WO2019124951A1 - Gpcr heteromer inhibitors and uses thereof - Google Patents

Gpcr heteromer inhibitors and uses thereof Download PDF

Info

Publication number
WO2019124951A1
WO2019124951A1 PCT/KR2018/016166 KR2018016166W WO2019124951A1 WO 2019124951 A1 WO2019124951 A1 WO 2019124951A1 KR 2018016166 W KR2018016166 W KR 2018016166W WO 2019124951 A1 WO2019124951 A1 WO 2019124951A1
Authority
WO
WIPO (PCT)
Prior art keywords
cxcr4
gpcrx
inhibitor
treating
heteromer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2018/016166
Other languages
English (en)
French (fr)
Other versions
WO2019124951A9 (en
Inventor
Dong Seung Seen
Eun Hee Kim
Jae Yeon Jeong
Chang Soo Yang
Mi Lim Lee
So Hui Kim
Won Ki Huh
Yong Bhum Song
Chul O Park
Hye Ryung Park
Ji Yeong Lee
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GPCR Therapeutics Inc
Original Assignee
GPCR Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP21174644.1A priority Critical patent/EP3900712A1/en
Priority to CA3086337A priority patent/CA3086337A1/en
Priority to BR112020012075-8A priority patent/BR112020012075A2/pt
Priority to AU2018388302A priority patent/AU2018388302B2/en
Priority to KR1020267002674A priority patent/KR20260035212A/ko
Priority to JP2020535043A priority patent/JP7517986B2/ja
Priority to CN201880089801.6A priority patent/CN111741752A/zh
Priority to EP18892135.7A priority patent/EP3727371A4/en
Application filed by GPCR Therapeutics Inc filed Critical GPCR Therapeutics Inc
Priority to KR1020207019080A priority patent/KR20200103018A/ko
Publication of WO2019124951A1 publication Critical patent/WO2019124951A1/en
Publication of WO2019124951A9 publication Critical patent/WO2019124951A9/en
Anticipated expiration legal-status Critical
Priority to JP2024074184A priority patent/JP7818648B2/ja
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/195Chemokines, e.g. RANTES
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • A61K31/404Indoles, e.g. pindolol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/13Amines
    • A61K31/135Amines having aromatic rings, e.g. ketamine, nortriptyline
    • A61K31/138Aryloxyalkylamines, e.g. propranolol, tamoxifen, phenoxybenzamine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/21Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A61K31/22Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin
    • A61K31/222Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acyclic acids, e.g. pravastatin with compounds having aromatic groups, e.g. dipivefrine, ibopamine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/403Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/439Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom the ring forming part of a bridged ring system, e.g. quinuclidine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/451Non condensed piperidines, e.g. piperocaine having a carbocyclic group directly attached to the heterocyclic ring, e.g. glutethimide, meperidine, loperamide, phencyclidine, piminodine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/4523Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/4545Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • A61K31/5415Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame ortho- or peri-condensed with carbocyclic ring systems, e.g. phenothiazine, chlorpromazine, piroxicam
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/04Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/12Cyclic peptides, e.g. bacitracins; Polymyxins; Gramicidins S, C; Tyrocidins A, B or C
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/286Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against neuromediator receptors, e.g. serotonin receptor, dopamine receptor
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/5758Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • A61K2039/507Comprising a combination of two or more separate antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the invention disclosed herein relates generally to inhibitors of novel, functional GPCR heteromers, and more specifically to inhibitors of CXC receptor 4 (CXCR4)-G protein-coupled receptor (GPCR) heteromers that display enhanced signaling downstream of CXCR4 as a result of functional heteromer formation and that are associated with cancers and other diseases.
  • CXCR4 CXC receptor 4
  • GPCR G protein-coupled receptor
  • G protein-coupled receptors are seven-transmembrane domain cell surface receptors that are coupled to G proteins. GPCRs mediate diverse sensory and physiological responses by perceiving stimuli including light, odorants, hormones, neurotransmitters, chemokines, small lipid molecules, and nucleotides. There are approximately 800 GPCR genes in human genome, and more than half of them are predicted to encode sensory receptors such as olfactory, visual, and taste receptors (Bjarnadottir, et al., 2006).
  • GPCRs have physiologically important roles in embryonic development, behavior, mood, cognition, regulation of blood pressure, heart rate, and digestive processes, regulation of immune system and inflammation, maintenance of homeostasis, and growth and metastasis of cancers (Filmore 2004, Overington, et al., 2006). GPCRs are associated with many diseases and are the targets of approximately 40% of all prescription drugs (Filmore 2004).
  • CXC receptor 4 is a member of the chemokine receptor family GPCR.
  • CXCR4 is expressed on most of the hematopoietic cell types, bone marrow stem cells, endothelial progenitor cells, vascular endothelial cells, neurons and neuronal stem cells, microglia and astrocytes (Klein and Rubin 2004, Griffith, et al., 2014).
  • CXCR4 responds to its ligand C-X-C Motif Chemokine ligand 12 (CXCL12), also known as Stromal cell-derived factor 1 (SDF-1), and has essential roles in the embryonic development of the hematopoietic, cardiovascular, and nervous systems (Griffith, et al., 2014).
  • CXCR4 was discovered as a co-receptor for human immunodeficiency virus (HIV), and has important roles in the homing of hematopoietic stem cells (HSCs) to the bone marrow, inflammation, immune surveillance of tissues, and tissue regeneration in adult (Chatterjee, et al. 2014). Mutations in the C-terminus of CXCR4 cause persistent CXCR4 activation, leading to a congenital immune deficiency called WHIM syndrome (Warts, Hypogammaglobulinemia, Infections, and Myelokathexis) characterized by neutropenia and B cell lymphopenia (Hernandez, et al., 2003; Kawai, 2009). CXCR4 also has essential roles in T and B lymphocyte development within lymphoid organs and the thymus during development and in adult (Allen, et al., 2004; Ara, et al., 2003).
  • HCV human immunodeficiency virus
  • CXCR4 is implicated in various immune and autoimmune diseases, such as HIV infection, ischaemia, wound healing, rheumatoid arthritis, systemic lupus erythematosus (SLE), interstitial pneumonias, vascular disease, multiple sclerosis, pulmonary fibrosis, and allergic airway disease (Chu et al., 2017; Debnath, et al., 2013; Domanska, et al., 2013).
  • autoimmune diseases such as HIV infection, ischaemia, wound healing, rheumatoid arthritis, systemic lupus erythematosus (SLE), interstitial pneumonias, vascular disease, multiple sclerosis, pulmonary fibrosis, and allergic airway disease (Chu et al., 2017; Debnath, et al., 2013; Domanska, et al., 2013).
  • CXCR4 The involvement of CXCR4 in rheumatoid arthritis was demonstrated by the increased accumulation of CXCR4-positive T-cells in arthritic joints, and a reduction in collagen-induced arthritis in CXCR4-deficient mice (Buckley et al., 2000; Chung et al., 2010). Moreover, CXCR4 antagonist, AMD3100, alleviated collagen-induced arthritis significantly in a mouse model (De Klerck et al., 2005). CXCR4 also regulates pulmonary fibrosis by recruiting circulatory fibroblasts and bone marrow-derived progenitor cells during lung injury, and AMD3100 demonstrated a preventive effect in bleomycin-induced mouse pulmonary fibrosis (Song et al., 2010).
  • CXCR4/CXCL12 axis is also implicated in the pathogenesis of SLE.
  • inflammatory cells such as monocytes, neutrophils, and B-cells showed increased expression of CXCR4 and migrated toward skin and lung that overexpress CXCL12 predominantly (Chong and Mohan, 2009; Wang et al., 2009; Wang et al., 2010).
  • CXCR4 is also involved in brain and cardiac diseases including brain injury, stroke, myocardial infarction, atherosclerosis and injury-induced vascular restenosis (Cheng et al., 2017; Domanska, et al., 2013; Doring, et al., 2014).
  • CXCR4 chronic lymphocytic leukemia
  • CXCR4 is subsequently characterized to be responsible for breast cancer metastasis to organs that express higher levels of CXCL12 such as lymph nodes, bone marrow, lung, and liver (Muller, et al., 2001). After initial discovery, increasing evidence indicates that CXCR4 is associated with a variety of different cancers and has multiple potential roles in malignancy.
  • CXCR4 is overexpressed in more than 23 human cancers, including breast cancer, lung cancer, brain cancer, kidney cancer (or renal cell carcinoma), pancreatic cancer, ovarian cancer, prostate cancer, melanoma, leukemia, multiple myeloma, gastrointestinal cancers, and soft tissue sarcomas, and regarded as a poor prognosis marker (Domanska, et al., 2013; Chatterjee, et al., 2014; Furusato et al., 2010).
  • CXCR4 is the only chemokine receptor that is expressed by the majority of cancer types (Liang et al., 2015), and stimulates tumor cell growth, survival, and invasiveness in response to CXCL12 secreted by the cancer cells and the surrounding cancer-associated cells (Burger and Kipps, 2006; Chatterjee et al., 2014; Domanska et al., 2013).
  • CXCR4/CXCL12 axis plays a central role in tumor growth, invasion, angiogenesis, vasculogenesis, metastasis, drug resistance, and cancer cell-tumor microenvironment interaction (D'Alterio et al., 2012; Domanska et al., 2013; Guo et al., 2016)
  • CXCR4 critical role of CXCR4 in cancer cell proliferation and tumor growth was demonstrated in various experimental models in vitro and in vivo such as orthotopic, subcutaneous human xenograft, and transgenic mouse models using CXCR4 antagonists (Domanska et al., 2013).
  • the Daoy medulloblastoma cells and U87 glioblastoma cells showed CXCR4 expression and exhibited dose-dependent increase in proliferation to a gradient of CXCL12 in vitro , and systemic administration of AMD3100 inhibited the growth of intracranial U87 and Daoy cell xenografts (Rubin et al., 2003).
  • the main mechanism of action described for the small molecules or peptides antagonists of CXCR4 is centered on their ability to mobilize malignant cells from the BM, thereby sensitizing them to chemotherapy. These agents have shown limitations regarding short half-lives, making their adequate management over long periods of time difficult (Hendrix et al., 2000). In contrast, therapeutic monoclonal antibodies have the advantage of having more prolonged half-lives, and are suitable for less frequent dosing. Additionally, human IgG antibodies have the ability to induce cell death upon binding to their target protein on cancer cells, via interaction with Fc-receptor on effector cells, including antibody-dependent cell mediated cytotoxicity/phagocytosis (ADCC/ADCP) (Jiang et al., 2011). Such cytotoxic mechanism of action are not inherent to small molecules or peptides, and have been demonstrated to play a key role in the clinical activity of several therapeutic antibodies (Wang et al., 2015).
  • CXCR4 using a neutralizing anti-CXCR4 antibody or CXCR4 specific antagonists inhibited primary tumor growth as well as metastasis to secondary organs in breast cancer, colon cancer, hepatocellular carcinoma, osteosarcoma, and melanoma (De Falco et al., 2007; Hassan et al., 2011; Huang et al., 2009; Kim et al., 2008; Muller et al., 2001; Schimanski et al., 2006; Smith et al., 2004; Zeelenberg et al., 2003).
  • Cancer stem cells are a population of cancer cells with properties such as infinite self-renewal, potential to differentiate into multiple cancer lineages, ability to adopt a quiescent state, and intrinsic high resistance to chemo- and radio-therapy. CSCs are considered as the major cause of cancer relapse and recurrence after standard anti-proliferative therapy. Therefore, targeting cancer stem cells are expected to provide more effective therapeutic interventions to eradicate the cancer and prevent relapse (Batlle and Clevers, 2017; Reya et al., 2001; Wurth, 2016).
  • CSCs also express CXCR4, and CXCR4 directs the trafficking and metastasis of these cells to the CXCL12-rich microenvironments such as bone marrow and subventricular zone in the brain that favor cancer stem cell maintenance, survival and growth.
  • CXCR4 antagonists have been shown to mobilize CSCs from these protective microenvironments, and sensitize them to conventional chemo- and radiotherapy, and anti-angiogenic therapy (Burger and Kipps, 2006; Burger and Peled, 2009; Furusato et al., 2010; Redondo-Munoz et al., 2006; Walenkamp et al., 2017; Wurth, 2016).
  • tumor mass contains various cell types such as stromal fibroblasts, immune cells, endothelial cells, connective tissue, and extracellular matrix in addition to cancer cells that constitute tumor microenvironment (TME) or cancer cell niches.
  • CXCR4/CXCL12 axis plays pivotal roles in tumor cell-microenvironment interaction that support tumor structure, growth, angiogenesis, and evasion of immune surveillance in various cancers of both the hematopoietic and nonhematopoietic system (Burger and Kipps, 2006; Burger and Peled, 2009; Walenkamp et al., 2017).
  • CXCL12 can promote tumor angiogenesis by recruiting endothelial cells to the TME directly, or indirectly by attracting CXCR4-positive inflammatory cells to the tumor mass, and making them to secret proangiogenic factors (Owen and Mohamadzadeh, 2013; Walenkamp et al., 2017).
  • VEGF Vascular endothelial growth factor
  • bevacizumab increased the expression of CXCL12 and CXCR4 in cancer cells, and increased plasma levels of CXCL12 in these patients were associated with rapid disease progression and metastasis (Owen and Mohamadzadeh, 2013; Xu et al., 2009).
  • CXCR4/CXCL12 axis has been demonstrated to disrupt the tumor microenvironment (TME) and expose the tumor cells to immune attack by decreasing the infiltration of myeloid-derived suppressor cells, by increasing the ratio of CD8+ cytotoxic T cells to Treg cells, or eliminating tumor re-vascularization (Burger et al., 2011; Domanska et al., 2013; Walenkamp et al., 2017).
  • CXCR4 antagonists AMD3100 or T22
  • immune checkpoint inhibitors such as cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4) antibodies, programmed cell death protein 1 (PD-1), and programmed cell death ligand 1 (PD-L1) antibodies and greatly increased their antitumor activity in a model of pancreatic ductal adenocarcinoma, advanced hepatocellular carcinoma (HCC), and CXCR4-transduced B16 melanoma (Chen et al., 2015; Feig et al., 2013; Lee et al., 2006; Scala, 2015; Walenkamp et al., 2017).
  • CXCR4/CXCL12 axis offers benefit to the conventional immune checkpoint inhibitors.
  • CXCR4 inhibitors can be divided into 5 categories:
  • non-peptide small molecule antagonists such as AMD3100 (plerixafor, MozobilTM, Genzyme (MA, USA); (Cashen et al., 2007; Donzella et al., 1998), AMD070 (AMD11070; Crawford and Alan Kaller, 2008; Stone et al., 2007), AMD3465 (Genzyme Corp., Biochem Pharmacol.
  • small-peptide antagonists such as anti-HIV peptides T22 (Masuda et al., 1992), T134 and T140 (Tamamura et al., 1998), BKT140 (a/k/a BL-8040; TF14016; 4F-Benzoyl-TN14003, Biokine Therapeutics Ltd.
  • CXCR4 antibodies to CXCR4, such as ulocuplumab (MDX1338/BMS-936564; Kuhne et al., 2013), PF-06747143 (Pfizer; Liu et al., 2017), 12G5 (Endres et al., 1996), i-bodies (AD-114, AD-114-6H, AD-114-Im7-FH, and AD-114-PA600-6H; AdAlta; Griffiths et al., 2016; Griffiths et al., 2018), nanobodies (238D2 and 238D4; Jahnichen et al., 2010; Proc. Natl Acad. Sci. 2010, USA 107(47), 20565-20570), and ALX-0651 (Ablynx, biparatopic nanobody, ClinicalTrials.gov Identifier: NCT01374503);
  • CXCL12 ligand (CXCL12) analogs with suppressive activity, such as CTCE-9908 (Chemokine Therapeutics (BC, Canada); Wong et al., 2014); and
  • radiolabeled CXCR4 ligands such as [99mTc]O2-AMD3100 (Hartimath et al., 2013), [68Ga]pentixafor (Demmer et al., 2011; Gourni et al., 2011), [177Lu]pentixather, and [90Y]pentixather (Herrmann et al., 2016).
  • AMD3100 JM 3100, plerixafor, marketed as Mozobil is a CXCR4-specific small molecule antagonist that inhibits CXCL12-mediated calcium mobilization and chemotaxis in various cell types (Hatse, Princen et al. 2002), and prevents tumor growth in mouse xenograft models (Rubin, Kung et al. 2003, Cho, Yoon et al. 2013, Liao, Fu et al. 2015). AMD3100 was originally developed for HIV therapy (as an HIV entry blocker that specifically antagonizes CXCR4, one of the HIV entry co-receptors), but was approved by the U.S.
  • AMD3100 for HIV therapy was suspended due to significant side effects including thrombocytopenia, premature ventricular contractions, and leukocytosis following long-term inhibition of CXCR4/CXCL12 axis (Hendrix, et al., 2004; Peled, et al., 2012). Although investigating the possibility of the use of AMD3100 as an anticancer drug is underway, lack of oral availability and some severe side effects accompanying with long-term use need to be overcome (Peled, et al., 2012).
  • subcutaneous AMD3100 was approved in combination with G-CSF for autologous stem cell mobilization and transplantation for patients in the US with non-Hodgkin lymphoma (NHL) or multiple mylenoma for up to 4 consecutive days, and for patients in Europe with multiple mylenoma or lymphoma for 2-4 consecutive days and for up to 7 consecutive days, respectively (DiPersio et al., 2009a; DiPersio et al., 2009b; Keating, 2011). So far, AMD3100 is the only CXCR4 antagonist approved by the FDA.
  • AMD3100 has been shown to inhibit CXCL12-mediated calcium mobilization and chemotaxis in various cancer cell types expressing CXCR4 (Hatse et al., 2002), and has demonstrated significant anti-tumor activity with decreased metastasis and increased overall survival in various mouse xenograft models (Burger et al., 2011; Chatterjee et al., 2014; Cho et al., 2013; Debnath et al., 2013; Domanska et al., 2013; Liao et al., 2015; Rubin et al., 2003; Walenkamp et al., 2017).
  • AMD3100 exhibits partial agonism for CXCR4 in vitro and increases the proliferation of meloma cells (Kim et al., 2010; Zhang et al., 2002). AMD3100 also acts as a positive allosteric modulator of CXCR7, an alternative chemokine receptor for CXCL12, and increases CXCL12 binding to CXCR7 (Kalatskaya et al., 2009). Like CXCR4, CXCR7 is also highly expressed by many types of cancers and is associated with tumor metastasis (Decaillot et al., 2011; Zabel et al., 2011). Due to the complex properties of AMD3100, the exact role of AMD3100 on cancer needs to be investigated carefully.
  • AMD3100 has been clinically evaluated as anticancer drug in combination with conventional cytotoxic drugs such as mitoxantrone, etoposide, cytrabine, daunorubicin, azacitidine, lenalidomide, decitabine, clofarabine, fludarabine, and/or idarubicin; receptor tyrosine kinase inhibitors AC220 and sorafenib; HSP90 inhibitor (Ganetespib); G-CSF; proteasome inhibitor (bortezomib); or monoclonal antibody (rituximab) in hematological malignancies including acute myeloid leukemia (AML), MM, Myelodysplastic Syndromes (MDS), CLL, and small lymphocytic lymphoma (SLL) (ClinicalTrials.gov Identifier: NCT00512252, NCT00694590, NCT00903968, NCT00990054, NCT01065129,
  • AMD3100 was examined for interrupting lymphoid tumor microenvironment communication (NCT01610999) and for chemosensitization in combination with other anti-cancer drugs in patients with relapsed or refractory AML, ALL, and MDS (ClinicalTrials.gov identifier: NCT00906945 and NCT01319864).
  • AMD3100 has been or is also being evaluated in solid tumors including high grade glioma, Ewing's sarcoma, neuroblastoma, pancreatic, ovarian, and colorectal cancers alone or in combination with angiogenesis inhibitor bevacizumab (ClinicalTrials.gov identifier: NCT01339039, NCT01977677, NCT01288573, NCT02179970, and NCT03277209).
  • AMD3100 has been tested or is currently being evaluated for the mobilization of the hematopoietic stem/progenitor/precursor cells in patients with various hematological malignancies and diseases including AML, MDS, neutropenia, beta-thalassemia, sickle cell disease, WHIMS, Fanconi anemia, Wiskott-Aldrich Syndrome, systemic mastocytosis ((Domanska et al., 2013), NCT01058993, NCT01206075, NCT03226691, NCT00967785, NCT02678533, NCT03019809, and NCT00001756).
  • CD34+ cells endothelial progenitor cells
  • EPC endothelial progenitor cells
  • CD117+ progenitor cells CD117+ progenitor cells in patients with diabetes, wounds, cirtical limb ischemia, chronic obstructive pulmonary disease (COPD), cystic fibrosis, pulmonary fibrosis (ClinicalTrials.gov identifier: NCT02056210, NCT02790957, NCT01916577, NCT03182426).
  • AMD070 also referred to herein as AMD-070, AMD11070, AMD-11070, or X4P-001; X4 Pharmaceuticals
  • AMD070 has demonstrate antitumor activity in various tumor models (Morimoto et al., 2016; O'Boyle et al., 2013; Parameswaran et al., 2011) and has been studied in a phase I/II clinical trial in HIV infected subjects (ClinicalTrials.gov identifier: NCT00089466, (Debnath et al., 2013).
  • AMD070 is now in Phase II/III clinical trial in patients with WHIM syndrome, advanced melanoma, and renal cell carcinoma alone or together with pembrolizumab, nivolumab, or axitinib (ClinicalTrials.gov identifier: NCT03005327, NCT02823405, NCT02923531, and NCT02667886).
  • BKT140 is under clinical development for hematopoietic stem and progenitor cell mobilization in various hematopoietic malignancies (ClinicalTrials.gov identifier: NCT02502968, NCT03154827, NCT02763384, NCT02639559, and NCT02462252).
  • BKT140 is in Phase II clinical trials for interfering tumor microenvironment interaction in subjects with AML in combination with cytarabine (ClinicalTrials.gov identifier: NCT02502968).
  • CTCE-9908 (Chemokine Therapeutics Corp., Canada), a peptide inhibitor of CXCR4, reduced metastases in mouse models of osteosarcoma and melanoma (Kim et al., 2008).
  • CTCE-9908 was designated as an orphan drug for the treatment of osteosarcoma by the FDA in 2005. There is no further development after phase I/II clinical trial has been completed in 2008 (Debnath, et al., 2013).
  • MSX-122 (Altiris Therapeutics), a small molecule CXCR4 antagonist, has been abandoned after clinical trial in patients with solid tumors (ClinicalTrials.gov identifier: NCT00591682). Two major setbacks have been reported in 2017 in the field of developing CXCR4 antagonists as anti-cancer drugs.
  • BMS-936564 / MDX1338, (Kuhne et al., 2013), a fully human anti-CXCR4 antibody, in patients with solid tumors for lack of efficacy (https://seekingalphacom/article/4057548-bristol-failure-makes-small-dent-cxcr4-blocking-approach?page 2).
  • Eli Lilly decided to abandon a few anti-cancer programs including LY2510924, which is a CXCR4 peptide antagonist (http://wwwfiercebiotechcom/biotech/lilly-puts-two-thirds-mid-phase-cancer-pipeline-up-for-sale-major-shake-up-r-d-priorities) after a series of clinical trials in solid tumors (ClinicalTrials.gov identifier: NCT02737072, NCT01391130, and NCT01439568). These events indicate that development of CXCR4 antagonists as anti-cancer drugs, especially for solid tumors, is an ongoing challenge.
  • USL311 (Upsher-Smith) is under phase I and phase II in patients with solid tumors and glioblastoma multiforme (GBM), respectively (ClinicalTrials.gov identifier: NCT02765165); GMI-1359 (Glycomimetics) is in phase I trial (ClinicalTrials.gov identifier: NCT02931214).
  • PF-06747143 (Pfizer), a humanized anti-CXCR4 antibody, is in phase I clinical trial in patients with AML either alone or combined with chemotherapy (ClinicalTrials.gov identifier: NCT02954653, (Liu et al., 2017)).
  • AD-114 (i-body, AdAlta; (Griffiths et al., 2018) is a humanized shark anti-CXCR4 antibody and received orphan drug designation from united states FDA for a drug candidate used for treatment of Idiopathic Pulmonary Fibrosis in 2017 (https://www.reuters.com/article/idUSFWN1F70Y0).
  • AD-114 study is mainly focused on fibrotic conditions, including wet age-related macular degeneration and non-alcoholic fatty liver disease (https://lungdiseasenews.com/2017/08/23/adalta-present-research-on-investigative-therapy-ad-114-at-ipf-summit/).
  • POL6326 (balixafortide, Polyphor), a peptide CXCR4 antagonist, has been under clinical evaluation in subjects with breast cancer (ClinicalTrials.gov identifier: NCT01837095), hematologic malignancies (ClinicalTrials.gov identifier: NCT01413568), and stem cell mobilization and healing in patients with acute myocardial infarction (ClinicalTrials.gov identifier: NCT01905475).
  • Radiolabeled CXCR4 ligands such as [99mTc]O2-AMD3100 and [68Ga]Pentixafor has been used for preclinical or clinical SPECT or PET imaging of CXCR4 expression (Demmer et al., 2011; Gourni et al., 2011; Hartimath et al., 2013; Walenkamp et al., 2017).
  • PET imaging with [68Ga]Pentixafor has demonstrated increased expression of CXCR4 not only in hematologic and solid tumors such as leukemia, lymphoma, MM, adrenocortical carcinoma, and SCLC, but also in other pathological conditions such as splenosis, stroke, atherosclerosis, and myocardial infartion (Walenkamp et al., 2017).
  • a peptide CXCR4 ligand labeled with ⁇ - or ⁇ -emitters has been tested in more than 30 therapies as CXCR4-directed endoradiotherapy together with standard chemotherapy in patients with hematologic malignancies (Walenkamp et al., 2017).
  • CXCR4 antagonists are administered with cytotoxic drugs or radiotherapy, HSCs mobilized into periphery would be exposed to the effects of cytotoxic treatment which could exacerbate cytopenias. Cardiac complications observed in patients treated with AMD3100 also raised general concern in prolonged use of CXCR4 antagonists as anticancer drugs.
  • GPCR heteromers offer new possibilities for developing more specific and disease-restricted therapeutics.
  • GPCRs were considered to be monomeric since monomeric GPCRs can activate G proteins by inducing conformational changes of the heptahelical domain upon ligand binding (Pin et al., 2008; Okada et al., 2001).
  • increasing evidence demonstrates that GPCRs may form oligomers, either homo- or hetero-oligomers, and GPCR heteromers can exhibit specific properties that clearly distinguish them from existing well-defined monomers, such as signaling pathways, ligand binding affinities, internalization, and recycling (De Falco et al., 2007; Ferre et al., 2010; Gomes et al., 2016).
  • GPCR oligomerization may provide a way to increase the diversity of GPCR entities with a limited number of genes (Park and Palczewski, 2005).
  • identification of novel GPCR heteromers would offer new possibilities for understanding the roles of GPCR heteromers in specific tissues and in specific diseases, as well as providing new opportunities for developing more efficient therapeutics with less side effects.
  • CXCR4 also forms heteromers with different GPCRs. So far CXCR4 is known to interact with GPCRs in the chemokine receptor family (CCR2 (Rodriguez-Frade et al., 2004; Sohy et al., 2007; Sohy et al., 2009; Armando et al., 2014), CCR5 (Agrawal et al., 2004; Rodriguez-Frade et al., 2004; Sohy et al., 2007, Sohy et al., 2009; Martinez-Munoz et al., 2014), CXCR3 (Watts et al., 2013), and CXCR7 (Sierro et al., 2007; Levoye et al., 2009; Decaillot et al., 2011)), chemerin chemokine-like receptor 1 (CMKLR1) (de Poorter et al., 2013), ⁇ -opioid receptor (OPRD) (P
  • ADRA1A Tripathi et al., 2015
  • ADRA1B Tripathi et al., 2015
  • ADRB2 LaRocca et al. 2010; Nakai et al., 2014
  • CXCR4-CCR2 and CXCR4-CCR5 heteromers were first noticed by studying HIV infection.
  • Rodriguez-Frade et al. showed that CCR2-01, a CCR2-specific monoclonal antibody, did not compete with CCL2 for binding to CCR2 or trigger CCR2 signaling, but blocked replication of monotropic (R5) and T-tropic (X4) HIV strains by inducing oligomerization of CCR2 with CCR5 or CXCR4 (Rodriguez-Frade et al., 2004).
  • CCR5D32 specifically inhibited CCR5 and CXCR4 cell surface expression by heteromerization with CCR5 and CXCR4, thereby inhibiting HIV coreceptor activity of CCR5 and CXCR4 in CD4+ cells.
  • Co-expression of CCR5 was shown to prevent HIV-1 gp120 binding to the cell surface and to reduce X4 HIV-1 infectivity by inducing CCR5-CD4-CXCR4 oligomerization and conformational changes in CD4 and CXCR4 (Martinez-Munoz et al., 2014).
  • Sohy et al. reported the existence of negative binding cooperativity between the subunits of CXCR4-CCR2 and CXCR4-CCR5 heteromers, i.e. the ligands of one receptor competed for the binding of a specific tracer of the other, in recombinant cell lines and primary leukocytes (Sohy et al., 2007; Sohy et al., 2009).
  • TAK-779 the CCR2 and CCR5 antagonist, prevented calcium mobilization and chemotaxis initiated by the CXCR4 agonist CXCL12 in cells co-expressing CCR2 and CXCR4 or CCR5 and CXCR4 (Sohy et al., 2007; Sohy et al., 2009).
  • Armando et al. showed that CXCR4 and CCR2 can form homo- and hetero-oligomers, and co-activation of CCR2 and CXCR4 with the human monocyte chemotactic protein 1 (MCP-1) and CXCL12 caused a synergistic increase in calcium mobilization (Armando et al., 2014).
  • MCP-1 human monocyte chemotactic protein 1
  • CXCR4 also interacts with ACKR3, also known as CXCR7, a chemokine family GPCR that binds the CXCL12 and CXCL11, but is unable to couple with G proteins upon agonist binding.
  • Sierro et al. identified CXCR4-ACKR3 heteromers as functional heteromers that displayed enhanced CXCL12-induced calcium signaling and altered ERK1/2 signaling in HEK293 cells (Sierro et al., 2007). Lovoye et al., reported an opposite result showing that CXCR4-ACKR3 heteromers exhibited reduced G ⁇ i and calcium responses upon exposure to CXCL12 in CHO-K1 cells (Levoye et al., 2009). Decaillot et al.
  • CXCR4 and ACKR3 constitutively recruited ⁇ -arrestin to CXCR4/ACKR3 heteromers and potentiated CXCL12-mediated ⁇ -arrestin-dependent downstream signaling pathways, including ERK1/2, p38 MAPK, and enhanced cell migration upon exposure to CXCL12 (Decaillot et al., 2011).
  • CXCR4 also interacts with the chemerin chemokine-like receptor 1 (CMKLR1, also known as ChemR23) (de Poorter et al., 2013).
  • CXCR4-CMKLR1 heteromers display negative agonist binding cooperativity similar to CXCR4-CCR2 and CXCR4-CCR5 heteromers reported by Sohy et al. (Sohy et al., 2007; Sohy et al., 2009), AMD3100 did not cross inhibit chemerin binding or inhibit calcium mobilization induced by CXCL12 (de Poorter et al., 2013).
  • CXCR4 and the ⁇ -opioid receptor (DOR) are widely distributed in brain tissues and immune cells.
  • Pello et al. reported that CXCR4 and DOR can form heteromers, and simultaneous stimulation with both agonists suppressed the activation of G ⁇ i signaling, and prevented cell migration toward CXCL12, although individual agonist elicit robust G ⁇ i signaling (Pello et al., 2008).
