of δ-carotene formed is reduced in a certain time by the protein ε-cyclase compared to the wild type. The determination of the ε-cyclase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably carried out under the following conditions:

The ε-cyclase activity can be determined according to Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15) / t7 vitro if potassium phosphate is used as a buffer for a certain amount of plant extract (pH 7.6 ), Lycopene as substrate, stromal protein from paprika, NADP +, NADPH and ATP are added.

The determination of the ε-cyclase activity in genetically modified plants according to the invention and in wild-type or reference plants is carried out particularly preferably according to Bouvier, d'Harlingue and Camara (Molecular Analysis of carotenoid cyclase inhibition; Arch. Biochem. Biophys. 346 (1) ( 1997) 53-64):

The in vitro assay is carried out in a volume of 0.25 ml. The mixture contains 50 mM potassium phosphate (pH 7.6), different amounts of plant extract, 20 nM lycopene, 0.25 mg of chromoplastid stromal protein from paprika, 0.2 mM NADP +, 0.2 mM NADPH and 1 mM ATP. NADP / NADPH and ATP are dissolved in 0.01 ml ethanol with 1 mg Tween 80 immediately before adding to the incubation medium. After a reaction time of 60 minutes at 30C, the reaction is ended by adding chloroform / methanol (2: 1). The reaction products extracted in chloroform are analyzed by HPLC.

An alternative assay with a radioactive substrate is described in Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15). Another analytical method is described in Beyer, Kröncke and Nievelstein (On the mechanism of the lycopene isomerase / cyclase reaction in Narcissus pseudonarcissus L chromopast, J. Biol. Chem. 266 (26) (1991) 17072-17078).

Endogenous β-hydroxylase activity is understood to mean the enzyme activity of the endogenous, plant-specific β-hydroxylase.

An endogenous .beta.-hydroxylase is understood to mean an endogenous, plant-specific hydroxylase as described above. For example, if Tagetes errecta is the genetically modified target plant, the endogenous β-hydroxylase is understood to mean the ß-hydroxylase of Tagetes errecta. An endogenous β-hydroxylase is accordingly understood to mean, in particular, a plant's own protein which has the enzymatic activity to convert β-carotene into zeaxanthin.

Accordingly, endogenous .beta.-hydroxylase activity is understood to mean the amount of .beta.-carotene or the amount of zeaxanthin formed by the protein which is endogenous .beta.-hydroxylase.

With a reduced endogenous ß-hydroxylase activity compared to the wild type, the amount of ß-carotene converted by the protein endogenous ß-hydroxylase or the amount of zeaxanthin formed is reduced in a certain time compared to the wild type.

This reduction in endogenous β-hydroxylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, further preferably 100%. The endogenous β-hydroxylase activity is particularly preferably completely switched off.

It has surprisingly been found that it is advantageous in plants which produce the majority of carotenoids of the α-carotene pathway, such as lutein, such as plants of the genus Tagetes, to reduce the activity of the endogenous β-hydroxylase and, if appropriate, the activity of a heterologous one To increase hydroxylase. Hydroxylases or functional equivalents thereof which are derived from plants which produce predominantly loaned carotenoids of the β-carotene pathway, such as, for example, the above-described β-hydroxylase from tomato (nucleic acid: SEQ ID No. 5, protein: SEQ ID No. 6).

Can we anticipate this already?

The endogenous β-hydroxylase activity is determined as described above analogously to the determination of the hydroxylase activity.

A reduced ε-cyclase activity or hydroxylase activity is preferably the partial or essentially complete prevention or blocking of the functionality of an ε-cyclase or hydroxylase in a plant cell, plant or one of these, based on different cell biological mechanisms understood derived part, tissue, organ, cells or seeds. The enzyme activities according to the invention in plants can be reduced compared to the wild type, for example by reducing the amount of protein or the amount of mRNA in the plant. Accordingly, an enzyme activity which is reduced compared to the wild type can be determined directly or by determining the amount of protein or the amount of mRNA of the plant according to the invention in comparison to the wild type.

A reduction in ε-cyclase activity includes a quantitative reduction in ε-cyclase up to an essentially complete absence of ε-cyclase (i.e. lack of detectability of ε-cyclase activity or lack of immunological detectability of ε-cyclase). Preferably, the ε-cyclase activity (or the ε-cyclase protein amount or the ε-cyclase mRNA amount) in the plant, particularly preferably in flowers compared to the wild type by at least 5%, more preferably by at least 20% , more preferably reduced by at least 50%, more preferably by 100%. In particular, "reduction" also means the complete absence of the ε-cyclase activity (or the ε-cyclase protein or the ε-cyclase mRNA).

A reduction in the endogenous β-hydroxylase activity comprises a quantitative reduction of an endogenous β-hydroxylase up to an essentially complete absence of the endogenous β-hydroxylase (ie lack of detectability of endogenous β-hydroxylase activity or lack of immunological detectability of the endogenous β-hydroxylase hydroxylase). The endogenous ß-hydroxylase activity (or the endogenous ß-hydroxylase protein amount or the endogenous ß-hydroxylase mRNA amount) in the plant, particularly preferably in flowers, is preferably more preferably reduced by at least 5% compared to the wild type at least 20%, more preferably reduced by at least 50%, more preferably reduced by 100%. In particular, "reduction" also means the complete absence of the endogenous β-hydroxylase activity (or the endogenous β-hydroxylase protein or the endogenous β-hydroxylase mRNA).

The ε-cyclase activity and / or the endogenous ß-hydroxylase activity in plants is preferably reduced by at least one of the following methods:

a) introducing at least one double-stranded ε-cyclase-ribonucleic acid sequence and / or endogenous ß-hydroxylase-ribonucleic acid sequence or an expression cassette or expression cassettes ensuring their expression in plants. Such procedures are included in which the dsRNA is directed against a gene (ie genomic DNA sequences such as the promoter sequence) or a transcript (ie mRNA sequences),

b) introducing at least one ε-cyclase-antisense-ribonucleic acid sequence and / or endogenous ß-hydroxylase-antisense-ribonucleic acid sequence or an expression cassette or expression cassette ensuring their expression into plants. These include methods in which the antisense RNA is directed against a gene (that is to say genomic DNA sequences) or a gene transcript (that is to say RNA sequences). Also included are α-anomeric nucleic acid sequences

c) introduction of at least one ε-cyclase-antisense-ribonucleic acid sequence and / or endogenous ß-hydroxylase-antisense-ribonucleic acid sequence in each case combined with a ribozyme or one which ensures their expression. Expression cassette or expression cassettes in plants,

d) introducing at least one ε-cyclase-sense ribonucleic acid sequence and / or endogenous ß-hydroxylase-sense ribonucleic acid sequence to induce a suppression or an expression cassette or expression cassette ensuring its expression in plants,

e) Introduction of at least one DNA or protein binding factor against an ε-cyclase gene, RNA or protein and / or endogenous β-hydroxylase gene, RNA or protein or an expression cassette or expression cassette which ensures its expression in plants,

f) introducing at least one viral nucleic acid sequence or nucleic acid sequences which bring about the ε-cyclase RNA and / or endogenous β-hydroxylase RNA degradation or an expression cassette or expression cassette ensuring their expression,

g) introducing at least one construct for generating an insertion, deletion, inversion or mutation in a ε-cyclase gene and / or endogenous ß-hydroxylase gene in plants. The method comprises the introduction of at least one construct to generate a loss of function, such as the generation of stop codons or a shift in the reading frame, on a gene, for example by generating an insertion, deletion, inversion or mutation in a gene. Knockout mutants can preferably be inserted by means of targeted insertion into said gene by homologous recombination or Introduction of sequence-specific nucleases against the corresponding gene sequences can be generated.

It is known to the person skilled in the art that other methods can also be used in the context of the present invention for reducing an ε-cyclase and / or endogenous β-hydroxylase or its activity or function. For example, the introduction of a dominant-negative variant of an ε-cyclase or endogenous β-hydroxylase or an expression cassette ensuring its expression can also be advantageous. Each of these methods can reduce the amount of protein, amount of mRNA and / or activity of an ε-cyclase or endogenous ß-hydroxylase. A combined application is also conceivable. Other methods are known to the person skilled in the art and can hinder or prevent the processing of ε-cyclase or endogenous ß-hydroxylase, the transport of ε-cyclase or endogenous ß-hydroxylase or its mRNAs, inhibition of ribosome attachment, inhibition of RNA splicing , Induction of an ε-cyclase-RNA or endogenous ß-hydroxylase-RNA degrading enzyme and / or inhibition of translation elongation or termination.

As a result, the individual preferred methods are described by way of exemplary embodiments:

a) introduction of a double-stranded ε-cyclase-ribonucleic acid sequence (ε-cyclase-dsRNA) or double-stranded endogenous ß-hydroxylase-ribonucleic acid sequence (endogenous ß-hydroxylase-dsRNA)

The method of gene regulation using double-stranded RNA (“double-stranded RNA interference”; dsRNAi) is known and is described, for example, in Matzke MA et al. (2000) Plant Mol Biol 43: 401-415; Fire A. et al (1998) Nature 391: 806-811; WO 99/32619; WO 99/53050; WO 00/68374; WO 00/44914; WO 00/44895; WO 00/49035 or WO 00/63364. We hereby expressly refer to the methods and methods described in the quotations given.

According to the invention, “double-stranded ribonucleic acid sequence” means one or more ribonucleic acid sequences that are theoretically in vitro and / or in vivo due to complementary sequences, for example according to the base pair rules of Waston and Crick and / or factually, for example due to hybridization experiments. to form double-stranded RNA structures.

The person skilled in the art is aware that the formation of double-stranded RNA structures represents an equilibrium state. The ratio of is preferred double-stranded molecules to corresponding dissociated forms at least 1 to 10, preferably 1: 1, particularly preferably 5: 1, most preferably 10: 1.

A double-stranded ε-cyclase-ribonucleic acid sequence or ε-cyclase-dsRNA is preferably understood to mean an RNA molecule which has a region with a double-strand structure and which contains a nucleic acid sequence in this region which

a) is identical to at least part of the plant's own ε-cyclase transcript and / or

b) is identical to at least part of the plant's own ε-cyclase promoter sequence.

In order to reduce the ε-cyclase activity, methods according to the invention are therefore preferably introduced into the plant with an RNA which has an area with a double-strand structure and which contains a nucleic acid sequence in this area which

The term "ε-cyclase transcript is understood to mean the transcribed part of an ε-cyelase gene which, in addition to the ε-cyclase coding sequence, also contains, for example, non-coding sequences such as, for example, also UTRs.

An RNA which is "identical to at least part of the plant's own ε-cyclase promoter sequence is preferably taken to mean that the RNA sequence with at least part of the theoretical transcript of the ε-cyclase promoter sequence, ie the corresponding RNA sequence, is identical.

"A part" of the plant's own ε-cyclase transcript or the plant's own ε-cyclase promoter sequence is understood to mean partial sequences which can range from a few base pairs to complete sequences of the transcript or the promoter sequence. The person skilled in the art can easily determine the optimal length of the partial sequences by routine experiments. A double-stranded endogenous β-hydroxylase ribonucleic acid sequence or also endogenous β-hydroxylase dsRNA is preferably understood to mean an RNA molecule which has a region with a double-strand structure and which contains a nucleic acid sequence in this region

a) is identical to at least part of the plant's own endogenous β-hydroxylase transcript and / or

b) is identical to at least a part of the plant's own endogenous β-hydroxylase promoter sequence.

In the method according to the invention, an RNA which has an area with a double-strand structure and which contains a nucleic acid sequence in this area is therefore preferably introduced into the plant to reduce the endogenous β-hydroxylase activity

The term "endogenous β-hydroxylase transcript" is understood to mean the transcribed part of an endogenous β-hydroxylase gene which, in addition to the endogenous β-hydroxylase coding sequence, also contains, for example, non-coding sequences, such as UTRs.

An RNA "which is identical to at least a part of the plant's own endogenous β-hydroxylase promoter sequence" means preferably that the RNA sequence with at least part of the theoretical transcript of the endogenous β-hydroxylase promoter Sequence, ie the corresponding RNA sequence, is identical.

"A part" of the plant's own, endogenous β-hydroxylase transcript or the plant's own endogenous β-hydroxylase promoter sequence is understood to mean partial sequences which can range from a few base pairs to complete sequences of the transcript or the promoter sequence. The person skilled in the art can easily determine the optimal length of the partial sequences by routine experiments. As a rule, the length of the partial sequences is at least 10 bases and at most 2 kb, preferably at least 25 bases and at most 1.5 kb, particularly preferably at least 50 bases and at most 600 bases, very particularly preferably at least 100 bases and at most 500, most preferably at least 200 bases or at least 300 bases and at most 400 bases.

The partial sequences are preferably selected in such a way that the highest possible specificity is achieved and activities of other enzymes, the reduction of which is not desired, are not reduced. It is therefore advantageous for the partial sequences of the dsRNA to select parts of the transcripts and / or partial sequences of the promoter sequences which do not occur in other activities.

In a particularly preferred embodiment, the dsRNA therefore contains a sequence which is identical to part of the plant's own ε-cyclase transcripts or endogenous β-hydroxylase transcripts and the 5 'end or the 3' end of the plant's own nucleic acid, encoding an ε-cyclase or endogenous ß-hydroxylase. In particular, non-translated regions in the 5 'or 3' of the transcript are suitable for producing selective double-strand structures.

Another object of the invention relates to double-stranded RNA molecules (dsRNA molecules) which, when introduced into a plant organism (or a cell, tissue, organ or propagation material derived therefrom) reduce a ε-cyclase or an endogenous ß- Cause hydroxylase.

A double-stranded RNA molecule for reducing the expression of an ε-cyclase (ε-cyclase-dsRNA) preferably comprises

a) a "sense" RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least part of a "sense" RNA ε-cyclase transcript, and

b) an “antisense” RNA strand which is essentially, preferably completely, complementary to the RNA “sense” strand under a).

To transform the plant with an endogenous β-hydroxylase dsRNA, a nucleic acid construct is preferably used which is introduced into the plant and which is transcribed in the plant into the endogenous β-hydroxylase dsRNA. A double-stranded RNA molecule for reducing the expression of an endogenous β-hydroxylase (endogenous β-hydroxylase dsRNA) preferably comprises

a) a “sense” RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least part of a “sense” RNA endogenous β-hydroxylase transcript, and

To transform the plant with an endogenous β-hydroxylase dsRNA, a nucleic acid construct is preferably used which is introduced into the plant and which is transcribed into the endogenous β-hydroxylase dsRNA in the plant.

These nucleic acid constructs are also called expression cassettes or expression vectors below.

With regard to the dsRNA molecules, ε-cyclase nucleic acid sequence or the corresponding transcript for the preferred plant Tagetes erecta is preferably understood to mean the sequence according to SEQ ID NO: 8 or a part thereof.

With regard to the dsRNA molecules, the endogenous β-hydroxylase nucleic acid sequence or the corresponding transcript for the preferred plant Tagetes erecta is preferably understood to mean the sequence according to SEQ ID NO: 16 or a part thereof.

“Essentially identical” means that the dsRNA sequence can also have insertions, deletions and individual point mutations in comparison to the target sequence and nevertheless brings about an efficient reduction in expression. The homology is preferably at least 75%, preferably at least 80%, very particularly preferably at least 90%, most preferably 100% between the "sense" strand of an inhibitory dsRNA and at least part of the "sense" RNA transcript, or between the "antisense" strand the complementary strand of the corresponding gene.

