WO2020004924A1 - 신규한 트라우즈토카이트리움 속 균주, 및 이를 이용한 다중불포화지방산 생산방법 - Google Patents

신규한 트라우즈토카이트리움 속 균주, 및 이를 이용한 다중불포화지방산 생산방법 Download PDF

Info

Publication number
WO2020004924A1
WO2020004924A1 PCT/KR2019/007697 KR2019007697W WO2020004924A1 WO 2020004924 A1 WO2020004924 A1 WO 2020004924A1 KR 2019007697 W KR2019007697 W KR 2019007697W WO 2020004924 A1 WO2020004924 A1 WO 2020004924A1
Authority
WO
WIPO (PCT)
Prior art keywords
microalgae
genus
cjm01
docosahexaenoic acid
present application
Prior art date
Application number
PCT/KR2019/007697
Other languages
English (en)
French (fr)
Inventor
김지영
박명근
박혜민
최정운
박상민
배상영
장진숙
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to EP19825193.6A priority Critical patent/EP3760705B1/en
Priority to CN201980026079.6A priority patent/CN112513247B/zh
Priority to ES19825193T priority patent/ES2932536T3/es
Priority to CA3095279A priority patent/CA3095279C/en
Priority to AU2019292277A priority patent/AU2019292277B2/en
Priority to US16/971,713 priority patent/US11773417B2/en
Priority to RU2020128068A priority patent/RU2754686C1/ru
Priority to MYPI2020004539A priority patent/MY194114A/en
Priority to FIEP19825193.6T priority patent/FI3760705T3/fi
Priority to BR112020019053A priority patent/BR112020019053B8/pt
Priority to DK19825193.6T priority patent/DK3760705T5/da
Priority to JP2020545479A priority patent/JP6947941B2/ja
Publication of WO2020004924A1 publication Critical patent/WO2020004924A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C12P7/6434—Docosahexenoic acids [DHA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/12—Unicellular algae; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/12—Unicellular algae; Culture media therefor
    • C12N1/125—Unicellular algae isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/89—Algae ; Processes using algae
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/30—Fuel from waste, e.g. synthetic alcohol or diesel