  • Burbassi et al. also noticed increased CXCR4-DOR heteromers and reduced coupling of CXCR4 to G-proteins in brain tissue and cultured glia from ⁇ -opioid receptor (MOR)-deficient mice (Burbassi et al., 2010).
  • CXCR4 function was rescued with a DOR antagonist, indicating that DOR is involved in the suppression of CXCR4 in glia by forming CXCR4-DOR heteromers (Burbassi et al., 2010).
  • CXCR4 is also known to interact with ⁇ - and ⁇ -adrenergic receptors ( ⁇ -AR and ⁇ -AR).
  • ⁇ -AR and ⁇ -AR ⁇ -adrenergic receptors
  • LaRocca et al. reported that stimulation of CXCR4 with CXCL12 negatively regulates ⁇ -AR-induced cAMP accumulation and PKA-dependent phosphorylation of phospholamban in adult rat ventricular myocytes using non-selective ⁇ -AR agonist, isoproterenol (LaRocca et al., 2010).
  • ADRB2 Nakai et al. studied the function of ADRB2 on lymphocytes. Stimulation of lymphocytes with ADRB2-selective agonists suppressed egress of lymphocytes from lymph nodes and produced lymphopenia in mice (Nakai et al., 2014). ADRB2 physically interacted with CCR7 and CXCR4, and activation of ADRB2 enhanced retention-promoting signals through CCR7-ADRB2 and CXCR4-ADRB2 heteromers, and subsequently reduced lymphocyte egress from lymph nodes.
  • Tripathi et al. revealed the presence of CXCR4-ADRA1A ( ⁇ 1A-AR) and CXCR4-ADRA1B ( ⁇ 1B-AR) heteromers on the surface of vascular smooth muscle cells (VSMC) (Tripathi et al., 2015).
  • a peptide derived from the second transmembrane helix of CXCR4 disrupted the interaction between ADRA1A/B and CXCR4, inhibited calcium mobilization and contraction of VSMC upon ⁇ 1-AR stimulation.
  • Activation of CXCR4 with CXCL12 increased the potency of ⁇ 1-AR agonists on blood pressure response in rats, suggesting that CXCR4-ADRA1A/B heteromers could be a novel pharmacological target for blood pressure regulation.
  • CXCR4 was reported to interact with CNR2 (Cannabinoid Receptor 2, aka CB2) (Coke et al., 2016; Scarlett et al., 2018). Simultaneous activation of CXCR4 and CB2 with both agonists resulted in reduction of ERK1/2 activation, calcium mobilization and cellular chemotaxis. These results show that cannabinoid system can negatively modulate CXCR4 function and tumor progression.
  • AdHTS adenovirus high-throughput system
  • BiFC bimolecular fluorescence complementation
  • a method for treatment, amelioration, prevention, or diagnosis, of a cancer in a subject having CXCR4-GPCRx heteromer comprising: administering to the subject a therapeutically effective amount of an inhibitor of a CXCR4-GPCRx heteromer, wherein: GPCRx heteromerizes with CXCR4 in the subject, the heteromerization of GPCRx with CXCR4 is accompanied by enhancement of signaling downstream of CXCR4; and the enhancement of signaling downstream of CXCR4 is suppressed by the inhibitor of the CXCR4-GPCRx heteromer.
  • a method for treating cancer in a patient having a cell containing a CXCR4-GPCRx heteromer comprising: administering to the patient an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein:
  • the CXCR4-GPCRx heteromer has enhanced downstream signaling
  • the administered inhibitor or combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient.
  • a method of suppressing enhanced downstream signaling from a CXCR4-GPCRx heteromer in a cell of a patient suffereing from cancer comprising: administering to the patient an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein:
  • the CXCR4-GPCRx heteromer has enhanced downstream signaling
  • the administered inhibitor or combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient.
  • a pharmaceutical kit for use in treating cancer in a patient having a cell containing a CXCR4-GPCRx heteromer comprising: an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein the CXCR4-GPCRx heteromer has enhanced downstream signaling.
  • composition for use in treating cancer in a patient having a cell containing a CXCR4-GPCRx heteromer, the pharmaceutical composition comprising:
  • an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer;
  • CXCR4-GPCRx heteromer has enhanced downstream signaling.
  • a method for treating cancer in a patient having a cancer cell containing a CXCR4-GPCRx heteromer, wherein the CXCR4-GPCRx heteromer has enhanced downstream signaling comprising:
  • a CXCR4-GPCRx heteromer-selective reagent alters heteromer-specific properties or function of said CXCR4-GPCRx heteromer in a patient derived cell(s); alters heteromer-specific properties of a patient derived cell(s) containing the CXCR4-GPCRx heteromer; or decreases cell proliferation of a patient derived cell(s) containing the CXCR4-GPCRx heteromer; and
  • a method for treating cancer in a patient having a cancer cell containing a CXCR4-GPCRx heteromer comprising:
  • the GPCRx of the CXCR4-GPCRx heteromer is selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; and
  • the assay performed on the biological sample is or comprises one or more of the following: a co-internalization assay, a colocalization assay, in situ hybridization, immunohistochemistry, immunoelectron microscopy, a proximity-based assay, a co-immunoprecipitation assay, or a fluorescent animal assay; and
  • a method for treating cancer in a patient having a cancer cell containing a CXCR4-GPCRx heteromer having enhanced downstream signaling comprising:
  • the patient's cancer cell contains said CXCR4-GPCRx heteromer
  • a CXCR4-GPCRx heteromer-selective reagent alters heteromer-specific properties or function of said CXCR4-GPCRx heteromer in a patient derived cell(s); alters heteromer-specific properties of a patient derived cell(s) containing said CXCR4-GPCRx heteromer; or decreases cell proliferation of a patient derived cell(s) containing said CXCR4-GPCRx heteromer; and
  • a method for treating cancer in a patient having a cancer cell containing a CXCR4-GPCRx heteromer comprising:
  • the GPCRx of the CXCR4-GPCRx heteromer is selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; and
  • the assay performed on the biological sample is or comprises one or more of the following: a co-internalization assay, a colocalization assay, in situ hybridization, immunohistochemistry, immunoelectron microscopy, a proximity-based assay, a co-immunoprecipitation assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, RNAseq, qRT-PCR, microarray, or a fluorescent animal assay; and
  • the heteromerization of CXCR4 with GPCRx is evaluated by a proximity-based assay.
  • the proximity-based assay is selected from the group consisting of bimolecular fluorescence complementation (BiFC), proximity ligation assay (PLA), fluorescence resonance energy transfer (FRET), bioluminescence resonance energy transfer (BRET), cysteine crosslinking, co-immunoprecipitation, and. a combination of TR-FRET and SNAP-tag (Comps-Agrar et al., 2011).
  • the heteromerization of CXCR4 with GPCRx is evaluated by a co-internalization assay.
  • the enhancement of cell signaling downstream of CXCR4 is evaluated by an intracellular Ca2+ assay.
  • GPCRx is selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, APLNR, C5AR1, CALCR, CCR5, CHRM1, GALR1, EDNRB, HRH1, MLNR, NTSR1, PTGER2, PTGER3, SSTR2, and TACR3.
  • GPCRx is selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, PTGER2, and TACR3.
  • GPCRx is selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3.
  • GPCRx is selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3.
  • GPCRx is selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3.
  • GPCRx is selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, NTSR1, and TACR3.
  • GPCRx is selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, HRH1, NTSR1, and TACR3.
  • GPCRx is selected from the group consisting of ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, NTSR1, and TACR3.
  • GPCRx is selected from the group consisting of ADRB2, CHRM1, EDNRB, HRH1, NTSR1, and TACR3.
  • GPCRx is selected from the group consisting of ADRB2, CHRM1, EDNRB, HRH1, and TACR3.
  • GPCRx is selected from the group consisting of ADRB2, CHRM1, HRH1, and TACR3.
  • GPCRx is selected from the group consisting of ADRB2, EDNRB, HRH1, and TACR3.
  • GPCRx is selected from the group consisting of ADRB2, EDNRB, and HRH1.
  • GPCRx is selected from the group consisting of ADRB2, CHRM1, and HRH1.
  • GPCRx is selected from the group consisting of ADRB2, HRH1, and TACR3.
  • GPCRx is selected from the group consisting of ADRB2 and HRH1.
  • the inhibitor of the CXCR4-GPCRx heteromer is, or comprises, an inhibitor of the CXCR4.
  • the inhibitor of CXCR4 is selected from the group consisting of: AD-114, AD-114-6H, AD-114-Im7-FH, AD-114-PA600-6H, ALX-0651, ALX40-4C, AMD070 (AMD11070, X4P-001), AMD3100 (plerixafor), AMD3465, ATI 2341, BKT140 (BL-8040; TF14016; 4F-Benzoyl-TN14003), CTCE-9908, CX549,,D-[Lys3] GHRP-6, FC122, FC131, GMI-1359, GSK812397, GST-NT21MP, isothiourea-1a, isothiourea-1t (IT1t), KRH-1636, KRH-3955, LY2510924, LY2624587, MSX-122, N-[ 11 C]Methyl-
  • the inhibitor of the CXCR4-GPCRx heteromer is, or comprises, an antagonist of the CXCR4.
  • the antagonist of CXCR4 is selected from the group consisting of ALX40-4C, AMD070 (AMD11070, X4P-001), AMD3100 (plerixafor), AMD3465, ATI 2341, BKT140 (BL-8040; TF14016; 4F-Benzoyl-TN14003), CTCE-9908, CX549,,D-[Lys3] GHRP-6, FC122, FC131, GMI-1359, GSK812397, GST-NT21MP, isothiourea-1a, isothiourea-1t (IT1t), KRH-1636, KRH-3955, LY2510924, MSX-122, N-[11C]Methyl-AMD3465, POL6326, SDF-1 1-9[P2G] dimer, SDF1 P2G, T134, T140, T22, TC 14012
  • the inhibitor of the CXCR4-GPCRx heteromer is, or comprises, an antibody of the CXCR4.
  • the antibody of CXCR4 is selected from the group consisting of AD-114, AD-114-6H, AD-114-Im7-FH, AD-114-PA600-6H, ALX-0651, LY2624587, PF-06747143, ulocuplumab (MDX1338/BMS-936564), 12G5, 238D2, and 238D4.
  • the inhibitor of the CXCR4-GPCRx heteromer is, or further comprises, an inhibitor of the GPCRx.
  • the inhibitor of the GPCRx is concurrently or sequentially administered with the inhibitor of the CXCR4.
  • the inhibitor of the CXCR4-GPCRx heteromer is, or comprises, an antagonist, an inverse agonist, an allosteric modulator, an antibody or binding portion thereof, a ligand, or any combinations, of GPCRx.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, PTGER2, and TACR3.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, NTSR1, and TACR3.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, HRH1, NTSR1, and TACR3.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, NTSR1, and TACR3.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADRB2, CHRM1, EDNRB, HRH1, NTSR1, and TACR3.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADRB2, CHRM1, EDNRB, HRH1, and TACR3.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADRB2, CHRM1, HRH1, and TACR3.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADRB2, EDNRB, HRH1, and TACR3.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADRB2, EDNRB, and HRH1.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADRB2, CHRM1, and HRH1.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADRB2, HRH1, and TACR3.
  • the inhibitor of GPCRx is an inhibitor of a molecule selected from the group consisting of ADRB2 and HRH1.
  • the inhibitor of GPCRx is an inhibitor of ADCYAP1R1 selected from the group consisting of: M65, Max.d.4, MK-0893, N-stearyl-[Nle 17 ] neurotensin-(6-11)/VIP-(7-28), PACAP-(6-38), and PG 97-269.
  • the inhibitor of GPCRx is an inhibitor of ADORA2B selected from the group consisting of: 3-isobutyl-8-pyrrolidinoxanthine, alloxazine, AS16, AS70, AS74, AS94, AS95, AS96, AS99, AS100, AS101, ATL802, BW-A1433, caffeine, CGS 15943, CPX, CSC, CVT-6883, DAX, DEPX, derenofylline, DPCPX, FK-453, I-ABOPX, istradefylline, KF26777, LAS38096, LUF5981, MRE 2029F20, MRE 3008F20, MRS1191, MRS1220, MRS1523, MRS1706, MRS1754, MSX-2, OSIP339391, pentoxifylline, preladenant, PSB-10, PSB-11, PSB36
  • ADORA2B inhibitor of ADORA2B selected from the group consisting of: 3-iso
  • the inhibitor of GPCRx is an inhibitor of ADORA3 selected from the group consisting of: ATL802, BW-A1433, caffeine, CGS 15943, CSC, CVT-6883, derenofylline, dexniguldipine, DPCPX, FK-453, flavanone, flavone, galangin, I-ABOPX, istradefylline, KF26777, LAS38096, LUF5981, MRE 2029F20, MRE 3008F20, MRE 3010F20, MRS1041, MRS1042, MRS1067, MRS1088, MRS1093, MRS1097, MRS1177, MRS1186, MRS1191, MRS1191, MRS1220, MRS1476, MRS1486, MRS1505, MRS1523, MRS1754, MRS928, MSX-2, nicardipine, preladenant, PSB-10, PSB
  • the inhibitor of GPCRx is an inhibitor of ADRB2 selected from the group consisting of: Alprenolol, atenolol, betaxolol, bupranolol, butoxamine, carazolol, carvedilol, CGP 12177, cicloprolol, ICI 118551, ICYP, labetalol, levobetaxolol, levobunolol, LK 204-545, metoprolol, nadolol, NIHP, NIP, propafenone, propranolol, sotalol, SR59230A, and timolol.
  • ADRB2 an inhibitor of ADRB2 selected from the group consisting of: Alprenolol, atenolol, betaxolol, bupranolol, butoxamine, carazolol, carvedilol, CGP 12177, cicloprolol, ICI 1185
  • the inhibitor of ADRB2 is Carvedilol.
  • the inhibitor of GPCRx is an inhibitor of C5AR1 inhibitor is selected from the group consisting of: A8 ⁇ 71-73 , AcPhe-Orn-Pro-D-Cha-Trp-Arg, avacopan, C089, CHIPS, DF2593A, JPE1375, L-156,602, NDT9520492, N -methyl-Phe-Lys-Pro-D-Cha-Trp-D-Arg-CO 2 H, PMX205, PMX53, RPR121154, and W54011.
  • the inhibitor of GPCRx is an inhibitor of CALCR selected from the group consisting of ⁇ -CGRP-(8-37) (human), AC187, CT-(8-32) (salmon), and olcegepant.
  • the inhibitor of CALCR is AC187.
  • the inhibitor of GPCRx is an inhibitor of CHRM1 selected from the group consisting of 3-Quinuclidinyl benzilate (QNB), 4-DAMP, aclidinium, AE9C90CB, AFDX384, amitriptyline, AQ-RA 741, atropine, benzatropine, biperiden, darifenacin, dicyclomine, dosulepin, ethopropazine, glycopyrrolate, guanylpirenzepine, hexahydrodifenidol, hexahydrosiladifenidol, hexocyclium, himbacine, ipratropium, litrocholylcholine, methoctramine, ML381, muscarinic toxin 1, muscarinic toxin 2, muscarinic toxin 3, N-methyl scopolamine, o
  • the inhibitor of CHRM1 is Oxybutynin, umeclidinium, and VU0255035.
  • the inhibitor of GPCRx is an inhibitor of EDNRB selected from the group consisting of A192621, ambrisentan, atrasentan, bosentan (RO 470203, Tracleer);, BQ788, IRL 2500, K-8794, macitentan, RES7011, Ro 46-8443, SB209670, SB217242 (enrasentan), TAK 044, and tezosentan (RO610612).
  • the inhibitor of EDNRB is bosentan.
  • the inhibitor of GPCRx is an inhibitor of HRH1 selected from the group consisting of (-)-chlorpheniramine, (+)-chlorpheniramine, (-)- trans -H 2 -PAT, (+)- cis -H 2 -PAT, (+)- trans -H 2 -PAT, ( ⁇ )- cis -H 2 -PAT, ( ⁇ )- trans -H 2 -PAT, ( R )-cetirizine, ( S )-cetirizine, 9-OH-risperidone, A-317920, A-349821, ABT-239, alimemazine, amitriptyline, aripiprazole, arpromidine, asenapine, astemizole, AZD3778, azelastine, BU-E 47, cetirizine, chlorpheniramine, chlorpromazine,
  • the inhibitor of HRH1 is cetirizine, pyrilamine, hydroxyzine, or loratadine.
  • the inhibitor of GPCRx is an inhibitor of MLNR selected from the group consisting of GM-109, MA-2029, and OHM-11526.
  • the inhibitor of MLNR is MA-2029.
  • the inhibitor of GPCRx is an inhibitor of NTSR1 selected from the group consisting of Meclinertant, SR48527, SR48692, and SR142948A.
  • the inhibitor of NTSR1 is Merclinertant.
  • the inhibitor of GPCRx is an inhibitor of TACR3 selected from the group consisting of [Trp 7 , ⁇ -Ala 8 ] neurokinin A-(4-10), AZD2624, FK 224, GR138676, GSK 172981, GSK 256471, N',2-diphenylquinoline-4-carbohydrazide 8m, N′,2-diphenylquinoline-4-carbohydrazide, osanetant, PD 154740, PD 161182, PD157672, saredutant, SB 218795, SB 222200, SB 235375, SCH 206272, SSR 146977, and talnetant.
  • TACR3 selected from the group consisting of [Trp 7 , ⁇ -Ala 8 ] neurokinin A-(4-10), AZD2624, FK 224, GR138676, GSK 172981, GSK 256471, N',2-diphenylquinoline-4-
  • the inhibitor of TACR3 is SSR146977.
  • the inhibitor of the CXCR4-GPCRx heteromer is a protein-protein interaction (PPI) inhibitor.
  • PPI protein-protein interaction
  • the cancer is selected from the group consisting of breast cancer, lung cancer, brain cancer, kidney cancer, pancreatic cancer, ovarian cancer, prostate cancer, melanoma, multiple myeloma, gastrointestinal cancers, renal cell carcinoma, soft tissue sarcomas, hepatocellular carcinoma, stomach cancer, colorectal cancer, esophageal cancer, and leukemia.
  • the inhibitor of CXCR4-GPCRx heteromer is administered to the subject in a pharmaceutical composition.
  • a method for assessing response, or potential response, of a subject having CXCR4-GPCRx heteromer, to treatment, amelioration, or prevention of a cancer comprising: obtaining a sample from the subject; detecting heteromerization of CXCR4 and GPCRx in the sample; and based at least in part on detection of the heteromerization of CXCR4 and GPCRx, assessing the subject's response, or potential response, to the treatment, amelioration, or prevention of a cancer.
  • the heteromerization of CXCR4 and GPCRx is accompanied by enhancement of signaling downstream of CXCR4.
  • the enhancement of cell signaling downstream of CXCR4 is evaluated by an intracellular Ca2+ assay.
  • the heteromerization of CXCR4 with GPCRx is evaluated by a proximity-based assay.
  • the proximity-based assay is selected from the group consisting of bimolecular fluorescence complementation (BiFC), proximity ligation assay (PLA), fluorescence resonance energy transfer (FRET), bioluminescence resonance energy transfer (BRET), cysteine crosslinking, and co-immunoprecipitation.
  • BiFC bimolecular fluorescence complementation
  • PLA proximity ligation assay
  • FRET fluorescence resonance energy transfer
  • BRET bioluminescence resonance energy transfer
  • cysteine crosslinking and co-immunoprecipitation.
  • the heteromerization of CXCR4 with GPCRx is evaluated by a co-internalization assay.
  • the CXCR4-GPCRx heteromer has, causes, or produces, the enhanced downstream signaling.
  • the enhanced downstream signaling results from the CXCR4-GPCRx heteromer, such as results from agonism of the CXCR4-GPCRx heteromer, results from CXCR4 agonism of the CXCR4-GPCRx heteromer, or results from GPCRx agonism of the CXCR4-GPCRx heteromer.
  • the enhanced downstream signaling is downstream of the CXCR4, the respective GPCRx, or the CXCR4-GPCRx heteromer.
  • the inhibitor or combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient, such as suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the patient's cancer cells.
  • the enhanced downstream signaling from the CXCR4-GPCRx heteromer is determined by an intracellular Ca2+ assay.
  • the enhanced downstream signaling is an enhanced amount of calcium mobilization.
  • the enhanced amount of calcium mobilization is a synergistic amount of calcium mobilization.
  • the CXCR4-GPCRx heteromer has two or more of the following characteristics:
  • the CXCR4-GPCRx heteromer components in a cell colocalize and physically interact, either directly or via intermediate proteins acting as conduits for allosterism, as determined via one or more of the following: a co-internalization assay, a colocalization assay, in situ hybridization, immunohistochemistry, immunoelectron microscopy, a proximity-based assay, a co-immunoprecipitation assay, or a fluorescent animal assay;
  • an enhanced amount of calcium mobilization such that: a) either CXCR4 or the respective GPCRx in an individual protomer context in a cell, upon co-stimulation with CXCL12 and a respective selective GPCRx agonist, results in a calcium mobilization amount that is equal to or less than the sum of calcium mobilization amounts resulting from single agonist stimulation with either the CXCL12 or the respective selective GPCRx agonist; and b) the CXCR4-GPCRx heteromer exhibits an enhanced calcium mobilization upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist relative to the sum of calcium mobilization amounts resulting from single agonist stimulation with either the CXCL12 or the respective selective GPCRx agonist; as determined via a calcium mobilization assay; or
  • a CXCR4-GPCRx heteromer-selective reagent i) alters heteromer-specific properties of the CXCR4-GPCRx heteromer in a patient derived cell, ii) alters heteromer-specific function of the CXCR4-GPCRx heteromer in a patient derived cell; iii) alters heteromer-specific properties of a patient derived cell containing the CXCR4-GPCRx heteromer; or iv) decreases cell proliferation of a patient derived cell(s) containing the CXCR4-GPCRx heteromer.
  • the CXCR4-GPCRx heteromer components in the cell colocalize and physically interact, either directly or via intermediate proteins acting as conduits for allosterism, as determined via one or more of the following: a co-internalization assay, a colocalization assay, in situ hybridization, immunohistochemistry, immunoelectron microscopy, a proximity-based assay, a co-immunoprecipitation assay, or a fluorescent animal assay.
  • the proximity-based assay is, or comprises, resonance energy transfer (RET), bioluminescence RET (BRET), fluorescence RET (FRET), time-resolved fluorescence RET (TR-FRET), antibody-aided FRET, ligand-aided FRET, bimolecular fluorescence complementation (BiFC), or a proximity ligation assay (PLA).
  • RET resonance energy transfer
  • BRET bioluminescence RET
  • FRET fluorescence RET
  • TR-FRET time-resolved fluorescence RET
  • antibody-aided FRET ligand-aided FRET
  • BiFC bimolecular fluorescence complementation
  • PKA proximity ligation assay
  • the CXCR4-GPCRx heteromer exhibits the enhanced amount of calcium mobilization, such that:
  • the CXCR4-GPCRx heteromer exhibits an enhanced calcium mobilization upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist relative to the sum of calcium mobilization amounts resulting from single agonist stimulation with either the CXCL12 or the respective selective GPCRx agonist;
  • the CXCR4-GPCRx heteromer-selective reagent i) alters heteromer-specific properties of the CXCR4-GPCRx heteromer in the patient derived cell; ii) alters heteromer-specific function of the CXCR4-GPCRx heteromer in the patient derived cell; iii) alters heteromer-specific properties of the patient derived cell containing the CXCR4-GPCRx heteromer; or iv) decreases cell proliferation of the patient derived cell containing the CXCR4-GPCRx heteromer.
  • the CXCR4-GPCRx heteromer-selective reagent is a CXCR4 inhibitor, a GPCRx inhibitor, or a CXCR4-GPCRx heteromer inhibitor.
  • the CXCR4-GPCRx heteromer-selective reagent is a CXCR4 antagonist, a GPCRx antagonist, or a CXCR4-GPCRx heteromer antagonist.
  • the method administers an inhibitor selected from the group consisting of: the CXCR4 inhibitor, the GPCRx inhibitor, or the CXCR4-GPCRx heteromer inhibitor.
  • the inhibitor is administered as a pharmaceutical composition.
  • the administered inhibitor is the CXCR4 inhibitor.
  • the administered inhibitor is the GPCRx inhibitor.
  • the administered inhibitor is the inhibitor of the CXCR4-GPCRx heteromer.
  • the method administers the combination of inhibitors selected from the group consisting of: the CXCR4 inhibitor, the GPCRx inhibitor, and the inhibitor of the CXCR4-GPCRx heteromer.
  • the combination of inhibitors are administered sequentially, concurrently, or simultaneously.
  • the CXCR4 inhibitor is an antagonist of CXCR4, an inverse agonist of CXCR4, a partial antagonist of CXCR4, an allosteric modulator of CXCR4, an antibody of CXCR4, an antibody fragment of CXCR4, a ligand of CXCR4, or an antibody-drug conjugate of CXCR4.
  • the GPCRx inhibitor is an antagonist of GPCRx, an inverse agonist of GPCRx, a partial antagonist of GPCRx, an allosteric modulator of GPCRx, an antibody of GPCRx, an antibody fragment of GPCRx, a ligand of GPCRx, or an antibody-drug conjugate of GPCRx.
  • the inhibitor of the CXCR4-GPCRx heteromer is an antagonist of the CXCR4-GPCRx heteromer, an inverse agonist of the CXCR4-GPCRx heteromer, a partial antagonist of the CXCR4-GPCRx heteromer, an allosteric modulator of the CXCR4-GPCRx heteromer, an antibody of the CXCR4-GPCRx heteromer, an antibody fragment of the CXCR4-GPCRx heteromer, a ligand of the CXCR4-GPCRx heteromer, a protein-protein interaction (PPI) inhibitor of the CXCR4-GPCRx heteromer, or an antibody-drug conjugate of the CXCR4-GPCRx heteromer.
  • PPI protein-protein interaction
  • the method further comprises detecting the CXCR4-GPCRx heteromer in the cancer patient.
  • the method further comprises identifying the CXCR4-GPCRx heteromer in the cancer patient.
  • the method further comprises:
  • the patient's biological sample is a biological fluid sample or a biological tissue sample.
  • a liquid biopsy is performed on the biological fluid sample or the biological tissue sample.
  • the biological fluid sample includes circulating tumor cells (CTCs), tumor-derived cell-free DNA (cfDNA), circulating small RNAs, and extracellular vesicles including exosomes, from bodily fluids as disclosed, for example, in Campos CDM et al., "Molecular Profiling of Liquid Biopsy Samples for Precision Medicine," Cancer J. 2018 Mar/Apr;24(2):93-103, which is incorporated hereby in its entirety.
  • CTCs tumor cells
  • cfDNA tumor-derived cell-free DNA
  • RNAs extracellular vesicles including exosomes
  • the biological fluid sample is a blood sample, a plasma sample, a saliva sample, a cerebral fluid sample, an eye fluid sample, or a urine sample.
  • the biological tissue sample is an organ tissue sample, a bone tissue sample, or a tumor tissue sample.
  • the cancer cell contains the CXCR4-GPCRx heteromer.
  • a normal, non-cancerous cell does not contain the CXCR4-GPCRx heteromer.
  • the progression of the cancer in the patient having said cancer cell containing the CXCR4-GPCRx heteromer is decreased in the range of 5-100% more upon administration of the combination of inhibitors, relative to administering the CXCR4 inhibitor or GPCRx inhibitor as the single inhibitor to said patient.
  • the efficacy of a CXCR4 inhibitor is increased in the range of 5-2000% when administered in combination with the GPCRx inhibitor to the patient having said cancer cell containing the CXCR4-GPCRx heteromer, relative to efficacy of the CXCR4 inhibitor when administered as a single inhibitor.
  • the efficacy of a GPCRx inhibitor is increased in the range of 5-2000% when administered in combination with the CXCR4 inhibitor to the patient having said cancer cell containing the CXCR4-GPCRx heteromer, relative to efficacy of the GPCRx inhibitor when administered as a single inhibitor.
  • the progression of the cancer in the patient having said cancer cell containing the CXCR4-GPCRx heteromer is decreased in the range of 5-100% more upon administration of the combination of inhibitors, relative to administering the CXCR4 inhibitor or GPCRx inhibitor as the single inhibitor to said patient.
  • the efficacy of a CXCR4 inhibitor is increased in the range of 5-2000% when administered in combination with the GPCRx inhibitor to the patient having said cancer cell containing the CXCR4-GPCRx heteromer, relative to efficacy of the CXCR4 inhibitor when administered as a single inhibitor.
  • the efficacy of a GPCRx inhibitor is increased in the range of 5-2000% when administered in combination with the CXCR4 inhibitor to the patient having said cancer cell containing the CXCR4-GPCRx heteromer, relative to efficacy of the GPCRx inhibitor when administered as a single inhibitor.
  • the method administers a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer.
  • the method administers a combination of a CXCR4 inhibitor and a GPCRx inhibitor.
  • the method administers a CXCR4-GPCRx heteromer inhibitor.
  • the administering of the combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient in the range of between 5-2000 fold, relative to single inhibitor administration.
  • the administering of the combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient in the range of between 5-1500 fold, relative to single inhibitor administration.
  • the administering of the combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient in the range of between 500-1500 fold, relative to single inhibitor administration.
  • the administering of the inhibitor or combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient in the range of between 5-2000 fold, relative to suppression of downstream signaling from either a CXCR4 protomer or a GPCRx protomer in their respective individual protomer context.
  • the administering of the inhibitor or combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient in the range of between 5-1500 fold, relative to suppression of downstream signaling from either a CXCR4 protomer or a GPCRx protomer in their respective individual protomer context.
  • the administering of the inhibitor or combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient in the range of between 500-1500 fold, relative to suppression of downstream signaling from either a CXCR4 protomer or a GPCRx protomer in their respective individual protomer context.
  • the cancer cell of the patient contains the CXCR4-GPCRx heteromer in a greater concentration than a normal, non-cancerous cell from said patient,
  • the presence of the CXCR4-GPCRx heteromer in the cancer cell of the patient identifies a sub-population of CXCR4-mediated cancer patients.
  • the presence of the CXCR4-GPCRx heteromer in the cancer cell of the patient is a biomarker of a sub-population of CXCR4-mediated cancer patients.
  • the biomarker of the sub-population of CXCR4-mediated cancer patients allows for precision medicine, patient stratification, or patient classification.
  • the biomarker of the sub-population of CXCR4-mediated cancer patients allows for GPCR-based precision cancer therapeutics.
  • the inhibitor is an antibody.
  • the CXCR4-GPCRx heteromer-selective reagent is an antibody.
  • the antibody is a bi-specific antibody of the CXCR4-GPCRx heteromer.
  • the antibody is a heteromer-specific antibody of the CXCR4-GPCRx heteromer.
  • the inhibitor is a bi-specific ligand(s) of the CXCR4-GPCRx heteromer.
  • the antibody is an antibody-drug conjugate (ADC), as disclosed in, for example, Beck a et al., “Strategies and challenges for the next generation of antibody-drug conjugates", Nature Reviews Drug Discovery, 16:315-337, (2017) and Lambert, et al., “Antibody-Drug Conjugates for Cancer Treatment", Annual Review of Medicine, 69:191-207 (2018), each of which are incorporated hereby in its entirety.
  • ADC antibody-drug conjugate
  • FIGURE 1 Shows schematic drawing of bimolecular fluorescence complementation (BiFC) assay.
  • GPCR A is fused with N-terminal fragment of yellow fluorescent protein (YFP) Venus (VN) and GPCR B is fused with C-terminal fragment of Venus (VC).
  • YFP yellow fluorescent protein
  • VN yellow fluorescent protein
  • VC C-terminal fragment of Venus
  • FIGURES 2a-2u Shows identification of CXCR4-interacting GPCRs using BiFC assay. Representative images that showed negative BiFC signal; CXCR4-VN and HA-VC (FIG. 2a), and CXCR4-VN and GCGR-VC (FIG. 2c). Representative images of CXCR4 and GPCRx that showed positive BiFC signal; CXCR4-VN and CXCR4-VC (FIGS. 2b), CXCR4-VN and ADCYAP1R1-VC (FIG. 2d), CXCR4-VC and ADORA2B-VN (FIG. 2e), CXCR4-VN and ADORA3-VC (FIG.
