EP1532266A2

EP1532266A2 - Method for producing ketocarotinoids in plant fruit

Info

Publication number: EP1532266A2
Application number: EP03792349A
Authority: EP
Inventors: Christel Renate Schopfer; Ralf Flachmann; Karin Herbers; Irene Kunze; Matt Sauer; Martin Klebsattel
Original assignee: SunGene GmbH
Current assignee: SunGene GmbH
Priority date: 2002-08-20
Filing date: 2003-08-18
Publication date: 2005-05-25
Also published as: WO2004017749A2; CA2495235A1; ZA200602230B; WO2004018385A3; IL166507A0; EP1531683A2; US7385123B2; NO20050598L; WO2004018693A2; DE50313184D1; AU2003258623A1; WO2004018695A3; CA2495878A1; NO20050704L; MXPA05001948A; US20060031963A1; MXPA05001659A; EP1532264A2; US7381541B2; NO20050703L

Abstract

The present invention relates to a process for preparing ketocarotenoids by cultivation of genetically modified organisms which, compared with the wild type, have a modified ketolase activity, to the genetically modified organisms, and to the use thereof as human and animal foods and for producing ketocarotenoid extracts.

Description

Process for the production of ketocarotenoids in fruit of plants

description

The present invention relates to a process for the production of ketocarotenoids by cultivating genetically modified plants which have a ketolase activity in fruits, the genetically modified plants, and their use as food or feed and for the production of ketocarotenoid extracts.

Carotenoids are synthesized de novo in bacteria, algae, fungi and plants. Ketocarotenoids, ie carotenoids, which contain at least one keto group, such as, for example, astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3 '-hydroxyechinenone, adonirubin or adonixanthin are natural antioxidants and pigments which some algae and microorganisms use as Secondary metabolites are produced.

Due to their coloring properties, the ketocarotenoids and especially astaxanthin are used as pigmenting aids in animal nutrition, especially in trout, salmon and shrimp farming.

Nowadays, astaxanthin is mainly produced using chemical synthesis processes. Natural ketocarotenoids, such as natural astaxanthin, are nowadays obtained in small amounts in biotechnological processes by cultivating algae, for example Haematococcus pluvialis, or by fermentation of genetically optimized microorganisms and subsequent isolation.

An economical biotechnological process for the production of natural ketocarotenoids is therefore of great importance.

WO 98/18910 describes the synthesis of ketocarotenoids in nectaries of tobacco flowers by introducing a ketolase gene into tobacco.

WO 01/20011 describes a DNA construct for the production of ketocarotenoids, in particular astaxanthin, in seeds of oilseed plants such as oilseed rape, sunflower, soybean and mustard using a seed-specific promoter and a ketolase from Haematococcus. The methods disclosed in the prior art provide genetically modified plants which contain ketocarotenoids in specific tissues, but have the disadvantage that the level of the ketocarotenoids and the purity, in particular astaxanthin, are not yet satisfactory ,

The object of the invention was therefore to provide an alternative process for the production of ketocarotenoids by cultivating plants, or to provide further transgenic plants which produce ketocarotenoids which have optimized properties, such as a higher ketocarotenoid content , and do not have the described disadvantage of the prior art.

Accordingly, a method for producing ketocarotenoids has been found by cultivating genetically modified plants that have ketolase activity in fruits.

Ketolase activity means the enzyme activity of a ketolase. s

A ketolase is understood to mean a protein which has the enzymatic activity of introducing a keto group on the optionally substituted β-ionone ring of carotenoids.

In particular, a ketolase is understood to mean a protein which has the enzymatic activity of converting β-carotene into cantaxanthin.

Accordingly, ketolase activity is understood to mean the amount of β-carotene converted or the amount of canthaxanthin formed in a certain time by the protein ketolase.

In a preferred embodiment, genetically modified plants which express a ketolase in fruits are used in order to have ketoase activity in the fruits of the genetically modified plants.

Genetically modified plants which contain at least one nucleic acid, coding for a ketolase, are therefore preferably used in the method according to the invention. No plants are known which have a ketolase activity as a wild type in fruits. In particular, the preferred plants described below in fruits as wild type have no ketolase activity.

In the present invention, the ketolase activity in fruits of the genetically modified plants is caused by the genetic modification of the parent plant. The genetically modified plant according to the invention thus has a ketolase activity in fruits in comparison to the genetically unmodified starting plant and is therefore preferably able to express a ketolase in fruits.

The term “parent plant” or “wild type” is understood to mean the corresponding non-genetically modified parent plant.

The term "genetically modified plant" is preferably understood to mean a plant which is genetically modified in comparison with the starting plant.

Depending on the context, the term "plant" can mean the starting plant (wild type) or a genetically modified plant according to the invention or both.

The gene expression of a nucleic acid encoding a ketolase is caused in the fruits of the plants preferably by introducing nucleic acids encoding ketolases into the starting plant.

The invention therefore relates in particular to the method described above, characterized in that genetically modified plants are used, into which, starting from a starting plant, at least one nucleic acid coding for a ketolase has been introduced.

In principle, any ketolase gene, ie any nucleic acid encoding a ketolase, can be used for this.

All nucleic acids mentioned in the description can be, for example, an RNA, DNA or cDNA sequence.

In the case of genomic ketolase sequences from eukaryotic sources which contain introns, in the event that the host plant is unable or unable to express the corresponding ketolase, nucleic acid sequences which have already been processed, such as the corresponding cDNAs, are preferred , to use. Examples of nucleic acids encoding a ketolase and the corresponding ketolases which can be used in the method according to the invention or in the genetically modified plants according to the invention described below are, for example, sequences from

Haematoccus pluvialis, especially from Haematoccus pluvialis Flotow em. Wille (Accession No. X86782; nucleic acid: SEQ ID No. 1, protein SEQ ID No. 2),

Haematoccus pluvialis, NIES-144 (Accession No. D45881; nucleic acid: SEQ ID No. 3, protein SEQ ID No. 4),

Agrobacterium aurantiacum (Accession No. D58420; nucleic acid: SEQ. ID. No. 5, protein SEQ ID No. 6),

Alicaligenes spec. (Accession No. D58422; nucleic acid: SEQ ID No. 7, protein SEQ ID No. 8),

Paracoccus marcusii (Accession No. Y15112; nucleic acid:

SEQ ID No. 9, protein SEQ ID No. 10). x

Synechocystis sp. Strain PC6803 (Accession No. S76617, NP442491; nucleic acid: SEQ ID No. 11, protein SEQ ID Nό. 12).

Bradyrhizobium sp. (Accession No. AF218415, BAB 74888; nucleic acid: SEQ ID No. 13, protein SEQ ID No. 14).

Nostoc sp. Strain PCC7120 (Accession No. AP003592; nucleic acid: SEQ ID No. 15, protein SEQ ID No. 16).

Haematococcus pluvialis (Accession NO: AF534876, AAN03484; nucleic acid: SEQ ID NO: 37, protein: SEQ ID NO: 38)

Paracoccus sp. MBIC1143 (Accession NO: D58420, P54972; nucleic acid: SEQ ID NO: 39, protein: SEQ ID NO: 40)

Brevundimonas aurantiaca (Accession NO: AY166610, AAN86030; Nucleic acid: SEQ ID NO: 41, Protein: SEQ ID NO: 42)

Nodularia spu igena NSOR10 (Accession NO: AY210783, AA064399; nucleic acid: SEQ ID NO: 43, protein: SEQ ID NO: 44)

Nostoc punctiforme ATCC 29133 (Accession NO: NZ_AABC01000195, ZP_00111258; nucleic acid: SEQ ID NO: 45, protein: SEQ ID NO: 46) Nostoc punctiforme ATCC 29133 (Accession NO: NZ_AABC01000196; nucleic acid: SEQ ID NO: 47, protein: SEQ ID NO: 48)

Deinococcus radiodurans Rl (Accession NO: E75561, AE001872; nucleic acid: SEQ ID NO: 49, protein: SEQ ID NO: 50)

Further natural examples of ketolases and ketolase genes which can be used in the process according to the invention can be obtained, for example, from different organisms, the genome sequence of which is known, by comparing the identity of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the databases described above Sequences and in particular with the sequences SEQ ID NO. 2 and / or SEQ ID NO. 16 easy to find.

Further natural examples of ketolases and ketolase genes can also be derived from the nucleic acid sequences described above, in particular from the sequences SEQ ID. No 1 and / or SEQ ID NO. 15 from different organisms, the genomic sequence of which is not known, can easily be found by hybridization techniques in a manner known per se. x

The hybridization can take place under moderate (low stringency) or preferably under stringent (high stringency) conditions.

Such hybridization conditions are described, for example, by Sambrook, J., Fritsch, EF, Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Gold Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6.

For example, the conditions during the washing step can be selected from the range of conditions limited by those with low stringency (with 2X SSC at 50 ° C) and those with high stringency (with 0.2X SSC at 50 ° C, preferably at 65 ° C) (20X SSC: 0.3 M sodium citrate, 3 M sodium chloride, pH 7.0).

In addition, the temperature during the washing step can be raised from moderate conditions at room temperature, 22 ° C, to stringent conditions at 65 ° C.

Both parameters, salt concentration and temperature, can be varied at the same time, one of the two parameters can also be kept constant and only the other can be varied. During the hybridization, denaturing agents such as Formamide or SDS can be used. In the presence of 50 R formamide, the hybridization is preferably carried out at 42 ° C.

Some exemplary conditions for hybridization and washing step are given as a result:

(1) Hybridization conditions with, for example

(i) 4X SSC at 65 ° C or

(ii) 6X SSC at 45 ° C, or

(iii) 6X SSC at 68 ° C, 100 mg / ml denatured fish sperm DNA, or

(iv) 6X SSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA at 68 ° C, or

(v) 6XSSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA, 50% formamide at 42 ° C, or

(vi) 50% formamide, 4X SSC at 42 ° C, or

(vii) 50% (vol / vol) formamide, 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer pH 6.5, 750 mM NaCl, 75 mM sodium citrate at 42 ° C, or

(viii) 2X or 4X SSC at 50 ° C (moderate conditions), or

(ix) 30 to 40% formamide, 2X or 4X SSC at 42 ° (moderate conditions).

(2) washing steps for 10 minutes each with for example

(i) 0.015 M aCl / 0.0015 M sodium citrate / 0.1% SDS at 50 ° C, or

(ii) 0.1X SSC at 65 ° C, or

(iii) 0.1X SSC, 0.5% SDS at 68 ° C, or

(iv) 0.1X SSC, 0.5% SDS, 50% formamide at 42 ° C, or

(v) 0.2X SSC, 0.1% SDS at 42 ° C, or (vi) 2X SSC at 65 ° C (moderate conditions).

In a preferred embodiment of the method according to the invention, nucleic acids are encoded which encode a protein containing the amino acid sequence SEQ ID NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, preferably at least 70 %, more preferably at least 80%, particularly preferably at least 90% at the amino acid level with the sequence SEQ ID NO. 2 and has the enzymatic property of a ketolase.

This can be a natural ketolase sequence that can be found as described above by comparing the identity of the sequences from other organisms or an artificial ketolase sequence that starts from the sequence SEQ ID NO. 2 has been modified by artificial variation, for example by substitution, insertion or deletion of amino acids.

In a further preferred embodiment of the method according to the invention, nucleic acids are encoded which encode a protein containing the amino acid sequence SEQ ID NO. 16 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70 %, more preferably at least 80%, particularly preferably at least 90% at the amino acid level with the sequence SEQ ID NO. 16 and has the enzymatic property of a ketolase.

This can be a natural ketolase sequence that can be found as described above by comparing the identity of the sequences from other organisms or an artificial ketolase sequence that starts from the sequence SEQ ID NO. 16 was modified by artificial variation, for example by substitution, insertion or deletion of amino acids.

In the description, the term “substitution” is to be understood as meaning the replacement of one or more amino acids by one or more amino acids. So-called conservative exchanges are preferably carried out, in which the replaced amino acid has a similar property to the original amino acid, for example exchange of Glu by Asp, Gin by Asn, Val by Ile, Leu by Ile, Ser by Thr.

Deletion is the replacement of an amino acid with a direct link. Preferred positions for deletions are the termini of the polypeptide and the links between the individual protein domains.

Inserts are insertions of amino acids into the polypeptide chain, whereby a direct bond is formally replaced by one or more amino acids.

Identity between two proteins is understood to mean the identity of the amino acids over the respective total protein length, in particular the identity that is obtained by comparison using the laser gene software from DNASTAR, inc. Madison, Wisconsin (USA) using the clustal method (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151-1) is calculated using the following parameters: x

Multiple align ent parameters:

Gap penalty 10 Gap length penalty 10

Pairwise alignment parameters:

K-tuple 1

Gap penalty 3

Window 5 Diagonals saved 5

Under a protein that has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO. 2 or 16, a protein is accordingly understood which, when its sequence is compared with the sequence SEQ ID NO. 2 or 16, in particular according to the above program algorithm with the above parameter set, has an identity of at least 20%.

Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

Those codons which are frequently used in accordance with the plant-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other known genes of the organisms concerned. In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO is brought. 1, in the plant.

In a further particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO is brought. 15, in the plant.

All of the above-mentioned ketolase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can, for example, in a known manner, according to the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, page

896-897). The attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of the DNA

Polymerase and ligation reactions as well as general cloning procedures are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press. x

In a particularly preferred embodiment of the method according to the invention, genetically modified plants are used which have the highest expression rate of a ketolase in fruits.

This is preferably achieved in that the gene expression of the ketolase takes place under the control of a fruit-specific promoter. For example, the nucleic acids described above, as described in detail below, are introduced into the plant in a nucleic acid construct, functionally linked to a fruit-specific promoter.

According to the invention, plants are preferably understood to mean plants which have chromoplasts as wild type in fruits.

Further preferred plants have, as wild type in the fruit, carotenoids, in particular β-carotene, zeaxanthin, neoxanthine, violaxanthin or lutein.

Further preferred plants have a hydroxylase activity as wild type in the fruit.

Hydroxylase activity means the enzyme activity of a hydroxylase. A hydroxylase is understood to mean a protein which has the enzymatic activity of introducing a hydroxyl group on the optionally substituted β-ionone ring of carotenoids.

In particular, a hydroxylase is understood to mean a protein which has the enzymatic activity to convert β-carotene into zeaxanthin or canthaxanthin into astaxanthin.

Accordingly, hydroxylase activity is understood to mean the amount of β-carotene or canthaxanthin converted or the amount of zeaxanthin or astaxanthin formed in a certain time by the protein hydroxylase.

In a preferred embodiment, plants are cultivated which, in addition to the wild type, have an increased hydroxylase activity and / or β-cyclase activity.

Hydroxylase activity means the enzyme activity of a hydroxylase.

A hydroxylase is understood to mean a protein which has the enzymatic activity of introducing a hydroxyl group on the optionally substituted β-ionone ring of carotenoids.