Definitions

  • the present application relates to a novel Thraustochytrium genus strain containing a high content of polyunsaturated fatty acids and biomass produced therefrom, and a method for producing lipids and polyunsaturated fatty acids comprising the same.
  • Docosahexaenoic acid a polyunsaturated fatty acid
  • DHA Docosahexaenoic acid
  • a polyunsaturated fatty acid is an essential fatty acid for the brain, eye tissue, and nervous system, and is known to play an important role in the development of vision and motor neuron capacity in children, especially in dementia brains.
  • DHA can also be used as a fish feed additive (Korean Patent Publication 10-2007-0040751).
  • the World Health Organization requires more than 1g of DHA-containing polyunsaturated fatty acids per day. It is recommended that you take steadily.
  • sources of DHA polyunsaturated fatty acids are deep-sea fish that occupy the top of the marine ecosystem, such as tuna and salmon.
  • pollutants such as mercury, heavy metals, environmental hormones, and radioactive substances in the body of deep sea fish. Therefore, microalgae in the Traztochitrium are of great industrial value as a new means of supplying DHA polyunsaturated fatty acid oil safely and stably.
  • the present inventors have mutated KC01 microalgae of the genus Trouttochitrium to develop microalgae with improved docosahexaenoic acid content and productivity, and by culturing the microalgae, biomass containing lipids containing docosahexaenoic acid and This application was completed by establishing a biooil production method.
  • One object of the present application is to provide a Thraustochytrium genus CJM01 microalgae (Accession No .: KCTC 13538BP) with increased docosahexaenoic acid (DHA) production and reduced amino acid production compared to wild type. will be.
  • Another object of the present application is to incubate the CJM01 microalgae of the genus Trozutochitrium; And recovering the docosahexaenoic acid (DHA) -containing biomass from the microalgae, its culture, its dried product or its crushed product.
  • DHA docosahexaenoic acid
  • Another object of the present application is to incubate the CJM01 microalgae of the genus Trozutochitrium; And recovering docosahexaenoic acid (DHA) -containing lipids from the microalgae, cultures thereof, dried products or lysates thereof.
  • DHA docosahexaenoic acid
  • the CJM01 microalgae of the novel Traztochitrium genus of the present application have a marked decrease in amino acid production, high fat content and high content of unsaturated fatty acids such as docosahexaenoic acid in biomass, and are produced by themselves or by culture and fermentation. Biomass, concentrates and dried products of the biomass are very useful as feed compositions.
  • FIG. 1 is a view showing photographs of a Thraustochytrium Genus KC01 strain observed with an optical microscope.
  • Figure 2 shows the phylogenetic tree between the Thraustochytrium Genus KC01 strain, the Thraustochytrium genus strain, the Aurantiochytrium genus strain and the Schizochytrium genus strain Drawing.
  • One aspect of the present application for achieving the above object provides a Thraustochytrium genus CJM01 microalgae with increased docosahexaenoic acid (DHA) production and reduced amino acid production compared to wild type .
  • DHA docosahexaenoic acid
  • Thraustochytrid genus strain is an organic heterotrophic microalgae, which contains a high concentration of various polyunsaturated fatty acids including docosahexaenoic acid (DHA). Plays an important role as a source of triacylglycerol.
  • DHA docosahexaenoic acid
  • microalgae is a chlorophyll, photosynthetic plants that are not visible to the naked eye can be seen only through the microscope and living freely floating in the water, also called phytoplankton (Phytoplankton).
  • the wild-type Trazutochitrium KC01 strain is irradiated with gamma rays to generate mutations, and among the mutant strains, strains for which the production capacity of the polyunsaturated fatty acid-containing oils are selected are selected, and this is a genus of Thraustochytrium genus) CJM01, and was deposited on May 30, 2018 at the Korea Collection for Type Cultures (KCTC), an international depository under the Treaty of Budapest, and assigned accession number KCTC 13538BP.
  • KCTC Collection for Type Cultures
  • the CJM01 microalgae of the genus Trazutochitrium of the present application may have an 18s rRNA sequence of SEQ ID NO: 1, but is not limited thereto.
  • DHA docosahexaenoic acid
  • EPA eicosapentaenoic acid
  • ALA alpha-linolenic acid
  • the CJM01 microalgae of the genus Trouttochitrium of the present application may include a large amount of docosahexaenoic acid as compared to the parent strain of Traztochitrium genus KC01, and in detail, based on the total weight of fatty acids included in the microalgae 30 To 65 weight percent, 30 to 60 weight percent. 40 to 65% by weight or 40 to 60% by weight of docosahexaenoic acid may be included, but is not limited thereto.
  • CJM01 microalgae of the genus Trozutochitrium of the present application may be an improved productivity of docosahexaenoic acid compared to the parent strain of Truztochitrium KC01, the productivity of the docosahexaenoic acid produced for 1 hour It can be measured by concentration (g / L).
  • the microalgae of the present application are 0.4 to 0.8 (g / l / h), 0.4 to 0.7 (g / l / h), 0.5 to 0.8 (g / l / h) or 0.5 to 0.7 (g / l / h) may have a productivity of docosahexaenoic acid, but is not limited thereto.
  • CJM01 microalgae of the genus Trozutochitrium of the present application may be a decrease in the amount of amino acid production compared to KC01 of the genus Truztochitrium.
  • the CJM01 microalgae or the culture medium of the genus Trozutochitrium of the present application is aspartate, serine, glutamate, glycine, alanine, valine, methionine, isoleucine, leucine, tyrosine, phenylalanine, lysine, and arginine. It may not comprise at least one or more amino acids selected from.
  • Example 2 aspartate, serine, glutamate, glycine, alanine, methionine, isoleucine, leucine, tyrosine, phenylalanine, lysine in the culture solution of CJM01 microalgae of the genus Trozutochitrium of the present application , And arginine may not be detected.
  • the total amino acid production of CJM01 microalgae in the Trujth tochitrium of the present application may be reduced by at least 90%, at least 95%, at least 97%, or at least 99% relative to the parent strain of Traztochitrium KC01.
  • the CJM01 strain more effectively uses the carbon source supplied compared to the KC01 parent strain in the docosahexaenoic acid biosynthesis pathway.
  • the culture medium of the strain is 0.1-20 mg / L, 0.1-15 mg / L or less, 0.1-10 mg / L or less, Or 0.1 to 7 mg / L or 0.1 to 5 mg / L of amino acids only.
  • Another embodiment of the present application comprises the steps of culturing the CJM01 microalgae of the genus Trozutochitrium; And recovering a biomass including docosahexaenoic acid (DHA) from the microalgae, its culture, its dried product or its crushed product.
  • DHA docosahexaenoic acid
  • the biomass may be in the form of dry cells, but is not limited thereto.
  • the present application provides a biomass produced by the above method.
  • the biomass is 15 to 40% by weight based on the total weight.
  • 20 to 35% by weight or 25 to 30% by weight of docosahexaenoic acid may be included, but is not limited thereto.
  • Another embodiment of the present application is a step of culturing the CJM01 microalgae of the genus Trozutochitrium, and recovering docosahexaenoic acid (DHA) containing lipids from the microalgae, cultures thereof, dried products or lysate thereof It provides a bio-oil manufacturing method comprising the step of.
  • DHA docosahexaenoic acid
  • the present application provides a biooil produced by the above method.
  • the biooil is 30 to 65% by weight, 30 to 60% by weight based on the total weight of fatty acids.
  • 40 to 65% by weight or 40 to 60% by weight of docosahexaenoic acid may be included, but is not limited thereto.
  • the bio-oil production method of the present application comprises the steps of culturing the CJM01 microalgae of the genus Trozutochitrium; Preparing a biomass comprising docosahexaenoic acid (DHA) from the microalgae, its culture, its dried product or its lysate; And recovering a lipid containing docosahexaenoic acid (DHA) from the prepared biomass, but is not limited thereto.
  • DHA docosahexaenoic acid
  • biooil is obtained from biomass by biological, thermochemical and physicochemical extraction processes, and the biooil prepared in the present application may include polyunsaturated fatty acid, and specifically, docosahexaenoic acid. It may contain, but is not limited thereto.
  • biomass refers to an energy source of bioenergy, that is, organisms such as plants, animals, and microorganisms that can be used as chemical energy, and ecologically refers to a weight or energy amount of a specific organism present in unit time and space. It also means.
  • the biomass may contain extracellular materials as well as cells and / or intracellular contents, including but not limited to compounds secreted by cells.
  • the biomass may be a CJM01 microalgae in Traztochitrium per se, a culture thereof, a dried product thereof, a lysate thereof, or a product produced by culturing or fermenting the microalgae, or a concentrate of the biomass. Or dry matter, but is not limited thereto.
  • the culture of CJM01 microalgae of the genus Truztochitrium refers to a product produced by culturing the algae, and specifically, may be a culture solution including the microalgae or a culture medium from which the microalgae is removed, but is not limited thereto. It doesn't happen.
  • the dried product of the CJM01 microalgae of the genus Truztochitrium is water that is removed from the microalgae, and may be specifically in the form of dry cells, but is not limited thereto.
  • CJM01 microalgae crushed genus Trozutochitrium of the present application is a generic term for the result of crushing the microalgae, it may be a supernatant or pellet of the crushed microalgae, but is not limited thereto.
  • CJM01 microalgae of the present genus Trazutochitrium itself, its culture, its dried product or its lysate contain docosahexaenoic acid, from which biomass or biooil can be prepared.
  • Cultivation in the present application means to grow the microalgae in moderately controlled environmental conditions. Cultivation process of the present application may be made according to suitable media and culture conditions known in the art. This culture process can be easily adjusted and used by those skilled in the art according to the microalgae selected.
  • the culture of the CJM01 microalgae of the genus Trozutochitrium of the present application may be performed under heterotrophic conditions, but is not limited thereto.
  • dependent nutrition is a nutritional form that relies on organic materials obtained from in vitro sources of energy (nutrients) and is a term corresponding to independent nutrition.
  • CJM01 microalgae of the genus Trozutochitrium of the present application can increase the content and productivity of docosahexaenoic acid through optimizing the medium composition of the carbon source or nitrogen source under heterotrophic conditions.
  • the term 'dependent nutrition' in the present application may be used interchangeably with 'cancer culture'.
  • the step of culturing the microalgae is not particularly limited, but may be performed by known batch culture method, continuous culture method, fed-batch culture method and the like.
  • the medium and other culture conditions used for culturing the microalgae of the present application may be any medium as long as it is a medium used for the cultivation of a conventional microalgae, but specifically, the microalgae of the present application may be a suitable carbon source, nitrogen source,
  • the culture may be carried out under aerobic conditions by adjusting the temperature, pH, and the like in a conventional medium containing phosphorus, inorganic compounds, amino acids, and / or vitamins.
  • an appropriate pH e.g. pH 5 to 9, specifically pH 6 to 8, most specifically PH 6.8 can be adjusted, but is not limited thereto.
  • oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen, or carbon dioxide gas may be injected without injecting gas or to maintain anaerobic and unaerobic states. It is not limited.
  • the culture temperature may be maintained at 20 to 45 °C, specifically 25 to 40 °C, it may be incubated for about 10 to 160 hours, but is not limited thereto.
  • an antifoaming agent such as fatty acid polyglycol esters, may be used during the culturing to suppress bubble generation, but is not limited thereto.
  • Truztochitrium of the present application can be carried out using a medium containing a carbon source and a nitrogen source.
  • the term "medium" in the present application means a culture medium to be cultured the microalgae of the present application and / or a product obtained after the culture.
  • the medium is a concept including both the form containing the microalgae and the form of removing the microalgae by centrifugation, filtration, etc. in the culture medium containing the microalgae.
  • the culture medium used in the present application is a source of sugar and carbohydrates (e.g. glucose, sucrose, lactose, fructose, galactose, mannose, maltose, arabinose, xylose, molasses, starch and cellulose ), Fats and fats (such as soybean oil, sunflower seed oil, peanut oil and coconut oil), fatty acids (such as palmitic acid, stearic acid and linoleic acid), alcohols (such as glycerol and ethanol) and organic acids (such as acetic acid) Etc. may be used individually or in combination.
  • sugar and carbohydrates e.g. glucose, sucrose, lactose, fructose, galactose, mannose, maltose, arabinose, xylose, molasses, starch and cellulose
  • Fats and fats such as soybean oil, sunflower seed oil, peanut oil and coconut oil
  • fatty acids such as palmitic acid, stearic acid and lino
  • the carbon source is one selected from the group consisting of glucose, fructose, maltose, galactose, mannose, sucrose, arabinose, xylose and glycerol It may be more than, but is not limited to the carbon source used to culture the microalgae.
  • the culture medium used in the present application is a glucose of 10 to 50 g / L, 10 to 40 g / L, 20 to 50 g / L, 20 to 40 g / L or 25 to 35 g / L concentration as a carbon source May be included, but is not limited thereto.
  • the nitrogen source of the culture medium used in the present application may be classified as an organic nitrogen source or an inorganic nitrogen source, but may be used individually or in combination with an organic nitrogen source or an inorganic nitrogen source.
