WO2021060932A1 - 항-c-met 항체 또는 그의 항원 결합 단편을 포함하는 키메라 항원 수용체, 및 이의 용도 - Google Patents

항-c-met 항체 또는 그의 항원 결합 단편을 포함하는 키메라 항원 수용체, 및 이의 용도 Download PDF

Info

Publication number
WO2021060932A1
WO2021060932A1 PCT/KR2020/013127 KR2020013127W WO2021060932A1 WO 2021060932 A1 WO2021060932 A1 WO 2021060932A1 KR 2020013127 W KR2020013127 W KR 2020013127W WO 2021060932 A1 WO2021060932 A1 WO 2021060932A1
Authority
WO
WIPO (PCT)
Prior art keywords
met
sequence
cells
nucleic acid
car
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2020/013127
Other languages
English (en)
French (fr)
Korean (ko)
Inventor
채진아
유승신
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Helixmith Co Ltd
Original Assignee
Helixmith Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Helixmith Co Ltd filed Critical Helixmith Co Ltd
Priority to CN202080067658.8A priority Critical patent/CN114450407A/zh
Priority to US17/763,712 priority patent/US12570719B2/en
Priority to JP2022519423A priority patent/JP7373242B2/ja
Priority to EP20868836.6A priority patent/EP4039703A4/en
Publication of WO2021060932A1 publication Critical patent/WO2021060932A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70521CD28, CD152
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/4203Receptors for growth factors
    • A61K40/4209Hepatocyte growth factor receptor [HGFR] or c-met]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70514CD4
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70532B7 molecules, e.g. CD80, CD86
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70535Fc-receptors, e.g. CD16, CD32, CD64 (CD2314/705F)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70596Molecules with a "CD"-designation not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2121/00Preparations for use in therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/33Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/10041Use of virus, viral particle or viral elements as a vector
    • C12N2740/10043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/10Plasmid DNA
    • C12N2800/106Plasmid DNA for vertebrates
    • C12N2800/107Plasmid DNA for vertebrates for mammalian