  • FIGURES 3a-3b Shows principle of GPCR co-internalization study.
  • Cells co-expressing CXCR4-GFP and GPCRx are treated with GPCRx specific agonist.
  • FIG. 3a CXCR4 and GPCRx does not physically interact with each other.
  • GPCRx agonist induces internalization of GPCRx, but not CXCR4-GFP.
  • FIG. 3b CXCR4 and GPCRx physically interact and forms heteromer.
  • GPCRx agonist induces internalization of GPCRx, and CXCR4-GFP is co-internalized with GPCRx.
  • FIGURES 4a-4q Shows co-internalization of CXCR4-EGFP upon stimulation of GPCRx with its corresponding agonist (control: CXCR4-GFP (FIG. 4a)).
  • U-2 OS cells were co-transduced with adenoviruses encoding CXCR-EGFP and GPCRx-VC, and the following GPCRx partners were examined to form heteromer with CXCR4-EGFP and to induce co-internalization of the CXCR4-EGFP:
  • GPCRx represents ADCYAP1R1 (FIG. 4b), ADORA2B (FIG. 4c), ADORA3 (FIG. 4d), ADRB2 (FIG. 4e), APLNR (FIG.
  • FIGURES 5a-5d Shows enhancement of the calcium response in cells co-expressing CXCR4 and ADRB2 upon co-stimulation with their respective selective agonists.
  • MDA-MB-231 human breast cancer cells were transduced with adenoviruses encoding CXCR4 and HA-VC (FIG. 5a), ADRB2 and HA-VC (FIG. 5b), or CXCR4 and ADRB2 (FIG. 5c).
  • Adenoviruses encoding HA-VC were used to adjust the total amount of adenoviruses transduced.
  • FIGURES 6a-6l Shows enhancement of the calcium response in cells co-expressing CXCR4 and GPCRx upon co-stimulation with their respective selective agonists as shown in FIGS 5a-c.
  • MDA-MB-231 cells were transduced with adenoviruses encoding CXCR4 and HA-VC, GPCRx and HA-VC, or CXCR4 and GPCRx.
  • GPCRx represents ADCYAP1R1 (FIG. 6a), ADORA2B (FIG. 6b), ADORA3 (FIG. 6c), C5AR1 (FIG. 6d), CALCR (FIG. 6e), CHRM1 (FIG. 6f), EDNRB (FIG. 6g), HRH1 (FIG.
  • FIGURES 7a-7e Shows examples of CXCR4-GPCRx heteromer that failed to show enhanced calcium signaling in cells co-expressing CXCR4 and GPCRx in the presence of agonists to both GPCRs.
  • MDA-MB-231 cells were transduced with adenoviruses encoding CXCR4 and HA-VC, GPCRx and HA-VC, or CXCR4 and GPCRx.
  • GPCRx represents APLNR (FIG. 7a), CCR5 (FIG. 7b), GALR1 (FIG. 7c), PTGER3 (FIG. 7d), and SSTR2 (FIG. 7e).
  • FIGURES 8a-8l Shows co-treatment of both antagonists efficiently suppressed the enhanced calcium response when cells expressing CXCR4-GPCRx heteromer were stimulated with CXCL12 and GPCRx agonists simultaneously.
  • MDA-MB-231 cells were co-transduced with adenoviruses encoding CXCR4 and GPCRx.
  • GPCRx represents ADRB2 (FIG. 8a), CHRM1 (FIGS. 8b-8d), EDNRB (FIG. 8e), HRH1(endo) (FIG. 8f and FIG. 8g), HRH1 (FIG. 8h and FIG. 8i), MLNR (FIG. 8j), NTSR1 (FIG. 8k), and TACR3 (FIG.
  • FIGURE 9 Shows principle of internalization inhibition study.
  • Cells co-expressing CXCR4-GFP and GPCRx are treated with CXCL12 (SDF-1) and /or GPCRx specific antagonist.
  • CXCR4 and GPCRx forms heteromer.
  • CXCR4 agonist, CXCL12 (SDF-1) induced internalization of CXCR4-GFP alone or CXCR4-GFP with GPCRx.
  • SDF-1 CXCR4-GFP
  • GPCRx antagonist does not induce internalization of CXCR4-GFP.
  • SDF-1 Internalization of CXCL12 (SDF-1) stimulated CXCR4-GFP is inhibited by GPCRx specific antagonist.
  • FIGURES 10a-10c Shows inhibition of internalization by GPCRx antagonist for heteromers.
  • FIG. 10a CXCR4-ADRB2;
  • FIG. 10b CXCR4-CHRM1;
  • FIG. 10c CXCR4-HRH1.
  • FIG. 10a CXCR4-GFP expressing U-2 OS cells were transduced with adenovirus encoding ADRB2.
  • SDF-1 CXCL12
  • CXCR4 agonist induced CXCR4-ADRB2 internalization.
  • Carvedilol an ADRB2 antagonist, did not induce internalization.
  • CXCR4-GFP expressing U-2 OS cells were transduced with adenovirus encoding HRH1.
  • Treatment by CXCL12 induced CXCR4-HRH1 internalization.
  • Prometazine, Hydroxyzine, or Loratadine, HRH1 antagonists did not induce internalization.
  • Co-treatment with CXCL12 and Prometazine, Hydroxyzine, or Loratadine inhibited CXCL12 induced CXCR4-HRH1 internalization.
  • FIGURES 11a-11c Shows the effect of GPCRx antagonist on the survival of patient derived cells (PDCs) from cancer patients.
  • FIG. 11b Effect of CHRM1 antagonists (Oxybutynin, Umeclidinium) on the survival of PDC. Oxybutynin and Umeclidinium
  • FIGURES 12a-12c Shows CXCR4-ADRB2 heterodimer detection by PLA and qRT-PCR in U-2 OS cells over-expressing CXCR4 and ADRB2.
  • CXCR4-GFP expressing U-2 OS cells were transduced with adenovirus encoding ADRB2 at different MOIs for 2 days. Then CXCR4-ADRB2 co-expressing U-2 OS cells were performed PLA.
  • FIG. 12a Image of CXCR4-ADRB2 heteromer detection by PLA.
  • FIG. 12b Increase of the PLA signal proportionate to the expression level of ADRB2 in a dose dependent manner.
  • FIG. 12c Data from qRT-PCR showing endogenous ADRB2 expression level of U-2 OS cells.
  • FIGURES 13a-13b Shows CXCR4-ADRB2 heteromer detection in PDC by PLA.
  • GBM originated PDCs (sample IDs : 986T, 948T, 783T, 777T, 352T1, 352T2, 578T, 559T, 464T, 448T, 096T) were plated at chamber slide and CXCR4-ADRB2 heteromer were detected by PLA with CXCR4 and ADRB2 specific antibodies.
  • FIG. 13a Image of CXCR4-ADRB2 heteromer detection. Nuclei were visualized with DAPI staining and CXCR4-ADRB2 heteromers were shown as small dots.
  • FIG. 13b Ratio of CXCR4-ADRB2 heteromer in PDC.
  • FIGURES 14a-14b Shows CXCR4-CHRM1 heteromer detection in PDC by PLA.
  • GBM originated PDCs (sample IDs : 986T, 948T, 783T, 777T, 352T1, 352T2, 578T, 559T, 464T, 448T, 096T) were plated at chamber slide and CXCR4-CHRM1 heteromer were detected by PLA with CXCR4 and CHRM1 specific antibodies.
  • FIG. 14a Image of CXCR4-CHRM1 heteromer detection. Nuclei were visualized with DAPI staining and CXCR4-ADRB2 heteromers were shown as small dots.
  • FIG. 14b Ratio of CXCR4-CHRM1 heteromer in PDC.
  • FIGURES 15a-15b Shows results from CXCR4-GPCRx heteromer detection in PDX.
  • GBM originated PDXs (sample IDs; 777T, 783T, 948T, 559T) were detected CXCR4-ADRB2 heteromer by PLA with CXCR4 and ADRB2 specific antibodies.
  • FIG. 15a Image of CXCR4-ADRB2 heteromer detection. Nuclei were visualized with DAPI staining and CXCR4-ADRB2 heteromers were shown as small dots.
  • FIG. 15b Ratio of CXCR4-ADRB2 heteromer in PDX.
  • FIGURES 16a-16b Shows the enhancement of the calcium response in cells co-expressing CXCR4 and GPCRx upon co-stimulation with their respective agonists.
  • MDA-MB-231 cells were transduced with adenoviruses encoding CXCR4 and ADRB2 (FIG. 16a) or CXCR4 and HRH1 (FIG. 16b).
  • Cells were cultured for 3 days, stained with Cal-520 AM, and were treated with either CXCL12 (30 nM) alone, increasing doses of histamine or salmeterol alone, or increasing doses of histamine or salmeterol in combination with 30 nM of CXCL12. Calcium mobilization was measured using FlexStation 3.
  • Sum represents the calculated additive value of the responses evoked by 30 nM of CXCL12 alone (open square) and GPCRx ligand alone at indicated doses (filled circle).
  • FIGURES 17a-17c Shows no enhancement of the calcium response in cells co-expressing CXCR4 and GPCRx upon co-stimulation with their respective agonists.
  • MDA-MB-231 cells were transduced with adenoviruses encoding CXCR4 and APLNR (FIG. 17a), CXCR4 and PTGER3 (FIG. 17b), or CXCR4 and SSTR2 (FIG. 17c).
  • FIGURES 18a-18b Shows the enhancement of the calcium response in wild-type MDA-MB-231 cells upon co-stimulation with CXCL12 and histamine.
  • FIG. 18a MDA-MB-231 cells were stimulated with CXCL12 (100 nM), histamine (10 nM), or CXCL12 and histamine together, and Ca2+ responses elicited by endogenous CXCR4 and HRH1 were measured.
  • FIG. 18b Calcium mobilization was quantified by calculating the area-under-the-curve (AUC) of each graph. Sum represents the calculated additive value of the responses evoked by each agonist. The data represent three independent experiments done in triplicates (mean ⁇ SEM). Statistically significant difference between the sum and co-treatmemt was determined by Student's t test. *P ⁇ 0.05.
  • FIGURES 19a-19b Shows enhanced migration of MDA-MB-231 cells in response to a co-stimulation with CXCL12 (30 nM) and histamine (50 nM).
  • MDA-MB-231 cells were transduced with 1 MOI of lentivirus encoding CXCR4, and chemotactic migration of the cells toward CXCL12, histamine, CXCL12 and histamine together in the presence or absence of pyrilamine (1 ⁇ M), a HRH1-selective inverse agonist, was evaluated. Chemotaxis was quantified by counting the migrated cells on the lower surface of the membrane of 10 fields per chamber.
  • FIG. 19a A representative picture of each group.
  • FIGURE 20 Shows efficient suppression of the enhanced calcium response by co-treatment of anti-CXCR4 antibody and ADRB2 antagonist when cells expressing CXCR4-ADRB2 heteromer were simultaneously stimulated with CXCL12 and ADRB2 agonist.
  • MDA-MB-231 cells were co-transduced with adenoviruses encoding CXCR4 and ADRB2.
  • Cells were treated with ADRB2 antagonist (Carvedilol), anti-CXCR4 antibody (12G5), or vehicle of indicated concentration and incubated with Cal 6 for 2 hours. Cells were subsequently stimulated with indicated amounts of CXCL12, ADRB2 agonist (Salmeterol), or CXCL12 and ADRB2 agonist.
  • FIGURES 21a-21b Shows detection of CXCR4-GPCR heteromer by PLA in U-2 OS cells over-expressing CXCR4 and GPCRx.
  • U-2 OS cells expressing CXCR4-GFP were transduced with adenovirus encoding CHRM1 or HRH1 at different MOIs for 2 days.
  • PLA was performed on U-2 OS cells co-expressing CXCR4-GPCRx using CXCR4- and GPCRx- specific antibodies.
  • the PLA signal increased in proportion to the expression level of CHRM1 (FIG. 21a) and HRH1(FIG. 21b) in a dose-dependent manner.
  • FIGURES 22a-22b Shows images of three mice that were transplanted with a parental cell A549, A549-CXCR4 overexpressing CXCR4 stably and A549-CXCR4-ADRB2 stably overexpressing CXCR4-ADRB2 heteromer, respectiviely, at 28 days after transplantation;
  • FIGURES 23a-23g Shows calcium response in MDAMB231 cells coexpressing CXCR4 and GPCRx upon co-stimulation with CXCL12 and endogenous ligand for GPCRx.
  • MDAMB231 cells were transduced with adenoviruses encoding CXCR4 and HA-VC, GPCRx and HA-VC, or CXCR4 and GPCRx where GPCRx represents ADCYAP1R1 (PAC1) (FIG. 23a), ADORA2B (FIG. 23b), ADORA3 (FIG. 23c), CHRM1 (FIG. 23d), EDNRB (FIG. 23e), MLNR (FIG. 23f), and TACR3 (FIG. 23g).
  • FIGURES 24a-24b Shows calcium response in MDAMB231 cells co-expressing CXCR4 and ADCYAP1R1 upon co-stimulation with their selective endogenous ligands.
  • MDA-MB-231 cells were transduced with adenoviruses encoding CXCR4 and ADCYAP1R1.
  • FIG. 24a Cells were treated with PACAP38 (1 nM, ADCYAP1R1 selective endogenous ligand) alone, increasing doses of CXCL12 alone, or increasing doses of CXCL12 in combination with 1 nM of PACAP38.
  • FIG. 24b Cells were treated with CXCL12 alone, increasing doses of PACAP38 alone, or increasing doses of PACAP38 in combination with 15 nM of CXCL12.
  • FIGURES 25a-25b Shows calcium response in MDA-MB-231 cells co-expressing CXCR4 and TACR3 upon co-stimulation with their selective endogenous ligands.
  • MDA-MB-231 cells were transduced with adenoviruses encoding CXCR4 and TACR3.
  • FIG. 25a Cells were treated with Neurokinin B (0.4 nM, TACR3 selective endogenous ligand) alone, increasing doses of CXCL12 alone, or increasing doses of CXCL12 in combination with 0.4 nM of Neurokinin B.
  • FIG. 25b Cells were treated with CXCL12 alone (30 nM), increasing doses of Neurokinin B alone, or increasing doses of Neurokinin B in combination with 30 nM of CXCL12.
  • FIGURES 26a-26b Shows validation of CRISPR/Cas9-mediated CXCR4 and HRH1 gene editing in MDA-MB-231 cells.
  • FIG. 26a MDA CXCR4+, HRH- cells were generated by disrupting HRH1 gene in MDA-MB-231 cells stably expressing CXCR4 (MDA CXCR4+ ), by transducing lentiviruses encoding Cas9 and guide RNA targeting HRH1. The absence of functional HRH1 was confirmed by measuring calcium responses upon exposure to histamine.
  • FIG. 26b CXCR4 gene was edited in MDA-MB-231 cells using CRISPR/Cas-9 system and expression of CXCR4 was detected using immunoblotting.
  • FIGURES 27a-27b Shows enhanced calcium response in MDA-MB-231 cells upon co-treatment with CXCL12 and histamine is abrogated in the absence of HRH1.
  • MDAMB231 cells stably overexpressing CXCR4 (MDA CXCR4+ ) or MDA CXCR4+ cells depleted with HRH1 using CRISPR/Cas9 system (MDA CXCR4+, HRH1- ) were treated with CXCL12 alone (50 nM), increasing concentrations of histamine, or histamine and CXCL12 together.
  • MDA CXCR4+ cells or MDA CXCR4+, HRH1- cells were treated with histamine alone (15 nM), increasing concentrations of CXCL12, or CXCL12 and histamine together.
  • FIGURES 28a-28b Shows enhanced calcium response in MDA-MB-231 cells upon co-treatment with CXCL12 and histamine is abrogated in the absence of CXCR4.
  • MDA-MB-231 cells MDA WT
  • MDA WT cells depleted with CXCR4 using CRISPR/Cas9 system MDA CXCR4-
  • MDA CXCR4- MDA CXCR4- cells were treated with histamine alone (15 nM), increasing concentrations of CXCL12, or histamine and CXCL12 together.
  • FIG. 28b MDA-MB-231 cells or MDA CXCR4- cells were treated with CXCL12 alone (100 nM), increasing concentrations of histamine alone, or CXCL12 and histamine together, and Ca2+ responses were measured.
  • FIGURES 29a-29b Shows anti-tumor effect of CXCR4 inhibitor, ADRB2 inhibitor, or CXCR4 and ADRB2 inhibitor in mice transplanted with A549-CXCR4-ADRB2 cell line stably overexpressing CXCR4-ADRB2 heteromer.
  • Figure 29a is a graph comparing tumor growth rates for the in vivo antitumor effect of CXCR4 inhibitor LY2510924, ADRB2 inhibitor Carvedilol, or combination of LY2510924 and Carvedilol.
  • Figure 29b is a graph comparing tumor growth rates for the antitumor effect of CXCR4 inhibitor AMD070, ADRB2 inhibitor Carvedilol, or combination of AMD070 and Carvedilol.
  • the results are presented as the mean ⁇ standard deviation of 10 individuals.
  • AML acute myeloid leukemia
  • ADORA3 Adenosine A3 Receptor
  • ADORA2B Adenosine Receptor A2b
  • AdHTS adenovirus high-throughput system
  • AdHTS AdHTS
  • ADCYAP1R1 Adrenoceptor Alpha 1A
  • ADRB2 Adrenoceptor Beta 2
  • APLNR Apelin Receptor
  • APLNR Atypical chemokine receptor 3
  • BiFC bimolecular fluorescence complementation
  • BRET Bioluminescence Resonance Energy Transfer
  • BRET Bioluminescence Resonance Energy Transfer
  • BRET Bioluminescence Resonance Energy Transfer
  • BRET Bioluminescence Resonance Energy Transfer
  • BRET Bioluminescence Resonance Energy Transfer
  • BRET Bioluminescence Resonance Energy Transfer
  • BRET bovine serum albumin
  • CALCR Calcitonin Receptor
  • CSCs C-C chemokine receptor type 2
  • CCR2 chem
  • CXCR4 plays important roles in tumor formation and progression, but the development of CXCR4 antagonists as anticancer drugs has not been successful possibly due to side effects and lack of efficacy within acceptable dose ranges. Recently, various CXCR4-GPCR heteromers with distinct physiological and pharmacological properties were reported, but their roles in cancer biology or possibilities for developing anti-cancer therapeutics targeting CXCR4-GPCR heteromers have not been clearly understood.
  • GPCR heteromerization is known to alter GPCR maturation and cell surface delivery, ligand binding affinity, signaling intensity and pathways, as well as receptor desensitization and recycling (Terrillon and Bouvier 2004; Ferre et al., 2010; Rozenfeld and Devi 2010; Gomes et al., 2016; Farran 2017).
  • GPCR heteromers display distinct functional and pharmacological properties, and GPCR heteromerization can vary depending on cell types, tissues, and diseases or pathological conditions (Terrillon and Bouvier 2004; Ferre et al., 2010;Rozenfeld and Devi 2010; Gomes et al., 2016; Farran 2017).
  • GPCR heteromerization is regarded as a general phenomenon, and deciphering GPCR heteromerization opens new avenues for understanding receptor function, physiology, roles in diseases and pathological conditions. Accordingly, identification of GPCR heteromers and their functional properties offers new opportunity for developing new pharmaceuticals or finding new use of old drugs with fewer side effects, higher efficacy, and increased tissue selectivity (Ferre et al., 2010; Rozenfeld and Devi 2010; Farran 2017).
  • GPCR heteromer The identification of bona fide GPCR heteromer requires intensive and critical evaluation.
  • N-IUPHAR International Union of Basic and Clinical Pharmacology Committee on Receptor Nomenclature and Drug Classification
  • Heteromers should exhibit appropriate co-localization and interaction to enable allosterism using co-immunoprecipitation, in situ hybridization, or proximity-based techniques including proximity ligation assays in cells/tissues that express both receptors and not in cells/tissues that lack one of the receptors; (2) Heteromers should exhibit distinct properties such as changes in signaling, ligand binding, and/or trafficking, only in cells/tissues expressing both receptors but not in cells/tissues that lack one of the receptors; and (3) Heteromer-selective reagents should alter heteromer-specific properties.
  • Heteromer-selective reagents include heteromer-selective antibodies, membrane-permeable peptides, and bivalent/bifunctional ligands (Gomes et al., 2016; Pin et al., 2007). Although many GPCR heteromers have been identified in vitro using recombinant receptors expressed in heterologous cells, only a few have demonstrated novel properties, and very few have shown evidence for GPCR heteromerization in native tissue due to technical problems (Gomes et al., 2016). NC-IUPHAR announced that one should provide evidence that satisfies at least two of the above three criteria for approval of new GPCR heteromers (Pin et al., 2007).
  • co-internalization assays co-localization assays (determining co-localization of the receptor portomers within a cellular compartment) such as in situ hybridization, immunohistochemistry, or immunoelectron microscopy; proximity-based assays, such as proximity-based biophysical techniques, including resonance energy transfer (RET), bioluminescence RET (BRET), fluorescence RET (FRET), time-resolved fluorescence RET (TR-FRET), antibody-aided FRET, ligand-aided FRET, bimolecular fluorescence complementation (BiFC), and proximity ligation assays (PLA); co-immunoprecipitation as RET, bioluminescence RET (BRET), fluorescence RET (FRET), time-resolved fluorescence RET (TR-FRET), antibody-aided FRET, ligand-aided FRET, bimolecular fluorescence complementation (BiFC), and proximity ligation assays (PLA); co-immun
  • criterion 2 of 3 relating to whether a heteromer exhibits properties distinct from those of the individual protomers), such as a CXCR4-GPCRx heteromer that results in an enhanced downstream signaling, for example an enhanced calcium mobilization (such as determined by a calcium mobilization assay)
  • a two-tiered approach was utilized on those CXCR4-GPCRx heteromers that satisfied criterion 1 of 3 discussed above: (1) determine the presence/absence of an enhanced downstream signaling, for example an enhanced calcium mobilization (synergism) in the individual protomer context - comparing calcium mobilization in cells co-expressing HA-VC and one of the protomers (either CXCR4 or GPCRx) upon (a) co-stimulation with CXCL12 and the respective selective agonist, relative to (b) stimulation with either CXCL12 alone or the respective selective agonist alone; and (2) determine the presence/absence of an enhanced downstream signaling, for example an enhanced calcium mobilization (synergism) in the
  • CXCR4-GPCRx heteromer that results in an enhanced downstream signaling, for example an enhanced calcium mobilization
  • an enhanced downstream signaling for example an enhanced calcium mobilization
  • the concentration of CXCL12 utilized to stimulate the cells (either as a single agent or in combination with the respective selective GPCRx agonist) and the concentration of the selective GPCRx agonist (either an endogenous agonist or a known selective agonist for the respective GPCRx) utilized to stimulate the cells (either as a single agent or in combination with CXCL12) are independently at a concentration of 100x the EC50 concentration or lower.
  • the concentration of CXCL12 utilized to stimulate the cells was at a concentration of 15 nM (which is approximately the EC50 concentration against CXCR4).
  • patient derived cells having satisfied criterion 1 of 3 and 2 of 3, are effected in the presence of an antagonist (a CXCR4 antagonist, a GPCRx antagonist, or a CXCR4-GPCRx heteromer antagonist), such as effecting cell proliferation of the patient derived cells containing a CXCR4-GPCRx heteromer.
  • an antagonist a CXCR4 antagonist, a GPCRx antagonist, or a CXCR4-GPCRx heteromer antagonist
  • the method of treating, method of suppressing, pharmaceutical composition, or pharmaceutical kit, as disclosed herein include or rely upon establishing that an association of CXCR4 and a GPCRx in a cell satisfies at least two of the following criteria or characteristics to be considered a CXCR4-GPCRx heteromer, comprising: 1) the CXCR4-GPCRx heteromer components in a cell colocalize and physically interact, either directly or via intermediate proteins acting as conduits for allosterism, as determined via one or more of the following: a co-internalization assay, a colocalization assay, in situ hybridization, immunohistochemistry, immunoelectron microscopy, a proximity-based assay, a co-immunoprecipitation assay, or a fluorescent animal assay; 2) an enhanced amount of calcium mobilization, such that: a) either CXCR4 or the respective GPCRx in an individual protomer context in a cell, upon co-stimulation with CXCL12 and a respective
  • the CXCR4-GPCRx heteromer-selective reagent alters heteromer-specific properties of the CXCR4-GPCRx heteromer in a patient derived cell, as determined by at least one of the following methods: PLA, radioligand binding assays, [35S]GTP- ⁇ S Binding assays, Calcuim assay, cAMP assay, GTPase assay, PKA activation, ERK1/2 and/or Akt/PKB Phosphorylation assays, Src and STAT3 phosphorylation assays, CRE-reporter assay, NFAT-RE-reporter assay, SRE-reporter assay, SRF-RE reporter assay, NF-kB-RE reporter assay, Secreted alkaline phosphatase Assay, Inositol 1-Phosphate Production assay, Adenylyl Cyclase Activity assay, analysis of target gene expression by RT-PCR, RT-q
  • the CXCR4-GPCRx heteromer-selective reagent alters heteromer-specific function of the CXCR4-GPCRx heteromer in a patient derived cell, as determined by at least one of the following methods: PLA, radioligand binding assays, [35S]GTP- ⁇ S Binding assays, Calcuim assay, cAMP assay, GTPase assay, PKA activation, ERK1/2 and/or Akt/PKB Phosphorylation assays, Src and STAT3 phosphorylation assays, CRE-reporter assay, NFAT-RE-reporter assay, SRE-reporter assay, SRF-RE reporter assay, NF-kB-RE reporter assay, Secreted alkaline phosphatase Assay, Inositol 1-Phosphate Production assay, Adenylyl Cyclase Activity assay, analysis of target gene expression by RT-PCR, RT-q
  • the CXCR4-GPCRx heteromer-selective reagent alters heteromer-specific properties of a patient derived cell containing the CXCR4-GPCRx heteromer, as determined by at least one of the following methods: assays on proliferation, migration, invasion, and drug resistance (survival) of cancer cells, modulation of immune cell function, angiogenesis, vasculogenesis, metastasis, drug resistance, tissue microarray (TMA), and cancer cell-tumor microenvironment (TME) interaction.
  • assays on proliferation, migration, invasion, and drug resistance (survival) of cancer cells modulation of immune cell function, angiogenesis, vasculogenesis, metastasis, drug resistance, tissue microarray (TMA), and cancer cell-tumor microenvironment (TME) interaction.
  • the method of treating, method of suppressing, pharmaceutical composition, or pharmaceutical kit, as disclosed herein include or rely upon establishing that an association of CXCR4 and a GPCRx in a cell satisfies at least two of the following criteria or characteristics to be considered a CXCR4-GPCRx heteromer, comprising: 1) the CXCR4-GPCRx heteromer components in a cell colocalize and physically interact, either directly or via intermediate proteins acting as conduits for allosterism, as determined via one or more of the following: a co-internalization assay, bimolecular fluorescence complementation (BiFC), or a proximity ligation assay (PLA); 2) an enhanced amount of calcium mobilization, such that: a) either CXCR4 or the respective GPCRx in an individual protomer context in a cell, upon co-stimulation with CXCL12 and a respective selective GPCRx agonist, results in a calcium mobilization amount that is equal to or less than the sum of calcium mobiliz
  • the method of treating, method of suppressing, pharmaceutical composition, or pharmaceutical kit, as disclosed herein include or rely upon establishing that an association of CXCR4 and a GPCRx in a cell satisfies criteria 1 and 2 to be considered a CXCR4-GPCRx heteromer.
  • the method of treating, method of suppressing, pharmaceutical composition, or pharmaceutical kit, as disclosed herein include or rely upon establishing that an association of CXCR4 and a GPCRx in a cell satisfies criteria 1 and 3 to be considered a CXCR4-GPCRx heteromer.
  • the method of treating, method of suppressing, pharmaceutical composition, or pharmaceutical kit, as disclosed herein include or rely upon establishing that an association of CXCR4 and a GPCRx in a cell satisfies criteria 2 and 3 to be considered a CXCR4-GPCRx heteromer.
  • the method of treating, method of suppressing, pharmaceutical composition, or pharmaceutical kit, as disclosed herein include or rely upon establishing that an association of CXCR4 and a GPCRx in a cell satisfies criteria 1, 2, and 3, to be considered a CXCR4-GPCRx heteromer.
  • the CXCR4-GPCRx heteromer satisfying at least two of the three criteria may have, cause, or produce an enhanced downstream signaling.
  • the enhanced downstram signaling may be the result from the CXCR4-GPCRx heteromer, such as from agonism of the CXCR4-GPCRx heteromer, from CXCR4 agonism of the CXCR4-GPCRx heteromer, from GPCRx agonism of the CXCR4-GPCRx heteromer, and/or from CXCR4 agonism and GPCRx agonism of the CXCR4-GPCRx heteromer.
  • the enhanced downstram signaling may be downstream of the CXCR4, the respective GPCRx, or the CXCR4-GPCRx heteromer.
  • the enhanced downstram signaling may be from the CXCR4-GPCRx heteromer, relative to downstream signaling from a CXCR4 protomer or a respective GPCRx protomer in their respective individual protomer context. In some embodiments, the enhanced downstram signaling may be from the CXCR4-GPCRx heteromer, relative to downstream signaling from a CXCR4 protomer in an individual protomer context. In some embodiments, the enhanced downstram signaling may be from the CXCR4-GPCRx heteromer, relative to downstream signaling from a respective GPCRx protomer in an individual protomer context.
  • the enhanced downstram signaling may be from the CXCR4-GPCRx heteromer, relative to downstream signaling from a CXCR4 protomer and a respective GPCRx protomer in their respective individual protomer context.
  • the enhanced downstream signaling from said CXCR4-GPCRx heteromer may in some embodiments, be suppressed in the cancer patient, such as suppressed in the patient's cancer cells.
  • the enhanced downstream signaling from said CXCR4-GPCRx heteromer may be an enhanced amount of calcium mobilization (or synergistic amount of calcium mobilization), which may be determined by an intracellular Ca2+ assay, such as a calcium mobilization assay.
  • the CXCR4-GPCRx heteromer satisfying at least two of the three criteria may have, cause, or produce an enhanced downstream signaling, wherein the enhanced downstream signaling is an enhanced amount of calcium mobilization.
  • the enhanced amount of calcium mobilization from the CXCR4-GPCRx heteromer may be a calcium mobilization amount that, upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist, is at least 10% greater, than the sum of calcium mobilization amounts resulting from single agonist stimulation of said cells with either the CXCL12 or the respective selective GPCRx agonist, as determined via a calcium mobilization assay.
  • the enhanced amount of calcium mobilization from the CXCR4-GPCRx heteromer may be a synergistic amount of calcium mobilization that, upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist, is at least 10% greater, than the sum of calcium mobilization amounts resulting from single agonist stimulation of said cells with either the CXCL12 or the respective selective GPCRx agonist, as determined via a calcium mobilization assay.
  • the enhanced amount of calcium mobilization (or synergistic amount of calcium mobilization) from the CXCR4-GPCRx heteromer may be a calcium mobilization amount that, upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist, is at least 20% greater, at least 30% greater, at least 40% greater, at least 50% greater, at least 75% greater, at least 90% greater, at least 100% greater, at least 150% greater, or at least 200% greater, than the sum of calcium mobilization amounts resulting from single agonist stimulation of said cells with either the CXCL12 or the respective selective GPCRx agonist, as determined via a calcium mobilization assay.
  • the enhanced amount of calcium mobilization (or synergistic amount of calcium mobilization) from the CXCR4-GPCRx heteromer may be a calcium mobilization amount that, upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist, may be between 10-100% greater than the sum of calcium mobilization amounts resulting from single agonist stimulation of said cells with either the CXCL12 or the respective selective GPCRx agonist, as determined via a calcium mobilization assay, for example, may be a calcium mobilization amount that, upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist, may be between 25-100% greater, 50-100% greater, 75-100% greater , or 100-200% greater, than the sum of calcium mobilization amounts resulting from single agonist stimulation of said cells with either the CXCL12 or the respective selective GPCRx agonist, as determined via a calcium mobilization assay.
  • the CXCR4-GPCRx heteromer satisfies at least two of the three criteria, thereby having, causing, or producing, an enhanced downstream signaling, wherein the enhanced downstream signaling is an enhanced amount of calcium mobilization, such that: a) either the CXCR4 or the respective GPCRx in an individual protomer context in the cell upon co-stimulation with CXCL12 and a respective selective GPCRx agonist results in a calcium mobilization amount that is equal to or less than the sum of calcium mobilization amounts resulting from single agonist stimulation with either the CXCL12 or the respective selective GPCRx agonist; and b) the CXCR4-GPCRx heteromer exhibits an enhanced calcium mobilization upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist relative to the sum of calcium mobilization amounts resulting from single agonist stimulation with either the CXCL12 or the respective selective GPCRx agonist;