A 100% sequence identity between dsRNA and a gene transcript is not absolutely necessary in order to bring about an efficient reduction in protein expression. As a result, there is the advantage that the method is tolerant of sequence deviations, such as may arise as a result of genetic mutations, polymorphisms or evolutionary divergences. For example, it is possible with the dsRNA, which was generated on the basis of the ε-cyclase sequence or endogenous ß-hydroxylase sequence of one organism, to suppress the ε-cyclase expression or endogenous ß-hydroxylase expression in another organism. For this purpose, the dsRNA preferably comprises sequence regions of gene transcripts which correspond to conserved regions. Said conserved areas can easily be derived from sequence comparisons.

“Essentially complementary” means that the “antisense” RNA strand can also have insertions, deletions and individual point mutations in comparison to the complement of the “sense” RNA strand. The homology is preferably at least 80%, preferably at least 90%, very particularly preferably at least 95%, most preferably 100% between the "antisense" RNA strand and the complement of the "sense" RNA strand.

In a further embodiment, the ε-cyclase dsRNA comprises

a) a “sense” RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least part of the promoter sequence of an ε-cyclase gene, and

b) an “antisense” RNA strand which is essentially — preferably completely — complementary to the RNA “sense” strand under a).

The promoter region of an ε-cyclase for the preferred plant Tagetes Erecta is preferably understood to mean a sequence according to SEQ ID NO: 9 or a part thereof.

To produce the ε-cyclase dsRNA sequences to reduce the ε-cyclase activity, the following partial sequences are used with particular preference, in particular for the preferred plant Tagetes erecta:

SEQ ID NO: 10: Sense fragment of the 5'-terminal region of the ε-cyclase

SEQ ID NO: 11: Antisense fragment of the 5'-terminal region of the ε-cyclase

SEQ ID NO: 12: Sense fragment of the 3'-terminal region of the ε-cyclase

SEQ ID NO: 13: Antisense fragment of the 3'-terminal region of the ε-cyclase

SEQ ID NO: 14: Sense fragment of the ε-cyclase promoter SEQ ID NO: 15: Antisense fragment of the ε-cyclase promoter

In a further embodiment, the endogenous β-hydroxylase dsRNA comprises

a) a “sense” RNA strand comprising at least one ribonucleotide sequence which is essentially identical to at least part of the promoter sequence of an endogenous β-hydroxylase gene, and

To produce the endogenous β-hydroxylase dsRNA sequences for reducing the endogenous β-hydroxylase activity, the following partial sequences are used with particular preference, in particular for the preferred plant Tagetes erecta:

SEQ ID NO: 18: Sense fragment of the 5'-terminal region of the endogenous β-hydroxylase

SEQ ID NO: 19: Antisense fragment of the 5'-terminal region of the endogenous β-hydroxylase

The dsRNA can consist of one or more strands of polyribonucleotides. Of course, in order to achieve the same purpose, several individual dsRNA molecules, each comprising one of the ribonucleotide sequence sections defined above, can be introduced into the cell or the organism.

The double-stranded dsRNA structure can be formed from two complementary, separate RNA strands or - preferably - from a single, self-complementary RNA strand. In this case, the “sense” RNA strand and the “antisense” RNA strand are preferably covalently linked to one another in the form of an inverted “repeat”.

As described, for example, in WO 99/53050, the dsRNA can also comprise a hairpin structure in that the “sense” and “antisense” strand are connected by a connecting sequence (“linker”; for example an intron). The self-complementary dsRNA structures are preferred because they only require the expression of an RNA sequence and always comprise the complementary RNA strands in an equimolar ratio. The connecting sequence is preferably an intron (for example an intron of the ST-LS1 potato gene; Vancanneyt GF et al. (1990) Mol Gen Genet 220 (2): 245-250).

The nucleic acid sequence coding for a dsRNA can contain further elements, such as, for example, transcription termination signals or polyadenylation signals.

However, if the dsRNA is directed against the promoter sequence of an enzyme, it preferably does not include any transcription termination signals or polyadenylation signals. This enables retention of the dsRNA in the nucleus of the cell and prevents distribution of the dsRNA in the entire plant ("spreading").

If the two strands of the dsRNA are to be brought together in a cell or plant, this can be done, for example, in the following way:

a) transformation of the cell or plant with a vector which comprises both expression cassettes,

b) Co-transformation of the cell or plant with two vectors, one comprising the expression cassettes with the “sense” strand, the other the expression cassettes with the “antisense” strand.

c) crossing of two individual plant lines, one comprising the expression cassettes with the "sense" strand, the other the expression cassettes with the "antisense" strand.

The formation of the RNA duplex can be initiated either outside the cell or inside it.

The dsRNA can be synthesized either in vivo or in vitro. For this purpose, a DNA sequence coding for a dsRNA can be placed in an expression cassette under the control of at least one genetic control element (such as, for example, a promoter). Polyadenylation is not required, and there is no need for elements to initiate translation. The expression cassette for the MP-dsRNA is preferably contained on the transformation construct or the transformation vector.

The expression cassettes coding for the "antisense" and / or the "sense" strand of an ε-cyclase dsRNA or for the self-complementary strand of the dsRNA are preferably inserted into a transformation vector and with the ones below described method introduced into the plant cell. A stable insertion into the genome is advantageous for the method according to the invention.

The dsRNA can be introduced in an amount that enables at least one copy per cell. Larger quantities (e.g. at least 5, 10, 100, 500 or 1000 copies per cell) can possibly result in an efficient reduction.

b) introduction of an antisense-ribonucleic acid sequence of an ε-cyclase (ε-cyclase-antisenseRNA) or introduction of an antisense-ribonucleic acid sequence of an endogenous ß-hydroxylase (endogenous ß-hydroxylase-antisenseRNA)

Methods for the reduction of a certain protein by the "antisense" technology have been described in many cases, including in plants (Sheehy et al. (1988) Proc Natl Acad Sei USA 85: 8805-8809; US 4,801,340; Mol JN et al. (1990) FEBS Lett 268 (2): 427-430).

The antisense nucleic acid molecule hybridizes or binds with the cellular mRNA and / or genomic DNA coding for the ε-cyclase or endogenous β-hydroxylase to be reduced. This suppresses the transcription and / or translation of the ε-cyclase or endogenous ß-hydroxylase.

Hybridization can occur in a conventional manner via the formation of a stable duplex or - in the case of genomic DNA - by binding of the antisense nucleic acid molecule with the duplex of the genomic DNA through specific interaction in the major groove of the DNA helix.

An ε-cyclase antisense RNA can be derived using the nucleic acid sequence coding for this ε-cyclase, for example the nucleic acid sequence according to SEQ ID NO: 7 according to the base pair rules of Watson and Crick. The ε-cyclase antisenseRNA can be complementary to the entire transcribed mRNA of the ε-cyclase, limited to the coding region or consist only of an oligonucleotide which is complementary to part of the coding or non-coding sequence of the mRNA. For example, the oligonucleotide can be complementary to the region that comprises the translation start for the ε-cyclase.

An endogenous β-hydroxylase antisense RNA can be used using the nucleic acid sequence coding for this endogenous β-hydroxylase, for example the nucleic acid sequence according to SEQ ID NO: 16 according to the base pair rules of Watson and crick are derived. The endogenous β-hydroxylase antisenseRNA can be complementary to the entire transcribed mRNA of the endogenous β-hydroxylase, limited to the coding region or consist only of an oligonucleotide which is complementary to part of the coding or non-coding sequence of the mRNA. For example, the oligonucleotide can be complementary to the region that comprises the translation start for the endogenous β-hydroxylase.

The antisenseRNAs can have a length of, for example, 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides, but can also be longer and comprise at least 100, 200, 500, 1000, 2000 or 5000 nucleotides , The antisenseRNAs are preferably recombinantly expressed in the target cell in the context of the method according to the invention.

Another object of the invention relates to transgenic expression cassettes containing a nucleic acid sequence coding for at least a part of an ε-cyclase or endogenous β-hydroxylase, said nucleic acid sequence being functionally linked to a promoter which is functional in plant organisms in an antisense orientation.

Said expression cassettes can be part of a transformation construct or transformation vector, or can also be introduced as part of a co-transformation.

In a further preferred embodiment, the expression of an ε-cyclase or endogenous β-hydroxylase can be inhibited by nucleotide sequences which are complementary to the regulatory region of an ε-cyclase gene or endogenous ß-hydroxylase gene (for example promoters and / or enhancers ) and form triple-helical structures with the DNA double helix there, so that the transcription of the ε-cyclase gene or endogenous ß-hydroxylase gene is reduced. Appropriate methods are described (Helene C (1991) Anticancer Drug Res 6 (6): 569-84;

Helene C et al. (1992) Ann NY Acad Sei 660: 27-36; Mower LJ (1992) bioassays

14 (12): 807-815).

In a further embodiment, the antisenseRNA can be an α-anomeric nucleic acid. Such α-anomeric nucleic acid molecules form specific double-stranded hybrids with complementary RNA in which, in contrast to the conventional β-nucleic acids, the two strands run parallel to one another (Gautier C et al. (1987) Nucleic Acids Res 15: 6625-6641). c) Introduction of an ε-cyclase antisenseRNA or endogenous β-hydroxylase antisenseRNA combined with a ribozyme

The antisense strategy described above can advantageously be coupled with a ribozyme method. Catalytic RNA molecules or ribozymes can be adapted to any target RNA and cleave the phosphodiester framework at specific positions, whereby the target RNA is functionally deactivated (Tanner NK (1999) FEMS Microbiol Rev 23 (3): 257-275 ). This does not modify the ribozyme itself, but is able to cleave further target RNA molecules analogously, which gives it the properties of an enzyme. The incorporation of ribozyme sequences into "antisense" RNAs gives precisely these "antisense" RNAs this enzyme-like, RNA-cleaving property and thus increases their efficiency in inactivating the target RNA. The preparation and use of corresponding ribozyme "antisense" RNA molecules is described (inter alia in Haseloff et al. (1988) Nature 334: 585-591); Haselhoff and Gerlach (1988) Nature 334: 585-591; Steinecke P et al. (1992) EMBO J 11 (4): 1525-1530; de Feyter R et al. (1996) Mol Gen Genet. 250 (3): 329-338).

In this way, ribozymes (e.g. "Hammerhead" ribozymes; Haselhoff and Gerlach (1988) Nature 334: 585-591) can be used to catalytically cleave the mRNA of a ε-cyclase to be reduced and thus to prevent translation. The

Ribozyme technology can increase the efficiency of an antisense strategy. Methods for the expression of ribozymes for the reduction of certain proteins are described in (EP 0291 533, EP 0321 201, EP 0360257). Ribozyme expression is also described in plant cells (Steinecke P et al. (1992) EMBO J 11 (4): 1525-1530; de Feyter R et al. (1996) Mol Gen Genet. 250 (3): 329- 338).

Suitable target sequences and ribozymes can, for example, as described in "Steinecke P, Ribozymes, Methods in Cell Biology 50, Galbraith et al. Eds, Academic Press, Inc. (1995), pp. 449-460", by secondary structure calculations of ribozyme and Target RNA and their interaction can be determined (Bayley CC et al. (1992) Plant Mol Biol. 18 (2): 353-361; Lloyd AM and Davis RW et al. (1994) Mol Gen Genet. 242 (6) : 653-657). For example, derivatives of Tetrahymena L-19 IVS RNA can be constructed which have regions complementary to the mRNA of the ε-cyclase to be suppressed (see also US Pat. No. 4,987,071 and US Pat. No. 5,116,742). Alternatively, such ribozymes can also be identified via a selection process from a library of diverse ribozymes (Bartel D and Szostak JW (1993) Science 261: 1411-1418). d) introduction of a sense ribonucleic acid sequence of an ε-cyclase or endogenous ß-hydroxylase (ε-cyclase-senseRNA or endogenous ß-hydroxylase-senseRNA) to induce co-suppression

The expression of an ε-cyclase ribonucleic acid sequence or endogenous ß-hydroxylase ribonucleic acid sequence (or a part thereof) in sense orientation can lead to a co-suppression of the corresponding ε-cyclase gene or endogenous ß-hydroxylase gene. The expression of sense RNA with homology to an endogenous gene can reduce or switch off its expression, similar to that described for antisense approaches (Jorgensen et al. (1996) Plant Mol Biol 31 (5): 957-973; Goring et al. (1991) Proc Natl Acad Sei USA 88: 1770-1774; Smith et al. (1990) Mol Gen Genet 224: 447-481; Napoli et al. (1990) Plant Cell 2: 279-289; Van der Krol et al. (1990) Plant Cell 2: 291-99). The construct introduced can represent the homologous gene to be reduced in whole or in part. The possibility of translation is not necessary. The application of this technology to plants is described (e.g. Napoli et al. (1990) Plant Cell 2: 279-289; in US 5,034,323.

The suppression for the particularly preferred plant Tagetes ercecta is preferably implemented using a sequence which is essentially identical to at least part of the nucleic acid sequence coding for an ε-cyclase or endogenous β-hydroxylase, for example the nucleic acid sequence according to SEQ ID NO: 7 or SEQ. ID. NO. 16th

The senseRNA is preferably selected in such a way that the corresponding protein or a part thereof cannot be translated. For this purpose, the 5'-untranslated or 3'-untranslated region can be selected, for example, or the ATG start codon can be deleted or mutated.

e) Introduction of DNA or protein binding factors against ε-cyclase genes, RNAs or proteins or against endogenous β-hydroxylase genes, RNAs or proteins

A reduction in ε-cyclase or endogenous ß-hydroxylase expression is also possible with specific DNA-binding factors, for example with factors of the type of zinc finger transcription factors. These factors attach to the genomic sequence of the endogenous target gene, preferably in the regulatory areas, and bring about a reduction in expression. Appropriate processes for the production of such factors are described (Dreier B et al. (2001) J Biol Chem 276 (31): 29466-78; Dreier B et al. (2000) J Mol Biol 303 (4): 489-502; Beerii RR et al. (2000) Proc NatI Acad Sei USA 97 (4): 1495-1500; Beerii RR et al. (2000) J Biol Chem 275 (42): 32617-32627; Segal DJ and Barbas CF 3rd. (2000) Curr Opin Chem Biol 4 (1): 34-39; Kang JS and Kim JS (2000) J Biol Chem 275 (12): 8742-8748; Beerii RR et al. (1998) Proc NatI Acad Sei USA 95 (25): 14628-14633; Kim JS et al. (1997) Proc NatI Acad Sei USA 94 (8): 3616-3620; Klug A (1999) J Mol Biol 293 (2): 215-218; Tsai SY et al. (1998) Adv Drug Deliv Rev 30 (1 -3): 23-31; Mapp AK et al. (2000) Proc NatI Acad Sei USA 97 (8): 3930-3935; Sharrocks AD et al. (1997) Int J Biochem Cell Biol 29 (12): 1371-1387; Zhang L et al. (2000) J Biol Chem 275 (43): 33850-33860).

These factors can be selected using any piece of an ε-cyclase gene or endogenous ß-hydroxylase gene. This section is preferably in the region of the promoter region. For gene suppression, however, it can also lie in the area of the coding exons or introns.

In addition, factors can be introduced into a cell that inhibit the ε-cyclase or endogenous ß-hydroxylase itself. These protein binding factors can e.g. Aptamers (Famulok M and Mayer G (1999) Curr Top Microbiol Immunol 243: 123- 36) or antibodies or antibody fragments or single-chain antibodies. The extraction of these factors has been described (Owen M et al. (1992) Biotechnology (NY) 10 (7): 790-794; Franken E et al. (1997) Curr Opin Biotechnol 8 (4): 411 -416; Whitelam ( 1996) Trend Plant Be 1: 286-272).

f) introduction of the ε-cyclase RNA degradation or endogenous ß-hydroxylase RNA degradation causing viral nucleic acid sequences and expression constructs

The ε-cyclase or endogenous ß-hydroxylase expression can also effectively by inducing the specific RNA degradation by the plant using a viral expression system (Amplikon; Angell SM et al. (1999) Plant J 20 (3): 357-362 ) will be realized. These systems - also referred to as "VIGS" (viral induced gene silencing) - introduce nucleic acid sequences into the plant with homology to the transcript of an enzyme activity to be reduced by means of viral vectors.