Definitions

  • the present invention relates to a chimeric antigen receptor comprising a c-Met binding domain, and uses thereof.
  • c-Met The activation of c-Met is a variety of inducing increased cell growth, scattering and motility, invasion, protection from apoptosis, branching morphogenesis and angiogenesis. Causes a biological reaction. Hence, inadequate activation of c-Met under pathological conditions can confer proliferation, survival and invasion/metastasis capabilities to cancer cells. Considering the various biological and physiological functions affected by c-Met activity, the c-Met protein has become a versatile therapeutic target.
  • CARs chimeric antigen receptors
  • the present inventors have made intensive research efforts to develop chimeric antigen receptors that can effectively treat diseases related to c-Met expression and effector cells including the same.
  • anti-c-Met CAR that specifically binds to c-Met and T cells expressing the same were produced, and anti-c-Met CAR-T has a therapeutic effect on carcinomas related to various c-Met expressions.
  • the present invention has been completed.
  • an object of the present invention is to provide a nucleic acid molecule encoding an anti-c-Met chimeric antigen receptor and a vector comprising the same.
  • Another object of the present invention is to provide an anti-c-Met chimeric antigen receptor molecule comprising a polypeptide encoded by the nucleic acid molecule and an effector cell expressing the same on the cell surface.
  • Another object of the present invention is to provide a pharmaceutical composition comprising the effector cells and a pharmaceutically acceptable carrier.
  • the present invention provides a nucleic acid molecule encoding an anti-c-Met chimeric antigen receptor comprising:
  • c-Met binding domain c-Met binding domain, transmembrane domain, and intracellular signaling domain.
  • the c-Met binding domain is an antibody or antigen binding fragment thereof that specifically binds to c-Met.
  • the antibody or antigen-binding fragment thereof is a heavy chain complementarity determining region 1 (complementarity determining region 1 of heavy chain, CDRH1) each comprising the amino acid sequence of SEQ ID NO: 15, 16, 17, heavy chain complementarity Crystal region 2 (CDRH2), and heavy chain complementarity determining region 3 (CDRH3); And light chain complementarity determining region 1 (complementarity determining region 1 of light chain, CDRL1), light chain complementarity determining region 2 (CDRL2), and light chain complementarity determining region 3 (CDRL3) each comprising the amino acid sequences of SEQ ID NOs: 18, 19, and 20.
  • a nucleic acid molecule comprising a.
  • the antibody or antigen-binding fragment thereof comprises a heavy chain variable region (VH) consisting of the amino acid sequence of SEQ ID NO: 21; And a light chain variable region (VL) consisting of the amino acid sequence of SEQ ID NO: 22.
  • VH heavy chain variable region
  • VL light chain variable region
  • the antibody or antigen-binding fragment thereof is a heavy chain variable region (VH) consisting of the amino acid sequence of SEQ ID NO: 64; And a light chain variable region (VL) consisting of the amino acid sequence of SEQ ID NO: 22.
  • VH heavy chain variable region
  • VL light chain variable region
  • the antibody or antigen-binding fragment thereof is a heavy chain variable region (VH) consisting of the amino acid sequence of SEQ ID NO: 65; And a light chain variable region (VL) consisting of the amino acid sequence of SEQ ID NO: 22.
  • VH heavy chain variable region
  • VL light chain variable region
  • the antibody or antigen-binding fragment thereof is a heavy chain variable region (VH) consisting of the amino acid sequence of SEQ ID NO: 65; And a light chain variable region (VL) consisting of the amino acid sequence of SEQ ID NO: 66.
  • VH heavy chain variable region
  • VL light chain variable region
  • antibody or Ab refers to a protein or polypeptide sequence derived from an immunoglobulin molecule that specifically binds to a specific antigen.
  • the antibody may be a natural antibody or a recombinant antibody.
  • recombinant antibody refers to an antibody produced using recombinant DNA technology, for example, an antibody expressed by an animal cell expression system.
  • the term also refers to an antibody produced by translation of a synthesized DNA molecule encoding an antibody.
  • Such antibodies include complete antibody forms as well as antigen binding fragments of antibody molecules.
  • a complete antibody is a structure having two full-length light chains and two full-length heavy chains, and each light chain is linked to a heavy chain by a disulfide bond.
  • the term “heavy chain” refers to the larger of the two kinds of polypeptide chains, which are present in the antibody molecule in its naturally occurring conformation and which usually determines the class to which the antibody belongs.
  • the “heavy chain” refers to a variable region of heavy chain domain VH and three constant regions of heavy chain of an antibody comprising an amino acid sequence having a sufficient variable region sequence to impart specificity to the antigen. It refers to all of the full-length heavy chains and fragments thereof comprising the domains CH1, CH2 and CH3.
  • the heavy chain constant region has gamma ( ⁇ ), mu ( ⁇ ), alpha ( ⁇ ), delta ( ⁇ ) and epsilon ( ⁇ ) types, and subclasses gamma 1 ( ⁇ 1), gamma 2 ( ⁇ 2), and gamma 3 ( ⁇ 3). ), gamma4( ⁇ 4), alpha1( ⁇ 1) and alpha2( ⁇ 2).
  • the term “light chain” refers to the smaller of the two kinds of polypeptide chains present in an antibody molecule in its naturally occurring conformation.
  • the “light chain” is a variable region of light chain domain VL and a constant region of light chain domain CL of an antibody comprising an amino acid sequence having a sufficient variable region sequence to confer antigen specificity. It means both a full-length light chain and fragments thereof, including.
  • the constant region of light chain has kappa ( ⁇ ) and lambda ( ⁇ ) types (Cellular and Molecular Immunology, Wonsiewicz, MJ, Ed., Chapter 45, pp. 41-50, WB Saunders Co. Philadelphia, PA (1991); Nisonoff, A., Introduction to Molecular Immunology, 2nd Ed., Chapter 4, pp. 45-65, sinauer Associates, Inc., Sunderland, MA (1984)).
  • the term "antigen or Ag” refers to a molecule that triggers an immune response.
  • the immune response may involve antibody production, or activation of specific immune-competent cells, or both.
  • CDR complementarity determining region
  • FR refers to variable domain residues other than hypervariable region (HVR) residues.
  • the FR of the variable domain is generally composed of four FR domains FR1, FR2, FR3 and FR4.
  • HVR and FR sequences generally appear in the following order in VH (or VL/Vk):
  • FRL1 Framework region 1 of Light chain
  • CDRL1 complementarity determining region 1 of Light chain
  • c-Met (mesenchymal-epithelial transition factor) is a receptor tyrosine kinase encoded by the Met proto-oncogene expressed on the cell surface.
  • c-Met is a disulfide-bonded dimer consisting of an extracellular alpha subunit (50 kDa) and a transmembrane beta subunit (140 kDa).
  • c-Met contains tyrosine kinase catalytic motifs involved in the phosphorylation of tyrosine residues in the extracellular domain, transmembrane moiety, and intracellular domain for ligand binding (Dean et al., Nature, 4: 318 (6044): 385, 1985; Park et al., PNAS, 84 (18): 6379, 1976; Maggiora et al., J. Cell Physiol., 173:183, 1997).
  • c-Met activation is a variety of biological agents that induce increased cell growth, scattering and motility, invasion, protection from apoptosis, branching morphogenesis and angiogenesis. causess a reaction. Inadequate activation of c-Met under pathological conditions can confer proliferation, survival and invasion/metastasis capabilities to cancer cells. Considering the various biological and physiological functions affected by c-Met activity, the c-Met protein has become a versatile therapeutic target.
  • the term “specifically binds” or the like means that an antibody or antigen-binding fragment thereof, or other construct, such as scFv, forms a complex with an antigen that is relatively stable under physiological conditions.
  • the specific binding of the anti -c-Met antibody or antigen-binding fragment of the invention is at least about 1 x 10 -6 M or less (e.g., 9 x 10 -7 M, 8 x 10 - 7 M, 7 x 10 -7 M , 6 x 10 -7 M, 5 x 10 -7 M, 4 x 10 -7 M, 3 x 10 -7 M, 2 x 10 -7 M, or 1 x 10 - 7 M), at least about 1 x 10 -7 M or less (e.g., 9 x 10 -8 M, 8 x 10 -8 M, 7 x 10 -8 M, 6 x 10 -8 M, 5 x 10 -8 M , 4 x 10 -8 M, 3 x 10 -8 M, 2 x 10 -8 M, or 1 x 10 -8 M), or at least about 1 x 10 -8 M or less (e.g., 9 x 10 -9 M , 8 x 10 -9 M, 7 x 10 -9 M, 7
  • affinity refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (eg, an antibody) and its binding partner (eg, an antigen).
  • binding affinity refers to an intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (eg, antibody and antigen). Represents.
  • the affinity of a molecule Y and its partner Y can generally be expressed as the dissociation constant (Kd). Affinity can be measured by conventional methods known in the art, including those described herein.
  • human antibody refers to the amino acid sequence of an antibody produced by a human or human cell, or an antibody derived from a non-human source using human antibody repertoires or other human antibody encoding sequences. It has the corresponding amino acid sequence. This definition of human antibody excludes humanized antibodies comprising non-human antigen binding moieties.
  • chimeric antibody refers to a heavy chain and/or a light chain in which a part is derived from a specific source or species, and the heavy chain and/or a light chain is derived from a different source or species. Means antibody.
  • the Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • the humanized antibody may contain residues that are not found either in the recipient antibody or in the imported CDR or framework sequences. These modifications are made to further improve and optimize antibody performance.
  • the humanized antibody will comprise at least one, and typically two, substantially all of the variable domains, in which all or substantially all of the CDR regions correspond to the CDR regions of a non-human immunoglobulin, All or substantially all of the FR region has the sequence of the FR region of a human immunoglobulin.