  • the nitrogen source is an organic nitrogen source or ammonium acetate, ammonium nitrate, ammonium chloride, ammonium sulfate or sodium nitrate selected from the group consisting of yeast extract, beef extract, peptone and tryptone. . It may be a mineral nitrogen source selected from the group consisting of urea and MSG (Monosodium glutamate).
  • the culture medium used in the present application may include yeast extract, ammonium sulfate, sodium nitrate and MSG as an example of a nitrogen source, but is not limited thereto as long as it is a nitrogen source used to culture microalgae.
  • the yeast extract is 0.1 to 10 g / L, 0.5 to 10 g / L, 0.5 to 7 g / L, 0.5 to 5 g / L, 0.5 to 3 g / L, 0.5 to 2 g / L in the medium Or 0.5 to 1.5 g / L, and the ammonium sulfate may be included in the medium at a concentration of 1 to 5 g / L, 1 to 4 g / L, 2 to 5 g / L, and 2 to 4 g / L.
  • the sodium nitrate is in the medium 0.1 to 10 g / L, 0.5 to 9 g / L, 1 to 9 g / L, 2 to 9 g / L, 3 to 9 g / L, 5 to 9 g / L Or it may be included in a concentration of 7 to 9 g / L, the MSG may be included in the concentration of 0.1 to 2 g / L, 0.1 to 1.5 g / L, 0.5 to 2 g / L, 0.5 to 1.5 g / L concentration
  • the present invention is not limited thereto.
  • CJM01 strain has no ammonia inhibition and can be grown at a wide salt concentration, so that the carbon source and nitrogen source can be properly adjusted in the medium in consideration of this.
  • the culture medium used in the present application may be used individually or in combination with potassium dihydrogen phosphate, dipotassium hydrogen phosphate, a corresponding sodium-containing salt, and the like as a phosphorus source, but is not limited thereto.
  • the medium may also contain essential growth-promoting substances such as other metal salts (eg magnesium sulfate or iron sulfate), amino acids and vitamins.
  • Recovering the biomass from the microalgae, the culture produced therefrom, the dried product or the lysate thereof cultured in the culturing step of the present application may collect the desired biomass using a suitable method known in the art. have.
  • the step of recovering the docosahexaenoic acid produced in the culture step of the present application is the desired docosahexaenoic acid from the microalgae itself or its culture using a suitable method known in the art according to the culture method.
  • centrifugation, filtration, anion exchange chromatography, crystallization and HPLC can be used, and the desired from microalgae or cultures thereof, dried products or lysates thereof, cultured using suitable methods known in the art.
  • Biomass or docosahexaenoic acid can be recovered. Recovering the biomass or docosahexaenoic acid may further include a separation process and / or a purification step.
  • lipids and lipid derivatives such as fatty aldehydes, fatty alcohols and hydrocarbons (eg alkanes) can be extracted with hydrophobic solvents such as hexane (Frenz et al. 1989, Enzyme Microb. Technol., 11: 717).
  • Lipids and lipid derivatives are also liquefied (Sawayama et al. 1999, Biomass and Bioenergy 17: 33-39 and Inoue et al. 1993, Biomass Bioenergy 6 (4): 269-274); Oil liquefaction (Minowa et al. 1995, Fuel 74 (12): 1735-1738); And supercritical CO 2 extraction (Mendes et al.
  • microalgal lipid recovery protocols include: i) collecting cells by centrifugation and washing with distilled water, and then drying by freeze drying, ii) the obtained cell powder is ground in mortar and then n-hexane Discloses a method for extracting lipids (Miao and Wu, Biosource Technology (2006) 97: 841-846).
  • compositions comprising the above Thraustochytrium genus CJM01 microalgae, cultures thereof, dried products thereof or lysates thereof.
  • the composition may include a biomass or biooil prepared using the microalgae.
  • Thraustochytrium genus CJM01 microalgae, its culture, its dried product or its lysate are as described above.
  • a description of the biomass or biooil produced using the microalgae is as described above.
  • the microalgae of the present application can be used for the purpose of preparing a composition containing a high content of docosahexaenoic acid.
  • the composition may be in the form of a solution, powder, or suspension, but is not limited thereto. More specifically, the food composition, feed composition or feed additive comprising the Thraustochytrium genus CJM01 microalgae, its culture, its dried product or its crushed products may be provided.
  • feed means any natural or artificial diet, meal, or the like for the animal to eat, ingest and digest, or as an ingredient of the meal, preventing or preventing metabolic diseases according to the present application.
  • Feed comprising the therapeutic composition as an active ingredient can be prepared in various forms of feed known in the art, specifically, it may include rich feed, forage and / or special feed.
  • the term "feed additive” is a substance added to the feed for the purpose of various effects, such as supplementation of nutrients and weight loss prevention, improving the digestive availability of the fiber in the feed, improving the oil quality, preventing reproductive disorders and improving conception, prevention of high temperature stress in summer It includes.
  • the feed additive of the present application corresponds to a feed supplement under the Feed Control Act, and includes mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and composite minerals, mineral preparations such as trace minerals such as zinc, copper, cobalt, and selenium, and kerosene.
  • Vitamins such as vitamin E, vitamin A, D, E, nicotinic acid, vitamin B complex, protective amino acids such as methionine, lyric acid, protective fatty acids such as fatty acid calcium salt, probiotics (lactic acid bacteria), yeast culture, mold Probiotics such as fermented products, yeasts and the like may be further included.
  • a "food composition” includes all forms such as functional food, nutritional supplement, health food and food additives, wherein the food composition of this type is sugar It may be prepared in various forms according to conventional methods known in the art.
  • the present application provides a method of preparing a composition comprising the biomass or biooil.
  • the biomass, biooil and composition are as described above.
  • Bio-oil production method as described above is a high content of the step by culturing CJM01 microalgae of the genus Trozutochitrium excellent in docosahexaenoic acid productivity using a medium containing a carbon source and a nitrogen source of a specific composition under heterotrophic conditions Biooils containing docosahexaenoic acid can be prepared.
  • CJM01 microalgae of the present application is a microalgae belonging to the Trouttochitrid family and has a polyunsaturated fatty acid producing ability including a high content of docosahexaenoic acid. It has a DNA sequence of the 18S rRNA gene represented by SEQ ID NO: 1, and shows a high biomass content under heterotrophic conditions, not growth conditions under general photoculture.
  • Example 1 Trozutochitrid Thraustochytrid Separation of Family Microalgae KC01
  • seawater, soil, and leaf environmental samples were collected from a total of 20 areas along the coast of Geoje, Tongyeong, Gyeongsangnam-do, Korea. Immediately after the collection, each sample was stored in a 10 ° C. ice box and transported to a laboratory. The sample was used for bacterial separation within 2-3 days. Read strains were isolated. Microscopic observation of the sample containing the trazutochitrid microalgae-like morphology was performed using IYP medium for microbial isolation (1 g / L yeast extract, 1 g / L peptone, MgSO 4 ⁇ 7H 2 O 2 g).
  • antibiotic cocktail cocktail mix solution (Streptomycin sulfate (Streptomycin sulfate) 0-500mg / L, Ampicillin 0-500mg / L, Penicillin G 0-500mg / L, Kanamycin Sulfate (Kanamycin sulfate) 0-500mg / L) was added to adjust the concentration, thereby controlling the growth and contamination of other microorganisms.
  • Isolated colonies were IGGYP medium (Glycerol 10g / L, Glucose 10g / L, 1g / L yeast extract, 1g / L peptone, MgSO 4 ⁇ 7H 2 O 2g / L, sun salt 20g / L , H 3 BO 3 5.0mg / L, MnCl 2 3.0mg / L, CuSO 4 0.2mg / L, NaMo 4 ⁇ 2H 2 O 0.05mg / L, CoSO 4 0.05mg / L, ZnSO 4 ⁇ 7H 2 O 0.7mg / L, vitamin mixed solution 10ml / L) was incubated for about 7 days at 15-28 °C, 50-200rpm in a 500mL flask.
  • the growth rate was fast, and the microalgae, which were not complicated in culture conditions, were finally selected, and the cells were recovered.
  • the morphology of the selected strains was observed using an optical microscope (FIG. 1).
  • the recovered cells were washed three times with PBS buffer (Phosphate buffered solution, pH 7.5), and then dried in a dry oven at 55 ° C. for 16 hours to obtain dry cells.
  • PBS buffer Phosphate buffered solution, pH 7.5
  • the 18s rRNA gene sequence was analyzed for molecular biological identification of the final microalgal strains. After DNA was isolated from the purely isolated colonies of the selected species, 18s rRNA was amplified by PCR using a gene amplification primer in the 18s rRNA region, and the primers for gene amplification are shown in Table 1 below.
  • the PCR reaction was denatured at 95 °C for 5 minutes, 95 °C 30 seconds denaturation, 52 °C 30 seconds annealing, 72 °C 1 minute 30 seconds polymerization was repeated 25 times, and then subjected to the polymerization reaction at 72 °C 7 minutes The method was progressed.
  • nucleotide sequence 1 (SEQ ID NO: 1) having a size of about 1792 bp was obtained.
  • NCBI BLAST search it has about 99% homology with the previously reported strain of Thraustochytrium , Aurantiochytrium genus and Schizochytrium genus strain It was confirmed that the homology of 84%.
  • the strain was identified as a microalgae belonging to the genus Thraustochytrid family Thraustochytrid family, and was named Thraustochytrium Genus KC01.
  • Example 2-1 Mutation strain selection by artificial mutation method
  • the present application is to isolate the strain improved production of docosahexaenoic acid (Dochahexaenoic acid (DHA)) by gamma-ray irradiation mutation of the Thraustochytrium genus KC01 strain isolated in Example 1 The same experiment was performed.
  • DHA docosahexaenoic acid
  • Thraustochytrium genus KC01 strain was cultured in GYEP medium (2% glucose, 1% peptone, 0.5% yeast extract, 2% natural salt) for 24 hours to activate the activated strain at 121 ° C. After inoculating in sterilized seed medium (5% glucose, 1% peptone, 0.5% yeast extract, 2% sun salt) for 14 hours, the cells were recovered. The collected cells were suspended in 50 ml of PBS buffer and gamma-ray irradiated at a dose of 1-5 kGy for 1 hour, followed by 500 ml flasks in 50 ml basal medium (5% glucose, 1% peptone, 0.5% yeast extract, 2% natural salt).
  • GYEP medium 2% glucose, 1% peptone, 0.5% yeast extract, 2% natural salt
  • GYEP plate medium Gibcose 2%, Peptone 1%, Yeast extract 0.5%, Sea salt 2%, Agar 2%, two times at pH 7.0.
  • the mutant strain obtained by the above method was named Thraustochytrium genus CJM01, and the Korean Collection for Type Cultures (KCTC), an international depository institution under the Treaty of Budapest on May 30, 2018. Was deposited with the accession number KCTC13538BP.
  • MJW01 medium (Glocose 30g / L, MgSO 4 ⁇ 7H 2 O 3.0g / L, Na 2 SO 4 10g / L , NaCl 1.0g / L, Yeast Extract 9.0g / L, MSG ⁇ 1H 2 O 1.0g / L, NaNO 3 1.0g / L, KH 2 PO 4 0.1g / L, K 2 HPO 4 0.5g / L, CaCl 2 0.5 g / L, 10 ml / L of the vitamin mixed solution) were incubated at 28 ° C., 300 rpm, 1 vvm, and pH 7.5 for about 4 days under basic culture medium conditions. The cells were collected by centrifugation, washed three times with PBS buffer and dried at 55 ° C. for 12 hours to determine the weight of the cells.
  • the content of docosahexaenoic acid-containing oil using dry cells was measured by the following method. Specifically, after adding 8.3M hydrochloric acid solution to 2g of dry cells, hydrolyzed the cell wall of the microalgae cells at 80 ° C, 30 mL of ethyl ether and 20 mL of petroleum ether were added and mixed for 30 seconds. The process of centrifugation was repeated three more times. Thereafter, the separated solvent layer was collected, transferred to a round flask that had been weighed in advance, and the solvent was removed by nitrogen purging and dried in a container from which moisture was removed. The dried oil was weighed to calculate the total oil content. The DHA content contained in the oil was measured by gas chromatography by pretreatment with methanolic 0.5N NaOH and 14% trifluoroboranmethanol (BF 3 ).
  • 'Biomass' in Tables 2 and 3 below means the concentration of cells in the culture medium, and can be used in combination with dry cell weight (DW).
  • the content of DHA is expressed as a content of biomass or total fatty acid (TFA). It was.
  • DHA Docosahexaenoic Acid
  • DHA Docosahexaenoic Acid
  • mutant strain CJM01 is a strain having improved DHA content and productivity compared to the parent strain KC01 strain.
  • a 10 ml sample was taken from each of the culture broths, diluted 20 times with distilled water, and filtered to perform total amino acid analysis using liquid chromatography.
  • aspartate, serine, glutamate, glycine, alanine, valine, methionine, isoleucine, leucine, tyrosine, phenylalanine, lysine, and arginine were all detected in the culture medium of the KC01 parent strain.
  • most amino acids were not detected in the culture medium of the CJM01 strain with an improved DHA content.
  • MJW01 medium used in Example 2-2 and to increase the nitrogen source content in the medium and to reduce the production cost, the concentration of yeast extract which is an organic nitrogen source is reduced, and the inorganic nitrogen source (NH 4 ) 2 SO 4 was added and NaNO 3 concentration was increased, finally MJW02 medium (glucose 30g / L, MgSO 4 ⁇ 7H 2 O 5.0g / L, Na 2 SO 4 3g / L, NaCl 0.5g / L, yeast extract 1.0 g / L, MSG.1H 2 O 1.0g / L, NaNO 3 8.0g / L, (NH 4 ) 2 SO 4 3.0g / L, KH 2 PO 4 0.1g / L, K 2 HPO 4 0.5g / L , CaCl 2 0.1g / L, vitamin mixed solution 10ml / L).
  • the culture of CJM01 strain was carried out in the medium.
  • the cell mass was decreased while the concentration of yeast extract, which is an organic nitrogen source, was reduced, but the culture time was significantly shortened through the increase of the inorganic nitrogen source.
  • the DHA content was equal or more and it was confirmed that the DHA productivity is improved by 1.13 times.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • Botany (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 고함량의 다중불포화지방산을 함유하는, 신규 트라우즈토카이트리움 속 (Thraustochytrium genus) 균주, 및 이를 이용한 바이오매스 제조방법에 관한 것으로, 본 출원의 신규한 트라우즈토카이트리움 속의 CJM01 미세조류는 바이오매스 중 지방의 함량 및 도코사헥사엔산과 같은 불포화지방산의 함량이 높아, 그 자체 또는 배양 및 발효에 의해 생산된 바이오매스, 이의 농축물 또는 건조물은 사료용 조성물로 매우 유용하다.

