EP1658377A1

EP1658377A1 - Method for producing ketocarotinoids in genetically modified, non-human organisms

Info

Publication number: EP1658377A1
Application number: EP04741347A
Authority: EP
Inventors: Ralf Flachmann; Christel Renate Schopfer; Karin Herbers; Irene Kunze; Matt Sauer; Martin Klebsattel; Thomas Luck; Dirk Voeste; Angelika-Maria Pfeiffer
Original assignee: SunGene GmbH
Current assignee: SunGene GmbH
Priority date: 2003-08-18
Filing date: 2004-07-31
Publication date: 2006-05-24

Abstract

The invention relates to a method for producing ketocarotinoids by cultivation of genetically modified organisms that have a modified ketolase activity and modified beta -cyclase activity as compared to the wild-type organism. The invention also relates to the genetically modified organisms, to their use as food stuff or feeding stuff and to their use for producing ketocarotinoid extracts.

Description

Process for the production of ketocarotenoids in genetically modified, non-human organisms

description

The present invention relates to a process for the preparation of ketocarotenoids by cultivating genetically modified organisms which, compared to the wild type, have an altered ketolase activity and an altered β-cyclase activity, the genetically modified organisms, and their use as food and feed and for the production of ketocarotenoid extracts.

Carotenoids are synthesized de novo in bacteria, algae, fungi and plants. .. ketocarotenoids, ie carotenoids, which contain at least one keto group, such as, "for example astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3'-hydroxyechinenone, adonirubin and adonixanthin are natural antioxidants and pigments, which are considered by some algae and microorganisms Secondary metabolites are produced.

Due to their coloring properties, the ketocarotenoids and in particular astaxanthin are used as pigmenting aids in animal nutrition, especially in trout, salmon and shrimp farming.

Nowadays, astaxanthin is mainly produced using chemical synthesis processes. Natural ketocarotenoids, such as natural astaxanthin, are nowadays obtained in small amounts in biotechnological processes by cultivating algae, for example Haematococcus pluvialis or by fermentation of genetically optimized microorganisms and subsequent isolation. An economical biotechnological process for the production of natural ketocarotenoids is therefore of great importance.

Nucleic acids encoding a ketolase and the corresponding protein sequences have been isolated and annotated from various organisms, such as nucleic acids encoding a ketolase from Agrobacterium aurantiacum (EP 735 137, Accession NO: D58420), from Alcaligenes sp. PC-1 (EP 735137, Accession NO: D58422), Haematococcus pluvialis Flotow em. Wille and Haematoccus pluvialis, NIES-144 (EP 725137, WO 98/18910 and Lotan et al, FEBS Letters 1995, 364, 125-128, Accession NO: X86782 and D45881), Paracoccus marcusii (Accession NO: Y15112), Synechocystis sp , Strain PC6803 (Accession NO: NP_442491), Bradyrhizobium sp. (Accession NO: AF218415) and Nostoc sp. PCC 7120 (Kaneko et al, DNA Res. 2001, 8 (5), 205-213; Accession NO: AP003592, BAB74888).

EP 735 137 describes the production of xanthophylls in microorganisms, such as, for example, E. coli by introducing ketolase genes (crtW) from Agrobacterium aurantiacum or Alcaligenes sp. PC-1 in microorganisms.

From EP 725 137, WO 98/18910, Kajiwara et al. (Plant Mol. Biol. 1995, 29, 343-352) and Hirschberg et al. (FEBS Letters 1995, 364, 125-128) it is known to produce astaxanthin by introducing ketolase genes from Haematococcus pluvialis (crtW, crtO or bkt) into E. coli.

Hirschberg et al. (FEBS Letters 1997, 404, 129-134) describe the production of astaxanthin in Synechococcus by introducing ketolase genes (crtO) from Haematococcus pluvialis. Sandmann et al. (Photochemistry and Photobiology 2001, 73 (5), 551-55) describe an analogous method which, however, leads to the production of cantaxanthin and only provides traces of astaxanthin.

WO 98/18910 and Hirschberg et al. (Nature Biotechnology 2000, 18 (8), 888-892) describe the synthesis of ketocarotenoids in nectaries of tobacco flowers by introducing the ketolase gene from Haematococcus pluvialis (crtO) into tobacco.

WO 01/20011 describes a DNA construct for the production of ketocarotenoids, in particular astaxanthin, in seeds of oilseed plants such as oilseed rape, sunflower, soybean and mustard using a seed-specific promoter and a ketolase from Haematococcus pluvialis.

All processes described in the prior art for the production of ketocarotenoids and in particular the processes described for the production of astaxanthin have the disadvantage that on the one hand the yield is not yet satisfactory and on the other hand the transgenic organisms provide a large amount of hydroxylated by-products such as zeaxanthin and adonixanthin ,

The invention was therefore based on the object of providing a process for the preparation of ketocarotenoids by cultivating genetically modified, non-human organisms, or of providing further genetically modified, non-human organisms which produce ketocarotenoids which have the disadvantages of the prior art described above to a lesser extent or no longer or which provide the desired ketocarotenoids in higher yields. Accordingly, a method for producing ketocarotenoids has been found by cultivating genetically modified, non-human organisms which have an altered ketolase activity and an altered β-cyclase activity compared to the wild type, and the altered β-cyclase activity by a β-cyclase is caused, containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

In the case that the starting organism or wild type has no ketolase activity, “an altered ketolase activity compared to the wild type” is preferably understood to mean a “ketolase activity caused compared to the wild type”.

In the case that the starting organism or wild type has a ketolase activity, “an altered ketolase activity compared to the wild type” is preferably understood to mean an “increased ketolase activity compared to the wild type”.

In the event that the starting organism or wild type has no β-cyclase activity, “β-cyclase activity changed compared to the wild type” is preferably understood to mean “β-cyclase activity caused compared to the wild type”.

In the case that the starting organism or wild type has a β-cyclase activity, “β-cyclase activity changed compared to the wild type” is preferably understood to mean “β-cyclase activity increased compared to the wild type”.

The non-human organisms according to the invention, such as, for example, microorganisms or plants, are preferably naturally able, as starting organisms, to produce carotenoids such as, for example, β-carotene or zeaxanthin, or can be enabled by genetic modification, such as re-regulation of metabolic pathways or complementation are to produce carotenoids such as ß-carotene or zeaxanthin.

Some organisms, as starting or wild-type organisms, are already able to produce ketocarotenoids such as astaxanthin or canthaxanthin. These organisms, such as Haematococcus pluvialis, Paracoccus marcusii, Xan- thophyllomyces dendrorhous, Bacillus circulans, Chlorococcum, Phaffia rhodozyma, Adonis, Neochlohs wimmeri, Protosiphon vacuolätus botryoides, Scotiellopsis oocystifor- mis, Scenedesmus, Chlorela zofingiensis, Ankistrodesmus braunii, Euglena sanguinea and Bacillus atrophaeus, already as starting or wild-type organisms a ketolase activity and a β-cyclase activity.

According to the invention, the term “wild type” is understood to mean the corresponding starting organism.

Depending on the context, the term “organism” can be understood to mean the non-human starting organism (wild type) or an inventive, genetically modified, non-human organism or both.

Preferably and particularly in cases where the plant or the wild type cannot be clearly assigned, "wild type" is used for increasing or causing ketolase activity, for increasing or causing hydroxylase activity described below, for that described below Increasing or causing the β-cyclase activity, for the increase in the HMG-CoA reductase activity described below, for the increase in the (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase described below Activity for increasing the 1-deoxy-D-xylose-5-phosphate synthase activity described below, for increasing the 1-deoxy-D-xylose-5-phosphate reductoisomerase activity described below for that described below Increase in isopentenyl diphosphate Δ isomerase activity, for the increase in geranyl diphosphate synthase activity described below, for the E described below increase in farnesyl diphosphate synthase activity, for the increase in geranyl-geranyl diphosphate synthase activity described below, for the increase in phytoene synthase activity described below, for the increase in phytoene desaturase described below Activity, for the increase in zeta-carotene desaturase activity described below, for the increase in crtlSO activity described below, for the increase in FtsZ activity described below, for the increase in MinD activity described below, for that described below Reduction of the ε-cyclase activity and for the reduction of the endogenous ß-hydroxylase activity described below and the increase in the content of ketocarotenoids each understood a reference organism.

This reference organism is preferably Haematococcus pluvialis for microorganisms which already have ketolase activity as a wild type.

This reference organism is preferably Blakeslea for microorganisms which, as a wild type, have no ketolase activity.

This reference organism is preferably Adonis aestivalis, Adonis flammeus or Adonis for plants which already have a ketolase activity as a wild type annuus, particularly preferably Adonis aestivalis.

This reference organism is particularly preferred for plants which, as wild type, have no ketolase activity in petals, preferably Tagetes erecta, Tagetes patula, Tagetes lucida, Tagetes pringlei, Tagetes palms, Tagetes minuta or Tagetes campanulata.

Ketolase activity means the enzyme activity of a ketolase.

A ketolase is understood to mean a protein which has the enzymatic activity of introducing a keto group on the optionally substituted β-ionone ring of carotenoids.

In particular, a ketolase is understood to be a protein which has the enzymatic activity to convert β-carotene into canthaxanthin.

Accordingly, ketolase activity is understood to mean the amount of β-carotene or amount of canthaxanthin formed by the protein ketolase in a certain time.

In one embodiment of the method according to the invention, non-human organisms are used as starting organisms which already have a ketolase activity as wild type or starting organism, such as, for example, Haematococcus pluvialis, Paracoccus marcusii, Xanthophyllomyces dendrorhous, Bacillus circulans, Chlorococcum, Phaffia rhodozyma, Adonis florets Neochloris wimmeri, Protosiphon botryoides, Scotiellopsis oocystiformis, Scenedesmus vacuolatus, Cholrela zofingiensis, Ankistrodesmus braunii, Euglena sanguinea or Bacillus atrophaeus. In this embodiment, the genetic modification causes an increase in ketolase activity compared to the wild type or parent organism.

If the ketolase activity is higher than that of the wild type, the amount of β-carotene or the amount of canthaxanthin formed is increased by the protein ketolase in a certain time compared to the wild type.

This increase in ketolase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the ketolase activity of the wild type. The ketolase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:

The ketolase activity in plant or microorganism material is determined in accordance with the method of Fraser et al., (J. Biol. Chem. 272 (10): 6128-6135, 1997). The ketolase activity in plant or microorganism extracts is determined with the substrates β-carotene and canthaxanthin in the presence of lipid (soy lecithin) and detergent (sodium cholate). Substrate / product ratios from the ketolase assays are determined by means of HPLC.

The ketolase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms at the translation and protein levels or by increasing the gene expression of a nucleic acid encoding a ketolase compared to the wild type, for example by inducing the ketolase gene by activators or by Introduction of nucleic acids encoding a ketolase into the organism.

Increasing the gene expression of a nucleic acid encoding a ketolase is understood according to the invention in this embodiment as also the manipulation of the expression of the organism's own endogenous ketolases. This can be achieved, for example, by changing the promoter DNA sequence for genes encoding ketolase. Such a change, which results in a changed or preferably increased expression rate of at least one endogenous ketolase gene, can be carried out by deleting or inserting DNA sequences.

As described above, it is possible to change the expression of at least one endogenous ketolase by applying exogenous stimuli. This can take place through special physiological conditions, ie through the application of foreign substances.

Furthermore, an increased expression of at least one endogenous ketolase gene can be achieved in that a regulator protein which is not found or modified in the wild-type organism interacts with the promoter of these genes.

Such a regulator can represent a chimeric protein which consists of a DNA binding domain and a transcription activator domain, as described, for example, in WO 96/06166. In a preferred embodiment, the ketolase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a ketolase.

In a further preferred embodiment, the gene expression of a nucleic acid encoding a ketolase is increased by introducing nucleic acids encoding ketolases into the organism.

In this embodiment, at least one further ketolase gene is thus present in the transgenic organisms according to the invention compared to the wild type. In this embodiment, the genetically modified organism according to the invention preferably has at least one exogenous (= heterologous) nucleic acid, coding for a ketolase, or at least two endogenous nucleic acids, coding for a ketolase

In another preferred embodiment of the method according to the invention, non-human organisms are used as starting organisms which, as a wild type, have no ketolase activity, such as, for example, Blakeslea, Marigold, Tagetes erecta, Tagetes lucida, Tagetes minuta, Tagetes pringlei, Tagetes palmeri and Tagetes campanulata ,

In this preferred embodiment, the genetic modification causes ketolase activity in the organisms. In this preferred embodiment, the genetically modified organism according to the invention thus has a ketolase activity in comparison with the genetically unmodified wild type and is therefore preferably capable of transgenically expressing a ketolase.

In this preferred embodiment, the gene expression of a nucleic acid encoding a ketolase is caused analogously to the above-described increase in gene expression of a nucleic acid encoding a ketolase, preferably by introducing nucleic acids which encode ketolases into the starting organism.

In principle, any ketolase gene, that is to say any nucleic acids encoding a ketolase, can be used in both embodiments.

All nucleic acids mentioned in the description can be, for example, an RNA, DNA or cDNA sequence.

In the case of genomic ketolase sequences from eukaryotic sources which contain introns, in the event that the host organism is unable or not able to the position can be shifted to express the corresponding ketolase, preferably to use already processed nucleic acid sequences, such as the corresponding cDNAs.

Examples of nucleic acids encoding a ketolase and the corresponding ketolases that can be used in the method according to the invention are, for example, sequences from

Haematoccus pluvialis, especially from Haematoccus pluvialis Flotow em. Wille (Accession NO: X86782; nucleic acid: SEQ ID NO: 3, protein SEQ ID NO: 4),

Haematoccus pluvialis, NIES-144 (Accession NO: D45881; nucleic acid: SEQ ID NO: 35, protein SEQ ID NO: 36),

Agrobacterium aurantiacum (Accession NO: D58420; nucleic acid: SEQ ID NO: 37, protein SEQ ID NO: 38),

Alicaligenes spec. (Accession NO: D58422; nucleic acid: SEQ ID NO: 39, protein SEQ ID NO: 40),

Paracoccus marcusii (Accession NO: Y15112; nucleic acid: SEQ ID NO: 41, protein SEQ ID NO: 42).

Synechocystis sp. Strain PC6803 (Accession NO: NP442491; nucleic acid: SEQ ID NO: 43, protein SEQ ID NO: 44).

Bradyrhizobium sp. (Accession NO: AF218415; nucleic acid: SEQ ID NO: 45, protein SEQ ID NO: 46).

Nostoc sp. Strain PCC7120 (Accession NO: AP003592, BAB74888; nucleic acid: SEQ ID NO: 47, protein SEQ ID NO: 48).

Haematococcus pluvialis

(Accession NO: AF534876, AAN03484; nucleic acid: SEQ ID NO: 49, protein: SEQ ID NO: 50)

Paracoccus sp. MBIC1143

(Accession NO: D58420, P54972; nucleic acid: SEQ ID NO: 51, protein: SEQ ID NO: 52) Brevundimonas aurantiaca

(Accession NO: AY166610, AAN86030; nucleic acid: SEQ ID NO: 53, protein: SEQ

ID NO: 54)

Nodularia spumigena NSOR10

(Accession NO: AY210783, AA064399; nucleic acid: SEQ ID NO: 55, protein: SEQ ID NO: 56)

Nostoc punctiforme ATCC 29133 (Accession NO: NZ_AABC01000195, ZP_00111258; nucleic acid: SEQ ID NO: 57, protein: SEQ ID NO: 58)

Nostoc punctiform ATCC 29133

(Accession NO: NZ_AABC01000196; nucleic acid: SEQ ID NO: 59, protein: SEQ ID NO: 60)

Deinococcus radiodurans R1

(Accession NO: E75561, AE001872; nucleic acid: SEQ ID NO: 61, protein: SEQ ID

NO: 62),

Synechococcus sp. WH 8102,

Nucleic acid: Acc.-No. NZ_ AABD01000001, base pair 1, 354.725-1, 355.528 (SEQ ID NO: 75), protein: Acc.-No. ZP_00115639 (SEQ ID NO: 76) (annotated as putative protein),

or sequences derived from these sequences, such as, for example

the ketolases of the sequence SEQ ID NO: 64 or 66 and the corresponding coding nucleic acid sequences SEQ ID NO: 63 or SEQ ID NO: 65, which result, for example, from the sequence SEQ ID NO: 58 or SEQ ID NO: 57 by variation / mutation .

the ketolases of the sequence SEQ ID NO: 68 or 70 and the corresponding coding nucleic acid sequences SEQ ID NO: 67 or SEQ ID NO: 69, which result, for example, from the sequence SEQ ID NO: 60 or SEQ ID NO: 59 by variation / mutation , or

the ketolases of the sequence SEQ ID NO: 72 or 74 and the corresponding coding nucleic acid sequences SEQ ID NO: 71 or SEQ ID NO: 73, for example by variation or mutation from the sequence SEQ ID NO: 76 or SEQ ID NO: 75 emerge.

Further natural examples of ketolases and ketolase genes that can be used in the method according to the invention can be obtained, for example, from different organisms whose genomic sequence is known by comparing the identity of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the sequences described above and easy to find especially with the sequences SEQ ID NO: 4 and / or 48 and / or 58 and / or 60.

Further natural examples of ketolases and ketolase genes can furthermore be derived from the nucleic acid sequences described above, in particular from the sequences SEQ ID NO: 3 and / or 47 and / or 57 and / or 59 from different organisms, the genomic sequence of which is not known is easy to find by hybridization techniques in a manner known per se.

The hybridization can take place under moderate (low stringency) or preferably under stringent (high stringency) conditions.

Such hybridization conditions, which apply to all nucleic acids in the description, are described, for example, by Sambrook, J., Fritsch, EF, Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Cold Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6.

For example, the conditions during the washing step can be selected from the range of conditions limited by those with low stringency (with 2X SSC at 50 ° C) and those with high stringency (with 0.2X SSC at 50 ° C, preferably at 65 ° C) (20X SSC: 0.3 M sodium citrate, 3 M sodium chloride, pH 7.0).

In addition, the temperature during the washing step can be raised from moderate conditions at room temperature, 22 ° C, to stringent conditions at 65 ° C.

Both parameters, salt concentration and temperature, can be varied simultaneously, one of the two parameters can be kept constant and only the other can be varied. Denaturing agents such as formamide or SDS can also be used during hybridization. In the presence of 50% formamide, the hybridization is preferably carried out at 42 ° C. Some exemplary conditions for hybridization and washing step are given as a result:

(l) Hybridization conditions with, for example

(i) 4X SSC at 65 ° C, or

(ii) 6X SSC at 45 ° C, or

(iii) 6X SSC at 68 ° C, 100 mg / ml denatured fish sperm DNA, or

(iv) 6X SSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA at 68 ° C, or

(v) 6XSSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA, 50% formamide at 42 ° C, or

(vi) 50% formamide, 4X SSC at 42 ° C, or

(vii) 50% (vol / vol) formamide, 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinyl pyrrolidone, 50 mM sodium phosphate buffer pH 6.5, 750 mM NaCI, 75 mM sodium citrate at 42 ° C, or

(viii) 2X or 4X SSC at 50 ° C (moderate conditions), or

(ix) 30 to 40% formamide, 2X or 4X SSC at 42_ (moderate conditions).

(2) washing steps for 10 minutes each with for example

(i) 0.015 M NaCI / 0.0015 M sodium citrate / 0.1% SDS at 50 ° C, or

(ii) 0.1X SSC at 65 ° C, or

(iii) 0.1X SSC, 0.5% SDS at 68 ° C, or

(iv) 0.1X SSC, 0.5% SDS, 50% formamide at 42 ° C, or

(v) 0.2X SSC, 0.1% SDS at 42 ° C, or (vi) 2X SSC at 65 ° C (moderate conditions).

In a preferred embodiment of the method according to the invention, nucleic acids are encoded which encode a protein containing the amino acid sequence SEQ ID NO: 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which have an identity of at least 70% , preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 98%, particularly preferably at least 99% at the amino acid level with the sequence SEQ ID NO: 4 and the enzymatic property has a ketolase.

This can be a natural ketolase sequence, which can be found as described above, by comparing the identity of the sequences from other organisms, or an artificial ketolase sequence which, starting from the sequence SEQ ID NO: 4, can be found by artificial variation, for example by Substitution, insertion or deletion of amino acids has been modified.

In a further preferred embodiment of the method according to the invention, nucleic acids are encoded which encode a protein containing the amino acid sequence SEQ ID NO: 48 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and which have an identity of at least 70%, preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 98%, particularly preferably at least 99% at the amino acid level with the sequence SEQ ID NO: 48 and exhibits enzymatic property of a ketolase.

This can be a natural ketolase sequence which, as described above, can be found by comparing the identity of the sequences from other organisms or an artificial ketolase sequence which can be derived from the sequence SEQ ID NO: 48 by artificial variation , for example by substitution, insertion or deletion of amino acids.

In a further preferred embodiment of the method according to the invention, nucleic acids which encode a protein are introduced, containing the amino acid sequence SEQ ID NO: 58 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 70%, preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 98%, particularly preferably at least 99% at the amino acid level of the sequence SEQ ID NO: 58 and has the enzymatic property of a ketolase.

This can be a natural ketolase sequence which, as described above, can be found by comparing the identity of the sequences from other organisms or an artificial ketolase sequence which, starting from the sequence SEQ ID NO: 58, can be found by artificial variation, for example was modified by substitution, insertion or deletion of amino acids.

In a further preferred embodiment of the method according to the invention, nucleic acids which encode a protein are introduced, comprising the amino acid sequence SEQ ID NO: 60 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 70%, preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 98%, particularly preferably at least 99% at the amino acid level with the sequence SEQ ID NO: 60 and the enzymatic Has property of a ketolase.

This can be a natural ketolase sequence which, as described above, can be found by comparing the identity of the sequences from other organisms or an artificial ketolase sequence which, starting from the sequence SEQ ID NO: 60, can be found by artificial variation, for example was modified by substitution, insertion or deletion of amino acids.

In the description, the term “substitution” is understood to mean the replacement of one or more amino acids by one or more amino acids for all proteins. So-called conservative exchanges are preferably carried out, in which the replaced amino acid has a similar property to the original amino acid, for example replacement of Glu by Asp, Gin by Asn, Val by Ile, Leu by Ile, Ser by Thr.

Deletion is the replacement of an amino acid with a direct link. Preferred positions for deletions are the termini of the polypeptide and the links between the individual protein domains.

Inserts are insertions of amino acids into the polypeptide chain, with a direct bond being formally replaced by one or more amino acids. Identity between two proteins is understood to mean the identity of the amino acids over the respective total protein length, in particular the identity which is obtained by comparison using the Vector NTI Suite 7.1 software from Informax (USA) using the Clustal method (Higgins DG, Sharp PM.Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151-1) is calculated using the following parameters:

Multiple alignment parameters:

Gap opening penalty 10 Gap extension penalty 10

Gap Separation penalty ranks 8th

Gap separation penalty off

% identity for alignment delay 40

Residue specific gaps off Hydrophilic residue gap off

Transition weighing 0

Pairwise alignment parameters:

FAST algorithm on

K-tuplesize 1 gap penalty 3

Window size 5

Number of best diagonals 5

A protein which has an identity of at least 70% at the amino acid level with a specific sequence is accordingly understood to be a protein which, when comparing its sequence with the specific sequence, in particular according to the above program logarithm with the above parameter set, has an identity of at least 70%.

A protein which has, for example, an identity of at least 70% at the amino acid level with the sequence SEQ ID NO: 4 or 48 or 58 or 60 is accordingly understood to be a protein which, when its sequence is compared with the sequence SEQ ID NO: 4 or 48 or 58 or 60, in particular according to the above program logarithm with the above parameter set, has an identity of at least 70%. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

Those codons which are frequently used in accordance with the organism-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other known genes of the organisms in question.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 3 is introduced into the plant.

In a further, particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 48 is introduced into the plant.

In a further, particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 58 is introduced into the plant.

In a further, particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 60 is introduced into the plant.

All of the above-mentioned ketolase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897). The attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press

As mentioned above, the non-human organisms used in the process according to the invention have an altered ketolase activity and an altered β-cyclase activity compared to the wild type, the altered β-cyclase activity being caused by a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has. In one embodiment of the method according to the invention, non-human organisms are used as starting organisms which already have a β-cyclase activity as wild type or starting organism. In this embodiment, the genetic modification brings about an increase in the β-cyclase activity in comparison to the wild type or starting organism, the increased β-cyclase activity being caused by a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

Β-cyclase activity means the enzyme activity of a β-cyclase.

A ß-cyclase is understood to mean a protein which has the enzymatic activity to convert a terminal, linear residue of lycopene into a ß-ionone ring.

In particular, a β-cyclase is understood to be a protein which has the enzymatic activity to convert γ-carotene into β-carotene.

Accordingly, ß-cyclase activity is understood to mean the amount of γ-carotene converted or the amount of ß-carotene formed in a certain time by the protein ß-cyclase.

With an increased ß-cyclase activity compared to the wild type, the amount of lycopene or γ-carotene converted or the amount of γ-carotene formed from lycopene or the formed amount of ß-carotene from γ-carotene increased.

This increase in the β-cyclase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the β- Wild-type cyclase activity.

The determination of the β-cyclase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably carried out under the following conditions:

The activity of the β-cyclase is determined according to Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15) / π vitro. It becomes a certain amount Potassium phosphate as buffer (pH 7.6), lycopene as substrate, paprika stromal protein, NADP +, NADPH and ATP added to organism extract.

The β-cyclase activity is particularly preferably determined under the following conditions according to Bouvier, d'Harlingue and Camara (Molecular Analysis of carotenoid cyclae inhibition; Arch. Biochem. Biophys. 346 (1) (1997) 53-64):

The in vitro assay is carried out in a volume of 250 μl volume. The mixture contains 50 mM potassium phosphate (pH 7.6), different amounts of organism extract, 20 nM lycopene, 250 μg of chromoplastid stromal protein from paprika, 0.2 M NADP +, 0.2 M NADPH and 1 mM ATP. NADP / NADPH and ATP are dissolved in 10 ml ethanol with 1 mg Tween 80 immediately before adding to the incubation medium. After a reaction time of 60 minutes at 30 ° C., the reaction is terminated by adding chloroform / methanol (2: 1). The reaction products extracted in chloroform are analyzed by HPLC.

An alternative assay with a radioactive substrate is described in Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15).

The ß-cyclase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing gene expression compared to the wild type of nucleic acids encoding a ß-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

The increase in the gene expression of the nucleic acids encoding a β-cyclase compared to the wild type can also be achieved in various ways, for example by inducing the β-cyclase gene by activators or by introducing one or more β-cyclase gene copies, ie by introducing at least one nucleic acid encoding a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has in the organism.

By increasing the gene expression of a nucleic acid encoding a β-cyclase, the manipulation of the expression of the organism's own endogenous β-cyclase containing the amino acid sequence SEQ is also carried out according to the invention. ID. NO. 2 or one derived from this sequence by substitution, insertion or deletion of amino acids te sequence that has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has understood.

This can be achieved, for example, by changing the promoter DNA sequence for genes coding for β-cyclases. Such a change, which results in an increased expression rate of the gene, can take place, for example, by deleting or inserting DNA sequences.

As described above, it is possible to change the expression of the endogenous β-cyclase by applying exogenous stimuli. This can take place through special physiological conditions, ie through the application of foreign substances.

Furthermore, an altered or increased expression of an endogenous β-cyclase gene can be achieved in that a regulator protein which does not occur in the non-transformed organism interacts with the promoter of this gene.

Such a regulator can represent a chimeric protein which consists of a DNA binding domain and a transcription activator domain, as described, for example, in WO 96/06166.

In a preferred embodiment, the gene expression of a nucleic acid coding for a β-cyclase is increased by introducing into the organism at least one nucleic acid coding for a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

In this embodiment, at least one further β-cyclase gene is thus present in the transgenic organisms according to the invention compared to the wild type. In this embodiment, the genetically modified organism according to the invention preferably has at least one exogenous (= heterologous) nucleic acid coding for a β-cyclase or at least two endogenous nucleic acids coding for a β-cyclase.

In another preferred embodiment of the method according to the invention, non-human organisms are used as starting organisms which, as a wild type, have no β-cyclase activity. In this, less preferred embodiment, the genetic modification causes the β-cyclase activity in the organisms. The genetically modified organism according to the invention thus has in this, Embodiment compared to the genetically unmodified wild type on a ß-cyclase activity and is therefore preferably able to transgenically express a ß-cyclase.

In this preferred embodiment, the gene expression of a nucleic acid encoding a β-cyclase is caused analogously to the above-described increase in gene expression of a nucleic acid encoding a β-cyclase, preferably by introducing nucleic acids which encode β-cyclase into the starting organism.

In principle, in both embodiments, each β-cyclase gene, that is to say any nucleic acid which encodes a β-cyclase, contains the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has to be used.

In the case of genomic β-cyclase nucleic acid sequences from eukaryotic sources which contain introns, preference is given to the case in which the host organism is unable or unable to express the corresponding β-cyclase to use already processed nucleic acid sequences, such as the corresponding cDNAs.

A particularly preferred β-cyclase is the chromoplast-specific β-cyclase from tomato (AAG21133) (nucleic acid: SEQ ID No. 1; protein: SEQ ID No. 2).

The β-cyclase genes which can be used according to the invention are nucleic acids which encode proteins, containing the amino acid sequence SEQ ID NO: 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and which have an identity of at least 70%, preferably at least 80 %, preferably at least 85%, more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 2, and which have the enzymatic property of a β-cyclase.