  • the humanized antibody comprises at least a portion of an immunoglobulin constant region (Fc region) to a substantially human immunoglobulin constant region (Fc region) sequence.
  • the anti-c-Met antibody or antigen-binding fragment thereof of the present invention may include a variant of an amino acid sequence within a range capable of specifically recognizing c-Met, as recognized by a person skilled in the art.
  • changes can be made to the amino acid sequence of an antibody to improve its binding affinity and/or other biological properties.
  • modifications include, for example, deletions, insertions and/or substitutions of amino acid sequence residues of the antibody.
  • each amino acid is assigned a hydrophobicity index according to its hydrophobicity and charge: isoleucine (+4.5); Valine (+4.2); Leucine (+3.8); Phenylalanine (+2.8); Cysteine/cysteine (+2.5); Methionine (+1.9); Alanine (+1.8); Glycine (-0.4); Threonine (-0.7); Serine (-0.8); Tryptophan (-0.9); Tyrosine (-1.3); Proline (-1.6); Histidine (-3.2); Glutamate (-3.5); Glutamine (-3.5); Aspartate (-3.5); Asparagine (-3.5); Lysine (-3.9); And arginine (-4.5).
  • the hydrophobic amino acid index is very important in imparting an interactive biological function of a protein. It is a known fact that similar biological activities can be retained only by substitution with amino acids having a similar hydrophobicity index. When introducing a mutation with reference to the hydrophobicity index, substitution is made between amino acids showing a difference in the hydrophobicity index, preferably within ⁇ 2, more preferably within ⁇ 1, and even more preferably within ⁇ 0.5.
  • substitution is made between amino acids showing a difference in hydrophilicity values of preferably within ⁇ 2, more preferably within ⁇ 1, and even more preferably within ⁇ 0.5.
  • the anti-c-Met antibody or antigen-binding fragment thereof of the present invention is an anti-c-Met antibody or antigen-binding fragment thereof limited to the specific amino acid sequence described above (eg, a heavy chain variable region and Amino acid sequence of the variable region of the light chain, or a fragment of an amino acid sequence including CDRH1 to CDRH3 and CDRL1 to CDRL3 thereof).
  • the anti-c-Met antibody or antigen-binding fragment thereof is an amino acid of the antibody or antigen-binding fragment thereof limited to the specific amino acid sequence described above, the CDR, the heavy chain variable region, or the light chain variable region.
  • At least about 60% homology with the sequence e.g., 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, or 69%), more preferably at least 70 % Or more homology (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%), even more preferably at least 80% or more (e.g.
  • homology most preferably at least 90% (e.g., 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). All integers of 70% or more and 100% or less and prime numbers therebetween are included within the scope of the present invention with respect to% homology.
  • the chimeric antigen receptor of the present invention contains the above-described anti-c-Met antibody or antigen-binding fragment thereof as an extracellular antigen-binding domain. Accordingly, the chimeric antigen receptor of the present invention is expressed as an anti-c-Met chimeric antigen receptor (anti-c-Met CAR), an anti-c-Met CAR, or the like.
  • c -Met CAR is a code name for the anti-c-Met chimeric antigen receptor invented by the present inventors, and refers to a chimeric antigen receptor comprising an extracellular antigen-binding domain that specifically binds to the c-Met described above.
  • the term “stimulatory molecule” is expressed by T cells that provide the primary cytoplasmic signaling sequence(s) that regulate the primary activation of the TCR complex in a manner of stimulation for at least some aspects of the T cell signaling pathway. Represents a molecule that becomes. More specifically, the primary signal is initiated, for example, by binding of the MHC molecule loaded with the peptide and the TCR/CD3 complex, which mediates T cell responses including, but not limited to, proliferation, activation, differentiation, and the like.
  • the primary cytoplasmic signaling sequence (or “primary signaling domain”) acting in a stimulating manner may comprise an immunoreceptor tyrosine-based activation motif or a signaling motif known as ITAM.
  • signaling domain refers to the function of a protein that generates a second messenger or transmits information into a cell to regulate cellular activity through a predetermined signaling pathway in response to the messenger. Means part.
  • the chimeric antigen receptor optionally further includes a leader sequence (LS).
  • the preceding sequence is located at the amino-terminal (N-terminal) of the recombinant polypeptide constituting the chimeric antigen receptor.
  • the preceding sequence is optionally cleaved from the antigen binding domain while localization to the intracellular processes and cell membranes of the chimeric antigen receptor.
  • the preceding sequence may be a preceding sequence of CD8 alpha, a preceding sequence of hGM-CSF receptor alpha-chain, or a preceding sequence of 3E8 antibody.
  • the c-Met binding domain and the transmembrane domain of the chimeric antigen receptor are linked by a hinge region, a spacer region, or a combination thereof.
  • the hinge region, the spacer region, or a combination thereof is the hinge of human IgG1, the hinge of IgG4, the hinge of IgD, the hinge of CD8 alpha, the hinge of IgG1, the extracellular domain of CD28, or these It may be a combination of all or part of the sequences of.
  • the hinge region includes an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 32, 34, 36, 38, 40 or 44.
  • the transmembrane domain is T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, It contains the transmembrane domain of a protein selected from the group consisting of the alpha, beta or zeta chains of CD137 and CD154.
  • the transmembrane domain includes an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 42, 46 or 47.
  • the intracellular signaling domain includes a signaling domain of CD3 zeta.
  • the signal transduction domain of CD3 zeta includes an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 55, 57 or 59.
  • the intracellular signaling domain is OX40, CD2, CD27, CD28, CDS, ICAM-1, LFA-1 (CD11a/CD18), ICOS (CD278) and 4-1BB ( CD137), a signaling domain of a protein selected from the group consisting of) is further included as a costimulatory domain.
  • the chimeric antigen receptor of the present invention may be a recombinant polypeptide comprising an antigen-binding domain, a transmembrane domain, an intracellular signaling domain derived from a stimulating molecule, and a signaling domain derived from a co-stimulatory molecule.
  • the co-stimulatory domain includes an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 49, 51 or 53.
  • the present invention provides a vector comprising a nucleic acid molecule encoding the chimeric antigen receptor described above.
  • nucleic acids has a meaning that comprehensively includes DNA (gDNA and cDNA) and RNA molecules, and nucleotides, which are basic structural units in nucleic acid molecules, are not only natural nucleotides, but also sugar or base moieties. Also includes modified analogs (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).
  • the nucleotide sequence encoding the chimeric antigen receptor polypeptide of the present invention is sufficient to be a nucleotide sequence encoding the amino acid sequence constituting the chimeric antigen receptor molecule, and is not limited to any specific nucleotide sequence. It is obvious to a person skilled in the art that not.
  • nucleotide sequence may be a functionally equivalent codon or a codon encoding the same amino acid (e.g., due to the degeneracy of the codon, there are six codons for arginine or serine), or a codon encoding a biologically equivalent amino acid. It includes a nucleotide sequence comprising.
  • Homology e.g., 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, or 69%), more preferably at least 70% or more homology (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%), even more preferably at least 80% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%) of homology, most preferably at least 90% (e.g. 90%, 91%, 92%, 93%) , 94%, 95%, 96%, 97%, 98%, 99%, or 100%). All integers of 70% or more and 100% or less and prime numbers therebetween are included within the scope of the present invention with respect to% homology.
  • NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10 (1990)) can be accessed from NBCI (National Center for Biological Information), etc., and blastp, blastn, and It can be used in conjunction with sequence analysis programs such as blastx, tblastn and tblastx.
  • BLAST can be accessed through the BLAST page of the ncbi website. The sequence homology comparison method using this program can be found on the BLAST help page of the ncbi website.
  • the vector is selected from the group consisting of DNA, RNA, plasmid, lentiviral vector, adenovirus vector, adeno-associated viral vector, or retroviral vector.
  • the vector is a lentiviral vector.
  • the vector further includes a promoter.
  • the promoter may be, for example, an EF-1 promoter, but is not limited thereto.
  • the vector may be a retroviral vector.
  • Retroviruses provide a convenient platform for gene delivery systems. Genes selected for gene delivery can be inserted into retroviral vectors and packaged into retroviral particles. The recombined retrovirus can then be delivered in vivo or in vitro to a host cell of interest.
  • Many retroviral vectors are known in the art, and in a specific embodiment of the present invention, the retroviral vector is a pMT retroviral vector, which is an MLV-based retroviral vector, but is not limited thereto.
  • Vectors can be readily introduced into host cells, such as mammalian, bacterial, yeast, or insect cells by methods known in the art.
  • a vector can be delivered into a host cell by physical, chemical, or biological means.
  • the physical means include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like.