In particular, a hydroxylase is understood to mean a protein which has the enzymatic activity to convert β-carotene into zeaxanthin or cantaxanthin into astaxanthin.

Accordingly, hydroxyase activity is understood to mean the amount of β-carotene or cantaxanthin converted or the amount of zeaxanthin or astaxanthin formed in a certain time by the protein hydroxylase.

With an increased hydroxylase activity compared to the wild type, the amount of β-carotene or cantaxantin or the amount of zeaxanthin or astaxanthin formed is increased in a certain time by the protein hydroxylase compared to the wild type.

This increase in hydroxylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the hydroxylase Wild type activity. Β-cyclase activity means the enzyme activity of a β-cyclase.

A ß-cyclase is understood to be a protein which has the enzymatic activity to convert a terminal, linear residue of lycopene into a ß-ionone ring.

In particular, a β-cyclase is understood to be a protein which has the enzymatic activity to convert γ-carotene into β-carotene.

Accordingly, β-cyclase activity is understood to mean the amount of γ-carotene converted or the amount of β-carotene formed in a certain time by the protein ß-cyclase.

If the β-cyclase activity is higher than that of the wild type, the amount of γ-carotene converted or the amount of β-carotene formed is increased by the protein ß-cyclase in a certain time compared to the wild type.

This increase in the β-cyclase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the β- Wild-type cyclase activity.

According to the invention, the term “wild type” is understood to mean the corresponding non-genetically modified starting plant.

Preferably and in particular in cases in which the plant or the wild type cannot be clearly assigned, “wild type” is used to increase the hydroxylase activity, to increase the β-cyclase activity and to increase the ketocarotenoid content in each case understood a reference plant.

This reference plant is preferably Lycopersicon esculentum.

The hydroxylase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably determined under the following conditions:

The activity of the hydroxylase is according to Bouvier et al. (Biochim. Biophys. Acta 1391 (1998), 320-328) in vi tro. Ferredoxin, ferredoxin-NADP oxidoreductase, catalase, NADPH and beta-carotene with mono- and digalact psylglycerides are added to a certain amount of plant extract. The hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, Keller, d'Harginue and Camara (xanthophyll biosynthesis: molecular and functional characterization of carotenoid hydroxylases from pepper 5 fruits (Capsicum annuum L .; Biochim. Biophys Acta 1391 (1998) 320-328):

The in vitro assay is carried out in a volume of 0.250 ml volume. The batch contains 50 mM potassium phosphate (pH 7.6),

10 0.025 mg ferredoxin from spinach, 0.5 units ferredoxin-NADP-t oxidoreductase from spinach, 0.25 mM NADPH, 0.010 mg beta-carotene (emulsified in 0.1 mg Tween 80), 0.05 mM a mixture of mono- and digalactosylglycerides (1: 1 ), 1 unit of catalysis, 200 mono- and digalactosylglycerides, (1: 1), 0.2 mg bovine serum albumin and

15 plant extract in different volumes. The reaction mixture is incubated for 2 hours at 30C. The reaction products are extracted with organic solvent such as acetone or chloroform / methanol (2: 1) and determined by means of HPLC.

The determination of the β-cyclase activity in genetically modified plants according to the invention and in wild-type or reference plants is preferably carried out under the following conditions:

The activity of the β-cyclase is determined in vitro according to Fräser and Sandmann (Bio-25 formerly Biophys. Res. Comm. 185 (1) (1992) 9-15). Potassium phosphate as a buffer (pH 7.6), lycopene as a substrate, paprika stromal protein, NADP +, NADPH and ATP are added to a certain amount of plant extract.

30 The hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, d'Harlingue and Camara (Molecular Analysis of carotenoid cyclae inhibition; Aren. Biochem. Biophys. 346 (1) (1997) 53-64):

35 The in vitro assay is carried out in a volume of 250 ° = 1 volume. The mixture contains 50 mM potassium phosphate (pH 7.6) _» different amounts of plant extract, 20 nM lycopene, 250 ° = g of chromoplastidic stromal protein from paprika, 0.2 mM NADP +, 0.2 mM NADPH and 1 mM ATP. NADP / NADPH and ATP are in

40 10 ml ethanol dissolved with 1 mg Tween 80 immediately before adding to the incubation medium. After a reaction time of 60 minutes at 30C, the reaction is ended by adding chloroform / methanol (2: 1). The reaction products extracted in chloroform are analyzed by HPLC.

45 An alternative assay with a radioactive substrate is described in Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15).

The hydroxylase activity and / or β-cyclase activity can be increased in various ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing the gene expression of nucleic acids encoding a hydroxylase and / or of nucleic acids encoding a β-cyclase the wild type.

The increase in the gene expression of the nucleic acids encoding a hydroxylase and / or the increase in the gene expression of the nucleic acid encoding a β-cyclase compared to the wild type can likewise be carried out in various ways, for example by inducing the hydroxylase gene and / or β-cyclase gene by activators or by introducing one or more hydroxylase gene copies and / or β-cyclase gene copies, ie by introducing at least one nucleic acid encoding a hydroxylase and / or at least one nucleic acid encoding an ε-cyclase into the plant.

Increasing the gene expression of a nucleic acid encoding a hydroxylase and / or β-cyclase is also understood according to the invention to mean the manipulation of the expression of the plants' own endogenous hydroxylase and / or β-cyclase.

This can be achieved, for example, by changing the promoter DNA sequence for genes encoding hydroxylases and / or β-cyclases. Such a change, which results in an increased expression rate of the gene, can take place, for example, by deleting or inserting DNA sequences.

As described above, it is possible to change the expression of the endogenous hydroxylase and / or β-cyclase by applying exogenous stimuli. This can take place through special physiological conditions, ie through the application of foreign substances.

Furthermore, an altered or increased expression of an endogenous hydroxylase and / or β-cyclase gene can be achieved in that a regulator protein which does not occur in the non-transformed plant interacts with the promoter of this gene. Such a regulator can represent a chimeric protein which consists of a DNA binding domain and a transcription activator domain, as described for example in WO 96/06166.

In a preferred embodiment, the gene expression of a nucleic acid encoding a hydroxylase is increased and / or the gene expression of a nucleic acid encoding a β-cyclase is increased by introducing at least one nucleic acid encoding a hydroxylase and / or by introducing at least one nucleic acid encoding one ß-cyclase into the plant.

In principle, any hydroxylase gene or each β-cyclase gene, that is to say any nucleic acid which codes for a hydroxylase and any nucleic acid which codes for a β-cyclase, can be used for this purpose.

With genomic hydroxylase or. β-cyclase nucleic acid sequences from eukaryotic sources which contain introns are preferably already processed in the event that the host plant is unable or cannot be able to express the corresponding hydroxylase or β-cyclase Nucleic acid sequences, how to use the corresponding cDNAs. x

Examples of hydroxylase genes are nucleic acids,

encoding a hydroxylase from Haematococcus pluvialis, accession AX038729, WO 0061764); (Nucleic acid: SEQ ID NO: 51, protein: SEQ ID NO: 52),

and hydroxylase genes of the following accession numbers:

| emb | CAB55626.1, CAA70427.1, CAA70888.1, CAB55625.1, AF499108_1, AF315289_1, AF296158_1, AAC49443.1, NP_194300.1, NP_200070.1, AAG10430.1, CAC06712.1, AAM889519.1 .1, AAL80006.1, AF162276_1, AA053295.1, AAN85601.1, CRTZ_ERWHE, CRTZ_PANAN, BAB79605.1, CRTZ_ALCSP, CRTZ_AGRAU, CAB56060.1, ZP_00094836.1, AAC4483852.1, NPAC745370.144, NPAC745370.144 .1, NP_849490.1, ZP_00087019.1, NP_503072.1, NP_852012.1, NP_115929.1, ZP_00013255.1

Another particularly preferred hydroxylase is the hydroxylase from tomato) (nucleic acid: SEQ. ID. No. 55; protein: SEQ. ID. No. 56) Examples of b-cyclase genes are nucleic acids encoding a b-cyclase from tomato (Accession X86452). (Nucleic acid: SEQ ID NO; 53, protein: SEQ ID NO: 54), and b-cyclase genes of the following accession numbers:

S66350 lycopene beta-cyclase (EC 5.5.1.-) - tomato

CAA60119 lycopene synthase [Capsicum annuum]

S66349 lycopene beta-cyclase (EC 5.5.1.-) - common tobacco CAA57386 lycopene cyclase [Nicotiana tabacum] AAM21152 lycopene beta-cyclase [Citrus sinensis] AAD38049 lycopene cyclase [Citrus x paradisi] AAN86060 lycopene cyclase [Citrus unshiuuene] AAF44 -cyclase [Citrus sinensis] AAK07430 lycopene beta-cyclase [Adonis palaestina] AAG10429 beta cyclase [Tagetes erecta] AAA81880 lycopene cyclase AAB53337 Lycopene beta cyclase AAL92175 beta-lycopene cyclase [Sandersonia aurantiaca] CAA6733on lyissene] CAA67331 lycopene erecta] AA018661 lycopene beta-cyclase [Zea mays] AAG21133 chromoplast-specific lycopene beta-cyclase

[Lycopersicon esculentum]

AAF18989 lycopene beta-cyclase [Daucus carota] ZP_001140 hypothetical protein [Prochlorococcus marinus str.

MIT9313]

ZP_001050 hypothetical protein [Prochlorococcus marinus subsp. pastoris str. CCMP1378]

ZP_001046 hypothetical protein [Prochlorococcus marinus subsp. pastoris str. CCMP1378]

ZP_001134 hypothetical protein [Prochlorococcus marinus str.

MIT9313]

ZP_001150 hypothetical protein [Synechococcus sp. WH 8102] AAF10377 lycopene cyclase [Deinococcus radiodurans] BAA29250 393aa long hypothetical protein [Pyrococcus horikoshii]

BAC77673 lycopene beta-monocyclase [marine bacterium P99-3] AAL01999 lycopene cyclase [Xanthobacter sp. Py2] ZP_000190 hypothetical protein [Chloroflexus aurantiacus] ZP_000941 hypothetical protein [Novosphingobium aromaticivorans]

AAF78200 lycopene cyclase [Bradyrhizobium sp. ORS278] BAB79602 crtY [Pantoea agglomerans pv. Milletiae] CAA64855 lycopene cyclase [Streptomyces griseus] AAA21262 dycopene cyclase [Pantoea agglomerans] C37802 crtY protein - Erwinia uredovora BAB79602 crtYans [Pantoea millglomer. AAA64980 lycopene cyclase [Pantoea agglomerans]

AAC44851 lycopene cyclase

BAA09593 Lycopene cyclase [Paracoccus sp. MBIC1143]

ZP_000941 hypothetical protein [Novosphingobium aromaticivorans]

CAB56061 lycopene beta-cyclase [Paracoccus marcusii]

BAA20275 lycopene cyclase [Erythrobacter longus]

ZP_000570 hypothetical protein [Thermobifida fusca]

ZP_000190 hypothetical protein [Chloroflexus aurantiacus] AAK07430 lycopene beta-cyclase [Adonis palaestina]

CAA67331 lycopene cyclase [Narcissus pseudonarcissus]

AAB53337 Lycopene beta cyclase

BAC77673 lycopene beta-monocyclase [marine bacterium P99-3]

A particularly preferred β-cyclase is also the chromoplast-specific b-cyclase from tomato (AAG21133) (nucleic acid: SEQ. ID. No. 57; protein: SEQ. ID. No. 58)

In this preferred embodiment, the preferred transgenic plants according to the invention therefore have at least one further hydroxylase gene and / or β-cyclase gene compared to the wild type.

In this preferred embodiment, the genetically modified plant has, for example, at least one exogenous nucleic acid, coding for a hydroxylase or at least two endogenous nucleic acids, coding for a hydroxylase and / or at least one exogenous nucleic acid, coding for a β-cyclase or at least two endogenous nucleic acids, coding for one β-cyclase.

In the preferred embodiment described above, nucleic acids encoding proteins are preferably used which contain the amino acid sequence SEQ ID NO: 52 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 30 %, preferably at least 50%, more preferably at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ. ID. NO: 52, and which have the enzymatic property of a hydroxylase.

Further examples of hydroxylases and hydroxylase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the amino acids or the corresponding ones with homology back-translated nucleic acid sequences from databases with the SeQ ID. NO: 52 easy to find.

Further examples of hydroxylases and hydroxylase genes can also be found, for example, based on the sequence

SEQ ID NO: 51 from various organisms whose genomic sequence is not known, as described above, can easily be found by hybridization and PCR techniques in a manner known per se.

10

In a further particularly preferred embodiment, to increase the hydroxylase activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the hydroxylase of the sequence SEQ ID NO: 52.

15

Those codons that are frequently used in accordance with the plant-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other, known genes of the organisms in question.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ is brought. ID. NO: 51 in the organism.

In the preferred embodiment described above, the β-cyclase genes used are preferably nucleic acids which encode proteins containing the amino acid sequence SEQ ID NO: 54 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and which have an identity of at least 30%, preferably at least 50%, more preferably at least 35 at least 70%, even more preferably at least 90%, most preferably at least 95% at the amino acid level with the sequence SEQ ID NO: 54, and which have the enzymatic property of a β-cyclase.

40 Further examples of β-cyclases and β-cyclase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID NO:

45 54 easy to find. Further examples of β-cyclases and β-cyclase genes can also be easily found, for example, starting from the sequence SEQ ID NO: 53 from various organisms whose genomic sequence is not known, using hybridization and PCR techniques in a manner known per se.

In a further particularly preferred embodiment, to increase the β-cyclase activity, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the β-cyclase of the sequence SEQ. ID. NO: 54.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ is brought. ID. NO: 53 in the organism.

All of the above-mentioned hydroxylase genes or β-cyclase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can, for example, be known

Way, according to the phosphoamidite method (Voet, Voet, 2nd edition, Willey Press New York, page 896-897). The addition of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al.

(1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

Particularly preferred plants are plants selected from the plant genera Actinophloeus, Aglaeonema, pineapple, Arbutus, Archontophoenix, Area, Aronia, Asparagus, Attalea, Berberis, Bixia, Brachychilum, Bryonia, Caliptocalix, Capsicum, Carica, Celastrus, Citrullus, Citrus, Convallaria Cotoneaster, Crataegus, Cucumis, Cucurbita, Cuscuta, Cycas, Cyphomandra, Dioscorea, Diospyrus, Dura, Elaeagnus, Elaeis, Erythroxylon, Euonymus, Ficus, Fortunella, Fragaria, Gardinia, Gonocaryum, Gossypium, Guava, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma, Guilielma Lathy- rus, Lonicera, Luffa, Lyciu, Lycopersicum, Malpighia, Mangifera, Mormodica, Murraya, Musa, Nenga, Palisota, Pandanus, Passiflora, Persea, Physalis, Prunus, Ptychandra, Punica, Pyracantha, Pyrus, Ribes, Rosa, Rubus, Sabal, Sambucus, Seaforita, Shepherdia, Solanum, Sorbus, Synaspadix, Tabernae, Ta us, Taxus, Trichosanthes, Triphasia, Vaccinium, Viburnum, Vignia or Vitis.