Further examples of β-cyclases and β-cyclase genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID NO: 2. Further examples of β-cyclases and β-cyclase genes can also be easily found, for example, starting from the sequence SEQ ID NO: 1 from various organisms whose genomic sequence is not known, using hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the β-cyclase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the β-cyclase of the sequence SEQ ID NO: 2.

Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

Those codons that are frequently used in accordance with the organism-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other, known genes of the organisms in question.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 1 is introduced into the organism.

All of the β-cyclase genes mentioned above can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). The attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In a preferred embodiment, non-human organisms are cultivated which, compared to the wild type, have an altered hydroxylase activity in addition to the altered ketolase activity and altered β-cyclase activity.

In the case that the starting organism or wild type has no hydroxylase activity, an “hydroxylase activity changed compared to the wild type” is preferably understood to mean “hydroxylase activity caused compared to the wild type”. In the case that the starting organism or wild type has a hydroxylase activity, an “hydroxylase activity changed in comparison to the wild type” is preferably understood to mean an “increased hydroxylase activity in comparison to the wild type”.

Accordingly, in a preferred embodiment, non-human organisms are cultivated which, compared to the wild type, have a caused or increased hydroxylase activity in addition to the changed ketolase activity and changed β-cyclase activity.

Hydroxylase activity means the enzyme activity of a hydroxylase.

A hydroxylase is understood to mean a protein which has the enzymatic activity of introducing a hydroxyl group on the optionally substituted β-ionone ring of carotenoids.

In particular, a hydroxylase is understood to mean a protein which has the enzymatic activity to convert β-carotene into zeaxanthin or canthaxanthin into astaxanthin.

Accordingly, hydroxyase activity is understood to mean the amount of β-carotene or canthaxanthin or the amount of zeaxanthin or astaxanthin formed in a certain time by the protein hydroxylase.

With an increased hydroxylase activity compared to the wild type, the amount of β-carotene or cantaxantin or the amount of zeaxanthin or astaxanthin formed is increased in a certain time by the protein hydroxylase compared to the wild type.

This increase in the hydroxylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the hydroxylase activity of the wild type.

The hydroxylase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:

The activity of the hydroxylase is according to Bouvier et al. (Biochim. Biophys. Acta 1391 (1998), 320-328) in vitro. There is a certain amount of organizing Mus extract, ferredoxin, ferredoxin-NADP oxidoreductase, catalase, NADPH and beta-carotene with mono- and digalactosylglycerides added.

The hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, Keller, d'Harlingue and Camara (xanthophyll bio-synthesis: molecular and functional characterization of carotenoid hydroxylases from pepper fruits (Capsicum annuum L; Biochim. Biophys. Acta 1391 (1998), 320-328):

The in vitro assay is carried out in a volume of 0.250 ml volume. The mixture contains 50 mM potassium phosphate (pH 7.6), 0.025 mg ferredoxin from spinach, 0.5 units ferredoxin-NADP + oxidoreductase from spinach, 0.25 mM NADPH, 0.010 mg beta-carotene (emulsified in 0.1 mg Tween 80), 0.05 mM a mixture of mono - and Digalactosylglyceriden (1: 1), 1 unit catalysis,, 0.2 mg bovine serum albumin and organism extract in different volumes. The reaction mixture is incubated at 30 ° C for 2 hours. The reaction products are extracted with organic solvent such as acetone or chloroform / methanol (2: 1) and determined by means of HPLC.

The hydroxylase activity can be increased or caused in various ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing or causing the gene expression of nucleic acids encoding a hydroxylase compared to the wild type.

The increase or causation of the gene expression of the nucleic acids encoding a hydroxylase compared to the wild type can also take place in different ways, for example by inducing the hydroxylase gene, by activators or by introducing one or more hydroxylase gene copies, i.e. by introducing at least one nucleic acid encoding one Hydroxylase in the organism.

Increasing the gene expression of a nucleic acid encoding a hydroxylase also means manipulating the expression of the organism's own endogenous hydroxylase.

This can be achieved, for example, by changing the promoter DNA sequence for genes encoding hydroxylases. Such a change, which results in an increased expression rate of the gene, can take place, for example, by deleting or inserting DNA sequences. As described above, it is possible to change the expression of the endogenous hydroxylase by applying exogenous stimuli. This can take place through special physiological conditions, ie through the application of foreign substances.

Furthermore, a caused or increased expression of an endogenous hydroxylase gene can be achieved in that a regulator protein which does not occur in the non-transformed organism interacts with the promoter of this gene.

In a preferred embodiment, the gene expression of a nucleic acid encoding a hydroxylase is increased or caused by introducing at least one nucleic acid encoding a hydroxylase into the organism.

In principle, any hydroxylase gene, that is to say any nucleic acid which codes for a hydroxylase, can be used for this purpose.

In the case of genomic hydroxylase sequences from eukaryotic sources which contain introns, in the event that the host plant is unable or unable to express the corresponding hydroxylase, nucleic acid sequences which have already been processed, such as the corresponding cDNAs, are preferred use.

Examples of a hydroxylase gene are:

a nucleic acid encoding a hydroxylase from Haematococcus pluvialis, Accession AX038729, WO 0061764); (Nucleic acid: SEQ ID NO: 77, protein: SEQ ID NO: 78),

and hydroxylases of the following accession numbers:

| emb | CAB55626.1, CAA70427.1, CAA70888.1, CAB55625.1, AF499108, AF315289, AF296158, AAC49443.1, NP_194300.1, NP_200070.1, AAG10430.1, CAC06712.1, AAM88619.1, CAC95130 .1, AAL80006.1, AF 162276, AA053295.1, AAN85601.1, CRTZ_ERWHE, CRTZ_PANAN, BAB79605.1, CRTZ_ALCSP, CRTZ_AGRAU, CAB56060.1, ZP_00094836.1, AAC44852.1, BAC77670.1 NP_745389.1, NP_344225.1, NP_849490.1, ZP_00087019.1, NP_503072.1,

NP_852012.1, NP_115929.1, ZP_00013255.1

A particularly preferred hydroxylase is also the hydroxylase from tomato (Accession Y14810) (nucleic acid: SEQ ID NO: 5; protein: SEQ ID NO. 6).

In this preferred embodiment, the preferred transgenic organisms according to the invention therefore have at least one further hydroxylase gene compared to the wild type.

In this preferred embodiment, the genetically modified organism has, for example, at least one exogenous nucleic acid encoding a hydroxylase or at least two endogenous nucleic acids encoding a hydroxylase.

In the preferred embodiment described above, the preferred hydroxylase genes used are nucleic acids encoding proteins containing the amino acid sequence SEQ ID NO: 6 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 70%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 6, and which have the enzymatic property of a hydroxylase.

Further examples of hydroxylases and hydroxylase genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 6.

Further examples of hydroxylases and hydroxylase genes can also be easily found, for example, starting from the sequence SEQ ID NO: 5 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the hydroxylase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the hydroxylase of the sequence SEQ ID NO: 6. Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 5 is introduced into the organism.

All of the above-mentioned hydroxylase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). The attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

Genetically modified non-human organisms which have as starting organisms a .beta.-cyclase activity and no ketolase activity are particularly preferably used, the genetically modified organisms having an increased .beta.-cyclase activity, caused by a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 and have caused ketolase activity.

Genetically modified non-human organisms which have no β-cyclase activity and no ketolase activity as starting organisms are particularly preferably used in the process according to the invention, the genetically modified organisms compared to the wild type having a β-cyclase activity, caused by a ß-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 and has caused ketolase Have activity.

Genetically modified non-human organisms which have a .beta.-cyclase activity and a ketolase activity as starting organisms are particularly preferably used in the process according to the invention, the genetically modified organisms having an increased .beta.-cyclase activity, caused by, in comparison to the wild type a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 and have an increased ketolase activity.

Genetically modified non-human organisms are particularly preferably used in the process according to the invention which have as starting organisms a β-cyclase activity, no ketolase activity and no hydroxylase activity, the genetically modified organisms having an increased β-cyclase activity compared to the wiid type. Activity caused by a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2, have a caused ketolase activity and a caused hydroxylase activity.

Genetically modified non-human organisms are particularly preferably used in the process according to the invention which have as starting organisms a β-cyclase activity, a hydroxylase activity and no ketolase activity, the genetically modified organisms having an increased β-cyclase activity compared to the wild type. Activity caused by a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has an increased hydroxylase activity and a caused ketolase activity.

Genetically modified, non-human organisms which have no β-cyclase activity, no hydroxylase activity and no ketolase activity as starting organisms are particularly preferably used in the process according to the invention, the genetically modified organisms causing a β- Cyclase activity caused by a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has a caused hydroxylase activity and a caused ketolase activity te hydroxylase activity and have caused ketolase activity.

Genetically modified non-human organisms which have a .beta.-cyclase activity, a hydroxylase activity and a ketolase activity as starting organisms are particularly preferably used in the process according to the invention, the genetically modified organisms having an increased .beta.-cyclase compared to the wild type Activity, caused by a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has an increased β-cyclase activity, an increased hydroxylase activity and an increased ketolase activity.

In a further preferred embodiment, genetically modified, non-human organisms are cultivated which, in addition to the wild type, have an increased activity of at least one of the activities selected from the group HMG-CoA reductase activity, (E) -4-hydroxy-3- Methylbut-2-enyl-diphosphate reductase activity, 1 -deoxy-D-xylose-5-phosphate synthase activity, 1 -deoxy-D-xylose-5-phosphate-reductoisomerase activity, isopentenyl-diphosphate-Δ- Isomerase activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity, geranyl geranyl diphosphate synthase activity, phytoene synthase activity, phytoene desaturase activity, zeta-carotene desaturase activity, have crtlSO activity, FtsZ activity and MinD activity.

HMG-CoA reductase activity is understood to mean the enzyme activity of an HMG-CoA reductase (3-hydroxy-3-methyl-glutaryl-coenzyme A reductase).

An HMG-CoA reductase is understood to be a protein which has the enzymatic activity to convert 3-hydroxy-3-methyl-glutaryl-coenzyme-A into mevalonate.

Accordingly, HMG-CoA reductase activity is understood to mean the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme A converted or amount of mevalonate formed in a certain time by the protein HMG-CoA reductase.

If the HMG-CoA reductase activity is increased compared to the wild type, the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme-A or the formed amount of mevalonate increased. This increase in the HMG-CoA reductase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the Wild-type HMG-CoA reductase activity.

The determination of the HMG-CoA reductase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably carried out under the following conditions:

Frozen organism material is homogenized by intensive Mosern in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available organism material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgCI2, 10 mM KCI, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε-aminocaproic acid, 10% glycerin, 5mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added.

The activity of HMG-CoA reductase can be measured according to published descriptions (e.g. Schaller, Grausem, Benveniste, Chye, Tan, Song and Chua, Plant Physiol. 109 (1995), 761-770; Chappell, Wolf, Proulx, Cuellar and Saunders, Plant Physiol. 109 (1995) 1337-1343). Organism tissue can be homogenized and extracted in cold buffer (100 M potassium phosphate (pH 7.0), 4 mM MgCl ₂ , 5 mM DTT). The homogenate is centrifuged at 10,000 g at 4C for 15 minutes. The supernatant is then centrifuged again at 100,000 g for 45-60 minutes. The activity of the HMG-CoA reductase is determined in the supernatant and in the pellet of the microsomal fraction (after resuspending in 100 mM potassium phosphate (pH 7.0) and 50 mM DTT). Aliquots of the solution and the suspension (the protein content of the suspension corresponds to approximately 1-10 μg) are dissolved in 100 mM potassium phosphate buffer (pH 7.0 with 3 mM NADPH and 20 μM ( ⁴ C) HMG-CoA (58 μCi / μM) ideally incubated in a volume of 26 μl for 15-60 minutes at 30 C. The reaction is terminated by adding 5 μl mevalonate lactone (1 mg / ml) and 6 N HCl, after which the mixture is incubated at room temperature for 15 minutes The ( ⁴ C) -evalonate formed in the reaction is quantified by adding 125 μl of a saturated potassium phosphate solution (pH 6.0) and 300 μl of ethyl acetate, the mixture is mixed well and centrifuged, and the radioactivity can be determined by scintillation measurement. Under (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, also called lytB or IspH, the enzyme activity of an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate is -Reductase understood.

An (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase means a protein which has the enzymatic activity, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate in Convert isopentenyl diphosphate and dimethylallyldiphosphate.

Accordingly, under (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity the protein (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate- Reductase converted amount (E) -4-hydroxy-3-methylbut-2-enyl diphosphate or amount formed isopentenyl diphosphate and / or dimethyl allyl diphosphate understood.

With an increased (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity compared to the wild type, the protein (E) -4-hydroxy-3- Methylbut-2-enyl diphosphate reductase increases the amount of (E) -4-hydroxy-3-methylbut-2-enyl diphosphate converted or the amount of isopentenyl diphosphate and / or dimethylallyldiphosphate formed.

This increase in the (E) -4-hydroxy-3-methylbut-2-enyldiphosphate reductase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, more preferably at least 500%, especially at least 600% of the (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity of the wild type.

The (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity is preferably determined in genetically modified, non-human organisms according to the invention and in wild-type or reference organisms under the following conditions:

Frozen organism material is homogenized by intensive Mosern in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available organism material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgCl 2, 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε- Aminocaproic acid, 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF added.

The (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity can be determined by immunological detection. The production of specific antibodies is by Rohdich and colleagues (Rohdich, Hecht, Gärtner, A-dam, Krieger, Amslinger, Arigoni, Bacher and Eisenreich: Studies on the nonmevalonat terpene biosynthetic pathway: metabolic role of IspH (LytB) protein, Natl Acad. Natl. USA 99 (2002), 1158-1163). To determine the catalytic activity, Altincicek and colleagues (Altincicek, Duin, Reichenberg, Hedderich, Kollas, Hintz, Wagner, Wiesner, Beck and Jomaa describe: LytB protein catalyzes the terminal step of the 2-C-methyl-D-erythritol 4-phosphate pathway of isoprenoid biosynthesis; FEBS Letters 532 (2002,) 437-440) an in vitro system which reduces the reduction of (E) -4-hydroxy-3-methyl-but-2-enyl diphosphate into the isopentenyl diphosphate and tracked dimethyl allyl diphosphate.

1-Deoxy-D-xylose-5-phosphate synthase activity means the enzyme activity of a 1-deoxy-D-xylose-5-phosphate synthase activity.

A 1-deoxy-D-xylose-5-phosphate synthase is understood to mean a protein which has the enzymatic activity to convert hydroxyethyl-ThPP and glyceraldehyde-3-phosphate into 1-deoxy-D-xylose-5-phosphate.

Accordingly, 1-deoxy-D-xylose-5-phosphate synthase activity means the amount of hydroxyethyl-ThPP and / or glyceraldehyde converted by the protein 1-deoxy-D-xylose-5-phosphate synthase in a certain time -3-phosphate or the amount of 1-deoxy-D-xylose-5-phosphate formed.

With an increased 1-deoxy-D-xylose-5-phosphate synthase activity compared to the wild type, the protein 1-deoxy-D-xylose-5-phosphate synthase thus converts the amount converted in a certain time compared to the wild type Hydroxyethyl-ThPP and / or glyceraldehyde-3-phosphate or the amount formed -deoxy-D-xylose-5-phosphate increased.

This increase in the 1-deoxy-D-xylose-5-phosphate synthase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600%, of the wild-type 1-deoxy-D-xylose-5-phosphate synthase activity. The determination of the 1-deoxy-D-xylose-5-phosphate synthase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably carried out under the following conditions:

Frozen organism material is homogenized by intensive mortar in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available organism material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgCI2, 10 mM KCI, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε- Aminocaproic acid, 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added.

The reaction solution (50-200 μl) for the determination of the D-1-deoxyxylulose-5-phosphate synthase activity (DXS) consists of 100 mM Tris-HCl (pH 8.0), 3 mM MgCl ₂ , 3 mM MnCl ₂ , 3 mM ATP, 1 mM thiamine diphosphate, 0.1% Tween-60, 1 mM Ka liumfluorid, 30 υM (2- ¹⁴ C) pyruvate (0.5 υCi), 0.6 mM DL-Glyerinaldehyd-3-phosphate. The organism extract is incubated for 1 to 2 hours in the reaction solution at 37C. Then the reaction is stopped by heating at 80C for 3 minutes. After centrifugation at 13,000 revolutions / minute for 5 minutes, the supernatant is evaporated, the rest is resuspended in 50 ul of methanol, applied to a TLC plate for thin layer chromatography (silica gel 60, Merck, Darmstadt) and in N-propyl alcohol / ethyl acetate / Water (6: 1: 3; v / v / v) separated. Radio-labeled D-1-deoxyxylulose-5-phosphate (or D-1-deoxyxylulose) separates from (2- ¹ C) - pyruvate. The quantification is carried out using a scintillation counter. The method was described in Harker and Bramley (FEBS Letters 448 (1999) 115-119). Alternatively, a fluorometric assay to determine the DXS synthase activity of Queol and colleagues has been described (Analytical Biochemistry 296 (2001) 101-105).

1-Deoxy-D-xylose-5-phosphate reductoisomerase activity describes the enzyme activity of a 1-deoxy-D-xylose-5-phosphate reductoisomerase, also called 1-deoxy-D-xylulose-5-phosphate reductoisomerase. Roger that.

A 1-deoxy-D-xylose-5-phosphate reductoisomerase means a protein which has the enzymatic activity, 1-deoxy-D-xylose-5-phosphate in 2-C-methyl-D-erythritol 4-phosphate convert.

Correspondingly, 1-deoxy-D-xyiose-5-phosphate reductoisomerase - activity which is determined in a certain time by the protein 1-deoxy-D-xylose-5-phosphate - Reductoisomerase understood amount of 1-deoxy-D-xylose-5-phosphate or amount of 2-C-methyl-D-erythritol 4-phosphate formed.

With an increased 1-deoxy-D-xylose-5-phosphate-reductoisomerase activity compared to the wild type, the protein 1-deoxy-D-xylose-5-phosphate-reductoisomerase in a certain time compared to the wild type converted amount of 1-deoxy-D-xylose-5-phosphate or the amount of 2-C-methyl-D-erythritol 4-phosphate formed increased.

This increase in 1-deoxy-D-xylose-5-phosphate is preferably

Reductoisomerase activity at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% 1-deoxy-D-xylose-5- Wild-type phosphate reductoisomerase activity.

The determination of the 1-deoxy-D-xylose-5-phosphate reductoisomerase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably carried out under the following conditions:

Frozen organism material is homogenized by intensive mortar in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available organism material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgCl 2, 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε-aminocaproic acid, 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added.

The activity of D-1-deoxyxylulose-5-phosphate reductoisomerase (DXR) is measured in a buffer of 100 mM Tris-HCl (pH 7.5), 1 mM MnCl ₂ , 0.3 mM NADPH and 0.3 mM 1-Deoxy-D-xylulose-4-phosphate, which can be synthesized, for example, enzymatically (Kuzuyama, Takahashi, Watanabe and Seto: Tetrahedon letters 39 (1998) 4509-4512). The reaction is started by adding the organism extract. The reaction volume can typically be 0.2 to 0.5 mL; incubation takes place at 37C for 30-60 minutes. During this time, the oxidation of NADPH is monitored photometrically at 340 nm. Isopentenyl diphosphate Δ isomerase activity is understood to mean the enzyme activity of an isopentenyl diphosphate Δ isomerase.

An isopentenyl diphosphate Δ isomerase is understood to mean a protein which has the enzymatic activity to convert isopentenyl diphosphate to dimethylallyl phosphate.

Accordingly, isopentenyl-diphosphate-Δ-isomerase activity is understood to mean the amount of isopentenyl-diphosphate or amount of dimethylallylphosphate formed in a certain time by the protein isopentenyl-diphosphate-D-Δ-isomerase.

If the isopentenyl-diphosphate-Δ-isomerase activity is higher than that of the wild type, the protein isopentenyl-diphosphate-Δ-isomerase increases the amount of isopentenyl-diphosphate or the amount of dimethylallylphosphate formed in a certain time compared to the wild type.

This increase in the isopentenyl diphosphate Δ-isomerase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of wild type isopentenyl diphosphate Δ isomerase activity.

The determination of the isopentenyl-diphosphate-Δ-isomerase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably carried out under the following conditions:

Frozen organism material is homogenized by intensive mortaring in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available organism material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgCl 2, 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε-aminocaproic acid, 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added.

Activity determinations of isopentenyl diphosphate isomerase (IPP isomerase) can be carried out using the method presented by Fräser and colleagues (Fräser, Römer, Shipton, Mills, Kiano, Misawa, Drake, Schuch and Bramley: Evaluation of transgenic tomato plants expressing an additional phytoene synthase in a fruit-specific manner; Proc. Natl. Acad. Be. USA 99 (2002), 1092-1097, based on milling cutters, Pinto, Holloway and Bramley, Plant Journal 24 (2000), 551-558). For enzyme assays, incubations with 0.5 υCi (1- ¹⁴ C) IPP (isopentenyl pyrophosphate) (56 mCi / mmol, Amersham pic) as substrate in 0.4 M Tris-HCl (pH 8.0) containing 1 mM DTT, 4 mM MgCl ₂ , 6 mM Mn Cl ₂ , 3 mM ATP, 0.1% Tween 60, 1 mM potassium fluoride in a volume of about 150-500 ul. Extracts are mixed with buffer (eg in a ratio of 1: 1) and incubated for at least 5 hours at 28 ° C. Then about 200 μl of methanol is added and, by adding concentrated hydrochloric acid (final concentration 25%), acid hydrolysis is carried out at 37 ° C. for about 1 hour. This is followed by a double extraction (500 μl each) with petroleum ether (mixed with 10% diethyl ether). The radioactivity in an aliquot of the hyperphase is determined using a scintillation counter. The specific enzyme activity can be determined with a short incubation of 5 minutes, since short reaction times suppress the formation of reaction by-products (see Lützow and Beyer: The isopentenyl-diphosphate Δ-isomerase and its relation to the phytoene synthase complex in daffodil chromoplasts; Biochim. Biophys. Acta 959 (1988) 118-126)

Geranyl diphosphate synthase activity means the enzyme activity of a geranyl diphosphate synthase.

A geranyl diphosphate synthase is understood to mean a protein which has the enzymatic activity to convert isopentenyl diphosphate and dimethylallyl phosphate to geranyl diphosphate.

Accordingly, geranyl diphosphate synthase activity means the amount of isopentenyl diphosphate and / or dimethylallyl phosphate or amount of geranyl diphosphate formed in a certain time by the protein geranyl diphosphate synthase.

If the geranyl diphosphate synthase activity is higher than that of the wild type, the amount of isopentenyl diphosphate and / or dimethylallyl phosphate or the amount of geranyl diphosphate formed is increased by the protein geranyl diphosphate synthase in a certain time compared to the wild type ,

This increase in geranyl diphosphate synthase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% the geranyl Wild-type diphosphate synthase activity.

The geranyl diphosphate synthase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:

Frozen organism material is homogenized by intensive mortar in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available organism material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 M HEPES-KOH (pH 7.4), 10 mM MgCI2, 10 mM KCI, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε- Aminocaproic acid, 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added.

The activity of geranyl diphosphate synthase (GPP synthase) can be found in 50 mM Tris-HCl (pH 7.6), 10 mM MgCl ₂ , 5 mM MnCl ₂ , 2 mM DTT, 1 mM ATP, 0.2% Tween-20.5 μM ( ^14C ) IPP and 50 μM DMAPP (dimethylallyl pyrophosphate) can be determined after adding organism extract (according to Bouvier, Suire, d'Harlingue, Backhaus and Camara: Meolcular cloning of geranyl diphosphate synthase and compartmentation of monoterpene synthesis in plant cells, plant Journal 24 (2000) 241-252). After incubation of, for example, 2 hours at 37 ° C., the reaction products are dephosphyrylated (according to Koyama, Fuji and Ogura: Enzymatic hydrolysis of polyprenyl pyrophosphats, Methods Enzymol. 110 (1985), 153-155) and analyzed by means of thin layer chromatography and measurement of the incorporated radioactivity (Dogbo, Bardat, Quennemet and Camara: Metabolism of plastid terpenoids: In vitrp inhibition of phytoene synthesis by phenethyl pyrophosphate derivates, FEBS Letters 219 (1987) 211-215).

Farnesyl diphosphate synthase activity means the enzyme activity of a farnesyl diphosphate synthase.

A famesyl diphosphate synthase is understood to mean a protein which has the enzymatic activity to sequentially convert 2 molecular sopentenyl diphosphate with dimethyl allyl diphosphate and the resulting geranyl diphosphate into farnesyl diphosphate.

Accordingly, the amount of dimethylallyl diphosphate and / or isopentenyl diphosphate or the amount formed in a certain time by famesyl diphosphate synthase activity is converted by the protein famesyl diphosphate synthase Farnesyl diphosphate understood.

With an increased famesyl diphosphate synthase activity compared to the wild type, the converted amount of dimethylallyl diphosphate and / or isopentenyl diphosphate or the amount formed is thus in a certain time compared to the wild type by the protein farnesyl diphosphate synthase Farnesyl diphosphate increased.

This increase in the famesyl diphosphate synthase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the Wild-type farnesyl diphosphate synthase activity.

The determination of the farnesyl diphosphate synthase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably carried out under the following conditions:

Frozen organism material is homogenized by intensive mortar in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available organism material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgCI2, 10 mM KCI, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε- Aminocaproic acid, 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 M PMSF are added.

The activity of franesyl pyrophosphate snthase (FPP synthase) can be determined according to a protocol by Joly and Edwards (Journal of Biological Chemistry 268 (1993), 26983-26989). The enzyme activity is then measured in a buffer of 10 mM HEPES (pH 7.2), 1 mM MgCl ₂ , 1 mM dithiothreitol, 20 μM geranyl pyrophosphate and 40 μM (1- ⁴ C) isopentenyl pyrophosphate (4 Ci / mmol). The reaction mixture is incubated at 37 ° C; the reaction is stopped by adding 2.5 N HCl (in 70% ethanol with 19 μg / ml Famesol). The reaction products are thus hydrolyzed within 30 minutes by acid hydrolysis at 37C. The mixture is neutralized by adding 10% NaOH and extracted with hexane. An aliquot of the hexane phase can be measured using a scintillation counter to determine the built-in radioactivity. Alternatively, after incubation of organism extract and radioactively labeled IPP, the reaction products can be separated into benzene / methanol (9: 1) by means of thin layer chromatography (silica gel SE60, Merck). Radioactively labeled products are eluted and the radioactivity determined (according to Gaffe, Bru, Causse, Vidal, Stamitti-Bert, Carde and Gallusci: LEFPS1, a tomato farnesyl pyrophosphate gene highly expressed during early fruit development; Plant Physiology 123 (2000) 1351 -1362).

Geranyl-geranyl diphosphate synthase activity is understood to mean the enzyme activity of a geranyl-geranyl diphosphate synthase.

A geranyl-geranyl diphosphate synthase is understood to mean a protein which has the enzymatic activity to convert farnesyl diphosphate and isopentenyl diphosphate into geranyl-geranyl diphosphate. Accordingly, geranyl-geranyl diphosphate synthase activity is understood to mean the amount of farnesyl diphosphate and / or isopentenyl diphosphate or the amount of geranyl-geranyl diphosphate formed in a certain time by the protein geranyl-geranyl diphosphate synthase. If the geranyl-geranyl-diphosphate synthase activity is higher than that of the wild type, the amount of farnesyl diphosphate and / or isopentenyl diphosphate or the formed amount of geranyl-geranyl diphosphate increased.

This increase in geranyl-geranyl diphosphate synthase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600 % of wild type geranyl-geranyl ~ piphosphate synthase activity.

The geranyl-geranyl-diphosphate synthase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:

Frozen organism material is homogenized by intensive mortar in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available organism material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the Extraction buffers consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgCI2, 10 mM KCI, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε-aminocaproic acid , 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added.

Activity measurements of geranylgeranyl pyrophosphate synthase (GGPP synthase) can be carried out by the method described by Dogbo and Camara (in Biochim. Biophys. Acta 920 (1987), 140-148: Purification of isopentenyl pyrophosphate isomerase and geranylgeranyl pyrophosphate synthase from Capsicochrome chromoplasts by affinity ) can be determined. For this purpose, a buffer (50 mM Tris-HCl (pH 7.6), 2 mM MgCl _2, 1 mM MnCl _2, 2 mM dithiothreitol, (1- ¹⁴ C) IPP (0.1 is υCi, 10 "M), 15 ": M DMAPP, GPP or FPP) with a total volume of about 200 ul of organism extract. Incubation can be for 1-2 hours (or longer) at 30C. The reaction is carried out by adding 0.5 ml of ethanol and 0.1 ml of 6N HCl. After incubation at 37 ° C. for 10 minutes, the reaction mixture is neutralized with 6N NaOH, mixed with 1 ml of water and extracted with 4 ml of diethyl ether. The amount of radioactivity is determined in an aliquot (for example 0.2 ml) of the ether phase by means of scintillation counting. Alternatively, after acid hydrolysis, the radioactively labeled prenyl alcohols can be shaken out in ether and HPLC (25 cm column Spherisorb ODS-1, 5μm; elution with methanol / water (90:10; v / v) at a flow rate of 1 ml / min) are separated and quantified using a radioactivity monitor (according to Wiedemann, Misawa and Sandmann: Purification and enzymatic characterization of the geranylgeranyl pyrophosphate synthase from Erwinia uredovora after expression in Escherichia coli; Archives Biochemistry and Biophysics 306 (1993), 152-157 ).