The transcription is then switched off - presumably mediated by plant defense mechanisms against viruses. Appropriate techniques and processes are described (Ratcliff F et al. (2001) Plant J 25 (2): 237-45; Fagard M and Vaucheret H (2000) Plant Mol Biol 43 (2-3): 285-93; Anandalakshmi R et al. (1998) Proc NatI Acad Sei USA 95 (22): 13079-84; Ruiz MT (1998) Plant Cell 10 (6): 937-46). The VIGS-mediated reduction is preferably implemented using a sequence which is essentially identical to at least part of the nucleic acid sequence coding for an ε-cyclase or an endogenous β-hydroxylase, for example the nucleic acid sequence according to SEQ ID NO: 7 or 16 ,

g) Introduction of constructs for generating a loss of function or a loss of function on ε-cyclase genes or endogenous ß-hydroxylase genes

Numerous methods are known to the person skilled in the art of how genomic sequences can be modified in a targeted manner. These include in particular methods such as the generation of knockout mutants by means of targeted homologous recombination e.g. by generating stop codons, shifts in the reading frame etc. (Hohn B and Puchta H (1999) Proc NatI Acad Sei USA 96: 8321-8323) or the targeted deletion or inversion of sequences using e.g. sequence-specific recombinases or nucleases (see below).

The reduction in the amount, function and / or activity of the enzyme can also be achieved by a targeted insertion of nucleic acid sequences (for example the nucleic acid sequence to be inserted in the context of the method according to the invention) into the sequence coding for an ε-cyclase or endogenous ß- Hydroxylase (eg by means of intermolecular homologous recombination) can be realized. In the context of this embodiment, a DNA construct is preferably used which comprises at least a part of the sequence of an ε-cyclase gene or endogenous β-hydroxylase gene or neighboring sequences, and can thus be recombined in a targeted manner in the target cell, so that a Deletion, addition or substitution of at least one nucleotide, the ε-cyclase gene or endogenous ß-hydroxylase gene is changed such that the functionality of the gene is reduced or completely eliminated.

The change can also affect the regulatory elements (eg the promoter) of the genes, so that the coding sequence remains unchanged, but expression (transcription and / or translation) is omitted and reduced. In conventional homologous recombination, the sequence to be inserted is flanked at its 5 'and / or 3' end by further nucleic acid sequences (A 'or B') which are of sufficient length and homology to the corresponding sequences of the ε-cyclase gene or endogenous β-hydroxylase gene (A or B) to enable homologous recombination. The length is usually in a range from several hundred bases to several kilobases (Thomas KR and Capecchi MR (1987) Cell 51: 503; Strepp et al. (1998) Proc NatI Acad Sei USA 95 (8): 4368- 4373). For homologous recombination, the plant cell with the Recombinant construct transformed using the method described below and successfully recombined clones selected based on the inactivated ε-cyclase or endogenous ß-hydroxylase.

In a further preferred embodiment, the efficiency of the recombination is increased by combination with methods which promote homologous recombination. Such methods are described and include, for example, the expression of proteins such as RecA or the treatment with PARP inhibitors. It could be shown that the intrachromosomal homologous recombination in tobacco plants can be increased by using PARP inhibitors (Puchta H et al. (1995) Plant J 7: 203-210). By using these inhibitors, the rate of homologous recombination in the recombination constructs after induction of the sequence-specific DNA double-strand break and thus the efficiency of deletion of the transgene sequences can be further increased. Various PARP inhibitors can be used. Inhibitors such as 3-aminobenzamide, 8-hydroxy-2-methylquinazolin-4-one (NU1025), 1, 11 b-dihydro- [2H] benzopyrano- [4,3,2-deJisoquinolin-3-one (GPI 6150), 5-aminoisoquinolinone, 3,4-dihydro-5- [4- (1-piperidinyl) butoxy] -1 (2H) -isoquinolinone or those described in WO 00/26192, WO 00/29384, WO 00/32579, WO 00/64878, WO 00/68206, WO 00/67734, WO 01/23386 and WO 01/23390.

Other suitable methods are the introduction of nonsense mutations into endogenous marker protein genes, for example by introducing RNA / DNA oligonucleotides into the plant (Zhu et al. (2000) Nat Biotechnol 18 (5): 555-558) or the generation of Knockout mutants with the help of e.g. T-DNA mutagenesis (Koncz et al., Plant Mol. Biol. 1992, 20 (5): 963-976). Point mutations can also be generated using DNA-RNA hybrids, also known as "chimeraplasty" (Cole-Strauss et al. (1999) Nucl Acids Res 27 (5): 1323-1330; Kmiec (1999) Gene therapy American Scientist 87 (3): 240-247).

In a particularly preferred embodiment of the method according to the invention, the ε-cyclase activity is reduced compared to the wild type by:

a) introducing at least one double-stranded ε-cyclase ribonucleic acid sequence or an expression cassette or expression cassettes ensuring its expression into plants and / or

b) introducing at least one ε-cyclase antisense ribonucleic acid sequences or an expression cassette ensuring their expression into plants. In a very particularly preferred embodiment, the ε-cyclase activity is reduced compared to the wild type by introducing at least one double-stranded ε-cyclase ribonucleic acid sequence or an expression cassette or expression cassettes ensuring its expression in plants.

The transcription of the ε-cyclase-dsRNA sequences in the method according to the invention is preferably carried out under the control of regulation signals, preferably a promoter and plastid transit peptides, which ensure the transcription of the ε-cyclase-dsRNA sequences in the plant tissues containing photosynthetically inactive plastids.

In a particularly preferred embodiment, genetically modified plants are used which, in plant tissues containing photosynthetically inactive plastids, have the highest transcription rate of the ε-cyclase dsRNA sequences. .

This is preferably achieved in that the transcription of the ε-cyclase dsRNA sequences takes place under the control of a promoter specific for the plant tissue.

In the case described above that the expression should take place in flowers, it is advantageous that the transcription of the ε-cyclase dsRNA sequences takes place under the control of a flower-specific or preferred petal-specific promoter.

In the case described above that the expression should take place in fruits, it is advantageous that the transcription of the ε-cyclase dsRNA sequences takes place under the control of a fruit-specific promoter.

In the case described above in which the expression is to take place in tubers, it is advantageous for the transcription of the ε-cyclase dsRNA sequences to take place under the control of a bulb-specific promoter.

In a particularly preferred embodiment of the method according to the invention, the endogenous β-hydroxylase activity is reduced compared to the wild type by:

a) introducing at least one double-stranded endogenous β-hydroxylase ribonucleic acid sequence or an expression cassette or expression cassettes ensuring its expression into plants and / or b) introducing at least one endogenous β-hydroxylase antisense-ribonucleic acid sequences or an expression cassette ensuring their expression into plants.

In a very particularly preferred embodiment, the endogenous β-hydroxylase activity is reduced compared to the wild type by introducing at least one double-stranded endogenous β-hydroxylase ribonucleic acid sequence or an expression cassette or expression cassettes ensuring its expression in plants.

The transcription of the endogenous β-hydroxylase dsRNA sequences in the method according to the invention is preferably carried out under the control of regulation signals, preferably a promoter and plastid transit peptides which transcribe the endogenous β-hydroxylase dsRNA sequences in the plant tissues, containing photosynthetically inactive plastids , guarantee.

In a particularly preferred embodiment, genetically modified plants are used which, in plant tissues containing photosynthetically inactive plastids, have the highest transcription rate of the endogenous β-hydroxylase dsRNA sequences.

This is preferably achieved in that the transcription of the endogenous β-hydroxylase dsRNA sequences is carried out under the control of a promoter specific for the plant tissue.

In the case described above that the expression should take place in flowers, it is advantageous that the transcription of the endogenous β-hydroxylase dsRNA sequences takes place under the control of a flower-specific or preferred petale-specific promoter.

In the case described above in which the expression is to take place in fruits, it is advantageous for the endogenous β-hydroxylase dsRNA sequences to be transcribed under the control of a fruit-specific promoter.

In the case described above in which the expression is to take place in tubers, it is advantageous for the endogenous β-hydroxylase dsRNA sequences to be transcribed under the control of a tuber-specific promoter.

Genetically modified plants with the following combinations of genetic changes are particularly preferably used in the method according to the invention: Genetically modified plants which have an increased β-cyclase activity according to the invention and an increased hydroxylase activity compared to the wild type,

genetically modified plants which, compared to the wild type, have an increased β-cyclase activity according to the invention and a reduced ε-cyclase activity,

genetically modified plants which, compared to the wild type, have an increased β-cyclase activity according to the invention and a reduced, endogenous β-hydroxylase activity,

genetically modified plants which, compared to the wild type, have an increased β-cyclase activity according to the invention, an increased hydroxylase activity and a reduced ε-cyclase activity.

genetically modified plants which, compared to the wild type, have an increased β-cyclase activity according to the invention, a reduced ε-cyclase activity and a reduced, endogenous β-hydroxylase activity,

genetically modified plants which, compared to the wild type, have an increased β-cyclase activity according to the invention, an increased hydroxylase activity and a reduced, endogenous β-hydroxylase activity,

genetically modified plants which, compared to the wild type, have an increased β-cyclase activity according to the invention, an increased hydroxylase activity and a reduced ε-cyclase activity and a reduced, endogenous β-hydroxylase activity.

As described below, these genetically modified plants can be produced, for example, by introducing individual nucleic acid constructs (expression cassettes) or by introducing multiple constructs which contain up to two, three or four of the activities described.

In the process according to the invention for producing β-carotenoids, the cultivation step of the genetically modified plants, hereinafter also referred to as transgenic plants, is preferably followed by harvesting the plants and isolating the β-carotenoids from the plants or the plant tissues containing photosynthetically inactive plastids.

The transgenic plants are grown on nutrient media in a manner known per se and harvested accordingly. The isolation of β-carotenoids from the harvested plant tissues containing photosynthetically inactive plastids, such as flowers, fruits or tubers, is carried out in a manner known per se, for example by drying and subsequent extraction and, if appropriate, further chemical or physical purification processes, such as, for example, precipitation methods. Crystallography, thermal separation processes such as rectification processes or physical separation processes such as chromatography. The isolation of β-carotenoids from the plant tissues containing photosynthetically inactive plastids, such as flowers, fruits or tubers, is preferably carried out, for example, by organic solvents such as acetone, hexane, ether or tert-methylbutyl ether.

Further isolation processes for β-carotenoids, in particular from petals, are described, for example, in Egger and Kleinig (Phytochemistry (1967) 6, 437-440) and Egger (Phytochemistry (1965) 4, 609-618).

The β-carotenoids are preferably selected from the group β-carotene, β-cryptoxanthine, zeaxanthin, antheraxanthin, violaxanthin and neoxanthine.

Preferred β-carotenoids are β-carotene and zeaxanthin, particularly preferably zeaxanthin.

The plant tissues containing photosynthetically inactive plastids are preferably selected from the group consisting of flower, fruit and tuber.

In a preferred embodiment of the method according to the invention, a plant selected from the Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae families is used as the genetically modified plants which have an increased β-cyclase activity in flowers compared to the wild type , Vitaceae, Brassiceae, Cucurbitaceae, Primulaceae, Caryophyllaceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeo- laceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliacideaeae, Liliacideaeae, Liliacideaeae, Liliacideaeae, Liliaceaeae, Liliaceaeae, Liliaceaeae, Liliaceaeae, Liliaceaeae, Liliaceaeae, Liliaceaeae, Liliaceaeae, Liliaceaeae, Liliaceaeae, Liliaceaeae, Liliaceaeae, Liliacideaeae, Liliacideae, Liliaceaeae,

Plants selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus, Bignonia, Calendula, Calendula officinalis, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum are particularly preferred Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Greviilea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hyperi- cum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Labumum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Solanum tuberosum, Sorbus, Spartium, Tecoma, Torenia, Tragiusogon , Tropaeolum, Tulipa, Tussilago, Ulex, Viola or Zinnia.

In a further preferred embodiment of the method according to the invention, a plant selected from the plant genera Actinophloeus, Aglaeonema, Pineapple, Arbutus, Archontophoenix, Area, Aronia is used as the genetically modified plants which have an increased β-cyclase activity in fruits compared to the wild type , Asparagus, Avocado, Attalea, Berberis, Bixia, Brachychilum, Bryonia, Caliptocalix, Capsicum, Carica, Celastrus, Citrullus, Citrus, Convallaria, Cotoneaster, Crataegus, Cucumis, Cucurbita, Cuscuta, Cycas, Cyphomandra, Diospyrusus, Diosyrusus , Elaeis, Erythroxylon, Euonymus, Pea, Ficus, Fortunella, Fragaria, Gardinia, Gonocaryum, Gossypium, Guava, Guilielma, Hibiscus, Hippophaea, Iris, Kiwi, Lathyrus, Lonicera, Luffa, Lycium, Lycopersicum, Mais, Malpighormod, Mang , Murraya, Musa, Nenga, Orange, Palisota, Pandanus, Passiflora, Persea, Physalis, Prunus, Ptychandra, Punica, Pyracantha, Pyrus, Ribes, Rosa, Rubus, Sabal, Sa mbucus, Seaforita, Shepherdia, Solanum, Sorbus, Synaspadix, Tabernae, Tamus, Taxus, Trichosanthes, Triphasia, Vaccinium, Viburnum, Vignia, Vitis or Zucchini.

In a further preferred embodiment of the method according to the invention, a plant selected from the plant species beetroot, radish, radish and Solanum tuberosum is used as the genetically modified plant which has an increased β-cyclase activity in tubers compared to the wild type.

Particularly preferred plants, as a wild type, have a higher proportion of α-carotenoids than β-carotenoids in the total carotenoid content in plant tissues containing photosynthetically inactive plastids.

Particularly preferred plants are Marigold, Tagetes erecta, Tagetes patula, the production of the β-carotenoids, preferably zeaxanthin, in flowers, particularly preferably in the petals.

The following is an example of the production of genetically modified plants with increased β-cyclase activity in plant tissues containing photosynthetically inactive plastids such as flowers, fruits or tubers. The increase Further activities, such as, for example, the hydroxylase activity, can be carried out analogously using a nucleic acid sequence encoding a hydroxylase instead of encoding a β-cyclase instead of nucleic acid sequences. The reduction of further activities, for example the reduction of the ε-cyclase activity and / or the endogenous ß-hydroxylase activity, can be carried out analogously using a antisense nucleic acid sequence or inverted repeat nucleic acid sequence instead of nucleic acid sequences encoding a ß-cyclase.

In the combination of genetic changes, the transformation can take place individually or through multiple constructs.

The transgenic plants are preferably produced by transforming the starting plants with a nucleic acid construct which contains the β-cyclase encoding the above-described nucleic acids and which are functionally linked to one or more regulation signals which ensure transcription and translation in plants.

These nucleic acid constructs, in which the coding nucleic acid sequence is functionally linked to one or more regulatory signals which ensure transcription and translation in plants, are also called expression cassettes below.