The ketolase activity in genetically modified plants according to the invention is determined in accordance with the method of Frazer et al. , (J. Biol. Chem. 272 (10): 6128-6135, 1997). The ketolase activity in plant extracts is determined with the substrates beta-carotene and canthaxanthin in the presence of lipid (soy lecithin) and detergent (sodium cholate). Substrate / product ratios from the ketolase assays are determined by means of HPLC.

In the process according to the invention for producing ketocarotenoids, the cultivation step of the genetically modified plants, hereinafter also referred to as transgenic plants, is preferably followed by harvesting the plants and isolating ketocarotenoids from the fruits of the plants. x

The transgenic plants are raised in a manner known per se

Culture media are grown and harvested accordingly.

Ketocarotenoids are isolated from the harvested fruits in a manner known per se, for example by drying and subsequent extraction and, if appropriate, further chemical or physical purification processes, such as, for example, precipitation methods, crystallography, thermal separation processes, such as rectification processes or physical separation processes, such as chromatography. Ketocarotenoids are isolated from the fruit, for example, preferably by organic solvents such as acetone, hexane, ether or tert. Methyl butyl ether.

Further isolation methods of ketocarotenoids are described, for example, in Egger and Kleinig (Phytochemistry (1967) 6, 437-440) and Egger (Phytochemistry (1965) 4, 609-618).

The ketocarotenoids are preferably selected from the group astaxanthin, canthaxanthin, echinenone, 3-hydroxyechinenone, 3'-hydroxyechinenone, adonirubin and adonixanthin.

A particularly preferred ketocarotenoid is astaxanthin. The transgenic plants are preferably produced by transforming the starting plants, using a nucleic acid construct which contains at least one, preferably also more than one of the above-described nucleic acids which are functionally linked to one or more regulatory signals which ensure transcription and translation in plants ,

These nucleic acid constructs, in which the coding nucleic acid sequence is functionally linked to one or more regulatory signals which ensure transcription and translation in plants, are also called expression cassettes below.

The regulation signals preferably contain one or more 15 promoters which ensure transcription and translation in plants.

The expression cassettes contain regulatory signals, that is, regulatory nucleic acid sequences which express the expression of the

Control 20 coding sequence in the host cell. According to a preferred embodiment, an expression cassette comprises upstream, i.e. at the 5 'end of the coding sequence, a promoter and downstream, i.e. at the 3 'end, a polyadenylation signal and optionally further regulatory elements which are associated with

25 of the intermediate coding sequence for at least one of the genes described above are operatively linked. An operative link is understood to mean the sequential arrangement of promoter, coding sequence, terminator and possibly other regulatory elements such that each of the regulatory

30 elements can perform its function as intended in the expression of the coding sequence.

The preferred nucleic acid constructs, expression cassettes and vectors for plants and methods for producing transgenic plants and the transgenic plants themselves are described below by way of example.

The sequences preferred but not limited to the operative linkage are targeting sequences to ensure

40 improvement of the subcellular localization in the apoplast, in the vacuole, in plastids, in the mitochondrion, in the endoplasmic reticulum (ER), in the cell nucleus, in oil corpuscles or other compartments and translation enhancers like the 5 'guiding sequence from tobacco Mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987),

45 8693-8711). In principle, any promoter which can control the expression of foreign genes in plants is suitable as promoters of the expression cassette.

"Constitutive" promoter means those promoters that have a

Ensure expression in numerous, preferably all, tissues over a longer period of plant development, preferably at all times during plant development.

In particular, a vegetable one is preferably used

Promoter or a promoter derived from a plant virus. Particularly preferred is the promoter of the 35S transcript of the CaMV cauliflower mosaic virus (Franck et al. (1980) Cell 21: 285-294; Odell et al. (1985) Nature 313: 810-812; Shewmaker et al. (1985) Virology 140 : 281-288; Gardner et al. (1986) Plant Mol Biol

6: 221-228) or the 19S CaMV promoter (US 5,352,605; WO 84/02913; Benfey et al. (1989) EMBO J 8: 2195-2202).

Another suitable constitutive promoter is the pds Prooter (Pecker et al. (1992) Proc. Natl. Acad. Be USA 89: 4962-4966) or the "Rubisco small subunit (SSU)" promoter (US 4,962,028) , the LeguminB promoter (GenBank Acc.No. X0S677), the promoter of nopaline synthase from Agrobacterium, the TR double promoter, the OCS (octopine synthase) promoter from Agrobacterium, the ubiquitin promoter (Holtorf S et al. (1995 ) Plant Mol Biol 29: 637-649), the Ubiquitin 1 promoter (Christensen et al. (1992) Plant Mol Biol 18: 675-689; Bruce et al. (1989) Proc Natl Acad Sei USA 86: 9692-9696) , the Smas promoter, the cinnamyl alcohol holdehydrogenase promoter (US 5,683,439), the promoters of the vacuolar ATPase subunits or the promoter of a proline-rich protein from wheat (WO 91/13991), the Pnit promoter (Y07648.L, Hillebrand et al. (1998), Plant. Mol. Biol. 36, 89-99, Hillebrand et al. (1996), Gene, 170, 197-200, the ferredoxin NADPH oxidoreductase promoter (database entry ag AB011474, positions 70127 to 69493), the TPT promoter (WO 03006660), the "super promoter" (US patent 5955646), the 34S promoter (US patent 6051753) and further promoters of genes, their constitutive expression in plants is known to the expert.

The expression cassettes can also contain a chemically inducible promoter (review article: Gatz et al. (1997) Annu Rev Plant Physiol Plant Mol Biol 48: 89-108), by means of which the expression of the ketolase gene in the plant is controlled at a specific point in time can. Such promoters, such as the PRPl promoter (Ward et al. (1993) Plant Mol Biol 22: 361-366), salicylic acid-inducible promoter (WO 95/19443), a benzenesulfonamide-inducible promoter (EP 0 388 186), a promoter inducible by tetracycline (Gatz et al. (1992) Plant J 2: 397-404), a promoter inducible by abscisic acid (EP 0 335 528) or a promoter inducible by ethanol or cyclohexanone (WO 93 / 21334) can also be used.

Promoters which are induced by biotic or abiotic stress are also preferred, for example the pathogen-inducible promoter of the PRPL gene (Ward et al. (1993) Plant Mol Biol 22: 361-366), the heat-inducible hsp70 or hsp80 Promoter from tomato (US Pat. No. 5,187,267), the cold-inducible alpha-amylase promoter from the potato (WO 96/12814), the light-inducible PPDK promoter or the wound-induced pinII promoter (EP375091).

Pathogen-inducible promoters include those of genes induced by pathogen attack such as genes from PR proteins, SAR proteins, b-1, 3-glucanase, chitinase etc. (e.g. Redolfi et al. (1983) Neth J Plant Pathol 89: 245-254; Uknes, et al. (1992) The Plant

Cell4: 645-656; Van Loon (1985) Plant Mol Viral 4: 111-116; Marineau et al. (1987) Plant Mol Biol 9: 335-342; Matton et al. ^x (1987) Molecular Plant-Microbe Interactions 2: 325-342; Somssich et al. (1986) Proc Natl Acad Sei USA 83: 2427-2430; SÖmssich et al. (1988) Mol Gen Genetics 2: 93-98; Chen et al. (1996) Plant J 10: 955-966; Zhang and Sing (1994) Proc Natl Acad Sei USA 91: 2507-2511; Warner, et al. (1993) Plant J 3: 191-201; Siebertz et al. (1989) Plant Cell 1: 961-968 (1989).

Also included are wound-inducible promoters such as that of the pinll gene (Ryan (1990) Ann Rev Phytopath 28: 425-449; Duan et al. (1996) Nat Biotech 14: 494-498), the wunl and wun2 gene (US 5,428,148), the winl and win2 genes (Stanford et al. (1989) Mol Gen Genet 215: 200-208), the systemin (McGurl et al. (1992) Science 225: 1570-1573), the WIPl gene (Rohmeier et al. (1993) Plant Mol Biol 22: 783-792; Ekelkamp et al. (1993) FEBS Letters 323: 73-76), the MPI gene (Corderok et al. (1994) The Plant J 6 ( 2): 141-150) and the like.

Further suitable promoters are, for example, fruit ripening-specific promoters, such as, for example, the fruit ripening-specific promoter from tomato (WO 94/21794, EP 409 625). Development-dependent promoters partly include the tissue-specific promoters, since the formation of individual tissues is naturally development-dependent. Furthermore, promoters are particularly preferred which ensure expression in tissues or parts of plants in which, for example, the biosynthesis of ketocarotenoids or their precursors takes place. For example, promoters with specificities for the anthers, ovaries, petals, sepals, flowers, leaves, stems, roots and fruits and combinations thereof are preferred.

Tuber-, storage root- or root-specific promoters are, for example, the patatin class I promoter (B33) or the potato cathepsin D inhibitor promoter.

Leaf-specific promoters are, for example, the promoter of the cytosolic FBPase from potato (WO 97/05900), the SSU promoter (small subunit) of Rubisco (ribulose-1, 5-bisphosphate carboxylase) or the ST-LSI promoter from potato (Stockhaus et al (1989) EMBO J 8: 2445-2451).

Flower-specific promoters are, for example, the phytoene synthesis promoter (WO 92/16635) or the promoter of the P-rr gene (WO

98/22593). x

Anther-specific promoters are, for example, the 5126 promoter (US 5,689,049, US 5,689,051), the glόb-1 promoter or the g-zein promoter.

Fruit-specific promoters are, for example

the Pds promoter from tomato (Genbank ACCESSION U46919; Corona, V., Aracri, B., Kosturkova, G., Bartley, GE, Pitto, L., Giorgetti, L., Scolnik, PA and Giuliano, G ., Regulation of a carotenoid biosynthesis gene promoter during plant development Plant J. 9 (4), 505-512 (1996)), SEQ ID N0.17,

the 2A11 promoter from tomato (Pear, JR, Ridge, N., Rasmussen, R., Rose, RE and Houck, CM. Isolation and characterization of a fruit-specific cDNA and the corresponding genomic clone from tomatoPlant Mol. Biol. 13 ( 6), 639-651 (1989), SEQ ID NO. 18,

the cucumisin promoter (Yamagata, H., Yonesu, K., Hirata, A. and Aizono, Y., TGTCACA Motif Is a Novel cis-Regulatory Enhancer Element Involved in Fruit-specific Expression of the cucumisin Gene J. Biol. Chem. 277 (13), 11582-11590 (2002), SEQ ID NO. 19, the promoter of the endogalacturonase gene (Redondo-Nevado, J., Medina-Escobar, N., Caballero-Repullo, JL and Munoz-Blanco, J.

A fruit-specific and developmentally regulated endo-polygalacturonase gene from strawberry (Fragaria x ananassa c.v. Chandler), J Experimental Botany 52 (362) 1941-1945 (2001), SEQ ID NO. 20

the polygalacturonase promoter from tomato (Nicholass, FJ, Smith, CJ, Schuch, W., Bird, CR and Grierson, D., High levels of ripening-specific reporter gene expression directed by tomato fruit polygalacturonase gene-flanking regions, Plant Mol. Biol. 28 (3), 423-435 (1995)), SEQ ID NO. 21

the TMF7 and TMF9 promoters (US 5608150),

the promoter E4 (Cordes S. Deikman J. Margossian LJ. Fischer RL. Interaction of a developmentally regulated DNA-binding factor with sites flanking two different fruit-ripening genes from tomato (1989), Plant Cell 1, 1025-1034) and

the promoter E8 (Deikman and Fisher, Interaction of a DNA binding factor with the 5 '-flanking region of an ethylene-responsive fruit ripening gene from tomato (1988), EMBO J. 7, 3315-3320). Further promoters suitable for expression in plants are described (Rogers et al. (1987) Meth in Enzymol 153: 253-277; Schardl et al. (1987) Gene 61: 1-11; Berger et al. (1989) Proc Natl Acad Sei USA 86: 8402-8406)

All promoters described in the present application generally enable expression of the ketolase in fruits of the plants according to the invention.

In the method according to the invention, constitutive and in particular fruit-specific promoters are particularly preferred.

The present invention therefore relates in particular to a nucleic acid construct containing functionally linked a fruit-specific promoter, particularly preferably a fruit-specific promoter described above, and a nucleic acid encoding a ketolase.

An expression cassette is preferably produced by fusing a suitable promoter with a nucleic acid described above, encoding a ketolase and preferably a nucleic acid inserted between promoter and nucleic acid sequence, which codes for a plastid-specific transit peptide, and a polyadenylation signal in accordance with current standards Recombination and cloning techniques, as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in TJ Silhavy, ML Berman and LW En - quist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, FM et al. , Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).

The preferably inserted nucleic acids encoding a plastic transit peptide ensure localization in plastids and in particular in chromoplasts.

Expression cassettes, the nucleic acid sequence of which codes for a ketolase fusion protein, can also be used, part of the fusion protein being a transit peptide which controls the translocation of the polypeptide. Preferred transit peptides are preferred for the chromoplasts, which are cleaved enzymatically from the ketolase part after translocation of the ketolase into the chromoplasts.

The transit peptide which is derived from the plastic Nicotiana tabacum Transketolase or another transit peptide (for example the transit peptide of the small subunit of Rubisco (rbcS) or the ferredoxin NADP oxidoreductase and also the isopentenyl pyrophosphate isomerase-2) or its functional equivalent is particularly preferred is derived.

Nucleic acid sequences of three cassettes of the plastid transit peptide of plastid transketolase from tobacco in three reading frames are particularly preferred as Kpnl / BamHI fragments with an ATG codon in the Ncol interface:

pTP09

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGA TCC_BamHI

pTPlO

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA

ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGCTG GATCC_BamHI

pTPll

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATCCTCTCTCGTTCTGTC CCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAA ATCCAATCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCG TAAGGTCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGAGACTGCGGGG ATCC_BamHI

Further examples of a plastid transit peptide are the transit peptide of the plastid isopentenyl pyrophosphate isomerase-2 (IPP-2) from Arabisopsis thaliana and the transit peptide of the small subunit of the ribulose bisphosphate carboxylase (rbcS) from pea (Guerineau, F, Woolston, S Brooks, L, Mullineaux, P (1988) An expression cassette for targeting foreign proteins into the chloroplstas. Nucl. Acids Res. 16: 11380).

The nucleic acids according to the invention can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural nucleic acid constituents, and can consist of different heterologous gene segments from different organisms.

As described above, preference is given to synthetic nucleotide sequences with codons which are preferred by plants. These plant-preferred codons can be determined from the highest protein frequency codons expressed in most interesting plant species.