  • Such chemical means include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • the biological means include the use of DNA or RNA vectors, such as lentivirus, retrovirus, etc.
  • the present invention provides an anti-c-Met chimeric antigen receptor molecule comprising a polypeptide encoded by the nucleic acid molecule described above.
  • the anti-c-Met chimeric antigen receptor molecule according to an aspect of the present invention is obtained by introducing and expressing the above-described nucleic acid molecule or a vector containing the same into a cell. Accordingly, description thereof will be omitted within a range overlapping with the above-described nucleic acid molecule and vector containing the same.
  • the present invention provides an effector cell expressing the above-described anti-c-Met chimeric antigen receptor molecule on a cell surface.
  • the effector cell is selected from the group consisting of dendritic cells, killer dendritic cells, mast cells, natural killer cells, B lymphocytes, T lymphocytes, macrophages, and progenitor cells thereof, but is limited thereto. It is not.
  • the T lymphocyte is selected from the group consisting of inflammatory T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes or helper T lymphocytes.
  • the effector cells include autologous cells or a population of allogeneic cells. That is, the effector cells include autologous cells or a population of allogeneic cells expressing the anti-c-Met CAR polypeptide.
  • the term “self” refers to any substance derived from the same subject that is intended to be reintroduced into the subject.
  • the term “homologous” refers to any substance derived from a different animal of the same species as the individual into which the substance is introduced.
  • the effector cells include a population of cells transfected or transduced with a vector containing a nucleic acid molecule encoding an anti-c-Met CAR polypeptide.
  • the transfection or transduction may be performed without limitation by various means known in the art as described above.
  • the effector cells of the present invention such as T lymphocytes, or natural killer cells are delivered, and the anti-c-Met CAR encoding nucleic acid molecule is transcribed into mRNA, and anti-c- The Met CAR polypeptide is translated and expressed on the surface of effector cells.
  • the effector cells expressing the anti-c-Met chimeric antigen receptor of the present invention are cancer cell lines A549, PC-3, MCF-7, SKOV3, and SK-HEP-1 cells. Effectively kills. Therefore, the effector cells expressing the anti-c-Met chimeric antigen receptor of the present invention can be usefully used as an active ingredient of a therapeutic composition for various carcinomas.
  • the present invention provides a pharmaceutical composition for immunotherapy comprising an effector cell expressing the above-described anti-c-Met CAR and a pharmaceutically acceptable carrier.
  • immunotherapy is a method of treating cancer that helps the immune system to eliminate cancer.
  • Immunotherapy is divided into active immunotherapy and passive immunotherapy.
  • Active immunotherapy includes i) cancer vaccine therapy that activates the immune system by injecting cancer cells or substances produced by cancer cells into the body, ii) immunomodulators such as cytokines (interferon, interleukin, etc.), growth factors, etc. immune-modulating agents) to activate certain leukocytes.
  • Passive immunotherapy includes therapeutic antibodies that bind to specific cancer cells and immune cell therapy.
  • Immune cell therapy specifically includes dendritic cell vaccine therapy, CAR-T (chimeric antigen receptor T cell) therapy, natural killer cell therapy, CTL therapy, and adoptive cells. It includes, but is not limited to, such as adoptive cell transfer.
  • immunotherapy mainly refers to the above-described immune cell therapy.
  • the pharmaceutical composition of the present invention includes an antibody or antigen-binding fragment that binds to the c-Met antigen of a target cell, or an effector cell expressing a chimeric antigen receptor containing the same, and thus, diagnosis of a disease related to the expression of c-Met or It is effective in treatment.
  • the pharmaceutical composition for immunotherapy is a pharmaceutical composition for the treatment of diseases associated with c-Met expression.
  • the disease associated with c-Met expression is a disease selected from the group consisting of brain cancer (malignant brain tumor), glioma, breast cancer, pancreatic cancer, pleural dysthelioma, liver cancer, stomach cancer, lung cancer, ovarian cancer, colon cancer, etc. , But is not limited thereto.
  • the glioma is a tumor arising from glial cells, one of the cells present in the nervous system of the human body.
  • the glial cells include central glial cells such as astrocytes, oligodendroglia cells (oligodendroglia), and ependymal cells; There are peripheral ganglion cells, Schwann's cell, and ganglion cell (capsular cell).
  • Gliomas are i) astrocytic tumors (including glioblastomas), ii) oligodendroglial tumors, and iii) top cell tumors (ventricular cell tumors), depending on the type of main glial cells constituting the glioma. , Ependymoma).
  • the pharmaceutical composition of the present invention may comprise the aforementioned CAR-expressing effector cells, for example, a plurality of CAR-expressing effector cells, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients.
  • the pharmaceutical composition may include buffering agents such as neutral buffered saline, phosphate buffered saline, and the like; Carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; protein; Polypeptides or amino acids such as glycine; Antioxidants; Chelating agents such as EDTA or glutathione; Adjuvants (eg, aluminum hydroxide); And preservatives.
  • the pharmaceutical composition is formulated for intravenous administration.
  • the pharmaceutical composition of the present invention can be administered orally or parenterally, such as intravenous administration, subcutaneous administration, intradermal administration, intramuscular administration, intraperitoneal administration, intrasternal administration, intracranial administration, intracranial administration, intrapulmonary administration, and It can be administered by rectal administration, etc., but is not limited thereto.
  • the pharmaceutical composition comprising the effector cells of the present invention is administered to a patient by intradermal or subcutaneous injection.
  • the pharmaceutical composition of the present invention is administered by intravenous injection.
  • the pharmaceutical composition of the present invention can be administered directly into a tumor, lymph node, or site of infection.
  • Subjects in need of the present invention can receive standard treatment using high-dose chemotherapy after peripheral blood stem cell transplantation.
  • a subject in need of the present invention may receive the expanded CAR T cells of the present invention after or simultaneously with the peripheral blood stem cell transplantation.
  • the expanded cells are administered before or after surgery.
  • the appropriate dosage for the "immunologically effective amount”, “anti-tumor effective amount”, “tumor-suppressing effective amount”, or “therapeutic amount” of the pharmaceutical composition of the present invention is the formulation method, mode of administration, age, body weight, sex, pathology of the patient. It is determined by factors such as condition, food, time of administration, route of administration, rate of excretion and responsiveness, and usually a skilled practitioner can easily determine and prescribe an effective dosage for the desired treatment or prophylaxis. The dosage will be determined by clinical trial.
  • treatment means reduction, suppression, sedation or eradication of a disease state.
  • anti-tumor refers to a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, a decrease in tumor cell proliferation, a decrease in tumor cell survival, or various physiological conditions associated with a cancerous condition. Including, but not limited to, improvement of medical symptoms.
  • compositions comprising T cells described herein can be administered at a dosage of 10 4 to 10 9 cells/kg body weight, in some cases 10 5 to 10 6 cells/kg body weight (including all integer values within this range). It can be generally referred to as being present.
  • the T cell composition can also be administered multiple times at these dosages.
  • Cells can be administered using injection techniques commonly known in immunotherapy (see, eg, Rosenberg et al., New Eng. J. of Med. 319:1676, 1988).
  • the pharmaceutical composition of the present invention may also be used in combination with other pharmaceutically active agents and therapy in addition to the above-described active ingredients.
  • the “combination” can be expressed as simultaneous or co-administration.
  • the CAR-expressing effector cells described herein and at least one additional therapeutic agent can be administered simultaneously, in the same composition or in separate compositions, or sequentially.
  • the CAR-expressing cells described herein may be administered first and additional agents may be administered second, or the order of administration may be reversed.
  • the therapeutic agents that can be used in combination with the pharmaceutical composition of the present invention include one or more chemotherapeutic agents known in the art, one or more targeted therapeutic agents, and PD-1/PD-L1 specific immune checkpoint inhibitors, but are limited thereto. no.
  • the present invention provides an immunotherapy method comprising administering an effector cell expressing the chimeric antigen receptor to a subject in need of treatment.
  • Diseases related to c-Met expression which is the target disease of the immunotherapy method of the present invention, are the same as those defined in relation to the disease target of the pharmaceutical composition.
  • the subject is a mammal or a human.
  • the method of treating diseases related to c-Met expression of the present invention is a method of commonly using effector cells expressing the above-described chimeric antigen receptor as an active ingredient, overlapping contents are described in order to avoid excessive complexity of the present specification. Is omitted.