Phytoene synthase activity means the enzyme activity of a phytoene synthase.

In particular, a phytoene synthase is understood to mean a protein which has the enzymatic activity of converting geranyl-geranyl diphosphate into phytoene.

Accordingly, phytoene synthase activity is understood to mean the amount of geranyl-geranyl diphosphate or amount of phytoene formed in a certain time by the protein phytoene synthase.

With an increased phytoene synthase activity compared to the wild type, the amount of geranyl-geranyl diphosphate or the amount of phytoene formed is increased in a certain time by the protein phytoene synthase compared to the wild type. This increase in phytoene synthase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the phytoene Wild-type synthase activity.

The phytoene synthase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:

Activity determinations of phytoene synthase (PSY) can be carried out using the method presented by Fräser and colleagues (Fräser, Romer, Shipton, Mills, Kiano, Misawa, Drake, Schuch and Bramley: Evaluation of transgenic tomato plants expressing an additional phytoene synthase in a fruit- specific manner; Proc. Natl. Acad. Sci. USA 99 (2002), 1092-1097, based on Fraser, Pinto, Holloway and Bramley, Plant Journal 24

(2000) 551-558). For enzyme measurements, incubations with ( ³ H) geranylgeranyl pyrophosphate (15 mCi / mM, American Radiolabeled Chemicals, St. Louis) as a substrate in 0.4 M Tris-HCl (pH 8.0) with 1 mM DTT, 4 mM MgCl ₂ , 6 mM Mn Cl ₂ , 3 mM ATP, 0.1% Tween 60, 1 mM potassium fluoride. Organism extracts are mixed with buffer, eg 295 ul buffer with extract in a total volume of 500 ul. Incubate for at least 5 hours at 28C. Then phytoene is extracted by shaking twice (500 ol each) with chloroform. The radioactively labeled phytoene formed during the reaction is separated by thin layer chromatography on silica plates in methanol / water (95: 5; v / v). Phytoene can be identified on the silica plates in an iodine-enriched atmosphere (by heating fewer iodine crystals). A phytoene standard serves as a reference. The amount of radioactively labeled product is determined by measurement in a scintillation counter. Alternatively, phytoene can also be quantified using HPLC, which is equipped with a radioactivity detector (Fräser, Albrecht and Sandmann: Development of high performance liquid chromatography systems for the separation of radiolabeled carotenes and precursors formed in specific enzymatic reactions; J. Chromatogr. 645 (1993) 265-272).

Phytoene desaturase activity means the enzyme activity of a phytoene desaturase.

A phytoene desaturase is understood to mean a protein which has the enzymatic activity to convert phytoene into phytofluene and / or phytofluene into ζ-carotene (zeta-carotene).

Accordingly, phytoene desaturase activity is understood to mean the amount of phytoene or phytofluene or amount of phytofluene or ζ-caotin converted in a certain time by the protein phytoene desaturase.

With an increased phytoene desaturase activity compared to the wild type, the amount of phytoene or phytofluene or the amount of phytofluen or bzw.-carotene formed is increased in a certain time by the protein phytoen desaturase compared to the wild type.

This increase in phytoene desaturase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the phytoene Wild-type desaturase activity.

The phytoene desaturase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:

Frozen organism material is homogenized by intensive mortar in liquid nitrogen and extracted with extraction buffer in a ratio of 1: 1 to 1:20. The respective ratio depends on the enzyme activities in the available organism material, so that a determination and quantification of the enzyme activities within the linear measuring range is possible. Typically, the extraction buffer can consist of 50 mM HEPES-KOH (pH 7.4), 10 mM MgCl 2, 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 0.1% (v / v) Triton X-100, 2 mM ε-aminocaproic acid, 10% glycerin, 5 mM KHC03. Shortly before the extraction, 2 mM DTT and 0.5 mM PMSF are added. The activity of phytoene desaturase (PDS) can be measured by incorporating radioactively labeled ( ¹⁴ C) phytoene in unsaturated carotenes (according to Römer, Fraser, Kiano, Shipton, Misawa, Schuch and Bramley: Elevation of the provitamin A content of transgenic tomato plants; Nature Biotechnology 18 (2000) 666-669). Radioactive labeled phytoenes can be synthesized according to Fräser (Fräser, De la Rivas, Mackenzie, Bramley: Phycomyces blakesleanus CarB mutants: their use in assays of phytoene desaturase; Phytochemistry 30 (1991), 3971-3976). Membranes of plastids of the target tissue can be incubated with 100 mM MES buffer (pH 6.0) with 10 mM MgCl ₂ and 1 mM dithiothreitol in a total volume of 1 mL. ( ⁴ C) -Phytoene dissolved in acetone (about 100,000 decays / minute for one incubation each) is added, the acetone concentration not exceeding 5% (v / v). This mixture is incubated at 28C for about 6 to 7 hours in the dark with shaking. Then pigments are extracted three times with about 5 mL petroleum ether (mixed with 10% diethyl ether) and separated and quantified by HPLC.

Alternatively, the activity of phytoene desaturase according to Fräser et al. (Fräser, Misawa, Linden, Yamano, Kobayashi and Sandmann: Expression in Escherichia coli, purification, and reactivation of the recombinant Erwinia uredovora phytoene desaturase, Journal of Biological Chemistry 267 (1992), 19891-9895).

Zeta-carotene desaturase activity means the enzyme activity of a zeta-carotene desaturase.

A zeta-carotene desaturase is understood to mean a protein which has the enzymatic activity to convert ζ-carotene into neurosporin and / or neurosporin into lycopene.

Accordingly, zeta-carotene desaturase activity means the amount of ζ-carotene or neurosporin or the amount of neurosporin or lycopene formed in a certain time by the protein zeta-carotene desaturase.

If the zeta-carotene desaturase activity is increased compared to the wild type, the amount of ζ-carotene or neurosporin or the amount of neurosporin or lycopene formed is increased in a certain time by the protein zeta-carotene desaturase compared to the wild type ,

This increase in zeta-carotene desaturase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 00%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the Zeta-carotene desaturase - Wild type activity.

The zeta-carotene desaturase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:

Analyzes to determine the ξ-carotene desaturase (ZDS desaturase) can be carried out in 0.2 M potassium phosphate (pH 7.8, buffer volume of about 1 ml). The analysis method was developed by Breitenbach and colleagues (Breitenbach, Kuntz, Takaichi and Sandmann: Catalytic properties of an expressed and purified higher plant type ξ-carotene desaturase from Capsicum annuum; European Journal of Biochemistry. 265 (1): 376-383 , 1999). Each analysis batch contains 3 mg phosphytidylcholine, which is suspended in 0.4 M potassium phosphate buffer (pH 7.8), 5 µg ξ-carotene or neurosporin, 0.02% butylhydroxytoluene, 10 µl decyl plastoquinone (1 mM methanolic see Stock solution) and organism extract. The volume of the organism extract must be adjusted to the amount of ZDS desaturase activity present in order to enable quantifications in a linear measuring range. Incubations typically take place for about 17 hours with vigorous shaking (200 revolutions / minute) at about 28 ° C in the dark. Carotenoids are extracted by adding 4 ml acetone at 50 ° C for 10 minutes while shaking. The carotenoids are transferred from this mixture to a petroleum ether phase (with 10% diethyl ether). The ethyl ether / petroleum ether phase is evaporated under nitrogen, the carotenoids redissolved in 20 ul and separated and quantified by HPLC.

CrtlSO activity means the enzyme activity of a crtlSO protein.

A crtlSO protein is understood to mean a protein which has the enzymatic activity of converting 7,9,7 ', 9'-tetra-cis-lycopene into all-trans-lycopene. Accordingly, crtlSO activity is understood to mean the amount of 7,9,7 ', 9'-tetra-cis-lycopene or amount of all-trans-lycopene formed in a certain time by the crtlSO protein.

If crtlSO activity is higher than that of the wild type, the amount of 7,9,7 ', 9'-tetra-cis-lycopene converted or the amount of all-trans formed by the crtlSO protein is reduced in a certain time compared to the wild type - Lycopene increased.

This increase in crtlSO activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the crtlSO- Wild type activity.

FtsZ activity is understood to mean the physiological activity of an FtsZ protein.

An FtsZ protein is understood to be a protein which has a cell division and plastid division promoting effect and has homologies to tubulin proteins.

MinD activity is understood to mean the physiological activity of a MinD protein.

A MinD protein is understood to be a protein that has a multifunctional role in cell division. It is a membrane-associated ATPase and can show an oscillating movement from pole to pole within the cell.

Furthermore, increasing the activity of enzymes in the non-mevalonate pathway can lead to a further increase in the desired ketocarotenoid end product. Examples of this are the 4-diphosphocytidyl-2-C-methyl-D-erythritol synthase, the 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase and the 2-C-methyl-D-erythritol kinase 2,4-cyclodiphoshate synthase. The activity of the enzymes mentioned can be increased by changing the gene expression of the corresponding genes. The changed concentrations of the relevant proteins can be detected using antibodies and corresponding blotting techniques as standard.

The increase in HMG-CoA reductase activity and / or (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity and / or 1-deoxy-D-xylose-5-phosphate

Synthase activity and / or 1-deoxy-D-xylose-5-phosphate reductoisomerase activity and / or isopentenyl diphosphate Δ isomerase activity and / or geranyl diphosphate synthase activity and / or famesyl diphosphate Synthase activity and / or geranylgeranyl diphosphate synthase activity and / or phytoene synthase activity and / or phytoene desaturase activity and / or zeta-carotene desaturase activity and / or crtlSO activity and / or FtsZ activity and / or MinD activity can take place in various ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing the gene expression of nucleic acids encoding an HMG-CoA reductase and / or nucleic acids encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or nucleic acids encoding a 1-deoxy-D-xylose-5-phosphate synthase and / or nucleic acids encoding a 1-deoxy D-xylose-5-phosphate reductoisomerase and / or nucleic acids encoding an isopentenyl diphosphate Δ isomerase and / or nucleic acids encoding a geranyl diphosphate synthase and / or nucleic acids encoding a farnesyl diphosphate synthase and / or nucleic acids encoding a geranyl-geranyl diphosphate synthase and / or nucleic acids encoding a phytoene synthase and / or nucleic acids encoding a phytoene desaturase and / or nucleic acids encoding a cell ta-carotene desaturase and / or nucleic acids encoding a crtlSO protein and / or nucleic acids encoding an FtsZ protein and / or nucleic acids encoding a MinD protein compared to the wild type.

The increase in the gene expression of the nucleic acids encoding an HMG-CoA reductase and / or nucleic acids encoding an (E) -4-hydroxy-3-methylbut-2-enyldiphosphate reductase and / or nucleic acids encoding a 1 -deoxy-D- Xylose-5-phosphate synthase and / or nucleic acids encoding a 1-deoxy-D-xylose-5-phosphate reductoisomerase and / or nucleic acids encoding an isopentenyl-diphosphate-Δ-isomerase and / or nucleic acids encoding a geranyl-diphosphate synthase and / or nucleic acids encoding a farnesyl diphosphate synthase and / or nucleic acids encoding a geranyl-geranyl diphosphate synthase and / or nucleic acids encoding a phytoene synthase and / or nucleic acids encoding a phytoene desaturase and / or nucleic acids encoding a zeta Carotene desaturase and / or nucleic acids encoding a crtlSO protein and / or nucleic acids encoding an FtsZ protein and / or nucleic acids encoding a MinD protein compared to the wild type can also by different routes, for example by inducing the HMG-CoA reductase gene and / or (E) -4-

Hydroxy-3-methylbut-2-enyl-diphosphate reductase gene and / or 1-deoxy-D-xylose 5-phosphate synthase gene and / or 1-deoxy-D-xylose-5-phosphate reductoisomerase Gene and / or isopentenyl diphosphate Δ isomerase gene and / or geranyl diphosphate synthase gene and / or farnesyl diphosphate synthase gene and / or geranyl geranyl diphosphate synthase gene and / or phy- toen synthase gene and / or phytoene desaturase gene and / or zeta-carotene desaturase gene and / or crtlSO gene and / or FtsZ gene and / or MinD gene by activators or by introducing one or more Copies of the HMG-CoA reductase gene and / or (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase gene and / or 1-deoxy-D-xylose-5-phosphate synthase- Gene and / or 1- Deoxy-D-xylose-5-phosphate reductoisomerase gene and / or isopentenyl diphosphate Δ isomerase gene and / or geranyl diphosphate synthase gene and / or famesyl diphosphate synthase gene and / or geranyl geranyl diphosphate synthase gene and / or phytoene synthase gene and / or phytoene desaturase gene and / or zeta-carotene desaturase gene and / or crtlSO gene and / or FtsZ gene and / or MinD- Gene, ie by introducing at least one nucleic acid encoding an HMG-CoA reductase and / or at least one nucleic acid encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or at least one nucleic acid 1-deoxy-D-xylose-5-phosphate synthase and / or at least one nucleic acid encoding a 1-deoxy-D-xylose-5-phosphate

Reductoisomerase and / or at least one nucleic acid encoding an isopentyl diphosphate Δ isomerase and / or at least one nucleic acid encoding a geranyl diphosphate synthase and / or at least one nucleic acid encoding a farnesyl diphosphate synthase and / or at least one nucleic acid encoding a geranyl-geranyl diphosphate synthase and / or at least one nucleic acid encoding a phytoene synthase and / or at least one nucleic acid encoding a phytoene desaturase and / or at least one nucleic acid encoding a zeta-carotene desaturase and / or at least one nucleic acid encoding a crtlSO protein and / or at least one nucleic acid encoding an FtsZ protein and / or encoding at least one nucleic acid a MinD protein into the plant.

Increasing the gene expression of a nucleic acid encoding an HMG-CoA reductase and / or (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or 1-deoxy-D-xylose-5-phosphate Synthase and / or 1-deoxy-D-xylose-5-phosphate reductoisomerase and / or isopentenyl diphosphate Δ isomerase and / or geranyl diphosphate synthase and / or farnesyl diphosphate synthase and / or geranyl Geranyl diphosphate synthase and / or phytoene synthase and / or phytoene desaturase and / or zeta-carotene desaturase and / or a crtlSO protein and / or FtsZ protein and / or MinD protein is also the manipulation of the invention Expression of the organism's own endogenous HMG-CoA reductase and / or (E) - 4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or 1-deoxy-D-xylose-5-phosphate synthase and / or 1-deoxy-D-xylose-5-phosphate reductoisomerase and / or isopentenyl diphosphate Δ isomerase and / or geranyl diphosphate synthase and / or farnesyl diphosphate synthase and / or geranyl-gera nyl diphosphate synthase and / or phytoene synthase and / or phytoene desaturase and / or zeta-carotene desaturase and / or the organism's own crtlSO protein and / or FtsZ protein and / or MinD protein understood.

This can be achieved, for example, by changing the corresponding promoter DNA sequence. Such a change, which is an increased expression rate of the gene can result, for example, by deletion or insertion of DNA sequences.

In a preferred embodiment, the gene expression of a nucleic acid encoding an HMG-CoA reductase is increased and / or the gene expression of a nucleic acid encoding an (E) -4-hydroxy-3-methylbut-2-enyldiphosphate reductase and / or is increased. or increasing the gene expression of a nucleic acid encoding a 1-deoxy-D-xylose-5-phosphate synthase and / or increasing the gene expression of a nucleic acid encoding a 1-deoxy-D-xylose-5-phosphate reductoisomerase and / or the Increasing the gene expression of a nucleic acid encoding an isopentenyl diphosphate Δ isomerase and / or increasing the gene expression of a nucleic acid encoding a geranyl diphosphate synthase and / or increasing the gene expression of a nucleic acid encoding a farnesyl diphosphate synthase and / or the Increasing the gene expression of a nucleic acid encoding a geranylgeranyl diphosphate synthase and / or increasing the gene expression encoding a nucleic acid and a phytoene synthase and / or the increase in gene expression of a nucleic acid encoding a phytoene desaturase and / or the increase in gene expression of a nucleic acid encoding a zeta-carotene desaturase and / or the increase in gene expression of a nucleic acid encoding a crtlSO protein and / or the increase in the gene expression of a nucleic acid encoding an FtsZ protein and / or the increase in the gene expression of a nucleic acid encoding a MinD protein by introducing at least one nucleic acid encoding an HMG-CoA reductase and / or by introducing at least one nucleic acid an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or by introducing at least one nucleic acid encoding a 1-deoxy-D-

Xylose-5-phosphate synthase and / or a 1-deoxy-D-xylose-5-phosphate reductoisomerase and / or by introduction of at least one nucleic acid encoding an isopentenyl-diphosphate-Δ- by introducing at least one nucleic acid Isomerase and / or by introducing at least one nucleic acid encoding a geranyl diphosphate synthase and / or by introducing at least one nucleic acid encoding a farnesyl diphosphate synthase and / or by introducing at least one nucleic acid encoding a geranyl geranyl diphosphate Synthase and / or by introducing at least one nucleic acid encoding a phytoene synthase and / or by introducing at least one nucleic acid encoding a phytoene desaturase and / or by introducing at least one nucleic acid encoding a zeta-carotene desaturase and / or by introducing at least one nucleic acid encoding a crtlSO protein and / or by introducing at least one at least one nucleic acid encoding an FtsZ protein and / or by introducing at least at least one nucleic acid encoding a MinD protein into the plant.

In principle, any HMG-CoA reductase gene or (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase gene or 1 -deoxy-D-xylose-5-phosphate synthase- Gene or 1-deoxy-D-xylose

5-phosphate reductoisomerase gene or isopentenyl diphosphate Δ isomerase gene or geranyl diphosphate synthase gene or farnesyl diphosphate synthase gene or geranyl geranyl diphosphate synthase gene or phytoen - Synthase gene or phytoene desaturase gene or zeta-carotene desaturase gene or crtlSO gene or FtsZ gene or MinD gene can be used.

For genomic HMG-CoA reductase sequences or (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase sequences or 1-deoxy-D xylose-5-phosphate synthase sequences or 1 -deoxy-D-xylose- 5-phosphate reductoisomerase sequences or isopentenyl diphosphate Δ isomerase sequences or geranyl diphosphate synthase sequences or farnesyl diphosphate synthase sequences or geranyl geranyl Diphosphate synthase sequences or phytoene synthase sequences or phytoene desaturase sequences or zeta-carotene desaturase sequences or crtlSO sequences or FtsZ sequences or MinD sequences from eukaryotic sources which contain introns In the event that the host plant is unable or unable to express the corresponding proteins, it is preferable to use nucleic acid sequences that have already been processed, such as the corresponding cDNAs.

In this preferred embodiment, the preferred transgenic organisms according to the invention therefore have at least one further HMG-CoA reductase gene and / or (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase gene and compared to the wild type / or 1-deoxy-D-xylose-5-phosphate synthase gene and / or 1-deoxy-D-xylose-5-phosphate reductoisomerase gene and / or isopentenyl-diphosphate-Δ-isomerase gene and / or Geranyl diphosphate synthase gene and / or famesyl diphosphate synthase gene and / or geranyl geranyl diphosphate synthase gene and / or phytoene synthase gene and / or phytoene desaturase gene and / or zeta Carotene desaturase gene and / or crtlSO gene and / or FtsZ gene and / or MinD gene.

In this preferred embodiment, the genetically modified plant has, for example, at least one exogenous nucleic acid encoding an HMG-CoA reductase or at least two endogenous nucleic acids encoding an HMG-CoA reductase and / or at least one exogenous nucleic acid encoding an (E) -4 - Hydroxy-3-methylbut-2-enyl-diphosphate reductase or at least two endogenous Nucleic acids encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase and / or at least one exogenous nucleic acid encoding a 1-deoxy-D-xylose-5-phosphate synthase or at least two endogenous Nucleic acids encoding a 1-deoxy-D-xylose-5-phosphate synthase and / or at least one exogenous nucleic acid encoding a 1-deoxy-D-xylose-5-phosphate reductoisomerase or at least two endogenous nucleic acids encoding a 1 - Deoxy-D-xylose-5-phosphate reductoisomerase and / or at least one exogenous nucleic acid encoding an isopentenyl diphosphate Δ isomerase or at least two endogenous nucleic acids encoding an isopentenyl diphosphate Δ isomerase and / or at least one exogenous nucleic acid encoding a geranyl diphosphate synthase or at least two endogenous nucleic acids encoding a geranyl diphosphate synthase and / or at least one exogenous nucleic acid encoding a farnesyl diphosphate synthase or at least two endogenous ne nucleic acids encoding a farnesyl diphosphate synthase and / or at least one exogenous nucleic acid, encoding a geranyl geranyl diphosphate synthase or at least two endogenous nucleic acids, encoding a geranyl geranyl diphosphate synthase and / or at least one exogenous nucleic acid, encoding a phytoene synthase or at least two endogenous nucleic acids, encoding a phytoene synthase and / or at least one exogenous nucleic acid, encoding a phytoene desaturase or at least two endogenous nucleic acids, encoding a phytoene desaturase and / or at least one exogenous nucleic acid, encoding a zeta-carotene desaturase or at least two endogenous nucleic acids, encoding a zeta-carotene desaturase and / or at least one exogenous nucleic acid, encoding a crtlSO protein or at least two endogenous nucleic acids, encoding a crtlSO protein and / or at least an exogenous nucleic acid encoding an FtsZ protein or at least between an endogenous nucleic acid encoding an FtsZ protein and / or at least one exogenous nucleic acid encoding a MinD protein or at least two endogenous nucleic acids encoding a MinD protein.

Examples of HMG-CoA reductase genes are:

A nucleic acid encoding an Arabidopsis thaliana HMG-CoA reductase, Accession NM_106299; (Nucleic acid: SEQ ID NO: 7, protein: SEQ ID NO: 8),

as well as other HMG-CoA reductase genes from other organisms with the following accession numbers:

P54961, P54870, P54868, P54869, 002734, P22791, P54873, P54871, P23228, P13704, P54872, Q01581, P17425, P54874, P54839, P14891, P34135, 064966, P29057, P480436, P480436, P480436, P480196, P48043, P480196 064967, P29058, P48022, Q41437, P12684, Q00583, Q9XHL5, Q41438, Q9YAS4, 076819, 028538, Q9Y7D2, P54960, 051628, P48021, Q03163, P00347, P14773, Q12577, Q59468, P0946202, Q0946202, P0406202, P0405806, Q05405, Q05405, Q05405, Q05405, Q05405, Q05405, Q05405, Q05605 Q12649, 074164, 059469, P51639, Q10283, 008424, P20715, P13703, P13702, Q96UG4, Q8SQZ9, 015,888, Q9TUM4, P93514, Q39628, P93081, P93080, Q944T9, Q40148, Q84MM0, Q84LS3, Q9Z9N4, Q9KLM0

Examples of (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase genes are:

A nucleic acid encoding an (E) -4-hydroxy-3-methylbut-

2-enyl diphosphate reductase from Arabidopsis thaliana (lytB / ISPH), ACCESSION AY168881, (nucleic acid: SEQ ID NO: 9, protein: SEQ ID NO: 102),

as well as other (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase genes from other organisms with the following accession numbers:

T04781, AF270978_1, NP_485028.1, NP_442089.1, NP_681832.1, ZP_00110421.1, ZP_00071594.1, ZP_00114706.1, ISPH_SYNY3, ZP_00114087.1, ZP_00104269.1, AF398146_1, AF398146A, AF398146A, AF398146, AF398146, AF398146, AF398146, AF398146, AF398146, AF398146.1, AF398146, AF398146.1, AF398146, AF398146, AF398146.1, AF398146, AF398146.1, AF398146.1, AF398146, AF398146.1, AF398146, AF398146, AF398146.1, AF398146.1, AF398146.1, AF398146, AF398146.143 1, NP_348471.1, NP_562001.1, NP_223698.1, NP_781941.1, ZP_00080042.1, NP_859669.1, NP_214191.1, ZP_00086191.1, ISPH_VIBCH, NP_230334.1, NP_742768.1, NP_30230Y.1.1, ISPH NP_602581.1, ZP_00026966.1, NP_520563.1, NP_253247.1, NP_282047.1, ZP_00038210.1, ZP_00064913.1, CAA61555.1, ZP_00125365.1, ISPH_ACICA, EAA24703.1, ZP_00013029.1.1, ZP_00013067.1, ZAA NP_790656.1, NP_217899.1, NP_641592.1, NP_636532.1, NP_719076.1, NP_660497.1, NP_422155.1, NP_715446.1, ZP_00090692.1, NP_759496.1, ISPH_BURPS, ZP_00122156.1, NP NP_335584.1, ZP_00135016.1, NP_789585.1, NP_787770.1, NP_769647.1, ZP_00043336.1, NP_242248.1, ZP_00008555.1, NP_246603.1, ZP_00030951.1, NP_670994.1, NP_405206.1. 1, NP_733653.1, NP_697503.1, NP_840730.1, NP_274828.1,

NP_796916.1, ZP_00123390.1, NP_824386.1, NP_737689.1, ZP_00021222.1, NP_757521.1, NP_390395.1, ZP_00133322.1, CAD76178.1, NP_600249.1, NP_454660.1, NP_7126018.1. 1, NP_751989.1

Examples of 1-deoxy-D-xylose-5-phosphate synthase genes are:

A nucleic acid encoding a 1-deoxy-D-xylose-5-phosphate synthase from Lycopersicon esculentum, ACCESSION # AF143812 (nucleic acid: SEQ ID NO: 103, protein: SEQ ID NO: 12), as well as further 1-deoxy-D-xylose-5-phosphate synthase genes from other organisms with the following accession numbers:

AF143812_1, DXS_CAPAN, CAD22530.1, AF182286_1, NP_193291.1, T52289, AAC49368.1, AAP14353.1, D71420, DXS_ORYSA, AF443590_1, BAB02345.1, CAA09804.2, NP_850620.1, AAM65155.1 NP_566686.1, CAD22531.1, AAC33513.1, CAC08458.1, AAG10432.1, T08140, AAP14354.1, AF428463, ZP_00010537.1, NP_769291.1, AAK59424.1, NP 07784.1, NP_697464.1, NP_5404 , NP_196699.1, NP_384986.1, ZP_00096461.1, ZP_00013656.1, NP_353769.1, BAA83576.1, ZP_00005919.1, ZP_00006273.1, NP_420871.1, AAM48660.1, DXS_RHOCA, ZP_0004560316, , NP_841218.1, ZP_00022174.1, ZP_00086851.1, NP_742690.1, NP_520342.1, ZP_00082120.1, NP_790545.1, ZP_00125266.1, CAC17468.1, NP_252733.1, ZP_00092466.1, NP_439591 .1, NP_752465.1, NP_622918.1, NP_286162.1, NP_836085.1, NP_706308.1, ZP_00081148.1, NP_797065.1, NP_213598.1, NP_245469.1, ZP_00075029.1, NP_455016.1, NP_230536.1 , NP_459417.1, NP_274863.1, NP_283402.1, NP_759318.1, NP_406652.1, DXS_SYNLE, DXS_SYNP7, NP_440409.1, ZP_00067331.1, ZP_00122853.1, N P_717142.1, ZP_00104889.1, NP_243645.1, NP_681412.1, DXS_SYNEL, NP_637787.1, DXS_CHLTE, ZP_00129863.1, NP_661241.1, DXS_XANCP, NP_470738.1, NP_48464388, ZP90_001033 NP_846629.1, NP_658213.1,

NP_642879.1, ZP_00039479.1, ZP_00060584.1, ZP_00041364.1, ZP_00117779.1,

NP_299528.1

Examples of 1-deoxy-D-xylose-5-phosphate reductoisomerase genes are:

A nucleic acid encoding a 1-deoxy-D-xylose-5-phosphate reductoisomerase from Arabidopsis thaliana, ACCESSION # AF148852, (nucleic acid: SEQ ID NO: 13, protein: SEQ ID NO: 14),

as well as further 1-deoxy-D-xylose-5-phosphate reductoisomerase genes from other organisms with the following accession numbers:

AF148852, AY084775, AY054682, AY050802, AY045634, AY081453, AY091405, AY098952, AJ242588, AB009053, AY202991, NP_201085.1, T52570, AF331705, BAB167205121, AF361205151_1, AF361705.121, AF3617051501_1 ZP_00071219.1, NP_488391.1, ZP_00111307.1, DXR_SYNLE, AAP56260.1, NP_681831.1, NP_442113.1, ZP_00115071.1, ZP_00105106.1, ZP_00113484.1, NP_833540.1, NP_657789 DXR_BACHD, NP_833080.1, NP_845693.1, NP_562610.1, NP_623020.1, NP_810915.1, NP_243287.1, ZP_00118743.1, NP_464842.1, NP_470690.1, ZP_00082201.1, NP_781898.1, ZP_00123667 NP_348420.1, NP_604221.1, ZP_00053349.1, ZP_00064941.1, NP_246927.1, NP_389537.1, ZP_00102576.1, NP_519531.1, AF124757 9, DXR_ZYMMO, NP_713472.1, NP_459225.1, NP_454827.1, ZP_00045738.1, NP_743754.1, DXR , NP_702530.1, NP_841744.1, NP_438967.1, AF514841, NP_706118.1, ZP_00125845.1, NP_404661.1, NP_285867.1, NP_240064.1, NP_414715.1, ZP_00094058.1,

NP_791365.1, ZP_00012448.1, ZP_00015132.1, ZP_00091545.1, NP_629822.1, NP_771495.1, NP_798691.1, NP_231885.1, NP_252340.1, ZP_00022353.1, NP_355549.1, NP_420785.1, ZP. 1, EAA17616.1, NP_273242.1, NP_219574.1, NP_387094.1, NP_296721.1, ZP_00004209.1, NP_823739.1, NP_282934.1, BAA77848.1, NP_660577.1, NP_760741.1, NP_641750.1, NP_636741.1, NP_829309.1, NP_298338.1, NP_444964.1, NP_717246.1, NP_224545.1, ZP_00038451.1, DXR_KITGR, NP_778563.1.