When preparing an expression cassette, various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame. To connect the DNA fragments to one another, adapters or linkers can be attached to the fragments.

The promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction sites for the insertion of this sequence. As a rule, the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. In general, the linker has a size of less than 100 bp within the regulatory areas, often less than 60 bp, but at least 5 bp. The promoter can be native or homologous as well as foreign or heterologous to the host plant his. The expression cassette preferably contains in the 5 '-3' transcription direction the promoter, a coding nucleic acid sequence or a nucleic acid construct and a region for the transcriptional termination. Different termination areas are interchangeable.

An example of a terminator is the 35S terminator (Guerineau et al. (1988) Nucl Acids Res. 16: 11380), the nos terminator (Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM. Nopaline synthase: transcript mapping and DNA sequence. J Mol Appl Genet. 1982; 1 (6): 561-73) or the ocs terminator (Gielen, J, de Beuckeleer, M, Seurinck, J, Debroek, H, de Greve, H, Lemmers, M, van Montagu, M, Schell, J (1984) The complete sequence of the TL-DNA of the Agrobacterium tumefaciens plasmid pTiAch5. EMBO J. 3: 835-846).

Manipulations which provide suitable restriction sites or which remove superfluous DNA or restriction sites can also be used. Where insertions, deletions or substitutions such as Transitions and transversions can be used in v ro mutagenesis, "primer repair", restriction or ligation.

With suitable manipulations, e.g. Restriction, "chewing-back" or filling of overhangs for "bluntends", complementary ends of the fragments can be made available for the ligation.

Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) of the Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 (1984), 835 ff) or functional equivalents.

The transfer of foreign genes into the genome of a plant is called transformation.

Methods known per se for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation can be used for this purpose.

Suitable methods for the transformation of plants are the protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene gun - the so-called particle bombardment method, the electroporation, the incubation of dry embryos in DNA-containing solution, the micro- injection and Agrobacterium-mediated gene transfer described above. The methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Academic Press (1993), 128- 143 and in Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225).

The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711) or particularly preferably pSUN2, pSUN3, pSUN4 or pSUN5 (WO 02/00900).

Agrobacteria transformed with an expression plasmid can be used in a known manner to transform plants, e.g. by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

For the preferred production of genetically modified plants, hereinafter also referred to as transgenic plants, the fused expression cassette, which expresses a ketolase, is cloned into a vector, for example pBin19 or in particular pSUN2, which is suitable for being transformed into Agrobacterium tumefaciens

Agrobacteria transformed with such a vector can then be used in a known manner to transform plants, in particular crop plants, for example by bathing wounded leaves or leaf pieces in an agrobacterial solution and then cultivating them in suitable media.

The transformation of plants by agrobacteria is known, among other things, from F.F. White, Vectors for Gene Transfer in

Higher plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S.D. Kung and R. Wu, Academic Press, 1993, pp. 15-38. From the transformed cells of the wounded leaves or leaf pieces, transgenic plants can be regenerated in a known manner, which plants contain a gene encoding the expression cassette for the expression of a nucleic acid encoding a ketolase.

To transform a host plant with a nucleic acid coding for a ketolase, an expression cassette is inserted as an insert into a recombinant vector whose vector DNA contains additional functional regulatory signals, for example Contains sequences for replication or integration. Suitable vectors are described in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chap. 6/7, pp. 71-119 (1993).

Using the recombination and cloning techniques cited above, the expression cassettes can be cloned into suitable vectors which enable their multiplication, for example in E. coli. Suitable cloning vectors include pJITH7 (Guerineau et al. (1988) Nucl. Acids Res. 16: 11380), pBR332, pUC series, Ml3mp series, pACYC184, pMC1210, pMcl 210 and pCLl920. Binary vectors which can replicate both in E. coli and in agrobacteria are particularly suitable.

Depending on the choice of the promoter, the expression can be constitutive or preferably specific in the fruit.

Accordingly, the invention further relates to a method for producing genetically modified plants, characterized in that a nucleic acid construct containing functionally linked, a fruit-specific promoter and nucleic acids encoding a ketolase is introduced into the genome of the starting plant.

The invention further relates to the genetically modified plants which have a ketolase activity in fruits compared to the starting plant.

In a preferred embodiment, the ketolase activity is achieved in that the genetically modified plant expresses a ketolase in the fruit.

The preferred, genetically modified plants therefore contain at least one nucleic acid encoding a keto-glass in fruits.

In a further preferred embodiment, as explained above, the gene expression of a nucleic acid, coding for a ketolase, is caused by introducing nucleic acids, coding for a ketolase, into the starting plant.

The invention therefore particularly preferably relates to a genetically modified plant described above, characterized in that, starting from a starting plant, at least one nucleic acid coding for a ketolase has been introduced into the plant. The invention relates in particular to genetically modified plants selected from the plant genera Actinophloeus, Aglaeo-nema, pineapple, Arbutus, Archontophoenix, Area, Aronia, Asparagus, Attalea, Berberis, Bixia, Brachychilum, Bryonia, Caliptocalix, Capsicum, Carica, Celastrus, Citrullus, Citrus, Convallaria, Cotoneaster, Crataegus, Cucumis, Cucurbita, Cuscuta, Cycas, Cyphomandra, Dioscorea, Diospyrus, Dura, Elaeagnus, Elaeis, Erythroxylon, Euonymus, Ficus, Fortunella, Fragaria, Gardinia, Gonocaryum, Gossypilma, Gossypilma, Guossilium, Guossypium, Guossypium, Gu Hippophaea, Iris, Lathyrus, Lonicera, Luffa, Lycium, Lycopersicum, Malpighia, Mangifera, Mormodica, Murraya, Musa, Nenga, Palisota, Pandanus, Passiflora, Persea, Physalis, Prunus, Ptychandra, Punica, Pyra- cantha, Pyrus, Ribes Rosa, Rubus, Sabal, Sambucus, Seaforita, Shepherdia, Solanum, Sorbus, Synaspadix, Tabernae, Tamus, Taxus, Trichosanthes, Triphasia, Vaccinium, Viburnum, Vignia or Vitis, containing at least one nucleic acid, kodi a ketolase.

Very particularly preferred plant genera are pineapple, asparagus, capsicum, citrus, cucumis, cucurbita, citrullus, lycopersicum, passiflora, prunus, physalis, solanum, vaccinium and vitis, containing at least one transgenic nucleic acid, encoding a ketolase.

As mentioned above, the ketolase is expressed in the fruits in preferred transgenic plants, particularly preferably the expression of the ketolase is highest in the fruits.

As mentioned above, particularly preferred, genetically modified plants additionally have an increased hydroxylase activity and / or β-cyclase activity compared to a wild plant. Further preferred embodiments are described above in the method according to the invention.

The present invention further relates to the transgenic plants, their propagation material, and their plant cells, tissue or parts, in particular their fruits.

The genetically modified plants can, as described above, be used to produce ketocarotenoids, in particular astaxanthin.

Genetically modified plants according to the invention with an increased content of ketocarotenoids which can be consumed by humans and animals can also be used, for example, directly or after processing known per se as food or feed or as feed and food supplements. Furthermore, the genetically modified plants for the production of ketocarotenoids extracts of the plants containing noid and / or for the production of feed and food supplements.

The genetically modified plants have an increased ketocarotenoid content compared to the wild type.

An increased ketocarotenoid content is generally understood to mean an increased total ketocarotenoid content.

10 An increased content of ketocarotenoids is also understood to mean, in particular, a changed content of the preferred ketocarotenoids, without the total carotenoid content necessarily having to be increased.

In a particularly preferred embodiment, the genetically modified plants according to the invention have an increased astaxanthin content compared to the wild type.

In this case, an increased salary is particularly

20 understood a caused content of ketocarotenoids or astaxanthin. x

The invention is illustrated by the following examples, but is not limited to these: 25

General experimental conditions: Sequence analysis of recombinant DNA

The sequencing of recombinant DNA molecules was carried out with a laser fluorescence DNA sequencer from Licor (sales by MWG Biotech, Ebersbach) according to the method of Sanger (Sanger et al., Proc. Natl. Acad. Sci. USA 74 (1977) , 5463-5467).

Example 1: Amplification of a cDNA which contains the entire primary sequence of the ketolase from Haematococcus pluvialis Floow em. Will encodes

The cDNA coding for the ketolase from Haematococcus pluvialis was amplified by PCR from Haematococcus pluvialis (strain 40 192.80 from the "Collection of algal cultures of the University of Göttingen") suspension culture.

For the preparation of total RNA from a suspension culture of Haematococcus pluvialis (strain 192.80), which has been used for 2 weeks with direct sunlight at room temperature in Haerπatococcus medium (1 - .2 g / 1 sodium acetate, 2 g / 1 yeast extract, 0.2 g / 1 MgC12x6H20, 0.02 CaCl2x2H20; pH 6.8; after autoclaving, add 400 mg / 1 L-asparagine, 10 mg / 1 FeS04xH20), the cells were harvested, frozen in liquid nitrogen and pulverized in a mortar. Then 100 mg of the frozen, pulverized algal cells were transferred to a reaction vessel and taken up in 0.8 ml of Trizol buffer (Life Technologies). The suspension was extracted with 0.2 ml of chloroform. After centrifugation at 12,000 g for 15 minutes, the aqueous supernatant was removed and transferred to a new reaction vessel and extracted with a volume of ethanol. The RNA was precipitated with a volume of isopropanol, washed with 75% ethanol and the pellet dissolved in DEPC water (overnight incubation of water with 1/1000 volume of diethyl pyrocarbonate at room temperature, then autoclaved). The RNA concentration was determined photometrically.

For the cDNA synthesis, 2.5 μg of total RNA were denatured for 10 min at 60 ° C., cooled on ice for 2 min and using a cDNA kit (ready-to-go-you-prime beads, Pharmacia Biotech) according to the manufacturer's instructions rewritten into cDNA using an antisense specific primer (PRI SEQ ID No. 29).

The nucleic acid encoding a ketolase from Haematococcus x pluvialis (strain 192.80) was determined using the polymerase chain reaction

(PCR) from Haematococcus pluvialis using a sense-specific primer (PR2 SEQ ID No. 30) and an antisense-specific primer (PRI SEQ ID No. 29).

The PCR conditions were as follows:

The PCR for the amplification of the cDNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture which contained:

- 4 ul of a Haematococcus pluvialis cDNA (prepared as described above) - 0.25 mM dNTPs

0.2 mM PRI (SEQ ID No. 29) 0.2 mM PR2 (SEQ ID No. 30)

- 5 μl 10X PCR buffer (TAKARA) 0.25 μl R Taq polymerase (TAKARA) - 25.8 μl Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

53 ° C for 2 minutes

72 ° C for 3 minutes IX 72 ° C 10 minutes

PCR amplification with SEQ ID No. 29 and SEQ ID No. 30 resulted in an 1155 bp fragment coding for a protein consisting of the entire primary sequence (SEQ ID No. 22). Using standard methods, the amplificate was cloned into the PCR cloning vector pGEM-Teasy (Promega) and the clone pGKET02 was obtained.

Sequencing of the clone pGKET02 with the T7 and the SP6 primer confirmed a sequence which differs from the published sequence X86782 only in the three codons 73, 114 and 119 in one base each. These nucleotide changes were reproduced in an independent amplification experiment and thus represent the nucleotide sequence in the Haematococcus pluvialis strain 192.80 used (Figures 3 and 4, sequence comparisons).

This clone was therefore used for cloning into the expression vector pJITH7 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380). The cloning was carried out by isolating the 1027 bp SpHI fragment from pGKET02 and ligation into the SpHI-cut vector pJIT117. The clone that contains the Haematococcus pluvialis ketola gene in the correct orientation as an N-terminal translational fusion with the rbcs transit peptide sequence is called pJKET02.

Example 2: Amplification of a cDNA which contains the ketolase from Haematococcus pluvialis Flotow em. Will encoded with an N-terminus shortened by 14 amino acids

The cDNA, which codes for the ketolase from Haematococcus pluvialis (strain 192.80) with an N-terminus shortened by 14 amino acids, was amplified by PCR from Haematococcus pluvialis suspension culture (strain 192.80 from the "Collection of algal cultures of the University of Göttingen") ,

Total RNA was prepared from a suspension culture of Haematococcus pluvialis (strain 192.80) as described in Example 1.

The cDNA synthesis was carried out as described in Example 1.

The nucleic acid encoding a ketolase from Haema tococcus pluvialis (strain 192.80) with an N-terminus shortened by 14 amino acids was extracted by means of polymerase chain reaction (PCR)

Haematococcus pluvialis using a sense specific Primers (PR3 SEQ ID No. 31) and an antisense specific primer (PRI SEQ ID No. 29) amplified.

The PCR conditions were as follows:

5

The PCR for the amplification of the cDNA, which codes for a ketolase protein with an N-terminus shortened by 14 amino acids, was carried out in a 50 μl reaction mixture which contained:

10 - 4 μl of a Haema tococcus pluvialis cDNA (prepared as described above)

0.25 mM dNTPs

0.2 mM PRI (SEQ ID No. 29)

0.2 mM PR3 (SEQ ID No. 31)

15 - 5 μl 10X PCR buffer (TAKARA)

0.25 μl R Taq polymerase (TAKARA)

25.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions;

20

IX 94 ° C 2 minutes 35X 94 ° C 1 minute 53 ° C 2 minutes 72 ° C 3 minutes

25 IX 72 ° C 10 minutes

PCR amplification with SEQ ID No.29 and SEQ ID No. 31 resulted in an 1111 bp fragment coding for a ketolase protein in which the N-terminal amino acids (position 2-16) are replaced by 30 a single amino acid (leucine).

The amplificate was cloned into the PCR cloning vector pGEM-Teasy (Promega) using standard methods and the clone pGKET03 was obtained. Sequencing with the primers T7 and

35 SP6 confirmed a sequence SEQ ID No. 22 identical

Sequence, the 5 'region (position 1-53) of SEQ ID No. 22 in the SEQ ID No. 24 has been replaced by a nonamer sequence differing in sequence. This clone was therefore used for cloning into the expression vector pJITH7 (Guerineau et al.

40 1988, Nucl. Acids Res. 16: 11380) is used.

The cloning was carried out by isolating the 985 bp SpHI fragment from pGKET03 and ligation with the SpHI-cut vector pJITH7. The clone that contains the correct Haematococcus pluvialis ketolase with 45 N-terminus shortened by 14 amino acids Containing orientation as an N-terminal translational fusion with the rbcs transit peptide is called pJKET03.

Example 3: Amplification of a cDNA which contains the ketolase from Haema-5 tococcus pluvialis Flotow em. Will (tribe 192.80 the

"Collection of algal cultures from the University of Göttingen") consisting of the entire primary sequence and fused C-terminal myc tag

10 The cDNA coding for the ketolase from Haematococcus pluvialis (strain 192.80) consisting of the entire primary sequence and fused C-terminal myc tag was PCR-analyzed using the plasmid pGKET02 (described in Example 1) and the primer PR15 (SEQ ID No. 32). The PR15 primer

15 come from an antisense specific 3 'region (nucleotides

40-59) and a 5 'region encoding myc-tag (nucleotides 1-39).