  • the enhanced downstream signaling from the CXCR4-GPCRx heteromer is an enhanced amount of calcium mobilization, such that: i) the calcium mobilization from the protomer CXCR4 or GPCRx, in the individual protomer context in the cell, is non-synergistic, as determined via calcium mobilization assay; and ii) the calcium mobilization from the CXCR4-GPCRx heteromer in the cell is synergistic, as determined via a calcium mobilization assay.
  • the individual protomer context may be: a) the individual protomer CXCR4 in the cell, in the absence of the respective individual protomer GPCRx; or b) the respective individual protomer GPCRx in the cell, in the absence of the individual protomer CXCR4; upon co-stimulation with CXCL12 and a respective selective GPCRx agonist results in a calcium mobilization amount that is equal to or less than the sum of calcium mobilization amounts resulting from single agonist stimulation with either the CXCL12 or the respective selective GPCRx agonist, as determined via a calcium mobilization assay.
  • the individual protomer context may be, independently: a) the individual protomer CXCR4 in the cell, in the absence of the respective individual protomer GPCRx; and b) the respective individual protomer GPCRx in the cell, in the absence of the individual protomer CXCR4; upon co-stimulation with CXCL12 and a respective selective GPCRx agonist results in a calcium mobilization amount that is equal to or less than the sum of calcium mobilization amounts resulting from single agonist stimulation with either the CXCL12 or the respective selective GPCRx agonist, as determined via a calcium mobilization assay.
  • the CXCR4-GPCRx heteromer upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist, may result in a calcium mobilization amount that is greater than the sum of calcium mobilization amounts resulting from single agonist stimulation of said cells with either the CXCL12 or the respective selective GPCRx agonist, as determined via a calcium mobilization assay.
  • CXCR4 refers to C-X-C Motif Chemokine Receptor 4, also identified by unique database identifiers (IDs) and alternate names as shown in Table 1 (Chatterjee et al., 2014; Debnath et al., 2013; Domanska et al., 2013; Guo et al., 2016; Peled et al., 2012; Roccaro et al., 2014; Walenkamp et al., 2017).
  • IDs unique database identifiers
  • GPCRx refers to GPCRs that were used in this study to investigate if these GPCRs interact with CXCR4 and show properties distinct from those of individual protomers, including ADCYAP1R1 (ADCYAP Receptor Type I), ADORA2B (Adenosine A2b Receptor), ADORA3 (Adenosine A3 Receptor), ADRB2 (Adrenoceptor Beta 2), APLNR (Apelin Receptor), C5AR1 (Complement C5a Receptor 1), CALCR (Calcitonin Receptor), CCR5 (Chemokine (C-C Motif) Receptor 5), CHRM1 (Cholinergic Receptor Muscarinic 1), GALR1 (Galanin Receptor 1), EDNRB (Endothelin Receptor Type B), HRH1 (Histamine Receptor H1), MLNR (Motilin Receptor), NTSR1 (Neurotensin
  • Table 1 shown below provides the nomenclature of GPCRx that form heteromers with CXCR4 and synergistically enhance Ca2+ response upon co-stimulation with both agonists
  • Table 2 shown below provides the nomenclature of GPCRx that form heteromers with CXCR4, but do not synergistically enhance Ca2+ response upon co-stimulation with both agonists.
  • ADCYAP1R1 Pituitary adenylate cyclase-activating polypeptide type I receptor also known as PAC1
  • PAC1 Pituitary adenylate cyclase-activating polypeptide type I receptor also known as PAC1
  • ADCYAP1R1 is a protein that in humans is encoded by the ADCYAP1R1 gene. This receptor binds pituitary adenylate cyclase activating peptide.
  • ADCYAP1R1 is a membrane-associated protein and shares significant homology with members of the G-protein coupled class B glucagon/secretin receptor family. This receptor mediates diverse biological actions of adenylate cyclase activating polypeptide 1 and is positively coupled to adenylate cyclase (Vaudry et al., 2000). This is a receptor for PACAP-27 and PACAP-38.
  • ADCYAP1R1 may regulate the release of adrenocorticotropin, luteinizing hormone, growth hormone, prolactin, epinephrine, and catecholamine. ADCYAP1R1 may play a role in spermatogenesis and sperm motility. ADCYAP1R1 causes smooth muscle relaxation and secretion in the gastrointestinal tract (Ogi et al., 1993).
  • ADCYAP1R1 is expressed in the adrenal medulla, pancreatic acini, uterus, myenteric plexus and brain (Reubi, 2000; Reubi et al., 2000). It is also expressed in the trigeminal, otic and superior cervical ganglia (prejunctional) and cerebral arteries (postjunctional) (Knutsson and Edvinsson, 2002). Diseases associated with ADCYAP1R1 include post-traumatic stress disorder (Lowe et al., 2015) and anxiety disorder. Among its related pathways are G alpha(s) signalling events and RET signaling (Cooper et al., 2013).
  • Adenosine A2B receptor also known as ADORA2B
  • ADORA2B is a G-protein coupled adenosine receptor, and also denotes the human adenosine A2b receptor gene which encodes it.
  • Adenosine functions as a signaling molecule through the activation of four distinct adenosine receptors - ADORA1, ADORA2A, ADORA2B, and ADORA3, also called as A1, A2A, A2B, and A3, respectively.
  • This integral membrane protein stimulates adenylate cyclase activity in the presence of adenosine. This protein also interacts with netrin-1, which is involved in axon elongation.
  • ADORA2A and ADORA2B receptors are important in cancer immunology.
  • the tumor microenvironment is hypoxic, which promotes the expression of CD39 and CD73 by immune cells.
  • CD39 and CD73 are ectonucleotidases that convert ATP to adenosine, elevating concentrations of adenosine locally.
  • Adenosine is a crucial mediator of altered immune function in cancer as it binds ADORA2A and ADORA2B receptors on lymphocytes silencing the antitumor immune response (Chen et al., 2013).
  • ADORA2B has a role in regulating CXCR4 expression in vivo and in protecting against vascular lesion formation (Yang et al., 2008) and promotes progression of human oral cancer (Kasama et al., 2015). Identification of a pharmacologically tractable Fra-1/ADORA2B axis promoting breast cancer metastasis (Desmet et al., 2013). ADORA2B receptors display high expression levels in the cecum, colon and bladder, with lower levels in the lung, blood vessels and eye (Fagerberg et al., 2014).
  • ADORA3 The adenosine A3 receptor, also known as ADORA3, is an adenosine receptor, but also denotes the human gene encoding it.
  • ADORA3 receptors are G-protein coupled receptors that couple to Gi/Gq and are involved in a variety of intracellular signaling pathways and physiological functions. It mediates a sustained cardioprotective function during cardiac ischemia, it is involved in the inhibition of neutrophil degranulation in neutrophil-mediated tissue injury, it has been implicated in both neuroprotective and neurodegenerative effects, and it may also mediate both cell proliferation and cell death (Gao et al., 2008; Miwatashi et al., 2008).
  • Cordycepin induces apoptosis in human bladder cancer cells via activation of ADORA3 receptors (Cao et al., 2017). Jafari et al. showed that ADORA3 receptor agonist inhibited survival of breast cancer stem cells via GLI-1 and ERK1/2 pathway (Jafari et al., 2017). ADORA3 is broadly expressed in adrenal (RPKM 4.4), small intestine (RPKM 2.9) and 20 other tissues containing brain, bladder, lymph node and colon (Fagerberg et al., 2014).
  • ADRB2 The beta-2 adrenergic receptor ( ⁇ 2 adrenoreceptor), also known as ADRB2, is a cell membrane-spanning beta-adrenergic receptor that interacts with epinephrine, a hormone and neurotransmitter (ligand synonym, adrenaline) whose signaling, via a downstream L-type calcium channel interaction, mediates physiologic responses such as smooth muscle relaxation and bronchodilation (Gregorio et al., 2017).
  • ADRB2 functions in muscular system such as smooth muscle relaxation, motor nerve terminals, glycogenolysis and in circulatory system such as heart muscle contraction, cardiac output increase.
  • beta-2 stimulation by salbutamol increases intraocular pressure via net.
  • the ADRB2 induces glycogenolysis and gluconeogenesis in liver and insulin secretion from pancreas (Fitzpatrick, 2004).
  • ADRB2 signaling in the cardiac myocyte is modulated by interactions with CXCR4 (LaRocca et al., 2010). Norepinephrine attenuates CXCR4 expression and the corresponding invasion of MDA-MB-231 breast cancer cells via ADRB2 (Wang et al., 2015a). ADRB2 is expressed in several cancers such as pancreatic, prostate (Braadland et al., 2014; Xu et al., 2017), renal and breast cancer (Choy et al., 2016).
  • C5AR1 The C5a receptor also known as complement component 5a receptor 1 (C5AR1) or CD88 (Cluster of Differentiation 88) is a G protein-coupled receptor for C5a. It functions as a complement receptor. C5AR1 modulates inflammatory responses, obesity, development and cancers. (Gerard and Gerard, 1994).
  • the C5AR1 is expressed on granulocytes, monocytes, dendritic cells, hepatoma-derived cell line HepG2, astrocytes, microglia (Klos et al., 2013). C5AR1 is related in several diseases such as inflammatory bowel disease, rheumatoid arthritis, psoriasis, experimental allergic encephalomyelitis, multiple sclerosis, meningitis, and brain trauma (Lee et al., 2008).
  • CT The calcitonin receptor
  • the calcitonin receptor is a G protein-coupled receptor that binds the peptide hormone calcitonin and is involved in maintenance of calcium homeostasis, particularly with respect to bone formation and metabolism (Dacquin et al., 2004; Davey et al., 2008).
  • CT works by activating the G-proteins Gs and Gq often found on osteoclasts, on cells in the kidney, and on cells in a number of regions of the brain. It may also affect the ovaries in women and the testes in men.
  • the activity of this receptor is mediated by G proteins which activate adenylyl cyclase.
  • the calcitonin receptor is thought to couple to the heterotrimeric guanosine triphosphate-binding protein that is sensitive to cholera toxin.
  • the physiological effects of CT such as inhibition of osteoclast mediated bone resorption or increased Ca2+ excretion by the kidney are mediated by high affinity CTs (Albrandt et al., 1995).
  • the muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system (Rang, 2003).
  • the muscarinic cholinergic receptor 1 is involved in mediation of vagally-induced bronchoconstriction and in the acid secretion of the gastrointestinal tract. It is predominantly found bound to G proteins of class Gq that use upregulation of phospholipase C and, therefore, inositol trisphosphate and intracellular calcium as a signaling pathway (Qin et al., 2011).
  • CHRM1 - CHRM5 Muscarinic receptors are widely distributed throughout the body and control distinct functions according to location and subtype (CHRM1 - CHRM5). They are predominantly expressed in the parasympathetic nervous system where they exert both inhibitory and excitatory effects. This receptor is found mediating slow excitatory postsynaptic potential at the ganglion in the postganglionic nerve, is common in exocrine glands and in the CNS (Johnson, 2002). Diseases associated with CHRM1 include asthma and heart block, congenital and Pelizaeus-Merzbacher disease. Activators of CHRM1 muscarinic acetylcholine receptors (mAChRs) may provide novel treatments for schizophrenia and Alzheimer's disease (Marlo et al., 2009).
  • mAChRs muscarinic acetylcholine receptors
  • EDNRB -- Endothelin receptor type B (ETB) receptor was cloned shortly after the ETA receptor (EDBRA).
  • EDNRA Endothelin receptor type B
  • the EDNRA belongs to class A of G protein-coupled heptahelical receptors with an external amino terminus and internal carboxy terminus and binding sites intrinsic to the heptahelical portions of the receptor.
  • ET-1 has a high affinity for the EDNRB.
  • the pharmacology of the EDNRB receptor is somewhat richer than that of the EDNRA in that multiple agonists of the EDNRB are recognized, including sarafotoxin 6c (S6c) and IRL1620.
  • Selective antagonists of the EDNRB include BQ788, A192621, RES7011, and IRL2500.
  • the EDNRB has been localized to cardiovascular tissues, the pulmonary system, neurons, bone, pancreas, and kidney (Watts, 2010).
  • EDNRB is a G protein-coupled receptor which activates a phosphatidylinositol-calcium second messenger system. Its ligand, endothelin, consists of a family of three potent vasoactive peptides: ET1, ET2, and ET3. In melanocytic cells the EDNRB gene is regulated by the microphthalmia-associated transcription factor. Mutations in either gene are links to Waardenburg syndrome (Sato-Jin et al., 2008). The multigenic disorder, Hirschsprung disease type 2, is due to mutation in EDNRB gene (Tanaka et al., 1998). Diseases associated with EDNRB include Waardenburg syndrome, Type 4A and Abcd syndrome. Among its related pathways are calcium signaling pathway and prostaglandin synthesis and regulation of Waardenburg Syndrome (Sato-Jin et al., 2008).
  • HRH1 The H1 receptor is a histamine receptor belonging to the family of rhodopsin-like G-protein-coupled receptors. This receptor is activated by the biogenic amine histamine.
  • the HRH1 is linked to an intracellular G-protein (Gq) that activates phospholipase C and the inositol triphosphate (IP3) signaling pathway.
  • Gq G-protein
  • IP3 inositol triphosphate
  • Antihistamines which act on this receptor, are used as anti-allergy drugs.
  • the crystal structure of the receptor has been determined and used to discover new HRH1 ligands in structure-based virtual screening studies (de Graaf et al., 2011).
  • a subunit of the G-protein subsequently dissociates and affects intracellular messaging including downstream signaling accomplished through various intermediaries such as cyclic AMP, cyclic GMP, calcium, and nuclear factor kappa B. It functions in immune-cell chemotaxis, pro-inflammatory cytokine production, expression of cell adhesion molecules, and other allergic and inflammatory conditions (Canonica and Blaiss, 2011).
  • the HRH1 mediates the contraction of smooth muscles, increase in capillary permeability due to contraction of terminal venules, and catecholamine release from adrenal medulla, as well as mediating neurotransmission in the central nervous system. It is also known to contribute to the pathophysiology of allergic diseases such as atopic dermatitis, asthma, anaphylaxis and allergic rhinitis (Xie and He, 2005). It is expressed in smooth muscles, on vascular endothelial cells, in the heart, and in the central nervous system (de Graaf et al., 2011).
  • MLNR -- Motilin receptor is a G protein-coupled receptor that binds motilin. Motilin in turn is an intestinal peptide that stimulates contraction of gut smooth muscle. Also, the MLNR mediates progastrokinetic effects. MLNR is an important therapeutic target for the treatment of hypomotility disorders (Depoortere, 2001).
  • NTSR1 Neurotensin receptor 1 belongs to the large superfamily of G-protein coupled receptors. Neurotensin is a 13-amino acid peptide originally isolated from hypothalamic and later from intestines of bovine. In the brain, neurotensin is exclusively found in nerve cells, fibers, and terminals, whereas the majority of peripheral neurotensin is found in the endocrine N-cells located in the intestinal. Central or peripheral injections of neurotensin produce completely different pharmacological effects indicating that the peptide does not cross the blood-brain barrier. NTSR1 mediates the multiple functions of neurotensin, such as hypotension, hyperglycemia, hypothermia, antinociception, and regulation of intestinal motility and secretion (Vincent, 1995).
  • Signaling is effected via G proteins that activate a phosphatidylinositol-calcium second messenger system. Signaling leads to the activation of downstream MAP kinases and protects cells against apoptosis (Heakal et al., 2011). Swift et al. showed altered expression of neurotensin receptors is associated with the differentiation state of prostate cancer (Swift et al., 2010).
  • PTGER2 -- Prostaglandin E2 receptor 2 also known as EP2 is a prostaglandin receptor for prostaglandin E2 (PGE2) encoded by the human gene PTGER2.
  • PGE2 prostaglandin receptor for prostaglandin E2
  • PTGER2 is classified as a relaxant type of prostanoid receptor based on its ability, upon activation, to relax certain types of smooth muscle. When initially bound to PGE2 or any other of its agonists, it mobilizes G proteins containing the G ⁇ s-G ⁇ complex. The G ⁇ s- G ⁇ complexes dissociate into their G ⁇ s and G ⁇ subunits which in turn regulate cell signaling pathways.
  • G ⁇ s stimulates adenyl cyclase to raise cellular levels of cAMP thereby activating PKA;
  • PKA activates various types of signaling molecules such as the transcription factor CREB which lead to different types of functional responses depending on cell type (Markovic et al., 2017; Woodward et al., 2011).
  • PTGER2 also activates the GSK-3 pathway which regulates cell migratory responses and innate immune responses including pro-inflammatory cytokine and interleukin production and Beta-catenin pathway which regulates not only cell-cell adhesion but also activates the Wnt signaling pathway which, in turn, stimulates the transcription of genes responsible for regulating cell migration and proliferation (Woodward et al., 2011).
  • the PTGER2 receptor can act as a tumor promoter.
  • PTGER2 gene knockout mice have less lung, breast, skin, and colon cancers following exposure to carcinogens. Knockout of this gene in mice with the adenomatous polyposis coli mutation also causes a decrease in the size and number of pre-cancerous intestinal polyps that the animals develop. These effects are commonly ascribed to the loss of PTGER2-mediated: vascular endothelial growth factor production and thereby of tumor vascularization; regulation of endothelial cell motility and survival; interference with transforming growth factor- ⁇ 's anti-cell proliferation activity; and, more recently, regulation of host anti-tumor immune responses (O'Callaghan and Houston, 2015).
  • PTGER2 is widely distributed in humans. Its protein is expressed in human small intestine, lung, media of arteries and arterioles of the kidney, thymus, uterus, brain cerebral cortex, brain striatum, brain hippocampus, corneal epithelium, corneal choriocapillaries, Myometriuml cells, eosinophiles, sclera of the eye, articular cartilage, the corpus cavernosum of the penis, and airway smooth muscle cells; its mRNA is expressed in gingival fibroblasts, monocyte-derived dendritic cells, aorta, corpus cavernosum of the penis, articular cartilage, airway smooth muscle, and airway epithelial cells. In rats, the receptor protein and/or mRNA has been found in lung, spleen, intestine, skin, kidney, liver, long bones, and rather extensively throughout the brain and other parts of the central nervous system (Yagami et al., 2016).
  • PTGER2 may be a target for treating and/or preventing particular human disorders involving: allergic diseases such as asthma (particular aspirin and nonsteroidal inflammatory drug-induced asthma syndromes) and rhinitis (Machado-Carvalho et al., 2014); glaucoma (Doucette and Walter, 2017); various diseases of the nervous system (Yagami et al., 2016); fractures, osteoporosis, and other bone abnormalities (Li et al., 2007); pulmonary fibrosis; certain forms of malignant disease such as colon cancer including those that arise from Adenomatous polyposis coli mutations (O'Callaghan and Houston, 2015); and salt-sensitive forms of hypertension (Yang and Du, 2012); This receptor has also been suggested to be a target for contraception (Sugimoto et al., 2015).
  • allergic diseases such as asthma (particular aspirin and nonsteroidal inflammatory drug-induced asthma syndromes) and rhinitis (Machado-Carval
  • TACR3 -- Tachykinin receptor 3 also known as TACR3, function as receptors for tachykinins.
  • the tachykinins are a family of peptides that comprise substance P (SP), neurokinin A (NKA), neurokinin B (NKB) and the species divergent endokinins including endokinin B (EKB) in humans. These tachykinins are encoded on three different genes, preprotachykinin 1 (TAC1) encoding SP and NKA, TAC3 encoding NKB and TAC4 encoding EKB.
  • SP substance P
  • NKA neurokinin A
  • NKB neurokinin B
  • EKB endokinin B
  • TACR1, TACR2, and TACR3 also called as NK1, NK2 and NK3, respectively, whereby SP and EKB show the greatest potency for TACR1, NKA for TACR2 and NKB for TACR3.
  • Receptor affinities are specified by variations in the 5'-end of the sequence.
  • Tachykinin receptor-3 (TACR3) is the mediator of biologic actions encoded by the C-terminal sequence of tachykinins, for which neurokinin B is a more potent agonist than neurokinin A or substance P (Page et al., 2003).
  • NKB a member of the substance P-related tachykinin family, is known to be highly expressed in hypothalamic neurons that also express kisspeptin (Goodman et al., 2007), a recently identified regulator of gonadotropin-releasing hormone secretion (Gianetti and Seminara, 2008).
  • APLNR The apelin receptor (also known as the APJ receptor) is a G protein-coupled receptor which binds apelin and Apela/ELABELA/Toddler (Medhurst et al., 2003).
  • APLNR Receptor for apelin receptor early endogenous ligand (APELA) and apelin (APLN) hormones coupled to G proteins that inhibit adenylate cyclase activity.
  • APLNR plays a key role in early development such as gastrulation and heart morphogenesis by acting as a receptor for APELA hormone.
  • APLNR plays also a role in various processes in adults such as regulation of blood vessel formation, blood pressure, heart contractility, and heart failure by acting as a receptor for APLN hormone.
  • APLNR phosphorylation of protein kinase B (Akt), ERK1/25 and p70S6K, calcium mobilization7 and nitric oxide synthase (NOS).
  • Akt protein kinase B
  • NOS nitric oxide synthase
  • CCR5 -- C-C chemokine receptor type 5 also known as CCR5 or CD195, is a protein on the surface of white blood cells that is involved in the immune system as it acts as a receptor for chemokines. This is the process by which T cells are attracted to specific tissue and organ targets.
  • Certain populations have inherited the Delta 32 mutation resulting in the genetic deletion of a portion of the CCR5 gene. Homozygous carriers of this mutation are resistant to M-tropic strains of HIV-1 infection (Hutter et al., 2009).
  • CCR5's cognate ligands include CCL3, CCL4 (also known as MIP 1 ⁇ and 1 ⁇ , respectively), and CCL3L1.
  • CCR5 furthermore interacts with CCL5 (Struyf et al.
  • CCR5 plays a role in inflammatory responses to infection, though its exact role in normal immune function is unclear. Regions of this protein are also crucial for chemokine ligand binding, functional response of the receptor, and HIV co-receptor activity (Barmania and Pepper, 2013). CCR5 is predominantly expressed on T cells, macrophages, dendritic cells, eosinophils, microglia and a subpopulation of ether breast or prostate cancer cells (Sicoli et al., 2014; Velasco-Velazquez et al., 2012).
  • GALR1 -- Galanin receptor 1 (GAL1) is a G-protein coupled receptor encoded by the GALR1 gene.
  • the ubiquitous neuropeptide galanin controls numerous functions such as endocrine secretions, intestinal motility, and behavioral activities. These regulatory effects of galanin are mediated through the interaction with specific membrane receptors and involve the pertussis toxin-sensitive guanine nucleotide binding proteins Gi/Go as transducing elements (Habert-Ortoli et al., 1994).
  • GALR1 has anti-proliferative effects in oral squamous cell carcinoma.
  • GALR1 protein and mRNA expression and GAL secretion were detected at variable levels in immortalized human oral keratinocytes and human oropharyngeal squamous cell carcinoma cell lines.
  • proliferation was up-regulated in immortalized and malignant keratinocytes (Henson et al., 2005)
  • PTGER3 -- Prostaglandin EP3 receptor (53kDa), also known as EP3, is a prostaglandin receptor for prostaglandin E2 (PGE2) encoded by the human gene PTGER3; it is one of four identified EP receptors, the others being PTGER1, PTGER2, and PTGER4, also called as EP1, EP2, and EP4, respectively, all of which bind with and mediate cellular responses to PGE2 and also, but generally with lesser affinity and responsiveness, certain other prostanoids.
  • PGE2 prostaglandin E2
  • PTGER3 activation promotes duodenal secretion in mice; this function is mediated by PTGER3 activation in humans.
  • EP receptor functions can vary with species and most of the functional studies cited here have not translated their animal and tissue models to humans (Moreno, 2017).
  • PTGER3 is widely distributed in humans. Its protein and/or mRNA is expressed in kidney (i.e. glomeruli, Tamm-Horsfall protein negative late distal convoluted tubules, connecting segments, cortical and medullary collecting ducts, media and endothelial cells of arteries and arterioles); stomach (vascular smooth muscle and gastric fundus mucosal cells); thalamus (anterior, ventromedial, laterodorsal, paraventricular and central medial nuclei); intestinal mucosal epithelia at the apex of crypts; myometrium (stromal cells, endothelial cells, and, in pregnancy, placenta, chorion, and amnion); mouth gingival fibroblasts; and eye (corneal endothelium and keratocytes, trabecular cells, ciliary epithelium, and conjunctival and iridal stroma cells, and retinal M ⁇ ller cells) (Norel
  • Somatostatin receptor type 2 is a protein that in humans is encoded by the SSTR2 gene. Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR2 has been shown to interact with shank2 (Zitzer et al., 1999).
  • SSTR2 encodes somatostatin receptor that can inhibit the cell proliferation of solid tumors.
  • SSTR2 promoter hypermethylation is associated with the risk and progression of laryngeal squamous cell carcinoma in males (Shen et al., 2016). Most pituitary adenomas express SSTR2, but other somatostatin receptors are also found (Miller et al., 1995).
  • Somatostatin analogs i.e. Octreotide, Lanreotide
  • SSTR2 is expressed in highest levels in cerebrum and kidney (Fagerberg et al., 2014).
  • inhibitor refers to molecule that inhibits or suppresses the enhanced function of CXCR4-GPCRx heteromer.
  • Non-limiting examples of the inhibitor of the invention that can be used for treatment, amelioration, or prevention of a cancer or related symptoms include GPCRx antagonist, GPCRx inverse agonist, GPCRx positive and negative allosteric modulator, CXCR4-GPCRx heteromer-specific antibody or its antigen biding portions including single-domain antibody-like scaffolds, bivalent ligands which have a pharmacophore selective for CXCR4 joined by a spacer arm to a pharmacophore selective for GPCRx, bispecific antibody against CXCR4 and GPCRx, radiolabeled CXCR4 ligand linked with GPCRx ligand, and small molecule ligands that inhibit heteromer-selective signaling.
  • antagonist refers to a type of receptor ligand or drug that blocks or dampens a biological response by binding to and blocking a receptor, also called blockers. Antagonists have affinity but no efficacy for their cognate receptors, and their binding disrupts the interaction and inhibit the function of an agonist or inverse agonist at the cognate receptors. Certain examples of antagonists against GPCRx that form heteromers with CXCR4 and enhance Ca2+ response upon co-stimulation with both agonists are listed in Table 3.
  • Antibodies/ nanobodies/ i-bodies/others CXCR4 ALX40-4C, AMD070 (AMD11070, X4P-001), AMD3100 (plerixafor), AMD3465, ATI 2341, BKT140 (BL-8040; TF14016; 4F-Benzoyl-TN14003), CTCE-9908, CX549, D-[Lys3] GHRP-6, FC122, FC131, GMI-1359, GSK812397, GST-NT21MP, isothiourea-1a, isothiourea-1t (IT1t), KRH-1636, KRH-3955, LY2510924, MSX-122, N-[ 11 C]Methyl-AMD3465, POL6326, SDF-1 1-9[P2G] dimer, SDF1 P2G, T134, T140, T22, TC 14012, TG-0054 (Burixa
  • MLNR GM-109, MA-2029, and OHM-11526 NTSR1 Meclinertant, SR48527, SR48692, and SR142948A TACR3 [Trp 7 , ⁇ -Ala 8 ] neurokinin A-(4-10), AZD2624, FK 224, GR138676, GSK 172981, GSK 256471, N',2-diphenylquinoline-4-carbohydrazide 8m, N′,2-diphenylquinoline-4-carbohydrazide, osanetant, PD 154740, PD 161182, PD157672, saredutant, SB 218795, SB 222200, SB 235375, SCH 206272, SSR 146977, and talnetant.
  • the method for treating cancer in a patient having a cell containing a CXCR4-GPCRx heteromer, or the method of suppressing enhanced downstream signaling from a CXCR4-GPCRx heteromer in a cell of a patient suffereing from cancer may comprise administering, or the pharmaceutical kit or pharmaceutical kit, comprise, administering to the patient an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein: i) the CXCR4-GPCRx heteromer has enhanced downstream signaling; and ii) the administered inhibitor or combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient.
  • the pharmaceutical kit or pharmaceutical composition for use in treating cancer in a patient having a cell containing a CXCR4-GPCRx heteromer may comprise an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein the CXCR4-GPCRx heteromer has enhanced downstream signaling.
  • the CXCR4 inhibitor is an antagonist of CXCR4, an inverse agonist of CXCR4, a partial antagonist of CXCR4, an allosteric modulator of CXCR4, an antibody of CXCR4, an antibody fragment of CXCR4, a ligand of CXCR4, or an antibody-drug conjugate of CXCR4.
  • the GPCRx inhibitor is an antagonist of GPCRx, an inverse agonist of GPCRx, a partial antagonist of GPCRx, an allosteric modulator of GPCRx, an antibody of GPCRx, an antibody fragment of GPCRx, a ligand of GPCRx, or an antibody-drug conjugate of GPCRx.
  • the inhibitor of the CXCR4-GPCRx heteromer is an antagonist of the CXCR4-GPCRx heteromer, an inverse agonist of the CXCR4-GPCRx heteromer, a partial antagonist of the CXCR4-GPCRx heteromer, an allosteric modulator of the CXCR4-GPCRx heteromer, an antibody of the CXCR4-GPCRx heteromer, an antibody fragment of the CXCR4-GPCRx heteromer, a ligand of the CXCR4-GPCRx heteromer, a protein-protein interaction (PPI) inhibitor of the CXCR4-GPCRx heteromer, or an antibody-drug conjugate of the CXCR4-GPCRx heteromer.
  • PPI protein-protein interaction
  • the method for treating, method of suppressing, pharmaceutical kit, or pharmaceutical composition, as disclosed herein includes a combination of inhibitors selected from the group consisting of: the CXCR4 inhibitor, the GPCRx inhibitor, and the inhibitor of the CXCR4-GPCRx heteromer, wherein the combination may be in a single pharmaceutical composition or a plurality of separate pharmaceutical compositions for each respective inhibitor.
  • the combination of inhibitors comprises the CXCR4 inhibitor and the GPCRx inhibitor.
  • the combination of inhibitors comprises the CXCR4 inhibitor and the inhibitor of the CXCR4-GPCRx heteromer.
  • the combination of inhibitors comprises the GPCRx inhibitor and the inhibitor of the CXCR4-GPCRx heteromer.