  • An object of the present invention is to provide an anti-c-Met chimeric antigen receptor and a pharmaceutical composition using the same.
  • the chimeric antigen receptor containing the c-Met binding domain of the present invention it can be usefully used as a therapeutic agent for diseases related to the expression of various c-Met.
  • FIG. 1 is a diagram showing the structure of the c-Met-CAR-001 construct of the present invention.
  • FIG. 2 is a diagram showing the structure of the pBHA-c-Met-CAR-001 plasmid of the present invention.
  • FIG. 3 is a diagram showing the structure of the pMT-CAR-001 plasmid of the present invention.
  • FIG. 4 is a diagram showing the structure of the pMT-CAR-002 plasmid of the present invention.
  • FIG. 5 is a diagram showing the structure of the pMT-CAR-003 plasmid of the present invention.
  • FIG. 6 is a diagram showing the c-Met-CAR-002 PCR amplification process of the present invention.
  • FIG. 7 is a diagram showing the structure of the c-Met-CAR-002 construct of the present invention.
  • FIG. 8 is a diagram showing the c-Met-CAR-003 PCR amplification process of the present invention.
  • FIG. 9 is a diagram showing the structure of the c-Met-CAR-003 construct of the present invention.
  • FIG. 10 is a diagram showing the c-Met-CAR-004 PCR amplification process of the present invention.
  • FIG. 11 is a diagram showing the structure of the c-Met-CAR-004 construct of the present invention.
  • 12A to 12D are pMT-c-Met-CAR-001, pMT-c-Met-CAR-002, pMT-c-Met-CAR-003, and pMT-c-Met-CAR-004 plasmids of the present invention. It is a diagram showing the structure of.
  • FIGS. 13A to 13C are diagrams illustrating CAR expression through expression of CD3 zeta in anti-c-Met-CAR-expressing T cells of the present invention.
  • FIG. 14 is a diagram confirming the expression of CAR on the surface of anti-c-Met-CAR-expressing T cells of the present invention.
  • 15A to 15F are diagrams illustrating the c-Met expression rates in cancer cell lines A549, PC-3, MCF-7, SKOV3, SK-HEP-1, and Jurkat cells.
  • 16A to 16D are diagrams showing the anti-cancer activity of the anti-c-Met CAR-expressing T cells of the present invention against the A549 cancer cell line.
  • 18A to 18D are diagrams showing the anti-cancer activity of the anti-c-Met CAR-expressing T cells of the present invention against the MCF-7 cancer cell line.
  • 19A to 19D are diagrams showing the anti-cancer activity of the anti-c-Met CAR-expressing T cells of the present invention against the SKOV3 cancer cell line.
  • FIG. 20 is a diagram showing the anti-cancer activity of the anti-c-Met CAR-expressing T cells of the present invention against the SK-HEP-1 cancer cell line.
  • 21A to 21C are diagrams showing the anticancer activity of the anti-c-Met CAR-expressing T cells of the present invention against the Jurkat cell line.
  • % used to indicate the concentration of a specific substance is (weight/weight)% for solids/solids, (weight/volume)% for solids/liquids, and Liquid/liquid is (vol/vol) %.
  • Example 1-1 Anti-c-Met scFv antibody gene preparation
  • Nucleotide sequence of finally selected unique anti-c-Met scFv clones ID Nucleotide sequence SEQ ID NO 1E4-H4k2 CAGGTGCAGCTGGTGCAGTCTGGCGCCGAAGTGAAGAAGCCCGGCTCCTCCGTGAAGGTCTCCTGCCAGGGCTCCGGCTACTCCTTCCCCACCCACTGGATCACCTGGGTGCGACAGGCCCCCGGCCAAGGCCTGGAATGGATGGGCACCATCGACCCCACCGACTCCTACAACTTCTACGGCCCCAGCTTCCAGGGCAGAGTGACCATCACCGCCGACTCCTCCACGTCCACCGCCTACATGGAGCTGTCCTCCCTGAGATCTGAGGACACCGCCATGTACTACTGCGCCAGGGACGGCAACTACTACGACTCCCGGGGCTACTACTACGATACCTTCGACATGTGGGGCCAGGGCACCCTGGTCACCGTCTGGTCAGCCTCAGATCTGGTCACCGTCTGGTCACCGTCTGGTCAGATCTGGTCACCGTCTGGTCACCGTCT
  • the 5'region of the anti-c-Met scFv antibody variable heavy chain (VH) of the present invention includes a BamH I restriction enzyme nucleotide sequence and a CD8 alpha lead sequence (LS), and anti-c-
  • the 3'region of the Met scFv antibody variable light chain (VL) contains Hinge and TM of hCD8alpha, the co-stimulatory domains 4-1BB and CD3 ⁇ -iso2M (modified CD3 ⁇ -iso2) and Xho I restriction enzyme sequences. The base sequence was secured.
  • the obtained nucleotide sequence has the nucleotide sequence of BamH I-hCD8 ⁇ LS-scFv-hCD8 ⁇ hinge-hCD8 ⁇ TM-41BB-CD3 ⁇ -iso2M-Xho I (Table 2), and based on this, c-Met-CAR-001 of SEQ ID NO: 60 ( Figure 1)
  • the structure was synthesized.
  • the synthesized pBHA-c-Met-CAR-001 (FIG. 2) was used to secure another c-Met-CAR structure.
  • LS, Hinge, TM, ICD, co-stimulatory domain and CD3 ⁇ gene sequence ID Nucleotide sequence BamH I-start codon-hCD8a LS GGATCC ATG GCCCTCCCTGTCACCGCCCTGCTGCTTCCGCTGGCTCTTCTGCTCCACGCCGCTCGGCCC ScFv (Table 1) hCD8a hinge ACCACTACCCCAGCACCGAGGCCACCCACCCCGGCTCCTACCATCGCCTCCCAGCCTCTGTCCCTGCGTCCGGAGGCATGTAGACCCGCAGCTGGTGGGGCCGTGCATACCCGGGGTCTTGACTTCGCCTGCGAT hCD8a TM ATCTACATTTGGGCCCCTCTGGCTGGTACTTGCGGGGTCCTGCTGCTTTCACTCGTGATCACTCTTTACTGT 4-1BB AAGCGCGGTCGGAAGAAGCTGCTGTACATCTTTAAGCAACCCTTCATGAGGCCTGTGCAGACTACTCAAGAGGAGGACGGCTGTTCATGCCGGTTCCCAG
  • Example 2-1 Anti-c-Met scFv antibody gene preparation
  • the pBHA-c-Met-CAR-001 obtained through gene synthesis was amplified by PCR using primers SEQ ID NO: 1 (Table 3) and SEQ ID NO: 2 (Table 3) as templates.
  • the primer binding to the 5'region of the anti-c-Met scFv antibody variable heavy chain (VH) has 12 base sequences of hGM-CSF rec. ⁇ (Human GM-CSF receptor alpha-chain), and anti-
  • the primer binding to the 3'region of the variable light chain (VL) of the c-Met scFv antibody has 9 base sequences of the hinge and 3 base sequences of hCD28 pECD
  • the amplified PCR product is hGM-CSF rec. ⁇ -scFv-hinge -hCD28 pECD has the nucleotide sequence (Table 4).
  • the amplified PCR product was used in the next PCR amplification process.
  • GMCSF rec.a LS+1E4-H4k2 scFv (F) CTCCTGATCCCACAGGTGCAGCTGGTG 2 1E4-H4k2 scFv +hinge+hCD28 pECD (R) AATTGCGGCCGCACGTTTGATTTCCAC 3 AS+BamHI+GMCSF rec.a LS(F) CGGGATCCATGCTTCTCCTGGTGACAA 4 GMCSF rec.a LS+1E4-H4k2 scFv(R) CAGCTGCACCTGTGGGATCAGGAGGAA 5 1E4-H4k2 scFv+hinge+CD28 pECD(F) GAAATCAAACGTGCGGCCGCAATTGAA 6 AS+Xho1+CD3- ⁇ (R) CCGCTCGAGTTATTAGCGAGGGGGCAGG 7 3E8 LS+1E4-H4k2
  • Example 2-2 Preparation of signal sequence genes for hGM-CSF receptor alpha-chain
  • LS, Hinge, TM, ICD, co-stimulatory domain and CD3 ⁇ gene sequence ID Nucleotide sequence BamH I-start codon-hGM-CSF rec.a LS GGATCC ATG CTTCTCCTGGTGACAAGCCTTCTGCTCTGTGAGTTACCACACCCAGCATTCCTCCTGATCCCA ScFv (Table 1) hinge GCGGCCGCA hCD28 pECD ATTGAAGTTATGTATCCTCCTCCTTACCTAGACAATGAGAAGAGCAATGGAACCATTATCCATGTGAAAGGGAAACACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCC hCD28 TM TTTTGGGTGCTGGTGGTGGTTGGGGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTG hCD28 ICD AGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCAT
  • Example 2-3 Hinge, TM, ICD, co-stimulatory domain and CD3 ⁇ gene preparation
  • Hinge, pECD of hCD28 and pMT-CAR-001 plasmid (Fig. 3) containing TM, ICD and hCD3 ⁇ -iso2 as a template using primers SEQ ID NO: 5 (Table 3) and SEQ ID NO: 6 (Table 3) PCR method was amplified and used.
  • the primer binding to the 5'site of Hinge has 12 base sequences of the variable light chain (VL) of the anti-c-Met antibody, and the primer binding to the 3'site of CD3 ⁇ -iso2 is the Xho I restriction enzyme sequence.
  • the PCR product amplified by having a scFv-Hinge-hCD28 pECD-hCD28 TM-hCD28 ICD-CD3 ⁇ -iso2-XhoI nucleotide sequence (Table 4). The amplified product was used in the next PCR amplification process.
  • Example 3-1 Anti-c-Met scFv antibody gene preparation
  • the pBHA-cMet-CAR-001 obtained through gene synthesis was amplified by PCR using primers SEQ ID NO: 7 (Table 3) and SEQ ID NO: 8 (Table 3) as templates.
  • the primer binding to the 5'region of the anti-c-Met scFv antibody variable heavy chain (VH) has 12 base sequences of the 3E8 preceding sequence (LS), and the anti-c-Met scFv antibody variable light chain (VL)
  • the primers binding to the 3'site of the hIgD hinge have 12 nucleotide sequences, and the amplified PCR product has the nucleotide sequence of the 3E8 LS-scFv-hIgD hinge (Table 5).
  • the amplified PCR product was used in the next PCR amplification process.
  • Example 3-2 Preparing the preceding sequence (LS) gene of the 3E8 antibody
  • the pMT-CAR-002 plasmid (Fig. 4) containing the preceding sequence (LS) of the 3E8 antibody was amplified by PCR using primers SEQ ID NO: 9 (Table 3) and SEQ ID NO: 10 (Table 3) as a template.
  • the primer binding to the 5'region of the 3E8 preceding sequence (LS) has a BamH I restriction enzyme nucleotide sequence
  • the primer binding to the 3'region of the 3E8 preceding sequence (LS) is an anti-c-Met scFv antibody variable.
  • the PCR product amplified by having 12 base sequences of the heavy chain (VH) has the base sequence of BamH I-3E8 LS-scFv (Table 5). The amplified product was used in the next PCR amplification process.
  • Example 3-3 Hinge, TM, ICD, co-stimulatory domain and CD3 ⁇ gene preparation
  • the primer that binds to the 5'site of the hIgD hinge has 12 base sequences of the anti-c-Met scFv antibody variable light chain (VL), and the primer that binds to the 3'site of CD3 ⁇ -iso1 Xho I restriction enzyme base.
  • the PCR product amplified with the sequence has the scFv-IgD hinge-IgG1 hinge-CH3-CD28 TM-CD28 ICD-OX40-CD3 ⁇ -iso1-Xho I nucleotide sequence (Table 5).
  • the amplified PCR product was used in the next PCR amplification process.
  • Example 4-1 Anti-c-Met scFv antibody gene preparation
  • the pMT-CAR-003 plasmid ( Figure 5) containing the preceding sequence (LS) of the 3E8 antibody was amplified by PCR using primers SEQ ID NO: 9 (Table 3) and SEQ ID NO: 10 (Table 3) as a template and used. .
  • the primer binding to the 5'region of the 3E8 preceding sequence (LS) has a BamH I restriction enzyme nucleotide sequence
  • the primer binding to the 3'region of the 3E8 preceding sequence (LS) is an anti-c-Met scFv antibody variable.
  • the PCR product amplified by having 12 base sequences of the heavy chain (VH) has the base sequence of BamH I-3E8 LS-scFv (Table 6). The amplified product was used in the next PCR amplification process.
  • Example 4-3 Hinge, TM, ICD, co-stimulatory domain and CD3 ⁇ gene preparation
  • the PCR product amplified with the sequence has the scFv-hIgD hinge-CD28 TM-CD28 ICD-OX40-CD3 ⁇ -iso1-Xho I base sequence (Table 6).
  • the amplified PCR product was used in the next PCR amplification process.