The denaturation (5 min at 95 ° C.) and annealing (slow cooling at room temperature to 40 ° C.) of pGKET02 and PR15 was carried out in an 11.5 μl reaction mixture which contained:

1 μg pGKET02 plasmid DNA 0.1 μg PR15 (SEQ ID No. 32;

25 The 3 'ends were filled in (30 min at 30 ° C.) in a 20 μl reaction mixture which contained:

11.5 μl pGKET02 / PR15 annealing reaction (prepared as described above)

30-50 µM dNTPs

2 ul IX Klenow buffer

2U Klenow enzyme

The nucleic acid encoding a ketolase from Haematococcus 35 pluvialis (strain 192.80) consisting of the entire primary sequence and fused C-terminal myc tag was determined by means of polymerase chain reaction (PCR) from Haematococcus pluvialis using a sense-specific primer (PR2 SEQ ID No. 30 ) and an antisense-specific primer (PR15 SEQ ID No. 32).

40

The PCR conditions were as follows:

The PCR for the amplification of the cDNA, which codes for a ketolase protein with a fused C-terminal myc tag, was carried out in a 45 50 μl reaction mixture which contained: - 1 ul of an annealing reaction (prepared as described above) 0.25 mM dNTPs

0.2 μM PR15 (SEQ ID No. 32) - 0.2 μM PR2 (SEQ ID No. 30)

5 ul 10X PCR buffer (TAKARA) 0.25 ul R Taq polymerase (TAKARA) 28.8 ul Aq. Dest.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

53 ° C for 1 minute 72 ° C for 1 minute

IX 72 ° C 10 minutes

PCR amplification with SEQ ID No. 32 and SEQ ID No. 30 resulted in a 1032 bp fragment coding for a protein consisting of the entire primary sequence of the ketolase from Haematococcus pluvialis as a double translational fusion with the rbcS transit peptide at the N-terminus and the myc tag at the C-terminus.

The amplificate was cloned into the PCR cloning vector pGEM-Teasy (Promega) using standard methods and the clone pGKET04 was obtained. Sequencing with the primers T7 and SP6 confirmed a sequence SEQ ID no. 22 identical sequence, the 3 'region (position 993-1155) of SEQ ID No. 22 in the amplificate SEQ ID No. 26 was replaced by one in the different sequence from 39 bp. This clone was therefore made for

Cloning in the expression vector pJITH7 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380) was used.

The cloning was carried out by isolating the 1038 bp EcoRI-SpHI fragment from pGKET04 and ligation with the EcoRI-SpHI cut vector pJITH7. The ligation creates a translational fusion between the C-terminus of the rbcS transit peptide sequence and the N-terminus of the ketolase sequence. The clone which contains the Haematococcus pluvialis ketolase with fused C-terminal myc tag in the correct orientation as a translational N-terminal fusion with the rbcs transit peptide is called pJKET4.

Example 4: Production of expression vectors for the constitutive expression of the Haematococcus pluvialis ketolase in

^• Lycopersicon esculentum Expression of Haematococcus pluvialis ketolase in. esculentum took place under the control of the constitutive promoter d35S from CaMV (Franck et al. 1980, Cell 21: 285-294). Expression was carried out using the pea transit peptide rbcS (Andersson et al. 1986, Biochem J. 240: 709-715).

The production of an expression plasmid for the Agrobacterium -mediated transformation of ketolase from Haematococcus pluvialis in L. esculentum was carried out using the binary vector pSUN3 (WO02 / 00900).

- To produce the expression vector pS3KET02, the 2.8 Kb Sacl-Xhol fragment from pJKET02 was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 5, construct map). In Figure 5, fragment d35S contains the duplicate

35S promoter (747 bp), fragment rbcS the rbcS transit peptide from pea (204 bp), fragment KET02 (1027 bp) the entire primary sequence coding for the Haema tococcus pluvialis ketolase, fragment term (761 bp) the polyadenylation signal from CaMV.

This was used to produce the expression vector pS3KET03

2.7 Kb bp Sacl-Xhol fragment from pJKET03 ligated with the Sacl-Xhol cut vector pSUN3. (Figure 6, construct card). In Figure 6, fragment d35S contains the duplicated 35S promoter (747 bp), fragment rbcS the rbcS transit peptide from pea (204 bp), fragment KET03 (985 bp) the primary sequence shortened by 14 N-terminal amino acids coding for the Haematococcus pluvialis Ketolase, fragment term (761 bp) the polyadenylation signal of CaMV.

To produce the expression vector pS3KET04, the 2.8 Kb Sacl-Xhol fragment from pJKET04 was ligated with the Sacl-Xhol cut vector pSUN3. (Figure 7, construct card). In Figure 7, fragment d35S contains the duplicated 35S promoter ((747 bp), fragment rbcS the rbcS transit peptide from pea (204 bp), fragment KET04 (1038 bp) the entire primary sequence coding for the Haematococcus pluvialis ketolase with C-terminal myc- Day, fragment term (761 bp) the polyadenylation signal of CaMV.

Example 5: Production of expression vectors for the expression of Haematococcus pluvialis ketolase in Lycopersicon esculentum

Expression of Haematococcus pluvialis ketolase in L. esculentum occurred with the transit peptide rbcS from pea

(Anderson et al. 1986, Biochem J. 240: 709-715). The expression was carried out under the control of a modified version of AP3P Arabidopsis thaliana AP3 promoter (AL132971: nucleotide region 9298-10200; Hill et al. (1998) Development 125: 1711-1721).

The DNA fragment, which contains the AP3 promoter region -902 to +15 from Arabidopsis thaliana, was analyzed by means of PCR

Using genomic DNA (isolated from Arabidopsis thaliana according to standard methods) and the primers PR7 (SEQ ID No. 33) and PR10 (SEQ ID No. 36).

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which contains the AP3 promoter fragment (-902 to +15), was carried out in a 50 μl reaction mixture, which contained:

100 ng of genomic DNA from A. thaliana 0.25 mM dNTPs

0.2 mM PR7 (SEQ ID No. 33) 0.2 mM PR10 (SEQ ID No. 36) - 5 μl 10X PCR buffer (Stratagene) - 0.25 μl Pfu polymerase (Stratagene) 28.8 μl Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

50 ° C for 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes

The 922 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pTAP3 was obtained.

Sequencing of the clone pTAP3 confirmed a sequence consisting only of an insertion (a G in position 9765 of the sequence AL132971) and a base exchange (a G instead of an A in position 9726 of the sequence AL132971) from the published AP3 sequence (AL132971, nucleotide region 9298-10200) differs. These nucleotide differences were reproduced in an independent amplification experiment and thus represent the actual nucleotide sequence in the Arabidopsis thaliana plants used. The modified version AP3P was produced by recombinant PCR using the plasmid pTAP3. The region 10200-9771 was amplified with the primers PR7 (SEQ ID No. 33) and primers PR9 (SEQ ID No. 35) (amplificate A7 / 9), the region 9526-9285 with the PR8 (SEQ ID No. 34 ) and PR10 (SEQ ID No. 36) amplified (amplificate A8 / 10).

The PCR conditions were as follows:

The PCR reactions for the amplification of the DNA fragments, which contain the regions region 10200-9771 and region 9526-9285 of the AP3 promoter, were carried out in 50 μl reaction batches which contained:

- 100 ng AP3 amplificate (described above)

0.25 mM dNTPs

0.2 mM sense primer (PR7 SEQ ID No. 33 or PR8

SEQ ID No. 35)

0.2 mM antisense primer (PR9 SEQ ID No. 35 or PR10 SEQ ID No. 36)

5 μl 10X PCR buffer (Stratagene)

0.25 μl Pfu Taq polymerase (Stratagene)

28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes:

35X 94 ° C 1 minute

50 ° C for 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes:

The recombinant PCR includes annealing of the amplificates A7 / 9 and A8 / 10, which overlap over a sequence of 25 nucleotides, completion into a double strand and subsequent amplification. This creates a modified version of the AP3 promoter, AP3P, in which positions 9670-9526 are deleted. The denaturation (5 min at 95 ° C.) and annealing (slow cooling at room temperature to 40 ° C.) of both amplificates A7 / 9 and A8 / 10 was carried out in a 17.6 1 reaction, which contained:

0.5 μg A7 / 9 amplificate 0.25 μg A8 / 10 amplificate The 3 'ends were filled in (30 min at 30 ° C) in a 20 ° cl reaction mixture which contained:

17.6 ul A7 / 9 and A8 / 10 annealing reaction (prepared as described above)

50 µM dNTPs

2 ul IX Klenow buffer

- 2U Klenow enzyme

The nucleic acid coding for the modified promoter version AP3P was amplified by means of PCR using a sense-specific primer (PR7 SEQ ID No. 28) and an antisense-specific primer (PR10 SEQ ID No. 36).

The PCR conditions were as follows:

The PCR for the amplification of the AP3P fragment was carried out in a 50 μl reaction mixture, which contained:

- 1 μl annealing reaction (prepared as described above)

0.25 mM dNTPs ^/

0.2 mM PR7 (SEQ ID No. 33)

0.2 mM PR10 (SEQ ID No. 36) - 5 μl 10X PCR buffer (Stratagene)

0.25 μl Pfu Taq polymerase (Stratagene)

28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

50 ° C for 1 minute

72 ° C for 1 minute

-IX 72 ° C 10 minutes

PCR amplification with SEQ ID No. 33 and SEQ ID No. 36 resulted in a 778 bp fragment coding for the modified promoter version AP3P. The amplificate was cloned into the cloning vector pCR .1 (Invitrogen) and the clone pTAP3P was obtained. Sequencing with the primers T7 and M13 confirmed a sequence identical to the sequence AL132971, region 10200-9298, the internal region 9285-9526 being deleted. This clone was therefore used for the cloning into the expression vector pJIT117 (Guerineau et al. 1988, Nucl. Acids Res. 16: 11380). The cloning was carried out by isolating the 771 bp SacI-HindIII fragment from pTAP3P and ligating into the SacI-HindIII cut vector pJITH7. The clone that contains the AP3P promoter instead of the original d35S promoter is called pJAP3P.

To produce an expression cassette pJAP3PKET02, the 1027 bp SpHI fragment KET02 (described in Example 1) was cloned into the SpHI-cut vector pJAP3P. The clone that contains the fragment KET02 in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJAP3PKET02.

To produce an expression cassette pJAP3PKET04, the 1032 bp SpHI-EcoRI fragment KET04 (described in Example 3) was cloned into the SpHI-EcoRI cut vector pJAP3P. The clone that contains the fragment KET04 in the correct orientation as an N-terminal fusion with the rbcS transit peptide is called pJAP3PKET04.

An expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled ketolase from Haematococcus pluvialis into L. esculentum was produced using the binary vector pSUN3 (WO02 / 00900).

- To produce the expression vector pS3AP3PKET02, the 2.8 KB bp Sacl-Xhol fragment from pJAP3KET02 was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 8, construct map). In Figure 8, fragment AP3P contains the modified AP3P promoter (771 bp), fragment rbcS the rbcS transit peptide from pea (204 bp), fragment KET02 (1027 bp) the entire primary sequence coding for the Haematococcus pluvialis ketolase, fragment term (761 Bp) the polyadenylation signal from CaMV.

- To produce the expression vector pS3AP3PKET04, the 2.8 KB Sacl-Xhol fragment from pJAP3PKET04 was ligated with the Sacl-Xhol cut vector pSUN3. (Figure 9, construct card). In Figure 9, fragment AP3P contains the modified AP3P promoter (771 bp), fragment rbcS the rbcS transit peptide from pea (204 bp), fragment KET04 (1038 bp) the entire primary sequence coding for the Haematococcus pluvialis ketolase with C-terminal myc tag , Fragment term (761 bp) the polyadenylation signal of CaMV.

Example 6: Production of transgenic Lycopersicon esculentum plants Transformation and regeneration of tomato plants was carried out according to the published method by Ling and co-workers (Plant Cell Reports (1998), 17: 843-847). For the microtome variety, higher kanamycin concentrations (100 mg / L) were selected. 5

The starting explant for the transformation was cotyledons and hypocotyls, seven to ten day old seedlings of the Microtome line. The culture medium according to Murashige and Skoog (1962: Murashige and Skoog, 1962, Physiol. Plant 15,

10 473-) with 2% sucrose, pH 6.1. Germination took place at 21 ° C with little light (20 to 100 μE). After seven to ten days, the cotyledons were divided transversely and the hypocotyls were cut into sections about 5 to 10 mm long and placed on the medium MSBN (MS, pH 6.1, 3% sucrose + 1 mg / 1 BAP, 0.1 mg / 1 NAA)

15, which was loaded with suspension-cultivated tobacco cells the day before. The tobacco cells were covered with sterile filter paper without air bubbles. The explants were precultured on the medium described for three to five days. Cells from the Agrobacterium tumefaciens LBA4404 strain were isolated individually with the

20 plasmids pS3KET02, pS3KET03 and pS3AP3KET02 were transformed. From each of the individual Agrobacterium strains transformed with the binary vectors pS3KET02, pS3KET03 or pS3KET02, an overnight culture was cultivated in YEB medium with kanamycin (20 mg / 1) at 28 degrees Celsius and the cells were centrifuged. The bacteria

25 pellet was resuspended with liquid MS medium (3% sucrose, pH 6.1) and adjusted to an optical density of 0.3 (at 600 nm). The precultivated explants were transferred to the suspension and incubated for 30 minutes at room temperature with gentle shaking. Then the

30 explants dried with sterile filter paper and put back on their preculture medium for the three-day co-culture (21 ° C).

After the co-culture, the explants were placed on MSZ2 medium (MS pH 6, 1 + 3% sucrose, 2 mg / 1 zeatin, 100 mg / 1 kanamycin,

35 160 mg / 1 timentin) and stored for selective regeneration at 21 ° C under low light conditions (20 to 100 ° = E, light rhythm 16 h / 8 h). The explants were transferred every two to three weeks until shoots formed. Small shoots could be separated from the explant and on MS

40 (pH 6.1 + 3% sucrose) 160 mg / 1 timentin, 30 mg / 1 kanamycin, 0.1 mg / 1 IAA. Rooted plants were transferred to the greenhouse.

45 According to the transformation method described above, the following lines were obtained with the following expression constructs:

With pS3KET02 it was obtained: csl3-24, csl3-30, csl3-40.

With pS3KET03 it was obtained: csl4-2, csl4-3, csl4-9, csl4-19.

With pS3AP3PKET02 was obtained: csl6-15, csl6-34, cslδ-35, csl6-40.