  • the combination of inhibitors are administered sequentially, concurrently, or simultaneously. In some embodiments, the combination of inhibitors are administered as a pharmaceutical composition further comprising a pharmaceutically acceptable carrier. In some embodiments, the combination of inhibitors are administered as separate pharmaceutical compositions, wherein the separate pharmaceutical compositions independently further comprise a pharmaceutically acceptable carrier. In some embodiments, the method for treating, method of suppressing, pharmaceutical kit, or pharmaceutical composition, as disclosed herein, comprises a therapeutically effective amount or a sub-therapeutically effective amount of the CXCR4 inhibitor, such as administering a therapeutically effective amount of the CXCR4 inhibitor to the patient.
  • the method for treating, method of suppressing, pharmaceutical kit, or pharmaceutical composition, as disclosed herein comprises a therapeutically effective amount or a sub-therapeutically effective amount of the GPCRx inhibitor, such as administering a therapeutically effective amount of the GPCRx inhibitor to the patient.
  • the method for treating, method of suppressing, pharmaceutical kit, or pharmaceutical composition, as disclosed herein comprises a therapeutically effective amount or a sub-therapeutically effective amount of the inhibitor of the CXCR4-GPCRx heteromer, such as administering a therapeutically effective amount of the inhibitor of the CXCR4-GPCRx heteromer to the patient.
  • the method for treating cancer in a patient having a cancer cell containing a CXCR4-GPCRx heteromer may comprise: 1) determining whether the patient has the cancer cell containing the CXCR4-GPCRx heteromer having enhanced downstream signaling by: obtaining or having obtained a biological sample from the patient; and performing or having performed an assay on the biological sample to determine if: i) the patient's cancer cell containing said CXCR4-GPCRx heteromer; or ii) a CXCR4-GPCRx heteromer-selective reagent: alters heteromer-specific properties or function of said CXCR4-GPCRx heteromer in a patient derived cell(s); alters heteromer-specific properties of a patient derived cell(s) containing the CXCR4-GPCRx heteromer; or decreases cell proliferation of a patient derived cell(s) containing the CXCR4-GPCRx heteromer; and 2) if the patient has a cancer cell containing
  • the method for treating cancer in a patient having a cancer cell containing a CXCR4-GPCRx heteromer may comprise: 1) determining whether the patient's cancer cell contains the CXCR4-GPCRx heteromer by: obtaining or having obtained a biological sample from the patient and performing or having performed an assay on the biological sample to determine if said CXCR4-GPCRx heteromer is present in the patient's cancer cell; wherein: a) the GPCRx of the CXCR4-GPCRx heteromer is selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; and b) the assay performed on the biological sample is or comprises one or more of the following: a co-internalization assay, a colocalization assay, in situ hybridization, immunohistochemistry, immunoelectron microscopy
  • the patient's biological sample is a biological fluid sample or is a biological tissue sample.
  • a liquid biopsy is performed on the biological fluid sample or performed on the biological tissue sample.
  • the biological fluid sample is a blood sample, a plasma sample, a saliva sample, a cerebral fluid sample, an eye fluid sample, or a urine sample.
  • the biological fluid sample includes circulating tumor cells (CTCs), tumor-derived cell-free DNA (cfDNA), circulating small RNAs, and extracellular vesicles including exosomes, from bodily fluids as disclosed, for example, in Campos CDM et al., "Molecular Profiling of Liquid Biopsy Samples for Precision Medicine," Cancer J. 2018 Mar/Apr;24(2):93-103, which is incorporated hereby in its entirety.
  • the biological tissue sample is an organ tissue sample, a bone tissue sample, or a tumor tissue sample.
  • heteromer refers to macromolecular complex composed of at least two GPCR units [protomerswith biochemical properties that are demonstrably different from those of its individual components. Heteromerization can be evaluated by in situ hybridization, immunohistochemistry, RNAseq, Reverse transcription-quantitative PCR (RT-qPCR, realtime PCR), microarray, proximity ligation assay (PLA), time-resolved FRET (TR-FRET), whole-body Single-photon emission computed tomography (SPECT) or Positron Emission Tomography/Computed Tomography (PET/CT).
  • an effective amount refers to an amount sufficient to effect beneficial or desired results.
  • An effective amount can be administered in one or more administrations, applications or dosages. Such delivery is dependent on a number of variables including the time period for which the individual dosage unit is to be used, the bioavailability of the agent, the route of administration, etc.
  • therapeutically effective amount refers to the amount of a therapeutic agent (e.g., an inhibitor, an antagonist, or any other therapeutic agent provided herein) which is sufficient to reduce, ameliorate, and/or prevent the severity and/or duration of a cancer and/or a symptom related thereto.
  • a therapeutically effective amount of a therapeutic agent can be an amount necessary for the reduction, amelioration, or prevention of the advancement or progression of a cancer, reduction, amelioration, or prevention of the recurrence, development or onset of a cancer, and/or to improve or enhance the prophylactic or therapeutic effect of another therapy (e.g., a therapy other than the administration of a inhibitor, an antagonist, or any other therapeutic agent provided herein).
  • a therapeutic agent refers to any agent that can be used in the treatment, amelioration, prevention, or management of a cancer and/or a symptom related thereto.
  • a therapeutic agent refers to an inhibitor of CXCR4-GPCRx heteromer of the invention.
  • a therapeutic agent can be an agent which is well known to be useful for, or has been or is currently being used for the treatment, amelioration, prevention, or management of a cancer and/or a symptom related thereto.
  • intracellular Ca2+ assay refers to cell-based assay to measure the calcium flux associated with GPCR activation or inhibition.
  • the method utilizes a calcium sensitive fluorescent dye that is taken up into the cytoplasm of most cells. The dye binds the calcium released from intracellular store and its fluorescence increases. The change in the fluorescence intensity is directly correlated to the amount of intracellular calcium that is released into cytoplasm in response to ligand activation of the receptor of interest.
  • proximity-based assay refers to biophysical and biochemical techniques that are able to monitor proximity and/or binding of two protein molecules in vitro (in cell lysates) and in live cells, including bioluminescence resonance energy transfer (BRET), fluorescence resonance energy transfer (FRET), bimolecular fluorescence complementation (BiFC), Proximity ligation assay (PLA), cysteine crosslinking, and co-immunoprecipitation (Ferre et al., 2009; Gomes et al., 2016).
  • BRET bioluminescence resonance energy transfer
  • FRET fluorescence resonance energy transfer
  • BiFC bimolecular fluorescence complementation
  • PHA Proximity ligation assay
  • cysteine crosslinking cysteine crosslinking
  • co-immunoprecipitation Ferre et al., 2009; Gomes et al., 2016.
  • Alternative methods for detecting heteromer formation include, but are not limited to: immunostaing (Bushlin et al., 2012; Decaillot et al., 2008); immunoelectron microscopy (Fernandez-Duenas et al., 2015); BRET (Pfleger and Eidne, 2006); Time-resolved FRET assays (Fernandez-Duenas et al., 2015); In Situ Hybridization (He et al., 2011); FRET (Lohse et al., 2012); ⁇ -arrestin recruitment assay using GPCR heteromer identification technology (GPCR-HIT, Dimerix Bioscience) (Mustafa and Vietnameser, 2011) using BRET, FRET, BiFC, Bimolecular Luminescence Complementation, enzyme fragmentation assay, and Tango Tango GPCR assay system (Thermo Fisher Scientific) (Mustafa, 2010); PRESTO-Tango system (Kroeze
  • Radioligand Binding Assays (Bushlin et al., 2012; Pfeiffer et al., 2002); Cell Surface Biotinylation and Immunoblotting (He et al., 2011); immunostaing (Bushlin et al., 2012; Decaillot et al., 2008); immunoelectron microscopy (Fernandez-Duenas et al., 2015); [35S]GTP S Binding assays (Bushlin et al., 2012); Calcuim imaging or assays using dyes such as Fura 2-acetomethoxy ester (Molecular Probes), Fluo-4 NW calcium dye (Thermo Fisher Scientific), or FLIPR5 dye (Molecular Devices); cAMP assays using radioimmunoassay kit (Amersham
  • protein-protein interaction inhibitor refers to any molecules that can interfere with protein-protein interactions.
  • Protein-protein interaction unlike enzyme-substrate interaction involving well-defined binding pockets, is a transient interaction or association between proteins over relatively large areas and is often driven by electrostatic interactions, hydrophobic interactions, hydrogen bonds, and/or Van der Waals forces.
  • PPI inhibitors may include, but not limited to, membrane-permeable peptides or lipid fused to a peptide sequence that disrupts the GPCR heteromeric interface, for example, transmembrane helix, intracellular loop, or C-terminal tail of GPCRx.
  • the PPI inhibitor of the CXCR4-GPCRx heteromer may be a membrane-permeable peptide or cell-penetrating peptide (CPP) conjugated with peptide that targets the CXCR4-GPCRx heteromeric interface(s), or may be a cell-penetrating lipidated peptide targeting the CXCR4-GPCRx heteromeric interface(s).
  • CPP cell-penetrating peptide
  • the membrane-permeable peptide or cell-penetrating peptide includes: HIV-1 TAT peptides, such as TAT 48-60 and TAT 49-57 ; Penetratins, such as pAntp(43-58); Polyarginines (Rn such as R5 to R12); Diatos peptide vector 1047 (DPV1047, Vectocell®); MPG (HIV gp41 fused to the nuclear localization signal (NLS) of the SV40 large T antigen); Pep-1 (tryptophan-rich cluster fused to the NLS of SV40 large T antigen); pVEC peptide (vascular endothelial cadherin); p14 alternative reading frame (ARF) protein-based ARF(1-22); N-terminus of the unprocessed bovine prion protein BPrPr(1-28); Model amphipathic peptide (MAP); Transportans; Azurin-derived p28 peptide; amphipathic ⁇ -
  • the membrane-permeable peptide or cell-penetrating peptide can further include, for example, TAT-derived cell-penetrating peptides, signal sequence-based (e.g., NLS) cell-penetrating peptides, hydrophobic membrane translocating sequence (MTS) peptides, and arginine-rich molecular transporters.
  • the cell-penetrating lapidated peptide includes, for example, pepducins, such as ICL1/2/3, C-tail- short palmitoylated peptides (Covic et al., 2002; O'Callaghan et al., 2012).
  • the peptide(s) that target the CXCR4-GPCRx heteromeric interface may be, for example, a transmembrane domain of CXCR4, transmembrane domain of GPCRx, intracellular loop of CXCR4, intracellular loop of GPCRx, C-terminal domain of CXCR4, or C-terminal domain of GPCRx., extracellular loop of CXCR4, extracellular loop of GPCRx, N-terminal region of CXCR4, or N-terminal region of GPCRx.
  • the invention provides a pharmaceutical composition (sometimes referred to herein as "pharmaceutical formulations") having an inhibitor of a CXCR4-GPCRx heteromer of the invention and a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier that can be used in the pharmaceutical compositions of the invention include any of the standard pharmaceutical carriers known in the art, such as physiologically acceptable carriers, excipients or stabilizers, for example, phosphate buffered saline solution, water and emulsions such as an oil and water emulsion, and various types of wetting agents.
  • compositions can be prepared in liquid unit dose forms or any other dosing form that is sufficient for delivery of the inhibitor of a CXCR4-GPCRx heteromer of the invention to the target area of the subject in need of treatment.
  • the pharmaceutical compositions can be prepared in any manner appropriate for the chosen mode of administration, e.g., intravascular, intramuscular, subcutaneous, intradermal, intrathecal, etc.
  • Other optional components e.g., pharmaceutical grade stabilizers, buffers, preservatives, excipients and the like can be readily selected by one of skill in the art.
  • the preparation of a pharmaceutically composition having due regard to pH, isotonicity, stability and the like, is within the level of skill in the art.
  • compositions containing one or more inhibitors of a CXCR4-GPCRx heteromer of the invention provided herein can be prepared for storage by mixing the inhibitors having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences (1990) Mack Publishing Co., Easton, PA), in the form of lyophilized formulations or aqueous solutions.
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol; low molecular weight polypeptides of less than about 10 residues; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, argin
  • the invention provides a method for treatment, amelioration, or prevention of a disease in a subject in need thereof.
  • the methods of the invention can include administering a therapeutically effective amount of a pharmaceutical composition provided herein to the subject.
  • the pharmaceutical composition can include one or more inhibitors of a CXCR4-GPCRx heteromer provided herein.
  • Diseases that can be treated or prevented using the methods of the invention include cancer, tumor, metastasis, and/or angiogenesis.
  • the methods of the invention are useful for treating cancers or related symptoms wherein the cells of cancer, tumor, and/or microenvironment expresses the CXCR4-GPCRx heteromer.
  • Non-limiting examples of cancers or tumors that can be treated, ameliorated, or prevented using the methods of the invention include tumors of the gastrointestinal tract, for example, breast cancer, lung cancer, small cell carcinoma of the lung, hepatocellular carcinoma, brain cancer, kidney cancer, pancreatic cancer or pancreatic adenocarcinoma, ovarian cancer, prostate cancer, melanoma, lymphoma, leukemia, multiple myeloma, renal cell carcinoma, soft tissue sarcoma, gastrointestinal cancer, stomach cancer, colon cancer, colorectal cancer, colorectal adenocarcinoma, bladder adenocarcinoma, esophageal cancer, and adenocarcinoma of the stomach, esophagus, throat, and urogenital tract.
  • breast cancer breast cancer
  • lung cancer small cell carcinoma of the lung
  • hepatocellular carcinoma brain cancer
  • kidney cancer pancreatic cancer or pancreatic adenocarcinoma
  • ovarian cancer prostate cancer
  • the invention provides a method for treating cancer in a patient having a cell containing a CXCR4-GPCRx heteromer, or provides a method of suppressing enhanced downstream signaling from a CXCR4-GPCRx heteromer in a cell of a patient suffereing from cancer, the method comprising: administering to the patient an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein: i) the CXCR4-GPCRx heteromer has enhanced downstream signaling; and ii) the administered inhibitor or combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient.
  • the invention provides a pharmaceutical kit for use in treating cancer in a patient having a cell containing a CXCR4-GPCRx heteromer, the pharmaceutical kit comprising: an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein the CXCR4-GPCRx heteromer has enhanced downstream signaling.
  • the invention provides a pharmaceutical composition for use in treating cancer in a patient having a cell containing a CXCR4-GPCRx heteromer, the pharmaceutical composition comprising: i) an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; and ii) a pharmaceutically acceptable carrier; wherein the CXCR4-GPCRx heteromer has enhanced downstream signaling.
  • the progression of the cancer in the patient having said cancer cell containing the CXCR4-GPCRx heteromer is decreased in the range of 5-100% more upon administration of the combination of inhibitors, relative to administering the CXCR4 inhibitor or GPCRx inhibitor as the single inhibitor to said patient, such as decreased in the range of 5-100% more, 10-100% more, 20-100% more, 30-100% more, 40-100% more, 50-100% more, 60-100% more, 75-100% more, 5-75% more, 5-50% more, or 5-25% more, upon administration of the combination of inhibitors, relative to administering the CXCR4 inhibitor or GPCRx inhibitor as the single inhibitor to said patient.
  • the GPCRx of the CXCR4-GPCRx heteromer is selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; for example, selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2
  • the GPCRx inhibitor is selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, C5AR1 inhibitor, CALCR inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; for example, selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, C5AR1 inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3
  • the efficacy of a CXCR4 inhibitor is increased in the range of 5-2000% when administered in combination with the GPCRx inhibitor to the patient having said cancer cell containing the CXCR4-GPCRx heteromer, relative to efficacy of the CXCR4 inhibitor when administered as a single inhibitor, such as increased in the range of 5-1750%, 5-1500%, 5-1250%, 5-1000%, 5-900%, 5-800%, 5-700%, 5-500%, 5-400%, 5-250%, 5-200%, 5-100%, 5-75%, 5-50%, 5-40%, 5-30%, 5-25%, 100-2000%, 200-2000%, 300-2000%, 500-2000%, 750-2000%, 1000-2000%, 1250-2000%, 1500-2000%, 5-1500%, 25-1500%, 50-1500%, 75-1500%, 100-1500%, 200-1500%, 300-1500%, 500-150
  • the GPCRx of the CXCR4-GPCRx heteromer is selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; for example, selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2
  • the GPCRx inhibitor is selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, C5AR1 inhibitor, CALCR inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; for example, selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, C5AR1 inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3
  • the efficacy of a GPCRx inhibitor is increased in the range of 5-2000% when administered in combination with the CXCR4 inhibitor to the patient having said cancer cell containing the CXCR4-GPCRx heteromer, relative to efficacy of the GPCRx inhibitor when administered as a single inhibitor, such as increased in the range of 5-1750%, 5-1500%, 5-1250%, 5-1000%, 5-900%, 5-800%, 5-700%, 5-500%, 5-400%, 5-250%, 5-200%, 5-100%, 5-75%, 5-50%, 5-40%, 5-30%, 5-25%, 100-2000%, 200-2000%, 300-2000%, 500-2000%, 750-2000%, 1000-2000%, 1250-2000%, 1500-2000%, 5-1500%, 25-1500%, 50-1500%, 75-1500%, 100-1500%, 200-1500%, 300-1500%, 500-1500%
  • the GPCRx of the CXCR4-GPCRx heteromer is selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; for example, selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2
  • the GPCRx inhibitor is selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, C5AR1 inhibitor, CALCR inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; for example, selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, C5AR1 inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3
  • the method administers a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; or the pharmaceutical kit or pharmaceutical composition comprises a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer.
  • the combination of inhibitors is a combination of two inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer.
  • the method administers a combination of a CXCR4 inhibitor and a GPCRx inhibitor; or the pharmaceutical kit or pharmaceutical composition comprises a combination of a CXCR4 inhibitor and a GPCRx inhibitor.
  • the method administers a CXCR4-GPCRx heteromer inhibitor; or the pharmaceutical kit or pharmaceutical composition comprises a CXCR4-GPCRx heteromer inhibitor.
  • the administering of the combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient in the range of between 5-2000 fold, relative to single inhibitor administration, such as suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient in the range of between 5-1750 fold, 5-1500 fold, 5-1250 fold, 5-1000 fold, 5-900 fold, 5-800 fold, 5-700 fold, 5-500 fold, 5-400 fold, 5-250 fold, 5-200 fold, 5-100 fold, 5-75 fold, 5-50 fold, 5-40 fold, 5-30 fold, 5-25 fold, 100-2000 fold, 200-2000 fold, 300-2000 fold, 500-2000 fold, 750-2000 fold, 1000-2000 fold, 1250-2000 fold, 1500-2000 fold, 5-1500 fold, 25-1500 fold, 50-1500 fold, 75-1500 fold, 100-1500 fold, 200-1
  • the GPCRx of the CXCR4-GPCRx heteromer is selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; for example, selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2
  • the GPCRx inhibitor is selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, C5AR1 inhibitor, CALCR inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; for example, selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, C5AR1 inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3
  • the administering of the inhibitor or combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient in the range of between 5-2000 fold, relative to suppression of downstream signaling from either a CXCR4 protomer or a GPCRx protomer in their respective individual protomer context, such as suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient in the range of between 5-1750 fold, 5-1500 fold, 5-1250 fold, 5-1000 fold, 5-900 fold, 5-800 fold, 5-700 fold, 5-500 fold, 5-400 fold, 5-250 fold, 5-200 fold, 5-100 fold, 5-75 fold, 5-50 fold, 5-40 fold, 5-30 fold, 5-25 fold, 100-2000 fold, 200-2000 fold, 300-2000 fold, 500-2000 fold, 750-2000 fold, 1000-2000 fold, 1250-2000 fold, 1500-2000
  • the GPCRx of the CXCR4-GPCRx heteromer is selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; for example, selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2
  • the GPCRx inhibitor is selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, C5AR1 inhibitor, CALCR inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; for example, selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, C5AR1 inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3
  • Initial testing and evaluation of an inhibitor, or combination of inhibitors, regarding whether effective, or therapeutically effective, in suppressing an enhanced downstream signaling from a CXCR4-GPCRx heteromer, according to the methods disclosed herein, and/or in determining an IC50 value according to the assays disclosed herein, may utilize a concentration of the inhibitor in the range of between 1-10 ⁇ M (or each of the inhibitors of the combination at concentrations in the range of between 1-10 ⁇ M), such as at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 ⁇ M. If suppression of the signal by the inhibitor is not appreciable enough for a determinable measurement, then a greater concentration of the inhibitor may be used to better evaluate a determinable measurement, such as an IC50 value. If suppression of the signal by the inhibitor is very strong, then a lower concentration of the inhibitor may be used to better evaluate a determinable measurement, such as an IC50 value.
  • CXCR4-GPCRx heteromers To identify novel CXCR4-GPCRx heteromers, we made recombinant adenoviruses encoding 143 GPCRs fused with N-terminal fragments of yellow fluorescent protein Venus (VN) and 147 GPCRs fused with C-terminal fragment of Venus (VC) as described in Song et al. (Song et al., 2014; SNU patent; Song, thesis). CXCR4-GPCR heteromers were identified using bimolecular fluorescence complementation (BiFC) assay (FIG. 1), in which two complementary VN and VC fragments of Venus reconstitute a fluorescent signal only when both fragments are close enough through interaction between two different proteins to which they are fused (Hu et al., 2002).
  • BiFC bimolecular fluorescence complementation
  • U-2 OS cells were plated in 96-well plates, were co-transduced with 30 MOI each of adenoviruses encoding CXCR4-VN and GPCRx-VC or CXCR4-VC and GPCRx-VN, and were allowed to express GPCRs for 2 days.
  • BiFC and nuclear images were obtained from three fields per well using IN Cell Analyzer 1000. Images of about 200 cells from each well were analyzed with Multi-target analysis software in IN Cell Developer ToolBox (GE Healthcare, Waukesha, WI). Cell boundary was marked based on Hoechst signal, and fluorescence intensity per cell was measured. Cells with fluorescence intensities higher than background level were considered as BiFC positive cells. Dead cells that showed extremely high intensities were excluded from the cell count. Positive cells were determined, and positive cell count ratio ("BiFC score”) was calculated as (positive cells/total cells) x 100 (see Table 4 below).
  • APLNR-VC (FIG. 2h), C5AR1-VC (FIG. 2i), CALCR-VC (FIG. 2j), CCR5-VC (FIG. 2k), CHRM1-VC (FIG. 2l), GALR1-VC (FIG. 2m), EDNRB-VC (FIG. 2n), HRH1-VC (FIG. 2o), MLNR-VC (FIG. 2p), NTSR1-VC (FIG. 2q), PTGER2-VC (FIG. 2r), SSTR2-VC (FIG. 2t), and TACR3-VC (FIG. 2u).
  • Protein-protein interaction can be affected by fusion tags such as fluorescence protein fragments in BiFC or renilla luciferase in BRET through interfering with the expression, folding, or localization of the partner protein.
  • Partner protein can also impair the expression or folding of the fusion tags, and affect proximity-based assay result.
  • the absence of signal between two proteins in specific combination does not necessarily imply that the proteins do not interact, but simply that the attached donor and acceptor molecules are in particular conformation that does not allow interaction to occur (Eidne et al., 2002; Kerppola, 2006).
  • CXCR4 and GPCRx that gave BiFC signal in either CXCR4-VN and GPCRx-VC or CXCR4-VC and GPCRx-VN combination were considered as interacting proteins.
  • CXCR4-GPCRx pairs that gave BiFC score equal or higher than 10 were selected as candidates for CXCR-GPCRx heteromer as shown in Table 4.
  • GPCRs ADCYAP1R1, ADORA3, ADRB2, APLNR, C5AR1, CALCR, CCR5, CHRM1, GALR1, EDNRB, HRH1, MLNR, NTSR1, PTGER2, SSTR2, and TACR3, were identified as CXCR4-interacting GPCRs in CXCR4-VN and GPCRx-VC combination and two GPCRs, ADORA2B and PTGER3, gave BiFC score higher than 10 in CXCR4-VC and GPCRx-VN combination as shown in Table 4.
  • ADRB2 and CCR5 have been reported to form heteromers with CXCR4 (LaRocca 2010, Nakai 2014, (Agrawal et al., 2004; LaRocca et al., 2010; Rodriguez-Frade et al., 2004; Sohy et al., 2007; Sohy et al., 2009; Martinez-Munoz et al., 2014)), and the remaining 16 GPCRs were found to be novel CXCR4-GPCRx heteromers that have not been reported to the best of our knowledge.
  • ADRA1A and CXCR3 were also included in our BiFC assay. These GPCRs were excluded from further investigation since they gave BiFC signal of less than 10 with CXCR4: ADRA1A (CXCR4-VN-ADRA1A-VC: BiFC score 7.85) and CXCR3 (BiFC score 1.16).
  • Cannabinoid Receptor 2 (CB2, sometimes referred to as CNR2) was identified as a CXCR4-interacting GPCR in our BiFC assay (CNR2-VN-CXCR4-VC configuration: BiFC score 4.25; CNR2-VC-CXCR4-VN configuration: BiFC score 38.1), and co-internalization assay as described in FIGS. 3a-3b and 4a-4q. But CNR2 was not selected as the final candiadate because it failed to exhibit an enhanced downstream signaling in the calcium mobilization assay (see Example 3 below).
  • GPCR heteromers are known to exhibit, as a result of the heteromerization, altered trafficking properties such as maturation of the partner GPCR (GABA(B) receptor) (White, 1998), agonist-mediated internalization of the partner GPCR from the cell surface (DOR-GRPR, A2A-D2R) (Hillion et al., 2002; Liu et al., 2011; Torvinen et al., 2005), and changes in the localization of the partner GPCR from an intracellular compartment to the cell surface (DOR-CB1) (Rozenfeld et al., 2012).
  • GABA(B) receptor maturation of the partner GPCR
  • DOR-GRPR, A2A-D2R agonist-mediated internalization of the partner GPCR from the cell surface
  • DOR-CB1 changes in the localization of the partner GPCR from an intracellular compartment to the cell surface
  • FIGS. 4a-4q cells were stimulated with GPCRx agonists specific for CXCR4 (FIG. 4a), ADCYAP1R1 (FIG. 4b), ADORA2B (FIG. 4c), ADORA3 (FIG. 4d), ADRB2 (FIG. 4e), APLNR (FIG. 4f), C5AR1 (FIG. 4g), CCR5 (FIG. 4h), CHRM1 (FIG. 4i), GALR1 (FIG. 4j), EDNRB (FIG. 4k), HRH1 (FIG. 4l), MLNR (FIG. 4m), NTSR1 (FIG. 4n), PTGER3 (FIG. 4o), SSTR2 (FIG.
  • FIG. 4q 10 nM of CXCL12 (FIG. 4a), 1 ⁇ M of vasoactive intestinal peptide (VIP) (FIG. 4b), 1 ⁇ M of BAY 60-6583 (FIG. 4c), 1 ⁇ M of CGS21680 (FIG. 4d), 100 nM of formoterol (FIG. 4e), 1 ⁇ M of apelin-13 (FIG. 4f), 100 nM of C5a (FIG. 4g), 100 nM of CCL2 (FIG. 4h), 1 ⁇ M of acetylcholine (FIG. 4i), 100 nM of galanin (FIG.
  • the selection of the concentration of these GPCRx agonists was initially set at the EC50 concentration (or alternatively, the Ki or Kd concentration) for the respective specific GPCRx, and if the resulting signal was too intense, then the concertation was lowered below the EC50, and if the resulting signal was too weak, then the concertation was increased to no more than 10,000x the EC50 concentration.
  • CXCR4-GPCRx heteromers identified by BiFC assay, 16 heteromers containing the following GPCRx induced internalization of CXCR4 as revealed by increased intracellular GFP granules and reduced GFP signal in the plasma membrane in cells co-expressing CXCR4-GFP and GPCRx, confirming heteromer co-internalization: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, APLNR, C5AR1, CCR5, CHRM1, GALR1, EDNRB, HRH1, MLNR, NTSR1, PTGER3, SSTR2, and TACR3 (FIG. 4b-q).
  • Example 3 Evaluation by Ca2+ mobilization assay of enhanced CXCR4 downstream signaling upon CXCR4-GPCRx heteromer formation and inhibition of the enhanced signaling.
  • FIGS. 5a-5d were performed for other identified GPCRx partners.
  • ADCYAP1R1 FIG. 6a
  • ADORA2B FIG. 6b
  • ADORA3 FIG. 6c
  • C5AR1 FIG. 6d
  • CALCR FIG. 6e
  • CHRM1 FIG. 6f
  • EDNRB FIG. 6g
  • HRH1 FIG. 6h
  • MLNR FIG. 6i
  • NTSR1 FIG. 6j
  • PTGER2 FIG.
  • co-treatment of CXCL12 and respective GPCRx agonist significantly increased calcium responses compared with the sum of calcium responses that were induced by individual agonists as shown in FIGS. 5c and 5d, and as shown in FIGS. 6a-6l.
  • the cells co-expressing the CXCR4 and the GPCRx either ADCYAP1R1 (FIG. 6a), ADORA2B (FIG. 6b), ADORA3 (FIG. 6c), C5AR1 (FIG. 6d), CALCR (FIG. 6e), CHRM1 (FIG. 6f), EDNRB (FIG. 6g), HRH1 (FIG. 6h), MLNR (FIG.
  • CXCL12-induced calcium response was significantly reduced, rather than enhanced, upon addition of CXCL12 alone or together with JWH-133, a selective CNR2 agonist, compared with the CXCL12-mediated calcium response observed in cells expressing CXCR4 alone (data not shown).
  • those systems co-expressing CXCR4 and the GPCRx selected from the group consisting of ADCYAP1R1 (FIG. 6a), ADORA2B (FIG. 6b), ADORA3 (FIG. 6c), C5AR1 (FIG. 6d), CALCR (FIG. 6e), CHRM1 (FIG. 6f), EDNRB (FIG. 6g), HRH1 (FIG. 6h), MLNR (FIG. 6i), NTSR1 (FIG. 6j), and TACR3 (FIG.
  • CXCR4-GPCRx heteromers would increase the sensitivity and dynamic range of these receptors at limiting ligand concentrations in vivo , and may be associated with poor prognosis.
  • the enhanced calcium signaling by the CXCR4-GPCRx heteromers also indicates that the current diagnosis based on the level of CXCR4 expression alone needs to be changed to consider the expression levels of CXCR4 and GPCRx.