Description

신규한 트라우즈토카이트리움 속 균주, 및 이를 이용한 다중불포화지방산 생산방법
본 출원은 고함량의 다중불포화지방산을 함유하는, 신규 트라우즈토카이트리움 속 (Thraustochytrium genus) 균주 및 이로부터 생산된 바이오매스, 이를 포함하는 지질 및 다중불포화지방산 제조방법에 관한 것이다.
다중불포화지방산인 도코사헥사엔산(docosahexaenoic acid: DHA)은 두뇌, 안구조직 및 신경계에 필수적인 지방산으로 특히 유아의 시력 및 운동신경능력 개발에 중요한 기능을 하는 것으로 알려져 있고, 치매 환자 뇌에서는 그 양이 현저하게 줄어드는 것으로 보고되었으며, 노안의 황반 변성 억제 등 다양한 항노화 기능들이 새롭게 밝혀지고 있다. 또한, DHA는 어류 사료첨가제로도 이용될 수 있다고 보고되었다(한국 공개특허 10-2007-0040751). 사람을 비롯한 대부분의 고등 동물은 정상적인 생체기능에 필요한 다중불포화지방산을 자체적으로 원활하게 합성하지 못하기 때문에 다중불포화지방산을 필수 영양소로 반드시 섭취하여야 하며, 세계보건기구는 하루 1g 이상의 DHA 함유 다중불포화지방산을 꾸준히 섭취할 것을 권장하고 있다. 전통적으로 DHA 다중불포화지방산의 공급원은 참치, 연어와 같은 해양 생태환경의 상위를 차지하는 심해성 어류들이다. 하지만, 해양환경의 오염이 심해지면서 심해성 어류의 체내에 수은을 비롯한 중금속, 환경호르몬, 방사성물질 등 오염물질의 축적으로 인해 심해어류 섭취에 대한 위험이 커지고 있다. 따라서 DHA 다중불포화지방산 오일을 안전하고, 안정적으로 공급할 수 있는 새로운 수단으로 트라우즈토카이트리움 속 미세조류는 산업적으로 매우 중요한 가치를 지닌다.
트라우즈토카이트리움 속 미세조류에서 유전자 과발현을 위한 다양한 방법들이 제시된 바 있다. 마르텍사에 의해 아세토락테이트 신타제(acetolactate synthase)를 선별마커로 이용한 트라우즈토카이트리움 속 미세조류의 유전형질전환방법이 최초로 제시된 이후, 다양한 항생제 내성 유전자를 선별마커로 활용한 트라우즈토카이트리움 속 미세조류 형질전환기술이 보고되었으며, 구체적으로 한국공개특허 제2015-0084148호에서는 '미세조류의 바이오매스와 지질생산성을 증가시키기 위한 재조합 벡터 및 이의 용도'가 개시된 바 있다.
하지만, 현재까지 트라우즈토카이트리움 속 미세조류에서 개발된 유전형질전환기술은 공통적으로 도입된 유전자가 염색체 DNA로 삽입되는 방법(chromosomal integration)으로, 삽입된 유전자가 안정적으로 유지되는 장점이 있지만, 자가복제 능력을 지닌 centromeric 혹은 episomal 플라스미드를 이용한 유전자 발현 방법에 비해 유전자 복제수(copy number), 발현 조절 등에서 제약을 지닌다.
본 발명자들은 트라우즈토카이트리움 속 KC01 미세조류를 돌연변이 시켜, 도코사헥사엔산 함량 및 생산성이 향상된 미세조류를 개발하였고, 상기 미세조류를 배양하여 도코사헥사엔산 함유 지질이 포함된 바이오매스 및 바이오오일 제조방법을 확립함으로써 본 출원을 완성하였다.
본 출원의 하나의 목적은 야생형에 비해 도코사헥사엔산(DHA) 생산량이 증가되고, 아미노산 생산량이 감소된 트라우즈토카이트리움 속(Thraustochytrium genus) CJM01 미세조류(기탁번호: KCTC 13538BP)을 제공하는 것이다.
본 출원의 다른 하나의 목적은 상기 트라우즈토카이트리움 속 CJM01 미세조류를 배양하는 단계; 및 상기 미세조류, 이의 배양물, 이의 건조물 또는 이의 파쇄물로부터 도코사헥사엔산(DHA) 함유 바이오매스를 회수하는 단계를 포함하는, 바이오매스 제조방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 트라우즈토카이트리움 속 CJM01 미세조류를 배양하는 단계; 및 상기 미세조류, 이의 배양물, 이의 건조물 또는 이의 파쇄물로부터 도코사헥사엔산(DHA) 함유 지질을 회수하는 단계를 포함하는, 바이오오일 제조방법을 제공하는 것이다.
본 출원의 신규한 트라우즈토카이트리움 속의 CJM01 미세조류는 아미노산 생성량은 현저히 감소하고, 바이오매스 중 지방함량 및 도코사헥사엔산과 같은 불포화지방산의 함량이 높아, 그 자체 또는 배양 및 발효에 의해 생산된 바이오매스, 상기 바이오매스의 농축물 및 건조물은 사료용 조성물로 매우 유용하다.
도 1은 트라우즈토카이트리움 속 (Thraustochytrium Genus) KC01 균주를 광학현미경으로 관찰한 사진을 나타내는 도면이다.
도 2는 트라우즈토카이트리움 속 (Thraustochytrium Genus) KC01 균주, 트라우즈토카이트리움 속(Thraustochytrium genus) 균주, 오란티오카이트리움 속 (Aurantiochytrium genus) 균주 및 스키조카이트리움 속 (Schizochytrium genus) 균주간의 계통수를 나타내는 도면이다.
이하에서는, 본 출원을 더욱 상세히 설명한다.
한편, 본 출원에서 개시되는 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술되는 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 할 수 없다. 또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
상기 목적을 달성하기 위한 본 출원의 하나의 양태는, 야생형에 비해 도코사헥사엔산(DHA) 생산량이 증가되고, 아미노산 생산량이 감소된 트라우즈토카이트리움 속(Thraustochytrium genus) CJM01 미세조류를 제공한다.
본 출원에서 용어 “트라우즈토카이트리움 속(Thraustochytrid genus)” 균주는 유기종속영양 미세조류로서, 도코사헥사엔산(docosahexaenoic acid: DHA)를 비롯한 다양한 다중불포화지방산(polyunsaturated fatty acid)을 고농도로 함유하는 트리아실글리세롤(triacylglycerol)의 공급원으로 중요한 역할을 수행한다. 또한, 상기 “미세조류(microalgae)”는 엽록소로 광합성을 하는 식물 중 육안으로 볼 수 없어 현미경을 통해서만 볼 수 있으며 물속에서 자유로이 부유하여 살아가는 생물을 의미하며, 식물플랑크톤(Phytoplankton)로도 불린다.
본 출원에서는 일 예로, 야생형 트라우즈토카이트리움 KC01 균주에 감마선을 조사하여 돌연변이를 발생시키고, 상기 돌연변이 균주 중 다중불포화지방산 함유 오일의 생산능이 향산된 균주를 선별하여, 이를 트라우즈토카이트리움 속(Thraustochytrium genus) CJM01로 명명하였고, 2018년 5월 30일자로 부다페스트 조약하의 국제 기탁기관인 한국생명공학연구원 생물자원센터 (Korean Collection for Type Cultures: KCTC)에 기탁하여 수탁번호 KCTC 13538BP을 부여 받았다.
또한, 본 출원의 트라우즈토카이트리움 속 CJM01 미세조류는 서열번호 1의 18s rRNA 염기서열을 가질 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, “도코사헥사엔산(docosahexaenoic acid: DHA)”은 C22H32O2 의 화학식을 갖는 다중불포화지방산 중 하나로서, 등 푸른 생선인 참치나 정어리에서 많이 추출되는 물질이다. 또한 도코사헥사엔산은 에이코사펜타엔산(eicosapentaenoic acid: EPA) 및 알파-리놀렌산(α-linolenic acid: ALA)과 함께 오메가 3에 속한다.
본 출원의 트라우즈토카이트리움 속 CJM01 미세조류는 모균주인 트라우즈토카이트리움 속 KC01 대비 다량의 도코사헥사엔산을 포함할 수 있으며, 구체적으로 상기 미세조류에 포함된 지방산 총 중량을 기준으로 30 내지 65 중량%, 30 내지 60 중량%. 40 내지 65 중량% 또는 40 내지 60 중량%의 도코사헥사엔산을 포함할 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 트라우즈토카이트리움 속 CJM01 미세조류는 모균주인 트라우즈토카이트리움 속 KC01 대비 도코사헥사엔산 생산성이 향상된 것일 수 있으며, 상기 생산성은 1시간 동안 생산된 도코사헥사엔산의 농도(g/L)로 측정할 수 있다. 구체적으로, 본 출원의 미세조류는 0.4 내지 0.8 (g/l/h), 0.4 내지 0.7 (g/l/h), 0.5 내지 0.8 (g/l/h) 또는 0.5 내지 0.7 (g/l/h)의 도코사헥사엔산 생산성을 가질 수 있으나, 이에 제한되지 않는다.
한편, 본 출원의 트라우즈토카이트리움 속 CJM01 미세조류는 모균주인 트라우즈토카이트리움 속 KC01 대비 아미노산 생산량이 감소된 것일 수 있다. 구체적으로, 본 출원의 트라우즈토카이트리움 속 CJM01 미세조류 또는 이의 배양액은 아스파테이트, 세린, 글루타메이트, 글라이신, 알라닌, 발린, 메치오닌, 이소류신, 루이신, 타이로신, 페닐알라닌, 라이신, 및 알지닌으로 이루어진 군으로부터 선택되는 적어도 하나 이상의 아미노산을 포함하지 않을 수 있다. 예를 들면, 실시예 2에서 확인할 수 있듯이, 본 출원의 트라우즈토카이트리움 속 CJM01 미세조류의 배양액 내에서 아스파테이트, 세린, 글루타메이트, 글라이신, 알라닌, 메치오닌, 이소류신, 루이신, 타이로신, 페닐알라닌, 라이신, 및 알지닌이 검출되지 않을 수 있다.
일 예로, 본 출원의 트라우즈토카이트리움 속 CJM01 미세조류의 토탈 아미노산 생산량은 모균주인 트라우즈토카이트리움 속 KC01 대비 90 %이상, 95 %이상, 97 % 이상, 또는 99% 이상 저감된 것일 수 있으며, 이를 통해 CJM01 균주가 KC01 모균주 대비 공급된 탄소원을 도코사헥사엔산 생합성 경로에서 더 효과적으로 사용하는 것임을 알 수 있다. 구체적으로, 본 출원의 트라우즈토카이트리움 속 CJM01 미세조류는 아미노산을 거의 생산하지 않으므로, 상기 균주의 배양액은 0.1 내지 20 mg/L, 0.1 내지 15 mg/L 이하, 0.1 내지 10 mg/L 이하, 또는 0.1 내지 7 mg/L 또는 0.1 내지 5 mg/L 의 아미노산만을 함유할 수 있다.
본 출원의 다른 하나의 양태는 상기 트라우즈토카이트리움 속 CJM01 미세조류를 배양하는 단계; 및 상기 미세조류, 이의 배양물, 이의 건조물 또는 이의 파쇄물로부터 도코사헥사엔산(DHA)을 포함하는 바이오매스를 회수하는 단계를 포함하는 바이오매스 제조방법을 제공한다. 또한, 상기 바이오매스는 건조 균체 형태일 수 있으나 이에 제한되는 것은 아니다.
본 출원은 상기 방법에 의해 제조된 바이오매스를 제공한다. 상기 바이오매스는 총 중량을 기준으로 15 내지 40 중량%. 20 내지 35 중량% 또는 25 내지 30 중량%의 도코사헥사엔산을 포함할 수 있으나, 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 상기 트라우즈토카이트리움 속 CJM01 미세조류를 배양하는 단계, 및 상기 미세조류, 이의 배양물, 이의 건조물 또는 이의 파쇄물로부터 도코사헥사엔산(DHA) 함유 지질을 회수하는 단계를 포함하는, 바이오오일 제조방법을 제공한다.
본 출원은 상기 방법에 의해 제조된 바이오오일을 제공한다. 상기 바이오오일은 지방산 총 중량을 기준으로 30 내지 65 중량%, 30 내지 60 중량%. 40 내지 65 중량% 또는 40 내지 60 중량%의 도코사헥사엔산을 포함할 수 있으나, 이에 제한되지 않는다.
구체적으로, 본 출원의 바이오오일 제조방법은 상기 트라우즈토카이트리움 속 CJM01 미세조류를 배양하는 단계; 상기 미세조류, 이의 배양물, 이의 건조물 또는 이의 파쇄물로부터 도코사헥사엔산(DHA)을 포함하는 바이오매스를 제조하는 단계; 및 상기 제조된 바이오매스로부터 도코사헥사엔산(DHA) 함유 지질을 지질을 회수하는 단계를 포함할 수 있으나, 이에 제한되는 것은 아니다.
상기 “트라우즈토카이트리움 속” 및 “도코사헥사엔산”은 전술한 바와 같다.
본 출원에서 "바이오오일"은 생물학적, 열화학 그리고 물리화학 추출공정에 의해 바이오매스로부터 얻어진 것으로서, 본 출원에서 제조된 바이오오일은 다중불포화지방산을 함유하는 것일 수 있고, 구체적으로 도코사헥사엔산을 함유하는 것일 수 있으나, 이에 제한되는 것은 아니다.
또한, 상기 "바이오매스"는 화학적 에너지로 사용 가능한 식물, 동물, 미생물 등의 생물체, 즉 바이오에너지의 에너지원을 의미하며, 생태학적으로 단위 시간 및 공간 내에 존재하는 특정 생물체의 중량 또는 에너지량을 의미하기도 한다. 또한, 상기 바이오매스는 세포에 의해 분비되는 화합물을 포함하지만 이에 제한되지 않는, 세포 외 물질뿐만 아니라 세포 및/또는 세포 내 내용물을 함유할 수 있다. 본 출원에서 상기 바이오매스는 트라우즈토카이트리움 속 CJM01 미세조류 그 자체, 이의 배양물, 이의 건조물, 이의 파쇄물 또는 상기 미세조류를 배양하거나 발효하여 생산된 산물일 수 있으며, 또는 상기 바이오매스의 농축물 또는 건조물 일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 트라우즈토카이트리움 속 CJM01 미세조류의 배양물은 상기 미새조류를 배양하여 생성된 산물을 지칭하는 것으로서, 구체적으로 미세조류를 포함하는 배양액 또는 미세조류가 제거된 배양액일 수 있으나, 이에 제한되는 것은 아니다. 본 출원에서 트라우즈토카이트리움 속 CJM01 미세조류의 건조물은 상기 미세조류에서 수분이 제거된 것으로서, 구체적으로 건조 균체 형태일 수 있으나 이에 제한되는 것은 아니다. 또한, 본 출원의 트라우즈토카이트리움 속 CJM01 미세조류 파쇄물은 상기 미세조류를 파쇄한 결과물을 총칭하는 것으로서, 파쇄된 미세조류의 상청액 또는 펠렛일 수 있으나 이에 제한되는 것은 아니다.
본 출원의 트라우즈토카이트리움 속 CJM01 미세조류 그 자체, 이의 배양물, 이의 건조물 또는 이의 파쇄물은 도코사헥사엔산을 함유하는 것으로서, 이로부터 바이오매스 또는 바이오오일을 제조할 수 있다.