10

Example 8: Characterization of the transgenic fruits

The fruit material of the transgenic plants was ground in liquid nitrogen and the powder (about 250 to 500 mg) extracted with 100% acetone (three times 500 ul each). The solvent was evaporated and the carotenoids resuspended in 100 ul acetone.

20 A C30 reverse phase column was used to distinguish between mono- and diesters of carotenoids. HPLC running conditions were modified according to a published method (Frazer et al. (2000), Plant Journal 24 (4): 551-558

The following HPLC conditions were set. 25 separation column: Prontosil C30 column, 250 x 4.6 mm, (Bischoff, Leonberg, Germany)

Flow rate: 1.0 ml / min

Eluents: mobile phase A - 100% methanol

Solvent B - 80% methanol, 0.2% ammonium acetate Solvent C - 100% t-butyl methyl ether

30

Gradient profile;

Detection: 300 530 nm

45

The spectra were determined using a photodiode array detector. The carotenoids were absorbed through their Spectra and their retention times compared to standard samples identified.

Table 1 shows the carotenoid profile in tomato fruits of the transgenic tomatoes and control tomato plants produced according to the examples described above. Compared to the genetically unmodified control plant, the genetically modified plants have a ketocarotenoid content and in particular astaxanthin content.

Table 1

+ means carotenoid detectable means carotenoid not detected (+) means carotenoid concentration at the detection limit

Table 2a shows the amounts of carotenoids in ripe fruit of transgenic tomatoes and control plants. The data are mean values of various linines and are given as a percentage of the total carotenoid content.

Table 2b shows the amounts of carotenoids in ripening fruits of transgenic tomatoes and control plants. The data are mean values of various linines and are given as a percentage of the total carotenoid content.

Example 9:

10 Amplification of a DNA encoding the entire primary sequence of the NPl96 ketolase from Nostoc puncti forme ATCC 29133

The DNA encoding the NP196 ketolase from Nostoc punctiform ATCC 29133 was amplified by PCR from Nostoc punctiform ATCC 15 29133 (strain of the "American Type Culture Collection").

For the preparation of genomic DNA from a suspension culture of Nostoc punctiforme ATCC 29133, which is 1 week with continuous light

20 and constant shaking (150 rpm) at 25 ° C in BG 21 medium (1.5 g / 1 NaN0 ₃ , 0.04 g / 1 K ₂ P0 ₄ x3H ₂ 0, 0.075 g / 1 MgS0 ₄ xH ₂ 0, 0.036 g / 1 CaClx2H0, 0.006 g / 1 citric acid, 0.006 g / 1 ferric ammonium citrate, 0.001 g / 1 EDTA disodium magnesium, 0.04 g / 1 Na ₂ C0 ₃ , 1 ml trace metal mix "A5 + Co" (2.86 g / 1 H ₃ B0 ₃ , 1.81 '' g / 1 MnCl ₂ x4H ₂ o,

25 0.222 g / 1 ZnSO ₄ x7H ₂ 0, 0.39 g / 1 NaMo0 ₄ X2H ₂ o, 0.079 g / 1 CuS0 ₄ x5H ₂ 0, 0.0494 g / 1 Co (N0 ₃ ) x6H0), the cells were centrifuged harvested, frozen in liquid nitrogen and pulverized in a mortar.

30 Protocol for DNA isolation from Nostoc punctiforme ATCC 29133:

The bacterial cells were pelleted from a 10 ml liquid culture by centrifugation at 8000 rpm for 10 minutes. The bacterial cells were then washed in liquid nitrogen with a mortar.

35 crushed and ground. The cell material was resuspended in 1 ml 10mM Tris_HCl (pH 7.5) and transferred to an Eppendorf reaction vessel (2ml volume). After adding

The cell suspension was incubated for 3 hours at 37 ° C. in 100 μl proteinase K (concentration: 20 mg / ml). Then was

40 the suspension extracted with 500 ul phenol. After 5 minutes

Centrifugation at 13,000 rpm, the upper, aqueous phase was transferred to a new 2 ml Eppendorf reaction vessel. The extraction with phenol was repeated 3 times. The DNA was obtained by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 0.6 volume of iso-

45 propanol precipitated and then washed with 70% ethanol. The DNA pellet was dried at room temperature, taken up in 25 μl of water and dissolved with heating to 65 ° C.

The nucleic acid, coding for a ketolase from Nostoc punctiform ATCC 29133, was determined by means of a "polymerase chain reaction" (PCR) from Nostoc punctiform ATCC 29133 using a sense-specific primer (NP196-1, SEQ ID No. 59) and an antisense -specific primer (NP196-2 SEQ ID No. 60) amplified.

The PCR conditions were as follows:

The PCR for the amplification of the DNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture which contained:

1 µl of a Nostoc punctiform ATCC 29133 DNA (prepared as described above)

0.25 mM dNTPs

0.2 mM NP196-1 (SEQ ID No. 59) - 0.2 mM NP196-2 (SEQ ID No. 60)

5 ul 10X PCR buffer (TAKARA)

0.25 ul R Taq polymerase (TAKARA)

25.8 ul Aq. Dest.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

55 ° C for 1 minute

72 ° C for 3 minutes

IX 72 ° C 10 minutes

PCR amplification with SEQ ID No. 59 and SEQ ID No. 60 resulted in a 792 bp fragment which codes for a protein consisting of the entire primary sequence (NP196, SEQ ID No. 61).

Using standard methods, the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNP196 was obtained.

Sequencing of the clone pNP196 with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence from 140.571-139.810 of the database entry NZ_AABC01000196 (inverse oriented to the published database entry) with the exception that G in position 140.571 was replaced by A to create a standard start codon ATG. This nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nostoc punctiform ATCC 29133 used.

This clone pNPl96 was therefore used for cloning into the expression vector pJAP3P (described in Example 5).

PJAP3P was modified by the 35S terminator through the OCS terminator (octopine synthase) of the Ti plasmid pTil5955 from Agrobacterium tumefaciens (database entry X00493 from position 10 12.541-12.350, Gielen et al. (1984) EMBO J. 3 835-846 ) was replaced.

The DNA fragment containing the OCS terminator region was isolated by PCR using the plasmid pHELLSGATE (database entry 15 AJ311874, Wesley et al. (2001) Plant J. 27 581-590, isolated from E. coli by standard methods) as well as the primer OCS-1 (SEQ ID No. 63) and OCS-2 (SEQ ID No. 64).

The PCR conditions were as follows:

20

The PCR for the amplification of the DNA, which contains the octopine synthase (OCS) terminator region (SEQ ID 65), was carried out in a 50 μl reaction mixture which contained:

25-100ng pHELLSGATE plasmid DNA

0.25 mM dNTPs

0.2 mM OCS-1 (SEQ ID No. 63)

0.2 mM OCS-2 (SEQ ID No. 64)

5 ul 10X PCR buffer (Stratagene) 30-0.25 ul Pfu polymerase (Stratagene)

28.8 ul Aq. Least.

The PCR was carried out under the following cycle conditions:

35 IX 94 ° C 2 minutes

35X 94 ° C 1 minute

50 ° C for 1 minute

72 ° C for 1 minute

IX 72 ° C 10 minutes

40

The 210 bp amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) using standard methods and the plasmid pOCS was obtained.

45 Sequencing of the clone pOCS confirmed a sequence which corresponds to a sequence section on the Ti plasmid pTil5955 from Agrobacterium tumefaciens (database entry X00493) from positions 12,541 to 12,350.

The cloning was carried out by isolating the 210 bp Sall-Xhol fragment from pOCS and ligation into the Sall-Xhol cut vector pJAP3P.

This clone is called pJOAP and was therefore used for cloning into the expression vector pJOAP: NP196.

The cloning was carried out by isolating the 782 bp Sphl fragment from pNPl96 and ligating into the SphI cut vector pJOAP. The clone that contains the Nostoc punctiforme NPl96 ketolase in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJOAP: NPl96.

Example 10;

Production of expression vectors for the fruit-specific overexpression of NP196 ketolase from Nostoc punctiforme ATCC 2 ^* 9133 (strain of the "American Type Culture Collection") in Lycopersicon esculentum. Expression of NP196 ketolase from Nostoc punctiforme in. Esculentum took place with the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715). Expression was carried out under the control of the AP3P promoter from Arabidopsis thaliana (described in Example 5).

An expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled NPl96 ketolase from Nostoc punctiform ATCC 29133 into L. esculentum was produced using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector MSP120, the 1,958 KB bp Sacl-Xhol fragment from pJOAP: NP196 was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 10, construct map). In Figure 10 fragment AP3P PROM contains the AP3P promoter (765 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP196 KETO CDS (761 bp), coding for the nos toc punctiform NPl96 ketolase, fragment OCS terminator (192 bp) the octopine synthase polyadenylation signal. Example 11:

Amplification of a DNA which contains the entire primary sequence of the NOST ketolase from Nostoc spp. PCC 7120 coded 5

The DNA coding for the NOST ketolase from Nostoc punctiform PCC 7120 was amplified by means of PCR from Nostoc PCC 7120 (strain of the "Pasteur Culture Collection of Cyanobacterium").

10 For the preparation of genomic DNA from a suspension culture of from Nostoc spp. PCC 7120, the 1 week with continuous light and constant shaking (150 rpm) at 25 ° C in BG 22 medium (1.5 g / 1 NaN0 ₃ , 0.04 g / 1 K ₂ P0 ₄ x3H ₂ 0, 0.075 g / 1 MgS0 ₄ xH ₂ 0, 0.036 g / 1 CaCl x2H0, 0.006 g / 1 citric acid, 0.006 g / 1 Ferric ammonium ci-

15 steps, 0.001 g / 1 EDTA disodium magnesium, 0.04 g / 1 Na ₂ C0 ₃ , 1 ml trace metal mix "A5 + Co" (2.86 g / 1 H ₃ B0 ₃ , 1.81 g / 1 MnCl ₂ x4H ₂ o, 0.222 g / 1 ZnSO ₄ x7H ₂ 0, 0.39 g / 1 NaMo0 ₄ X2H ₂ o, 0.079 g / 1 CuS0 ₄ x5H ₂ 0, 0.0494 g / 1 Co (N0 ₃ ) x6H0), the cells were harvested by centrifugation, frozen in liquid nitrogen and

20 powdered in a mortar.

Protocol for DNA isolation from from Nostoc spp. PCC 712O:

The bacterial cells were removed from a 10 ml liquid culture by 10

Pelleted for 25 minutes at 8000 rpm. The bacterial cells were then crushed and ground in liquid nitrogen using a mortar. The cell material was resuspended in 1 ml 10mM Tris_HCl (pH 7.5) and transferred to an Eppendorf reaction vessel (2ml volume). After adding

The cell suspension was incubated for 3 hours at 37 ° C. in 30 100 μl proteinase K (concentration: 20 mg / ml). The suspension was then extracted with 500 μl of phenol. After centrifugation at 13,000 rpm for 5 minutes, the upper, aqueous phase was transferred to a new 2 ml Eppendorf reaction vessel. The extraction

35 with phenol was repeated 3 times. The DNA was precipitated by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 0.6 volume of isopropanol and then washed with 70% ethanol. The DNA pellet was dried at room temperature, taken up in 25 μl of water and dissolved with heating to 65 ° C.

40

The nucleic acid encoding a ketolase from Nostoc PCC 7120 was determined by means of a "polymerase chain reaction" (PCR) from Nostoc PCC 7120 using a sense-specific primer (NOST-1, SEQ ID No. 66) and an antisense-specific primer NOST-2

45 SEQ ID No. 67) amplified. The PCR conditions were as follows:

1 µl of a Nostoc PCC 7120 DNA (prepared as described in Example 9)

0.25 mM dNTPs - 0.2 mM NOST-1 (SEQ ID No. 66)

0.2 mM NOST-2 (SEQ ID No. 67)

5 ul 10X PCR buffer (TAKARA)

0.25 ul R Taq polymerase (TAKARA)

25.8 ul Aq. Dest.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

55 ° C for 1 minute

72 ° C for 3 minutes

IX 72 ° C 10 minutes

PCR amplification with SEQ ID No. 66 and SEQ ID No. 67 resulted in an 809 bp fragment that codes for a protein consisting of the entire primary sequence (SEQ ID No. 68). Using standard methods, the amplificate was cloned into the PCR cloning vector pGEM-T (Promega) and the clone pNOST was obtained.

Sequencing of the clone pNOST with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence of the database entry AP003592. This nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nostoc PCC 7120 used.

This clone pNOST was therefore used for the cloning into the expression vector pJOAP (described in Example 9).

The cloning was carried out by isolating the 799 bp Sphl fragment from pNOST and ligation into the SphI-cut vector pJOAP. The clone that contains the NOSToc PCC7120 NOST ketolase in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJOAP: NOST Example 12:

Production of expression vectors for fruit-specific overexpression of the NOST-Ketolase from Nostoc spp. PCC 7120 in Lycopersicon esculentum.

The expression of the NOST ketolase from Nostoc spp. PCC 7120 in L. Esculentum occurred with the pea transit peptide rbcS (Anderson et al. 1986, Biochem J. 240: 709-715). Expression was carried out under the control of the AP3P promoter from Arabidopsis thaliana (described in Example 5).

The production of an expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled NOST ketolase from Nostoc spp. PCC 7120 in L. esculentum was carried out using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector MSP121, the 1,982 KB bp Sacl-Xhol fragment from pJOAP: NOST was ligated to the Sacl-Xhol-cut vector pSUN3 (Figure 11, construct map). In Figure 11 fragment AP3P PROM contains the AP3P promoter (765 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NOST KETO CDS (774 bp), coding for the Nostoc spp. PCC 7120 NOST-Ketolase, fragment OCS terminator (192 bp) the polyadenylation signal of octopine synthase.

Example 13:

Amplification of a DNA encoding the entire primary sequence of the NPl95 ketolase from Nostoc punctiforme ATCC 29133

The DNA which codes for the NPl95 ketolase from Nostoc punctiform ATCC 29133 was amplified by means of PCR from Nostoc punctiform ATCC 29133 (strain of the "American Type Culture Collection"). The preparation of genomic DNA from a suspension culture of Nostoc punctiforme ATCC 29133 was described in Example 9.

The nucleic acid, coding for a ketolase from Nostoc punctiform ATCC 29133, was determined by means of a "polymerase chain reaction" (PCR) from Nostoc punctiform ATCC 29133 using a sense-specific primer (NP195-1, SEQ ID No. 70) and an antisense -specific primer (NP195-2 SEQ ID No. 71) amplified.

The PCR conditions were as follows: The PCR for the amplification of the DNA, which codes for a ketolase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture which contained:

1 µl of a Nostoc punctiform ATCC 29133 DNA (prepared as described in Example 9) 0.25 mM dNTPs

0.2 mM NP195-1 (SEQ ID No. 70) 0.2 mM NP195-2 (SEQ ID No. 71) - 5 ul 10X PCR buffer (TAKARA)

0.25 ul R Taq Polymerase (TAKARA) 25.8 ul Aq. Dest.