Examples of isopentenyl diphosphate Δ isomerase genes are:

A nucleic acid encoding an isopentenyl diphosphate Δ isomerase from Adonis palaestina clone AplPI28, (ipiAal), ACCESSION # AF188060, published by Cunningham.F.X. Jr. and Gantt.E .: Identification of multi-gene families encoding isopentenyl diphosphate isomerase in plants by heterologous complementation in Escherichia coli, Plant Cell Physiol. 41 (1), 119-123 (2000) (nucleic acid: SEQ ID NO : 15, protein: SEQ ID NO: 16),

as well as other isopentenyl diphosphate Λ isomerase genes from other organisms with the following accession numbers:

Q38929, 048964, Q39472, Q13907, 035586, P58044, 042641, 035760, Q10132, P15496, Q9YB30, Q8YNH4, Q42553, 027997, P50740, 051627, 048965, Q8KFR5, Q39471F926, Q39471F926 Q9CIF5, Q88WB6, Q92BX2, Q8Y7A5, Q8TT35 Q9KK75, Q8NN99, Q8XD58, Q8FE75, Q46822, Q9HP40, P72002, P26173, Q9Z5D3, Q8Z3X9, Q8ZM82, Q9X7Q6, 013504, Q9HFW8, Q8NJL9, Q9UUQ1, Q9NH02, Q9M6K9, Q9M6K5, Q9FXR6, 081,691 , Q9S7C4, Q8S3L8, Q9M592, Q9M6K3, Q9M6K7, Q9FV48, Q9LLB6, Q9AVJ1, Q9AVG8, Q9M6K6, Q9AVJ5, Q9M6K2, Q9AYS5, Q9M6K8, Q9AVG7, Q8S3L7, Q8W250, Q94IE1, Q9AVI8, Q9AYS6, Q9SAY0, Q9M6K4, Q8GVZ0, Q84RZ8, Q8KZ12 , Q8KZ66, Q8FND7, Q88QC9, Q8BFZ6, BAC26382, CAD94476.

Examples of geranyl diphosphate synthase genes are:

A nucleic acid encoding a geranyl diphosphate synthase from Arabidopsis thaliana, ACCESSION # Y17376, Bouvier.F., Suire.C, d'Harlingue.A., Backhaus.RA and Camara, B .; Molecular cloning of geranyl diphosphate synthase and compartmentation of monoterpene synthesis in plant cells, Plant J. 24 (2), 241-252 (2000) (nucleic acid: SEQ ID NO: 17, protein: SEQ ID NO: 18),

as well as other geranyl diphosphate synthase genes from other organisms with the following accession numbers:

Q9FT89, Q8LKJ2, Q9FSW8, Q8LKJ3, Q9SBR3, Q9SBR4, Q9FET8, Q8LKJ1, Q84LG1. Q9JK86

Examples of famesyl diphosphate synthase genes are:

A nucleic acid encoding a farnesyl diphosphate synthase from Arabidopsis thaliana (FPS1), ACCESSION # U80605, published by Cunillera.N., Arro.M., DeLourme.D., Karst.F., Boronat.A. and Ferrer.A .: Arabidopsis thaliana contains two differentially expressed famesyl-diphosphate synthase genes, J. Biol. Chem. 271 (13), 7774-7780 (1996), (nucleic acid: SEQ ID NO: 19, protein: SEQ ID NO: 112),

as well as other famesyl diphosphate synthase genes from other organisms with the following accession numbers:

P53799, P37268, Q02769, Q09152, P49351, 024241, Q43315, P49352, 024242, P49350, P08836, P14324, P49349, P08524, 066952, Q08291, P54383, Q45220, P539A550, Q59A5506, Q59A5506, Q5395256, Q5395256, Q5395256, Q5395256, Q5395256, Q5395, Q5 Q9AVI7, Q9FRX2, Q9AYS7, Q94IE8, Q9FXR9, Q9ZWF6, Q9FXR8, Q9AR37, O50009, Q94IE9, Q8RVK7, Q8RVQ7, 004882, Q93RA8, Q93RB0, Q93RB4, Q93R31, Q93RB3, Q93R3, Q93R3, Q93R3, Q93R3, Q93R3, Q93R3, Q93R3, Q93R3, Q93R3, Q93R3, Q93B3

Examples of geranyl-geranyl diphosphate synthase genes are:

A nucleic acid encoding a geranyl-geranyl diphosphate synthase from Sinaps alba, ACCESSION # X98795, published by Bonk.M., Hoffmann, B., Von Lintig.J., Schledz.M., AI-Babili, S., Hobeika.E., Kleinig, H. and Beyer.P .: Chloroplast import of four carotenoid biosynthetic enzymes in vitro reveals differential fates prior to membrane binding and oligomeric assembly, Eur. J. Biochem. 247 (3), 942-950 (1997), (nucleic acid: SEQ ID NO: 21, protein: SEQ ID NO: 114),

as well as other geranyl-geranyl-diphosphate synthase genes from other organisms r with the following accession numbers: P22873, P34802, P56966, P80042, Q42698, Q92236, 095749, Q9WTN0, Q50727, P24322, P39464, Q9FXR3, Q9AYN2, Q9FXR2, Q9AVG6, Q9FRW4, Q9SXZ5, QAV9J7 Q9SSU0, Q9SXZ6, Q9SST9, Q9AVJ0, Q9AVI9, Q9FRW3, Q9FXR5, Q94IF0, Q9FRX1, Q9K567, Q93RA9, Q93QX8, CAD95619, EAA31459

Examples of phytoene synthase genes are:

A nucleic acid encoding a phytoene synthase from Erwinia uredovora, ACCESSION # D90087; published by Misawa.N., Nakagawa.M., Kobayashi.K., Yamano, S., lzawa, Y., Nakamura, K. and Harashima.K .: Elucidation of the Erwinia uredovora carotenoid biosynthetic pathway by functional analysis of gene products expressed in

Escherichia cell; J. Bacteriol. 172 (12), 6704-6712 (1990), (nucleic acid: SEQ ID NO:

23, protein: SEQ ID NO: 24),

as well as other phytoene synthase genes from other organisms with the following

Accession numbers:

CAB39693, BAC69364, AAF10440, CAA45350, BAA20384, AAM72615, BAC09112, CAA48922, P_001091, CAB84588, AAF41518, CAA48155, AAD38051, AAF33237, AAG10427, AAA34187, BAB73532, CAC19567, AAM62787, CAA55391, AAB65697, AAM45379, CAC27383, AAA32836, AAK07735, BAA84763, P_000205, AAB60314, P_001163, P_000718, AAB71428, AAA34153, AAK07734, CAA42969, CAD76176, CAA68575, P_000130, P_001142, CAA47625, CAA85775, BAC14416, CAA79957, BAC76563, P_000242, P_000551, AAL02001, AAK15621, CAB94795, AAA91951, P_000448

Examples of phytoene desaturase genes are:

A nucleic acid encoding a phytoene desaturase from Erwinia uredovora, ACCESSION # D90087; published by Misawa.N., Nakagawa.M., Kobayashi.K., Yamano, S., lzawa, Y., Nakamura, K. and Harashima.K .: Elucidation of the Erwinia uredovora carotenoid biosynthetic pathway by functional analysis of gene products expressed in Escherichia coli; J. Bacteriol. 172 (12), 6704-6712 (1990), (nucleic acid: SEQ ID NO: 25, protein: SEQ ID NO: 26),

as well as other phytoene desaturase genes from other organisms with the following accession numbers: AAL15300, A39597, CAA42573, AAK51545, BAB08179, CAA48195, BAB82461, AAK92625, CAA55392, AAG10426, AAD02489, AA024235, AAC12846, AAA99519, AAL38046, CAA60479, CAA75094, ZP_001041, ZP_001163, CAA39004, CAA44452, ZP_001142, ZP_000718, BAB82462, AAM45380, CAB56040, ZP_001091, BAC091 13, AAP79175, AAL80005, AAM72642, AAM72043, ZP_000745, ZP_001141, BAC07889, CAD55814, ZP_001041, CAD27442, CAE00192, ZP_001163, ZP_000197, BAA18400, AAG10425, ZP_001119, AAF13698, 2121278A, AAB35386, AAD02462, BAB68552, CAC85667 , AAK51557, CAA12062, AAG51402, AAM63349, AAF85796, BAB74081, AAA91 161, CAB56041, AAC48983, AAG14399, CAB65434, BAB73487, ZP_001117, ZP_000448, CAB39695, CAD76173, B6 BAB74484, ZP_001156, AAF23289, AAG28703, AAP09348, AAM71569, BAB69140, ZP_000130, AAF41516, AAG18866, CAD95940, NP_656310, AAG10645, ZP_000276, ZP_000192, ZPAM60006, ZPAM6136, ZPAM6126, ZPAM6126, ZPAM6126, ZPAM6126, ZPAM6126, ZPAM6126, ZPAM6126, ZPAM6126, ZPAM6126, ZPAM6126, ZPAM6126, ZPAM612611,

Examples of zeta-carotene desaturase genes are:

A nucleic acid encoding a Narcissus pseudonarcissus zeta-carotene desaturase, ACCESSION # AJ224683, published by AI-Babili, S., Oelschlegel.J. and Beyer.P .: A cDNA encoding for beta carotene desaturase (Accession No.AJ224683) from Narcissus pseudonarcissus L. (PGR98-103), Plant Physiol. 117, 719-719 (1998), (nucleic acid: SEQ ID NO: 119, protein: SEQ ID NO: 28),

as well as other zeta-carotene desaturase genes from other organisms with the following accession numbers:

Q9R6X4, Q38893, Q9SMJ3, Q9SE20, Q9ZTP4, 049901, P74306, Q9FV46, Q9RCT2, ZDS_NARPS, BAB68552.1, CAC85667.1, AF372617_1, ZDS_TARER, CAD55814Z_2_1227C7DS2, CAD2778A13.1, CAD1278A4DS1, CAD2778A13.1, CAD2778A4D. 1, AAM63349.1, ZDS_ARATH, AAA91161.1, ZDS_MAIZE, AAG14399.1, NP_441720.1, NP_486422.1, ZP_00111920.1, CAB56041.1, ZP_00074512.1, ZP_00116357.1, NP_68112114.1, ZP_00116357.1 ZP_00104126.1, CAB65434.1, NP_662300.1

Examples of crtlSO genes are:

A nucleic acid encoding a crtlSO from Lycopersicon esculentum; ACCESSION # AF416727, published by Isaacson.T., Ronen, G., Zamir.D. and Hirschberg, J .: Cloning of tangerine from tomato reveals a carotenoid isomerase essential for the production of beta-carotene apd xanthophylls in plants; Plant Cell 14 (2), 333-342 (2002), (Nucleic acid: SEQ ID NO: 29, protein: SEQ ID NO: 122),

as well as other crtlSO genes from other organisms with the following accession numbers:

AAM53952

Examples of FtsZ genes are:

A nucleic acid encoding an FtsZ from Tagetes erecta, ACCESSION # AF251346, published by Moehs.C.P., Tian.L., Osteryoung.K.W. and Dellapenna.D .: Analysis of carotenoid biosynthetic gene expression during marigold petal development Plant Mol. Biol. 45 (3), 281-293 (2001), (nucleic acid: SEQ ID NO: 31, protein: SEQ ID NO: 32) .

as well as other FtsZ genes from other organisms with the following accession numbers:

CAB89286.1, AF205858_1, NP_200339.1, CAB89287.1, CAB41987.1, AAA82068.1, T06774, AF383876_1, BAC57986.1, CAD22047.1, BAB91150.1, ZP_00072546.1, NP_440816.1_ T683172,. 1, BAA85116.1, NP_487898.1, JC4289, BAA82871.1, NP_781763.1, BAC57987.1, ZP_00111461.1, T51088, NP 90843.1, ZP_00060035.1, NP_846285.1, AAL07180.1, NP_243424.1, NP_833626 .1, AAN04561.1, AAN04557.1, CAD22048.1, T51089, NP_692394.1, NP_623237.1, NP_565839.1, T51090, CAA07676.1, NP_113397.1, T51087, CAC44257.1, E84778, ZP_00105267 , BAA82091.1, ZP_00112790.1, BAA96782.1, NP_348319.1, NP_471472.1, ZP_00115870.1, NP_465556.1, NP_389412.1, BAA82090.1, NP_562681.1, AAM22891.1, NP_371710.1, NP_764416 .1, CAB95028.1, FTSZ_STRGR, AF120117_1, NP_827300.1, JE0282, NP_626341.1, AAC45639.1, NP_785689.1, NP_336679.1, NP_738660.1, ZP_00057764.1, AAC32265M.1, NP_KA14733.1 , NP_216666.1, CAA75616.1, NP_301700.1, NP_601357.1, ZP_00046269.1, CAA70158.1, ZP_00037834.1, NP_268026.1, FTSZ_ENTHR, NP_787643.1, NP_346105.1, AAC32 264.1, JC5548, AAC95440.1, NP_710793.1, NP_687509.1, NP_269594.1, AAC32266.1, NP_720988.1, NP_657875.1, ZP_00094865.1, ZP_00080499.1, ZP_00043589.1, JC7087, NP_66055 AAC46069.1, AF179611_14, AAC44223.1, NP_404201.1.

Examples of MinD genes are: A nucleic acid encoding a MinD from Tagetes erecta, ACCESSION # AF251019, published by Moehs.CP, Tian.L, Osteryoung.KW and Dellapena, D .: Analysis of carotenoid biosynthetic gene expression during marigold petal development; Plant Mol. Biol. 45 (3), 281-293 (2001), (nucleic acid: SEQ ID NO: 33, protein: SEQ ID NO: 34),

as well as other MinD genes with the following accession numbers:

NP_197790.1, BAA90628.1, NP_038435.1, NP_045875.1, AAN33031.1, NP_050910.1, CAB53105.1, NP_050687.1, NP_682807.1, NP_487496.1, ZP_001117081, ZP_00071109.1, NP_4425 NP_603083.1, NP_782631.1, ZP_000973671, ZP_00104319.1, NP_294476.1, NP_622555.1, NP_563054.1, NP_347881.1 ZP_00113908.1, NP_834154.1, NP_658480.1, ZP_0005938815.1, NP_24709. 1, NP_465069.1, ZP_00116155.1, NP_390677.1, NP_692970.1 NP_298610.1, NP_207129.1, ZP_00038874.1, NP_778791.1, NP_223033.1 NP_641561.1, NP_636499.1, ZP_00088135.1,. 1, NP_743889.1 NP_231594.1, ZP_00085067.1, NP_797252.1, ZP_00136593.1, NP_251934.1 NP_405629.1, NP_759144.1, ZP_00102939.1, NP_793645.1, NP_699517.1 NP_4607714.1, NP_860755.1 , NP_456322.1, NP_718163.1, NP_229666.1 NP_357356.1, NP_541904.1, NP_287414.1, NP_660660.1, ZP_001282731, NP 03411.1, NP_785789.1, NP_715361.1, AF149810, NP_84789.1 ZP_00022726.1, EAA24844.1, ZP_00029547.1, NP_521484.1 NP_240148.1, NP_770852.1, AF345908_2, NP_777923.1, ZP_000488791, NP _579340.1, NP_143455.1, NP_126254.1, NP_142573.1, NP_613505.1 NP I27112.1, NP_712786.1, NP_578214.1, NP_069530.1, NP_247526.1 AAA85593.1, NP_212403.1, NP_782258.1 , ZP_00058694.1, NP_247137.1 NP_219149.1, NP_276946.1, NP_614522.1, ZP_00019288.1, CAD78330.1

In the preferred embodiment described above, nucleic acids which encode proteins are preferably used as HMG-CoA reductase genes, comprising the amino acid sequence SEQ ID NO: 8 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 8, and which have the enzymatic property of an HMG-CoA reductase.

Further examples of HMG-CoA reductases and HMG-CoA reductase genes can be found, for example, from different organisms, their genomic sequence is known, as described above, by homology comparisons of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 8.

Further examples of HMG-CoA reductases and HMG-CoA reductase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 7 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques easy to find in a manner known per se.

In a further particularly preferred embodiment, nucleic acids which encode proteins containing the amino acid sequence of the HMG-CoA reductase of the sequence SEQ ID NO: 8 are introduced into organisms to increase the HMG-CoA reductase activity.

Those codons are preferably used for this which are frequently used in accordance with the organism-specific codon usage. The codon usage can easily be determined on the basis of computer evaluations of other known genes of the organisms in question.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 7 is introduced into the organism.

In the preferred embodiment described above, preference is given to using (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase genes nucleic acids which code for proteins containing the amino acid sequence SEQ ID NO: 10 or one of these sequences Substitution, insertion or deletion of amino acid-derived sequence that have an identity of at least 30%, preferably at least 50%, more preferably at least 70%, more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 10, and which have the enzymatic property of an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase.

Further examples of (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductases and (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase genes can be obtained, for example, from different organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or find the corresponding back-translated nucleic acid sequences from databases with SeQ ID NO: 10.

Further examples of (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductases and (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase genes can also be obtained, for example, from the sequence SEQ ID NO: 9 from various organisms, the genomic sequence of which is not known, as described above, can easily be found by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the (E) - 4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of (E) - 4- Hydroxy-3-methylbut-2-enyl-diphosphate reductase of the sequence SEQ ID NO: 10.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 9 is introduced into the organism.

In the preferred embodiment described above, use is preferably made of (1-deoxy-D-xyiosis-5-phosphate synthase genes) nucleic acids which encode proteins containing the amino acid sequence SEQ ID NO: 12 or one of these sequences by substitution, insertion or deletion sequence derived from amino acids, which has an identity of at least 30%, preferably at least 50%, more preferably at least 70%, more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 12, and which has the enzymatic property a (1-deoxy-D-xylose-5-phosphate synthase.

Further examples of (1-deoxy-D-xylose-5-phosphate synthase and (1-deoxy-D-xylose-5-phosphate synthase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above , easily by homology comparisons of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 12 find.

Further examples of (1-deoxy-D-xylose-5-phosphate synthase and (1-deoxy-D-xylose-5-phosphate synthase genes can also be obtained from different organisms, for example, starting from the sequence SEQ ID NO: 11 whose genomic sequence is not known, as described above, can easily be found by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, in order to increase the (1-deoxy-D-xylose-5-phosphate synthase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the (1-deoxy-D-xylose-5 Phosphate synthase of sequence SEQ ID NO: 12.

Those codons which are frequently used in accordance with the organism-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other, known genes of the organisms concerned.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 11 is introduced into the organism.

In the preferred embodiment described above, 1-deoxy-D-xylose-5-phosphate reductoisomerase genes are preferably used nucleic acids which encode proteins containing the amino acid sequence SEQ ID NO: 14 or one of these sequences by substitution, insertion or deletion of Amino acid-derived sequence which has an identity of at least 30%, preferably at least 50%, more preferably at least 70%, more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 14, and which is the enzymatic Have property of a 1-deoxy-D-xylose-5-phosphate reductoisomerase.

Further examples of 1-deoxy-D-xylose-5-phosphate reductoisomerase and 1-deoxy-D-xylose-5-phosphate reductoisomerase genes can be obtained, for example, from various organisms, the genomic sequence of which is known, as described above Homology comparisons of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 14 easy to find.

Further examples of 1-deoxy-D-xylose-5-phosphate reductoisomerases and 1-deoxy-D-xylose-5-phosphate reductoisomerase genes can also be found, for example, starting from the sequence SEQ ID NO: 13 from different organisms, their genomic Sequence is not known, as described above, can be easily found by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, in order to increase the 1-deoxy-D-xylose-5-phosphate reductoisomerase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the 1-deoxy-D-xylose-5-phosphate Reductoisomerase of sequence SEQ ID NO: 14.

Those codons which are frequently used in accordance with the organism-specific codon usage are preferably used for this. The codon usage can be determined on the basis of computer evaluations of other known genes of the relevant organ. easily identify nisms.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 13 is introduced into the organism.

In the preferred embodiment described above, nucleic acids which encode proteins are preferably used as isopentenyl-D-isomerase genes, containing the amino acid sequence SEQ ID NO: 16 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 16, and which have the enzymatic property of an isopentenyl-D-isomerase.

Further examples of isopentenyl-D-isomerases and isopentenyl-D-isomerase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 16 easy to find. Further examples of isopentenyl-D-isomerases and isopentenyl-D-isomerase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 15 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques easy to find in a manner known per se.

In a further particularly preferred embodiment, to increase the isopentenyl-D-isomerase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the isopentenyl-D-isomerase of the sequence SEQ ID NO: 16.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 15 is introduced into the organism.

In the preferred embodiment described above, the geranyl diphosphate synthase genes used are preferably nucleic acids which encode proteins, the amino acid sequence SEQ ID NO: 18 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is a Identity of at least 30%, preferably at least 50%, more preferably at least 70%, more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 18, and which has the enzymatic property of a geranyl diphosphate Have synthase.

Further examples of geranyl diphosphate synthases and geranyl diphosphate synthase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 18 easy to find.

Further examples of geranyl diphosphate synthases and geranyl diphosphate synthase genes can also be derived, for example, starting from the sequence SEQ ID NO: 17 from different organisms whose genomic sequence cannot be determined. is, as described above, easy to find by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the geranyl diphosphate synthase activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the geranyl diphosphate synthase of the sequence SEQ ID NO: 18.

Those codons which are frequently used in accordance with the organism-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other, known genes of the organisms in question.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 17 is introduced into the organism.

In the preferred embodiment described above, preference is given to using, as farnesyl diphosphate synthase genes, nucleic acids which encode proteins, containing the amino acid sequence SEQ ID NO: 20 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and which have an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 20, and which have the enzymatic property of a farnesyl diphosphate synthase ,

Further examples of famesyl diphosphate synthases and famesyl diphosphate synthase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 20 easy to find.

Further examples of farnesyl diphosphate synthases and famesyl diphosphate synthase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 19 from various organisms whose genomic sequence is not known, as described above, by means of hybridization and PCR techniques easy to find in a manner known per se. In a further particularly preferred embodiment, nucleic acids which encode proteins containing the amino acid sequence of the farnesyl diphosphate synthase of the sequence SEQ ID NO: 20 are introduced into organisms in order to increase the famesyl diphosphate synthase activity.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 19 is introduced into the organism.

In the preferred embodiment described above, the geranyl-geranyl-diphosphate synthase genes used are preferably nucleic acids which encode proteins containing the amino acid sequence SEQ ID NO: 22 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which is a Identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 22, and which the enzymatic property of a geranyl-geranyl-diphosphate Have synthase.

Further examples of geranyl-geranyl-diphosphate synthases and geranyl-geranyl-diphosphate synthase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases easy to find with SeQ ID NO: 22.

Further examples of geranyl-geranyl-diphosphate synthases and geranyl-geranyl-diphosphate synthase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 21 from various organisms whose genomic sequence is not known, as described above, by hybridization. and PCR techniques can be easily found in a manner known per se.

In a further particularly preferred embodiment, to increase the geranyl-geranyl-diphosphate synthase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the geranyl-geranyl- Diphosphate synthase of sequence SEQ ID NO: 22.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 21 is introduced into the organism.

In the preferred embodiment described above, nucleic acids encoding proteins are preferably used as phytoene synthase genes, containing the amino acid sequence SEQ ID NO: 24 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30 %, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 24, and which have the enzymatic property of a phytoene synthase.

Further examples of phytoene synthases and phytoene synthase genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 24.

Further examples of phytoene synthases and phytoene synthase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 23 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se Easy to find.

In a further particularly preferred embodiment, in order to increase the phytoene synthase activity, nucleic acids are introduced into organisms which code for proteins containing the amino acid sequence of the phytoene synthase of the sequence SEQ ID NO: 24. Suitable nucleic acid sequences are, for example, by back-translating the

Polypeptide sequence available according to the genetic code.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 23 is introduced into the organism.

In a preferred embodiment described above, the phytoene desaturase genes used are preferably nucleic acids which encode proteins containing the amino acid sequence SEQ ID NO: 26 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30 %, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 26, and which have the enzymatic property of a phytoene desaturase.

Further examples of phytoene desaturases and phytoene desaturase genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 26.

Further examples of phytoene desaturases and phytoene desaturase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 25 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se Easy to find.

In a further particularly preferred embodiment, nucleic acids which encode proteins containing the amino acid sequence of the phytoene desaturase of the sequence SEQ ID NO: 26 are introduced into organisms in order to increase the phytoene desaturase activity.

Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code. Those codons which are frequently used in accordance with the organism-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other, known genes of the organisms in question.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 25 is introduced into the organism.

In the preferred embodiment described above, the zeta-carotene desaturase genes used are preferably nucleic acids which encode proteins containing the amino acid sequence SEQ ID NO: 28 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and which have an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 28, and which have the enzymatic property of a zeta-carotene desaturase ,

Further examples of zeta-carotene desaturases and zeta-carotene desaturase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID NO: 28 easy to find.

Further examples of zeta-carotene desaturases and zeta-carotene desaturase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 119 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques easy to find in a manner known per se.

In a further particularly preferred embodiment, in order to increase the zeta-carotene desaturase activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the zeta-carotene desaturase of the sequence SEQ ID NO: 28.

Those codons which are frequently used in accordance with the organism-specific codon usage are preferably used for this. The codon usage can be determined on the basis of computer evaluations of other known genes of the relevant organ easily identify nisms.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 119 is introduced into the organism.

In a preferred embodiment described above, nucleic acids which encode proteins are preferably used as CrtlSO genes, comprising the amino acid sequence SEQ ID NO: 30 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 30, and which have the enzymatic property of a Crtlso.

Further examples of CrtlSO and CrtlSO genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 30.

Further examples of CrtlSO and CrtlSO genes can also be easily found, for example, starting from the sequence SEQ ID NO: 29 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, nucleic acids which encode proteins containing the amino acid sequence of the CrtlSO of the sequence SEQ ID NO: 30 are introduced into organisms to increase the CrtlSO activity.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQJD NO: 29 is introduced into the organism. In the preferred embodiment described above, the FtsZ genes used are preferably nucleic acids which encode proteins, containing the amino acid sequence SEQ ID NO: 32 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 32, and which have the enzymatic property of an FtsZ.

Further examples of FtsZn and FtsZ genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 32.

Further examples of FtsZn and FtsZ genes can also be easily found, for example, starting from the sequence SEQ ID NO: 31 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the

FtsZ activity Nucleic acids introduced into organisms which encode proteins, containing the amino acid sequence of the FtsZ of the sequence SEQ ID NO: 32

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 31 is introduced into the organism.

In the preferred embodiment described above, the preferred MinD genes are nucleic acids encoding proteins containing the amino acid sequence SEQ ID NO: 34 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the Sequence SEQ ID NO: 34, and which have the enzymatic property of a MinD.

Further examples of MinDn and MinD genes can easily be found, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID NO: 34.

Further examples of MinDn and MinD genes can also easily be obtained, for example, starting from the sequence SEQ ID NO: 33 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se find.

In a further particularly preferred embodiment, to increase the Min D activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the MinD of the sequence SEQ ID NO: 34.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 33 is introduced into the organism.

All of the above-mentioned HMG-CoA reductase genes, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase genes, 1 -deoxy-D-xylose-

5-phosphate synthase genes, 1-deoxy-D-xylose-5-phosphate reductoisomerase genes, isopentenyl diphosphate Δ isomerase genes, geranyl diphosphate synthase genes, fernesyl diphosphate synthase genes Genes, geranyl-geranyl diphosphate synthase genes, phytoene synthase genes, phytoene desaturase genes, zeta-carotene desaturase genes, crtl-SO genes, FtsZ genes or MinD genes are still in themselves can be prepared in a known manner by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). The attachment of synthetic Oligonucleotides and gap filling using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

The nucleic acids encoding a ketolase, nucleic acids encoding a β-hydroxylase, nucleic acids encoding a β-cyclase, containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2, and the nucleic acids encoding an HMG-CoA reductase, nucleic acids encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase, nucleic acids encoding a 1-deoxy-D-xylose-5 Phosphate synthase, nucleic acids encoding a 1-deoxy-D-xylose-5-phosphate reductoisomerase, nucleic acids encoding an isopentenyl diphosphate Δ isomerase, nucleic acids encoding a geranyl diphosphate synthase, nucleic acids encoding a farnesyl diphosphate synthase, Nucleic acids encoding a geranyl-geranyl diphosphate synthase, nucleic acids encoding a phytoene synthase, nucleic acids encoding a phytoene desaturase, nucleic acids encoding a zeta-carotene desaturase, nucleic acids encoding a CrtlSO protein, nucleic acids encoding / a FtsZ protein a MinD protein are also called "effect genes" below.

The genetically modified, non-human organisms can be produced, as described below, for example by introducing individual nucleic acid constructs (expression cassettes) containing an effect gene or by introducing multiple constructs which contain up to two or three of the effect genes or more than three effect genes

According to the invention, organisms are preferably understood to mean organisms which, as wild-type or starting organisms, naturally or by genetic complementation and / or reorganization of the metabolic pathways, are capable of producing carotenoids, in particular β-carotene and / or zeaxanthin and / or neoxanthine and / or violaxanthin and / or to produce lutein.

Further preferred organisms already have hydroxylase activity as wild-type or starting organisms and are therefore able to produce zeaxanthin as wild-type or starting organisms. Preferred organisms are plants or microorganisms, such as bacteria, yeasts, algae or fungi.