The invention further relates to nucleic acid constructs containing at least one nucleic acid encoding a β-cyclase and additionally at least one further nucleic acid selected from the group a) nucleic acids encoding a β-hydroxylase, b) double-stranded endogenous β-hydroxylase ribonucleic acid sequence and / or endogenous ß-hydroxylase antisense Ribonucleic acid sequences and c) double-stranded ε-cyclase ribonucleic acid sequence and / or ε-cyclase antisense ribonucleic acid sequence,

wherein the nucleic acids are functionally linked to one or more regulatory signals that ensure transcription and translation in plants.

It is difficult to achieve technically, especially in plants, several

Increase or decrease activities with a nucleic acid construct. Combinations of nucleic acid constructs are therefore preferably used in order to increase or decrease the activities, in particular to increase or decrease more than 3 activities in plants. However, it is also possible to cross over genetically modified plants that already contain modified activities. For example, by crossing genetically modified plants that each contain two modified activities, it is possible to produce plants with four modified activities. The same can also be achieved by introducing a combination of two nucleic acid constructs into the plants that each change 2 activities.

In a preferred embodiment, the preferred genetically modified plants are produced by introducing combinations of nucleic acid constructs.

The regulation signals preferably contain one or more promoters which ensure transcription and translation in plant tissues containing photosynthetically inactive plastids, such as flowers, fruits or tubers.

The expression cassettes contain regulatory signals, that is to say regulatory nucleic acid sequences which control the expression of the coding sequence in the host cell. According to a preferred embodiment, an expression cassette comprises upstream, i.e. at the 5 'end of the coding sequence, a promoter and downstream, i.e. at the 3 'end, a polyadenylation signal and optionally further regulatory elements which are operatively linked to the coding sequence in between for at least one of the genes described above. An operative link is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended when expressing the coding sequence.

The preferred nucleic acid constructs, expression cassettes and vectors for plants and methods for producing transgenic plants and the transgenic plants themselves are described below by way of example.

The sequences preferred but not limited to the operative linkage are targeting sequences to ensure subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochondrion, in the endoplasmic reticulum (ER), in the nucleus, in oil bodies or other compartments and translation enhancers such as the 5 'leader sequence from the tobacco mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711).

In principle, any promoter which expresses the expression of foreign genes in plant tissues is suitable as a promoter of the expression cassette according to the invention. holding photosynthetically inactive plastids, such as flower, fruit or tuber.

“Constitutive” promoter means those promoters which ensure expression in numerous, preferably all, tissues over a relatively long period of plant development, preferably at all times during plant development.

In particular, a plant promoter or a plant virus-derived promoter is preferably used. Particularly preferred is the promoter of the 35S transcript of the CaMV cauliflower mosaic virus (Franck et al. (1980) Cell 21: 285-294; Odell et al. (1985) Nature 313: 810-812; Shewmaker et al. (1985) Virology 140 : 281-288; Gardner et al. (1986) Plant Mol Biol 6: 221-228) or the 19S CaMV promoter (US 5,352,605; WO 84/02913; Benfey et al. (1989) EMBO J 8: 2195-2202) ,

Another suitable constitutive promoter is the pds promoter (Pecker et al. (1992) Proc. NatI. Acad. Be USA 89: 4962-4966) or the "Rubisco small subunit (SSU)" promoter (US 4,962,028), the LeguminB Promoter (GenBank Acc. No. X03677), the promoter of nopaline synthase from agrobaeterium, the TR double promoter, the OCS (oetopin synthase) promoter from agrobaeterium, the ubiquitin promoter (Holtorf S et al. (1995) Plant Mol Biol 29: 637-649), the Ubiquitin 1 promoter (Christensen et al. (1992) Plant Mol Biol 18: 675-689; Bruce et al. (1989) Proc NatI Acad Sei USA 86: 9692-9696), the Smas Promoter, the cinnamyl alcohol dehydrogenase promoter (US 5,683,439), the promoters of the vacuolar ATPase units or the promoter of a proline-rich protein from wheat (WO 91/13991), the Pnit promoter (Y07648.L, Hillebrand et al. ( 1998), Plant. Mol. Biol. 36, 89-99, Hillebrand et al. (1996), Gene, 170, 197-200, the ferredoxin NADPH oxidoreductase promoter (database entry AB011474, Positions 70127 to 69493), the TPT promoter (WO 03006660), the "super promoter" (US patent 5955646), the 34S promoter (US patent 6051753) and further promoters of genes whose constitutive expression in plants is known to the person skilled in the art is.

The expression cassettes can also contain a chemically inducible promoter (review article: Gatz et al. (1997) Annu Rev Plant Physiol Plant Mol Biol 48: 89-108), through which the expression of the β-cyclase gene in the plant at a specific point in time can be controlled. Such promoters, such as the PRP1 promoter (Ward et al. (1993) Plant Mol Biol 22: 361-366), a salicylic acid-inducible promoter (WO 95/19443), a benzenesulfonamide-inducible promoter (EP 0388 186) by tetracycline-inducible promoter (Gatz et al. (1992) Plant J 2: 397-404), an abscisic acid-inducible promoter (EP 0335528) or a promoter inducible by ethanol or cyclohexanone (WO 93/21334) can also be used.

Also preferred are promoters that are induced by biotic or abiotic stress, such as the pathogen-inducible promoter of the PRP1 gene (Ward et al. (1993) Plant Mol Biol 22: 361-366), the heat-inducible hsp70 or hsp80 promoter from tomato (US 5,187,267), the cold-inducible alpha-amylase promoter from the potato (WO 96/12814), the light-inducible PPDK promoter or the wound-induced pinII promoter (EP375091).

Pathogen-inducible promoters include those of genes induced by pathogen attack such as genes from PR proteins, SAR proteins, β-1, 3-glucanase, chitinase etc. (e.g. Redolfi et al. (1983) Neth J Plant Pathol 89: 245-254; Uknes, et al. (1992) The Plant Cell 4: 645-656; Van Loon (1985) Plant Mol Viral 4: 111-116; Marineau et al. (1987) Plant Mol Biol 9: 335-342; Matton et al. (1987) Molecular Plant-Microbe Interactions 2: 325-342; Somssich et al. (1986) Proc NatI Acad Sei USA 83: 2427-2430; Somssich et al. (1988) Mol Gen Genetics 2: 93-98; Chen et al. (1996) Plant J 10: 955-966; Zhang and Sing (1994) Proc NatI Acad Sei USA 91: 2507-2511; Warner, et al. (1993) Plant J 3: 191-201; Siebertz et al. (1989) Plant Cell 1: 961-968 (1989).

Also included are wound-inducible promoters such as that of the pinll gene (Ryan (1990) Ann Rev Phytopath 28: 425-449; Duan et al. (1996) Nat Biotech 14: 494-498), the wunl and wun2 gene (US 5,428,148), the winl and win2 genes (Stanford et al. (1989) Mol Gen Genet 215: 200-208), the systemin (McGurl et al. (1992) Science 225: 1570-1573), the WIP1 gene (Rohmeier et al. (1993) Plant Mol Biol 22: 783-792; Ekelkamp et al. (1993) FEBS Letters 323: 73-76), the MPI gene (Corderok et al. (1994) The Plant J 6 ( 2): 141-150) and the like.

Other suitable promoters are, for example, fruit ripening-specific

Promoters, such as the fruit-ripening-specific promoter from tomato (WO 94/21794, EP 409625). Development-dependent promoters partly include the tissue-specific promoters, since the formation of individual tissues is naturally development-dependent.

Furthermore, promoters are particularly preferred which ensure expression in tissues or plant tissues in which, for example, the biosynthesis of β-X-carotinoids or its precursors takes place. For example, promoters with specificities for the anthers, ovaries, petals, sepals, flowers, leaves, stems and roots and combinations thereof are preferred. Tuber-, storage root- or root-specific promoters are, for example, the patatin class I promoter (B33) or the potato cathepsin D inhibitor promoter.

Flower-specific promoters are, for example, the phytoene synthase promoter (WO 92/16635), the promoter of the P-rr gene (WO 98/22593), the EPSPS promoter (M37029), the DFR-A promoter (X79723), the B gene Promoter (WO 0008920) and the CHRC promoter (WO 98/24300; Vishnevetsky et al. (1996) Plant J. 10, 1111-1118), the promoter P76 and P84 (DE patent application 10247599.7) and the promoters of the Arabidopsis gene Loci At5g33370 (as a result of M1 promoter), At5g22430 (as a result of M2 promoter) and At1g26630 (as a result of M3 promoter).

Further promoters suitable for expression in plants are described in Rogers et al. (1987) Methods in Enzymol 153: 253-277; SchardI et al. (1987) Gene 61: 1-11 and Berger et al. (1989) Proc NatI Acad Sei USA 86: 8402-8406).

All promoters described in the present application enable the expression of the β-cyclase in plant tissues containing photosynthetically inactive plastids, such as, for example, flower, fruit or tuber.

Preferred promoters are promoters which are specific for plant tissue containing photosynthetically inactive plastids.

As mentioned above, depending on the plant used, constitutive, flower-specific and in particular petal-specific, fruit-specific and tuber-specific promoters are particularly preferred in the process according to the invention.

The present invention therefore relates in particular to a nucleic acid construct containing functionally linked a flower-specific or in particular a petal-specific promoter and a nucleic acid encoding a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

The present invention therefore relates in particular to a nucleic acid construct containing functionally linked a fruit-specific promoter and a nucleic acid encoding a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or one of this sequence by substitution, insertion or deletion of amino acid-derived sequence that has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2, with the proviso that the natural promoter of the β-cyclase is excluded.

The present invention therefore relates in particular to a nucleic acid construct containing functionally linked a tuber-specific promoter and a nucleic acid encoding a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2, with the proviso that the natural promoter of the β-cyclase is excluded.

The present invention therefore relates in particular to a nucleic acid construct containing functionally linked a constitutive promoter and a nucleic acid encoding a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO.2, with the proviso that the natural promoter of the β-cyclase is excluded.

An expression cassette is preferably produced by fusing a suitable promoter with a nucleic acid described above encoding a β-cyclase and preferably a nucleic acid inserted between the promoter and nucleic acid sequence, which codes for a plastid-specific transit peptide, and a polyadenylation signal according to common recombination and cloning techniques, such as these for example in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in T.J. Silhavy, M.L Berman and L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).

The preferably inserted nucleic acids encoding a plastid transit peptide ensure localization in plastids and in particular in chromoplasts.

Expression cassettes, the nucleic acid sequence of which codes for a β-cyclase fusion protein, can also be used, part of the fusion protein being a transit peptide which controls the translocation of the polypeptide. Preferred transit peptides are preferred for the chromoplasts, which after translocation of the ß-Cyclase in the chromoplasts from the ß-cyclase part are cleaved enzymatically.

Particularly preferred is the transit peptide derived from the Nicotiana tabacum Transketolase plastid or another transit peptide (e.g. the Rubisco small subunit transit peptide (rbcS) or the ferredoxin NADP oxidoreductase as well as the isopentenyl pyrophosphate isomerase-2) or its functional equivalent.

Nucleic acid sequences of three cassettes of the plastid transit peptide of plastid transketolase from tobacco in three reading frames are particularly preferred as Kpnl / BamHI fragments with an ATG codon in the Ncol interface:

pTP09

KpnLGGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTC GTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CAC I I I I I CCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGC-, GATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGG- GATCC_BamHI

PTP10

KpnLGGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTC GTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CACTTTTTCCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGC- GATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGCTG- GATCC_BamHI

pTP11

KpnLGGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTC GTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CAC IIIII CCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGC- GATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGG- GATCC_BamHI Further examples of a plastid transit peptide are the transit peptide of the plastid isopentenyl pyrophosphate isomerase-2 (IPP-2) from Arabisopsis thaliana and the transit peptide of the small subunit of ribulose bisphosphate carboxylase (rbcS) from pea (Guerineau, F, Woolston, S, Brook L, Mullineaux, P (1988) An expression cassette for targeting foreign proteins into the chloroplasts. Nucl. Acids Res. 16: 11380).

The nucleic acids according to the invention can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural nucleic acid constituents, and can consist of different heterologous gene segments from different organisms.

As described above, preference is given to synthetic nucleotide sequences with codons which are preferred by plants. These plant-preferred codons can be determined from the highest protein frequency codons expressed in most interesting plant species.

When preparing an expression cassette, various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame. To connect the DNA fragments to one another, adapters or linkers can be attached to the fragments.

The promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction sites for the insertion of this sequence. As a rule, the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. In general, the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges. The promoter can be native or homologous as well as foreign or heterologous to the host plant. The expression cassette preferably contains, in the 5'-3 'transcription direction, the promoter, a coding nucleic acid sequence or a nucleic acid construct and a region for the transcriptional termination. Different termination areas are interchangeable.

Examples of a terminator are the 35S terminator (Guerineau et al. (1988) Nucl Acids Res. 16: 11380), the nos terminator (Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM. Nopaline synthase: transcript mapping and DNA sequence. J Mol Appl Genet. 1982; 1 (6): 561-73) or the ocs terminator (Gielen, J, de Beuekeleer, M, Seurinck, J, Debroek, H, de Greve, H, Lemmers, M van Montagu M, Schell, J (1984) The complete sequence of the TL-DNA of the Agrobaeterium tumefaciens plasmid pTiAchδ. EMBO J. 3: 835-846).

Manipulations which provide suitable restriction sites or which remove superfluous DNA or restriction sites can also be used. Where insertions, deletions or substitutions such as Transitions and transversions can be used in wϊro mutagenesis, "primer repair", restriction or ligation.

With suitable manipulations, e.g. Restriction, "chewing-back" or filling of overhangs for "bluntends", complementary ends of the fragments can be made available for the ligation.

Preferred polyadenylation signals are vegetable polyadenylation signals, preferably those which essentially comprise T-DNA polyadenylation signals

Agrobaeterium tumefaciens, in particular gene 3 of T-DNA (oetopin synthase) of the Ti plasmid pTiACHδ (Gielen et al., EMBO J. 3 (1984), 835 ff) or functional equivalents.

The transfer of foreign genes into the genome of a plant is called transformation.

Methods known per se for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation can be used for this purpose.

Suitable methods for the transformation of plants are the protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene gun - the so-called particle bombardment method, the electroporation, the incubation of dry embryos in DNA-containing solution, the microinjection and the Agrobaeterium-mediated gene transfer described above. The methods mentioned are described, for example, in B. Jenes et al., Technologies for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, published by S.D. Kung and R. Wu, Academic Press (1993), 128-143 and in Potrykus, Annu. Rev. Plant Physiol. Plant Molee. Biol. 42 (1991), 205-225).

The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobaeterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711) or particularly preferably pSUN2, pSUN3, pSUN4 or pSUN5 (WO 02/00900).

Agrobacteria transformed with an expression plasmid can be used in a known manner to transform plants, e.g. by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

For the preferred production of genetically modified plants, hereinafter also referred to as transgenic plants, the fused expression cassette, which expresses a β-cyclase, is cloned into a vector, for example pBin19 or in particular pSUN5, which is suitable for being transformed into Agrobaeterium tumefaciens with a Agrobacteria transformed in this way can then be used in a known manner for transforming plants, in particular crop plants, for example by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

The transformation of plants by agrobacteria is known, among other things, from F.F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S.D. Kung and R. Wu, Academic Press, 1993, pp. 15-38. In a known manner, transgenic plants can be regenerated from the transformed cells of the wounded leaves or leaf pieces, which plants contain a gene encoding a β-cyclase coding for the expression of a nucleic acid for the expression of a nucleic acid.

To transform a host plant with a nucleic acid coding for a β-cyclase, an expression cassette is inserted as an insert into a recombinant vector whose vector DNA contains additional functional regulation signals, for example sequences for replication or integration. Suitable vectors are inter alia in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, pp. 71-119 (1993).