  • GPCRs such as APLNR (FIG. 7a), CCR5 (FIG. 7b), GALR1 (FIG. 7c), PTGER3 (FIG. 7d), and SSTR2 (FIG. 7e) did not show enhanced calcium responses when cells expressing both receptors were co-treated with both agonists, although these GPCRs were shown to interact with CXCR4 in BiFC (Table 5) and CXCR4-GFP co-internalization assay.
  • CXCR4-GPCRx heteromers that is not shared by other CXCR4-GPCRx heteromers such as CXCR4-APLNR, CXCR4-CCR5, CXCR4-GALR1, CXCR4-PTGER3, and CXCR4-SSTR2.
  • CXCR4-GFP expressing U-2 OS cells were co-internalized by partner GPCRx specific agonist when CXCR4 and GPCRx were simultaneously transduced to cells (control: CXCR4-GFP (FIG. 4a)). If CXCR4 formed heterodimer with GPCRx and co-internalized by partner GPCRx, it can be blocked by GPCRx specific antagonist.
  • U-2 OS cells stably expressing CXCR4-GFP were transduced with Adenoviruses encoding GPCRx (ADRB2, CHRM1, HRH1). After 2 days, images were obtained before and 20 minutes after stimulating cells with CXCR4-specific agonist, CXCL12 (SDF-1) (20 nM), and/ or GPCRx-specific antagonist (10 ⁇ M). Internalization of CXCR4-GFP was observed as GFP granules using IN Cell Analyzer 2500. Loss of GFP expression on the cell surface or appearance of GFP granules inside the cells were considered as CXCR4-GFP co-internalization.
  • CXCR4 agonist, CXCL12 induced internalization of CXCR4-GFP with GPCRx
  • GPCRx antagonists treated as follows, had no effect on the internalization of the heteromer (FIGS. 10a-c, second columns): Carvedilol, an ADRB2 antagonist (FIG. 10a); Oxybutynin and Umeclidinium, CHRM1 antagonists (FIG. 10b); Prometazine, Hydroxyzine, and Loratadine, HRH1 antagonists (FIG. 10c).
  • GPCRx specific antagonists FIGS. 10a-c, third columns).
  • Example 5 Evaluation by cell proliferation assay of phenotypic effects of inhibitor of CXCR4-GPCRx heteromer signaling on tumor growth.
  • ATPlite PerkinElmer, Cat. No. 6016739 reagent.
  • ATPlite is an Adenosine Triphospate monitoring system based on firefly luciferase. This luminescence assay is the alternative to colorimetric, fluorometric and radioisotopic assays for the quantitative evaluation of proliferation and cytotoxicity of cultured mammalian cells.
  • Cells were seeded in 384-well plate at 500 cells/well in 40 ⁇ l culture media. After overnight growth, the cells were cultured for 7 days in the presence of several dose of GPCRx antagonist or DMSO alone.
  • Cell viability (%) (OD of antagonist treatment/OD of DMSO only treatment) x 100%.
  • Example 6 Evaluation of CXCR4-GPCRx heteromer formation in patient derived cells (PDC) using Proximity ligation assay (PLA).
  • Bazin et al. employed a time-resolved fluorescence resonance energy transfer (TR-FRET)-based approach that offers a much higher signal-to-noise ratio (Bazin et al., 2002).
  • FRET is based on the transfer of energy between two fluorophores, a donor and an acceptor, when in close proximity. Molecular interactions between biomolecules can be assessed by coupling each partner with a fluorescent label and by detecting the level of energy transfer. Introducing a time delay of approximately 50 to 150 ⁇ seconds between the system excitation and fluorescence measurement allows the signal to be cleared of all non-specific short-lived emissions.
  • Proximity ligation assay is a technology that extends the capabilities of traditional immunoassays to include direct detection of proteins, protein interactions and modifications with high specificity and sensitivity (Gullberg et al., 2004).
  • Two primary antibodies raised in different species recognize the target antigen on the proteins of interest.
  • Secondary antibodies directed against the constant regions of the different primary antibodies, called PLA probes bind to the primary antibodies.
  • Each of the PLA probes has a unique short DNA strand attached to it, If the PLA probes are in close proximity (that is, if the two original proteins of interest are in close proximity, or part of a protein complex, as shown in the figures), the DNA strands can participate in rolling circle DNA synthesis when appropriate substrates and enzymes are added.
  • the DNA synthesis reaction results in several-hundred fold amplification of the DNA circle.
  • fluorescent-labeled complementary oligonucleotide probes are added, and they bind to the amplified DNA.
  • the resulting high concentration of fluorescence is easily visible as a distinct bright spot when viewed with a fluorescence microscope (Gustafsdottir et al., 2005).
  • CXCR4 overexpressing cell line U2OS-CXCR4
  • ADRB2 expressing adenovirus Ad-ADRB2
  • PLA was performed as described previously (Brueggemann et al., 2014; Tripathi et al., 2014).
  • PFA paraformaldehyde
  • FIGS. 12a-12b the PLA signal increases in a dose dependent manner as the expression level of ADRB2.
  • FIG. 12a Images of PLA signal from U2OS cells expressing CXCR4-ADRB2 heteromer over a series of MOIs (multiplicity of infection).
  • FIG. 12b The red signal spots were counted and calculated by normalization against negative control. The PLA signal increased proportionate to the expression level of ADRB2 in a dose dependent manner.
  • FIG. 12c To investigate endogenous ADRB2 expression, qRT-PCR was performed with ADRB2 specific primers. As the results show, endogenous ADRB2 expression level of U2OS cell was quite high, indicating that the PLA signal is detected even in the section without virus infection (at 0 MOI for ADRB2).
  • GBM Glioblastoma
  • PDC Patient derived cell
  • the patient derived cells were plated and fixed with 4 % PFA on sixteen-well tissue culture slides. Slides were blocked with blocking solution provided by Duolink and incubated with mouse anti-CXCR4 (1:200, Santa Cruz, Sc-53534), rabbit anti-ADRB2 (1:200, Thermo Scientific, PA5-33333), rabbit anti-CHRM1 (1:200, Lsbio, Ls-C313301) at 37 °C for 1 h in a humidifying chamber. Slides were then washed and incubated (1 h at 37 °C) with secondary anti-rabbit and anti-mouse antibodies conjugated with plus and minus Duolink II PLA probes.
  • PLA ratio refers to the CXCR4 GPCRx heteromer, and the frequency of the heteromer formation varies depending on the patient.
  • PLA ratio was calculated as: number of fluorescent spots in PDC sample / number of fluorescent spots in negative control.
  • Negative control represents background fluorescence signal, indicated by the number of spots when only the secondary antibody conjugated with plus and minus Duolink II PLA probes is treated without primary antibody (mouse anti-CXCR4, rabbit anti-ADRB2, rabbit anti-CHRM1) treatment in PLA processing.
  • Example 7 Evaluation of CXCR4-GPCRx heteromer formation in vivo using PDX model.
  • FFPE samples were used (provided by Samsung Seoul hospital in Seoul, Korea). After FFPE sample were de-paraffinized and performed heat induced antigen retrieval for 15 minutes at 100°C. Slides were blocked with blocking solution provided by Duolink and incubated with rabbit anti-CXCR4 (1:200, Thermoscientific, PA3305), mouse anti-ADRB2 (1:200, Santacruz, Sc-271322), at 37 °C for 1 h in a humidifying chamber. The other process was same as described above (PLA with PDC).
  • FIG. 15a nuclei were visualized with DAPI staining, and CXCR4-ADRB4 heteromers were stained with PLA as small dots.
  • FIG. 15b PLA ratio is different according to the patient and based on this result, indicating that it is possible to perform personalized medicine by the companion diagnostics.
  • Example 8 Evaluation by Ca2+ mobilization assay of enhanced CXCR4 downstream signaling upon CXCR4-GPCRx heteromer formation.
  • Example 9 Evaluation of enhanced Ca2+ mobilization upon co-stimulation of endogenous CXCR4-HRH1 heteromer in MDA-MB-231 cells.
  • Example 10 Evaluation of enhanced migration of cancer cells by CXCR4-HRH1 heteromer upon co-stimulation with both ligands.
  • MDA-MB-231 cells express about twice more HRH1 mRNA compared with CXCR4 mRNA when measured by RT-qPCR, the MDA-MB-231 cells were transduced with small amount of lentivirus encoding CXCR4 (1 MOI) and chemotactic migration of the cells toward CXCL12 and HRH1 was measured (FIGS. 19a and 19b). Histamine (50 nM) alone, sufficient to produce calcium signaling as shown in FIG. 27a (see below), did not induce cell migration. On the other hand, when treated together with CXCL12, histamine significantly enhanced the migration of MDA-MB-231 cells towards CXCL12.
  • Example 11 Evaluation by Ca2+ mobilization assay of enhanced CXCR4 downstream signaling upon CXCR4-GPCRx heteromer formation and inhibition of the enhanced signaling.
  • MDA-MB-231 human breast cancer cells were seeded at 20,000 cells per well in a black clear bottom 96-well plate (Corning Costar, #3340) in 100 ⁇ L of RPMI 1640 supplemented with 10% FBS. The next day, cells were co-transduced with 10 MOI of CXCR4 and 30 MOI of GPCRx. After 2 days, cells were treated with ADRB2 antagonist, Carvedilol(Tocris), anti-CXCR4 antibody, 12G5 (Thermo Scientific, 35-8800) with indicated amounts and incubated with Cal 6 (FLIPR® Calcium 6 Assay Kit by Molecular Devices, Cat. R8191) for 2 hr.
  • Example 12 Evaluation of CXCR4-GPCRx heteromer formation in CXCR4-GPCRx expressing cell using PLA.
  • a process for screening a CXCR4-GPCRx heteromer is essential for the treatment of CXCR4-GPCRx targeted anticancer drug.
  • PLA was performed in CXCR4-GPCRx expressing cells.
  • CXCR4 overexpressing cell line the U2OS-CXCR4 was infected with GPCRx expressing adenovirus, Ad-GPCRx at the dose of 0, 2.5, 10, 40 MOIs for 2 days.
  • the transduced cells were fixed with 4% paraformaldehyde and performed PLA was performed.
  • the number of PLA signals means quantitatively demonstrating the formation of CXCR4-GPCRx heteromerization.
  • the PLA signal increased proportionate to the expression level of CHRM1 (FIG. 21a) and HRH1 (FIG. 21b) in a dose dependent manner.
  • the U2OS-CXCR4 was infected with GPCRx expressing adenovirus, Ad-GPCRx at the dose of 0, 2.5, 10, 40 MOIs for 2 days.
  • PLA was performed as described previously (Brueggemann et al., 2014; Tripathi et al., 2014).
  • To perform PLA infected cells were fixed with 4% PFA on sixteen-well tissue culture slides.
  • Slides were blocked with blocking solution provided by Duolink and incubated with mouse anti-CXCR4 (Santacruz, Sc-53534), rabbit anti-CHRM1 (LS Bio, LS-C313301), or rabbit anti-HRH1 (Thermoscientific, PA5-27817) at 37°C for 1 h in a humidifying chamber. Slides were then washed and incubated (1 h at 37°C) with secondary anti-rabbit and anti-mouse antibodies conjugated with plus and minus Duolink II PLA probes. Slides were washed again and then incubated with ligation-ligase solution (30 min at 37°C) followed by incubation with amplification-polymerase solution (2 h at 37°C).
  • Example 13 Ca2+ Mobilization Inhibition of the Enhanced CXCR4 Downstream Signaling upon CXCR4-GPCRx heteromer Formation - Comparison of Single Inhibitor Treatment to Combination Inhibitor Treatment.
  • MDA-MB-231 cells were transduced with adenoviruses encoding CXCR4 only, or CXCR4 and ADRB.
  • the cells were cultured for 2 days and were treated CXCR4 inhibitor alone or co-treated with a CXCR4 inhibitor and an ADRB2 inhibitor (Carvedilol; 10 uM).
  • the cells were then stained with Cal-6 for 2 hours and stimulated with CXCR4 agonsit (CXCL12; 20 nM) and ADRB2 agonist (Salmeterol; 1 ⁇ M).
  • the IC50 value of Ca 2+ response was CXCR4 inhibitor dependent in the context of single treatment of MDA-MB-231 cells expressing CXCR4 alone, and in the single treatment context and the co-treatment context with an ADRB2 inhibitor of MDA-MB-231 cells expressing CXCR4-ADRB2 heteromer.
  • the IC50 value of Ca 2+ response in the CXCR4-ADRB2 heteromer context decreased by 1400 times or more when treated in combination with an ADRB2 inhibitor (3 rd column), relative to single treatment with the CXCR4 inhibitor alone (4 th column).
  • the IC50 value of Ca 2+ response in the CXCR4-ADRB2 heteromer context decreased about 540 fold (from 28.65 nM to 0.053 nM), about 1400 fold (from 1.12 nM to 0.0008 nM), or about 890 fold (from 17.78 nM to 0.02 nM), upon co-treatment of Carvedilol with AMD3100, Ulocuplumab, or TZ14011, relative to single treatement with AMD3100, Ulocuplumab, or TZ14011, respectively.
  • These results suggest that co-treating with a CXCR4 inhibitor and ADRB2 inhibitor more effectively inhibits increased Ca 2+ response than single treatment with a CXCR4 inhibitor alone in CXCR4-ADRB2 heteromer expressing cells.
  • Example 14 Effect of CXCR4 -ADRB2 heteromer on Tumor Growth.
  • cell lines stably overexpressing CXCR4 alone or CXCR4-ADRB2 heteromer were prepared in A549 lung cancer cell, and the same amount of cells (1x10 7 cell / head) were injected subcutaneously in nude mice to compare tumor growth rates.
  • the tumor size at 28 days after transplantation was 351.4 ⁇ 214.7 mm 3 for A549, 726.9 ⁇ 259.6 mm 3 for A549-CXCR4, and 1012.2 ⁇ 556.1 mm 3 for A549-CXCR4-ADRB2.
  • mice transplanted with the A549-CXCR4 overexpressing CXCR4 was faster than that of mice bearing only parental A549, and the fastest tumor growth was observed in mice transplanted with cells overexpressing the CXCR4-ADRB2 heteromer.
  • the mice bearing CXCR4-expressing cell show relatively fast tumor growth as compared to the mice bearing parental cell A549, and the tumor growth is the fastest in mice transplanted with cells overexpressing the CXCR4-ADRB2 heteromer.
  • Example 15 Evaluation by Ca2+ Mobilization Assay of Enhanced CXCR4 Downstream Signaling Upon Co-stimulation of CXCR4-GPCRx heteromer with Endogenous Ligands.
  • FIGS. 23a-23g The enhancement of the calcium response in MDA-MB-231 cells co-expressing CXCR4 and GPCRx upon co-stimulation with CXCL12 and endogenous ligand for GPCRx, are shown in FIGS. 23a-23g.
  • MDA-MB-231 cells were transduced with adenoviruses encoding CXCR4 and HA-VC, GPCRx and HA-VC, or CXCR4 and GPCRx where GPCRx represents ADCYAP1R1 (FIG. 23a), ADORA2B (FIG. 23b), ADORA3 (FIG. 23c), CHRM1 (FIG. 23d), EDNRB (FIG. 23e), MLNR (FIG. 23f), and TACR3 (FIG.
  • FIG. 6a enhanced Ca 2+ signaling was observed in cells expressing CXCR4 and ADCYAP1R1 together, but not in cells expressing individual GPCR alone, upon co-treatment with CXCL12 and VIP, a non-selective endogenous ADCYAP1R1 ligand.
  • FIG. 23a An ADCYAP1R1-selective endogenous ligand, enhanced Ca 2+ signaling was also observed (FIG. 23a).
  • the result demonstrates that enhanced signaling of CXCR4-ADCYAP1R1 heteromer upon co-stimulation with CXCL12 is not only limited to VIP, but also selective ADCYAP1R1 natural ligand. It further suggests this enhancement could happen in vivo in cells expressing CXCR4 and ADCYAP1R1 together by their natural ligands.
  • Enhanced Ca 2+ signaling was observed in cells expressing CXCR4 and ADORA2B (FIG. 6b) or CXCR4 and ADORA3 together (FIG. 6c), but not in cells expressing individual GPCR alone, upon co-treatment with CXCL12 and BAY 60-6583 (ADORA2B-selective agonist), or CXCL12 and Cl-IB-MECA (ADORA3-selective agonist), respectively.
  • ADORA2B-selective agonist CXCL12 and Cl-IB-MECA
  • FIG. 6f enhanced Ca 2+ signaling was observed in cells expressing CXCR4 and CHRM1 together, but not in cells expressing individual GPCR alone, upon co-treatment with CXCL12 and bethanechol, a synthetic CHRM1 agonist.
  • CXCL12 and CHRM1 endogenous ligand for all acetylcholine receptors
  • enhanced Ca 2+ signaling was also observed (FIG. 23d).
  • the result demonstrates that natural endogenous ligand, not only synthetic agonist, enhances signaling of CXCR4-CHRM1 heteromer upon co-stimulation with CXCL12. It further suggests that synergistic enhancement of downstream signaling could happen in vivo in cells expressing CXCR4 and CHRM1 together by their natural ligands.
  • FIG. 6i enhanced Ca 2+ signaling was observed in cells expressing CXCR4 and MLNR together, but not in cells expressing individual GPCR alone, upon co-treatment with CXCL12 and roxithromycin, an antibiotic as well as full MLNR agonist.
  • CXCL12 and motilin a selective endogenous ligand for MLNR
  • enhanced Ca 2+ signaling was also observed (FIG. 23f).
  • the result demonstrates that natural endogenous ligand, not only synthetic agonist, enhances signaling of CXCR4-MLNR heteromer upon co-stimulation with CXCL12. It further suggests that synergistic enhancement of downstream signaling could happen in vivo in cells expressing CXCR4 and MLNR together by their natural ligands.
  • FIG. 6l enhanced Ca 2+ signaling was observed in cells expressing CXCR4 and TACR3 together, but not in cells expressing individual GPCR alone, upon co-treatment with CXCL12 and senktide, a TACR3-selective agonist.
  • CXCL12 and neurokinin B selective endogenous ligand for TACR3
  • enhanced Ca 2+ signaling was also observed (FIG. 23g).
  • the result demonstrates that natural endogenous ligand, not only synthetic agonist, enhances signaling of CXCR4-TACR3 heteromer upon co-stimulation with CXCL12. It further suggests that synergistic enhancement of downstream signaling could happen in vivo in cells expressing CXCR4 and EDNRB together by their natural ligands.
  • Example 16 Evaluation by Ca2+ Mobilization Assay of Enhanced CXCR4 Downstream Signaling Upon Co-stimulation of CXCR4-GPCRx heteromer.
  • MDA-MB-231 cells co-expressing CXCR4 and ADCYAP1R1 stimulate stimulation with selective endogenous ligands CXCL12 alone or PACAP38 alone, respectively, produced calcium signaling dose-dependently (FIGS. 24a-24b).
  • MDA-MB-231 cells were transduced with adenoviruses encoding CXCR4 and ADCYAP1R1.
  • PACAP38 selective endogenous ligand
  • FIG. 24a addition of small amount of ADCYAP1R1 selective endogenous ligand (PACAP38; 1 nM) significantly enhanced calcium response in a broad range of CXCL12 concentrations compared with the sum values calculated by adding the responses obtained by PACAP38 alone and CXCL12 alone at indicated doses (FIG. 24a).
  • FIGS. 25a-25b The enhancement of calcium response in a broad range of ligand concentrations in cells co-expressing CXCR4 and TACR3 is shown in FIGS. 25a-25b.
  • MDA-MB-231 cells were transduced with adenoviruses encoding CXCR4 and TACR3. Stimulation of the cells with CXCL12 alone or Neurokinin B alone, respectively, produced calcium signaling dose-dependently (FIGS. 25a-25b). As shown in FIG.
  • Example 17 Confirmation of a Loss of Heteromer-Specific Property Upon Deletion of One of the Protomers.
  • FIG. 8f & 8g enhanced calcium signaling was observed in MDA-MB-231 cells overexpressing CXCR4 alone upon co-treatment with CXCL12 and histamine.
  • MDA-MB-231 cells were previsouly shown to express HRH1 as well as low level of CXCR4 mRNAs, with about twice more HRH1 mRNA being expressed compared with CXCR4 mRNA (Example 9).
  • HRH1 gene in MDA CXCR4+ cells was deleted using CRISPR/Cas9 system.
  • MDA-MB-231 cells stably expressing CXCR4 were transduced with lentiviruses encoding Cas9 and guide RNA targeting HRH1.
  • the presence of functional HRH1 was detected by measuring calcium responses upon exposure to histamine. While MDA CXCR4+ cells showed dose-dependent increase in calcium signaling upon exposure to histamine, MDA CXCR4+, HRH1- cells did not show any calcium response even at 1 ⁇ M histamine (FIG. 26a). The result implies almost complete absence of functional HRH1 in MDA CXCR4+, HRH1- cells.
  • FIGS. 18a-18b significant enhancement in calcium signaling was also observed in wildtype MDA-MB-231 cells in the presence of CXCL12 and histamine together although individual ligand alone only produced faint signals.
  • CXCR4 gene was targeted using CRISPR/Cas9 system, and expression of CXCR4 was detected using immunoblotting. Expression of CXCR4 was significantly decreased in MDA-MB-231 cells treated with guide RNA targeting CXCR4 compared to the expression in cells treated with control non-targeting guide RNA (FIG. 26b).
  • Enhanced calcium response in MDA-MB-231 cells upon co-treatment with CXCL12 and histamine is abrogated in the absence of CXCR4.
  • MDA-MB-231 cells MDA-MB-231 cells (MDA WT )
  • MDA WT cells MDA WT cells depleted with CXCR4 using CRISPR/Cas9 system
  • MDA CXCR4- CRISPR/Cas9 system
  • Example 18 Ca2+ Mobilization Inhibition of the Enhanced CXCR4 Downstream Signaling upon CXCR4-GPCRx heteromer Formation - Comparison of Single Inhibitor Treatment to Combination Inhibitor Treatment.
  • the cells were cultured for 2 days and were treated CXCR4 antagonist alone or co-treatment of CXCR4 antagonist and the specified GPCRx antagonist. And then, cells were stained with Cal-6 for 2 hours and stimulated with CXCL12 (20 nM) and the specified GPCRx agonist. Calcium mobilization was measured using FlexStation3.
  • a value in the column labeled "None” is the IC50 of Ca2+ response in the specified CXCR4-GPCRx heteromer-expressing MDA-MB-231 treated with CXCR4 inhibitor only (in the absence of a specified GPCRx antagonist).
  • a value in the remaining columns is the IC50 of Ca2+ response in the specified CXCR4-GPCRx heteromer-expressing MDA-MB-231 from the simultaneous treatment with CXCR4 antagonist and the specified GPCRx antagonist.
  • CXCR4 inhibitors The efficiency of CXCR4 inhibitors in suppressing the enhanced signaling of CXCR4-ADRB2 heteromer was measured in the absence or presence of the representative ADRB2 inhibitors Carazolol or Propranolol ( Table 7 ).
  • MDA-MB-231 cells were co-transduced with adenoviruses encoding CXCR4 and ADRB2, and Ca2+ signaling was measured upon co-stimulating the cells with CXCL12 (20 nM) and Salmeterol (1 ⁇ M). Inhibitors were treated 30 min before agonist stimulation. Ca2+ mobilization was measured as described in Fig. 5 , and IC 50 values were calculated using GraphPad Prism software.
  • CXCR4 inhibitors AMD-3100, Ulocuplumab and BKT140 suppressed the CXCR4-ADRB2 signaling more efficiently (greater potency) in the presence of 10 ⁇ M of Carazolol or Propranolol as shown with the reduced IC 50 values compared to the IC 50 values of CXCR4 inhibitors in the absence of ADRB2 inhibitors.
  • the IC50 value of Ca response in the CXCR4-ADRB2 heteromer context decreased by up to about 25 times or more when treated in combination with an ADRB2 inhibitor (Carazolol or Propranolol), relative to single treatment with the CXCR4 inhibitor alone ("None" column).
  • CXCR4 inhibitors The efficiency of CXCR4 inhibitors in suppressing the enhanced signaling of CXCR4-HRH1 heteromer was measured in the absence or presence of the representative HRH1 inhibitors Hydroxyzine, Prometazine, or Cyproheptadine ( Table 8 ).
  • MDA-MB-231 cells were co-transduced with adenoviruses encoding CXCR4 and HRH1, and Ca2+ signaling was measured upon co-stimulating the cells with CXCL12 (20 nM) and Histamine (1 nM). Inhibitors were treated 30 min before agonist stimulation. Ca2+ mobilization was measured as described in Fig. 5 , and IC 50 values were calculated using GraphPad Prism software.
  • CXCR4 inhibitors AMD-3100, Ulocuplumab and BKT140 suppressed the CXCR4-HRH1 signaling more efficiently (greater potency) in the presence of 10 ⁇ M of Hydroxyzine, Prometazine, or Cyproheptadine as shown with the reduced IC 50 values compared to the IC 50 values of CXCR4 inhibitors in the absence of HRH1 inhibitors.
  • the IC50 value of Ca response in the CXCR4-HRH1 heteromer context decreased by up to about 5,100 times or more when treated in combination with an HRH1 inhibitor (Hydroxyzine, Promethazine, or Cyproheptadine), relative to single treatment with the CXCR4 inhibitor alone ("None" column).
  • CXCR4 inhibitors The efficiency of CXCR4 inhibitors in suppressing the enhanced signaling of CXCR4-ADCYAP1R1 heteromer was measured in the absence or presence of the representative ADCYAP1R1 inhibitors M65 or PACAP-(6-38) ( Table 9 ).
  • MDA-MB-231 cells were co-transduced with adenoviruses encoding CXCR4 and ADCYAP1R1, and Ca2+ signaling was measured upon co-stimulating the cells with CXCL12 (20 nM) and PACAP-38 (1 nM). Inhibitors were treated 30 min before agonist stimulation. Ca2+ mobilization was measured as described in Fig. 5 , and IC 50 values were calculated using GraphPad Prism software.
  • CXCR4 inhibitors AMD-3100 and BKT140 suppressed the CXCR4-ADCYAP1R1 signaling more efficiently (greater potency) in the presence of 1 ⁇ M of M65 or 1 ⁇ M of PACAP-(6-38) as shown with the reduced IC 50 values compared to the IC 50 values of CXCR4 inhibitors in the absence of ADCYAP1R1 inhibitors.
  • the IC50 value of Ca response in the CXCR4-ADCYAP1R1 heteromer context decreased by up to about 225 times or more when treated in combination with an ADCYAP1R1 inhibitor (M65 or PACAP-(6-38)), relative to single treatment with the CXCR4 inhibitor alone ("None" column).
  • CXCR4 inhibitors The efficiency of CXCR4 inhibitors in suppressing the enhanced signaling of CXCR4-C5AR1 heteromer was measured in the absence or presence of the representative C5AR1 inhibitor W54011 ( Table 10 ).
  • MDA-MB-231 cells were co-transduced with adenoviruses encoding CXCR4 and C5AR1, and Ca2+ signaling was measured upon co-stimulating the cells with CXCL12 (20 nM) and C5a (0.03 nM). Inhibitors were treated 30 min before agonist stimulation. Ca2+ mobilization was measured as described in Fig. 5 , and IC 50 values were calculated using GraphPad Prism software.
  • CXCR4 inhibitors AMD-3100, BKT140, and Ulocuplumab suppressed the CXCR4-C5AR1 signaling more efficiently (greater potency) in the presence of 10 ⁇ M of W54011, as shown with the reduced IC 50 values compared to the IC 50 values of CXCR4 inhibitors in the absence of C5AR1 inhibitors.
  • the IC50 value of Ca response in the CXCR4-C5AR1 heteromer context decreased by up to about 12 times or more when treated in combination with an C5AR1 inhibitor (W54011), relative to single treatment with the CXCR4 inhibitor alone ("None" column).
  • CXCR4 inhibitors The efficiency of CXCR4 inhibitors in suppressing the enhanced signaling of CXCR4-CALCR heteromer was measured in the absence or presence of the representative CALCR inhibitor CT-(8-32) ( Table 11 ).
  • MDA-MB-231 cells were co-transduced with adenoviruses encoding CXCR4 and CALCR, and Ca2+ signaling was measured upon co-stimulating the cells with CXCL12 (20 nM) and calcitonin (100 nM). Inhibitors were treated 30 min before agonist stimulation. Ca2+ mobilization was measured as described in Fig. 5 , and IC 50 values were calculated using GraphPad Prism software.
  • CXCR4 inhibitors AMD-3100 and BKT140 suppressed the CXCR4-CALCR signaling more efficiently (greater potency) in the presence of 10 ⁇ M of CT-(8-32) as shown with the reduced IC 50 values compared to the IC 50 values of CXCR4 inhibitors in the absence of CALCR inhibitors.
  • the IC50 value of Ca response in the CXCR4-CALCR heteromer context decreased by up to about 210 times or more when treated in combination with an CALCR inhibitor (CT-(8-32)), relative to single treatment with the CXCR4 inhibitor alone ("None" column).
  • CXCR4 inhibitors The efficiency of CXCR4 inhibitors in suppressing the enhanced signaling of CXCR4-EDNRB heteromer was measured in the absence or presence of the representative EDNRB inhibitors ambrisentan or bosentan ( Table 12 ).
  • MDA-MB-231 cells were co-transduced with adenoviruses encoding CXCR4 and EDNRB, and Ca2+ signaling was measured upon co-stimulating the cells with CXCL12 (20 nM) and BQ3020 (0.5 nM). Inhibitors were treated 30 min before agonist stimulation. Ca2+ mobilization was measured as described in Fig. 5 , and IC 50 values were calculated using GraphPad Prism software.
  • CXCR4 inhibitors AMD-3100, BKT140, and Ulocuplumab suppressed the CXCR4-EDNRB signaling more efficiently (greater potency) in the presence of 10 ⁇ M of ambrisentan or 10 ⁇ M of bosentan, as shown with the reduced IC 50 values compared to the IC 50 values of CXCR4 inhibitors in the absence of EDNRB inhibitors.
  • the IC50 value of Ca response in the CXCR4-EDNRB heteromer context decreased by up to about 315 times or more when treated in combination with an EDNRB inhibitor (ambrisentan or bosentan), relative to single treatment with the CXCR4 inhibitor alone ("None" column).
  • CXCR4 inhibitors The efficiency of CXCR4 inhibitors in suppressing the enhanced signaling of CXCR4-MLNR heteromer was measured in the absence or presence of the representative MLNR inhibitor MA-2029 ( Table 13 ).
  • MDA-MB-231 cells were co-transduced with adenoviruses encoding CXCR4 and MLNR, and Ca2+ signaling was measured upon co-stimulating the cells with CXCL12 (20 nM) and motilin (0.2 nM). Inhibitors were treated 30 min before agonist stimulation. Ca2+ mobilization was measured as described in Fig. 5 , and IC 50 values were calculated using GraphPad Prism software.
  • CXCR4 inhibitors AMD-3100, BKT140, and Ulocuplumab suppressed the CXCR4-MLNR signaling more efficiently (greater potency) in the presence of 10 ⁇ M of MA-2029 as shown with the reduced IC 50 values compared to the IC 50 values of CXCR4 inhibitors in the absence of MLNR inhibitor.
  • the IC50 value of Ca response in the CXCR4-MLNR heteromer context decreased by up to about 11 times or more when treated in combination with an MLNR inhibitor (MA-2029), relative to single treatment with the CXCR4 inhibitor alone ("None" column).
  • CXCR4 inhibitors The efficiency of CXCR4 inhibitors in suppressing the enhanced signaling of CXCR4-TACR3 heteromer was measured in the absence or presence of the representative TACR3 inhibitors SB 222200, osanetant, or talnetant ( Table 14 ).
  • MDA-MB-231 cells were co-transduced with adenoviruses encoding CXCR4 and TACR3, and Ca2+ signaling was measured upon co-stimulating the cells with CXCL12 (20 nM) and neurokinin B (0.3 nM). Inhibitors were treated 30 min before agonist stimulation. Ca2+ mobilization was measured as described in Fig. 5 , and IC 50 values were calculated using GraphPad Prism software.
  • CXCR4 inhibitors AMD-3100, BKT140, and ulocuplumab suppressed the CXCR4-TACR3 signaling more efficiently (greater potency) in the presence of 10 ⁇ M of SB-222200, 10 ⁇ M of osanetant, or 10 ⁇ M of talnetant as shown with the reduced IC 50 values compared to the IC 50 values of CXCR4 inhibitors in the absence of TACR3 inhibitors.
  • the IC50 value of Ca response in the CXCR4-TACR3 heteromer context decreased by up to about 16 times or more when treated in combination with an TACR3 inhibitor (SB-222200, osanetant, or talnetant), relative to single treatment with the CXCR4 inhibitor alone ("None" column).
  • CXCR4-ADRB2 heteromer inhibitors were injected subcutaneously in nude mice.
  • tumor sizes were reached an average of 50-100mm 3
  • CXCR4 inhibitor, ADRB2 inhibitor alone or combination of CXCR4 and ADRB2 inhibitors were treated.
  • Figure 29a is a graph comparing tumor growth rates for the in vivo antitumor effect of CXCR4 inhibitor LY2510924 (3 mg/kg), ADRB2 inhibitor Carvedilol (30 mg/kg), or combination of LY2510924 (3 mg/kg) and Carvedilol (30 mg/kg).
  • Figure 29b is a graph comparing tumor growth rates for the antitumor effect of CXCR4 inhibitor AMD070 (10 mg/kg), ADRB2 inhibitor Carvedilol (30 mg/kg), or combination of AMD070 (10 mg/kg) and Carvedilol (30 mg/kg).
  • CXCR4-ADRB2 overexpressing mice were more inhibited tumor growth by the CXCR4 inhibitor, LY2510924 or the ADRB2 inhibitor, Carvedilol than the control mice.