본 출원에서 "배양"은 상기 미세조류를 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 미세조류에 따라 당업자가 용이하게 조정하여 사용할 수 있다.
구체적으로, 본 출원의 트라우즈토카이트리움 속 CJM01 미세조류의 배양은 종속영양 조건하에서 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 "종속영양"은 에너지(영양)원을 체외에서 얻어낸 유기물에 의존하고 있는 영양형식으로, 독립영양에 대응되는 용어이다. 본 출원의 트라우즈토카이트리움 속 CJM01 미세조류는 종속영양 조건 하에서의 탄소원 또는 질소원의 배지 조성 최적화를 통해 도코사헥사엔산의 함량 및 생산성을 높일 수 있다. 또한, 본 출원에서 '종속영양'의 용어는 '암배양'과 혼용하여 사용될 수 있다.
또한, 상기 미세조류를 배양하는 단계는, 특별히 이에 제한되지 않으나, 공지된 회분식 배양방법, 연속식 배양방법, 유가식 배양방법 등에 의해 수행될 수 있다. 본 출원의 미세조류의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미세조류의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 구체적으로는 본 출원의 미세조류를 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
구체적으로, 염기성 화합물(예: 수산화나트륨, 수산화칼륨 또는 암모니아) 또는 산성 화합물(예: 인산 또는 황산)을 사용하여 적정 pH(예컨대, pH 5 내지 9, 구체적으로는 pH 6 내지 8, 가장 구체적으로는 pH 6.8)를 조절할 수 있으나, 이에 제한 되는 것은 아니다.
또한, 배양물의 호기상태를 유지하기 위하여, 배양물 내로 산소 또는 산소 함유 기체를 주입하거나, 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으나, 이에 제한 되는 것은 아니다.
또한, 배양온도는 20 내지 45℃, 구체적으로는 25 내지 40℃를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 제한되는 것은 아니다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있으나, 이에 제한 되는 것은 아니다.
본 출원의 트라우즈토카이트리움 속 CJM01 미세조류의 배양은 탄소원 및 질소원을 포함하는 배지를 사용하여 수행할 수 있다.
본 출원에서 용어, "배지"는 본원의 미세조류를 배양할 배양배지 및/또는 배양한 다음 수득한 산물을 의미한다. 상기 배지는 미세조류를 포함하는 형태 및 상기 미세조류를 포함하는 배양액에서 원심분리, 여과 등으로 미세조류를 제거한 형태도 모두 포함하는 개념이다.
아울러, 본 출원에서 사용되는 배양용 배지는 탄소원으로는 당 및 탄수화물 (예: 글루코오스, 수크로오스, 락토오스, 프럭토오스, 갈락토오스, 만노오스, 말토오스, 아라비노오스, 자일로오스, 몰라세, 전분 및 셀룰로오스), 유지 및 지방 (예: 대두유, 해바라기씨유, 땅콩유 및 코코넛유), 지방산 (예: 팔미트산, 스테아르산 및 리놀레산), 알코올 (예: 글리세롤 및 에탄올) 및 유기산 (예: 아세트산) 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있고, 구체적으로, 상기 탄소원은 글루코오스, 프럭토오스, 말토오스, 갈락토오스, 만노오스, 수크로오스, 아라비노오스, 자일로오스 및 글리세롤로 이루어진 군으로부터 선택되는 1종 이상인 것일 수 있으나, 미세조류를 배양하는데 사용되는 탄소원이라면 이에 제한되지 않는다. 또한, 본 출원에서 사용되는 배양용 배지는 탄소원으로서 10 내지 50 g/L, 10 내지 40 g/L, 20 내지 50 g/L, 20 내지 40 g/L 또는 25 내지 35 g/L 농도의 글루코오스가 포함될 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 사용되는 배양용 배지의 질소원은 유기질소원 또는 무기질소원으로 구별될 수 있으나, 유기질소원 또는 무기질소원을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있다. 구체적으로 상기 질소원은 효모 추출물, 우육 추출물(beef extract), 펩톤(peptone) 및 트립톤(tryptone)으로 이루어진 군으로부터 선택되는 유기질소원 또는 암모늄 아세테이트, 암모늄 나이트레이트, 암모늄 클로라이드, 암모늄 설페이트, 소듐 나이트레이트. 우레아 및 MSG(Monosodium glutamate)로 이루어진 군으로부터 선택되는 무기질소원일 수 있다.
또한, 본 출원에서 사용되는 배양용 배지에는 질소원의 일 예로 효모 추출물, 암모늄 설페이트, 소듐 나이트레이트 및 MSG를 포함할 수 있으나, 미세조류를 배양하는데 사용되는 질소원이라면 이에 제한되지 않는다.
구체적으로, 상기 효모 추출물은 배지 내에 0.1 내지 10 g/L, 0.5 내지 10 g/L, 0.5 내지 7 g/L, 0.5 내지 5 g/L, 0.5 내지 3 g/L, 0.5 내지 2 g/L 또는 0.5 내지 1.5 g/L 농도로 포함될 수 있고, 상기 암모늄 설페이트는 배지 내에 1 내지 5 g/L, 1 내지 4 g/L, 2 내지 5 g/L, 2 내지 4 g/L 농도로 포함될 수 있고, 상기 소듐 나이트레이트는 배지 내에 0.1 내지 10 g/L, 0.5 내지 9 g/L, 1 내지 9 g/L, 2 내지 9 g/L, 3 내지 9 g/L, 5 내지 9 g/L 또는 7 내지 9 g/L 농도로 포함될 수 있으며, 상기 MSG는 배지 내에 0.1 내지 2 g/L, 0.1 내지 1.5 g/L, 0.5 내지 2 g/L, 0.5 내지 1.5 g/L 농도로 포함될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 목적상 CJM01 균주는 암모니아 저해가 없고, 넓은 염농도에서 성장이 가능한 특징이 있으므로, 이를 고려하여 탄소원 및 질소원을 배지에서 적절하게 조절할 수 있다.
본 출원에서 사용되는 배양용 배지는 인 공급원으로 인산 이수소칼륨, 인산수소이칼륨, 이에 상응하는 나트륨 함유염 등을 개별적으로 사용하거나 또는 혼합하여 사용할 수 있으나, 이에 제한되지 않는다. 또한, 배지에는 기타 금속염 (예: 황산마그네슘 또는 황산철), 아미노산 및 비타민과 같은 필수성장-촉진 물질을 포함할 수 있다.
본 출원의 상기 배양 단계에서 배양된 미세조류, 이로부터 생산된 배양물, 이의 건조물 또는 이의 파쇄물로부터 바이오매스를 회수하는 단계는 당해 분야에 공지된 적합한 방법을 이용하여 목적하는 바이오매스를 수집할 수 있다.
또한, 본 출원의 상기 배양 단계에서 생산된 도코사헥사엔산을 회수하는 단계는 배양방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 미세조류 자체 또는 이의 배양물로부터 목적하는 도코사헥사엔산을 수집(collet)할 수 있다. 예를 들어, 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배양된 미세조류 또는 이의 배양물, 이의 건조물 또는 이의 파쇄물로부터 목적하는 바이오매스 또는 도코사헥사엔산을 회수할 수 있다. 상기 바이오매스 또는 도코사헥사엔산을 회수하는 단계는 분리 공정 및/또는 정제 단계를 추가적으로 포함할 수 있다.
예를 들면, 지방 알데하이드, 지방 알콜 및 탄화수소(예를 들어, 알칸)와 같은 지질 및 지질 유도체는 헥산과 같은 소수성 용매로 추출할 수 있다(Frenz et al. 1989, Enzyme Microb. Technol., 11:717). 지질 및 지질 유도체는 또한 액화(Sawayama et al. 1999, Biomass and Bioenergy 17:33-39 and Inoue et al. 1993, Biomass Bioenergy 6(4):269-274); 오일 액화(Minowa et al. 1995, Fuel 74(12): 1735-1738); 및 초임계 CO2 추출(Mendes et al. 2003, Inorganica Chimica Acta 356:328-334)를 사용하여 추출할 수 있다. 또한, 공지된 미세조류 지질 회수의 프로토콜은, i) 원심분리에 의해 세포를 수거하고 증류수로 세척한 후, 동결 건조에 의해 건조시키고, ii) 수득한 세포 분말은 모르타르에서 분쇄하고 이어서 n-헥산으로 지질을 추출하는 방법을 개시하고 있다 [Miao and Wu, Biosource Technology (2006) 97:841-846].
본 출원의 또 다른 하나의 양태는, 상기 트라우즈토카이트리움 속(Thraustochytrium genus) CJM01 미세조류, 이의 배양물, 이의 건조물 또는 이의 파쇄물을 포함하는 조성물을 제공한다. 상기 조성물은, 상기 미세조류를 이용하여 제조된 바이오매스 또는 바이오오일을 포함할 수 있다.
트라우즈토카이트리움 속(Thraustochytrium genus) CJM01 미세조류, 이의 배양물, 이의 건조물 또는 이의 파쇄물에 대해서는 상기에서 설명한 바와 같다. 상기 미세조류를 이용하여 제조된 바이오매스 또는 바이오오일에 대한 설명도 전술된 바와 같다. 고함량의 도코사헥사엔산을 함유하는 조성물을 제조하기 위한 목적에서 본 출원의 미세조류를 사용할 수 있다. 상기 조성물은 용액, 분말, 또는 현탁액 형태일 수 있으나, 이에 제한되지는 않는다. 보다 구체적으로, 상기 트라우즈토카이트리움 속(Thraustochytrium genus) CJM01 미세조류, 이의 배양물, 이의 건조물 또는 이의 파쇄물을 포함하는 식품 조성물, 사료 조성물 또는 사료 첨가제가 제공될 수 있다.
본 출원에서 용어, "사료"는 동물이 먹고, 섭취하며, 소화시키기 위한 또는 이에 적당한 임의의 천연 또는 인공 규정식, 한끼식 등 또는 상기 한끼식의 성분으로, 본 출원에 따른 대사 질환의 예방 또는 치료용 조성물을 유효성분으로 포함하는 사료는 당업계의 공지된 다양한 형태의 사료로 제조가능하며, 구체적으로는 농후사료, 조사료 및/또는 특수사료가 포함될 수 있다.
본 출원에서 용어, "사료 첨가제"는 영양소 보충 및 체중감소 예방, 사료 내섬유소의 소화 이용성 증진, 유질 개선, 번식장애 예방 및 수태율 향상, 하절기 고온 스트레스 예방 등 다양한 효과를 목적으로 사료에 첨가하는 물질을 포함한다. 본 출원의 사료 첨가제는 사료관리법상의 보조사료에 해당하며, 탄산수소나트륨, 벤토나이트(bentonite), 산화마그네슘, 복합광물질 등의 광물질제제, 아연, 구리, 코발트, 셀레늄 등의 미량 광물질인 미네랄제제, 케로틴, 비타민 E, 비타민 A, D, E, 니코틴산, 비타민 B 복합체 등의 비타민제, 메티오닌, 리이산 등의 보호아미노산제, 지방산 칼슘염 등의 보호지방산제, 생균제(유산균제), 효모배양물, 곰팡이 발효물 등의 생균, 효모제 등이 추가로 포함될 수 있다.
본 출원에서 “식품 조성물”은 기능성 식품(functional food), 영양 보조제(nutritional supplement), 건강 식품(health food) 및 식품 첨가제(food additives)등의 모든 형태를 포함하며, 상기 유형의 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다.
본 출원은 상기 바이오매스 또는 바이오오일을 포함하는 조성물을 제조하는 방법을 제공한다. 상기 바이오매스, 바이오오일 및 조성물에 대해서는 상기에서 설명한 바와 같다.
상기와 같은 바이오오일 제조방법은 도코사헥사엔산 생산성이 우수한 트라우즈토카이트리움 속 CJM01 미세조류를 종속영양 조건하에서 특정 조성의 탄소원 및 질소원을 포함하는 배지를 이용하여 배양하는 단계에 의해 고함량의 도코사헥사엔산을 함유하는 바이오오일을 제조할 수 있다.
이하, 실시예를 통하여 본 출원의 구성 및 효과를 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 출원을 예시하기 위한 것일 뿐 본 출원의 범위가 실시예에 의해 제한되는 것은 아니다.
본 출원의 CJM01 미세조류는 트라우즈토카이트리드 패밀리에 속하는 미세조류로서, 높은 함량의 도코사헥사엔산을 포함한 다중불포화지방산 생산능을 갖는다. 서열번호 1로 표시되는 18S rRNA 유전자의 DNA 염기서열을 가지며, 일반적인 광배양하에서의 성장 조건이 아닌 종속영양 조건하에서의 높은 바이오매스 함량을 나타낸다.
이하, 실시예에서는, 더욱 구체적으로 실험방법에 대하여 설명하도록 하겠다.
실시예 1: 트라우즈토카이트리드( Thraustochytrid ) 패밀리 미세조류 KC01의 분리
트라우즈토카이트리드 패밀리 미세조류 균주를 분리하기 위해 하기와 같은 실험을 수행하였다.
구체적으로, 대한민국 경상남도 거제, 통영 지역 해안의 총 20개 지역으로부터 해수, 토양 및 나뭇잎 환경 시료를 채취하였다. 채취 직후 각 샘플은 10℃ 아이스박스에 보관되어 실험실로 운반되었고, 상기 샘플은 2-3일 이내 균 분리 작업에 사용되었으며, 한천 배지에 직접 도말한 후 액상 송화가루 부착법을 이용하여 트라우즈토카이트리드 균주를 분리하였다. 현미경 관찰을 통해 트라우즈토카이트리드 미세조류 유사 형태를 포함하는 시료를 미생물 분리용 IYP 배지(1 g/L 효모 추출물(Yeast extract), 1g/L 펩톤(Peptone), MgSO4·7H2O 2g/L, 천일염(Sea salt) 20g/L, H3BO3 5.0mg/L, MnCl2 3.0mg/L, CuSO4 0.2mg/L, NaMo4·2H2O 0.05mg/L, CoSO4 0.05mg/L, ZnSO4·7H2O 0.7mg/L, 한천(Agar) 15g/L)에 도말하였다. 얻어진 콜로니들은 수회 계대 배양을 거쳐 순수 분리한 후, 트라우즈토카이트리드 미세조류의 전형적인 특징인 유주자(zoospore)낭을 형성하는 균주만을 선별 및 분리하였다. 현미경 관찰을 통하여 확인이 불가한 환경 시료는 1.5% 염도의 멸균된 해수를 활용하여 희석 및 세척 후, 샘플 50ml에 송화가루를 뿌리고 배양하였다. 각 채집 환경과 유사한 온도 및 pH 조건에서 배양하여 얻어진 미생물 군집은 미생물 분리용 IYP 배지에 도말 및 계대 배양하여 순수 분리하였다. 이 때, 각 시기별로 항생제 칵테일 믹스(cocktail mix) 용액(스트렙토마이신 설페이트(Streptomycin sulfate) 0-500mg/L, 암피실린(Ampicillin) 0-500mg/L, 페니실린(Penicillin) G 0-500mg/L, 카나마이신 설페이트(Kanamycin sulfate) 0-500mg/L)을 농도를 조절하면서 투입하였으며, 이를 통해 기타 미생물의 성장 및 오염을 제어하였다.