Using the recombination and cloning techniques cited above, the expression cassettes can be cloned into suitable vectors that allow their proliferation, for example in E. coli. Suitable cloning vectors include pJIT117 (Guerineau et al. (1988) Nucl. Acids Res. 16: 11380), pBR332, pUC series, M13mp series and pACYCI 84. Binary vectors which are particularly suitable are those found both in E. coli and in can replicate in agrobacteria. The invention further relates to the genetically modified plants, the genetic modification increasing the activity of a β-cyclase in plant tissues containing photosynthetically inactive plastids compared to the wild type and the increased β-cyclase activity being caused by a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

The β-cyclase activity is preferably increased by increasing the gene expression of a nucleic acid coding for a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 compared to the wild type. ;

The gene expression is preferably increased by introducing into the plant nucleic acids which encode β-cyclases containing the amino acid sequence SEQ. ID. NO.2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

Genetically modified plants are preferred which contain at least one nucleic acid encoding a β-cyclase and containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO.2 included, with the proviso that tomato is excluded.

Further particularly preferred, genetically modified plants, as mentioned above, additionally have an increased hydroxase activity compared to the wild type. Further preferred embodiments are described above in the method according to the invention.

Further particularly preferred, genetically modified plants, as mentioned above, additionally have a reduced activity compared to the wild type, at least one of the activities selected from the group ε-cyclase activity and endogenous ß-hydroxylase activity. Further preferred embodiments are described above in the method according to the invention. The plant tissues containing photosynthetically inactive plastids are preferably selected from the group consisting of flower, fruit and tuber.

In a preferred embodiment, the genetically modified plants which, compared to the wild type, have an increased β-cyclase activity in flowers are selected from the families Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Brassiceae, Cucurbitacee, Primulaceae , Caryophyllaceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Liliaceae, Amaryllidaceae, Poaceae, Orchidaceae or Maivaceae, Maivaceae.

Plants selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus, Bignonia, Calendula, Calendula officinalis, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum are particularly preferred Citrus, Crepis, Croeus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracle Hisbiscus, Heliopsis, Hyperi- cum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Labumum, Lathyrus, Leontodon, ülium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcis- sus, Oenothera, Osmanthus, Petunia Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Solanum tuberosum, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ulex, Viola or Zinnia.

In a further preferred embodiment, the genetically modified plants which, compared to the wild type, have an increased β-cyclase activity in fruits are selected from the plant genera Actinophloeus, Aglaeonema, pineapple, Arbutus, Archontophoenix, Area, Aronia, Asparagus, Avocado, Attalea, Berberis, Bixia, Brachychilum, Bryonia, Caliptocalix, Capsicum, Carica, Celastrus, Citrullus, Citrus, Convallaria, Cotoneaster, Crataegus, Cucumis, Cucurbita, Cuscuta, Cycas, Cyphomandra, Dioscorea, Diospyrus, Dura, Elauraonymus, Elaeagnusroxy Pea, Ficus, Fortunella, Fragaria, Gardinia, Gonocaryum, Gossypium, Guava, Guilielma, Hibiscus, Hippophaea, Iris, Kiwi, Lathyrus, Lonicera, Luffa, Lycium, Lycopersicum, Maize, Malpighia, Mangifera, Mormodica, Murraya, Musa Orange, Palisota, Pandanus, Passiflora, Persea, Physalis, Prunus, Ptychandra, Punica, Pyracantha, Pyrus, Ribes, Rosa, Rubus, Sabal, Sambucus, Seaforita, Shepherdia, Solanum, Sorbus, Synaspad ix, Tabernae, Tamus, Taxus, Trichosanthes, Triphasia, Vaccinium, Vibumum, Vignia, Vitis or Zucchini are used. In a further preferred embodiment, the genetically modified plants which have an increased β-cyclase activity in tubers compared to the wild type are Solanum tuberosum.

Particularly preferred plants have a higher proportion of α-Ca as a wild type in the total carotenoid content in plant tissues containing photosynthetically inactive plastids _. rotinoids as ß-carotenoids.

Genetically modified plants of the genus Tagetes containing at least one nucleic acid encoding a β-cyclase containing the amino acid sequence SEQ are particularly preferred. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

Particularly preferred plant tissues containing photosynthetically inactive plastids are the tuber of Solanum tuberosum, the seed fruits of Zea maize, the flower of Tagetes erecta and the flower of Calendula officinalis.

The genetically modified plants, their propagation material, and their plant cells and tissue. or parts, in particular their petals, bulbs or fruits, are a further subject of the present invention.

As described above, the genetically modified plants can be used to produce β-carotenoids, in particular β-carotene and zeaxanthin.

Genetically modified plants according to the invention with increased β-carotenoid content that can be consumed by humans and animals can also be used, for example, directly or after processing known per se as food or feed or as feed and food supplements. Furthermore, the genetically modified plants can be used for the production of β-carotenoid-containing extracts of the plants and / or for the production of feed and food supplements.

Extracts containing zeaxanthin can be used to pigment animal products, especially those of the Galiformes family. The pigmentation takes place by oral administration of the extracts containing zeaxanthin, which were processed according to the respective animal and prepared for oral administration. Animal products are understood in particular as skin, rich, feather and egg yolk

The genetically modified plants can also be used as ornamental plants in the horticulture area.

The genetically modified plants have an increased content of β-carotenoids in plant tissues, containing photosynthetically inactive plastids, compared to the wild type.

An increased content of β-carotenoids is generally understood to mean an increased content of total β-carotenoids.

An increased content of β-carotenoids is also understood to mean, in particular, an altered content of the preferred β-carotenoids, without the total carotenoid content necessarily having to be increased.

In a particularly preferred embodiment, the genetically modified plants according to the invention have an increased content of β-carotene or zeaxanthin, in particular zeaxanthin, in comparison to the wild type in plant tissues containing photosynthetically inactive plastids.

In this case, an increased content is also understood to mean a caused content of β-carotenoids, or β-carotene or zeaxanthin.

The invention is illustrated by the following examples, but is not limited to these:

General experimental conditions: Sequence analysis of recombinant DNA

The sequencing of recombinant DNA molecules was carried out with a laser fluorescence

Licor DNA sequencer (distributed by MWG Biotech, Ebersbach) according to the Sanger method (Sanger et al., Proc. NatI. Acad. Sci. USA 74 (1977), 5463-5467). Example 1: Production of expression vectors for the flower-specific expression of the chromoplast-specific lycopene β cyclase from Lycopersicon esculentum under the control of the promoter P76

a) Isolation of promoter P76 by means of PCR using genomic DNA from Arabidopsis thallana as a template.

For this, the oligonucleotide primers SEQ. ID. No. 20 (P76for) and SEQ. ID. NO. 21 (P76rev) used. The oligonucleotides were provided with a 5 'phosphate residue during the synthesis. The genomic DNA was isolated from Arabidopsis thallana as described (Galbiati M et al. Funct. Integr. Genomics 2000, 20 1: 25-34).

The PCR amplification was carried out as follows:

80ng genomic DNA

Ix Expand Long Template PCR buffer

2.5 mM MgCI2 each 350 μM dATP, dCTP, dGTP, dTTp each 300 nM each primer 2.5 units Expand Long Template Polymerase in a final volume of 25 μl

The following temperature program is used:

1 cycle with 120 sec at 94 ° C

35 cycles at 94 ° C for 10 sec, 48 ° C for 30 sec and 68 ° C for 3 min 1 cycle at 68 ° C for 10 min

The PCR product (SEQ. ID. NO. 22) is purified by agarose gel electrophoresis and the 1032 bp fragment is isolated by gel elution.

The vector pSun5 is digested with the restriction endonuclease EcoRV and also purified by agarose gel electrophoresis and obtained by gel elution.

The purified PCR product is cloned into the vector treated in this way.

In order to check the orientation of the promoter in the vector, BamHI is digested with the restriction endonuclease. If this results in a 628 bp fragment, the orientation is as shown in Fig. 2. This construct is called p76.

b) Isolation of the nucleic acid encoding a β-cyclase (Bgene) by means of PCR with genomic DNA from Lycopersicon esculentum as a template.

For this, the oligonucleotide primers SEQ. ID. NO. 23 (BgeneFor) and SEQ. ID. NO. 24 (BgeneRev) used. The oligonucleotides were provided with a 5 'phosphate residue during the synthesis. The genomic DNA was isolated from Lycopersicon esculentum as described (Galbiati M et al. Funct. Integr. Genomics 2000, 20 1: 25-34).

The PCR amplification was carried out as follows:

80ng genomic DNA 1 x. Expand long template PCR buffer

2.5 mM MgCl2 each 350 μM dATP, dCTP, dGTP, dTTp each 300 nM of each primer

2.5 units of expand long template polymerase in a final volume of 25 μl

The following temperature program was used:

1 cycle with 120 sec at 94 ° C 35 cycles with 94 ° C for 10 sec, 48 ° C for 30 sec and 68 ° C for 3 min 1 cycle with 68 ° C for 10 min

The PCR product was purified by agarose gel electrophoresis and the 1486 bp fragment isolated by gel elution.

The vector p76 is digested with the restriction endonuclease Smal and also purified by agarose gel electrophoresis and obtained by gel elution.

The purified PCR product is cloned into the vector treated in this way. In order to check the orientation of Bgene in the VeMor, the restriction endonuclease EcoRI is digested. If this results in a 445 bp fragment, the orientation is as shown in Fig. 2.

This construct is called p76Bgene. Example 2: Production of a cloning vector for the production of double-stranded ε-cyclase-ribonucleic acid sequence expression cassettes for the flower-specific expression of epsilon-cyclase dsRNAs in Tagetes erecta

The expression of inverted repeat transcripts consisting of fragments of the epsilon cyclase in Tagetes erecta was carried out under the control of a modified version AP3P of the flower-specific promoter AP3 from Arabidopsis thaliana (AL132971: nucleotide region 9298-10200; Hill et al. (1998) Development 125: 1711 -1721)

The inverted-repeat transcript contains a fragment in the correct orientation (sense fragment) and a sequence-identical fragment in the opposite orientation (antisense fragment), which is generated by a functional intron, the PIV2 intron of the ST-LH1 gene from potato (Vancanneyt G. et al. (1990) Mol Gen Genet 220: 245-50).

The cDNA coding for the AP3 promoter (-902 to +15) from Arabidopsis thaliana was PCR-analyzed using genomic DNA (isolated from Arabidopsis thaliana according to the standard method) and the primers PR7 (SEQ ID No. 25) and PR10 (SEQ ID No. 28).

The PCR conditions were as follows:

The PCR for the amplification of the DNA encoding the AP3 promoter fragment (-902 to +15) was carried out in a 50 μl reaction mixture which contained:

- 1 ml AΛhaliana genomic DNA (1: 100 dil prepared as described above)

- 0.25 mM dNTPs - 0.2 mM PR7 (SEQ ID No. 25)

- 0.2 mM PR10 (SEQ ID No. 28) - 5 mHOX PCR buffer (Stratagene)

- 0.25 ml Pfu polymerase (Stratagene)

- 28.8 miAq. Least.

The PCR was carried out under the following cycle conditions:

1X 94 ° C 2 minutes 35X 94 ° C 1 minute 50 ° C 1 minute 72 ° C 1 minute 1X 72 ° C 10 minutes

The 922 bp amplificate was cloned into the PCR cloning VeMor pCR 2.1 (Invitrogen) using standard methods and the plasmid pTAP3 was obtained. Sequencing of the clone pTAP3 confirmed a sequence which is only in the insert (an G in position 9765 of the sequence AL132971) and a base exchange (a G instead of an A in position 9726 of the sequence AL132971) of the published AP3 sequence (AL132971 , Nucleotide region 9298-10200) (position 33: T instead of G, position 55: T instead of G). These nucleotide differences were reproduced in an independent amplification experiment and thus represent the nucleotide sequence in the Arabidopsis thaliana plant used.

The modified version AP3P was produced by recombinant PCR using the plasmid pTAP3. The region 10200-9771 was amplified with the primers PR7 (SEQ ID No. 25) and primers PR9 (SEQ ID No.27) (amplificate A7 / 9), the region 9526-9285 with the PR8 (SEQ ID No. 26 ) and PR10 (SEQ ID No. 28) amplified (amplificate A8 / 10).

The PCR conditions were as follows:

The PCR reactions for the amplification of the DNA fragments, which code for the regions region 10200-9771 and 9526-9285 of the AP3 promoter, were carried out in 50 μl reaction batches, which contained:

- 100 ng AP3 amplificate (described above)

- 0.25 mM dNTPs

- 0.2 mM PR7 (SEQ ID No. 15) or PR8. (SEQ ID No. 26)

- 0.2 mM PR9 (SEQ ID No. 17) or PR10 (SEQ ID No. 28) - 5 ml 10 X PCR buffer (Stratagene)

- 0.25 ml Pfu Taq polymerase (Stratagene)

- 28.8 ml Aq. Least.

The PCR was carried out under the following cycle conditions:

1 X 94 ° C 2 minutes 35 X 94 ° C 1 minute

50 ° C for 2 minutes

72 ° C for 3 minutes 1 X 72 ° C 10 minutes

The recombinant PCR includes annealing of the amplificates A7 / 9 and A8 / 10, which overlap over a sequence of 25 nucleotides, completion into a double strand and subsequent amplification. This creates a modified version of the AP3 promoter, AP3P, in which positions 9670-9526 are deleted. The denaturation (5 min at 95 ° C) and annealing (slow cooling at room temperature to 40 ^Q C) of the two amplicons A7 / A8 and 9/10 was performed in a 17.6 ml of reaction mixture containing:

- 0.5 mg A7 / 9 - 0.25 mg A8 / 10

The 3 'ends were filled in (30 min at 30 ° C.) in a 20 μl reaction mixture, which contained:

- 17.6 ml A7 / 9 and A8 / 10 annealing reaction (prepared as described above) - 50 M dNTPs - 2 ml 1 X Klenow buffer

- 2 U Klenow enzyme

The nucleic acid coding for the modified promoter version AP3P was amplified by means of PCR using a sense-specific primer (PR7 SEQ ID No. 25) and an antisense-specific primer (PR10 SEQ ID No. 28).

The PCR conditions were as follows:

The PCR for the amplification of the AP3P fragment was carried out in a 50 ml reaction mixture, which contained:

- 1 ml annealing reaction (prepared as described above)

- 0.25 mM dNTPs - 0.2 mM PR7 (SEQ ID No. 25)

- 0.2 mM PR10 (SEQ ID No. 28)

- 5 ml 10 X PCR buffer (Stratagene)

- 0.25 ml Pfu Taq polymerase (Stratagene)

- 28.8 ml Aq. Least. The PCR was carried out under the following cycle conditions:

1 X 94 ° C 2 minutes 35 X 94 ° C 1 minute

50 ° C for 1 minute

72 ° C 1 minutes 1 X 72 ° C 10 minutes

PCR amplification with PR7, SEQ ID No. 25 and PR10 SEQ ID No. 28 resulted in a 778 bp fragment which codes for the modified promoter version AP3P. The amplificate was cloned in the cloning membrane Mor pGR2.1 (Invitrogen). Sequencing with the primers T7 and M13 confirmed a sequence identical to the sequence AL132971, region 10200-9298, the internal region 9285-9526 being deleted. This clone was therefore used for the cloning in the expression vMor pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380).

The cloning was carried out by isolating the 771 bp SacI-HindIII fragment from pTAP3P and ligation in the SacI-HindIII cut VeMor pJIT117. The clone that contains the AP3P promoter instead of the original d35S promoter is called pJAP3P.