Both bacteria can be used as bacteria that are able to synthesize xanthophylls due to the introduction of genes of the carotenoid biosynthesis of a carotenoid-producing organism, such as, for example, bacteria of the genus Escherichia, which contain, for example, crt genes from Erwinia, as well Bacteria that are able to synthesize xanthophylls on their own, such as, for example, bacteria of the genus Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Paracoccus, Nostoc or cyanobacteria of the genus Synechocystis.

Preferred bacteria are Escherichia coli, Erwinia herbicola, Erwinia uredovora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobacterium sp. strain R1534, the Cyanobacterium Synechocystis sp. PCC6803, Paracoccus marcusii or Paracoccus carotinifaciens.

Preferred yeasts are Candida, Saccharomyces, Hansenula, Pichia or Phaffia. Particularly preferred yeasts are Xanthophyllomyces dendrorhous or Phaffia rhodozyma.

Preferred mushrooms are Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, in particular Blakeslea trispora, Phycomyces, Fusarium or others in Indian Chem. Engr. Section B. Vol. 37, No. 1, 2 (1995) on page 15, table 6 described mushrooms.

Preferred algae are green algae, such as algae of the genus Haematococcus, Phaedactylum tricornatum, Volvox or Dunaliella. Particularly preferred algae are Haematococcus puvialis or Dunaliella bardawil.

Further useful microorganisms and their preparation for carrying out the method according to the invention are known, for example, from DE-A-199 16 140, to which reference is hereby made.

Particularly preferred plants are plants selected from the families Amaranthaceae, Amaryllidaceae, Apocynaceae ceae, Asteraceae, Balsaminaceae, Begonia-, Berberidaceae, Brassicaceae.Cannabaceae, Caprifoliaceae, Caryophyllaceae, Chenopodiaceae, Compositae, Cucurbitaceae, Cruciferae, Euphorbiaceae, Fabaceae, Gentianaceae, Geraniaceae , Graminae, llliaceae, Labiatae, Lamiaceae, Leguminosae, Liliaceae, Linaceae, Lobeliaceae, Malvaceae, Oleaceae, Orchidaceae, Papaveraceae, Plumbaginaceae, Poaceae, Polemoniaceae, Primulacaceae, Roseaeaeae, Rosunceae ceae, Vitaceae and Violaceae.

Very particularly preferred plants are selected from the group of the plant genera Marigold, Tagetes errecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aquilegia, Aster, Astragalus, Bignonia, Calendula, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum , Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillaea, Helenium, Helianthus, Hepatica , Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kenya, Laburnum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcissus, Oenothera, Osiaanthus , Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, U lex, viola or zinnia, particularly preferably selected from the group of the plant genera Marigold, Tagetes erecta, Tagetes patula, Lycopersicon, Rosa, Calendula, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium, Tropaeolum or Adonis.

In the process according to the invention for the production of ketocarotenoids, the cultivation step of the genetically modified organisms is preferably followed by harvesting the organisms and, more preferably, additionally isolating ketocarotenoids from the organisms.

The organisms are harvested in a manner known per se in accordance with the respective organism. Microorganisms, such as bacteria, yeast, algae or fungi or plant cells, which are cultivated by fermentation in liquid nutrient media, can be separated off, for example, by centrifuging, decanting or filtering. Plants are grown on nutrient media in a manner known per se and harvested accordingly.

The cultivation of the genetically modified microorganisms is preferably carried out in the presence of oxygen at a cultivation temperature of at least about 20 ° C., for example 20 ° C. to 40 ° C., and a pH of about 6 to 9. In the case of genetically modified microorganisms preferably first culturing the microorganisms in the presence of oxygen and in a complex medium, such as, for example, TB or LB medium at a cultivation temperature of about 20 ° C. or more, and a pH of about 6 to 9, until a sufficient cell density is reached is. In order to be able to better control the oxidation reaction, the use of an inducible promoter is preferred. The cultivation is carried out after induction of ketolase expression in presence of oxygen, for example 12 hours to 3 days.

The ketocarotenoids are isolated from the harvested biomass in a manner known per se, for example by extraction and, if appropriate, further chemical or physical purification processes, such as, for example, precipitation methods, crystallography, thermal separation processes, such as rectification processes or physical separation processes, such as chromatography.

As mentioned below, the ketocarotenoids in the genetically modified plants according to the invention can preferably be produced specifically in various plant tissues, such as, for example, seeds, leaves, fruits, flowers, in particular in petals.

Ketocarotenoids are isolated from the harvested petals in a manner known per se, for example by drying and subsequent extraction and, if appropriate, further chemical or physical purification processes, such as, for example, precipitation methods, crystallography, thermal separation processes, such as rectification processes or physical separation processes, such as chromatography. Ketocarotenoids are isolated from the petals, for example, preferably by organic solvents such as acetone, hexane, ether or tert-methylbutyl ether.

Further isolation processes for ketocarotenoids, in particular from petals, are described, for example, in Egger and Kleinig (Phytochemistry (1967) 6, 437-440) and Egger (Phytochemistry (1965) 4, 609-618).

The ketocarotenoids are preferably selected from the group of astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3'-hydroxyechinenone, adonirubin and adonixanthin.

A particularly preferred ketocarotenoid is astaxanthin.

Depending on the organism used, the ketocarotenoids are obtained in free form or as fatty acid esters or as diglucosides

In the petals of plants, the ketocarotenoids are obtained in the process according to the invention in the form of their mono- or diesters with fatty acids. Some detected fatty acids are, for example, myristic acid, palmitic acid, stearic acid, oleic acid, linolenic acid, and lauric acid (Kamata and Simpson (1987) Comp. Biochem. Physiol. Vol. 86B (3), 587-591).

The ketocarotenoids can be produced in the whole plant or, in a preferred embodiment, specifically in plant tissues which contain chromoplasts. Preferred plant tissues are, for example, roots, seeds, leaves, fruits, flowers and in particular nectaries and petals, which are also called petals.

In a particularly preferred embodiment of the method according to the invention, genetically modified plants are used which have the highest expression rate of a ketolase in flowers.

This is preferably achieved in that the gene expression of the ketolase takes place under the control of a flower-specific promoter. For example, the nucleic acids described above, as described in detail below, are introduced into the plant in a functionally linked manner with a flower-specific promoter in a nucleic acid construct.

In a further, particularly preferred embodiment of the method according to the invention, genetically modified plants are used which have the highest expression rate of a ketolase in fruits.

This is preferably achieved in that the gene expression of the ketolase takes place under the control of a fruit-specific promoter. For example, the nucleic acids described above, as described in detail below, are introduced into the plant in a nucleic acid construct functionally linked with a fruit-specific promoter.

In a further, particularly preferred, embodiment of the method according to the invention, genetically modified plants are used which have the highest expression rate of a ketolase in seeds.

This is preferably achieved in that the gene expression of the ketolase takes place under the control of a seed-specific promoter. For example, the nucleic acids described above, as described in detail below, are introduced into the plant in a nucleic acid construct functionally linked with a seed-specific promoter. The targeting in the chrome peaks is carried out by a functionally linked plastid transit peptide.

In the following, the production of genetically modified plants with increased or caused ketolase activity and increased or caused ß-

Cyclase activity described, wherein the altered ß-cyclase activity is caused by a ß-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

Increasing other activities, such as hydroxylase activity, HMG-CoA reductase activity, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, 1-deoxy-D-xylose- 5-phosphate synthase activity, 1-deoxy-D-xylose-5-phosphate reductoisomerase activity, isopentenyl diphosphate Δ isomerase activity, geranyl diphosphate synthase activity, famesyl diphosphate synthase activity, Geranyl-geranyl diphosphate synthase activity, phytoene synthase activity, phytoene desaturase activity, zeta-carotene desaturase activity, crtlSO activity, FtsZ activity and / or MinD activity can be used analogously corresponding effects occur.

In the combination of genetic changes, the transformation can take place individually or through multiple constructs.

The transgenic plants are preferably produced by transforming the starting plants, using a nucleic acid construct which contains the nucleic acids described above, coding for a ketolase and coding for a .beta.-cyclase, which are functionally linked to one or more regulation signals which relate to transcription and translation in plants ensure, wherein the nucleic acid encodes a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

Alternatively, the transgenic plants are preferably produced by transforming the starting plants using two nucleic acid constructs. A nucleic acid construct contains at least one nucleic acid described above, encoding a ketolase, which is functionally linked to one or more regulatory signals which ensure transcription and translation in plants. The second nucleic acid construct contains at least one nucleic acid described above, encoding a β-cyclase, which are functionally linked to one or more regulatory signals which ensure transcription and translation in plants, the nucleic acid encoding a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has ..

These nucleic acid constructs, in which the effect genes are functionally linked to one or more regulation signals which ensure transcription and translation in plants, are also called expression cassettes below.

The regulation signals preferably contain one or more promoters which ensure transcription and translation in plants.

The expression cassettes contain regulatory signals, that is to say regulatory nucleic acid sequences which control the expression of the effect genes in the host cell. According to a preferred embodiment, an expression cassette comprises upstream, i.e. at the 5 'end of the coding sequence, a promoter and downstream, i.e. at the 3 'end, a polyadenylation signal and optionally further regulatory elements which are operatively linked to the coding sequence of the effect gene in between for at least one of the genes described above. An operative link is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended when expressing the coding sequence.

The preferred nucleic acid constructs, expression cassettes and vectors for plants and methods for producing transgenic plants and the transgenic plants themselves are described below by way of example.

The sequences which are preferred, but not limited to, for operative linking are targeting sequences to ensure subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochondrion, in the endoplasmic reticulum (ER), in the cell nucleus, in oil bodies or other compartments and translation enhancers such as the 5 'leader sequence from the tobacco mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711).

In principle, any promoter which can control the expression of foreign genes in plants is suitable as the promoter of the expression cassette. “Constituent” promoter means those promoters which ensure expression in numerous, preferably all, tissues over a relatively long period of plant development, preferably at all times during plant development.

In particular, a plant promoter or a plant virus-derived promoter is preferably used. Particularly preferred is the promoter of the 35S transcript of the CaMV cauliflower mosaic virus (Franck et al. (1980) Cell 21: 285-294; Odell et al. (1985) Nature 313: 810-812; Shewmaker et al. (1985) Virology 140: 281-288; Gardner et al. (1986) Plant Mol Biol 6: 221-228), the 19S CaMV promoter (US 5,352,605; WO 84/02913; Benfey et al. (1989) EMBO J 8: 2195- 2202), the triose-phosphate translocator (TPT) promoter from Arabidopsis thaliana Acc.-No. AB006698, base pair 53242 to 55281; the gene starting from bp 55282 is annotated with "phosphate / triose-phosphate translocator", or the 34S promoter from Figwort - ^• mosaic virus Acc.-No. X16673, base pair 1 to 554.

Another suitable constitutive promoter is the pds promoter (Pecker et al. (1992) Proc. Natl. Acad. Be USA 89: 4962-4966) or the "Rubisco small subunit (SSU)" promoter (US 4,962,028), the LeguminB Promoter (GenBank Acc. No. X03677), the promoter of nopaline synthase from Agrobacterium, the TR double promoter, the OCS (octopine synthase) promoter from Agrobacterium, the ubiquitin promoter (Holtorf S et al. (1995) Plant Mol Biol 29: 637-649), the Ubiquitin 1 promoter (Christensen et al. (1992) Plant Mol Biol 18: 675-689; Bruce et al. (1989) Proc Natl Acad Sei USA 86: 9692-9696), the Smas Promoter, the cinnamyl alcohol dehydrogenase promoter (US 5,683,439), the promoters of the vacuolar ATPase subunits or the promoter of a proline-rich protein from wheat (WO 91/13991), the Pnit promoter (Y07648.L, Hillebrand et al. ( 1998), Plant. Mol. Biol. 36, 89-99, Hillebrand et al. (1996), Gene, 170, 197-200) as well as other promoters of genes whose constitutive expression in Pf lances is known to the expert.

The expression cassettes can also contain a chemically inducible promoter (review article: Gatz et al. (1997) Annu Rev Plant Physiol Plant Mol Biol 48: 89-108), by means of which the expression of the effect genes in the plant can be controlled at a specific point in time. Such promoters, such as the PRP1 promoter (Ward et al. (1993) Plant Mol Biol 22: 361-366), a promoter induced by salicylic acid (WO 95/19443), a promoter induced by benzenesulfonamide (EP 0 388 186) , a tetracycline-inducible promoter (Gatz et al. (1992) Plant J 2: 397-404), an abscisic acid-inducible promoter (EP 0 335 528) or an ethanol- or cyclohexanone-inducible promoter (WO 93 / 21334) can also be used. Also preferred are promoters that are induced by biotic or abiotic stress, such as the pathogen-inducible promoter of the PRP1 gene (Ward et al. (1993) Plant Mol Biol 22: 361-366), the heat-inducible hsp70 or hsp80 promoter from tomato (US 5,187,267), the cold-inducible alpha-amylase promoter from the potato (WO 96/12814), the light-inducible PPDK promoter or the wound-induced pinII promoter (EP375091).

Pathogen-inducible promoters include those of genes that are induced as a result of a pathogen attack, such as, for example, genes from PR proteins, SAR proteins, b-1, 3-glucanase, chitinase etc. (for example Redolfi et al. (1983) Neth J Plant Pathol 89: 245-254; Uknes, et al. (1992) The Plant Cell 4: 645-656; Van Loon

(1985) Plant Mol Viral 4: 111-116; Marineau et al. (1987) Plant Mol Biol 9: 335-342; Matton et al. (1987) Molecular Plant-Microbe Interactions 2: 325-342; Somssich et al.

(1986) Proc Natl Acad Sei USA 83: 2427-2430; Somssich et al. (1988) Mol Gen Genetics 2: 93-98; Chen et al. (1996) Plant J 10: 955-966; Zhang and Sing (1994) Proc Natl

Acad Sei USA 91: 2507-2511; Warner, et al. (1993) Plant J 3: 191-201; Siebertz et al. (1989) Plant Cell 1: 961-968 (1989).

Also included are wound inducible promoters such as that of the pinll gene (Ryan (1990) Ann Rev Phytopath 28: 425-449; Duan et al. (1996) Nat Biotech 14: 494-498), the wunl and wun2 genes ( US 5,428,148), the winl and win2 genes (Stanford et al. (1989) Mol Gen Genet 215: 200-208), the systemin gene (McGurl et al. (1992) Science 225: 1570-1573), des WIP1 gene (Rohmeier et al. (1993) Plant Mol Biol 22: 783-792; Ekeikamp et al. (1993) FEBS Letters 323: 73-76), the MPI gene (Corderok et al. (1994) The Plant J 6 (2): 141-150) and the like.

Other suitable promoters are, for example, fruit-ripening-specific promoters, such as the fruit-ripening-specific promoter from tomato (WO 94/21794, EP 409 625). Development-dependent promoters partly include the tissue-specific promoters, since the formation of individual tissues is naturally development-dependent.

Furthermore, promoters are particularly preferred which ensure expression in tissues or parts of plants in which, for example, the biosynthesis of ketocarotenoids or their precursors takes place. For example, promoters with specificities for the anthers, ovaries, petals, sepals, flowers, leaves, stems, seeds and roots and combinations thereof are preferred.

Tuber-, storage-root or root-specific promoters are, for example, the patatin promoter class I (B33) or the promoter of the cathepsin D inhibitor from cardiac toffel.

Leaf-specific promoters are, for example, the promoter of the cytosolic FBPase from potato (WO 97/05900), the SSU promoter (small subunit) of Rubisco (ribulose-1, 5-bisphosphate carboxylase) or the ST-LSI promoter from potato (Stockhaus et al. ( 1989) EMBO J 8: 2445-2451).

Flower-specific promoters are, for example, the phytoene synthase promoter (WO 92/16635) or the promoter of the P-rr gene (WO 98/22593), the AP3 promoter from Arabidopsis thaliana, the CHRC promoter (chromoplast-specific carotenoid-associated protein ( CHRC) gene promoter from Cucumis sativus Acc.-No. AF099501, base pair 1 to 1532), the EPSP_Synthase promoter (5-enolpyruvylshikimate-3-phosphate synthase gene promoter from Petunia hybrida, Acc.-No. M37029, base pair 1 to 1788), the PDS promoter (Phytoene desaturase gene promoter from Solanum lycopersicum, Acc.-No. U46919, base pair 1 to 2078), the DFR-A promoter (dihydroflavonol 4-reductase gene A promoter from Petunia hybrida, Acc.-No. X79723 , Base pair 32 to 1902) or the FBP1 promoter (floral binding protein 1 gene promoter from Petunia hybrida, Acc.-No. L10115, base pair 52 to 1069).

Anther-specific promoters are, for example, the 5126-

Promoter (US 5,689,049, US 5,689,051), the glob-l promoter or the g-zein promoter.

Seed-specific promoters are, for example, the ACP05 promoter (acyl carrier protein gene, W09218634), the promoters AtS1 and AtS3 from Arabidopsis (WO 9920775), the LeB4 promoter from Vicia faba (WO 9729200 and US 06403371), the napin Promoter from Brassica napus (US 5608152; EP 255378; US 5420034), the SBP promoter from Vicia faba (DE 9903432) or the corn promoters End1 and End2 (WO 0011177).

Further promoters suitable for expression in plants are described in Rogers et al. (1987) Meth in Enzymol 153: 253-277; Schardl et al. (1987) Gene 61: 1-11 and Berger et al. (1989) Proc Natl Acad Sei USA 86: 8402-8406).

In the method according to the invention, particular preference is given to constitutive, seed-specific, fruit-specific, flower-specific and in particular flower-leaf-specific promoters.

An expression cassette is preferably produced by fusing a suitable promoter with at least one of the effects described above. ne, and preferably a nucleic acid inserted between promoter and nucleic acid sequence, which codes for a plastid-specific transit peptide, and a polyadenylation signal according to common recombination and cloning techniques, as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning : A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel , FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).

The preferably inserted nucleic acids encoding a plastid transit peptide ensure localization in plastids and in particular in chromoplasts.

Expression cassettes, the nucleic acid sequence of which codes for an effect gene-product fusion protein, can also be used, part of the fusion protein being a transit peptide which controls the translocation of the polypeptide. Preferred transit peptides are preferred for the chromoplasts, which are split off enzymatically from the effect gene product part after translocation of the effect genes into the chromoplasts.

The transit peptide which is derived from the plastid Nicotiana tabacum transketolase or another transit peptide (for example the transit peptide of the small subunit of the Rubisco (rbcS) or the ferredoxin NADP oxidoreductase as well as the isopentenyl pyrophosphate isomerase-2) or its functional equivalent is particularly preferred ,

Nucleic acid sequences of three cassettes of the plastid transit peptide of plastid transketolase from tobacco in three reading frames are particularly preferred as Kpnl / BamHI fragments with an ATG codon in the Ncol interface:

pTP09

Kpnl_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTC GTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CAC MIM CCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGC- GATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGG- GATCC Bam PTP10

Kpnl_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTC GTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CACTTTTTCCGGCCTTAAATCCAATCCCAATATCACCACCTCCCGCCGCCG- TACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGGTCACCGGC- GATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGCTG- GATCC_BamHI

pTP11

Kpnl_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTC GTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCT- CACTTTTTCCGGCCTTAAATCCAATCCCACCCCCCCCCCCCCCGCCCCTACCGCCCC

GATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGG- GATCC_BamHI

Further examples of a plastid transit peptide are the transit peptide of plastid isopentenyl pyrophosphate isomerase-2 (IPP-2) from Arabisopsis thaliana and the transit peptide of the small subunit of ribulose bisphosphate carboxylase (rbcS) from pea (Guerineau, F, Woolston, S Brooks, L, Mullineaux, P (1988) An expression casette for targeting foreign proteins into the chloroplasts. Nucl. Acids Res. 16: 11380).

The nucleic acids according to the invention can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural nucleic acid constituents, and can consist of different heterologous gene segments from different organisms.

As described above, preference is given to synthetic nucleotide sequences with codons which are preferred by plants. These plant-preferred codons can be determined from the highest protein frequency codons expressed in most interesting plant species.

When preparing an expression cassette, various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame. To connect the DNA fragments to one another, adapters or linkers can be attached to the fragments. The promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction sites for the insertion of this sequence. As a rule, the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. In general, the linker has a size of less than 100 bp within the regulatory areas, often less than 60 bp, but at least 5 bp. The promoter can be native or homologous as well as foreign or heterologous to the host plant. The expression cassette preferably contains, in the 5'-3 'transcription direction, the promoter, a coding nucleic acid sequence or a nucleic acid construct and a region for the transcriptional termination. Different termination areas are interchangeable.

Examples of a terminator are the 35S terminator (Guerineau et al. (1988) Nucl Acids Res. 16: 11380), the nos terminator (Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM. Nopaline synthase: transeript mapping and DNA sequence. J Mol Appl Genet. 1982; 1 (6): 561-73) or the ocs terminator (Gielen, J, de Beuckeleer, M, Seurinck, J, Debroek, H, de Greve, H, Lemmers , M, van Montagu, M, Schell, J (1984) The complete sequence of the TL-DNA of the Agrobacterium tumefaciens plasmid pTiAchδ. EMBO J. 3: 835-846).

Manipulations which provide suitable restriction sites or which remove superfluous DNA or restriction sites can also be used. Where insertions, deletions or substitutions such as Transitions and transversions can be used in wϊro mutagenesis, "primer repair", restriction or ligation.

With suitable manipulations, e.g. Restriction, "chewing-back" or filling of overhangs for "bluntends", complementary ends of the fragments can be made available for the ligation.

Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) of the ti plasmid pTiACHδ (Gielen et al., EMBO J. 3 ( 1984), 835 ff) or functional equivalents.

The transfer of foreign genes into the genome of a plant is called transformation. Methods known per se for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation can be used for this purpose.

Suitable methods for the transformation of plants are the protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene cannon - the so-called "particle bombardment" method, the electroporation, the incubation of dry embryos in DNA-containing solution, the Microinjection and the Agrobacterium-mediated gene transfer described above. The methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene

Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S.D. Kung and R. Wu, Academic Press (1993), 128-143 and in Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225).

The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711) or particularly preferably pSUN2, pSUN3, pSUN4 or pSUN5 (WO 02/00900).

Agrobacteria transformed with an expression plasmid can be used in a known manner to transform plants, e.g. by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

For the preferred production of genetically modified plants, hereinafter also referred to as transgenic plants, the fused expression cassette is cloned into a vector, for example pBin19 or in particular pSUN5 and pSUN3, which is suitable for being transformed into Agrobacterium tumefaciens. Agrobacteria transformed with such a vector can then be used in a known manner to transform plants, in particular crop plants, for example by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

The transformation of plants by agrobacteria is known, inter alia, from FF White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Academic Press, 1993, pp. 15-38. Transgenic plants which contain one or more genes integrated into the expression cassette can be regenerated in a known manner from the transformed cells of the wounded leaves or leaf pieces. To transform a host plant with one or more effect genes according to the invention, an expression cassette is inserted as an insert into a recombinant vector whose vector DNA contains additional functional regulatory signals, for example sequences for replication or integration. Suitable vectors are inter alia in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, pp. 71-119 (1993).

Using the recombination and cloning techniques cited above, the expression cassettes can be cloned into suitable vectors which allow their multiplication, for example in E. coli. Suitable cloning vectors include pJIT117 (Guerineau et al. (1988) Nucl. Acids Res. 16: 11380), pBR332, pUC series, M13mp series and pACYC184. Binary vectors which can replicate both in E. coli and in agrobacteria are particularly suitable.

In the following, the production of genetically modified microorganisms according to the invention with increased or caused ketolase activity and increased or caused β-cyclase activity is described in more detail, the changed β-cyclase activity being caused by a β-cyclase containing the amino acid sequence SEQ , ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

Increasing other activities such as hydroxylase activity, HMG-CoA reductase activity, (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, 1-deoxy-D-xylose 5-phosphate synthase activity, 1-deoxy-D-xylose-5-

Phosphate reductoisomerase activity, isopentenyl diphosphate Δ isomerase activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity, geranyl geranyl diphosphate synthase activity, phytoene synthase activity, Phytoene desaturase activity, zeta-carotene desaturase activity, crtlSO activity, FtsZ activity and / or Min D activity can be carried out analogously using the corresponding effect genes.

The nucleic acids described above, encoding a ketolase, β-hydroxylase or β-cyclase, and the nucleic acids encoding an HMG-CoA reductase, nucleic acids encoding an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate

Reductase, nucleic acids encoding a 1-deoxy-D-xylose-5-phosphate synthase, nucleic acids encoding a 1-deoxy-D-xylose-5-phosphate reductoisomerase, nucleic acids encoding an isopentenyl-diphosphate-Δ-isomerase, nucleic acids encoding one Geranyl diphosphate synthase, nucleic acids encoding a farnesyl diphosphate synthase, nucleic acids encoding a geranyl geranyl diphosphate synthase, nucleic acids encoding a phytoene synthase, encoding nucleic acids linseed acids encoding a phytoene synthase, nucleic acids encoding a phytoene desaturase, nucleic acids encoding a zeta-carotene desaturase, nucleic acids encoding a crtlSO protein, nucleic acids encoding an FtsZ protein and / or nucleic acids encoding a MinD protein are preferably incorporated into expression constructs the genetic control of regulatory nucleic acid sequences is a nucleic acid sequence coding for an enzyme according to the invention; and vectors comprising at least one of these expression constructs.

Such constructs according to the invention preferably comprise a promoter 5 'upstream of the respective coding sequence and a terminator sequence 3' downstream and, if appropriate, further customary regulatory elements, in each case operatively linked to the effect gene. An “operative linkage” is understood to mean the sequential arrangement of promoter, coding sequence (effect gene), terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can perform its function as intended in the expression of the coding sequence.

Examples of sequences which can be linked operatively are targeting sequences and translation enhancers, enhancers, polyadenylation signals and the like. Further regulatory elements include selectable markers, amplification signals, origins of replication and the like.

In addition to the artificial regulation sequences, the natural regulation sequence can still be present before the actual effect gene. This natural regulation can possibly be switched off by genetic modification and the expression of the genes increased or decreased. However, the gene construct can also have a simpler structure, ie no additional regulation signals are inserted in front of the structural gene and the natural promoter with its regulation is not removed. Instead, the natural regulatory sequence is mutated so that regulation no longer takes place and gene expression is increased or decreased. The nucleic acid sequences can be contained in one or more copies in the gene construct.

Examples of useful promoters in microorganisms are: cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac-, Ipp-lac-, laclq-, T7-, T5-, T3-, gal- , trc, ara, SP6, lambda PR or in the lambda PL promoter, which are advantageously used in gram-negative bacteria; as well as the gram-positive promoters amy and SP02 or the yeast promoters ADC1, MFa, AC, P-60, CYC1, GAPDH. The use of inducible promoters, such as, for example, light-inducible and in particular temperature-inducible, is particularly preferred Promoters, such as the P _r P _r promoter.

In principle, all natural promoters with their regulatory sequences can be used. In addition, synthetic promoters can also be used advantageously.

The regulatory sequences mentioned are intended to enable the targeted expression of the nucleic acid sequences and the protein expression. Depending on the host organism, this can mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.

The regulatory sequences or factors can preferably have a positive influence on the expression and thereby increase or decrease it. Thus, the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or "enhancers". In addition, an increase in translation is also possible, for example, by improving the stability of the mRNA.

An expression cassette is produced by fusing a suitable promoter with the nucleic acid sequences described above, encoding a ketolase, β-hydroxylase, β-cyclase, HMG-CoA reductase, (E) -4-hydroxy-3-methylbut-2- enyl diphosphate reductase, 1-deoxy-D-xylose-5-phosphate synthase, 1 - deoxy-D-xylose-5-phosphate reductoisomerase, isopentenyl diphosphate Δ isomerase, geranyl diphosphate synthase, farnesyl Diphosphate synthase, geranyl-geranyl diphosphate synthase, phytoene synthase, phytoene desaturase, zeta-carotene desaturase, crtlSO protein, FtsZ protein and / or a MinD protein and a terminator or polyadenylation signal. Common recombination and cloning techniques are used, such as those described in T. Maniatis, EF Fritsch and J. - Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987). For expression in a suitable host organism, the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector which enables optimal expression of the genes in the host. Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels PH et al., Ed., Elsevier, Amsterdam-New York-Oxford, 1985). In addition to plasmids, vectors are also known to all those skilled in the art. To understand vectors such as phages, viruses such as SV40, CMV, baculovirus and adevirus, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. These vectors can be replicated autonomously in the host organism or replicated chromosomally.

The following may be mentioned as examples of suitable expression vectors:

Common fusion expression vectors such as pGEX (Pharmacia Biotech Ine; Smith, DB and Johnson, KS (1988) Gene 67: 31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT 5 (Pharmacia, Piscataway, NJ) which glutathione-S-transferase (GST), maltose E-binding protein or protein A is fused to the recombinant target protein.

Non-fusion protein expression vectors such as pTrc (Amann et al., (1988) Gene 69: 301-315) and pET 11d (Studier et al. Gene Expression Technology: Methods in

Enzymology 185, Academic Press, San Diego, California (1990) 60-89) or pBluescript and pUC vectors.

Yeast expression vector for expression in the yeast S. cerevisiae, such as pYepSed (Baldari et al., (1987) Embo J. 6: 229-234), pMFa (Kurjan and Herskowitz (1982) Cell

30: 933-943), pJRY88 (Schultz et al. (1987) Gene 54: 1 13-123) and pYES2 (Invitrogen Corporation, San Diego, CA).