분리된 콜로니들은 IGGYP 배지 (글리세롤(Glycerol) 10g/L, 글로코오스(Glucose) 10g/L, 1 g/L 효모 추출물, 1g/L 펩톤, MgSO4·7H2O 2g/L, 천일염 20g/L, H3BO3 5.0mg/L, MnCl2 3.0mg/L, CuSO4 0.2mg/L, NaMo4·2H2O 0.05mg/L, CoSO4 0.05mg/L, ZnSO4·7H2O 0.7mg/L, 비타민 혼합 용액 10ml/L)를 이용하여 500mL 플라스크에서 15-28℃, 50-200rpm 으로 약 7일간 배양하였다. 그 중 성장속도가 빠르며, 배양조건이 복잡하지 않은 미세조류 1종을 최종 선정하여, 균체를 회수하였다. 선정된 균주의 형태는 광학현미경을 이용하여 관찰하였다(도 1). 회수된 균체는 PBS 버퍼 (Phosphate buffered solution, pH 7.5)로 3회 세척 후, 55℃, 16시간 동안 Dry oven에 건조하여 건조 균체를 획득하였다.
최종 선정된 미세조류 균주의 분자생물학적 동정을 위하여 18s rRNA 유전자 서열을 분석하였다. 선정된 균종의 순수 분리 콜로니로부터 DNA를 분리한 후, 18s rRNA 지역의 유전자 증폭용 프라이머를 이용하여 PCR법으로 18s rRNA 를 증폭하였으며, 유전자 증폭용 프라이머는 하기 표 1과 같다.
프라이머 서열 (5' - 3') 서열번호
18s-001F AACCTGGTTGATCCTGCCAGTA 2
18s-013R CCTTGTTACGACTTCACCTTCCTCT 3
이 때, PCR 반응은 95℃에서 5분간 변성 후, 95℃ 30초 변성, 52℃ 30초 어닐링, 72℃ 1분 30초 중합을 25회 반복한 후, 72℃에서 7분간 중합반응을 수행하는 방법으로 진행되었다.
증폭된 반응액을 활용하여 염기서열을 분석한 결과, 약 1792bp 크기의 염기서열 1(서열번호 1)을 확보하였다. 이를 NCBI BLAST 검색한 결과, 종래 보고된 트라우즈토카이트리움(Thraustochytrium) 속 균주와 약 99%의 상동성을 가지며, 오란티오카이트리움 속 (Aurantiochytrium genus) 및 스키조카이트리움 속 (Schizochytrium genus) 균주와 약 84%의 상동성을 가짐을 확인하였다.
이를 통해, 균주간 계통수를 나타내었으며, 그 결과를 도 2에 도시하였다. 해당 균주는 새로운 트라우즈토카이트리드 (Thraustochytrid) 패밀리(family)의 트라우즈토카이트리움 속에 해당하는 미세조류로 확인되어, 트라우즈토카이트리움 속 (Thraustochytrium Genus) KC01로 명명하였다.
실시예 2: 돌연변이 미세조류 개발
실시예 2-1: 인공돌연변이 방법을 통한 변이주 선별
본 출원엔서는 상기 실시예 1에서 분리된 트라우즈토카이트리움 속 (Thraustochytrium genus) KC01 균주의 감마선 조사 변이에 의하여 도코사헥사엔산(Docosahexaenoic acid: DHA)의 생산이 보다 향상된 균주를 분리하고자 하기와 같은 실험을 수행하였다.
구제적으로, 트라우즈토카이트리움 속 (Thraustochytrium genus) KC01 균주를 GYEP 배지 (포도당 2%, 펩톤 1%, 효모엑기스 0.5%, 천일염 2%) 에서 24 시간 동안 배양하여 활성화된 균주를 121℃에서 15분간 멸균한 종배지 (글루코오스 5%, 펩톤 1%, 효모 추출물 0.5%, 천일염 2%) 에 접종하여 14시간 동안 배양한 후, 균체를 회수하였다. 회수한 균체를 PBS 버퍼 50ml에 현탁하여 감마선을 1~5 kGy 선량으로 1 시간 조사 후, 50ml 기본 배지 (포도당 5%, 펩톤 1%, 효모엑기스 0.5%, 천일염 2%)에서 500ml 플라스크를 이용하여 28℃에서 120rpm으로 2일간 배양한 후, 사멸률 99%일 때 현탁한 균체를 적당히 희석하여 GYEP 평판배지 (글로코오스 2%, 펩톤 1%, 효모 추출물 0.5%, 천일염 2%, 한천 2%, pH 7.0) 에서 2차례 계대하였다.
1차적으로, 다중불포화지방산 함유 오일 외에 생산되는 황산화 색소가 감소한 것으로 예측되는 균주를 선별하고자, 콜로니 색깔이 하얗게 변하는 콜로니를 선별하였다. 상기의 방법으로 얻어진 변이주를 트라우즈토카이트리움 속(Thraustochytrium genus) CJM01이라 명명하였고, 2018년 5월 30일자로 부다페스트 조약하의 국제 기탁기관인 한국생명공학연구원 생물자원센터 (Korean Collection for Type Cultures: KCTC)에 기탁하여 수탁번호 KCTC13538BP을 부여 받았다.
실시예 2-2: 신규 분리된 미세조류 및 돌연변이 균주의 다중불포화지방산 함유 오일 생산능 분석
상기 실시예 2-1로부터 선별된 CJM01와 KC01 균주의 다중불포화지방산 함유 오일 생산능을 비교하기 위하여 하기와 같이 배양하였다.
구제척으로, 본 출원의 트라우즈토카이트리움 속 미세조류인 KC01과 CJM01 균주 배양을 위하여, MJW01 배지 (글로코오스 30g/L, MgSO4·7H2O 3.0g/L, Na2SO4 10g/L, NaCl 1.0g/L, 효모 추출물 9.0g/L, MSG·1H2O 1.0g/L, NaNO3 1.0g/L, KH2PO4 0.1g/L, K2HPO4 0.5g/L, CaCl2 0.5g/L, 비타민 혼합 용액 10ml/L) 를 기본 배양 배지 조건으로 28℃, 300rpm, 1vvm, pH 7.5 에서 약 4일간 배양하였다. 원심분리법으로 균체를 회수한 후, PBS 버퍼로 3회 세척하고 55℃에서 12시간 건조하여 균체의 중량을 측정하였다.
건조균체를 활용한 도코사헥산엔산 함유 오일의 함량은 하기의 방법으로 측정하였다. 구체적으로, 건조균체 2g에 8.3M 염산용액을 가하여 80℃에서 미세조류 균체의 세포벽을 가수분해 한 후, 에틸 에테르(Ethyl ether) 30mL 및 석유 에테르(Petroleum ether) 20mL 을 첨가하고 30초간 섞어준 후 원심분리하는 과정을 3회 이상 반복하였다. 그 후, 분리된 용매 층을 회수하여, 미리 무게를 측정해 둔 라운드 플라스크에 옮긴 뒤 질소퍼징을 통해 용매를 제거하고 습기를 제거한 용기에 넣어 건조하였다. 건조된 오일의 무게를 측정하여, 전체 오일 함량을 산출하였다. 오일 중에 포함된 DHA 함량은 메탄올성 0.5N NaOH 및 14% 트리플루오로보란메탄올 (BF3)로 전처리하여 기체 크로마토그래피법으로 측정하였다.
상기 방법으로 배양한 트라우즈토카이트리움 속 KC01 균주 및 감마선 조사를 이용하여 선별한 CJM01 돌연변이 균주의 배양 성적을 표 2 및 표 3에 나타내었으며, 고기능성 오메가-3 오일인 DHA를 생산함을 확인하였다.
하기 표 2 및 표 3의 'Biomass'는 배양액 내의 균체 농도를 의미하는 것으로서, DCW(dry cell weight)와 혼용되어 사용될 수 있으며, DHA의 함량은 바이오매스 또는 TFA(total fatty acid) 대비 함량으로 표시하였다.
하기의 결과에서 보듯이, CJM01 돌연변이 균주의 DHA 생산량은 모균주 (트라우즈토카이트리움 속 KC01) 보다 향상된 것을 확인하였다 (표 2, 표 3). 구체적으로, 도코사헥사엔산 (DHA) 함량의 경우 CJM01 균주가 KC01 균주 대비 약 1.3배 생산이 증가하였다. 또한, 확보된 균체하락 없이 배양 시간이 현저히 단축되어 도코사헥사엔산 생산성 역시 CJM01 변이균주의 경우, KC01 모균주와 비교하여 약 1.7배 향상되었음을 확인하였다.
트라우즈토카이트리움 속 (Thraustochytrium sp.) KC01 모균주의 배양에 따른 도코사헥사엔산 (DHA) 함량 및 생산
Entry Time Biomass DHA Lipid DHA Productivity
(hr) g/L (%/Biomass) (%/TFA) % (g/l/h)
1 71.5 115.2 22.7 35.6 63.7 0.365
2 73.0 127.5 21.6 33.6 64.3 0.377
3 78.5 141.8 22.3 36.8 60.5 0.402
Avg. 74.3 128.2 22.2 35.3 62.8 0.381
트라우즈토카이트리움 속 (Thraustochytrium genus) CJM01 돌연변이 균주의 배양에 따른 도코사헥사엔산(DHA) 함량 및 생산
Entry Time Biomass DHA Lipid DHA Productivity
(hr) g/L (%/Biomass) (%/TFA) % (g/l/h)
1 57.3 123.0 29.3 47.6 61.5 0.629
2 55.5 133.5 27.5 45.5 60.4 0.661
3 54.8 133.5 28.0 57.1 49.0 0.682
Avg. 55.9 130.0 28.3 50.1 57.0 0.657
상기의 결과에 나타낸 바와 같이, 돌연변이 균주인 CJM01이 모균주인 KC01 균주 대비 DHA 함량 및 생산성 향상된 균주임을 확인하였다.
실시예 2-3: 신규 분리된 미세조류 및 돌연변이 균주의 아미노산 생산능 분석
또한 CJM01 균주의 배양 특성을 확인하기 위하여 상기의 배양액에서 토탈 아미노산 함량을 확인하고자 하였다.
구체적으로, 상기 각각의 배양액으로부터 10ml 샘플을 채취하여 증류수로 20배 희석한 후 여과하여 액체크로마토그래피를 이용하여 토탈아미노산 분석을 수행하였다. 토탈 아미노산 농도를 확인한 결과, KC01 모균주의 배양액 내 분석된 아스파테이트, 세린, 글루타메이트, 글라이신, 알라닌, 발린, 메치오닌, 이소류신, 루이신, 타이로신, 페닐알라닌, 라이신, 알지닌이 모두 10mg/L 이상 검출되는 반면, DHA 함량이 향상된 CJM01 균주의 배양액 내에는 대부분의 아미노산이 검출되지 않았다.
구체적으로, CJM01 변이균주의 경우, KC01 모균주 대비 생산된 DHA외 부산물로 생산된 토탈아미노산 농도가 평균 약 99% 이상 저감됨을 확인할 수 있었다 (표 4).
이는 CJM01 돌연변이 균주의 경우 KC01 모균주와 비교하여 균체성장이 동등한 수준으로 확인되었으며, 균체량 대비 총 지질 함량도 크게 감소하지 않을 것으로 확인되어, CJM01 균주가 공급된 탄소원을 KC01 모균주 대비 DHA 생합성 경로에 더 효과적으로 사용했음을 보여주고 있다.
트라우즈토카이트리움 속 (Thraustochytrium genus) KC01 모균주와 CJM01 돌연변이 균주의 배양에 따른 배양액 내 토탈 아미노산 분석
Amino acid T. KC01 모균주 T. CJM01 돌연변이균주
(mg/L) 1 2 3 Avg 1 2 3 Avg
Asp 20.3 28.9 12.3 20.5 0.0 0.0 0.0 0.0
Ser 49.5 85.2 28.6 54.4 0.0 0.0 0.0 0.0
Glu 91.6 108.4 193.0 131.0 0.0 0.0 0.0 0.0
Gly 32.4 52.8 28.7 38.0 0.0 0.0 0.0 0.0
Ala 72.6 104.4 41.1 72.7 0.0 0.0 0.0 0.0
Val 83.0 130.8 59.5 91.1 10.1 0.0 0.0 3.4
Met 32.1 58.2 16.0 35.4 0.0 0.0 0.0 0.0
Ile 42.1 77.0 18.8 46.0 0.0 0.0 0.0 0.0
Leu 93.0 166.9 41.8 100.6 0.0 0.0 0.0 0.0
Tyr 51.7 86.5 0.0 46.1 0.0 0.0 0.0 0.0
Phe 83.4 129.9 58.4 90.5 0.0 0.0 0.0 0.0
Lys 45.9 83.3 20.2 49.8 0.0 0.0 0.0 0.0
His 15.9 25.0 0.0 13.6 0.0 0.0 0.0 0.0
Arg 57.0 93.7 24.0 58.2 0.0 0.0 0.0 0.0
Sum 770.5 1231.1 542.5 848.0 10.1 0.0 0.0 3.4
실시예 3: 배지 조건 최적화
상기의 실시예 2에서 선별된 아미노산 저감 및 DHA 함량이 향상된 CJM01 균주을 이용하여 DHA 함량 및 생산성을 더욱 향상하기 위해, 배지 조건 최적화를 수행하였다.
구체적으로, 실시예 2-2에서 사용한 MJW01 배지를 기본으로 하고 배지 내 질소원 함량을 증대시키고 또한 생산비용을 절감하고자 하여, 유기질소원인 효모 추출물의 농도는 감량하고, 무기질소원인 (NH4)2SO4를 추가하고 NaNO3 농도는 증량하여, 최종적으로 MJW02 배지 (글루코오스 30g/L, MgSO4·7H2O 5.0g/L, Na2SO4 3g/L, NaCl 0.5g/L, 효모 추출물 1.0g/L, MSG·1H2O 1.0g/L, NaNO3 8.0g/L, (NH4)2SO4 3.0g/L, KH2PO4 0.1g/L, K2HPO4 0.5g/L, CaCl2 0.1g/L, 비타민 혼합 용액 10ml/L) 로 변형하였다.
상기 MJW01와 MJW02배지 조건을 비교하고자, 상기 배지에서 CJM01 균주의 배양을 진행하였다. 그 결과, 하기의 표 5에서 보듯이, 유기질소원인 효모 추출물의 농도가 저감 되면서 균체량은 감소하였지만, 무기질소원 증가를 통해 배양 시간이 현저히 단축되었다. 결과적으로, DHA 함량은 동등 이상이었으며 DHA 생산성이 1.13배 향상되는 것을 확인하였다.
배양 배지 조건에 따른 도코사헥사엔산(DHA) 함량 및 생산
배지 조건 Time Biomass DHA Lipid Productivity
(hr) g/L (%/Biomass) (%/TFA) % (g/l/h)
MJW01 59.3 133.4 26.0 42.6 61.0 0.584
MJW02 52.1 124.3 27.7 49.0 56.6 0.661
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2019007697-appb-I000001