The PCR was carried out under the following cycle conditions:

IX 94 ° C 2 minutes

35X 94 ° C 1 minute

55 ° C for 1 minute

72 ° C 3 minutes IX 72 ° C 10 minutes

PCR amplification with SEQ ID No. 70 and SEQ ID No. 71 Resulted in an 819 bp fragment that codes for a protein consisting of the entire primary sequence (SEQ ID No. 72). Using standard methods, the amplificate was cloned into the PCR cloning vector pGEM-T (Promega) and the clone pNP195 was obtained.

Sequencing of the clone pNP195 with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence of

55,604-56,392 of the database entry NZ_AABC010001965 is identical, with the exception that T in position 55.604 was replaced by A in order to generate a standard start codon ATG. This nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nostoc punctiforme ATCC 29133 used.

This clone pNPl95 was therefore used for the cloning into the expression vector pJOAP (described in Example 9).

The cloning was carried out by isolating the 709 bp Sphl fragment from pNPl95 and ligating into the SphI-cut vector pJOAP. The clone which contains the NPl95 ketolase from Nostoc punctiforme ATCC 29133 in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJOAP: NPl95. Example 14:

Production of expression vectors for fruit-specific overexpression of the NP195 ketolase from Nostoc punctiforme ATCC 29133 in Lycopersicon esculentum

The expression of the NPl95 ketolase from Nostoc punctiform ATCC 29133 (strain of the "American Type Culture Collection") in L. esculentum was carried out with the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715). Expression was carried out under the control of the AP3P promoter from Arabidopsis thaliana (described in Example 5).

The production of an expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled NPl95 ketolase from Nostoc punctiforme ATCC 29133 in L. esculentum was carried out using the binary vector pSUN3 (WO02 / 00900).

To produce the expression vector MSP122, the 1,992 KB bp Sacl-Xhol fragment from pJOAP: NPl95 was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 12, construct map). In Figure 12, fragment AP3P PROM contains the AP3P promoter (765 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NP195 KETO CDS (789 bp), coding for the nostoc punctiform ATCC 29133 NP195 ketolase, Fragment OCS terminator (192 bp) the polyadenylation signal from octopine synthase.

Example 15;

Amplification of a DNA encoding the entire primary sequence of the NODK ketolase from Nodularia spumignea NSOR10.

The DNA encoding the ketolase from Nodularia spumignea NSOR10 was amplified by PCR from Nodularia spumignea NSOR10.

For the preparation of genomic DNA from a suspension culture of Nodularia spumignea NSOR10, which for 1 week with continuous light and constant shaking (150 rpm) at 25 ° C in BG 12 medium (1.5 g / 1 NaN0 ₃ , 0.04 g / 1 K ₂ P0 ₄ x3H ₂ 0, 0.075 g / 1 MgS0 ₄ xH ₂ 0, 0.036 g / 1 CaClx2H ₂ 0, 0.006 g / 1 citric acid, 0.006 g / 1 Ferric ammonium citrate, 0.001 g / 1 EDTA disodium agnes, 0.04 g / 1 Na ₂ C0 ₃ , 1ml trace metal mix "A5 + Co" (2.86 g / 1 H ₃ B0 ₃ , 1.81 g / 1 MnCl ₂ x4H ₂ o, 0.222 g / 1 ZnSO ₄ x7H ₂ 0, 0.39 g / 1 NaMo0 ₄ X2H ₂ o, 0.079 g / 1 CuS0 ₄ x5H ₂ 0, 0.0494 g / 1 Co (N0) x6H0), the cells were through Centrifugation harvested, frozen in liquid nitrogen and pulverized in a mortar.

Protocol for DNA isolation from Nodularia spumignea NSORIO:

The bacterial cells were pelleted from a 10 ml liquid culture by centrifugation at 8000 rpm for 10 minutes. The bacterial cells were then crushed and ground in liquid nitrogen using a mortar. The cell material was resuspended in 1 ml 10mM Tris_HCl (pH 7.5) and transferred to an Eppendorf reaction vessel (2ml volume). After adding 100 μl Proteinase K (concentration: 20 mg / ml), the cell suspension was incubated for 3 hours at 37 ° C. The suspension was then extracted with 500 μl of phenol. After centrifugation at 13,000 rpm for 5 minutes, the upper, aqueous phase was transferred to a new 2 ml Eppendorf reaction vessel. The extraction with phenol was repeated 3 times. The DNA was precipitated by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 0.6 volume of isopropanol and then washed with 70% ethanol. The DNA pellet was dried at room temperature, taken up in 25 μl of water and dissolved with heating to 65 ° C. x

The nucleic acid, coding for a ketolase from Nodularia spumignea NSORIO, was determined by means of a "polymerase chain reaction" (PCR) from Nodularia spumignea NSORIO using a sense-specific primer (NODK-1, SEQ ID No. 74) and an antisense-specific one Primers (NODK-2 SEQ ID No. 75) amplified.

The PCR conditions were as follows:

- 1 ul of a Nodularia spumignea NSORIO DNA (prepared as described above)

0.25 mM dNTPs

0.2 mM NODK-1 (SEQ ID No. 74)

0.2 mM NODK-2 (SEQ ID No. 75) - 5 ul 10X PCR buffer (TAKARA)

0.25 ul R Taq polymerase (TAKARA)

25.8 ul Aq. Dest.

The PCR was carried out under the following cycle conditions;

IX 94 ° C 2 minutes 35X 94 ° C 1 minute 55 ° C 1 minute 72 ° C 3 minutes IX 72 ° C 10 minutes

PCR amplification with SEQ ID No. 74 and SEQ ID No. 75 resulted in a 720 bp fragment coding for a protein consisting of the entire primary sequence (NODK, SEQ ID No. 76). Using standard methods, the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pNODK was obtained.

Sequencing of the clone pNODK with the M13F and M13R primers confirmed a sequence which is identical to the DNA sequence from 2130-2819 of the database entry AY210783 (inverse to the published database entry). This nucleotide sequence was reproduced in an independent amplification experiment and thus represents the nucleotide sequence in the Nodularia spumignea NSORIO used.

This clone pNODK was therefore used for the cloning into the expression vector pJOAP (described in Example 9). x

The cloning was carried out by isolating the 710 bp Sphl fragment from pNODK and ligation into the SphI-cut vector pJOAP. The clone that contains the NODK ketolase from Nodularia spumignea NSORIO in the correct orientation as an N-terminal translational fusion with the rbcS transit peptide is called pJOAP: NODK.

Example 16:

Production of expression vectors for fruit-specific overexpression of the NODK ketolase from Nodularia spumignea NSORIO in Lycopersicon esculentum.

The NODK ketolase from Nodularia spumignea NSORIO was expressed in L. esculentum with the transit peptide rbcS from pea (Anderson et al. 1986, Biochem J. 240: 709-715). The expression was carried out under the control of the AP3P promoter from Arabidopsis thaliana (described in Example 5).

An expression vector for the Agrobacterium -mediated transformation of the AP3P-controlled NPl95 ketolase from Nostoc punctiforme ATCC 29133 in L. esculentum was produced using the binary vector pSUN3 (WO02 / 00900). To produce the expression vector MSP123, the 1,893 KB bp Sacl-Xhol fragment from pJOAP: NODK was ligated with the Sacl-Xhol cut vector pSUN3 (Figure 13, construct map). In Figure 13 fragment AP3P PROM contains the AP3P promoter (765 bp), fragment rbcS TP FRAGMENT the rbcS transit peptide from pea (194 bp), fragment NODK KETO CDS (690 bp), coding for the Nodularia spumignea NSORIO NODK ketolase, fragment OCS terminator (192 bp) the octopine synthase polyadenylation signal.

Example 17: Production of an expression cassette for fruit-specific overexpression of the chromoplast-specific b-hydroxylase from Lycopersicon esculentum.

The expression of the chromoplast-specific β-hydroxylase from Lycopersicon esculentum in tomato takes place under the control of the fruit-specific promoter AP3P from Arabidopsis (Example 2). LB3 (database entry AX696005) from Vicia faba is used as the terminator element. The sequence of the chromoplast-specific β-hydroxylase (database entry Y14810 & BE354440) was produced by RNA isolation, reverse transcription and PCR.

The DNA fragment containing the LB3 terminator region was isolated by PCR.

Genomic DNA from Vicia faJba tissue according to standard methods is isolated and used by genomic PCR using the primers PR206 (SEQ ID No. 78) and PR207 (SEQ ID No. 79). The PCR for the amplification of this LB3 DNA fragment is carried out in a 50 μl reaction mixture which contains:

- 1 µl genomic DNA (prepared as described above) 0.25 mM dNTPs

0.2 uM PR206 (SEQ ID No. 78) 0.2 uM PR207 (SEQ ID No. 79) - 5 ul 10X PCR buffer (TAKARA)

0.25 ul. R Taq Polymerase (TAKARA) 28.8 ul. Aq. Least.

PCR amplification with SEQ ID No. 78 and SEQ ID No. 79 results in a 307 bp fragment (SEQ ID No. 80) which contains the LB terminator. Using standard methods, the amplificate was cloned into the PCR cloning vector pCR 2.1 (Invitrogen) and the clone pLB3 was obtained. Sequencing of the clone pLB3 with the M13F and the M13R primer confirmed a sequence which corresponds to the DNA sequence from 3-298 of the database entry AX696005 is identical. This clone is called pLB3 and is therefore used for cloning into the vector pJAP3P (see example 5).

The expression cassette pJAP3P was modified by replacing the 35S- 5 terminator with the Legumin LB3 terminator from Vicia faba (database entry AX696005; WO03 / 008596) (see below).

Total RNA is used to produce the ß-hydr -xylase sequence

10 tomatoes prepared. For this, 100 mg of the frozen, powdered flowers are transferred to a reaction vessel and taken up in 0.8 ml Trizol buffer (LifeTechnologies). The suspension is extracted with 0.2 ml chloroform. After centrifugation at 12,000 g for 15 minutes, the aqueous supernatant is removed and placed in a

15 new reaction vessel transferred and extracted with a volume of ethanol. The RNA is precipitated with a volume of isopropanol, washed with 75% ethanol and the pellet is dissolved in DEPC water (overnight incubation of water with 1/1000 volume of diethyl pyrocarbonate at room temperature, then autoclaved). The RNA

20 concentration is determined photometrically. For the cDNA synthesis, 2.5 µg of total RNA are denatured for 10 min at 60 ^a C, cooled on ice for 2 min and using a cDNA kit (Ready-to-go-you-prime beads, Pharmacia Biotech) according to the manufacturer's instructions using an antisense specific primer (PR215 SEQ ID No.

25 56) rewritten in cDNA.

The conditions of the subsequent PCR reactions are as follows:

30 The nucleic acid encoding the β-hydroxylase was extracted from tomato by means of a "polymerase chain reaction" (PCR) using a sense-specific primer (VPR204, SEQ ID No. 81) and an antisense-specific primer (PR215 SEQ ID No . 82) amplified.

35

The PCR for the amplification of the DNA, which codes for a β-hydroxylase protein consisting of the entire primary sequence, was carried out in a 50 μl reaction mixture which contained:

40-1 ul of cDNA (prepared as described above)

0.25 mM dNTPs

0.2 uM VPR204 (SEQ ID No. 81)

0.2 uM PR215 (SEQ ID No. 82)

5 ul 10X PCR buffer (TAKARA) 45-0.25 ul R Taq polymerase (TAKARA)

28.8 ul Aq. Least. The PCR amplification with VPR204 and PR215 results in a 1,040 bp fragment (SEQ ID No. 83) which codes for the b-hydroxylase. The amplificate is cloned into the PCR cloning vector pCR 2.1 (Invitrogen). This clone is called pCrtR-b2.

Sequencing of the clone pCrtR-b2 with the primers M13-R and M13-R confirmed a sequence which is identical to the DNA sequence from 33-558 of the database entry BE354440 and with the DNA sequence from 1-1009 of the database entry Y14810 is identical. The clone pCrtR-b2 is therefore used for the cloning into the vector pCSP02 (see below).

The first cloning step is carried out by isolating the 1,034 bp HindIII-EcoRI fragment from pCrtR-b2, derived from the cloning vector pCR-2.1 (Invitrogen), and ligation with the HindIII-EcoRI cut vector pJAP3P (see Example 5). The clone that contains the b-hydroxylase fragment CrtR-b2 is called pCSP02.

The second cloning step is carried out by isolating the 301 bp EcoRI-XhoI fragment from pLB3, derived from the cloning vector pCR-2.1 (Invitrogen), and ligation with the EcoRI-XhoI cut vector pCSP02. The clone that contains the 296 bp terminator LÖ3 is called pCSP03. The ligation creates a transcriptional fusion between the terminator LB3 and the b-hydroxylase fragment CrtR-b2. In addition, a transcriptional fusion occurs between the AP3P promoter and the b-hydroxylase fragment.

Example 18: Production of an expression cassette for fruit-specific overexpression of the B gene from Lycopersicon esculenurn.

The expression of the B gene from Lycopersicon esculentum in Tomat (Lycopene b-cyclase; database entry AF254793) takes place under the control of the fruit-specific promoter PDS (phytoene desaturase; database entry U46919) from Lycopersicon esculentum. 35S from CaMV is used as the terminator element. The sequence of the B gene was generated by PCR from genomic DNA from Lycopersicon esculentum.

The oligonucleotide primers BGEN-1 (SEQ ID No. 85) and BGEN-2 (SEQ ID No. 86) were used to isolate the B gene by means of PCR with genomic DNA from Lycopersicon esculentum.

The genomic DNA was isolated from Lycopersicon esculentum as described (Galbiati M et al. Funct. Integr. Genomics 2000, 20 1: 25-34). The PCR amplification was carried out as follows:

80ng genomic DNA lx Expand Long Template PCR buffer 5 2.5 mM MgCl2 each 350 μM dATP, dCTP, dGTP, dTTp 0.3 uM BGEN-1 (SEQ ID No. 85) 0.3 uM BGEN-2 (SEQ ID No. 86) 2 , 5 Units Expand Long Template Polymerase 10 in a final volume of 25 μl

The following temperature program was used:

1 cycle with 120 sec at 94 ° C 15 35 cycles with 94 ° C for 10 sec, 48 ° C for 30 sec and 68 ° C for 3 min 1 cycle with 68 ° C for 10 min

PCR amplification with BGEN-1 and BGEN-2 results in one

1,505 kb fragment (SEQ ID No. 87) which is co- for the b-hydroxylase

20 dated. The amplificate is in the PCR cloning vector pCR-2.1

(Invitrogen) cloned. This clone is called pBGEN. x

Sequencing of the clone pBGEN with the primers M13-R and M13-F confirmed a sequence which is identical to the DNA sequence from 1-1497 25 of the database entry AF254793. The clone pCrtR-b2 is therefore used for the cloning into the vector pCSP02 (see below).