A DNA fragment containing the PIV2 intron of the ST-LS1 gene was PCR-analyzed using plasmid DNA p35SGUS INT (Vancanneyt G. et al. (1990) Mol Gen Genet 220: 245-50) and the primer PR40 ( Seq ID No. 30) and Primer PR41 (Seq ID No. 31).

The PCR conditions were as follows:

The PCR for the amplification of the sequence of the intron PIV2 of the ST-LS1 gene was carried out in a 50 ° = 1 reaction mixture which contained:

- 1 ml p35SGUS INT

- 0.25 mM dNTPs - 0.2 mMPR40 (SEQ ID No. 30)

- 0.2 mM PR41 (SEQ ID No. 31)

- 5 mMOX PCR buffer (TAKARA)

- 0.25 ml R Taq polymerase (TAKARA)

1X 94 ° C 2 minutes 35X 94 ° C 1 minute

53 ° C for 1 minute

72 ° C 1 minute 1X 72 ° C 10 minutes

PCR amplification with PR40 and PR41 resulted in a 206 bp fragment. Using standard methods, the amplificate was cloned in the PCR cloning method Mor pBluntll (Invitrogen) and the clone pBluntll-40-41 was obtained. Sequencing of this clone with the primer SP6 confirmed a sequence which is identical to the corresponding sequence from the vector p35SGUS INT.

This clone was therefore used for cloning in the VeMor pJAP3P (described above).

The cloning was carried out by isolating the 206 bp Sall-BamHI fragment from pBluntl 1-40-41 and ligation with the Sall-BamHI cut VeMor pJAP3P. The clone which contains the intron PIV2 of the ST-LS1 gene in the correct orientation after the 3 'end of the rbcs transit peptide is called pJAH and is suitable for producing expression cassettes for the flower-specific expression of inverted repeat transcripts.

In Figure 3, fragment AP3P contains the modified AP3P promoter (771 bp), fragment rbcs the rbcS transit peptide from pea (204 bp), fragment intron the intron PIV2 of the potato gene ST-LS1, and fragment term (761 bp) the polyadenylation signal by CaMV.

Example 3: Production of inverted repeat expression cassettes for the flower-specific expression of epsilon cyclase dsRNAs in Tagetes erecta (directed against the 5 ′ region of the epsilon cyclase cDNA)

The nucleic acid, which contains the 5'-terminal 435bp region of the epsilon cyclase cDNA (Genbank accession no. AF251016), was extracted from Tagetes erecta cDNA using a polymerase chain reaction (PCR) using a sense-specific primer (PR42 SEQ ID NO. 32) and an antisense specific primer (PR43 SEQ ID NO. 33). The 5'-terminal 435 bp region of the Epsilon cyclase cDNA from Tagetes erecta is composed of 138 bp 5'-untranslated sequence (5'UTR) and 297 bp of the coding region corresponding to the N-terminus. For the preparation of total RNA from Tagetes flowers, 100 mg of the frozen, powdered flowers were transferred to a reaction vessel and taken up in 0.8 ml of Trizol buffer (LifeTechnologies). The suspension was extracted with 0.2 ml of chloroform. After centrifugation at 12,000 g for 15 minutes, the aqueous supernatant was removed and transferred to a new reaction vessel and extracted with a volume of ethanol. The RNA was precipitated with a volume of isopropanol, washed with 75% ethanol and the pellet dissolved in DEPC water (overnight incubation of water with 1/1000 volume of diethyl pyrocarbonate at room temperature, then autoclaved). The RNA concentration was determined photometrically. For the cDNA synthesis, 2.5 μg of total RNA were denatured for 10 min at 60 ° C., cooled on ice for 2 min and using a cDNA kit (ready-to-go-you-prime-beads, Pharmacia Biotech) according to the manufacturer's instructions using an antisense-specific primer (PR17 SEQ ID NO. 29) transcribed into cDNA.

The conditions of the subsequent PCR reactions were as follows:

The PCR for the amplification of the PR42-PR43 DNA fragment, which contains the 5'-terminal 435bp region of the epsilon cyclase, was carried out in a 50 ml reaction mixture which contained:

- 1 ml cDNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 M PR42 (SEQ ID No. 32) - 0.2 mM PR43 (SEQ ID No. 33)

- 5 ml 10X PCR buffer (TAKARA)

- 0.25 ml R Taq polymerase (TAKARA)

- 28.8 ml Aq. Least.

The PCR for the amplification of the PR44-PR45 DNA fragment, which contains the 5'-terminal 435 bp region of the epsilon cyclase, was carried out in a 50 ml reaction mixture which contained:

- 1 ml cDNA (prepared as described above) - 0.25 mM dNTPs

- 0.2 mM PR44 (SEQ ID No. 34)

- 0.2 mM PR45 (SEQ ID No. 35)

- 5 ml 10X PCR buffer (TAKARA)

- 0.25 ml R Taq polymerase (TAKARA) 1X 94 ° C 2 minutes 35X 94 ° C 1 minute 58 ° C 1 minute 72 ° C 1 minute 1X 72 ° C 10 minutes

The PCR amplification with primers PR42 and PR43 resulted in a 443 bp fragment, the PCR amplification with primers PR44 and PR45 resulted in a 444 bp fragment.

The two amplicons, the PR42-PR43 (Hindi II-Sall sense) fragment and the PR44r PR45 (EcoRI-BamHI antisense) fragment, were cloned into the PCR cloning vector pCR-BluntII (Invitrogen) using standard methods. Sequencing with the primer SP6 confirmed one each. published sequence AF251016 (SEQ ID No. 7) identical sequence apart from the restriction sites introduced. These clones were therefore used for the production of an inverted repeat construct in the cloning cell pJAH (see Example 2).

The first cloning step was carried out by isolating the 444 bp PR44-PR45 BamHI-EcoRI fragment from the cloning VeMor pCR-BluntII (Invitrogen) and ligation with the BamHI-EcoRI cut vector pJAH. The clone that contains the 5'-terminal region of the epsilon cyclase in the antisense orientation is called pJAI2. The ligation creates a transcriptional fusion between the antisense fragment of the 5'terminal region of the epsilon cyclase and the polyadenylation signal from CaMV.

The second cloning step was carried out by isolating the 443 bp PR42-PR43 HindIII-SalI fragment from the cloning VeMor pCR-BluntII (Invitrogen) and ligation with the HindII-SalI cut VeMor pJAI2. The clone which contains the 435 bp 5'-terminal region of the epsilon cyclase cDNA in the sense orientation is called pJAI3. The ligation creates a transcriptional fusion between the AP3P and the sense fragment of the 5'-terminal region of the epsilon cyclase.

For the production of an inverted repeat expression cassette under the control of the CHRC promoter, a CHRC promoter fragment using genomic DNA from petunia (produced according to standard methods) and the primers PRCHRC5 (SEQ ID No. 50) and PRCHRC3 (SEQ ID No. 51) amplified. The amplificate was cloned in the cloning cell pCR2.1 (Invitrogen). Sequencing of the resulting clone pCR2.1-CHRC with the primers M13 and T7 confirmed a sequence identical to the sequence AF099501. This clone was therefore used for the cloning in the expression cell pJAI3. Cloned in the cloning vector pCR2.1 (Invitrogen). Sequencing of the resulting clone pCR2.1-CHRC with the primers M13 and T7 confirmed a sequence identical to the sequence AF099501. This clone was therefore used for the cloning into the expression vector pJAI3.

The cloning was carried out by isolating the 1537 bp SacI-HindIII fragment from pCR2.1-CHRC and ligating into the SacI-HindIII cut vector pJAI3. The clone that contains the CHRC promoter instead of the original AP3P promoter is called pJCI3.

The expression vectors for the Agrobacterium -mediated transformation of the AP3P or CHRC-controlled inverted repeat transcripts in Tagetes erecta were produced using the binary VeMor pSUN5 (WO02 / 00900).

To produce the expression vector pS5AI3, the 2622 bp Sacl-Xhol fragment from pJAI3 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 4, KonstruMkarte).

In Figure 4, fragment AP3P contains the modified AP3P promoter (771 bp), fragment δsense the 5 'region of the epsilon cyclase from Tagetes erecta (435 bp) in sense orientation, fragment intron the intron PIV2 of the potato gene ST-LS1 , Fragment 5anti the 5 'region of the epsilon cyclase from Tagetes erecta (435 bp) in antisense orientation, and fragment term (761 bp) the polyadenylation signal of CaMV.

To produce the expression vector pS5CI3, the 3394 bp Sacl-Xhol fragment from pJCI3 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 5, KonstruMkarte).

In Figure 5, fragment CHRC contains the promoter (1537 bp), fragment 5sense the 5 'region of the Epsilon cyclase from Tagetes erecta (435 bp) in sense orientation, fragment intron the intron PIV2 of the potato gene ST-LS1, fragment 5anti the 5 'region of the Epsilon cyclase from Tagetes erecta (435 bp) in the antisense orientation, and fragment term (761 bp) the polyadenylation signal of CaMV. Example 4: Production of an inverted repeat expression cassette for the flower-specific expression of epsilon cyclase dsRNAs in Tagetes erecta (directed against the 3 ′ region of the epsilon cyclase cDNA)

The nucleic acid that contains the 3'terminaie region (384 bp) of the epsilon cyclase cDNA (Genbank accession no. AF251016) was obtained by means of polymerase chain reaction (PCR) from Tagetes erecta cDNA using a sense-specific primer (PR46 SEQ ID NO. 36) and an antisense-specific primer (PR47 SEQ ID NO. 37). The 3 'terminal region (384 bp) of the epsilon cyclase cDNA from Tagetes erecta is composed of 140 bp 3' untranslated sequence (3'UTR ) and 244 bp of the coding region corresponding to the C-terminus.

Total RNA was prepared from Tagetes flowers as described in Example 3.

The cDNA synthesis was carried out as described in Example 2 using the antisense-specific primer PR17 (SEQ ID No. 19).

The conditions of the subsequent PCR reactions were as follows:

The PCR for the amplification of the PR46-PR457 DNA fragment, which contains the 3'-terminal 384 bp region of the epsilon cyclase, was carried out in a 50 ml reaction mixture which contained:

- 1 ml cDNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 mM PR46 (SEQ ID No. 36)

- 0.2 mM PR47 (SEQ ID No. 37)

- 5 ml 10X PCR buffer (TAKARA) - 025 ml R Taq polymerase (TAKARA)

- 28.8 ml Aq. Least.

The PCR for the amplification of the PR48-PR49 DNA fragment, which contains the 3'-terminal 384 bp region of the epsilon cyclase, was carried out in a 50 μl reaction mixture which contained:

- 1 ml cDNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 M PR48 (SEQ ID No. 38) - 0.2 mM PR49 (SEQ ID No. 39)

- 5 ml 10 X PCR buffer (TAKARA)

- 0.25 ml R Taq polymerase (TAKARA)

- 28.8 ml Aq. Least.

The PCR reactions were carried out under the following cycle conditions:

1X 94 ° C 2 minutes 35X 94 ° C 1 minute 58 ° C 1 minute

72 ° C 1 minute 1X 72 ° C 10 minutes

The PCR amplification with SEQ ID NO.36 and SEQ ID NO.37 resulted in a 392 bp fragment, the PCR amplification with SEQ ID NO.38 and SEQ ID NO. 39 resulted in a 396 bp fragment.

The two amplicons, the PR46-PR47 fragment and the PR48-PR49 fragment, were cloned into the PCR cloning vector pCR-BluntII (Invitrogen) using standard methods. Sequencing with the primer SP6 confirmed in each case an identical sequence to the published sequence AF251016 (SEQ ID NO. 7) apart from the restriction sites introduced. These clones were therefore used for the production of an inverted repeat construct in the cloning vector pJAH (see example 2).

The first cloning step was carried out by isolating the 396 bp PR48-PR49 BamHI-EcoRI fragment from the cloning vector pCR-BluntII (Invitrogen) and ligation with the BamHI-EcoRI cut vector pJAM. The clone that contains the 3'-terminal region of the epsilon cyclase in the antisense orientation is called pJAI4. The ligation results in a transcriptional fusion between the antisense fragment of the 3'-terminal region of the epsilon cyclase and the polyadenylation signal from CaMV.

The second cloning step was carried out by isolating the 392 bp PR46-PR47 HindIII-SalI fragment from the cloning VeMor pCR-BluntII (Invitrogen) and ligation with the HindIII-SalI cut vector pJAI4. The clone which contains the 392 bp 3 ′ terminal region of the epsilon cyclase cDNA in the sense orientation is called pJAI5. The ligation creates a transcriptional fusion between the AP3P and the sense fragments 3'terminal region of the epsilon cyclase. An expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled inverted repeat transcript in Tagetes erecta was produced using the binary VeMor pSUN5 (WO02 / 00900). To produce the expression vector pS5AI5, the 2523 bp SacI-Xhol fragment from pJAI5 was ligated with the SacM-Xhol cut VeMor pSUN5 (Figure 5, KonstruMkarte).

In Figure 5, fragment AP3P contains the modified AP3P promoter (771 bp), fragment sense the 3 'region of the Epsilon cyclase from Tagetes erecta (435 bp) in sense orientation, fragment intron the intron IV2 of the potato gene ST-LS1, fragment anti the 3 'region of the Epsilon cyclase from Tagetes erecta (435 bp) in antisense orientation, and fragment term (761 bp) the polyadenylation signal of CaMV.

Example 5: Cloning of the epsilon cyclase promoter

A 199 bp fragment or the 312 bp fragment of the epsilon cyclase promoter was determined by two independent cloning strategies, inverse PCR (adapted Long et al. Proc. NatI. Acad. Sei USA 90: 10370) and TAIL-PCR (Liu YG. Et al. (1995) Plant J. 8: 457-463) using genomic DNA (isolated according to the standard method from Tagetes erecta, Orange Prince line, isolated).

For the inverse PCR approach, 2 μg of genomic DNA were digested with EcoRV and Rsal in a 25 μl reaction mixture, then diluted to 300 μl and religated overnight at 16 ° C. with 3U ligase. Using the primers PR50 (SEQ ID NO. 40) and PR51 (SEQ ID NO.41), a fragment was produced by PCR amplification, which, in each sense orientation, 354 bp of the epsilon cyclase cDNA (Genbank Accession AF251016), ligated to 300 bp of the epsilon cyclase promoter and 70 bp of the 5'terminal region of the cDNA containing epsilon cyclase (see Figure 7).

The conditions of the PCR reactions were as follows:

The PCR for the amplification of the PR50-PR51 DNA fragment, which contains, among other things, the 312 bp promoter fragment of epsilon cyclase, was carried out in a 50 μl reaction mixture which contained:

- 1 ml ligation mixture (prepared as described above)

- 0.25 mM dNTPs

- 0.2 mM PR50 (SEQ ID No. 40)

- 0 2 mM PR51 (SEQ ID No. 41) - 5 ml 10X PCR buffer (TAKARA) - 0.25 ml R Taq polymerase (TAKARA)

- 28.8 ml Aq. Least.

The PCR reactions were carried out under the following cycle conditions:

1X 94 ° C 2 minutes 35X 94 ° C 1 minute 53 ° C 1 minute 72 ° C 1 minute 1X 72 ° C 10 minutes

PCR amplification with primers PR50 and PR51 resulted in a 734 bp fragment which contains, among other things, the 312 bp promoter fragment of epsilon cyclase (Figure 7). J

The amplificate was cloned into the PCR cloning vector pCR2.1 (Invitrogen) using standard methods. Sequencing with the primers M13 and T7 resulted in the sequence SEQ ID No. 9. This sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Orange Prince line of Tagetes erecta used.