Claims (9)

  1. 야생형에 비하여 도코사헥사엔산(DHA) 생산량이 증가되고, 아미노산 생산량이 감소된 트라우즈토카이트리움 속(Thraustochytrium genus) CJM01 미세조류(기탁번호: KCTC 13538BP).
  2. 제1항에 있어서, 상기 트라우즈토카이트리움 속 CJM01 미세조류는, 지방산 총 중량을 기준으로 40 내지 60 중량%의 도코사헥사엔산을 포함하는, 미세조류.
  3. 제1항에 있어서, 상기 트라우즈토카이트리움 속 CJM01 미세조류는 도코사헥사엔산 생산성이 0.5 내지 0.7 (g/l/h) 인, 미세조류.
  4. 제1항의 트라우즈토카이트리움 속 CJM01 미세조류를 배양하는 단계; 및 상기 미세조류, 이의 배양물, 이의 건조물, 또는 이의 파쇄물로부터 도코사헥사엔산 함유 바이오매스를 회수하는 단계를 포함하는, 바이오매스 제조방법.
  5. 제4항에 있어서, 상기 배양은, 종속영양 조건하에서 수행되는 것인, 바이오매스 제조방법.
  6. 제4항에 있어서, 상기 배양은 탄소원 및 질소원을 포함하는 배지를 사용하여 수행하는 것인, 바이오매스 제조방법.
  7. 제6항에 있어서, 상기 탄소원은 글루코오스, 프럭토오스, 말토오스, 갈락토오스, 만노오스, 수크로오스, 아라비노오스, 자일로오스 및 글리세롤로 이루어진 군으로부터 선택되는 1종 이상인 것인, 바이오매스 제조방법.
  8. 제6항에 있어서, 상기 질소원은 i) 효모 추출물, 우육 추출물(beef extract), 펩톤(peptone) 및 트립톤(tryptone)으로 이루어진 군으로부터 선택되는 유기질소원 또는 ii) 암모늄 아세테이트, 암모늄 나이트레이트, 암모늄 클로라이드, 암모늄 설페이트, 소듐 나이트레이트, 우레아 및 MSG(Monosodium glutamate)로 이루어진 군으로부터 선택되는 무기질소원인 것인, 바이오매스 제조방법.
  9. 제1항의 트라우즈토카이트리움 속 CJM01 미세조류를 배양하는 단계; 및 상기 미세조류, 이의 배양물, 이의 건조물, 또는 이의 파쇄물로부터 도코사헥사엔산 함유 지질을 회수하는 단계를 포함하는, 바이오오일 제조방법.
PCT/KR2019/007697 2018-06-29 2019-06-26 신규한 트라우즈토카이트리움 속 균주, 및 이를 이용한 다중불포화지방산 생산방법 WO2020004924A1 (ko)

Priority Applications (12)

Application Number Priority Date Filing Date Title
EP19825193.6A EP3760705B1 (en) 2018-06-29 2019-06-26 Novel microalgal strain of thraustochytrium genus and method of producing polyunsaturated fatty acid using the same
CN201980026079.6A CN112513247B (zh) 2018-06-29 2019-06-26 破囊壶菌属的新型微藻菌株及使用其生产多不饱和脂肪酸的方法
ES19825193T ES2932536T3 (es) 2018-06-29 2019-06-26 Nueva cepa de microalgas del género Thraustochytrium y método de producción de ácido graso poliinsaturado mediante el uso de la misma
CA3095279A CA3095279C (en) 2018-06-29 2019-06-26 Novel microalgal strains of thraustochytrium genus, and method of producing polyunsaturated fatty acids using the same
AU2019292277A AU2019292277B2 (en) 2018-06-29 2019-06-26 Novel microalgal strains of thraustochytrium genus, and method of producing polyunsaturated fatty acids using the same
US16/971,713 US11773417B2 (en) 2018-06-29 2019-06-26 Microalgal strains of Thraustochytrium genus, and method of producing polyunsaturated fatty acids using the same
RU2020128068A RU2754686C1 (ru) 2018-06-29 2019-06-26 Новые штаммы микроводорослей рода Thraustochytrium и способ получения полиненасыщенных жирных кислот с их использованием
MYPI2020004539A MY194114A (en) 2018-06-29 2019-06-26 Novel microalgal strains of thraustochytrium genus, and method of producing polyunsaturated fatty acids using the same
FIEP19825193.6T FI3760705T3 (fi) 2018-06-29 2019-06-26 Uusi thraustochytrium-suvun mikroleväkanta ja menetelmä polytyydyttymättömän rasvahapon tuottamiseksi sitä käyttämällä
BR112020019053A BR112020019053B8 (pt) 2018-06-29 2019-06-26 Microalgas, método de produção de uma biomassa, e, método de produção de um bio-óleo
DK19825193.6T DK3760705T5 (da) 2018-06-29 2019-06-26 Hidtil ukendte mikroalgestammer af Thraustochytrium-slægten og fremgangsmåde til fremstilling af flerumættede fedtsyrer ved hjælp af samme
JP2020545479A JP6947941B2 (ja) 2018-06-29 2019-06-26 新規なスラウストキトリウム属菌株及びそれを用いた多価不飽和脂肪酸生産方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2018-0075945 2018-06-29
KR1020180075945A KR102100650B1 (ko) 2018-06-29 2018-06-29 신규한 트라우즈토카이트리움 속 균주, 및 이를 이용한 다중불포화지방산 생산방법