  • the combination of LY2510924 and Carvedilol demonstrated that the tumor growth inhibitory effect was superior to the single administration group.
  • CXCR4-ADRB2 overexpressing A549 bearing mice treated with vehicle as a control reached an average tumor volume of 554.2 ⁇ 152.7mm 3 at day 21 post-treatment, as compared to LY2510924, Carvedilol or LY2510924 and Carvedilol, which reached an average tumor volume of 488.9 ⁇ 135.2 mm 3 , and 432.0 ⁇ 206.4 mm 3 , 356.3 ⁇ 125.4 mm 3 respectively, in the same time period.
  • FIG. 29b shows CXCR4-ADRB2 heteromer-overexpressing cell lines were transplanted at nude mouse and when tumor size reached 50-100 mm 3 , CXCR4 inhibitor, AMD070 or ADRB2 inhibitor, Carvedilol was administered orally alone or in combination for 23 days.
  • the size of the tumor on the 23 days after administration of the drug was 618.5 ⁇ 190.9 mm 3 in the control group, 543.2 ⁇ 260.4 mm 3 or 510.4 ⁇ 139.9 mm 3 in the group treated with AMD070 or Carvedilol, respectively.
  • the tumor size of drug treated group is shown to be smaller than that of control group.
  • the size of the tumor was 418.0 ⁇ 238.4 mm 3 , which indicates that the antitumor effect is superior to that of the single administration group.
  • a method for treating cancer in a subject having a cell containing a CXCR4-GPCRx heteromer comprising: administering to the subject a therapeutically effective amount of an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer.
  • a method for treating cancer in a subject having CXCR4-GPCRx heteromer comprising: administering to the subject a therapeutically effective amount of an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein the cell containing the CXCR4-GPCRx heteromer has enhanced downstream signaling.
  • a method for treatment, amelioration, or prevention of a cancer in a subject having CXCR4-GPCRx heteromer comprising: administering to the subject a therapeutically effective amount of an inhibitor of a CXCR4-GPCRx heteromer, wherein: GPCRx heteromerizes with CXCR4 in the subject, the heteromerization of GPCRx with CXCR4 is accompanied by enhancement of signaling downstream of CXCR4; and the enhancement of signaling downstream of CXCR4 is suppressed by the inhibitor of the CXCR4-GPCRx heteromer.
  • a method for assessing response, or potential response, of a subject having CXCR4-GPCRx heteromer to treatment, amelioration, or prevention of a cancer comprising: obtaining a sample from the subject; detecting heteromerization of CXCR4 and GPCRx in the sample; and based at least in part on detection of the heteromerization of CXCR4 and GPCRx, assessing the subject's response, or potential response, to the treatment, amelioration, or prevention of a cancer.
  • a method for treating cancer in a patient having a cell containing a CXCR4-GPCRx heteromer comprising: administering to the patient an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein:
  • the CXCR4-GPCRx heteromer has enhanced downstream signaling
  • the administered inhibitor or combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient.
  • a method of suppressing enhanced downstream signaling from a CXCR4-GPCRx heteromer in a cell of a patient suffereing from cancer comprising: administering to the patient an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein:
  • the CXCR4-GPCRx heteromer has enhanced downstream signaling
  • the administered inhibitor or combination of inhibitors suppresses the enhanced downstream signaling from said CXCR4-GPCRx heteromer in the cancer patient.
  • a pharmaceutical kit for use in treating cancer in a patient having a cell containing a CXCR4-GPCRx heteromer comprising: an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein the CXCR4-GPCRx heteromer has enhanced downstream signaling.
  • a pharmaceutical composition for use in treating cancer in a patient having a cell containing a CXCR4-GPCRx heteromer comprising:
  • an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer;
  • CXCR4-GPCRx heteromer has enhanced downstream signaling.
  • a method for treating cancer in a patient having a cancer cell containing a CXCR4-GPCRx heteromer, wherein the CXCR4-GPCRx heteromer has enhanced downstream signaling comprising:
  • the patient's cancer cell contains said CXCR4-GPCRx heteromer
  • a CXCR4-GPCRx heteromer-selective reagent alters heteromer-specific properties or function of said CXCR4-GPCRx heteromer in a patient derived cell(s); alters heteromer-specific properties of a patient derived cell(s) containing the CXCR4-GPCRx heteromer; or decreases cell proliferation of a patient derived cell(s) containing the CXCR4-GPCRx heteromer; and
  • a method for treating cancer in a patient having a cancer cell containing a CXCR4-GPCRx heteromer comprising:
  • the GPCRx of the CXCR4-GPCRx heteromer is selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; and
  • the assay performed on the biological sample is or comprises one or more of the following: a co-internalization assay, a colocalization assay, in situ hybridization, immunohistochemistry, immunoelectron microscopy, a proximity-based assay, a co-immunoprecipitation assay, or a fluorescent animal assay; and
  • a method for treating cancer in a patient having a cancer cell containing a CXCR4-GPCRx heteromer having enhanced downstream signaling comprising:
  • the patient's cancer cell contains said CXCR4-GPCRx heteromer
  • a CXCR4-GPCRx heteromer-selective reagent alters heteromer-specific properties or function of said CXCR4-GPCRx heteromer in a patient derived cell(s); alters heteromer-specific properties of a patient derived cell(s) containing said CXCR4-GPCRx heteromer; or decreases cell proliferation of a patient derived cell(s) containing said CXCR4-GPCRx heteromer; and
  • a method for treating cancer in a patient having a cancer cell containing a CXCR4-GPCRx heteromer having enhanced downstream signaling comprising:
  • the patient's cancer cell contains said CXCR4-GPCRx heteromer
  • a CXCR4-GPCRx heteromer-selective reagent alters heteromer-specific properties or function of said CXCR4-GPCRx heteromer in a patient derived cell(s); alters heteromer-specific properties of a patient derived cell(s) containing said CXCR4-GPCRx heteromer; or decreases cell proliferation of a patient derived cell(s) containing said CXCR4-GPCRx heteromer; and
  • a) progression of the cancer in the patient having said cancer cell containing the CXCR4-GPCRx heteromer is decreased in the range of 5-100% more upon administration of the combination of inhibitors, relative to administering the CXCR4 inhibitor or GPCRx inhibitor as the single inhibitor to said patient;
  • efficacy of a CXCR4 inhibitor is increased in the range of 5-2000% when administered in combination with the GPCRx inhibitor to the patient having said cancer cell containing the CXCR4-GPCRx heteromer, relative to efficacy of the CXCR4 inhibitor when administered as a single inhibitor;
  • c) efficacy of a GPCRx inhibitor is increased in the range of 5-2000% when administered in combination with the CXCR4 inhibitor to the patient having said cancer cell containing the CXCR4-GPCRx heteromer, relative to efficacy of the GPCRx inhibitor when administered as a single inhibitor.
  • a method for treating cancer in a patient having a cancer cell containing a CXCR4-GPCRx heteromer comprising:
  • the GPCRx of the CXCR4-GPCRx heteromer is selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; and
  • the assay performed on the biological sample is or comprises one or more of the following: a co-internalization assay, a colocalization assay, in situ hybridization, immunohistochemistry, immunoelectron microscopy, a proximity-based assay, a co-immunoprecipitation assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, RNAseq, qRT-PCR, microarray, or a fluorescent animal assay; and
  • a method for treating cancer in a patient having a cancer cell containing a CXCR4-GPCRx heteromer comprising:
  • the GPCRx of the CXCR4-GPCRx heteromer is selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; and
  • the assay performed on the biological sample is or comprises one or more of the following: a co-internalization assay, a colocalization assay, in situ hybridization, immunohistochemistry, immunoelectron microscopy, a proximity-based assay, a co-immunoprecipitation assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, RNAseq, qRT-PCR, microarray, or a fluorescent animal assay; and
  • a) progression of the cancer in the patient having said cancer cell containing the CXCR4-GPCRx heteromer is decreased in the range of 5-100% more upon administration of the combination of inhibitors, relative to administering the CXCR4 inhibitor or GPCRx inhibitor as the single inhibitor to said patient;
  • efficacy of a CXCR4 inhibitor is increased in the range of 5-2000% when administered in combination with the GPCRx inhibitor to the patient having said cancer cell containing the CXCR4-GPCRx heteromer, relative to efficacy of the CXCR4 inhibitor when administered as a single inhibitor;
  • c) efficacy of a GPCRx inhibitor is increased in the range of 5-2000% when administered in combination with the CXCR4 inhibitor to the patient having said cancer cell containing the CXCR4-GPCRx heteromer, relative to efficacy of the GPCRx inhibitor when administered as a single inhibitor.
  • one or more than one (including for instance all) of the following further embodiments may comprise each of the other embodiments or parts thereof.
  • a biological sample e.g., cells or tissue, such as cells or tissue from a cancer patient
  • the assay is or comprises one or more of the following: a co-internalization assay, a colocalization assay, in situ hybridization, immunohistochemistry, immunoelectron microscopy, a proximity-based assay, a co-immunoprecipitation assay, or a fluorescent animal assay.
  • the enhanced amount of calcium mobilization from the CXCR4-GPCRx heteromer is a calcium mobilization amount that, upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist, is at least 10% greater, at least 20% greater, at least 30% greater, at least 40% greater, at least 50% greater, at least 7
  • the enhanced amount of calcium mobilization from the CXCR4-GPCRx heteromer is a calcium mobilization amount that, upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist, is between 10-100% greater than the sum of calcium mobilization amounts resulting from single agonist stimulation of said cells with either the CXCL12 or the respective selective GPCRx agonist, as determined via a calcium mobilization assay.
  • the enhanced amount of calcium mobilization from the CXCR4-GPCRx heteromer is a calcium mobilization amount that, upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist, is between 25-100% greater than the sum of calcium mobilization amounts resulting from single agonist stimulation of said cells with either the CXCL12 or the respective selective GPCRx agonist, as determined via a calcium mobilization assay.
  • the synergistic amount of calcium mobilization from the cells containing the CXCR4-GPCRx heteromer is a calcium mobilization amount that, upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist, is at least 10% greater, at least 20% greater, at least 30% greater
  • the CXCR4-GPCRx heteromer components in a cell colocalize and physically interact, either directly or via intermediate proteins acting as conduits for allosterism, as determined via one or more of the following: a co-internalization assay, a colocalization assay, in situ hybridization, immunohistochemistry, immunoelectron microscopy, a proximity-based assay, a co-immunoprecipitation assay, or a fluorescent animal assay;
  • the CXCR4-GPCRx heteromer exhibits an enhanced calcium mobilization upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist relative to the sum of calcium mobilization amounts resulting from single agonist stimulation with either the CXCL12 or the respective selective GPCRx agonist;
  • assays on proliferation, migration, invasion, and drug resistance (survival) of cancer cells modulation of immune cell function, angiogenesis, vasculogenesis, metastasis, drug resistance, tissue microarray (TMA), and cancer cell-tumor microenvironment (TME) interaction.
  • the method of treating, method of suppressing, pharmaceutical composition, or pharmaceutical kit, of any one of the above embodiments and any one or more of the further embodiments herein, wherein the cell containing either the CXCR4 or the respective GPCRx in an individual protomer context comprises, independently:
  • RET resonance energy transfer
  • BRET bioluminescence RET
  • FRET fluorescence RET
  • TR-FRET time-resolved fluorescence RET
  • antibody-aided FRET ligand-aided FRET
  • BiFC bimolecular fluorescence complementation
  • PKA proximity ligation assay
  • a co-internalization assay bimolecular fluorescence complementation (BiFC), or a proximity ligation assay (PLA).
  • the method of treating, method of suppressing, pharmaceutical composition, or pharmaceutical kit, of any one of the above embodiments and any one or more of the further embodiments herein, wherein the CXCR4-GPCRx heteromer exhibits the enhanced amount of calcium mobilization such that:
  • the CXCR4-GPCRx heteromer exhibits an enhanced calcium mobilization upon co-stimulation with the CXCL12 and the respective selective GPCRx agonist relative to the sum of calcium mobilization amounts resulting from single agonist stimulation with either the CXCL12 or the respective selective GPCRx agonist;
  • the calcium mobilization from the protomer CXCR4 or GPCRx, in the individual protomer context in the cell is non-synergistic, as determined via calcium mobilization assay;
  • the calcium mobilization from the CXCR4-GPCRx heteromer in the cell is synergistic, as determined via a calcium mobilization assay.
  • a calcium mobilization amount that is equal to or less than the sum of calcium mobilization amounts resulting from single agonist stimulation with either the CXCL12 or the respective selective GPCRx agonist, as determined via a calcium mobilization assay.
  • a calcium mobilization amount that is equal to or less than the sum of calcium mobilization amounts resulting from single agonist stimulation with either the CXCL12 or the respective selective GPCRx agonist, as determined via a calcium mobilization assay.
  • the CXCR4 inhibitor is an antagonist of CXCR4, an inverse agonist of CXCR4, a partial antagonist of CXCR4, an allosteric modulator of CXCR4, an antibody of CXCR4, an antibody fragment of CXCR4, or a ligand of CXCR4.
  • the GPCRx inhibitor is an antagonist of GPCRx, an inverse agonist of GPCRx, a partial antagonist of GPCRx, an allosteric modulator of GPCRx, an antibody of GPCRx, an antibody fragment of GPCRx, or a ligand of GPCRx.
  • the inhibitor of the CXCR4-GPCRx heteromer is an antagonist of the CXCR4-GPCRx heteromer, an inverse agonist of the CXCR4-GPCRx heteromer, a partial antagonist of the CXCR4-GPCRx heteromer, an allosteric modulator of the CXCR4-GPCRx heteromer, an antibody of the CXCR4-GPCRx heteromer, an antibody fragment of the CXCR4-GPCRx heteromer, a ligand of the CXCR4-GPCRx heteromer, or a protein-protein interaction (PPI) inhibitor of the CXCR4-GPCRx heteromer.
  • PPI protein-protein interaction
  • the method of treating, method of suppressing, pharmaceutical composition, or pharmaceutical kit, of any one of the above embodiments and any one or more of the further embodiments herein, wherein the CXCR4 inhibitor, the GPCRx inhibitor, or the inhibitor of the CXCR4-GPCRx heteromer, is an antibody-drug conjugate.
  • NTSR1 inhibitor is selected from the group consisting of:
  • the cancer is selected from the group consisting of: breast cancer, lung cancer, brain cancer, kidney cancer, pancreatic cancer, ovarian cancer, prostate cancer, melanoma, multiple myeloma, gastrointestinal cancers, renal cell carcinoma, soft tissue sarcomas, hepatocellular carcinoma, stomach cancer, colorectal cancer, esophageal cancer, and leukemia.
  • the biological fluid sample includes circulating tumor cells (CTCs), tumor-derived cell-free DNA (cfDNA), circulating small RNAs, and extracellular vesicles including exosomes, from bodily fluids as disclosed, for example, in Campos CDM et al., "Molecular Profiling of Liquid Biopsy Samples for Precision Medicine," Cancer J. 2018 Mar/Apr;24(2):93-103, which is incorporated hereby in its entirety.
  • CTCs tumor cells
  • cfDNA tumor-derived cell-free DNA
  • RNAs extracellular vesicles including exosomes
  • the biological fluid sample is a blood sample, a plasma sample, a saliva sample, a cerebral fluid sample, an eye fluid sample, or a urine sample.
  • the method of treating, method of suppressing, pharmaceutical composition, or pharmaceutical kit, of any one of the above embodiments and any one or more of the further embodiments herein, wherein the presence of the CXCR4-GPCRx heteromer in the cancer cell of the patient is a biomarker of a sub-population of CXCR4-mediated cancer patients.
  • ADC antibody-drug conjugate
  • an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein: i) the CXCR4-GPCRx heteromer has enhanced downstream signaling; and ii) the administered inhibitor or combination of inhibitors suppresses the enhanced downstream signaling from said CXCR
  • the method of treating, method of suppressing, pharmaceutical composition, or pharmaceutical kit, of any one of the above embodiments and any one or more of the further embodiments herein, wherein the pharmaceutical kit or pharmaceutical composition, such as for use in treating cancer in a patient having a cell containing a CXCR4-GPCRx heteromer comprises: an inhibitor or a combination of inhibitors selected from the group consisting of: an inhibitor of CXCR4, an inhibitor of GPCRx, and an inhibitor of the CXCR4-GPCRx heteromer; wherein the CXCR4-GPCRx heteromer has enhanced downstream signaling.
  • the GPCRx of the CXCR4-GPCRx heteromer is selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CALCR, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; for example, selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, C5AR1, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2B, ADORA3, ADRB2, CHRM1, EDNRB, HRH1, MLNR, NTSR1, and TACR3; selected from the group consisting of: ADCYAP1R1, ADORA2
  • the GPCRx inhibitor is selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, C5AR1 inhibitor, CALCR inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; for example, selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, C5AR1 inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3 inhibitor, ADRB2 inhibitor, CHRM1 inhibitor, EDNRB inhibitor, HRH1 inhibitor, MLNR inhibitor, NTSR1 inhibitor, and TACR3 inhibitor; selected from the group consisting of: ADCYAP1R1 inhibitor, ADORA2B inhibitor, ADORA3
  • CXCL12 vasoactive intestinal peptide (VIP), and CCL2 were purchased from R&D systems (Minneapolis, Minnesota, USA).
  • Apelin-13, roxithromycin, AMD3100, umeclidinium were obtained from Cayman Chemical Company (Ann Arbor, MI, USA), Selleckchem (Huston, TX, USA), Medchem express (Princeton, NJ, USA), and Santa Cruz Biotechnology (Santa Cruz, CA, USA), respectively.
  • VNm10 is a Venus VN154 variant containing L46F and L64F mutations.
  • DNAs containing VNm10 and VC155 were amplified by PCR and cloned into pShuttle-CMV.
  • pAdBiFC-VN and pAdBiFC-VC vectors were obtained through homologous recombination between pAdEasy-1 and either pShuttle-CMV-VNm10 or pShuttle-CMV-VC155 using AdEasy vector system according to the manufacturer's instructions (Qbiogene, Carlsbad, CA).
  • Human GPCR cDNA clones were obtained from the Missouri S&T cDNA Resource Center (Rolla, MO, USA). GPCR cDNAs were amplified by PCR and cloned into pDONR201 vector.
  • Adenoviruses encoding GPCR, GPCR-VN, GPCR-VC, and GPCR-EGFP were obtained through in vitro LR recombination between entry clones containing GPCR and either pAdHTS, pAdBiFC-VN, pAdBiFC-VC, or pAdHTS-GFPC vectors, and subsequent transfection into 293A cells using AdHTS system as described previously (Choi et al., 2012; Song et al., 2014).
  • U-2 OS cells and MDA-MB-231 cells were purchased from the American Type Culture Collection (Manassas, VA, USA), and 293A cells were from Invitrogen (Carlsbad, CA, USA).
  • U-2 OS cells, MDA-MB-231 cells, and 293A cells were grown in McCoy's 5A medium, RPMI 1640, and Modified Eagle's medium, respectively, in the presence of 10% fetal bovine serum (FBS), 100 units/ml of penicillin, and 100 ⁇ g/ml of streptomycin. Cells were cultured with 5% CO2 at 37 ⁇ C.
  • U-2 OS cells were seeded at a density of 3000 cells per well in a black 96-well clear-bottom plate in 100 ⁇ l of McCoy's 5A medium supplemented with 10% FBS. On the following day, the cells were transduced with 30 MOI each of adenoviruses encoding GPCR-VN and GPCR-VC. Three days post-transduction, cells were fixed with 2 % formaldehyde and nuclei were stained with Hoechst 33342 (Invitrogen, Carlsbad, CA). Images were acquired using IN cell Analyzer 1000 and analyzed with IN Cell Developer ToolBox (GE Healthcare, Waukesha, WI).
  • BiFC and nuclear images were visualized using a ⁇ 20 objective and 360-nm (Hoechst) and 480-nm excitation filters, and monitored through 460- and 535-nm emission filters, respectively, with a 61002 trichroic mirror.
  • U-2 OS cells were seeded at a density of 3000 cells per well in a black 96-well clear-bottom plate in 100 ⁇ l of McCoy's 5A medium supplemented with 10% FBS. On the following day, the cells were co-transduced with adenoviruses encoding CXCR4-EGFP (10 MOI) and GPCR-VC or GPCR-VN (30 MOI). Two days post-transduction, cells were stimulated with GPCRx agonists for 30 min and fixed with 2% formaldehyde. Images were obtained using IN cell analyzer 2000 using an excitation wavelength of 480 nm and an emission wavelength of 535 nm.
  • MDA-MB-231 human breast cancer cells were seeded at 20,000 cells per well in a black clear bottom 96-well plate (Corning Costar, #3340) in 100 ⁇ l of RPMI 1640 supplemented with 10% FBS. The next day, cells were co-transduced with 10 MOI of CXCR4 and 30 MOI of HA-VC, 10 MOI of HA-VC and 30 MOI of GPCRx, or 10 MOI of CXCR4 and 30 MOI of GPCRx. Adenoviruses encoding HA-VC were used to adjust the total amount of adenoviruses transduced.
  • CXCR4-GFP expressed U-2 OS cells were seeded at a density of 5000 cells per well in a black 96-well clear-bottom plate in 100 ⁇ l of McCoy's 5A medium supplemented with 10% FBS. On the following day, the cells were transduced with adenoviruses encoding GPCRx (30 MOI). Two days post-transduction, cells were stimulated with SDF-1 and/or GPCRx agonists for 20 min and fixed with 4% paraformaldehyde. Images were obtained using IN cell analyzer 2500 using an excitation wavelength of 480 nm and an emission wavelength of 535 nm.
  • the U2OS-CXCR4 was infected with ADRB2 expressing adenovirus, Ad-ADRB2 at the dose of 0, 2.5, 10, 40 MOIs for 2 days.
  • Proximity ligation assays were performed as described previously (Brueggemann et al., 2014; Tripathi et al., 2014).
  • PLA proximity ligation assays
  • PFA paraformaldehyde
  • Slides were blocked with blocking solution provided by Duolink and incubated with mouse anti-CXCR4 (1:200, Santacruz, Sc-53534), Rabbit anti-ADRB2 (1:200, Thermoscientific, PA5-33333) at 37°C for 1 h in a humidifying chamber. Slides were then washed and incubated (1 h at 37°C) with secondary anti-rabbit and anti-mouse antibodies conjugated with plus and minus Duolink II PLA probes. Slides were washed again and then incubated with ligation-ligase solution (30 min at 37°C) followed by incubation with amplification-polymerase solution (2 h at 37°C).
  • PDCs were seeded in 96-chamber slide at 100000 ea /well in 100 ul culture media.
  • PDCs were fixed with 4% paraformaldehyde (PFA) and were blocked with blocking solution provided by Duolink and incubated with mouse anti-CXCR4 (1:200, Santacruz, Sc-53534), Rabbit anti-ADRB2 (1:200, Thermoscientific, PA5-33333), Rabbit anti-CHRM1 (1:200, Ls bio, Ls-C313301) at 37°C for 1 h in a humidifying chamber.
  • PFA paraformaldehyde
  • Slides were then washed and incubated (1 h at 37°C) with secondary anti-rabbit and anti-mouse antibodies conjugated with plus and minus Duolink II PLA probes. Slides were washed again and then incubated with ligation-ligase solution (30 min at 37°C) followed by incubation with amplification-polymerase solution (2 h at 37°C).
  • FFPE samples were used (provided by Samsung Seoul hospital in Seoul, Korea). After FFPE sample were de-paraffinized and performed heat induced antigen retrieval for 15 minutes at 100°C. Slides were blocked with blocking solution provided by Duolink and incubated with rabbit anti-CXCR4 (1:200, Thermoscientific, PA3305), mouse anti-ADRB2 (1:200, Santacruz, Sc-271322), at 37 °C for 1 h in a humidifying chamber. The other process was same as described above (PLA with PDC).
  • Transwell plates (8 ⁇ m pore size polycarbonate membrane, 6.5-mm diameter) were coated with 50 ⁇ g/mL collagen for 2 h at 37 °C (Corning Inc.).
  • MDA-MB-231 cells were serum-starved 24 h and then plated in serum-free medium containing 0.5% BSA in the top chamber (20,000 cells/100 ⁇ L).
  • Antagonists or inverse agonists were added to the cells 30 min before plating the cells in the transwell plates. Attractants were added in the bottom chamber. Antagonists or inverse agonists were also included in the bottom chamber.
  • cells on the top transwell membrane were removed using a cotton swab, fixed, and stained with 0.1% Crystal violet. Chemotaxis was quantified by counting the migrated cells on the lower surface of the membrane of 10 fields per chamber at 10 ⁇ objective.
  • ADRB2-F 5'-CTCTTCCATCGTGTCCTTCTAC-3' (SEQ ID NO:1),
  • ADRB2-R 5'-AATCTTCTGGAGCTGCCTTT-3' (SEQ ID NO:2);
  • HRH1-R 5'-GGTTCAGTGTGGAGTTGATGTA-3' (SEQ ID NO:4);
  • CXCR4-F 5'- CCACCATCTACTCCATCATCTTC-3' (SEQ ID NO:5)
  • CXCR4-R 5'-ACTTGTCCGTCATGCTTCTC-3' (SEQ ID NO:6);
  • ⁇ -actin-F 5'-GGAAATCGTGCGTGACATTAAG-3' (SEQ ID NO:7)
  • ⁇ -actin-R 5'-AGCTCGTAGCTCTTCTCCA-3' (SEQ ID NO:8); GAPDH-F:
  • Threshold cycles were calculated by QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific).
  • pLenti CMV Hygro DEST (w117-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17454) (Campeau et al., 2009).
  • CXCR4 cDNA was inserted into the lentiviral vector using LR recombination.
  • Lentiviruses encoding CXCR4 were produced using ViraPower Lentiviral Expression Systems (Invirtogen).
  • lentiviral stock containing the packaged pLenti6-CXCR4 expression construct which inserted with CXCR4 gene in pLenti-CMV Hygro DEST (Addgene, #17454)
  • lentiviral stock were produced by co-transfecting the ViraPower Lentiviral Packaging Mix (Invitrogen, K497500) and pLenti6-CXCR4 expression construct into 293FT producer cell line.
  • Transduction of this lentiviral stock into A549 cell line was performed and followed by selection with hygromycin (100 ⁇ g/mL) and blasticitin (5 ⁇ g/mL).
  • lentiviral stock containing the packaged pLenti6/V5-ADRB2 expression construct which inserted with ADRB2 gene in pLenti6/V5-DEST Gateway TM Vector (Invitrogen, V49610)
  • lentiviral stock were produced by co-transfecting the ViraPower Packaging Mix and pLenti6/V5-ADRB2 expression construct into 293FT producer cell line.
  • Transduction of this lentiviral stock into A549-CXCR4 cell line was performed and followed by selection with hygromycin (100 ⁇ g/mL) and blasticitin (5 ⁇ g/mL). Then clones resistant to antibiotics were selected and performed RT-qPCR and immunofluorescence to confirm the expression of the inserted gene, CXCR4 and ADRB2.
  • mice Five week-old, female Balb/c-nu/nu mice were obtained from Envigo (France) and maintained in specific pathogen-free animal facility. All protocols for animal use and euthanasia were approved by the Qubest Bio (South Korea) Animal Experimental Ethics Committee based on the Animal Protection Act.
  • CRISPR guide RNAs targeting CXCR4 and HRH1 and non-targeting guide RNA cloned in lentiCRISPR v2 vector were purchased from GenScript (Piscataway, NJ) (Sanjana et al., 2014).
  • GenScript Procataway, NJ
  • the guide RNA sequences are as follows:
  • Non-targeting gRNA ACGGAGGCTAAGCGTCGCAA (non-targeting gRNA; (SEQ ID NO:13)).
  • Lentiviruses were produced using ViraPower Lentiviral Expression Systems (Invirtogen).
  • MDA-MB-231 cells and MDA-MB-231 cells overexpressing CXCR4 were transduced with lentiviruses encoding non-targeting gRNA, CXCR4 gRNA, or HRH1 gRNAs.
  • Cells were selected with puromycin (3 ⁇ M) for 2 weeks and loss of CXCR4 and HRH1 was estimated with immunoblotting and calcium responses, respectively.
  • anti-CXCR4 rabbit monoclonal antibody Abcam, #ab124824) was used.
  • Ulocuplumab was purchased from Creative Biolabs (Shirley, NY, USA).
  • BKT140 was purchased from Chem Scene (Monmouth Junction, NJ, USA).
  • Carazolol was purchased from Santacruz Biotech (Dallas, TX, USA).
  • Osanetant was purchased from Axon Medchem, (Groningen, Netherland).
  • M65 and CT-(8-32) (salmon) were from Bachem (San Diego, CA, USA).
  • PACAP-(6-38), W54011, PMX205, PMX53, AC187, SB 222200, and Talnetant were from Tocris Bioscience (Ellisville, MO, USA).
  • Propranolol, Prometazine, Cyproheptadine, Hydroxyzine, Ambrisentan and macitentan were from Prestwick Chemical (Illkirch, France), and Selleckchem (Huston, TX, USA), respectively.
  • A549-CXCR4-ADRB2 cell line overexpressing CXCR4 and ADRB2 in A549, lung cancer cell line was subcutaneously administered (1x10 7 cell in 100 ⁇ L PBS / head) to BALB/c-nu.
  • mice When Tumor size reached 50-100 mm 3 , groups of ten mice were administrated with vehicle (1% dimethylcellulose in PBS), CXCR4 inhibitor (3 mg/kg of LY2510924 formulated in PBS, 10 mg/kg of AMD070 formulated in DMSO), ADRB2 inhibitor (30 mg/kg of Carvedilol formulated in 1% dimethylcellulose in PBS) or combination of CXCR4 and ADRB2 inhibitor, AMD070 and Carvedilol, or LY2510924 and Carvedilol once a day for 21-23 days.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Neurology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Endocrinology (AREA)
  • Mycology (AREA)
  • Emergency Medicine (AREA)
  • Oncology (AREA)
PCT/KR2018/016166 2017-12-19 2018-12-18 Gpcr heteromer inhibitors and uses thereof Ceased WO2019124951A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CN201880089801.6A CN111741752A (zh) 2017-12-19 2018-12-18 Gpcr异聚体抑制剂及其用途
BR112020012075-8A BR112020012075A2 (pt) 2017-12-19 2018-12-18 inibidores de heterômero gpcr e usos dos mesmos
AU2018388302A AU2018388302B2 (en) 2017-12-19 2018-12-18 GPCR heteromer inhibitors and uses thereof
KR1020267002674A KR20260035212A (ko) 2017-12-19 2018-12-18 Gpcr 헤테로머 억제제들 및 이의 용도
JP2020535043A JP7517986B2 (ja) 2017-12-19 2018-12-18 Gpcrヘテロマー阻害剤及びその用途
EP21174644.1A EP3900712A1 (en) 2017-12-19 2018-12-18 Gpcr heteromer inhibitors and uses thereof
CA3086337A CA3086337A1 (en) 2017-12-19 2018-12-18 Gpcr heteromer inhibitors and uses thereof
EP18892135.7A EP3727371A4 (en) 2017-12-19 2018-12-18 GPCR HETEROMER INHIBITORS AND THEIR USES
KR1020207019080A KR20200103018A (ko) 2017-12-19 2018-12-18 Gpcr 헤테로머 억제제 및 이의 용도
JP2024074184A JP7818648B2 (ja) 2017-12-19 2024-05-01 Gpcrヘテロマー阻害剤及びその用途