For the TAIL-PCR approach, three successive PCR reactions were carried out, each with different gene-specific primers (nested primers).

The TAIL1-PCR was carried out in a 20 ml reaction mixture which contained:

- 1 genomic DNA (prepared as described above)

- 0.2 mM each dNTP - 0.2 M PR60 (SEQ ID No. 42) - 0.2 mM AD1 (SEQ ID No. 45)

- 2 ml 10X PCR buffer (TAKARA)

- 0.5 ml R Taq polymerase (TAKARA)

- with Aq. Destilled to 20 ul

AD1 initially represented a mixture of primers of the sequences (a / c / g / t) tcga (g / c) t (at) t (g / c) g (a / t) gtt. The PCR-ReaMion TAIL1 were carried out under the following cycle conditions

1X 93 ° C: 1 min., 95 ° C: 1 min. 5X 94 ° C: 30 sec., 62 ° C: 1 min., 72 ° C: 2.5 min. 1 X 94 ° C: 30 sec ., 25 ° C: 3 min., Ramp to 72 ° C in 3 min. 72 ° C: 2.5 min

15X94 ° C: 10 seconds, 68 ° C: 1 minute, 72 ° C: 2.5 minutes; 94 ° C: 10 seconds, 68 ° C: 1 minute, 72 ° C: 2.5 minutes; 94 ° C: 10 sec., 29 ° C: 1 min., 72 ° C: 2.5 min. 1X72 ° C: 5 min.

The TAIL2-PCR was carried out in a 21 ml reaction mixture which contained:

- 1. ml of a 1:50 dilution of the TAIL1 reaction mixture (prepared as described above)

- 0.8 mM dNTP

- 0.2 M PR61 (SEQ ID No. 43)

- 0.2 mM AD1 (SEQ ID No. 45)

- 2 ml 10X PCR buffer (TAKARA) - 0.5 ml R Taq polymerase (TAKARA)

- with Aq. Destilled to 21 ul

The PCR reaction TAIL2 was carried out under the following cycle conditions:

12X 94 ° C: 10 seconds, 64 ° C: 1 minute, 72 ° C: 2.5 minutes; 94 ° C: 10 seconds, 64 ° C: 1 minute, 72 ° C: 2.5 minutes; 94 ° C: 10 seconds, 29 ° C: 1 minute, 72 ° C: 2.5 minutes 1X72 ° C: 5 minutes

The TAIL3-PCR was carried out in a 100 ml reaction mixture, which contained:

- 1 ml of a 1:10 dilution of the TAIL2 reaction mixture (prepared as described above)

- 0.8 mM dNTP - 0.2 mM PR63 (SEQ ID No. 44)

- 0.2 mM AD1 (SEQ ID No. 45)

- 10 ml 10X PCR buffer (TAKARA)

- 0.5 ml R Taq polymerase (TAKARA) - with Aq. Make up to 100 µl

The PCR reaction TAIL3 was carried out under the following cycle conditions:

20X 94 ° C: 15 seconds, 29 ° C: 30 seconds, 72 ° C: 2 minutes 1X 72 ° C: 5 minutes

PCR amplification with primers PR63 and AD1 resulted in a 280 bp fragment, which contains, among other things, the 199 bp promoter fragment of epsilon cyclase (Figure 8).

The amplificate was cloned into the PCR cloning VeMor pCR2.1 (Invitrogen) using standard methods. Sequencing with the primers M13 and T7 resulted in the sequence SEQ ID No. 9. This sequence is identical to the ecyclase region within the sequence SEQ ID No. 7, which was isolated with the IPCR strategy, and thus represents the nucleotide sequence in the Tagetes erecta line Orange Prince used.

The pCR2.1 clone, which contains the 312 bp fragment (SEQ ID No. 9) of the epsilon cyclase promoter, which was isolated by the IPCR strategy, is called pTA-ecycP and was used for the preparation of the IR KonstruMe.

Example 6: Production of an inverted repeat expression cassette for the flower-specific expression of epsilon cyclase dsRNAs in Tagetes erecta (directed against the promoter region of the epsilon cyclase cDNA).

The expression of inverted repeat transcripts consisting of promoter fragments of the epsilon cyclase in Tagetes erecta was carried out under the control of a modified version AP3P of the flower-specific promoter AP3 from Arabidopsis (see Example 2) or the flower-specific promoter CHRC (Genbank accession ho. AF099501). The inverted repeat transcript each contains an epsilon cyclase promoter fragment in the correct orientation (sense fragment) and a sequence-identical epsilon cyclase promoter fragment in the opposite orientation (antisense fragment), which are linked to one another by a funMional intron (see Example 2) are.

The promoter fragments were PCR by means of plasmid DNA (clone pTA-ecycP, see Example 5) and the primers PR124 (SEQ ID No. 46) and PR126 (SEQ ID No. 48) or the primer PR125 (SEQ ID No . 47) and PR127 (SEQ ID No. 49). The conditions of the PCR reactions were as follows:

The PCR for the amplification of the PR124-PR126 DNA fragment, which contains the promoter fragment of epsilon cyclase, was carried out in a 50 ml reaction mixture which contained:

- 1 ml cDNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 mM PR124 (SEQ ID No. 46) - 0.2 mM PR126 (SEQ ID No. 48)

- 5 ml 10X PCR buffer (TAKARA)

- 0.25 ml R Taq Polymerase (TAKARA) - 28.8 ml Aq. Least.

The PCR for the amplification of the PR125-PR127 DNA fragment, which contains the 312bp promoter fragment of epsilon cyclase, was carried out in a 50 μl reaction mixture which contained:

- 1 ml cDNA (prepared as described above) - 0.25 mM dNTPs

- 0.2 mM PR125 (SEQ ID No. 47)

- 0.2 mM PR127 (SEQ ID No. 49)

- 5 ml 10X PCR buffer (TAKARA)

- 0.25 ml R Taq Polymerase (TAKARA) - 28.8 ml Aq. Least.

The PCR reactions were carried out under the following cycle conditions:

1X 94 ° C 2 minutes 35X 94 ° C 1 minute

53 ° C for 1 minute

72 ° C 1 minute 1X 72 ° C 10 minutes

PCR amplification with primers PR124 and PR126 resulted in a 358 bp fragment, PCR amplification with primers PR125 and PR127 resulted in a 361 bp fragment. The two amplicons, the PR124-PR126 (HindIII-Sall sense) fragment and the PR125-PR127 (EcoRI-BamHI antisense) fragment, were cloned into the PCR cloning vector pCR-BluntII (Invitrogen) using standard methods. Sequencing with the primer SP6 each confirmed a sequence which, apart from the restriction sites introduced, is identical to SEQ ID No. 7. These clones were therefore used for the production of an inverted repeat construct in the cloning cell pJAH (see example 2).

The first cloning step was carried out by isolating the 358 bp PR124-PR126 HindIII-SalI fragment from the cloning vector pCR-BluntII (Invitrogen) and ligation with the BamHI-EcoRI cut VeMor pJAH. The clone that contains the epsilon cyclase promoter fragment in the sense orientation is called cs43. The sense fragment of the epsilon cyclase promoter is inserted between the AP3P promoter and the intron by the ligation.

The second cloning step was carried out by isolating the 361 bp PR125-PR127 BamHI-EcoRI fragment from the cloning vector pCR-BluntII (Invitrogen) and ligation with BamHI-EcoRI cut VeMor cs43. The clone that contains the epsilon cyclase promoter fragment in the antisense orientation is called cs44. The ligation creates a transcriptional fusion between the intron and the antisense fragment of the epsilon cyclase promoter.

For the production of an inverted repeat expression cassette under the control of the CHRC promoter, a CHRC promoter fragment using genomic DNA from petunia (produced according to standard methods) and the primers PRCHRC3 '(SEQ ID NO. 51) and PRCHRC5' (SEQ ID NO. 50) amplified. The amplificate was cloned into the cloning vector pCR2.1 (Invitrogen). Sequencing of the resulting clone pCR2.1-CHRC with the primers M13 and T7 confirmed a sequence identical to the sequence AF099501. This clone was therefore used for the cloning in the expression VeMor cs44.

The cloning was carried out by isolating the 1537 bp Sacl-Hindlll fragment from pCR2.1-CHRC and ligation into the Sacl-Hindlll cut vector cs44. The clone that contains the CHRC promoter instead of the original AP3P promoter is called cs45.

For the production of an inverted repeat expression cassette under the control of two promoters, the CHRC promoter and the AP3P promoter, the AP3P promoter was cloned in cs45 in antisense orientation at the 3'terminus of the epsilon-cyclase antisense fragment. The AP3P promoter fragment from pJAH was under Use of the primers PR128 and PR129 amplified. The amplificate was cloned into the cloning cell pCR2.1 (Invitrogen). This clone pCR2.1-AP3PSX was used to produce an inverted repeat expression cassette under the control of two promoters.

The cloning was carried out by isolating the 771 bp Sal-Xhol fragment from pCR2.1-AP3PSX and ligation into the Xhol-cut vector cs45. The clone which contains the promoter AP3P in the antisense orientation on three sides of the inverted repeat is called cs46.

The expression vectors for the Agrobacterium -mediated transformation of the AP3P-controlled inverted repeat transcript in Tagetes erecta were produced using the binary VeMor pSUN5 (WO02 / 00900).

To produce the expression vector pS5AI7, the 1685bp Sacl-Xhol fragment from cs44 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 9, KonstruMkarte).

In Figure 9, fragment AP3P contains the modified AP3P promoter (771 bp), fragment P-sense the 312 bp promoter fragment of the epsilon cyclase in sense orientation, fragment intron the intron IV2 of the potato gene ST-LS1), and fragment P- anti the 312 bp promoter fragment of the epsilon cyclase in antisense orientation.

To produce the expression vector pS5CI7, the 2445bp Sacl-Xhol fragment from cs45 was ligated with the Sacl-Xhol cut VeMor pSUN5 (Figure 10, KonstruMkarte).

In Figure 10, fragment CHRC contains the CHRC promoter (1537 bp), fragment P-sense the 312 bp promoter fragment of epsilon cyclase in sense

Orientation, fragment intron the intron IV2 of the potato gene ST-LS1), and fragment P-anti the 312 bp promoter fragment of the epsilon cyclase in antisense orientation.

To produce the expression vector pS5CI7, the 3219bp Sacl-Xhol fragment from cs46 was ligated with the Sacl-Xhol cut vector pSUN5 (Figure 11, KonstruMkarte).

In Figure 11, fragment CHRC contains the CHRC promoter (1537 bp), fragment P-sense the 312 bp promoter fragment of epsilon cyclase in sense Orientation, fragment intron the intron IV2 of the potato gene ST-LS1), fragment P anti the 312 bp promoter fragment of epsilon cyclase in antisense orientation and the fragment AP3P the 771 bp AP3P promoter fragment in antisense orientation.

Example 7: Production of transgenic Tagetes plants

Day tea seeds are sterilized and placed on germination medium (MS medium; Murashige and Skoog, Physiol. Plant. 15 (1962), 473-497) pH 5.8, 2% sucrose). Germination takes place in a temperature / light / time interval of 18 to 28 ° C / 20 to 200 oCE / 3 to 16 weeks, but preferably at 21 ° C, 20 to 70 < _* E, for 4 to 8 weeks.

All leaves of the in vitro plants that had developed up to that point are harvested and cut across the midrib. The resulting leaf explants with a size of 10 to 60 mm ² are kept in the course of the preparation in liquid MS medium at room temperature for a maximum of 2 h.

The AgrobaMerium tumefaciens strain EHA105 was transformed with the binary plasmid PS5AI3. The transformed A. tumefaciens strain EHA105 was grown overnight under the following conditions: A single colony was grown in YEB (0.1% yeast extract, 0.5% beef extract, 0.5% peptone, 0.5% sucrose, 0.5% Magnesium sulfate x 7 H ₂ 0) inoculated with 25 mg / l kanamycin and attracted at 28 ° C for 16 to 20 h. The bacterial suspension was then harvested by centrifugation at 6000 g for 10 min and resuspended in liquid MS medium in such a way that an OD ₆₀₀ of approximately 0.1 to 0.8 was obtained. This suspension was used for the co-cultivation with the leaf material.

Immediately before the co-cultivation, the MS medium in which the leaves have been kept is replaced by the BaMeriensuspension. The leaflets were incubated in the Agroba mineral suspension for 30 min with gentle shaking at room temperature. The infected explants are then placed on an MS medium solidified with agar (for example 0.8% Plant Agar (Duchefa, NL) with growth regulators, for example 3 mg / l benzylaminopurine (BAP) and 1 mg / l indolylacetic acid (IAA). The orientation of the leaves on the medium is insignificant. Cultivation of the explants takes place for 1 to 8 days, but preferably for 6 days, the following can Conditions are used: light intensity: 30 to 80 mol / m ² x sec, temperature: 22 to 24 ° C., light / dark change of 16/8 hours, then the co-cultivated explants are placed on fresh MS medium, preferably with transferred to the same growth regulators, this second medium additionally containing an antibiotic to suppress bacterial growth, timentin in a concentration of 200 to 500 mg / l is for for this purpose very much suitable. The second seleMive component is used to select the success of the transformation. Phosphinothricin in a concentration of 1 to 5 mg / l selects very efficiently, but other selective components according to the method to be used are also conceivable.

After one to three weeks, the explants are transferred to fresh medium until shoot buds and small shoots develop, which are then on the same basal medium including timentin and PPT or alternative components with growth regulators, namely, for example, 0.5 mg / l indolylbutyric acid (IBA) and 0.5 mg / l gibberillic acid GA ₃ , are transferred for rooting. Rooted shoots can be transferred to the greenhouse.

In addition to the described method, the following advantageous modifications are possible:

• Before the explants are infected with the BaMeries, they can be used for 1 to

12 days, preferably 3 to 4, are pre-incubated on the medium described above for the co-culture. Then the InfeMion, co-culture and seleMive regeneration takes place as described above.

• The pH for regeneration (usually 5.8) can be adjusted to pH 5.2. This improves control of Agroba series growth.

• The addition of AgNO ₃ (3 to 10 mg / l) to the regeneration medium improves the condition of the culture, including the regeneration itself.

Components that reduce phenol formation and are known to those skilled in the art, such as Citric acid, ascorbic acid, PVP and many more have a positive effect on the culture.

• Liquid culture medium can also be used for the entire process. The culture can also be incubated on commercially available carriers which are positioned on the liquid medium.

According to the transformation method described above, the following lines were obtained with the following expression constructs:

With p76Bgene (from example 1) the following was obtained: MK14-1-1 With pS5AI3 the following were obtained: CS30-1, CS30-3 and CS30-4 Example 8: Characterization of the transgenic plants

Example 8.1: CS30-1, CS30-3 and CS30-4

The flower material of the transgenic Tagetes erecta plants CS30-1, CS30-3 and CS30-4 from Example 7 was ground in liquid nitrogen and the powder (about 250 to 500 mg) extracted with 100% acetone (three times 500 ul each). The solvent was evaporated and the carotenoids resuspended in 100 ul acetone.

A C30 reverse phase column was used to differentiate between mono- and diesters of the carotenoids. HPLC running conditions were almost identical to a published method (Frazer et al. (2000), Plant Journal 24 (4): 551-558). Identification of the carotenoids was possible on the basis of the UV-VIS spectra.

Table 1 shows the carotenoid profile in day tetals of the transgenic tagetes and control day plants produced according to the examples described above. All carotenoid amounts are given in [μg / g] fresh weight, percentage changes compared to the control plant are given in brackets. Compared to the genetically unmodified control plant, the genetically modified plants have a significantly increased content of carotenoids of the "β-carotene pathway", such as, for example, β-carotene and zeaxanthin, and a significantly reduced content of carotenoids of the "α-carotene pathway" , such as lutein.