Vectors and methods of constructing vectors suitable for use in other fungi such as filamentous fungi include those described in detail in: van den Hondel, C.A.M.J.J. & Punt, P.J. (1991) "Gene transfer Systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, J.F. Peberdy et al., Eds., Pp. 1-28, Cambridge University Press: Cambridge.

Baculovirus vectors available for expression of proteins in cultured insect cells (e.g. Sf9 cells) include the pAc series (Smith et al., (1983) Mol. Cell Biol .. 3: 2156-2165) and pVL series (Lucklow and Summers (1989) Virology 170: 31-39).

Further suitable expression systems for prokaryotic and eukaryotic cells are in chapters 16 and 17 of Sambrook, J., Fritsch, EF and Maniatis, T., Molecular cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press , Cold Spring Harbor, NY, 1989. The expression constructs or vectors according to the invention can be used to produce genetically modified microorganisms which have been transformed, for example, with at least one vector according to the invention.

The recombinant constructs according to the invention described above are advantageously introduced and expressed in a suitable host system. Common cloning and transfection methods known to the person skilled in the art, such as, for example, co-precipitation, protoplast fusion, electroporation, retroviral transfection and the like, are preferably used to bring the nucleic acids mentioned into expression in the respective expression system. Suitable systems are described, for example, in Current Protocols in Molecular Biology, F. Ausubel et al., Ed., Wiley Interscience, New York 1997.

Successfully transformed organisms can be selected using marker genes, which are also contained in the vector or in the expression cassette. Examples of such marker genes are genes for antibiotic resistance and for enzymes which catalyze a coloring reaction which stains the transformed cell. These can then be selected using automatic cell sorting.

Microorganisms successfully transformed with a vector and carrying an appropriate antibiotic resistance gene (e.g. G418 or hygromycin) can be selected using appropriate antibiotic-containing media or nutrient media. Marker proteins that are presented on the cell surface can be used for selection by means of affinity chromatography.

The combination of the host organisms and the vectors which match the organisms, such as plasmids, viruses or phages, such as, for example, plasmids with the RNA polymerase / promoter system, which forms phages 8 or other temperate phages or transposons and / or further advantageous regulatory sequences an expression system.

The invention further relates to the genetically modified, non-human organisms, the genetic modification being the activity of a ketolase

A in the event that the wild-type organism already has ketolase activity, increased compared to the wild-type and

B if the wild-type organism has no ketolase activity against the wild-type, and wherein the genetic modification is the activity of a β-cyclase

C in the event that the wild-type organism already has a β-cyclase activity, increased compared to the wild-type and

D in the event that the wild-type organism has no β-cyclase activity compared to the wild-type

and the β-cyclase activity increased after C or caused after D is caused by a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

As stated above, the ketolase activity is increased (according to A) or caused (according to B) compared to the wild type, preferably by increasing the gene expression of a nucleic acid encoding a ketolase.

In this embodiment, the transgenic organisms according to the invention therefore have at least one further ketolase gene compared to the wild type. In this embodiment, the genetically modified organism according to the invention preferably has at least one exogenous (= heterologous) nucleic acid, coding for a ketolase, or at least two endogenous nucleic acids, coding for a ketolase:

In principle, any ketolase gene, that is to say any nucleic acids encoding a ketolase, can be used for this purpose.

Preferred nucleic acids encoding a ketolase are described above in the method according to the invention.

The β-cyclase activity is preferably increased or caused, as described above, by increasing the gene expression compared to the wild type of nucleic acids, coding for a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% Amino acid level with the sequence SEQ. ID. NO. 2 has.

In this embodiment, the transgenic organisms according to the invention therefore have at least one further β-cyclase gene compared to the wild type. In this embodiment, the genetically modified organism according to the invention preferably has at least one exogenous (= heterologous) nucleic acid coding for a β-cyclase or at least two endogenous nucleic acids coding for a β-cyclase.

In principle, any β-cyclase gene, that is to say any nucleic acid encoding a β-cyclase, containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has to be used.

Preferred β-cyclase genes are described above.

As mentioned above, particularly preferred, genetically modified organisms additionally have an increased or caused hydroxlase activity compared to the wild-type organism. Further preferred embodiments are described above in the method according to the invention.

As mentioned above, further, particularly preferred, genetically modified non-human organisms additionally have at least one further increased activity compared to the wild type, selected from the group HMG-CoA reductase activity, (E) - 4-hydroxy-3-methylbut - 2-enyl-diphosphate reductase activity, 1-deoxy-D-xylose-5-phosphate synthase activity, 1-deoxy-D-xylose-5-phosphate reductoisomerase activity, isopentenyl-diphosphate-Δ-isomerase -Activity, geranyl diphosphate synthase activity, farnesyl diphosphate synthase activity, geranyl geranyl diphosphate synthase activity, phytoene synthase activity, phytoene desaturase activity, zeta-carotene desaturase activity, crtlSO Activity, FtsZ activity and MinD activity. Further preferred embodiments are described above in the process according to the invention. According to the invention, organisms are preferably understood to mean organisms which, as wild-type or starting organisms, naturally or by genetic complementation and / or reorganization of the metabolic pathways, are capable of producing carotenoids, in particular β-carotene and / or zeaxanthin and / or neoxanthine and / or violaxanthin and / or to produce lutein.

Further preferred organisms already have hydroxylase activity as wild-type or starting organisms and are therefore capable of producing zeaxanthin as wild-type or starting organisms.

Preferred organisms are plants or microorganisms, such as bacteria, yeasts, algae or fungi.

Both bacteria can be used as bacteria that are able to synthesize xanthophylls due to the introduction of genes of the carotenoid biosynthesis of a carotenoid-producing organism, such as bacteria of the genus Escherichia, which contain, for example, crt genes from Erwinia, as well as bacteria. which are capable of synthesizing xanthophylls, such as, for example, bacteria of the genus Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Paracoccus, Nostoc or cyanobacteria of the genus Synechocystis.

Preferred algae are green algae, such as algae of the genus Haematococcus, Phaedactylum tricomatum, Volvox or Dunaliella. Particularly preferred algae are Haematococcus puvialis or Dunaliella bardawil. Further useful microorganisms and their preparation for carrying out the method according to the invention are known, for example, from DE-A-199 16 140, to which reference is hereby made.

Particularly preferred plants are plants selected from the families amateur ranthaceae.Amaryllidaceae, Apocynaceae, Asteraceae, Balsaminaceae Begoniaceae, Berberidaceae, Brassicaceae.Cannabaceae, Caprifoliaceae, Caryophyllaceae, Chemischen nopodiaceae, Compositae, Cucurbitaceae, Cruciferae, Euphorbiaceae, Fabaceae, Gentianaceae, Geraniaceae , Graminae, liliaceae, Labiatae, Lamiaceae, Leguminosae, Liliaceae, Linaceae, Lobeliaceae, Malvaceae, Oleaceae, Orchidaceae, Papaveraceae, Plumbaginaceae, Poaceae, Polemoniaceae, Primulacaceae, Roseaaceae, Rosunceae , Vitaceae and Violaceae.

Very particularly preferred plants are selected from the group of the plant genera Marigold, Tagetes Errecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aquilegia, Aster, Astragalus, Bignonia, Calendula, Caltha, Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum , Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythie, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gerbera, Geum, Grevillaea, Helenium, Helianthus, Hepatica , Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kenya, Laburnum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcissus, Oenothera, Osiaanthus , Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ranunculus, Rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, U lex, viola or zinnia, particularly preferably selected from the group of the plant genera Marigold, Tagetes erecta, Tagetes patula, Lycopersicon, Rosa, Calendula, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium, Tropaeolum or Adonis.

Very particularly preferred genetically modified plants are selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Adonis, Lycopersicon, Rosa, Calendula, Physalis, Medicago, Helianthus, Chrysanthemum, Aster, Tulipa, Narcissus, Petunia, Geranium or Tropaeolum, whereby the genetically modified plant contains at least one transgenic nucleic acid encoding a ketolase.

The transgenic plants, their reproductive material and their plant cells, tissue or parts, in particular their fruits, seeds, flowers and petals are another object of the present invention.

As described above, the genetically modified plants can be used to produce ketocarotenoids, in particular astaxanthin.

Genetically modified organisms according to the invention, in particular plants or parts of plants, such as, in particular, petals with an increased content of ketocarotenoids, in particular astaxanthin, which can be consumed by humans and animals can also be used, for example, directly or after processing known per se as food or feed or as feed and food supplements.

Furthermore, the genetically modified organisms can be used for the production of ketocarotenoid-containing extracts of the organisms and / or for the production of feed and food supplements.

The genetically modified organisms have an increased ketocarotenoid content compared to the wild type.

An increased ketocarotenoid content is generally understood to mean an increased total ketocarotenoid content.

An increased content of ketocarotenoids is also understood to mean, in particular, a changed content of the preferred ketocarotenoids, without the total carotenoid content necessarily having to be increased.

In a particularly preferred embodiment, the genetically modified plants according to the invention have an increased astaxanthin content compared to the wild type.

In this case, an increased content is also understood to mean a caused content of ketocarotenoids or astaxanthin.

The invention is illustrated by the following examples, but is not limited to these:

General experimental conditions: Sequence analysis of recombinant DNA

The sequencing of recombinant DNA molecules was carried out using a laser fluorescence DNA sequencer from Licor (distributed by MWG Biotech, Ebersbach) according to the Sanger's method (Sanger et al., Proc. Natl. Acad. Sci. USA 74 (1977), 5463-5467).

Example 1 :

Amplification of a DNA that contains the entire primary sequence of the NOST ketolase from Nostoc sp. PCC 7120 coded

The DNA required for the NOST ketolase from Nostoc sp. PCC 7120 coded, was by means of PCR from Nostoc sp. PCC 7120 (strain of the "Pasteur Culture Collection of Cyanobacterium") amplified.

For the preparation of genomic DNA from a suspension culture from Nostoc sp. PCC 7120, the 1 week with constant light and constant shaking (150 rpm) at 25 ° C in BG 11 medium (1.5 g / l NaN03, 0.04 g / l K2P04x3H20, 0.075 g / l MgS04xH20, 0.036 g / l CaCI2x2H20, 0.006 g / l citric acid, 0.006 g / l ferric ammonium citrate, 0.001 g / l EDTA disodium magnesium, 0.04 g / l Na2C03, 1ml trace metal mix "A5 + Co" (2.86 g / l

H3B03, 1.81 g / l MnCI2x4H2o, 0.222 g / l ZnSO4x7H2o, 0.39 g / l NaMo04X2H20, 0.079 g / l CuS04x5H20, 0.0494 g / l Co (N03) 2x6H20)), the cells were harvested by centrifugation nitrogen, harvested by centrifugation nitrogen frozen and pulverized in a mortar.

Protocol for DNA isolation from Nostoc PCC7120:

The bacterial cells were pelleted from a 10 ml liquid culture by centrifugation at 8,000 rpm for 10 minutes. The bacterial cells were then crushed and ground in liquid nitrogen using a mortar. The cell material was resuspended in 1 ml of 10 mM Tris HCl (pH 7.5) and transferred to an Eppendorf reaction vessel (2 ml volume). After adding 100 μl Proteinase K (concentration: 20 mg / ml), the cell suspension was incubated for 3 hours at 37 ° C. The suspension was then extracted with 500 μl of phenol. After centrifugation at 13,000 rpm for δ minutes, the upper, aqueous phase was transferred to a new 2 ml Eppendorf reaction vessel. The extraction with phenol was repeated 3 times. The DNA was precipitated by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 0.6 volume of isopropanol and then washed with 70% ethanol. The DNA pellet was dried at room temperature, taken up in 25 μl of water and dissolved with heating to 65 ° C.

The nucleic acid encoding a ketolase from Nostoc PCC 7120 was determined by means of a "polymerase chain reaction" (PCR) from Nostoc sp. PCC 7120 using a sense-specific primer (NOSTF, SEQ ID No. 79) and an antisense specific primers (NOSTG SEQ ID No. 80).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture which contained:

- 1 ul of a Nostoc sp. PCC 7120 DNA (prepared as described above) - 0.25 mM dNTPs

- 0.2 mM NOSTF (SEQ ID No. 79)

- 0.2 mM NOSTG (SEQ ID No. 80)

- 5 ul 10X PCR buffer (TAKARA)

- 0.25 ul R Taq polymerase (TAKARA) - 25.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X 94 ° C 2 minutes 35X94 ° C 1 minute 55 ° C 1 minute 72 ° C 3 minutes 1X72 ° C 10 minutes

PCR amplification with SEQ ID No. 79 and SEQ ID No. 80 resulted in an 805 bp fragment which codes for a protein consisting of the entire primary sequence (SEQ ID No. 81). Using standard methods, the amplificate was cloned into the PCR cloning vector pGEM-T (Promega) and the clone pNOSTF-G was obtained.

Sequencing of the clone pNOSTF-G with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence from 88.886-89.662 of the database entry AP003592. This nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nostoc sp. PCC 7120.

This clone pNOSTF-G was therefore used for the cloning into the expression vector pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380). The cloning was carried out by isolating the 799 bp Sphl fragment from pNOSTF-G and ligating into the SphI-cut vector pJIT117. The clone that is the ketolase from Nostoc sp. PCC 7120, in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide, is called pJNOST.

Example 2: Construction of the plasmid pMCL-CrtYlBZ idi / gps for the synthesis of zeaxanthin in E. coli

PMCL-CrtYlBZ / idi / gps was constructed in three steps using the intermediate stages pMCL-CrtYlBZ and pMCL-CrtYlBZ / idi. The plasmid pMCL200 compatible with high-copy-number vectors was used as the vector (Nakano, Y., Yoshida, Y., Yamashita, Y. and Koga, T .; Construction of a series of pACYC-derived plasmid vectors; Gene 162 ( 1995), 157-158).

Example 2.1 .: Construction of pMCL-CrtYlBZ The biosynthetic genes crtY, crtB, crtl and crtZ come from the bacterium Erwinia uredovora and were amplified by PCR. Erwinia uredovora genomic DNA (DSM 30080) was prepared by the German Collection of Microorganisms and Cell Culture (DSMZ, Braunschweig) as part of a service. The PCR reaction was carried out according to the manufacturer's instructions (Röche, Long Template PCR: Procedure for amplification of 5-20 kb targets with the expand long template PCR system). The PCR conditions for the amplification of the Erwinia uredovora biosynthesis cluster were as follows:

Master Mix 1:

- 1.75 ul dNTPs (final concentration 350 μM)

- 0.3 μM primer Crt1 (SEQ ID No. 82)

- 0.3 μM primer Crt2 (SEQ ID No. 83)

- 250-500ng genomic DNA from DSM 30080 Aq. Dest. Up to a total volume of 50 μl

Master Mix 2:

- 5 ul 10x PCR buffer 1 (final concentration 1x, with 1.75 mM Mg2 +) - 10x PCR buffer 2 (final concentration 1x, with 2.25 mM Mg2 +)

- 10x PCR buffer 3 (final concentration 1x, with 2.25 mM Mg2 +)

- 0.75 ul Expand Long Template Enzyme Mix (final concentration 2.6 units) Aq. Dest. Up to a total volume of 50 μl The two approaches "Master Mix 1" and "Master Mix 2" were pipetted together. The PCR was carried out in a total volume of 50 μl under the following cycle conditions:

1X94 ° C 2 minutes 30X94 ° C 30 seconds 58 ° C 1 minute 68 ° C 4 minutes 1X72 ° C 10 minutes

PCR amplification with SEQ ID No. 82 and SEQ ID No. 83 resulted in a fragment (SEQ ID NO: 84) which is responsible for the genes CrtY (protein: SEQ ID NO: 85), CrtI (protein: SEQ ID NO: 86), crtB (protein: SEQ ID NO: 87) and CrtZ (iDNA) encoded. Using standard methods, the amplificate was cloned into the PCR cloning vector pCR2.1 (Invitrogen) and the clone pCR2.1-CrtYIBZ was obtained.

The plasmid pCR2.1-CrtYIBZ was cut Sall and Hindill, the resulting Sall / Hindlll fragment isolated and transferred by ligation into the Sall / Hindlll cut vector pMCL200. The Sall / Hindlll fragment from pCR2.1-CrtYIBZ cloned in pMCL 200 is 4624 bp long, codes for the genes CrtY, CrtI, crtB and CrtZ and corresponds to the sequence from positions 2295 to 6918 in D90087 (SEQ ID No. 84). The gene CrtZ is transcribed against the reading direction of the genes CrtY, CrtI and CrtB by means of its endogenous promoter. The resulting clone is called pMCL-CrtYlBZ.

Example 2.2 .: Construction of pMCL-CrtYlBZ / idi

The gene ^ (isopentenyl diphosphate isomerase; IPP isomerase) was amplified from E. coli by means of PCR. The nucleic acid encoding the entire idi gene with idi promoter and ribosome binding site was extracted from E. coli by means of "polymerase chain reaction" (PCR) using a sense-specific primer (5'-idi SEQ ID No. 88) and an antisense-specific primer (3'-idi SEQ ID No. 89) was amplified.

The PCR conditions were as follows:

The PCR for the amplification of the DNA was carried out in a 50 μl reaction mixture, which contained:

- 1 ul of a £. coli TOP10 suspension

- 0.25 mM dNTPs

- 0.2 mM 5'-idi (SEQ ID No. 88) - 0.2 mM 3'-idi (SEQ ID No. 89) - 5 ul 10X PCR buffer (TAKARA)

- 0.25 ul R Taq polymerase (TAKARA)

- 28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X94 ° C 2 minutes 20X94 ° C 1 minute 62 ° C1 minute 72 ° C 1 minute

1X72 ° C 10 minutes

PCR amplification with SEQ ID No. 88 and SEQ ID No. 89 resulted in a 679 bp fragment coding for a protein consisting of the entire primary sequence (SEQ ID No. 90). Using standard methods, the amplificate was cloned into the PCR cloning vector pCR2.1 (Invitrogen) and the clone pCR2.1-idi was obtained.

Sequencing of the clone pCR2.1-idi confirmed a sequence that does not differ from the published sequence AE000372 in position 8774 to position 9440. This region includes the promoter region, the potential ribosome binding site and the entire "open reading frame" for the IPP isomerase. The fragment cloned in pCR2.1-idi has a total length of 679 bp by inserting an Xhol site at the 5 'end and a SalI site at the 3' end of the / oY gene.

This clone was therefore used for the cloning of the / oY gene in the vector pMCL-CrtYlBZ. The cloning was carried out by isolating the Xhol / Sall fragment from pCR2.1-idi and ligating into the Xhol / Sall cut vector pMCL-CrtYlBZ. The resulting clone is called pMCL-CrtYlBZ / idi.

Example 2.3 .: Construction of pMCL-CrtYlBZ / idi / gps

The gene gps (geranylgeranyl pyrophosphate synthase; GGPP synthase) was amplified from Archaeoglobus fulgidus by means of PCR. The nucleic acid, encoding gps from Archaeoglobus fulgidus, was determined using a "polymerase chain reaction" (PCR) using a sense-specific primer (5'-gps SEQ ID No. 92) and an antisense-specific primer (3 ' -gps SEQ ID No. 93).

The DNA of Archaeoglobus fulgidus was prepared by the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig) as part of a service. The PCR conditions were as follows: The PCR for the amplification of the DNA, which codes for a GGPP synthase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture which contained:

- 1 µl of Archaeoglobus fulgidus DNA

- 0.25 mM dNTPs

- 0.2 mM 5'-gps (SEQ ID No. 92)

- 0.2 mM 3'-gps (SEQ ID No. 93) - 5 ul 10X PCR buffer (TAKARA)

- 0.25 ul R Taq polymerase (TAKARA)

- 28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X94 ° C 2 minutes 20X94 ° C 1 minute 56 ° C 1 minute 72 ° C 1 minute 1X72 ° C 10 minutes

Using PCR and the primers SEQ ID No. 92 and SEQ ID No. 93 amplified DNA fragments were eluted from the agarose gel using known methods and cut with the restriction enzymes Ncol and Hindill. This results in a 962 bp fragment which codes for a protein consisting of the entire primary sequence (SEQ ID No. 94). Using standard methods, the Ncol / HindIII cut amplificate was cloned into the vector pCB97-30 and the clone pCB-gps was obtained.

Sequencing of the clone pCB-gps confirmed a sequence for the GGPP synthase from A. fulgidus, which differs from the published sequence AF120272 in one nucleotide. The second codon of the GGPP synthase was changed by inserting an Ncol site in the grps gene. In the published sequence AF120272, CTG (position 4-6) codes for leucine. By amplification with the two primers SEQ ID No. 92 and SEQ ID No. In 93 this second codon was changed to GTG, which codes for valine.

The clone pCB-gps was therefore used for the cloning of the gps gene into the vector pMCL-CrtYlBZ / idi. The cloning was carried out by isolating the Kpnl / Xhol fragment from pCB-gps and ligation into the Kpnl and Xhol cut vector pMCL-CrtYlBZ / idi. The cloned Kpnl / Xhol fragment (SEQ ID No. 94) carries the Prm16 promoter together with a minimal 5 'UTR sequence of rbcL, the first 6 codons of rbcL, which extend the GGPP synthase N-terminally and 3 'from the gps gene the psbA sequence. The N-terminus of the GGPP synthase thus has the changed amino acid sequence Met-Thr-Pro-Gln-Thr-Ala-Met instead of the natural amino acid sequence with Met-Leu-Lys-Glu (amino acid 1 to 4 from AF120272) -Val-Lys- Glu. As a result, the recombinant GGPP synthase, starting with Lys in position 3 (in AF120272), is identical and has no further changes in the amino acid sequence. The rbcL and psbA sequences were based on a reference according to EibI et al. (Plant J. 19. (1999), 1-13). The resulting clone is called pMCL-CrtYlBZ / idi / gps.

Example 3:

Biotransformation of zeaxanthin in recombinant E. coli strains

Recombinant £ were used for zeaxanthin biotransformation. co // - strains produced which are capable of producing zeaxanthin by heterologous complementation. Strains of E. coli TOP10 were used as host cells for the complementation experiments with the plasmids pNOSTF-G and pMCL-CrtYlBZ / idi / gps.

The plasmid pMCL-CrtYlBZ idi / gps was constructed to produce E. co // strains which enable the synthesis of zeaxanthin in high concentration. The plasmid carries the genes crtY, crtB, crtl and crtY from Erwinia uredovora, the gene gps (for geranylgeranyl pyrophoshate synthastase) from Archaeoglobus fulgidus and the gene idi (isopentenyl diphosphate isomerase) from E. coli. Limiting steps for a high accumulation of carotenoids and their biosynthetic precursors were eliminated with this construct. This was previously reported by Wang et al. similarly described with several plasmids (Wang, C.-W., Oh, M.-K. and Liao, JC; engineered isoprenoid pathway enhancements astaxanthin production in Escherichia coli, Biotechnology and Bioengineering 62 (1999), 235-241).

Cultures of E. coli TOP10 were transformed in a manner known per se with the two plasmids pNOSTF-G and pMCL-CrtYlBZ / idi / gps and cultured in LB medium at 30 ° C. and 37 ° C. overnight. Ampicillin (50 μg / ml), chloramphenicol (50 μg / ml) and isopropyl-β-thiogalactoside (1 mmol) were also added overnight in a conventional manner.

To isolate the carotenoids from the recombinant strains, the cells were extracted with acetone, the organic solvent was evaporated to dryness and the Ca Rotinoids separated by HPLC on a C30 column. The following process conditions were set.

Separation column: Prontosil C30 column, 250 x 4.6 mm, (Bischoff, Leonberg) Flow rate: 1.0 ml / min Eluents: mobile solvent A - 100% methanol mobile solvent B - 80% methanol, 0.2% ammonium acetate mobile solvent C - 100% t- Butyl methyl ether gradient profile:

Detection: 300 - 500 nm The spectra were determined directly from the elution peaks using a photodiode array detector. The isolated substances were identified by their absorption spectra and their retention times in comparison to standard samples.

Example 4

Analogously to the preceding examples, an E.co// strain was produced which contains a ketolase from Haematococcus pluvialis Flotow em. Will expressed. For this purpose, the cDNA which is responsible for the entire primary sequence of the ketolase from Haematococcus pluvialis Flotow em. Will is coded amplified and cloned into the same expression vector according to Example 1.

The cDNA coding for the ketolase from Haematococcus pluvialis was amplified by means of PCR from a Haematococcus pluvialis (strain 192.80 from the "Collection of algal cultures of the University of Göttingen") suspension culture. For the preparation of total RNA from a suspension culture of Haematococcus pluvialis (strain 192.80), which was exposed to indirect daylight at room temperature in Haematococ cus medium (1.2 g / l sodium acetate, 2 g / l yeast extract, 0.2 g / l MgCI2x6H20, 0.02 CaCI2x2H20; pH 6.8; after autoclaving, 400 mg / l L-asparagine, 10 mg / l FeS04xH20) had been grown the cells are harvested, frozen in liquid nitrogen and pulverized in a mortar. Then 100 mg of the frozen, powdered algae cells were transferred to a reaction vessel and taken up in 0.8 ml of Trizol buffer (Life Technologies). The suspension was extracted with 0.2 ml chloroform. After centrifugation at 12,000 g for 15 minutes, the aqueous supernatant was removed and transferred to a new reaction vessel and extracted with a volume of ethanol. The RNA was precipitated with a volume of isopropanol, washed with 75% ethanol and the pellet was dissolved in DEPC water (overnight incubation of water with 1/1000 volume of diethyl pyrocarbonate at room temperature, then autoclaved). The RNA concentration was determined photometrically.

For the cDNA synthesis, 2.5 μg of total RNA were denatured for 10 min at 60 ° C., cooled on ice for 2 min and using a cDNA kit (ready-to-go-you-prime beads, Pharmacia Biotech) according to the manufacturer's instructions rewritten into cDNA using an antisense specific primer PR1 (gcaagctcga cagctacaaa cc).

The nucleic acid encoding a kematolase from Haematococcus pluvialis (strain 192.80) was amplified by means of a polymerase chain reaction (PCR) from Haematococcus pluvialis using a sense-specific primer PR2 (gaagcatgca gctagcagcg acag) and an antisense-specific primer PR1.

The PCR conditions were as follows:

The PCR for the amplification of the cDNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 ml reaction mixture which contained:

4 ml of a Haematococcus pluvialis cDNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 mM PR1

- 0.2 mM PR2

- 5 ml 10X PCR buffer (TAKARA) - 0.25 ml R Taq Polymerase (TAKARA)

- 25.8 ml Aq. Least.

The PCR was carried out under the following cycle conditions:

1X94 ° C 2 minutes 35X94 ° C 1 minute 53 ° C 2 minutes 72 ° C 3 minutes 1X72 ° C 10 minutes

The PCR amplification with PR1 and PR2 resulted in a 1155 bp fragment consisting encodes a protein consisting of the entire primary sequence: gaagcatgca gctagcagcg acagtaatgt tggagcagct taccggaagc gctgaggcac 60 tcaaggagaa ggagaaggag gttgcaggca gctctgacgt gttgcgtaca tgggcgaccc 120 agtactcgct tccgtcagag gagtcagacg cggcccgccc gggactgaag aatgcctaca 180 agccaccacc ttccgacaca aagggcatca caatggcgct agctgtcatc ggctcctggg 240 ccgcagtgtt cctccacgcc atttttcaaa tcaagcttcc gacctccttg gaccagctgc 300 actggctgcc cgtgtcagat gccacagctc agctggttag cggcagcagc agcctgctgc 360 acatcgtcgt agtattcttt gtcctggagt tcctgtacac aggccttttt atcaccacgc 420 atgatgctat catggcacc atcgccatga gaaacaggca gcttaatgac ttcttgggca 480 gagtatgcat ctccttgtac gcctggtttg attacaacat gctgcaccgc aagcattggg 540 agcaccacaa ccacactggc gaggtgggca aggaccctga cttccacagg ggaaaccctg 600 gcattgtgcc ctggtttgcc agcttcatgt ccagctacat gtcgatgtgg cagtttgcgc 660 gcctcgcatg gtggacggtg gtcatgcagc tgctgggtgc gccaatggcg aacctgctgg 720 tgttcatggc vs. ccgcgccc atcctgtccg ccttccgctt gttctacttt ggcacgtaca 780 tgccccacaa gcctgagcct ggcgccgcgt caggctcttc accagccgtc atgaactggt 840 ggaagtcgcg cactagccag gcgtccgacc tggtcagctt tctgacctgc taccacttcg 900 acctgcactg ggagcaccac cgctggccct ttgccccctg gtgggagctg cccaactgcc 960 gccgcctgtc tggccgaggt ctggttcctg cctagctgga cacactgcag tgggccctgc 1020 tgccagctgg gcatgcaggt tgtggcagga ctgggtgagg tgaaaagctg caggcgctgc 1080 tgccggacac gctgcatggg ctaccctgtg tagctgccgc cactagggga gggggtttgt 1140 agctgtcgag cttgc

Using standard methods, the amplificate was cloned into the PCR cloning vector pGEM-Teasy (Promega) and the clone pGKET02 was obtained.

Sequencing of the clone pGKET02 with the T7 and the SP6 primer confirmed a sequence which differs from the published sequence X86782 only in the three codons 73, 114 and 119 in one base each. These nucleotide changes were reproduced in an independent amplification experiment and thus represent the nucleotide sequence in the Haematococcus pluvialis strain 192.80 used.

This clone was used for the expression of Haematococcus pluvialis ketolase. The transformation of the E. coli strains, their cultivation and the analysis of the carotenoid profile were carried out as described in Example 3.