  • primers SEQ ID NO: 3 (Table 3) and SEQ ID NO: 2 (Table 3) Using the OE-PCR (overlap extension PCR) method. Primer SEQ ID NO: 3 (Table 3) and SEQ ID NO: 6 (Table 3) was amplified by the OE-PCR method (FIG. 6).
  • the amplified PCR product has a base sequence of BamH I-hGM-CSF rec. ⁇ -scFv-Hinge-hCD28 pECD-hCD28 TM-hCD28 ICD-CD3 ⁇ -iso2-Xho I, and c-Met-CAR- of SEQ ID NO: 61. It has a structure of 002 (Fig. 7).
  • the amplified PCR product was ligated to a pGemT EASY vector (Promega, WI, USA) having multiple T sequences at both ends of the linear DNA to obtain the construct pGemT-c-Met-CAR-002, which was the same as the original sequence through sequencing. Was confirmed.
  • primers SEQ ID NOs: 13 and 14 were used.
  • the amplified PCR products BamH I-3E8 LS-scFv and 3E8 LS-scFv-hIgD hinge were amplified by the OE-PCR method using primers SEQ ID NO: 9 (Table 3) and SEQ ID NO: 8 (Table 3) as templates.
  • the amplified PCR products, BamH I-3E8 LS-scFv-hIgD hinge and scFv-IgD hinge-IgG1 hinge-CH3-CD28 TM-CD28 ICD-OX40-CD3 ⁇ -iso1-Xho I were used as template primers SEQ ID NO: 9 (Table 3).
  • SEQ ID NO: 12 (Table 3) were amplified by the OE-PCR method (FIG. 8).
  • the amplified PCR product has a base sequence of BamH I-3E8 LS-scFv-hIgD hinge-IgG1 hinge-CH3-CD28 TM-CD28 ICD-OX40-CD3 ⁇ -iso1-Xho I, and c-Met-CAR of SEQ ID NO: 62 It has a structure of -003 (Fig. 9).
  • the amplified PCR product was ligated to a pGemT EASY vector having multiple T sequences at both ends of the linear DNA to obtain the construct pGemT-c-Met-CAR-003, and it was confirmed that it is the same as the original sequence through sequencing.
  • primers SEQ ID NOs: 13 and 14 were used for sequence analysis.
  • the amplified PCR products BamH I-3E8 LS-scFv and 3E8 LS-scFv-hIgD hinge were amplified by the OE-PCR method using primers SEQ ID NO: 9 (Table 3) and SEQ ID NO: 8 (Table 3) as templates.
  • the amplified PCR products, BamH I-3E8 LS-scFv-hIgD hinge and scFv-IgD hinge-CD28 TM-CD28 ICD-OX40-CD3 ⁇ -iso1-Xho I were used as template primers SEQ ID NO: 9 (Table 3) and SEQ ID NO: 12. It was amplified by the OE-PCR method using (Table 3) (FIG. 10).
  • the amplified PCR product has a base sequence of BamH I-3E8 LS-scFv-IgD hinge-CD28 TM-CD28 ICD-OX40-CD3 ⁇ -iso1-Xho I, and has the structure of c-Met-CAR-004 of SEQ ID NO: 63. Will have (Fig. 11).
  • the amplified PCR product was ligated to a pGemT EASY vector having multiple T sequences at both ends of the linear DNA to obtain the construct pGemT-c-Met-CAR-004, and it was confirmed that it is the same as the original sequence through sequencing.
  • primers SEQ ID NOs: 13 and 14 were used for sequence analysis.
  • Retroviruses for the delivery of the Anti-c-Met-CAR gene were constructed using plasmid DNA transformation (Soneoka Y et al., 1995).
  • a TransIT 293 transformation system (Mirus Bio LLC, WI, USA) was used and performed according to the manufacturer's protocol.
  • Four types of pMT-c-Met-CAR retrovirus vector, gag-pol expression vector, and RD114 env expression vector were transformed into 293T cell lines seeded with 1 ⁇ 10 6 cells on a 60 mm dish the day before, and then the cells were cultured for about 48 hours. . After completion of the culture, all the cell culture solutions were harvested, filtered using a 0.45 ⁇ m filter, and stored frozen at -80°C until use.
  • the four anti-c-Met-CAR retroviruses produced were used after titers were measured by real-time PCR using a retrovirus titer set kit (TaKaRa, JAPAN).
  • Mononuclear cells were obtained from the donated human blood using SepMate TM -50 (STEMCELL) and Ficoll-Paque PLUS (GE healthcare, Sweden).
  • AIMV medium Invitrogen
  • 1x10 7 pieces were dispensed into a 100 mm dish, and then 50 ng per mL of anti-CD3 (OKT3, eBioscience) antibody was added to the T cells.
  • Activated for the growth of T cells, human IL-2 (R&D) was added to the culture medium and cultured with 300 U per mL. After 48 hours incubation, activated T cells were harvested and used for delivery of four anti-c-Met-CAR retroviruses.
  • Retronectin (retronectin, TaKaRa, Japan) prepared at a concentration of 10 ug/mL in a 6 well plate was added 2 mL per well and then reacted at room temperature for 2 hours to coat the plate. After the reaction, retronectin was removed, 2 mL of PBS (phosphate-buffered saline) containing 2.5% human albumin was added per well, followed by reaction at room temperature for 30 minutes to block. After the reaction, the solution used for blocking was removed, and 3 mL of HBSS containing 2.5% 1M HEPES was added per well and washed.
  • PBS phosphate-buffered saline
  • Anti-c-Met-CAR retrovirus was diluted with AIMV medium containing 5% human serum at 3x10 10 copies per well, added 4 mL, and centrifuged at 2000xg at 32°C for 2 hours to transfer retrovirus to retronectin. Fixed. The same amount of the medium used for retrovirus dilution was added to the well to be used as a control. After the reaction, the retrovirus was removed, and the activated T cells were added at 2 ⁇ 10 6 per well, followed by centrifugation at 1000xg for 15 minutes to deliver the anti-c-Met-CAR retrovirus to the T cells. In order to increase the delivery efficiency, the delivery process was repeated once more the next day, and a total of 2 times were performed.
  • T cells were harvested and subcultured in a T flask at 5 ⁇ 10 5 cells per mL with AIMV medium containing 5% human serum and 300 U/mL human IL-2. It was subcultured at intervals of 3 to 4 days at 5 ⁇ 10 5 per mL, and maintained not to exceed 2x10 6 per mL.
  • anti-c-Met-CAR expression T activated T cells
  • 2 ⁇ 10 6 cells were harvested to extract protein, and the extracted protein was quantified by Bradford analysis, mixed with 4x sample buffer (Invitrogen) and Dithiothreitol, and boiled at 95° C. for 5 minutes for reduction treatment.
  • Anti-c-Met-CAR expression was confirmed by Western blot method.
  • the primary antibody used for expression confirmation was attached to CD3 ⁇ with mouse anti-human CD247 (BD, CA, USA), and goat anti-mouse IgG (H+L)-HRP (Thermo, USA) was used as the secondary antibody.
  • Western blot results in four anti-c-Met-CAR-expressing T cells bands were identified at 50-80 KDa positions, respectively, confirming that anti-c-Met-CAR was well expressed (Figs. 13A to 13A). 13c).
  • Example 8 In vitro ( In vitro ) Anti-c-Met-CAR expression T cells
  • Example 8-1 Confirmation of c-Met expression rate in target cells
  • A549 a human lung cancer cell line, is known to highly express c-Met, so it is a suitable cell line for confirming the anti-cancer activity of anti-c-Met-CAR-expressing T cells.
  • A549 cell lines were prepared in 100 uL of PBS in 5 ⁇ 10 5 cells, and 1 ug of 1E4-H4k2 antibody was added, followed by reaction at 4° C. for 30 minutes. After the reaction, the cells were washed twice with PBS, and then 2 uL of goat anti-human IgG-PE (Southern Biotech) was added and reacted at 4° C. for 30 minutes. After the reaction, the cells were washed twice with PBS, and c-Met expression was confirmed using flow cytometry.
  • a c-Met expression rate of about 83.9% was confirmed in A549 cancer cells.
  • c-Met from human prostate cancer cell line PC-3 and human breast cancer cell line MCF-7, ovarian cancer cell line SKOV3, human acute T-cell leukemia cell line Jurkat, and human liver cancer cell line SK-HEP-1.
  • PC-3 about 66.0% in PC-3, about 66.0% in SKOV3, about 99.9% in SK-HEP-1, and about 2.37% in Jurkat.
  • Example 8-2 Confirmation of anticancer activity using CellTox steamed green dye
  • CellToxTM Green dye was used to confirm the anticancer activity of anti-c-Met-CAR-expressing T cells (effector cells, E) against target cells (target cells, T).
  • CellToxTM Green dye is a dye that attaches to DNA released from dead cells and exhibits fluorescence. It is used to confirm anticancer activity (cytotoxicity).
  • the target cells were prepared in 50 uL of culture medium at 1 ⁇ 10 4 cells, and 0.2 uL of CellToxTM Green dye was added to the black 96 well plate.
  • a well containing only target cells was prepared to correct the low control (spontaneous DNA release) value, and a high control (maximum DNA release) value was corrected by adding a lysis solution to the well containing only target cells.
  • the killing ability for the target cells was calculated by the following equation.
  • Cytotoxicity(%) ⁇ (response value of target cells and effector cells)-(response value of effector cells) ⁇ -(Low control)/(High control-Low control) X 100
  • the anticancer activity of the 4 types of c-Met-CAR-001, -002, -003, -004-expressing T cells against A549 cancer cells was compared to the control group, which is a T cell that does not express anti-c-Met-CAR. It was confirmed that it was higher than that (FIG. 16).
  • the killing ability against SKOV3 cancer cells was confirmed. It was confirmed that the anticancer activity of c-Met-CAR-001, 002, -003, -004-expressing T cells against SKOV3 cancer cells was higher than that of the control group, which is a T cell that does not express anti-c-Met-CAR (Fig. 19).
  • the killing ability against Jurkat was confirmed.
  • the killing ability of c-Met-CAR-001, -002, -003, -004-expressing T cells using a Jurkat expressing low c-Met little killing ability was observed against Jurkat.
  • the anti-c-Met-CAR-expressing T cells have specific killing ability only for cells that highly express c-Met (FIG. 21).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hematology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Developmental Biology & Embryology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/KR2020/013127 2019-09-26 2020-09-25 항-c-met 항체 또는 그의 항원 결합 단편을 포함하는 키메라 항원 수용체, 및 이의 용도 Ceased WO2021060932A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CN202080067658.8A CN114450407A (zh) 2019-09-26 2020-09-25 包含抗-间质表皮转化因子抗体或其抗原结合片段的嵌合抗原受体及其用途
US17/763,712 US12570719B2 (en) 2019-09-26 2020-09-25 Chimeric antigen receptor comprising anti c-met antibody or antigen binding fragment thereof, and use thereof
JP2022519423A JP7373242B2 (ja) 2019-09-26 2020-09-25 抗c-met抗体又はその抗原結合断片を含むキメラ抗原受容体、及びその用途
EP20868836.6A EP4039703A4 (en) 2019-09-26 2020-09-25 Chimeric antigen receptor comprising anti c-met antibody or antigen binding fragment thereof, and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0119148 2019-09-26
KR1020190119148A KR102685211B1 (ko) 2019-09-26 2019-09-26 항-c-Met 항체 또는 그의 항원 결합 단편을 포함하는 키메라 항원 수용체, 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2021060932A1 true WO2021060932A1 (ko) 2021-04-01