Table 1

Example 8.2: Reduction of the ε-cyclase activity in Tagetes erecta by Antisense CS 32-9

Using conventional methods known to the person skilled in the art, a Tagetes erecta antisense line CS32-9 was produced as a comparative example, in which the ε-cyclase activity was reduced by antisense. The carotenoid profile of this line (CS32-9), measured by the method described above, is also shown in Table 1.

Example 8.3: Alkaline hydrolysis of carotenoid esters and identification of the carotenoids of MK14-1-1

The petals of the transgenic Tagetes Errecta plants MK14-1-1 from Example 7 were ground in liquid nitrogen and the petalen powder (about 20 mg) was extracted with 100% acetone (three times 500 ul each). The solvent was evaporated and the residue was taken up in 180 μl of acetone. In order to ensure homogeneity of the extract, the extract was treated with ultrasound for two minutes

20 μl of 10% KOH in methanol were added to the extract and shaken at room temperature at 1000-1300 rpm for 30 min. The ExtraM was then titrated to pH 7.5 with HCL and centrifuged at 10,000 g for 10 min.

The supernatant was analyzed using a C30 reverse phase column. HPLC running conditions were almost identical to a published method (Frazer et al. (2000), Plant Journal 24 (4): 551-558). Identification of the carotenoids was possible on the basis of the UV-VIS memory and on the basis of the masses.

The overexpression of the β-cyclase (Bgene) according to the invention from Lycopersicon esculentum under the control of the flower-specific promoter P76 from Arabidopsis thaliana in Tagetes erecta surprisingly not only led to the accumulation of higher ones

Amounts of ß carotenoids but a drastic reduction in the amount of α-carotenoids in favor of the amount of ß carotenoids.

As a result, the α-carotenoid present in the flower of Tagetes erecta

Amounts reduced from over 80% in the wild type to below 30% of the total carotenoids and the proportion of the ß carotenoids in the total carotenoid content increased from below 20% to over 70% in the wild type (see Figure 1).

Claims

claims

1. Process for the preparation of ß-carotenoids by cultivating genetically modified plants which, compared to the wild type, have an increased ß-cyclase activity in plant tissues containing photosynthetically inactive plastids, and the increased ß-cyclase activity by a ß-cyclase is caused, containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2, with the proviso that tomato is excluded as a plant.

2 ... The method according to claim 1, characterized in that to increase the β-cyclase activity, the gene expression of a nucleic acid encoding a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2, increased compared to the wild type.

3. The method according to claim 2, characterized in that to increase the gene expression nucleic acids are introduced into the plants, which encode β-cyclases containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

4. The method according to any one of claims 1 to 3, characterized in that nucleic acids containing the sequence SEQ. ID. NO. 1 brings.

5. The method according to any one of claims 1 to 4, characterized in that the expression of the β-cyclase takes place under the control of a promoter which ensures the expression of the β-cyclase in the plant tissues containing photosynthetically in aMive plastids.

6. The method according to any one of claims 1 to 5, characterized in that genetically modified plants are used which have the highest expression rate of β-cyclase in plant tissues containing photosynthetically inaMive plastids.

7. The method according to claim 6, characterized in that the expression of the β-cyclase takes place under the control of a promoter specific for the plant tissue.

8. The method according to any one of claims 1 to 7, characterized in that the plants additionally have an increased hydroxylase activity compared to the wild type.

9. The method according to claim 8, characterized in that to increase the hydroxylase activity, the gene expression of a nucleic acid encoding a hydroxylase is increased compared to the wild type.

10. The method according to claim 9, characterized in that a nucleic acid encoding a hydroxylase is introduced into the plant to increase gene expression.

11. The method according to claim 10, characterized in that nucleic acid encoding a hydroxylase is introduced, nucleic acids encoding a hydroxylase containing the amino acid sequence SEQ ID NO: 9 or one derived from this sequence by substitution, insertion or deletion of amino acids

Sequence which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 9.

12. The method according to claim 11, characterized in that nucleic acids containing the sequence SEQ ID NO: 8 are introduced.

13. The method according to any one of claims 1 to 12, characterized in that genetically modified plants are used which, in plant tissues containing photosynthetically inaMive plastids, the highest expression rate of the hydro- have xylase.

14. The method according to claim 13, characterized in that the expression of the hydroxylase takes place under the control of a promoter specific for the plant tissue.

15. The method according to any one of claims 1 to 14, characterized in that the plants compared to the wild type additionally have a reduced AMivity of at least one of the AMivities selected from the group ε-cyclase AMivity and endogenous β-hydroxylase AMivity.

16. The method according to claim 15, characterized in that the reduction of the ε-cyclase activity and / or the endogenous ß-hydroxylase activity in plants is achieved by at least one of the following methods:

a) introducing at least one double-stranded ε-cyclase-ribonucleic acid sequence and / or endogenous β-hydroxylase-ribonucleic acid sequence or an expression cassette or expression cassettes ensuring their expression,

b) introducing at least one ε-cyclase-antisense-ribonucleic acid sequence and / or endogenous ß-hydroxylase-antisense-ribonucleic acid sequence or an expression cassette or expression cassette ensuring their expression,

c) introducing at least one ε-cyclase-antisense-ribonucleic acid sequence and / or endogenous ß-hydroxylase-antisense-ribonucleic acid sequence into plants in each case combined with a ribozyme or an expression cassette or expression cassette ensuring their expression,

d) introducing at least one ε-cyclase-sense-ribonucleic acid sequence and / or endogenous ß-hydroxyiase-sense-ribonucleic acid sequence to induce cosuppression or an expression cassette or expression cassette ensuring its expression in plants,

e) introduction of at least one DNA or protein binding factor against an ε-cyclase gene, RNA or protein and / or endogenous β-hydroxylase gene, RNA or protein or an expression cassette or expression cassettes in plants which ensure its expression,

f) introduction of at least one viral nucleic acid sequence which effects ε-cyclase-RNA and / or endogenous ß-hydroxylase-RNA degradation or

Nucleic acid sequences or an expression cassette or expression cassettes in plants ensuring their expression,

g) Introduction of at least one construct to produce an insertion, deletion, inversion or mutation in a ε-cyclase gene and / or endogenous ß-hydroxylase gene in plants.

17. The method according to claim 16, embodiment a), characterized in that an RNA is introduced into the plant which has an area with double-stranded structure and in this area contains a nucleic acid sequence which

a) is identical to at least part of the plant's ε-cyclase transcript and / or

b) with at least part of the plant's own ε-cyclase promoter

Sequence is identical.

18. The method according to claim 17, characterized in that the region with double-strand structure contains a nucleic acid sequence which is identical to at least part of the plant's own ε-cyclase transcript and the 5 'end or the 3rd 'End of the plant's own nucleic acid, encoding an ε-cyclase.

19. The method according to claim 16, embodiment a), characterized in that an RNA is introduced into the plant, which has a region with a double-strand structure and in this region contains a nucleic acid sequence which

a) is identical to at least part of the plant's own, endogenous β-hydroxylase transcript and / or

b) with at least part of the plant's own endogenous β-hydroxylase -

Promoter sequence is identical.

20. The method according to claim 19, characterized in that the region with double-strand structure contains a nucleic acid sequence which is identical to at least a part of the plant's own, endogenous β-hydroxylase transcript and the 5 'end or contains the 3 'end of the plant's own nucleic acid, encoding an endogenous β-hydroxylase.

21. The method according to any one of claims 15 to 20, characterized in that genetically modified plants are used which have the lowest expression rate of an ε-cyclase and / or endogenous ß-hydroxylase in plant tissues containing photosynthetically inaMive plastids.

22. The method according to claim 21, characterized in that the transcription of the double-stranded ribonucleic acid sequence according to claim 16, embodiment a) and / or the antisense sequences according to claim 16, embodiment b) is carried out under the control of a promoter which is photosynthetic for the plant tissues inaMive Plastide, specific is:

23. The method according to any one of claims 1 to 22, characterized in that after the cultivation, the genetically modified plants are harvested and the β-carotenoids are then isolated from the plants or the plant tissues containing photosynthetically inactive plastids.

24. The method according to any one of claims 1 to 23, characterized in that the plant tissues containing photosynthetically inactive plastids are selected from the group flower, fruit and tuber.

25. The method according to any one of claims 1 to _. 24, characterized in that a plant selected from the Ranunculaceae, Berberidaceae, Papaveraceae, Cannabaceae, Rosaceae, Fabaceae, Linaceae families is a genetically modified plant which has an increased β-cyclase activity in flowers compared to the wild type , Vitaceae, Brassiceae, Cucurbitaceae, Primulaceae, Caryophylla- ceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolaceae, Solanaceae, Scrophulariaceae, Asteraceae, Malidaeae, Liliaceae, Liliaceae, Liliaceae

26. The method according to claim 25, characterized in that a plant is selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus, Bignonia, Calendula, Calendula officinalis, Caltha, Campanula, Canna, Centaurea, Cheranthus, Chrysanthemum, Citrus, Crepis, Croeus, Curcurbita, Cytisus, Delonia,

Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kenya, Labumum, Lathyrus, Leon-todon, Lilium, Linum, Lotus, Lysimachia, Maratia, Medicago, Mimulus, Narcissus,

Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Solanum tuberosum, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius Tropum , Tussilago, Ulex, Viola or Zinnia used:

27. The method according to any one of claims 1 to 24, characterized in that a plant selected from the plant genera Actinophloeus, Aglaeonema, pineapple, Arbutus as a genetically modified plant which has an increased β-cyclase activity in fruits compared to the wild type , Archontophoenix, Area, Aronia, Asparagus, Avocado, Attalea, Berberis, Bixia, Brachychilum, Bryonia, Calipocalix, Capsicum, Carica, Celastrus, Citrullus, Citrus, Convallaria, Cotoneaster, Crataegus, Cucumis, Cucurbita, Cuscutomandra, Cyus , Dioscorea, Diospyrus, Dura, Elaeagnus, Elaeis, Erythroxylon, Euonymus, Pea, Ficus, Fortunella, Fragaria, Gardinia, Gonocaryum, Gossypium, Guava, Guilielma, Hibiscus, Hippophaea, Iris, Kiwi, Lathyrus, Loniccium, Luffa , Malpighia, Mangifera, Mormodica, Murraya, Musa, Nenga, Orange, Palisota, Pandanus, Passiflora, Persea, Physalis, Prunus, Ptychandra, Punica, Pyracantha, Pyrus, Ribes, Rosa, Rubus, Sabal, Sambucus, Seaforita, Shephe rdia, Solanum, Sorbus, Synaspadix, Tabernae, Tamus, Taxus, Trichosanthes, Triphasia, Vaccinium, Viburnum, Vignia, Vitis or Zucchini

28. The method according to any one of claims 1 to 24, characterized in that Solanum tuberosum is used as the genetically modified plant which has an increased β-cyclase activity in tubers compared to the wild type.

29. The method according to any one of claims 1 to 28, characterized in that the ß-carotenoids are selected from the group ß-carotene, ß-cryptoxanthin, zeaxanthin, antheraxanthin, violaxanthin and neoxanthin.

30. Genetically modified plant, wherein the genetic change increases the activity of a β-cyclase in parts of plants containing photosynthetically inactive plastids compared to the wild type and the increased β-cyclase activity is caused by a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

31 Genetically modified plant according to claim 30, characterized in that the increase in ß-cyclase activity by increasing the gene expression of a nucleic acid encoding a ß-cyclase containing the amino acid sequence

SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2, against which wild type is hosted.

32. Genetically modified plant according to claim 31, characterized in that nucleic acids which encode β-cyclases containing the amino acid sequence SEQ are introduced into the plant to increase the gene expression. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

33. Genetically modified plant containing at least one nucleic acid encoding a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 60% at the amino acid level with the sequence SEQ. ID. NO. 2, with the proviso that tomato is excluded.

34. Genetically modified plant according to one of claims 30 to 33, characterized in that the genetic modification additionally increases the hydroxiase activity compared to the wild type.

35. Genetically modified plant according to one of claims 30 to 34, characterized in that the genetic change additionally reduces at least one of the AMivities selected from the group ε-cyclase AMivity and endogenous β-hydroxylase AMivity compared to the wild type.

36. Genetically modified plant according to one of claims 30 to 35, characterized in that the plant tissues containing photosynthetically inaMive plastids are selected from the group of flower, fruit and tuber.

37. Genetically modified plant according to one of claims 30 to 36, characterized in that the genetically modified plant, which has an increased β-cyclase activity in flowers compared to the wild type, is selected from the families Ranunculaceae, Berberidaceae, Papaveraceae , Cannabaceae, Rosaceae, Fabaceae, Linaceae, Vitaceae, Brassiceae, Cucurbitaceae, Primulaceae, Caryophyl- laceae, Amaranthaceae, Gentianaceae, Geraniaceae, Caprifoliaceae, Oleaceae, Tropaeolacaceae, Solaeacaceaeae , Malvaceae, liliaceae or Lamiaceae.

38. Genetically modified plant according to claim 37, characterized in that the plant is selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus,

Bignonia, Calendula, Calendula officinalis, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Croeus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Geysiumia, Forsythia, Fremysia , Genista, Gentiana, Geranium, Gerbera, Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hype- ricum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Laburnum, Lathyrus, Leon-todon, Liiium, Linum , Lotus, Lysimachia, Maratia, Medicago, Mimulus, Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Solanum tuberosum Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ulex, Viola or Zinnia.

39. Genetically modified plant according to one of claims 30 to 36, characterized in that the genetically modified plant, which has an increased β-cyclase activity in fruit compared to the Wiid type, is selected from the

Plant genera Actinophloeus, Aglaeonema, Pineapple, Arbutus, Archontophoe- nix, Area, Aronia, Asparagus, Avocado, Attalea, Berberis, Bixia, Brachychilum, Bryonia, Caliptocalix, Capsicum, Carica, Celastrus, Citrullus, Citrus, Custerus, Consteraria, Convallaria, , Cucurbita, Cuscuta, Cycas, Cyphomandra, Di- oscorea, Diospyrus, Dura, Elaeagnus, Elaeis, Erythroxylon, Euonymus, Pea, Ficus, Fortunella, Fragaria, Gardinia, Gonocaryum, Gossypium, Guava, Guilielma, Hibiscus, Hippopha , Kiwi, Lathyrus, Lonicera, Luffa, Lycium, Maize, Malpighia, Mangifera, Mormodica, Murraya, Musa, Nenga, Orange, Palisota, Pandanus, Passiflora, Persea, Physalis, Prunus, Ptychandra, Punica, Pyracantha, Pyrus, Ri - bes, Rosa, Rubus, Sabal, Sambucus, Seaforita, Shepherdia, Solanum, Sorbus,

Synaspadix, Tabernae, Tamus, Taxus, Trichosanthes, Triphasia, Vaccinium, Vibrumum, Vignia, Vitis or Zucchini.

40. Genetically modified plant according to one of claims 30 to 36, characterized in that the genetically modified plant, which has an increased β-cyclase activity in tubers compared to the wild type, is Solanum tuberosum.

41. Use of the genetically modified plants or plant tissues according to one of claims 30 to 40 as feed or food.

42. Use of the genetically modified plants or plant tissues according to one of claims 30 to 40 for the production of ß-carotenoid-containing extracts or for the production of ß-carotenoid-containing feed and nutritional supplements.

43. Use of zeaxanthin-containing extracts according to claim 42 for pigmenting animal products.