Table 1 shows a comparison of the bacterially produced amounts of carotenoids:

Table 1: Comparison of the bacterial ketocarotenoid synthesis when using two different ketolases, the NOST ketolase from Nostoc sp. PCC7120 (Example 1) and the Haematococcus pluvialis ketolase (Example 4). Amounts of carotenoids are in ng / ml culture fluid.

Example 5: Amplification of a DNA encoding the entire primary sequence of the NP196 ketolase from Nostoc punctiforme ATCC 29133

The DNA which codes for the NP196 ketolase from Nostoc punctiform ATCC 29133 was amplified by means of PCR from Nostoc punctiform ATCC 29133 (strain of the "American Type Culture Collection").

For the preparation of genomic DNA from a suspension culture of Nostoc punctiforme ATCC 29133, which 1 week with continuous light and constant shaking (150 rpm) at 25 ° C in BG 77 medium (1.5 g / l NaN0 ₃ , 0.04 g / l K ₂ P0 ₄ x3H ₂ 0, 0.075 g / l MgS0 ₄ xH ₂ 0, 0.036 g / l CaCI ₂ x2H ₂ 0, 0.006 g / l citric acid, 0.006 g / l ferric ammonium citrate, 0.001 g / l EDTA disodium magnesium, 0.04 g / l Na ₂ C0 ₃ , 1 ml trace metal mix "A5 + Co" (2.86 g / l H ₃ B0 ₃ , 1.81 g / l MnCl ₂ x4H ₂ o, 0.222 g / l ZnSO ₄ x7H ₂ 0, 0.39 g / l Na- oθ ₄ X2H ₂ o, 0.079 g / l CuS0 ₄ x5H ₂ 0, 0.0494 g / l Co (N0 ₃ ) ₂ x6H ₂ 0)) the cells were harvested by centrifugation, frozen in liquid nitrogen and pulverized in a mortar.

Protocol for DNA isolation from Nostoc punctiform ATCC 29133:

The bacterial cells were pelleted from a 10 ml liquid culture by centrifugation at 8000 rpm for 10 minutes. The bacterial cells were then crushed and ground in liquid nitrogen using a mortar. The cell material was resuspended in 1 ml of 10 mM Tris-HCl (pH 7.5) and transferred into an Eppendorf reaction vessel (2 ml volume). After adding 100 QCI Proteinase K (concentration: 20 mg / ml), the cell suspension was incubated for 3 hours at 37 ° C. The suspension was then extracted with 500 μl of phenol. After centrifugation at 13000 rpm for 5 minutes, the upper, aqueous phase was transferred to a new 2 ml Eppendorf reaction vessel. The extraction with phenol was repeated 3 times. The DNA was precipitated by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 0.6 volume of isopropanol and then washed with 70% ethanol. The DNA pellet was temperature dried, in 25 μl | Water was taken up and dissolved while heating to 65 ° C.

The nucleic acid encoding a ketolase from Nostoc punctiform ATCC 29133 was synthesized by means of a "polymerase chain reaction" (PCR) from Nostoc punctiform ATCC 29133 using a sense-specific primer (NP196-1, SEQ ID No. 100) and an antisense -specific primer (NP196-2 SEQ ID No. 101).

The PCR conditions were as follows:

- 1 µl of a Nostoc punctiform ATCC 29133 DNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 mM NP196-1 (SEQ ID No. 100)

- 0.2 mM NP196-2 (SEQ ID No. 101)

- 5 ul 10X PCR buffer (TAKARA) - 0.25 ul R Taq polymerase (TAKARA)

- 25.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X94 ° C 2 minutes 35X94 ° C 1 minute 55 ° C 1 minute 72 ° C 3 minutes 1X72 ° C 10 minutes

PCR amplification with SEQ ID No. 100 and SEQ ID No. 101 resulted in a 792 bp fragment that codes for a protein consisting of the entire primary sequence (NP196, SEQ ID No. 102). Using standard methods, the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNP196 was obtained.

Sequencing of the clone pNP196 with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence from 140.571-139.810 of the database entry NZ_AABC01000196 (inverse oriented to the published database entry) with the exception that G in Item 140.571 through A was replaced to create a standard start codon ATG. This nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nostoc punctiforme ATCC 29133 used.

This clone pNP196 was therefore used for the cloning into the expression vector pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380).

pJIT117 was modified by the 35S terminator using the OCS terminator (octopine synthase) of the Ti plasmid pTi15955 from Agrobacterium tumefaciens (database entry X00493 from position 12.541-12.350, Gielen et al. (1984) EMBO J. 3 835-846) was replaced.

The DNA fragment containing the OCS terminator region was PCR-isolated using the plasmid pHELLSGATE (database entry AJ311874, Wesley et al. (2001) Plant J. 27 581-590, isolated from E. coli by standard methods) and the primer OCS-1 (SEQ ID No. 133) and OCS-2 (SEQ ID No. 134).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which contains the octopine synthase (OCS) terminator region (SEQ ID No. 106), was carried out in a 50 μl reaction mixture, which contained:

- 100ng pHELLSGATE plasmid DNA - 0.25mM dNTPs

- 0.2 mM OCS-1 (SEQ ID No. 104)

- 0.2 mM OCS-2 (SEQ ID No. 105)

- 5 ul 10X PCR buffer (Stratagene)

- 0.25 ul Pfu polymerase (Stratagene) - 28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X94 ° C 2 minutes 35X94 ° C 1 minute 50 ° C 1 minute 72 ° C 1 minute 1X72 ° C 10 minutes The 210 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pOCS was obtained.

Sequencing of the clone pOCS confirmed a sequence which corresponds to a sequence section on the Ti plasmid pTi 15955 from Agrobacterium tumefaciens (database entry X00493) from positions 12,541 to 12,350.

The cloning was carried out by isolating the 210 bp Sall-Xhol fragment from pOCS and ligation into the Sall-Xhol cut vector pJIT117.

This clone is called pJO and was therefore used for the cloning into the expression vector pJONPI 96.

The cloning was carried out by isolating the 782 bp Sphl fragment from pNP196 and ligating into the SphI cut vector pJO. The clone that contains the NP196 ketolase from Nostoc punctiforme in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJONP196.

Example 6: Production of expression vectors for the constitutive expression of the NP196 ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum and Tagetes erecta.

The expression of the NP196 ketolase from Nostoc punctiforme in L. esculentum and in Tagetes erecta was carried out under the control of the constitutive promoter FNR (ferredoxin NADPH oxidoreductase, database entry AB011474 position 70127 to 69493;

WO03 / 006660), from Arabidopsis thaliana. The FNR gene begins at base pair 69492 and is annotated with "ferredoxin-NADP + reductase". Expression was carried out using the pea transit peptide rbcS (Anderson et al. 1986, Biochem J. 240: 709-715).

The DNA fragment containing the FNR promoter region from Arabidopsis thaliana was PCR-analyzed using genomic DNA (isolated from Arabidopsis thaliana according to standard methods) and the primers FNR-1 (SEQ ID No. 107) and FNR-2 (SEQ ID No. 108).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which contains the FNR promoter fragment FNR (SEQ ID No. 109), was carried out in a 50 μl reaction mixture which contained:

- 100ng of A. thaliana genomic DNA - 0.25 mM dNTPs

- 0.2 mM FNR-1 (SEQ ID No. 107)

- 0.2 mM FNR-2 (SEQ ID No. 108)

- 5 µl 10X PCR buffer (Stratagene) - 0.25 µl Pfu polymerase (Stratagene)

- 28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X94 ° C 2 minutes 35X94 ° C 1 minute 50 ° C 1 minute 72 ° C 1 minute 1X72 ° C 10 minutes

The 652 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pFNR was obtained.

Sequencing of the clone pFNR confirmed a sequence which corresponds to a sequence section on chromosome 5 of Arabidopsis thaliana (database entry AB011474) from positions 70127 to 69493.

This clone is called pFNR and was therefore used for the cloning into the expression vector pJONP196 (described in Example 5).

The cloning was carried out by isolating the 644 bp Smal-Hindlll fragment from pFNR and ligating into the Ecl136ll-Hindlll cut vector pJONP196. The clone which contains the promoter FNR instead of the original promoter d35S and the fragment NP196 in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJOFNR: NP196.

An expression cassette for the Agrobacterium-mediated transformation of the NP196 ketolase from Nostoc into L. esculentum was produced using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector MSP105, the 1,839 bp EcoRI-Xhol fragment from pJOFNR: NP196 was ligated with the EcoRI-Xhol cut vector pSUN3. The expression vector MSP105 contains fragment FNR promoter the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP196 KETO CDS (761 bp), coding for the Nostoc punctiforme NP196 ketolase, fragment OCS terminator (192 bp) the polyadenylation signal from the octopine synthase.

The production of an expression cassette for the The expression vector was transformed with the NP196 ketolase from Nostoc punctiforme in Tagetes erecta using the binary vector pSUN5 (WO02 / 00900).

To produce the Tagetes expression vector MSP106, the 1,839 bp EcoRI-Xhol fragment from pJOFNR: NP196 was ligated with the EcoRI-Xhol cut vector pSUN5. MSP106 contains fragment FNR promoter the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP196 KETO CDS (761 bp), coding for the nostoc punctiform NP196 ketolase, fragment OCS terminator (192 bp) the polyadenylation signal of octopine synthase.

Example 7:

Production of expression vectors for the flower-specific expression of the NP196 ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum and Tagetes erecta

The expression of the NP196 ketolase from Nostoc punctiforme in L. esculentum and Tagetes erecta was carried out with the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715). The expression was carried out under the control of the flower-specific promoter EPSPS from Petunia hybrida (database entry M37029: nucleotide region 7-1787; Benfey et al. (1990) Plant Cell 2: 849-856).

The DNA fragment which contains the EPSPS promoter region (SEQ ID No. 112) from Petunia hybrida was PCR-analyzed using genomic DNA (isolated from Petunia hybrida according to standard methods) and the primers EPSPS-1 (SEQ ID No. 110) and EPSPS -2 (SEQ ID No. 111).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which contains the EPSPS promoter fragment (database entry M37029: nucleotide region 7-1787), was carried out in a 50 μl reaction mixture which contained:

- 100ng of A. thaliana genomic DNA - 0.25mM dNTPs - 0.2 mM EPSPS-1 (SEQ ID No. 110)

- 0.2 mM EPSPS-2 (SEQ ID No. 111)

- 5 ul 10X PCR buffer (Stratagene)

- 0.25 ul Pfu polymerase (Stratagene) - 28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

1X94 ° C 2 minutes 35X94 ° C 1 minute 50 ° C 1 minute 72 ° C 2 minutes 1X72 ° C 10 minutes

The 1773 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pEPSPS was obtained.

Sequencing of the clone pEPSPS confirmed a sequence consisting only of two deletions (bases ctaagtttcagga in position 46-58 of sequence M37029; bases aaaaatat in positions 1422-1429 of sequence M37029) and the base changes (T instead of G in position 1447 of sequence M37029 ; A instead of C in position 1525 of sequence M37029; A instead of G in position 1627 of sequence M37029) differs from the published EPSPS sequence (database entry M37029: nucleotide region 7-1787). The two deletions and the two base changes at positions 1447 and 1627 of sequence M37029 were reproduced in an independent amplification experiment and thus represent the actual nucleotide sequence in the Petunia hybrida plants used.

The clone pEPSPS was therefore used for the cloning into the expression vector pJONP196 (described in Example 5).

The cloning was carried out by isolating the 1763 bp SacI-HindIII fragment from pEPSPS and ligation into the SacI-HindIII cut vector pJ0NP196. The clone that contains the EPSPS promoter instead of the original d35S promoter is called pJOESP: NP196. This expression cassette contains the fragment NP196 in the correct orientation as an N-terminal fusion with the rbcS transit peptide.

An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NP196 ketolase from Nostoc punctiforme ATCC 29133 in L. esculentum was produced using the binary vector pSUN3 To produce the expression vector MSP107, the 2,961 KB bp Sacl-Xhol fragment from pJOESP: NP196 was ligated with the Sacl-Xhol cut vector pSUN3. The expression vector MSP107 contains fragment EPSPS the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP196 KETO CDS (761 bp), coding for the Nostoc punctiform NP196 ketolase (fragment OCS terminator) bp) the polyadenylation signal of octopine synthase.

An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NP196 ketolase from Nostoc punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).

To produce the expression vector MSP108, the 2,961 KB bp Sacl-Xhol fragment from pJOESP: NP196 was ligated to the Sacl-Xhol cut vector pSUN5. The expression vector MSP108 contains fragment EPSPS the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP196 KETO CDS (761 bp), coding for the nostoc punctiform NP196 ketolase, fragment OCS terminator 192 bp) the polyadenylation signal of octopine synthase.

Example 8:

Amplification of a DNA encoding the entire primary sequence of the NP195 ketolase from Nostoc punctiforme A TCC 29133

The DNA encoding the NP195 ketolase from Nostoc punctiform ATCC 29133 was amplified by PCR from Nostoc punctiform ATCC 29133 (strain of the "American Type Culture Collection"). The preparation of genomic DNA from a suspension culture of Nostoc punctiforme ATCC 29133 was described in Example 5.

The nucleic acid encoding a Nostoc punctiform ATCC 29133 ketolase was synthesized by means of a "polymerase chain reaction" (PCR) from Nostoc punctiform ATCC 29133 using a sense-specific primer (NP195-1, SEQ ID No. 113) and an antisense-specific one Primers (NP195-2 SEQ ID No. 114) amplified.

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture in which hold was:

- 1 µl of a Nostoc punctiform ATCC 29133 DNA (prepared as described above)

- 0.25 mM dNTPs - 0.2 mM NP195-1 (SEQ ID No. 113)

- 0.2 mM NP195-2 (SEQ ID No. 114)

- 5 ul 10X PCR buffer (TAKARA)

- 0.25 ul R Taq polymerase (TAKARA)

- 25.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

PCR amplification with SEQ ID No. 113 and SEQ ID No. 114 resulted in an 819 bp fragment which codes for a protein consisting of the entire primary sequence (NP195, SEQ ID No. 115). Using standard methods, the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNP195 was obtained.

Sequencing of the clone pNP195 with the M13F- and the M13R-

Primer confirmed a sequence identical to the DNA sequence 55.604-56.392 of database entry NZ_AABC010001965, except that T at position 55.604 was replaced by A to create a standard ATG start codon. This nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nostoc punctiforme ATCC 29133 used.

This clone pNP195 was therefore used for the cloning into the expression vector pJO (described in Example 5). The cloning was carried out by isolating the 809 bp Sphl fragment from pNP195 and ligation into the SphI-cut vector pJO. The clone which contains the NP 95 ketolase from Nostoc punctiforme in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJONP195.

Example 9: Production of expression vectors for the constitutive expression of NP195-ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum and Tagetes erecta.

The expression of the NP195 ketolase from Nostoc punctiforme in L. esculentum and in Tagetes erecta was carried out under the control of the constitutive promoter FNR (ferredoxin-NADPH-oxidoreductase, database entry AB011474 position 70127 to 69493; WO03 / 006660), from Arabidopsis thaliana. The FNR gene begins at base pair 69492 and is annotated with "ferredoxin-NADP + reductase". Expression was carried out using the pea transit peptide rbcS (Anderson et al. 1986, Biochem J. 240: 709-715).

The clone pFNR (described in Example 6) was therefore used for the cloning into the expression vector pJONP 95 (described in Example 8).

The cloning was carried out by isolating the 644 bp Sma-Hindill fragment from pFNR and ligation in the Ecl136ll-

Hindlll cut vector pJONP195. The clone which contains the promoter FNR instead of the original promoter d35S and the fragment NP195 in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJOFNR: NP195.

An expression cassette for the Agrobacterium-mediated transformation of the NP195 ketolase from Nostoc punctiforme into L. esculentum was produced using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector MSP109, the 1,866 bp EcoRI-Xhol fragment from pJOFNR: NP195 was ligated with the EcoRI-Xhol cut vector pSUN3. The expression vector MSP109 contains fragment FNR promoter the FNR promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (789 bp), coding for the nostoc punctiform NP195-Ketolator, fragment (192 bp) the polyadenylation signal from the octopine synthase.

An expression cassette for the Λgroibacte ym-mediated transformation of the expression vector with the NP195 ketolase from Nostoc punctiforme puncti- forme in Tagetes erecta was produced using the binary vector pSUN5 (WO 02/00900).

To produce the Tagetes expression vector MSP110, the 1,866 bp EcoRI-Xhol fragment from pJOFNR: NP195 was ligated with the EcoRI-Xhol cut vector pSUN5. The expression vector MSP110 contains fragment FNR promoter the FNR Promoter (635 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (789 bp), coding for the Nostoc punctiform NP195 ketolase, fragment OCS terminator (192 bp) the polyadenylation signal from octopine synthase.

Example 10:

Production of expression vectors for the flower-specific expression of the NP195 ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum and Tagetes erecta.

The expression of the NP195 ketolase from Nostoc punctiforme in L. esculentum and Tagetes erecta was carried out with the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715). The expression was carried out under the control of the flower-specific promoter EPSPS from Petunia hybrida (database entry M37029: nucleotide region 7-1787; Benfey et al. (1990) Plant Cell 2: 849-856).

The clone pEPSPS (described in Example 7) was therefore used for the cloning into the expression vector pJONP195 (described in Example 8).

The cloning was carried out by isolating the 1763 bp SacI-HindIII fragment from pEPSPS and ligation into the SacI-HindIII cut vector pJ0NP195. The clone that contains the EPSPS promoter instead of the original d35S promoter is called pJOESP: NP195. This expression cassette contains the fragment NP195 in the correct orientation as an N-terminal fusion with the rbcS transit peptide.

An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NP195 ketolase from Nostoc punctiforme ATCC 29133 in L. esculentum was produced using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector MSP111, the 2,988 KB bp Sacl-Xhol fragment from pJOESP: NP195 was ligated with the Sacl-Xhol cut vector pSUN3. The expression vector MSP111 contains fragment EPSPS the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (789 bp), coding for the nostoc punctiform NP195 ketolase (fragment OCS terminator) 192 bp) the polyadenylation signal of octopine synthase. An expression vector for the Agrobacterium -mediated transformation of the EPSPS-controlled NP195 ketolase from Nostoc punctiforme in Tagetes erecta was produced using the binary vector pSUN5 (WO02 / 00900).

To produce the expression vector MSP112, the 2,988 KB bp Sacl-Xhol fragment from pJOESP: NP195 was ligated with the Sacl-Xhol cut vector pSUN5. The expression vector MSP112 contains fragment EPSPS the EPSPS promoter (1761 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (789 bp), coding for the nostoc punctiform NP195 ketolase (fragment OCS terminator) 192 bp) the polyadenylation signal of octopine synthase.

Example 11:

Production of an expression cassette for the flower-specific overexpression of the chromoplast-specific beta-hydroxylase from Lycopersicon esculentum.

The expression of the chromoplast-specific beta-hydroxylase from Lycopersicon esculentum in Tagetes erecta takes place under the control of the flower-specific promoter EPSPS from Petunia (Example 7). LB3 from Vicia faba is used as the terminator element. The sequence of the chromoplast-specific beta-hydroxylase was generated by RNA isolation, reverse transcription and PCR.

For the production of the LB3 terminator sequence from Vicia faba, genomic DNA from Vicia faba tissue is isolated according to standard methods and used by genomic PCR using the primers PR206 and PR207. The PCR for the amplification of this LB3 DNA fragment is carried out in a 50 μl reaction mixture which contains:

- 1 µl cDNA (prepared as described above) - 0.25 mM dNTPs

- 0.2 uM PR206 (SEQ ID No. 1 16)

- 0.2 uM PR207 (SEQ ID No. 117)

- 5 ul 10X PCR buffer (TAKARA)

- 0.25 ul R Taq polymerase (TAKARA) - 28.8 ul Aq. Least.

PCR amplification with PR206 and PR207 results in a 0.3 kb fragment which contains the LB terminator. The amplificate is cloned into the cloning vector pCR-BluntII (Invitrogen). Sequencing with the primers T7 and M13 confirm a sequence identical to the sequence SEQ ID: 118. This clone is called pTA-LB3 and is therefore used for the cloning into the vector pJIT117 (see below).

Total RNA from tomato is prepared for the production of the beta-hydroxylase sequence. For this, 100 mg of the frozen, powdered flowers are transferred to a reaction vessel and taken up in 0.8 ml of Trizol buffer (LifeTechnologies). The suspension is extracted with 0.2 ml of chloroform. After centrifugation at 12,000 g for 15 minutes, the aqueous supernatant is removed and transferred to a new reaction vessel and extracted with a volume of ethanol. The RNA is precipitated with a volume of isopropanol, washed with 75% ethanol and the pellet is dissolved in DEPC water (overnight incubation of water with 1/1000 volume of diethyl pyrocarbonate at room temperature, then autoclaved). The RNA concentration is determined photometrically. For cDNA synthesis, 2.5 μg of total RNA are denatured for 10 min at 60 ° C., cooled on ice for 2 min and using a cDNA kit (ready-to-go-you-prime-beads, Pharmacia Biotech) according to the manufacturer's instructions using an antisense-specific primer (PR215 SEQ ID No. 119) transcribed into cDNA.

The conditions of the subsequent PCR reactions are as follows:

The PCR for the amplification of the VPR203-PR215 DNA fragment which codes for the beta-hydroxylase is carried out in a 50 μl reaction mixture which contained:

1 ul cDNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 uM VPR203 (SEQ ID No. 120) - 0.2 uM PR215 (SEQ ID No. 119)

- 5 ul 10X PCR buffer (TAKARA)

- 0.25 ul R Taq polymerase (TAKARA)

- 28.8 ul Aq. Least.

The PCR amplification with VPR203 and PR215 results in a 0.9 kb fragment which codes for the beta-hydroxylase. The amplificate is cloned into the cloning vector pCR-BluntII (Invitrogen). Sequencing with primers T7 and M13 confirms a sequence SEQ ID No. 121 identical sequence. This clone is called pTA-CrtR-b2 and is therefore used for cloning into the vector pCSP02 (see below).

The EPSPS promoter sequence from petunia is produced by PCR amplification using the plasmid MSP107 (see Example 7) and the primers VPR001 and VPR002. The PCR for the amplification of this EPSPS-DNA fragment is carried out in a 50 μl reaction mixture, which contains: 1 ul cDNA (prepared as described above)

- 0.25 mM dNTPs

- 0.2 uM VPR001 (SEQ ID No. 122)

- 0.2 uM VPR002 (SEQ ID No. 123) - 5 ul 10X PCR buffer (TAKARA)

- 0.25 ul R Taq polymerase (TAKARA)

- 28.8 ul Aq. Least.

The PCR amplification with VPR001 and VPR002 results in a 1.8 kb fragment which encodes the EPSPS promoter. The amplificate is cloned into the cloning vector pCR-BluntII (Invitrogen). Sequencing with the primers T7 and M13 confirm a sequence identical to the sequence SEQ ID: 124. This clone is called pTA-EPSPS and is therefore used for cloning into the vector pCSP03 (see below).

The first cloning step is carried out by isolating the 0.3 kb PR206-PR207 EcoRI-Xhol fragment from pTA-LB3, derived from the cloning vector pCR-BluntII (Invitrogen), and ligation with the EcoRI-Xhol cut vector pJIT117. The clone that contains the 0.3 kb terminator LB3 is called pCSP02.

The second cloning step is carried out by isolating the 0.9 kb VPR003-PR215 Eco-Rl-Hindlll fragment from pTA-CrtR-b2, derived from the cloning vector pCR-Bluntll (Invitrogen), and ligation with the EcoRI-Hindlll cut vector pCSP02. The clone that contains the 0.9 kb beta-hydroxylase fragment CrtR-b2 is called pCSP03. The ligation creates a transcriptional fusion between the terminator LB3 and the beta-hydroxylase fragment CrtR-b2.

The third cloning step is carried out by isolating the 1.8 kb VPR001-VPR002 Ncol-Sacl fragment from pTA-EPSPS, derived from the cloning vector pCR-BluntII (Invitrogen), and ligation with the Ncol-Sacl cut vector pCSP03. The clone that contains the 1.8 kb EPSPS promoter fragment is called pCSP04. The ligation results in a transcriptional fusion between the EPSPS promoter and the beta hydroxylase fragment CrtR-b2. pCSP04 contains fragment EPSPS fragment (1792 bp) the EPSPS promoter, fragment crtRb2 (929 bp) beta-hydroxylase CrtRb2, fragment LB3 (301 bp) the LB3 terminator.

To clone this hydroxylase overexpression cassette into expression vectors for the Agrobacterium-mediated transformation of Tagetes erecta, the beta hydroxylase cassette is isolated as a 3103 bp Ecl136II-Xhol fragment. The 3 'ends (30 min at 30 ° C) are filled using standard methods (Klenow fill-in). The expression vector is called pCSEbhyd

Example 12:

Production of expression vectors for the flower-specific expression of the chromoplast-specific lycopene beta-cyclase from Lycopersicon esculentum under the control of the promoter P76 and for the flower-specific expression of the ketolase NP196 from Nostoc punctiform ATCC 29133 under the control of the EPSPS promoter

Isolation of promoter P76 (SEQ ID NO. 125) by means of PCR using genomic DNA from Arabidopsis thaliana as a template.

For this, the oligonucleotide primers P76for (SEQ ID NO. 126) and P76rev (SEQ ID NO. 127) were used. The oligonucleotides were provided with a 5 'phosphate residue during the synthesis. P76 for5'-CCCGGGTGCCAAAGTAACTCTTTAT-3 '

P76 rev 5'-GTCGACAGGTGCATGACCAAGTAAC-3 "

The genomic DNA was isolated from Arabidopsis thaliana as described (Galbiati M et al. Funct. Integr. Genomics 2000, 20 1: 25-34).

The PCR amplification was carried out as follows:

80 ng genomic DNA 1x Expand Long Template PCR buffer 2.5 mM MgCl2 each 350 μM dATP, dCTP, dGTP, dTTp each 300 nM each primer

2.5 units of expand long template polymerase in a final volume of 25 μl

The following temperature program is used:

1 cycle with 120 sec at 94 ° C 35 cycles with 94 ° C for 10 sec, 48 ° C for 30 sec and 68 ° C for 3 min 1 cycle with 68 ° C for 10 min The PCR product is separated by agarose gel electrophoresis and the 1032 bp fragment is isolated by gel elution.

The vector pSunδ is digested with the restriction endonuclease EcoRV and also purified by agarose gel electrophoresis and obtained by gel elution.

The purified PCR product is cloned into the vector treated in this way.

This construct is called p76. The 1032 bp fragment representing the Arabidopsis promoter P76 was sequenced (Seq ID NO. 131).

The terminator 35ST is obtained from pJIT 117 by digestion with the restriction endonucleases Kpnl and Smal. The resulting 969 bp fragment is purified by agarose gel electrophoresis and isolated by gel elution. The vector p76 is also digested with the restriction endonucleases Kpnl and Smal. The resulting 7276bp fragment is purified by agarose gel electrophoresis and isolated by gel elution.

The 35ST fragment obtained in this way is cloned into the p76 treated in this way. The resulting vector is called p76_35ST.

The Bgene (SEQ ID NO. 128) was isolated by means of PCR using genomic DNA from Lycopersicon esculentum as a template.

For this, the oligonucleotide primers BgeneFor (SEQ ID NO. 129) and BgeneRev (SEQ ID NO. 130) were used. The oligonucleotides were provided with a 5 'phosphate residue during the synthesis. SEQ ID NO 129: Bgenefor: 5'-CTATTGCTAGATTGCCAATCAG-3 '

SEQ ID NO 130 Bgenerev: 5'-ATGGAAGCTCTTCTCAAG-3 '

The genomic DNA was isolated from Lycopersicon esculentum as described (Galbiati M et al. Funct. Integr. Genomics 2000, 20 1: 25-34).

The PCR amplification was carried out as follows:

80ng genomic DNA

1x Expand Long Template PCR buffer

2.5 mM MgCI2 each 350 μM dATP, dCTP, dGTP, dTTp each 300 nM each primer 2.5 units expand long template polymerase in a final volume of 25 μl

The following temperature program was used:

1 cycle with 120 sec at 94 ° C

35 cycles at 94 ° C for 10 sec,

48 ° C for 30 sec and

68 ° C for 3 min

1 cycle at 68 ° C for 10 min

The PCR product was purified by agarose gel electrophoresis and the 1665 bp fragment isolated by gel elution.

The vector p76_35ST is digested with the restriction endonuclease Smal and also purified by agarose gel electrophoresis and obtained by gel elution.

The purified PCR product is cloned into the vector treated in this way. This construct is called pB. The 1486 bp fragment, which represents the tomato bgene, was sequenced and is identical in its nucleotide sequence to the database entry AF254793 (Seq ID NO. 1).

pB is digested with the restriction endonucleases Pmel and Sspl and the 3906bp fragment containing the promoter P76, Bgene and the 35ST is purified by agarose gel electrophoresis and obtained by gel elution

MSP108 (Example 7) is digested with the restriction endonuclease Ecl126ll, purified by agarose gel electrophoresis and obtained by gel elution

The purified 3906bp fragment containing the promoter P76, Bgene and the 35ST from pB is cloned into the Vector MSP108 treated in this way.

This construct is called pMKP1.