Family

ID=75164878

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/013127 Ceased WO2021060932A1 (ko) 2019-09-26 2020-09-25 항-c-met 항체 또는 그의 항원 결합 단편을 포함하는 키메라 항원 수용체, 및 이의 용도

Country Status (6)

Country Link
US (1) US12570719B2 (https=)
EP (1) EP4039703A4 (https=)
JP (1) JP7373242B2 (https=)
KR (1) KR102685211B1 (https=)
CN (1) CN114450407A (https=)
WO (1) WO2021060932A1 (https=)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4554101A (en) 1981-01-09 1985-11-19 New York Blood Center, Inc. Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity
US6451595B1 (en) 1998-06-26 2002-09-17 Viromed Limited High efficiency retroviral vectors that contain none of viral coding sequences
KR20160017918A (ko) * 2014-08-07 2016-02-17 주식회사 파멥신 c-Met 특이적 인간 항체 및 그 제조방법
CN106008721A (zh) * 2016-08-09 2016-10-12 安徽未名细胞治疗有限公司 一种c-Met特异性嵌合抗原受体及其应用
CN108341881A (zh) * 2018-01-31 2018-07-31 深圳市默赛尔生物医学科技发展有限公司 带安全开关的嵌合抗原受体及其表达基因、其修饰的nk细胞及应用
KR20180102116A (ko) * 2016-02-05 2018-09-14 주식회사 바이로메드 항―c―MET 항체 및 이의 용도
CN108707198A (zh) * 2018-06-28 2018-10-26 李永海 识别人c-Met蛋白的人源单链抗体、诊断试剂及其CAR-T细胞制剂
KR20190119148A (ko) 2017-03-09 2019-10-21 어플라이드 머티어리얼스, 인코포레이티드 회전 다각형 및 제2 반사 부재를 갖는 에너지 전달 시스템을 이용한 적층 제조