Publications (1)

Publication Number Publication Date
WO2020004924A1 true WO2020004924A1 (ko) 2020-01-02

Family

ID=68500429

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/007697 WO2020004924A1 (ko) 2018-06-29 2019-06-26 신규한 트라우즈토카이트리움 속 균주, 및 이를 이용한 다중불포화지방산 생산방법

Country Status (19)

Country Link
US (1) US11773417B2 (ko)
EP (1) EP3760705B1 (ko)
JP (1) JP6947941B2 (ko)
KR (1) KR102100650B1 (ko)
CN (1) CN112513247B (ko)
AR (1) AR115667A1 (ko)
AU (1) AU2019292277B2 (ko)
BR (1) BR112020019053B8 (ko)
CA (1) CA3095279C (ko)
CL (1) CL2020002416A1 (ko)
DK (1) DK3760705T5 (ko)
ES (1) ES2932536T3 (ko)
FI (1) FI3760705T3 (ko)
HU (1) HUE060352T2 (ko)
MY (1) MY194114A (ko)
RU (1) RU2754686C1 (ko)
TW (1) TWI715088B (ko)
UY (1) UY38286A (ko)
WO (1) WO2020004924A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20230066973A (ko) 2021-11-08 2023-05-16 씨제이제일제당 (주) 세포 내 오일 함유량이 높은 신규한 스키조키트리움 속 균주 및 이를 이용한 오메가3를 함유한 오일 생산방법
KR20230066972A (ko) 2021-11-08 2023-05-16 씨제이제일제당 (주) 세포 내 오일 추출이 용이한 신규한 스키조키트리움 속 균주 및 이를 이용한 오메가3를 함유한 오일 생산방법

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070040751A (ko) 2004-05-03 2007-04-17 뉴트리노바 뉴트리션 스페셜티 앤드 푸드 인그레디엔츠 게엠베하 발효된 고도불포화지방산 기재의 수산양식장용 어류 사료
KR20150084148A (ko) 2014-01-13 2015-07-22 재단법인 탄소순환형 차세대 바이오매스 생산전환 기술연구단 미세조류의 바이오매스와 지질 생산성을 증가시키기 위한 재조합 벡터 및 이의 용도
KR20160098233A (ko) * 2013-12-19 2016-08-18 로께뜨프레르 트라우스토키트리움 속 미세조류의 바이오매스의 ｄｈａ의 강화 방법
JP2017518747A (ja) * 2014-05-22 2017-07-13 シンセティック ジェノミクス インコーポレーテッド ドコサヘキサエン酸を生産するためのラビリンチュラ綱株
US20180179560A1 (en) * 2016-12-22 2018-06-28 MARA Renewables Corporation Methods for producing biomass rich in dha, palmitic acid and protein using a eukaryotic microorganism

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6451567B1 (en) * 1988-09-07 2002-09-17 Omegatech, Inc. Fermentation process for producing long chain omega-3 fatty acids with euryhaline microorganisms
JP4280158B2 (ja) * 2002-12-27 2009-06-17 富士フイルム株式会社 ドコサヘキサエン酸生産能を有する微生物及びその利用
WO2005021735A1 (en) * 2003-09-01 2005-03-10 Novozymes A/S Method for increasing yield of biomass of and/or components of biomass from marine microorganisms
AU2005339110A1 (en) * 2005-12-16 2007-06-21 Avestha Gengraine Technologies Pvt.Ltd. Docosahexaenoic acid (DHA) producing thraustochytrid strain - SC1
CN103025862B (zh) * 2010-05-04 2015-02-11 韩国生命工学研究院 新型破囊壶菌类微藻及用其生产生物油的方法
FR3003872B1 (fr) * 2013-03-29 2017-02-10 Roquette Freres Procede de stabilisation des metabolites sensibles a l'oxydation produits par les microalgues du genre chlorella
WO2016059262A1 (es) * 2014-10-15 2016-04-21 Universidade De Santiago De Compostela Procedimiento de enriquecimiento de biomasa de microalgas en acidos grasos poliinsaturados
FR3031984B1 (fr) * 2015-01-27 2019-05-24 Roquette Freres Procede d'enrichissement de la biomasse de microalgues du genre traustochytrium en dha et en acides amines arg et glu
KR101654219B1 (ko) * 2015-04-21 2016-09-05 한국생명공학연구원 고 함량의 다중불포화지방산을 함유하는 트라우스토키트리대 속 균주 및 이의 용도
WO2017094804A1 (ja) * 2015-12-01 2017-06-08 日本水産株式会社 ドコサヘキサエン酸含有油及びその製造方法
FR3045069B1 (fr) * 2015-12-14 2019-01-25 Metabolium Procede d'enrichissement de protistes en lipides riches en acides gras polyinsatures, plus particulierement de classe omega 3, et sa mise en oeuvre pour la production de ces lipides

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070040751A (ko) 2004-05-03 2007-04-17 뉴트리노바 뉴트리션 스페셜티 앤드 푸드 인그레디엔츠 게엠베하 발효된 고도불포화지방산 기재의 수산양식장용 어류 사료
KR20160098233A (ko) * 2013-12-19 2016-08-18 로께뜨프레르 트라우스토키트리움 속 미세조류의 바이오매스의 ｄｈａ의 강화 방법
KR20150084148A (ko) 2014-01-13 2015-07-22 재단법인 탄소순환형 차세대 바이오매스 생산전환 기술연구단 미세조류의 바이오매스와 지질 생산성을 증가시키기 위한 재조합 벡터 및 이의 용도
JP2017518747A (ja) * 2014-05-22 2017-07-13 シンセティック ジェノミクス インコーポレーテッド ドコサヘキサエン酸を生産するためのラビリンチュラ綱株
US20180179560A1 (en) * 2016-12-22 2018-06-28 MARA Renewables Corporation Methods for producing biomass rich in dha, palmitic acid and protein using a eukaryotic microorganism

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
FRENZ ET AL., ENZYME MICROB. TECHNOL., vol. 11, 1989, pages 717
FURLAN, V. J. M. ET AL.: "Production of docosahexaenoic acid (DHA) from Thraustochytrium sp. ATCC 26185 using differents nitrogen concentrations", BOLETIM DO CENTRO DE PESQUISA DE PROCESSAMENTO DE ALIMENTOS (B.CEPPA), vol. 32, no. 1, 2014, pages 1 - 10, XP055667295 *
INOUE ET AL., BIOMASS BIOENERGY, vol. 6, no. 4, 1993, pages 269 - 274
MAOWU, BIOSOURCE TECHNOLOGY, vol. 97, 2006, pages 841 - 846
MENDES ET AL., INORGANICA CHIMICA ACTA, vol. 356, 2003, pages 328 - 334
MINOWA ET AL., FUEL, vol. 74, no. 12, 1995, pages 1735 - 1738
SAWAYAMA ET AL., BIOMASS AND BIOENERGY, vol. 17, 1999, pages 33 - 39
YANG, H.-L. ET AL.: "Isolation and characterization of Taiwan ese heterotrophic microalgae: screening of strains for docosahexaenoic acid (DHA) production", MARINE BIOTECHNOLOG Y, vol. 12, 2010, pages 173 - 185, XP019784661 *

Also Published As

Publication number Publication date
AU2019292277A1 (en) 2021-02-04
DK3760705T3 (da) 2023-01-09
TWI715088B (zh) 2021-01-01
CL2020002416A1 (es) 2020-12-28
DK3760705T5 (da) 2024-06-10
UY38286A (es) 2019-08-30
ES2932536T3 (es) 2023-01-20
KR102100650B1 (ko) 2020-04-16
CA3095279C (en) 2023-04-04
FI3760705T3 (fi) 2023-01-13
US11773417B2 (en) 2023-10-03
JP2021514645A (ja) 2021-06-17
TW202016289A (zh) 2020-05-01
CA3095279A1 (en) 2020-01-02
US20210002680A1 (en) 2021-01-07
BR112020019053B1 (pt) 2021-12-07
CN112513247A (zh) 2021-03-16
EP3760705B1 (en) 2022-11-09
AR115667A1 (es) 2021-02-10
KR20200002448A (ko) 2020-01-08
CN112513247B (zh) 2023-11-14
RU2754686C1 (ru) 2021-09-06
AU2019292277B2 (en) 2022-09-01
BR112020019053A2 (pt) 2021-01-12
MY194114A (en) 2022-11-14
BR112020019053B8 (pt) 2022-01-25
JP6947941B2 (ja) 2021-10-13
EP3760705A4 (en) 2021-05-19
EP3760705A1 (en) 2021-01-06
HUE060352T2 (hu) 2023-02-28

Similar Documents

Publication Publication Date Title
WO2022124590A1 (ko) 신규한 스키조키트리움 속 균주 및 이를 이용한 다중불포화지방산 생산방법
EP3816293B1 (en) Strains and processes for single cell protein or biomass production
WO2020004924A1 (ko) 신규한 트라우즈토카이트리움 속 균주, 및 이를 이용한 다중불포화지방산 생산방법
WO2022124482A1 (ko) 단일 미세조류로부터 단백질 및 오메가-3 지방산을 포함하는 바이오매스를 제조하는 방법 및 이에 의해 제조된 바이오매스
WO2023080400A1 (ko) 세포 내 오일 함유량이 높은 신규한 스키조키트리움 속 균주 및 이를 이용한 오메가3를 함유한 오일 생산방법
KR101654219B1 (ko) 고 함량의 다중불포화지방산을 함유하는 트라우스토키트리대 속 균주 및 이의 용도
WO2024128494A1 (ko) 신규한 스키조키트리움 속 균주 및 이를 이용한 오메가-3를 함유한 오일 생산방법
WO2023080399A1 (ko) 세포 내 오일 추출이 용이한 신규한 스키조키트리움 속 균주 및 이를 이용한 오메가3를 함유한 오일 생산방법
JP3570741B2 (ja) アスタキサンチンの製造法
WO2024150941A1 (ko) 신규한 스키조키트리움 속 균주 및 이를 이용한 아라키돈산을 함유한 오일 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19825193

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020545479

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3095279

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019825193

Country of ref document: EP

Effective date: 20200930

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020019053

Country of ref document: BR

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 112020019053

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200923

ENP Entry into the national phase

Ref document number: 2019292277

Country of ref document: AU

Date of ref document: 20190626

Kind code of ref document: A