Example 13: Production and analysis of transgenic Lycopersicon esculentum plants

Transformation and regeneration of tomato plants was carried out according to the published method by Ling and co-workers (Plant Cell Reports (1998), 17: 843-847). For the Microtome variety, higher kanamycin concentrations (100 mg / L) were selected. The starting explant for the transformation was cotyledons and hypocotyls, seven to ten day old seedlings of the Microtome line. The culture medium according to Murashige and Skoog (1962: Murashige and Skoog, 1962, Physiol. Plant 15, 473-) with 2% sucrose, pH 6.1 was used for germination. Germination took place at 21 ° C with little light (20 to 100 μE). After seven to ten days, the cotyledons were divided transversely and the hypocotyls were cut into sections about 5 to 10 mm long and placed on the medium MSBN (MS, pH 6.1, 3% sucrose + 1 mg / l BAP, 0.1 mg / l NAA), which was loaded with suspension-cultivated tomato cells the day before. The tomato cells were covered with sterile filter paper without air bubbles. The explants were precultured on the medium described for three to five days. Cells from the Agrobacterium tumefaciens LBA4404 strain were individually transformed with the plasmids. An overnight culture of each of the individual Agrobacterium strains transformed with the binary vectors was cultivated in YEB medium with kanamycin (20 mg / l) at 28 ° C. and the cells were centrifuged. The bacterial pellet was washed with liquid MS medium (3% sucrose, pH 6, 1) resuspended and adjusted to an optical density of 0.3 (at 600 nm). The precultivated explants were transferred to the suspension and incubated for 30 minutes at room temperature with gentle shaking. The explants were then dried with sterile filter paper and placed back on their preculture medium for the three-day co-culture (21 ° C.).

After the co-culture, the explants were transferred to MSZ2 medium (MS pH 6.1 + 3% sucrose, 2 mg / l zeatin, 100 mg / l kanamycin, 160 mg / l timentin) and for selective regeneration at 21 ° C stored under weak conditions (20 to 100 μE, light rhythm 16 h / 8 h). The explants were transferred every two to three weeks until shoots formed. Small shoots could be separated from the explant and rooted on MS (pH 6.1 + 3% sucrose) 160 mg / l timentin, 30 mg / l kanamycin, 0.1 mg / l IAA. Rooted plants were transferred to the greenhouse.

According to the transformation method described above, the following lines were obtained with the following expression constructs:

With MSP105 the following was obtained: mspl 05-1, mspl 05-2, mspl 05-3

With MSP107 we got: msp107-1, msp107-2, msp107-3 With MSP109 we got: mspl 09-1, mspl 09-2, mspl 09-3

With MSP111 it was obtained: msp111-1, msp111-2, msp111-3 Example 14:

Production of transgenic tagetes plants

Day tea seeds are sterilized and placed on germination medium (MS medium; Murashige and Skoog, Physiol. Plant. 15 (1962), 473-497) pH 5.8, 2% sucrose). Germination takes place in a temperature / light / time interval of 18 to 28 ° G20-200 μE / 3 to 16 weeks, but preferably at 21 ° C, 20 to 70 mE, for 4 to 8 weeks.

All leaves of the in vitro plants that had developed up to that point are harvested and cut across the midrib. The resulting leaf explants with a size of 10 to 60 mm ² are kept in the course of the preparation in liquid MS medium at room temperature for a maximum of 2 hours.

Any Agrobacterium tumefaciens strain, but preferably a supervirulent strain, such as EHA105 with a corresponding binary plasmid, which can carry a selection marker gene (preferably bar or pat) and one or more trait or reporter genes, is grown overnight and used for the co -Cultivation with the leaf material used. The bacterial strain can be grown as follows: A single colony of the corresponding strain is in YEB (0.1% yeast extract, 0.5% beef extract, 0.5% peptone, 0.5% sucrose, 0.5% magnesium sulfate x 7 H) ₂ 0) inoculated with 25 mg / l kanamycin and dressed at 28 ° C for 16 to 20 hours. The bacterial suspension is then harvested by centrifugation at 6000 g for 10 min and resuspended in liquid MS medium in such a way that an OD ₆ oo of approximately 0.1 to 0.8 was obtained. This suspension is used for the co-cultivation with the leaf material.

Immediately before the co-cultivation, the MS medium in which the leaves have been kept is replaced by the bacterial suspension. The leaflets were incubated in the agrobacterial suspension for 30 min with gentle shaking at room temperature. The infected explants are then placed on an MS medium solidified with agar (for example 0.8% plant agar (Duchefa, NL) with growth regulators, such as 3 mg / l benzylaminopurine (BAP) and 1 mg / l indolylacetic acid (IAA). The orientation of the leaves on the medium is irrelevant: the explants are cultivated for 1 to 8 days, but preferably for 6 days, the following conditions being able to be used: light intensity: 30 to 80 μmol / m ² x sec, temperature : 22 to 24 ° C., light / dark change of 16/8 hours, after which the co-cultivated explants are transferred to fresh MS medium, preferably with the same growth regulators, this second medium additionally containing an antibiotic to suppress bacterial growth. Timentin in a concentration of 200 to 500 mg / l is very suitable for this purpose The second selective component is used to select the success of the transformation. Phosphinothricin in a concentration of 1 to 5 mg / l selects very efficiently, but other selective components according to the method to be used are also conceivable.

After one to three weeks, the explants are transferred to fresh medium until shoot buds and small shoots develop, which are then on the same basal medium including timentin and PPT or alternative components with growth regulators, namely, for example, 0.5 mg / l indolylbutyric acid (IBA) and 0.5 mg / l gibberillic acid GA ₃ , are transferred for rooting. Rooted shoots can be transferred to the greenhouse.

In addition to the described method, the following advantageous modifications are possible:

Before the explants are infected with the bacteria, they can be preincubated for 1 to 12 days, preferably 3 to 4, on the medium described above for the co-culture. The infection, co-culture and selective regeneration then take place as described above.

• The pH value for regeneration (normally 5.8) can be lowered to pH 5.2. This improves the control of agrobacterial growth.

• The addition of AgN0 ₃ (3 to 10 mg / l) to the regeneration medium improves the condition of the culture, including the regeneration itself.

Components that reduce phenol formation and are known to those skilled in the art, such as Citric acid, ascorbic acid, PVP and many more m., have a positive effect on the culture.

• Liquid culture medium can also be used for the entire process. The culture can also be incubated on commercially available carriers which are positioned on the liquid medium.

With MSP106 it was obtained: msp106-1, msp106-2, msp106-3

With MSP108 we got: msp108-1, msp108-2, msp108-3 With MSP110 we got: mspl 10-1, mspl 10-2, mspl 10-3 With MSP112 the following was obtained: mspl 12-1, mspl 12-2, mspl 12-3

With pCSEbhyd was obtained: csebhyd-1, csebhyd-2, csebhyd-3. With pMKPL was obtained: mkp1-1, mkp1-2, mkp1-3.

Example 15: Enzymatic lipase-catalyzed hydrolysis of carotenoid esters from plant material and identification of the carotenoids

General working instructions

a) Mortar plant material (e.g. petal material) (30-100 mg fresh weight) is extracted with 100% acetone (three times 500μl; shake for about 15 minutes each). The solvent is evaporated. Carotenoids are then taken up in 495 μl of acetone, 4.95 ml of potassium phosphate buffer (100 mM, pH 7.4) are added and mixed well. Then about 17 mg of Bile salts (Sigma) and 149 μl of a NaCl / CaCl ₂ solution (3M NaCl and 75 mM CaCl ₂ ) are added. The suspension is incubated at 37 ° C for 30 minutes. For the enzymatic hydrolysis of the carotenoid esters, 595 μl of a lipase solution (50 mg / ml lipase type 7 from Candida rugosa (Sigma)) is added and incubated with shaking at 37C. After about 21 hours, 595 μl of lipase was added again and incubation was continued for at least 5 hours at 37 ° C. Then about 700 mg Na ₂ S0 _{4 are dissolved} in the solution. After adding 1800 μl of petroleum ether, the carotenoids are extracted into the organic phase by vigorous mixing. This shaking is repeated until the organic phase remains colorless. The petroleum ether fractions are combined and the petroleum ether evaporated. Free carotenoids are taken up in 100-120 μl acetone. Free carotenoids can be identified on the basis of retention time and UV-VIS spectra using HPLC and C30 reverse phase columns.

The Bile salts or bile acid salts used are 1: 1 mixtures of cholate and deoxycholate.

b) Working procedure for processing if only small amounts of carotenoid esters are present in the plant material

Alternatively, the hydrolysis of the carotenoid esters by lipase from Candida rugosa can be achieved after separation by means of thin layer chromatography. For this, 50-100mg of plant material are extracted three times with about 750μl acetone. The solvent extract is rotated in a vacuum (elevated temperatures of 40-50 ° C are tolerable). Then add 300μl petroleum ether acetone (ratio 5: 1) and good Mixing. Suspended matter is sedimented by centrifugation (1-2 minutes). The upper phase is transferred to a new reaction vessel. The remaining residue is extracted again with 200 μl of petroleum ether acetone (ratio 5: 1) and suspended matter is removed by centrifugation. The two extracts are combined (volume 500 μl) and the solvents evaporated. The residue is resuspended in 30 μl of petroleum ether: acetone (ratio 5: 1) and applied to a thin-layer plate (silica gel 60, Merck). If more than one application is required for preparative-analytical purposes, several aliquots, each with a fresh weight of 50-100 mg, should be prepared in the manner described for thin-layer chromatography separation.

The thin-layer plate is developed in petroleum ether-acetone (ratio 5: 1). Carotenoid bands can be identified visually based on their color. Individual carotenoid bands are scraped out and can be pooled for preparative-analytical purposes. The carotenoids are eluted from the silica material with acetone; the solvent is evaporated in vacuo. For the hydrolysis of the carotenoid esters, the residue is dissolved in 495 μl acetone, 17 mg Bile salts (Sigma), 4.95 ml 0.1 M potassium phosphate buffer (pH 7.4) and 149 μl (3M NaCl, 75mM CaCl ₂ ) are added. After thorough mixing, equilibrate at 37 ° C for 30 minutes. This is followed by the addition of 595 μl of Candida rugosa lipase (Sigma, stock solution of 50 mg / ml in 5 mM CaCl ₂ ). Incubation with lipase takes place overnight with shaking at 37 ° C. After about 21 hours, the same amount of lipase is added again; Incubate again at 37 ° C with shaking for at least 5 hours. Then 700 mg of Na ₂ S0 ₄ (anhydrous) are added; with 1800μl of petroleum ether is shaken for about 1 minute and the mixture is centrifuged at 3500 revolutions / minute for 5 minutes. The upper

Phase is transferred to a new reaction vessel and the shaking is repeated until the upper phase is colorless. The combined petroleum ether phase is concentrated in vacuo (temperatures of 40-50 ° C are possible). The residue is dissolved in 120μl acetone, possibly using ultrasound. The dissolved carotenoids can be separated by means of HPLC using a C30 column and quantified using reference substances.

Example 16: HPLC analysis of free carotenoids

The analysis of the samples obtained according to the working instructions in Example 15 is carried out under the following conditions:

The following HPLC conditions were set.

Separation column: Prontosil C30 column, 250 x 4.6 mm, (Bischoff, Leonberg, Germany) Flow rate: 1.0 ml / min Eluents: solvent A - 100% methanol solvent B - 80% methanol, 0.2% ammonium acetate solvent C - 100% t-butyl methyl ether detection: 300-530 nm

gradient:

Some typical retention times for carotenoids formed according to the invention are, for example, violaxanthin 11.7 minutes, astaxanthin 17.7 minutes, adonixanthin 19 minutes, adonirubin 19.9 minutes and zeaxanthin 21 minutes.

Claims

patent claims

1. A process for the preparation of ketocarotenoids by cultivating genetically modified, non-human organisms which have an altered ketolase activity and an altered β-cyclase activity compared to the wild type, and the altered β-cyclase activity by an β-cyclase is caused, containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

2. The method according to claim 1, characterized in that non-human organisms are used which already have a ketolase activity as wild type, and the genetic change brings about an increase in ketolase activity compared to the wild type.

3. The method according to claim 2, characterized in that to increase the ketolase activity, the gene expression of a nucleic acid encoding a ketolase is increased compared to the wild type.

4. The method according to claim 3, characterized in that to increase the gene expression nucleic acids are introduced into the organism, which encode ketolases.

5. The method according to claim 4, characterized in that nucleic acid encoding a ketolase is introduced, nucleic acids encoding a ketolase containing the amino acid sequence SEQ ID NO: 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has an identity of at least 70% at the amino acid level with the sequence SEQ ID NO: 4.

6. The method according to claim 1, characterized in that non-human organisms are used which have no ketolase activity as a wild type and the genetic change causes a ketolase activity compared to the wild type. gently.

7. The method according to claim 6, characterized in that one uses genetically modified organisms which transgenically express a ketolase.

8. The method according to claim 6 or 7, characterized in that in order to cause the gene expression nucleic acids are introduced into the organisms which code for ketolases.

9. The method according to claim 8, characterized in that introducing nucleic acids encoding a ketolase containing the amino acid sequence SEQ. ID. NO. 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 4 has.

10. The method according to claim 5 or 9, characterized in that nucleic acids containing the sequence SEQ. ID. NO. 3 brings.

11. The method according to any one of claims 1 to 10, characterized in that organisms are used which as a wild type already have a β-cyclase activity, and the genetic change brings about an increase in the β-cyclase activity compared to the wild type.

12. The method according to claim 11, characterized in that to increase the β-cyclase activity, the gene expression of a nucleic acid, encoding a β-cyclase, containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2, increased compared to the wild type.

13. The method according to claim 12, characterized in that in order to increase gene expression nucleic acids are introduced into the organism, which encode β-cyclases containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the SEQ sequence. ID. NO. 2 has.

14. The method according to any one of claims 1 to 10, characterized in that organisms are used which have no ß-cyclase activity as a wild type and the genetic change causes a ß-cyclase activity compared to the wild type.

15. The method according to claim 14, characterized in that one uses genetically modified organisms, the transgenic a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 express.

16. The method according to claim 14 or 15, characterized in that in order to cause the gene expression, nucleic acids are introduced into the organisms which encode β-cyclases containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

17. The method according to claim 13 or 16, characterized in that nucleic acids containing the sequence SEQ. ID. NO. 1 brings.

18. The method according to any one of claims 1 to 17, characterized in that the non-human organisms additionally have an increased or caused hydroxylase activity compared to the wild type.

19. The method according to claim 18, characterized in that for additional increase or causation of the hydroxylase activity, the gene expression of a nucleic acid encoding a hydroxylase is increased or caused compared to the wild type.

20. The method according to claim 19, characterized in that to increase or cause the gene expression encoding a nucleic acid a hydroxy brings into the organism.

21. The method according to claim 20, characterized in that nucleic acid encoding a hydroxylase is introduced, nucleic acids encoding a hydroxylase containing the amino acid sequence SEQ ID NO: 6 or one of this sequence by substitution, insertion or deletion of amino acids derived sequence which has an identity of at least 70% at the amino acid level with the sequence SEQ ID NO: 6.

22. The method according to claim 21, characterized in that nucleic acids containing the sequence SEQ ID NO: 5 are introduced.

23. The method according to any one of claims 1 to 22, characterized in that the organisms in addition to the wild type an increased or caused activity of at least one of the activities selected from the group HMG-CoA reductase activity, (E) -4 -Hydroxy-3-methylbut-2-enyl-diphosphate reductase activity, 1 -deoxy-D-xylose-5-phosphate synthase activity, 1 -deoxy-D-xylose-5-phosphate reductoisomerase activity, isopentenyl -Diphosphate-Δ-isomerase activity, geranyl diphosphate synthase activity, famesyl diphosphate synthase activity, geranyl geranyl diphosphate synthase activity, phytoene synthase activity, phytoene desaturase activity, zeta-carotene -Desaturase activity, crtlSO activity, FtsZ activity and MinD activity.

24. The method according to claim 23, characterized in that for additional increase or causation of at least one of the activities, the gene expression of at least one nucleic acid selected from the group encoding an HMG-CoA reductase, nucleic acids encoding an (E) -4- Hydroxy-3-methylbut-2-enyl-diphosphate reductase, nucleic acids encoding a 1-deoxy-D-xylose-5-phosphate synthase, nucleic acids encoding a 1-deoxy-D-xylose-5-phosphate reductoisomerase, encoding nucleic acids an isopentenyl diphosphate Δ isomerase, encoding nucleic acids a geranyl diphosphate synthase, nucleic acids encoding a farnesyl diphosphate synthase, nucleic acids encoding a geranyl geranyl diphosphate synthase, nucleic acids encoding a phytoene synthase, nucleic acids Desaturase, nucleic acids encoding a zeta-carotene desaturase, nucleic acid ren encoding a crtlSO protein, nucleic acids encoding an FtsZ protein and nucleic acids encoding a MinD protein increased compared to the wild type.

25. The method according to claim 24, characterized in that to increase or cause the gene expression of at least one of the nucleic acids, at least one nucleic acid selected from the group, nucleic acids encoding an HMG-CoA reductase, nucleic acids encoding an (E) -4-hydroxy -3- Methylbut-2-enyl-diphosphate reductase, nucleic acids encoding a 1-deoxy-D-xylose-5-phosphate synthase, nucleic acids encoding a 1-deoxy-D-xylose-5-phosphate reductoisomerase, nucleic acids encoding one Isopentenyl-diphosphate-Δ-isomerase, nucleic acids encoding a geranyl diphosphate synthase, nucleic acids encoding a farnesyl diphosphate synthase, nucleic acids encoding a geranyl-geranyl diphosphate synthase, nucleic acids encoding a phytoene synthase, phasing nucleic acids , Nucleic acids encoding a zeta-carotene desaturase, nucleic acids encoding a crtlSO protein, nucleic acids encoding an FtsZ protein and nucleins acid encoding a MinD protein in the non-human organisms.

26. The method according to claim 25, characterized in that the nucleic acid encoding an HMG-CoA reductase, nucleic acids which encode an HMG-CoA reductase, containing the amino acid sequence SEQ ID NO: 8 or one of these sequences by substitution, insertion or deletion of amino acid-derived sequence which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 8.

27. The method according to claim 26, characterized in that nucleic acids containing the sequence SEQ ID NO: 7 are introduced.

28. The method according to claim 25, characterized in that the nucleic acid encoding is an (E) -4-hydroxy-3-methylbut-2-enyl-diphosphate reductase; nucleic acids are introduced which are an (E) -4-hydroxy-3- Encoding methylbut-2-enyl-diphosphate reductase containing the amino acid sequence SEQ ID NO: 10, or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of min. at least 20% at the amino acid level with the sequence SEQ ID NO: 10.

29. The method according to claim 28, characterized in that nucleic acids containing the sequence SEQ ID NO: 9 are introduced.

30. The method according to claim 25, characterized in that a 1-deoxy-D-xylose-5-phosphate synthase encoding nucleic acid is introduced, containing nucleic acids encoding a 1-deoxy-D-xylose-5-phosphate synthase the amino acid sequence SEQ ID NO: 12 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 12.

31. The method according to claim 30, characterized in that nucleic acids containing the sequence SEQ ID NO: 11 are introduced.

32. The method according to claim 25, characterized in that a 1-deoxy-D-xylose-5-phosphate reductoisomerase is encoded as nucleic acid, nucleic acids which encode a 1-deoxy-D-xylose-5-phosphate reductoisomerase are introduced - Holding the amino acid sequence SEQ ID NO: 14 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 14.

33. The method according to claim 32, characterized in that nucleic acids containing the sequence SEQ ID NO: 13 are introduced.

34. The method according to claim 25, characterized in that the nucleic acid encoding an isopentenyl diphosphate Δ isomerase, nucleic acids which encode an isopentenyl diphosphate Δ isomerase, containing the amino acid sequence SEQ ID NO: 16 or one of these sequences sequence derived by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 16.

35. The method according to claim 34, characterized in that nucleic acids containing the sequence SEQ ID NO: 15 are introduced.

36. The method according to claim 25, characterized in that a nucleic acid encoding a geranyl diphosphate synthase is introduced, nucleic acids encoding a geranyl diphosphate synthase containing the amino acid sequence SEQ ID NO: 18 or one of these sequences by substitution, insertion or deletion of amino acid-derived sequence which has at least 20% identity at the amino acid level with the sequence SEQ ID NO: 18.

37. The method according to claim 36, characterized in that nucleic acids containing the sequence SEQ ID NO: 17 are introduced.

38. The method according to claim 25, characterized in that the nucleic acid coding is a farnesyl diphosphate synthase, nucleic acids are introduced which encode a farnesyl diphosphate synthase containing the amino acid sequence SEQ ID NO: 20 or one of these sequences by substitution, insertion or deletion of amino acid-derived sequence which has at least 20% identity at the amino acid level with the sequence SEQ ID NO: 20.

39. The method according to claim 38, characterized in that 'nucleic acids containing the sequence SEQ ID NO: 19 are introduced.

40. The method according to claim 25, characterized in that a nucleic acid encoding a geranyl-geranyl diphosphate synthase is introduced, nucleic acids encoding a geranyl-geranyl diphosphate synthase containing the amino acid sequence SEQ ID NO: 22 or one of these sequences sequence derived by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 22.

41. The method according to claim 40, characterized in that nucleic acids containing the sequence SEQ ID NO: 21 are introduced.

42. The method according to claim 25, characterized in that a nucleic acid encoding a phytoene synthase, nucleic acids are introduced which a phytoene Coding synthase containing the amino acid sequence SEQ ID NO: 24 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 24.

43. The method according to claim 42, characterized in that nucleic acids containing the sequence SEQ ID NO: 23 are introduced.

44. The method according to claim 25, characterized in that a nucleic acid encoding a phytoene desaturase is introduced, nucleic acids encoding a phytoene desaturase containing the amino acid sequence SEQ ID NO: 26 or one of this sequence by substitution, insertion or deletion of amino acids derived sequence which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 26.

45. The method according to claim 44, characterized in that nucleic acids containing the sequence SEQ ID NO: 25 are introduced.

46. The method according to claim 25, characterized in that a nucleic acid encoding a zeta-carotene desaturase is introduced, nucleic acids encoding a zeta-carotene desaturase containing the amino acid sequence SEQ ID NO: 28 or one of these sequences by substitution , Insertion or deletion of amino acid-derived sequence which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 28.

47. The method according to claim 46, characterized in that nucleic acids containing the sequence SEQ ID NO: 27 are introduced.

48. The method according to claim 25, characterized in that the nucleic acid coding is a crtlSO protein, nucleic acids which encode a crtlSO protein are introduced, containing the amino acid sequence SEQ ID NO: 30 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 30.

49. The method according to claim 48, characterized in that nucleic acids containing the sequence SEQ ID NO: 29 are introduced.

50. The method according to claim 25, characterized in that the nucleic acid encoding is an FtsZ protein, nucleic acids which encode an FtsZ protein are introduced, containing the amino acid sequence SEQ ID NO: 32 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 32.

51. The method according to claim 50, characterized in that nucleic acids containing the sequence SEQ ID NO: 31 are introduced.

52. The method according to claim 25, characterized in that the nucleic acid encoding is a MinD protein, nucleic acids encoding a MinD protein are introduced, containing the amino acid sequence SEQ ID NO: 34 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 34.

53. The method according to claim 52, characterized in that nucleic acids containing the sequence SEQ ID NO: 33 are introduced.

54. The method according to any one of claims 1 to 53, characterized in that after culturing, the genetically modified organisms are harvested and then the ketocarotenoids are isolated from the organisms.

55. The method according to any one of claims 1 to 54, characterized in that the organism used is an organism which, as a starting organism, is of course capable of producing carotenoids or by genetic complementation or re-regulation of metabolic pathways.

56. The method according to any one of claims 1 to 55, characterized in that microorganisms or plants are used as organisms.

57. The method according to claim 56, characterized in that bacteria, yeasts, algae or fungi are used as microorganisms.

58. The method according to claim 57, characterized in that the microorganisms are selected from the group Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Paracoccus, Nostoc, cyanobacteria of the genus Synechocystis, Candida, Saccharomyces, Hansenula, Phaffia, Pichia, Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium, Haematococcus, Phaedactylum tricornatum, Volvox or Dunaliella.

59. The method according to claim 56, characterized in that plants are used as organisms.

60. The method according to claim 59, characterized in that the plant is a plant selected from the families Amaranthaceae, Amaryllidaceae, Apocynaceae, Asteraceae, Balsaminaceae, Begoniaceae, Berberidaceae, Brassica-ceae.Cannabaceae, Caprifoliaceae, Caryophopodlac, Caryophoplaceae - sitae, Cucurbitaceae, Cruciferae, Euphorbiaceae, Fabaceae, Gentianaceae, Geraniaceae, Graminae, liliaceae, Labiatae, Lamiaceae, Leguminosae, Liliaceae, Lina- ceae, Lobeliaceae, Malvaceeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaceaaceae , Primulaceae, Ranunculaceae, Rosaceae, Rubiaceae, Scrophulariaceae, Solanaceae, Tropaeolaceae, Umbelliferae, Verbanaceae, Vitaceae or Violaceae.

61. The method according to claim 60, characterized in that a plant is selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus, Bignonia, Calendula, Caltha , Campanula, Canna, Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelemium, Genista, Genta, Geranium, Geranium, Geranium, Geranium , Geum, Grevillea, Helenium, Helianthus, Hepatica, Heracleum, Hisbiscus, Heliopsis, Hypericum, Hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Laburnum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysjmachia, Maratia, Medicago , Narcissus, Oenothe- ra, Osmanthus, Petunia, Photinia, Physalis, Phyteuma, Potentilla, Pyracantha, Ra- nunculus, rhododendron, Rosa, Rudbeckia, Senecio, Silene, Silphium, Sinapsis, Sorbus, Spartium, Tecoma, Torenia, Tragopogon, Trollius, Tropaeolum, Tulipa, Tussilago, Ulex, Viola or Zinnia.

62. The method according to any one of claims 1 to 61, characterized in that the ketocarotenoids are selected from the group of astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3'-hydroxyechinenone, adonirubin and adonixanthin.

63. Genetically modified, non-human organism, the genetic modification being the activity of a ketolase

B in the event that the wild-type organism has no ketolase activity compared to the wild-type, and the genetic modification being the activity of a β-cyclase

D in the event that the wild-type organism has no β-cyclase activity, is caused compared to the wild-type and the β-cyclase activity increased after C or caused according to D is caused by a β-cyclase containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 70% at the amino acid level with the sequence SEQ. ID. NO. 2 has.

64. Genetically modified organism according to claim 63, characterized in that it is natural as a starting organism or by genetic grain implementation is able to produce carotenoids.

65. Genetically modified organism according to claim 63 or 64, selected from the group of microorganisms or plants.

66. Genetically modified microorganism according to claim 65, characterized in that the microorganisms are selected from the group of bacteria, yeast, algae or fungi.

67. Genetically modified microorganism according to claim 66, characterized in that the microorganisms are selected from the group Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Paracoccus, Nostoc, Cyanobacteria of the genus Synechocystis, Candida, Saccharomyces, Hansenula, Pichia, Aspergillus , Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium, Haematococcus, Phaedactylum tricornatum, Volvox or Dunaliella.

68. Genetically modified plant according to claim 65, characterized in that the plants are selected from the families Amaranthaceae.Amaryllidaceae, Apocynaceae, Asteraceae, Balsaminaceae, Begoniaceae, Berberidaceae, Brassi- caceae.Cannabaceae, Caprifoliaceae, Caryophyllaceae, Caryophyllaceae, Caryophyllaceae, Caryophyllaceae, Caryophyllaceae, Caryophyllaceae, Caryophyllaceae, Caryophyllaceae, Caryophyllaceae, Caryophyllaceae, Caryophyllaceae, Caryophyllaceae, Caryopyleaceae Cucurbitaceae, Cruciferae, Euphorbiaceae, Fabaceae, Gentianaceae, Geraniaceae, Graminae, liliaceae, Labiatae, Lamiaceae, Leguminosae, Liliaceae, Linaceae, Lobeliaceae, Malvaceae, Oleaceae, Plidaumaceae, Orchidacaceae, Orchidaceae Rosaceae, Rubiaceae, Scrophulariaceae, Solanaceae, Tropaeolaceae, Umbelliferae, Verbanaceae, Vitaceae and Violaceae are used.

69. Genetically modified plant according to claim 68, characterized in that plants are selected from the plant genera Marigold, Tagetes erecta, Tagetes patula, Acacia, Aconitum, Adonis, Arnica, Aqulegia, Aster, Astragalus, Bignonia, Calendula, Caltha, Campanula, Canna , Centaurea, Cheiranthus, Chrysanthemum, Citrus, Crepis, Crocus, Curcurbita, Cytisus, Delonia, Delphinium, Dianthus, Dimorphotheca, Doronicum, Eschscholtzia, Forsythia, Fremontia, Gazania, Gelsemium, Genista, Gentiana, Geranium, Gervillea, Geum , Helenium, helianthus, hepatica, heracleum, hisbiscus, heliopsis, hypericum, hypochoeris, Impatiens, Iris, Jacaranda, Kerria, Laburnum, Lathyrus, Leontodon, Lilium, Linum, Lotus, Lycopersicon, Lysimachia, Maratia, Medicago, Mimulus, Narcissus, Oenothera, Osmanthus, Petunia, Photinia, Physalis, Phyteuma, Potentilla, Pyra- cantha, ranunculus, rhododendron, pink, rudbeckia, senecio, silene, silphium, sinapsis, sorbus, spartium, tecoma, torenia, tragopogon, trollius, tropaeolum, tulipa, tussilago, ulex, viola or zinnia.

70. Use of the genetically modified organisms according to one of claims 63 to 69 as feed or food.

71. Use of the genetically modified organisms according to one of claims 63 to 69 for the production of ketocarotenoid-containing extracts or for the production of feed and food supplements.