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PH12013501201A1 (en) * 2010-12-09 2013-07-29 Univ Pennsylvania Use of chimeric antigen receptor-modified t cells to treat cancer
KR102042174B1 (ko) * 2013-03-29 2019-11-08 삼성전자주식회사 인간화 및 친화도 성숙된 항 c-Met 항체 및 그의 용도
CN109153975A (zh) * 2015-12-28 2019-01-04 诺华股份有限公司 制备嵌合抗原受体表达细胞的方法
CN109422815A (zh) 2017-08-28 2019-03-05 复旦大学 双特异性嵌合抗原受体c-Met/PD-1 scFv-CAR-T及其构建方法和应用
KR102353568B1 (ko) 2018-11-14 2022-01-20 주식회사 헬릭스미스 안정성이 향상된 항 c-Met 항체 또는 그의 항원 결합 단편
KR102077987B1 (ko) * 2018-12-19 2020-02-17 주식회사 헬릭스미스 신장 질환 진단용 바이오 마커
US11866493B2 (en) 2019-11-01 2024-01-09 East Tennessee State University Research Foundation Single-chain variable fragment of Met monoclonal antibody and methods of use in CAR T cell therapy

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4554101A (en) 1981-01-09 1985-11-19 New York Blood Center, Inc. Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity
US6451595B1 (en) 1998-06-26 2002-09-17 Viromed Limited High efficiency retroviral vectors that contain none of viral coding sequences
KR20160017918A (ko) * 2014-08-07 2016-02-17 주식회사 파멥신 c-Met 특이적 인간 항체 및 그 제조방법
KR20180102116A (ko) * 2016-02-05 2018-09-14 주식회사 바이로메드 항―c―MET 항체 및 이의 용도
CN106008721A (zh) * 2016-08-09 2016-10-12 安徽未名细胞治疗有限公司 一种c-Met特异性嵌合抗原受体及其应用
KR20190119148A (ko) 2017-03-09 2019-10-21 어플라이드 머티어리얼스, 인코포레이티드 회전 다각형 및 제2 반사 부재를 갖는 에너지 전달 시스템을 이용한 적층 제조
CN108341881A (zh) * 2018-01-31 2018-07-31 深圳市默赛尔生物医学科技发展有限公司 带安全开关的嵌合抗原受体及其表达基因、其修饰的nk细胞及应用
CN108707198A (zh) * 2018-06-28 2018-10-26 李永海 识别人c-Met蛋白的人源单链抗体、诊断试剂及其CAR-T细胞制剂

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
"Cellular and Molecular Immunology", 1991, W. B. SAUNDERS CO. PHILADELPHIA, pages: 41 - 50
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 10
CORPET ET AL., NUC. ACIDS RES., vol. 16, 1988, pages 10881 - 90
DEAN ET AL., NATURE, vol. 4, no. 318, 1985, pages 6044
H. NEURATHR. L. HILL: "The Proteins", 1979, ACADEMIC PRESS
HIGGINSSHARP, CABIOS, vol. 5, 1989, pages 151 - 3
HIGGINSSHARP, GENE, vol. 73, 1988, pages 237 - 44
HUANG ET AL., COMP. APPL. BIOSCI., vol. 8, 1992, pages 155 - 65
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1987, NATIONAL INSTITUTES OF HEALTH
MAGGIORA ET AL., J. CELL PHYSIOL., vol. 173, 1997, pages 183
NEEDLEMANWUNSCH, J. MOL. BIO., vol. 48, 1970, pages 443
NISONOFF, A.: "Introduction to Molecular Immunology", vol. 4, 1984, SINAUER ASSOCIATES, INC., pages: 45 - 65
PARK ET AL., PNAS, vol. 84, no. 18, 1976, pages 6379
PEARSON ET AL., METH. MOL. BIOL., vol. 24, 1994, pages 307 - 31
PEARSONLIPMAN, METHODS IN MOL. BIOL., vol. 24, 1988, pages 307 - 31
ROSENBERG ET AL., NEW ENG. J. OF MED., vol. 319, 1988, pages 1676
SCHEIT: "Nucleotide Analogs", 1980, JOHN WILEY
See also references of EP4039703A4
SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482
UHLMANPEYMAN, CHEMICAL REVIEWS, vol. 90, 1990, pages 543 - 584

Also Published As

Publication number Publication date
EP4039703A1 (en) 2022-08-10
EP4039703A4 (en) 2023-07-19
CN114450407A (zh) 2022-05-06
KR102685211B1 (ko) 2024-07-16
KR20210036742A (ko) 2021-04-05
US12570719B2 (en) 2026-03-10
JP7373242B2 (ja) 2023-11-02
JP2022550120A (ja) 2022-11-30
US20220362298A1 (en) 2022-11-17

Similar Documents

Publication Publication Date Title
WO2019098682A1 (ko) 항-her2 항체 또는 그의 항원 결합 단편, 및 이를 포함하는 키메라 항원 수용체
WO2021235894A1 (en) Anti-HER2 Antibody or Antigen-binding Fragment thereof, and Chimeric Antigen Receptor Comprising Same
WO2018124766A9 (ko) 키메라 항원 수용체 및 이를 발현하는 자연 살해 세포
WO2019112347A2 (ko) 악성 b 세포를 특이적으로 인지하는 항체 또는 그의 항원 결합 단편, 이를 포함하는 키메라 항원 수용체 및 이의 용도
US20220348689A1 (en) ADOPTIVE T-CELL THERAPY USING EMPD-SPECIFIC CHIMERIC ANTIGEN RECEPTORS FOR TREATING lgE-MEDIATED ALLERGIC DISEASES
WO2021256724A1 (ko) Bcma를 표적으로 하는 키메라 항원 수용체 및 이의 용도
WO2020080908A1 (ko) 항-l1cam 항체 또는 그의 항원결합 단편, 및 이를 포함하는 키메라 항원 수용체
WO2020153605A1 (ko) 메소텔린 특이적인 키메라 항원 수용체 및 이를 발현하는 t 세포
WO2022025638A1 (ko) 면역시냅스를 안정화시키는 키메라 항원 수용체(car) t 세포
WO2019203600A1 (ko) 스위치 분자 및 스위처블 키메라 항원 수용체
WO2021235697A1 (ko) Cd22에 특이적인 항체 및 이의 용도
CN113474368A (zh) 新型多肽
IL320155A (en) Novel cd19 binders, car-t constructs comprising the same, and methods of using the same
WO2022030730A1 (ko) 메소텔린에 특이적으로 결합하는 항-메소텔린 키메릭 항원 수용체
WO2022231298A1 (ko) 신규한 항-cd5 키메릭 항원 수용체 및 이를 발현하는 면역세포
WO2021210939A1 (ko) 항-her2 어피바디 및 이를 스위치 분자로 이용하는 스위처블 키메라 항원 수용체
WO2021235696A1 (ko) Cd22에 특이적인 항체 및 이의 용도
CA3233084A1 (en) Fusion protein dimer comprising pd-1 and il-21, and use thereof
WO2019125070A1 (ko) 악성 b 세포를 특이적으로 인지하는 항체 또는 그의 항원 결합 단편, 이를 포함하는 키메라 항원 수용체 및 이의 용도
WO2022220433A1 (ko) Programmed death-ligand 1(pd-l1)에 특이적으로 결합하는 키메릭 항원 수용체 및 이의 용도
WO2021060932A1 (ko) 항-c-met 항체 또는 그의 항원 결합 단편을 포함하는 키메라 항원 수용체, 및 이의 용도
WO2024049161A1 (ko) 신규한 항-pd-l1 키메릭 항원 수용체 및 이를 발현하는 면역세포
WO2024076121A1 (ko) Cd5를 표적하는 키메라 항원 수용체 및 이를 발현하는 면역세포
CN120981484A (zh) 抗entpd3嵌合抗原受体
WO2023191526A1 (ko) Cd30 유래의 세포내 신호전달 도메인을 포함하는 키메라 항원 수용체, 이를 발현하는 면역세포 및 이들의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20868836

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022519423

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020868836

Country of ref document: EP

Effective date: 20220426

WWG Wipo information: grant in national office

Ref document number: 17763712

Country of ref document: US