For the production of the PDS promoter sequence from Lycopersicon 30 esculentum, genomic DNA from Lycopersicon esculentum tissue is isolated according to standard methods and used by genomic PCR using the primers PDS-1 and PDS-2. The PCR for the amplification of this PDS-PRomotor fragment is carried out in a 50 ul. Reaction batch which contains: 35

1 µl genomic DNA (prepared as described above) 0.3 mM dNTPs

0.2 uM PDS-1 (SEQ ID No. 89) 0.2 uM PDS-2 (SEQ ID No. 90) 40 - 5 ul 10X Pfu-Turbo Polymerase (Stratagene) - 1 ul Pfu-Turbo Polymerase (Stratagene) 28.8 ul Aq. Dest.

The following temperature program was used:

45

1 cycle with 120 sec at 94 ° C

36 cycles with 94 ° C for 60 sec, 55 ° C for 120 sec and 72 ° C for 4 min 1 cycle at 72 ° C for 10 min

The PCR amplification with PDS-1 and PDS-2 results in a fragment that contains the sequence for the PDS promoter. The amplificate is cloned into the pCR4-BLUNT (Invitrogen). This clone is called pPDS.

Sequencing with the primers M13-R and M13-F confirm a sequence SEQ ID No. 91 identical sequence. This clone is called pPDS and is therefore used for cloning into the vector pJBGEN (see below).

The first cloning step is carried out by isolating the 1,499 bp Ncol / EcoRI fragment from pBGEN, derived from the cloning vector pCR2.1 (Invitrogen). First, pBGEN is cut with BamHI, the 3 'ends are filled in according to standard methods (30 min at 30 ° C.) (Klenow-fill-in) and then a partial digestion is carried out with Ncol, in which the resulting 1,499 kb fragment is isolated. This fragment was then cloned into pCSP02, which had previously been cut with EcoRI, the 3 'ends filled in according to standard methods (30 min at 30 ° C.) (Klenow fill-in) and then cut with Ncol. The clone that contains the 1,497 bp B gene fragment BGEN is called pJAP: BGEN. The ligation creates a transcriptional fusion between the 35S terminator and the B gene.

The second cloning step is carried out by isolating the 2,078 bp PDS PROM fragment from pPDS. First, pPDS is cut with Smal and then a partial digestion with Sacl is carried out, in which the resulting 2,088 bp fragment is isolated. This fragment was then cloned into the pJAP: BGEN, which had previously been cut with BamHI, the 3 'ends filled in using standard methods (30 min at 30 ° C.) (Klenow fill-in) and then cut with SacI. The ligation creates a transcriptional fusion between the promoter PDS and the B gene. The clone that contains the 2,078 bp PDS promoter BGEN is called pJPDS: BGEN.

Example 19: Production of a triple expression vector for the overexpression of the B gene, the expression of the Nostoc punctiform ketolase NP196, and the overexpression of the chromoplast-specific B-hydroxylase from Lycopersicon esculentum fruit-specifically in Lycopersicon esculentum.

First, a double construct is produced which contains expression cassettes for the overexpression of the Nostoc punctiform ATCC 29133 NP196 ketolase and for the overexpression of the B-hydroxylase. First the fragment AP3P: b-hydroxy lase: LB3, which contains the B-hydroxylase expression cassette, as a 2104 bp Ecll36lI-XhoI fragment isolated from pCSP03 (described in Example 18). The 3 'ends (30 min at 30 ^a C) are filled using standard methods (Klenow fill-in). Subsequently, this fragment was cut in the vector MSP120 (described in Example 10) with Ecll36ll and EcoRI, the 3 'ends were filled in according to standard methods (30 min at 30 ° C.) (Klenow fill-in). The ligation results in a T-DNA which contains two expression cassettes: firstly a cassette for the chromoplast-specific overexpression of the B-hydroxylase from Lycopersicon esculentum, and secondly a cassette for the overexpression of the ketolase NP196 from Nostoc punctiforme. The B-hydroxylase downregulation cassette can ligate into the vector in two orientations. The version in which both expression cassettes match in their orientation is preferred (see Figure 14). This version can be identified by PCR as described:

The PCR for the amplification of the PR206-PR010 plasmid fragment, which contains the compound of LB3 terminator of the B-hydroxylase cassette and the AP3P promoter of the ketolase cassette, is carried out in a 50 μl reaction mixture which contains:

1 µl of plasmid DNA (made using standard methods) - 0.25 mM dNTPs

0.2 uM PR010 (SEQ ID No. 92)

0.2 uM PR206 (SEQ ID No. 93)

5 ul 10X PCR buffer (TAKARA)

0.25 ul. R Taq Polymerase (TAKARA) - 28.8 ul. Aq. Least.

The PCR amplification with PR010 and PR206 results in a 1,080 bp fragment, which indicates the presence of the above-described connection of LB3 terminator and AP3P promoter, and thus the preferred orientation of both expression cassettes. This clone is called pBHYX: NPl96.

To clone this B gene overexpression cassette into expression vectors for the Agrobacterium -mediated transformation of tomato, isolation of the 4,362 bp EcoRV-XhoI fragment from pJPDS-.BGEN (see Example 19) and ligation in the Smal-Xhol-cut vector pBHYX: NPl96 (described above). The ligation results in a T-DNA which contains three expression cassettes: first a cassette for overexpressing the B gene, secondly a cassette for overexpressing the ketolase NP196-1 from Nostoc punctiforme, and thirdly a cassette for chromoplast-specific overexpression of the B-hydroxylase Lycopersicon esculentum (Figure 14, construct map). This clone is called MSP124. In Figure 14, fragment AP3P PROM (765 bp) contains the AP3P promoter, fragment BHYX b2 CDS (2 bp) the B-hydroxylase CrtRb2, fragment LB3 TERM (296 bp) the LB3 terminator.

Fragment AP3P PROM (765 bp) also contains the AP3P promoter, fragment rbcS TP FRAGMENT (194 bp) the transit peptide of the rbcS gene from pea, NP196 KETO CDS (761 bp) the ketolase from Noctoc punctiform ATCC29133, and OCS TERM (192 bp) the polyadenylation signal of the octopine synthase gene.

Furthermore, fragment PDS PROM (2078 bp) contains the PDS promoter, fragment BGEN CDS (1,497 bp) the B gene sequence, and fragment 35S TERM (746 bp) the 35S terminator.

Example 20:

Production of transgenic Lycopersicon esculentum plants

Transformation and regeneration of tomato plants was described in Example 6. s

According to the transformation method described, the following lines were obtained with the following expression constructs:

With MSP120 was obtained: MSP120-1, MSP120-2, MSP120-3

With MSP121 was obtained: MSP121-1, MSP121-2, MSP121-3

With MSP122 was obtained: MSP122-1, MSP122-2, MSP122-3

With MSP123 was obtained: MSP123-1, MSP123-2, MSP123-3

With MSP124 was obtained: MSP124-1, MSP124-2, MSP124-3

Claims

claims

1. Process for the preparation of ketocarotenoids by cultivating genetically modified plants which have a ketolase activity in fruit.

2. The method according to claim 1, characterized in that one uses genetically modified plants that express a ketolase in fruits.

3. The method according to claim 1 or 2, characterized in that genetically modified plants are used which contain at least one nucleic acid, coding for a keto-lase, in fruits.

4. The method according to claim 3, characterized in that one uses genetically modified plants, in which, starting from a starting plant, at least one nucleic acid coding for a ketolase has been introduced.

5. The method according to claim 4, characterized in that introducing nucleic acids encoding a protein containing the amino acid sequence SEQ ID NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO. 2 and has the enzymatic property of a ketolase.

6. The method according to claim 4, characterized in that one

Nucleic acids containing the sequence SEQ ID NO. 1 brings.

7. The method according to claim 4, characterized in that introducing nucleic acids encoding a protein containing the amino acid sequence SEQ ID NO. 16 or one of these

Sequence derived by substitution, insertion or deletion of amino acids, which has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO. 16 and has the enzymatic property of a ketolase.

8. The method according to claim 6, characterized in that nucleic acids containing the sequence SEQ ID NO. 15 brings.

Sequ. + Draw

9. The method according to any one of claims 1 to 8, characterized in that one uses genetically modified plants which have the highest expression rate of a ketolase in fruits.

5

10. The method according to claim 9, characterized in that the gene expression of the ketolase takes place under the control of a fruit-specific promoter.

11. The method according to any one of claims 1 to 10, characterized in that the plants additionally have an increased activity compared to the wild type of at least one of the activities selected from the group of hydroxylase activity and β-cyclase activity.

15

12. The method according to claim 11, characterized in that for additional increase of at least one of the activities, the gene expression of at least one nucleic acid selected from the group encoding a hydroxylase and nucleic acids

20 nucleic acids encoding a β-cyclase increased compared to the wild type.

13. The method according to claim 12, characterized in that to increase gene expression at least 'one of the nucleotides

25 acids, at least one nucleic acid selected from the group

Group, encoding nucleic acids encoding a hydroxylase and nucleic acids encoding a β-cyclase into the plant.

14. The method according to claim 13, characterized in that 30 nucleic acid encoding a hydroxylase, nucleic acids encoding a hydroxylase are introduced, containing the amino acid sequence SEQ ID NO: 52 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 20% 35 at the amino acid level with the sequence SEQ ID NO: 52.

15. The method according to claim 14, characterized in that nucleic acids containing the sequence SEQ ID NO: 51 are introduced.

40

16. The method according to claim 13, characterized in that the nucleic acid encoding a β-cyclase, nucleic acids which encode a β-cyclase, containing the amino acid sequence SEQ ID NO: 54 or one of these sequences

45 substitution, insertion or deletion of amino acids removed directed sequence that has at least 20% identity at the amino acid level with the sequence SEQ ID NO: 54.

17. The method according to claim 16, characterized in that nucleic acids containing the sequence SEQ ID NO: 53 are introduced.

18. The method according to any one of claims 11 to 17, characterized in that genetically modified plants are used which have the highest expression rate of a hydroxylase and / or β-cyclase in flowers.

19. The method according to claim 18, characterized in that the gene expression of the hydroxylase and / or β-cyclase takes place under the control of a flower-specific promoter.

20. The method according to any one of claims 1 to 10, characterized in that the plant used is a plant which has chromoplasts in fruits.

21. The method according to any one of claims 1 to 20, characterized in that a plant selected as a plant 'from the plant genera Actinophloeus, Aglaeonema, pineapple, Arbutus, Archontophoenix, Area, Aronia, Asparagus, Attalea, Berberis, Bixia, Brachychilum, Bryonia , Caliptocalix,

Capsicum, Carica, Celastrus, Citrullus, Citrus, Convallaria, Cotoneaster, Crataegus, Cucumis, Cucurbita, Cuscuta, Cycas, Cyphomandra, Dioscorea, Diospyrus, Dura, Elaeagnus, Elaeis, Erythroxylon, Euonymus, Ficus, Garduni- nia, Fragunellaia, Fragunellaia Gonocaryum, Gossypium, Guava, Guilielma, Hibiscus, Hippophaea, Iris, Lathyrus, Lonicera, Luffa, Lycium, Lycopersicum, Malpighia, Mangifera, Mormodica, Murraya, Musa, Nenga, Palisota, Pandanus, Passiflora, Persus, Palis, Pralis Punica, Pyracantha, Pyrus, Ribes, Rosa, Rubus, Sabal, Sambucus, Seaforita, Shepherdia, Solanum,

Sorbus, Synaspadix, Tabernae, Tamus, Taxus, Trichosanthes, Triphasia, Vaccinium, Viburnum, Vignia or Vitis are used.

22. The method according to any one of claims 1 to 21, characterized in that after cultivation, the genetically modified plants are harvested and then the ketocarotenoids are isolated from the fruits of the plants.

23. The method according to any one of claims 1 to 22, characterized in that the ketocarotenoids are selected from the group of astaxanthin, canthaxanthin, echinenone, 3-hydroxyquinene, 3 'hydroxyechinenone, adonirubin and adonixanthin.

5

24. Nucleic acid construct containing functionally linked a fruit-specific promoter and a nucleic acid encoding a ketolase.

10 25. Genetically modified plant that shows a ketolase activity in fruits.

26. Genetically modified plant according to claim 25, characterized in that the genetically modified plant in

15 the fruit expressed a ketolase.

27. Genetically modified plant according to claim 25 or 26, containing in fruits at least one nucleic acid encoding a ketolase.

20

28. Genetically modified plant according to one of claims 25 to

27, characterized in that at least one nucleic acid encoding a ketolase has been introduced into the plant starting from an initial plant.

25

29. Genetically modified plant according to one of claims 25 to

28, characterized in that the genetic modification additionally comprises at least one of the activities selected from the group hydroxlase activity and β-cyclase activity.

30 raised compared to a wild type plant.

30. Genetically modified plant, selected from the plant genera Actinophloeus, Aglaeonema, pineapple, Arbutus, Archon-tophoenix, Area, Aronia, Asparagus, Attalea, Berberis, Bixia,

35 Brachychilum, Bryonia, Caliptocalix, Capsicum, Carica, Celastus, Citrullus, Citrus, Convallaria, Cotoneaster, Crataegus, Cucumis, Cucurbita, Cuscuta, Cycas, Cyphomandra, Dioscorea, Diospyrus, Dura, Elaeagnus, Felicusonymus, Ericex , Fortunella, Fragaria, Gardinia, Gonocaryum, Gossypium,

40 Guava, Guilielma, Hibiscus, Hippophaea, Iris, Lathyrus, Lonicera, Luffa, Lycium, Lycopersicum, Malpighia, Mangifera, Mormodica, Murraya, Musa, Nenga, Palisota, Pandanus, Passiflora, Persea, Physalis, Prunus, Ptychandra, Puny , Pyracantha, Pyrus, Ribes, Rosa, Rubus, Sabal, Sambucus, Seaforita,

45 Shepherdia, Solanum, Sorbus, Synaspadix, Tabernae, Tamus,

Taxus, Trichosanthes, Triphasia, Vaccinium, Viburnum, Vignia or vitis containing at least one nucleic acid encoding a ketolase.

31. Genetically modified plant according to claim 30, characterized

5 characterized that the ketolase is expressed in fruits.

32. Genetically modified plant according to one of claims 25 to 31, characterized in that the expression rate of one

10 Ketolase is highest in fruits.

33. Use of the genetically modified plants according to one of claims 25 to 32 as feed or food.

15 34. Use of the fruits of the genetically modified plants according to one of claims 25 to 32 for the production of keto-carotenoid-containing extracts or for the production of feed or food supplements.

35. A method for producing genetically modified plants according to claim 32, characterized in that a nucleic acid construct containing functionally linking a fruit-specific promoter and coding for nucleic acids is introduced into the genome of the starting plant encoding a ketolase.

25

30

35

40

45