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201762607876P 2017-12-19 2017-12-19
US62/607,876 2017-12-19
US201862679598P 2018-06-01 2018-06-01
US62/679,598 2018-06-01
US201862732946P 2018-09-18 2018-09-18
US62/732,946 2018-09-18

Publications (2)

Publication Number Publication Date
WO2019124951A1 true WO2019124951A1 (en) 2019-06-27
WO2019124951A9 WO2019124951A9 (en) 2019-11-07

Family

ID=66813757

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/016166 Ceased WO2019124951A1 (en) 2017-12-19 2018-12-18 Gpcr heteromer inhibitors and uses thereof

Country Status (10)

Country Link
US (3) US10709763B2 (cg-RX-API-DMAC7.html)
EP (2) EP3727371A4 (cg-RX-API-DMAC7.html)
JP (2) JP7517986B2 (cg-RX-API-DMAC7.html)
KR (2) KR20260035212A (cg-RX-API-DMAC7.html)
CN (1) CN111741752A (cg-RX-API-DMAC7.html)
AU (1) AU2018388302B2 (cg-RX-API-DMAC7.html)
BR (1) BR112020012075A2 (cg-RX-API-DMAC7.html)
CA (1) CA3086337A1 (cg-RX-API-DMAC7.html)
TW (1) TWI818938B (cg-RX-API-DMAC7.html)
WO (1) WO2019124951A1 (cg-RX-API-DMAC7.html)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110755431A (zh) * 2019-11-08 2020-02-07 暨南大学 地氯雷他定在制备抗肝癌药物中的应用
WO2020234698A1 (en) * 2019-05-17 2020-11-26 Gpcr Therapeutics, Inc. Gpcr heteromer inhibitors and uses thereof
US11124515B2 (en) 2018-03-05 2021-09-21 Teon Therapeutics, Inc. Adenosine receptor antagonists and uses thereof
WO2022025168A1 (ja) * 2020-07-30 2022-02-03 国立大学法人広島大学 凝固・線溶系と補体を介したマスト細胞および好塩基球の活性化の制御ならびにその医薬用途

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3727371A4 (en) 2017-12-19 2021-10-27 GPCR Therapeutics, Inc. GPCR HETEROMER INHIBITORS AND THEIR USES
CA3129314A1 (en) * 2019-03-06 2020-09-10 Vikramaditya Ganapati Yadav Compositions and methods for biosynthesis of terpenoids or cannabinoids in a heterologous system
KR102268983B1 (ko) * 2019-09-11 2021-06-24 경북대학교 산학협력단 엔도테린 수용체 억제제에 의한 엑소좀 분비 억제 또는 pd-l1 발현 억제 용도
CN116057185A (zh) 2020-08-15 2023-05-02 雷杰纳荣制药公司 治疗具有编码降钙素受体(calcr)的变体核酸分子的受试者的肥胖症
CN112807425A (zh) * 2021-01-14 2021-05-18 南方医科大学深圳医院 一种tTIM融合蛋白疫苗、制备方法及应用
WO2023010330A1 (zh) * 2021-08-04 2023-02-09 杭州浙大迪迅生物基因工程有限公司 一种人组胺受体HRH1 mRNA检测引物探针组、试剂盒和检测方法
CN114574580B (zh) * 2022-02-14 2022-11-29 山东大学 靶向a2br联合化疗在三阴性乳腺癌治疗中的应用
WO2023211779A1 (en) * 2022-04-25 2023-11-02 Kallyope, Inc. Treatment of headache disorders with nk3 modulators
CA3258771A1 (en) * 2022-06-10 2023-12-14 Gpcr Therapeutics, Inc. GPCR INHIBITORS AND THEIR USES
CN114891742B (zh) * 2022-06-23 2024-06-04 杭州中赢生物医疗科技有限公司 一种强杀伤性nk细胞的培养基及体外扩增方法
CN116298305B (zh) * 2023-01-03 2024-05-28 郑州大学 一种抗nt5c1a自身抗体检测方法及体外诊断试剂盒
EP4698530A1 (en) 2023-04-18 2026-02-25 Kallyope, Inc. Nk3 modulators and uses thereof
AU2024334309A1 (en) * 2023-08-30 2026-03-05 Josephine Cardarelli Gpcr inhibitors and uses thereof
CN119345201B (zh) * 2024-12-25 2025-03-18 中国人民解放军总医院第三医学中心 治疗tfe3基因重排性肾细胞癌的药物或药物组合物及用途

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005103721A1 (en) * 2004-04-20 2005-11-03 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with cxc chemokine receptor 4 (cxcr4)
KR20110020825A (ko) * 2008-05-16 2011-03-03 아블린쓰 엔.브이. Cxcr4 및 다른 gpcr에 대해 유도된 아미노산 서열 및 이를 포함하는 화합물

Family Cites Families (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU3705097A (en) 1996-07-01 1998-01-21 Biosignal Inc. Peptides and peptidomimetic compounds affecting the activity of g-protein-coupled receptors by altering receptor oligomerization
AU3249997A (en) 1996-07-01 1998-01-21 Biosignal Inc. Method of assaying compounds which affect the activity of g protein-coupled receptors based on measurement of receptor oligomerization
US6855807B1 (en) 1999-06-16 2005-02-15 New York University Heterodimeric opioid G-protein coupled receptors
US20010053848A1 (en) 2000-03-10 2001-12-20 Patel Yogesh C. Hetero-oligomeric G protein-coupled receptors as novel drug targets
DK1411918T3 (da) * 2001-07-31 2012-04-23 Genzyme Global S A R L Fremgangsmåder til at mobilisere progenitor/stamceller
ATE500270T1 (de) 2003-05-20 2011-03-15 Univ Glasgow Materialien und methoden die sich auf g-protein gekoppelte rezeptor oligomere beziehen
CA2640087A1 (en) * 2006-01-25 2007-08-02 Mount Sinai School Of Medicine Methods and compositions for modulating the mobilization of stem cells
US20090028832A1 (en) * 2006-08-10 2009-01-29 Chung Leland F Compositions and methods for targeted tumor therapy
WO2010002468A1 (en) 2008-07-01 2010-01-07 The Trustees Of Columbia University In The City Of New York A functional complementation assay for defined gpcr oligomers
FR2949156B1 (fr) 2009-08-13 2016-04-15 Cis-Bio Int Methode de determination de la liaison d'un compose donne a un recepteur membranaire
US9216189B2 (en) 2010-01-25 2015-12-22 Icahn School Of Medicine At Mount Sinai Antibodies which bind type I cannabinoid receptor/angiotensis II receptor heteromers
JP2011168567A (ja) * 2010-02-22 2011-09-01 Kyoto Univ 再発癌の予防または治療用医薬
KR101029972B1 (ko) 2010-06-18 2011-04-20 서울대학교산학협력단 바이러스 벡터를 이용하여 단백질의 상호작용을 측정하는 방법
WO2012047339A2 (en) * 2010-06-28 2012-04-12 The General Hospital Corporation Anti-cxcr4 as a sensitizer to cancer therapeutics
US9267934B2 (en) * 2010-10-26 2016-02-23 University Of South Alabama Methods and compositions for ameliorating pancreatic cancer
CA2919790C (en) * 2013-08-02 2018-06-19 Pfizer Inc. Anti-cxcr4 antibodies and antibody-drug conjugates
CA2920377A1 (en) * 2013-08-05 2015-02-12 Cambridge Enterprise Limited Inhibition of cxcr4 signaling in cancer immunotherapy
CN103536594A (zh) * 2013-10-21 2014-01-29 江苏亚虹医药科技有限公司 G蛋白偶联受体拮抗剂在用于制备治疗谷氨酸受体高表达肿瘤药物中的用途
CA2970012C (en) 2013-12-23 2022-07-19 Universite De Montreal Systems and methods for the monitoring of protein complex formation in cells
ES2924394T3 (es) * 2015-01-09 2022-10-06 Adalta Ltd Moléculas de unión a CXCR4
WO2017020128A1 (en) * 2015-08-03 2017-02-09 Université de Montréal Markers for acute myeloid leukemias with core binding factor rearrangements and other genetic subtypes and uses thereof
EP3727371A4 (en) 2017-12-19 2021-10-27 GPCR Therapeutics, Inc. GPCR HETEROMER INHIBITORS AND THEIR USES

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005103721A1 (en) * 2004-04-20 2005-11-03 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with cxc chemokine receptor 4 (cxcr4)
KR20110020825A (ko) * 2008-05-16 2011-03-03 아블린쓰 엔.브이. Cxcr4 및 다른 gpcr에 대해 유도된 아미노산 서열 및 이를 포함하는 화합물

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BORROTO-ESCUELA, D. 0. ET AL.: "The G protein-coupled receptor heterodimer network (GPCR-HetNet) and its hub components", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 15, no. 5, 2014, pages 8570 - 8590, XP055621072 *
GOUPIL, E. ET AL.: "GPCR heterodimers: asymmetries in ligand binding and signalling output offer new targets for drug discovery", BRITISH JOURNAL OF PHARMACOLOGY, vol. 168, no. 5, 2013, pages 1101 - 1103, XP055621066 *
HAACK, K. K. V. ET AL.: "Functional consequences of GPCR heterodimerization: GPCRs as allosteric modulators", PHARMACEUTICALS, vol. 4, no. 3, 2011, pages 509 - 523, XP055621068 *
PARK, H. S. ET AL: "Chungbuk Creation Economic Innovation Center, following the role model of win-win cooperation, accelerates the leading role of creative job creation", 8 April 2016 (2016-04-08), KR, pages 1 - 25, XP009522161, Retrieved from the Internet <URL:http://eiec.kdi.re.kr/policy/material/view.jsp?num=153050> *
See also references of EP3727371A4 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11124515B2 (en) 2018-03-05 2021-09-21 Teon Therapeutics, Inc. Adenosine receptor antagonists and uses thereof
WO2020234698A1 (en) * 2019-05-17 2020-11-26 Gpcr Therapeutics, Inc. Gpcr heteromer inhibitors and uses thereof
JP2022532667A (ja) * 2019-05-17 2022-07-15 ジーピーシーアール セラピューティクス,インク. Gpcrヘテロマー阻害剤及びその使用
EP3969007A4 (en) * 2019-05-17 2023-06-07 GPCR Therapeutics, Inc. GPCR HETEROMERIC INHIBITORS AND THEIR USES
AU2020278977B2 (en) * 2019-05-17 2025-05-01 Gpcr Therapeutics, Inc. GPCR heteromer inhibitors and uses thereof
JP7676323B2 (ja) 2019-05-17 2025-05-14 ジーピーシーアール セラピューティクス,インク. Gpcrヘテロマー阻害剤及びその使用
CN110755431A (zh) * 2019-11-08 2020-02-07 暨南大学 地氯雷他定在制备抗肝癌药物中的应用
CN110755431B (zh) * 2019-11-08 2023-02-28 暨南大学 地氯雷他定在制备抗肝癌药物中的应用
WO2022025168A1 (ja) * 2020-07-30 2022-02-03 国立大学法人広島大学 凝固・線溶系と補体を介したマスト細胞および好塩基球の活性化の制御ならびにその医薬用途

Also Published As

Publication number Publication date
JP7818648B2 (ja) 2026-02-20
US10709763B2 (en) 2020-07-14
EP3900712A1 (en) 2021-10-27
WO2019124951A9 (en) 2019-11-07
TWI818938B (zh) 2023-10-21
BR112020012075A2 (pt) 2020-12-01
CA3086337A1 (en) 2019-06-27
US20200360478A1 (en) 2020-11-19
EP3727371A1 (en) 2020-10-28
CN111741752A (zh) 2020-10-02
JP7517986B2 (ja) 2024-07-17
AU2018388302A1 (en) 2020-07-02
US11857600B2 (en) 2024-01-02
US20190183976A1 (en) 2019-06-20
TW202017598A (zh) 2020-05-16
US20210268069A1 (en) 2021-09-02
EP3727371A4 (en) 2021-10-27
KR20260035212A (ko) 2026-03-12
AU2018388302B2 (en) 2024-10-31
JP2021507925A (ja) 2021-02-25
JP2024109616A (ja) 2024-08-14
KR20200103018A (ko) 2020-09-01

Similar Documents

Publication Publication Date Title
WO2019124951A1 (en) Gpcr heteromer inhibitors and uses thereof
Alampour‐Rajabi et al. MIF interacts with CXCR7 to promote receptor internalization, ERK1/2 and ZAP‐70 signaling, and lymphocyte chemotaxis
KR100945327B1 (ko) Il-17a/f 이종 폴리펩티드 및 그의 치료 용도
KR20160142360A (ko) Lgr5에 결합하는 인간화된 항체들
WO2013187556A1 (en) Novel antibody specific for clec14a and uses thereof
KR20070086020A (ko) 면역 관련 질환의 치료를 위한 신규 조성물 및 방법
KR20180030898A (ko) Gdf15의 활성 감소용 제제
WO2016018088A1 (ko) Met 저해제에 대한 감수성 예측용 신규한 바이오 마커 및 이의 용도
WO2021091319A1 (en) Glypican-3-specific modified aptamer and use thereof
CN117794571A (zh) 抗癌和免疫增强的新靶点
WO2015130115A1 (en) Novel antibody specific for tspan8 and uses thereof
WO2022244908A1 (ko) 항-bcam 항체 또는 그의 항원 결합 단편
JPWO2014126127A1 (ja) ネクロプトーシス関連疾患の治療用医薬組成物及びその有効成分のスクリーニング方法
WO2010137770A1 (ko) 신규한 gpcr 단백질 및 이의 용도
KR20210156849A (ko) Gpcr 헤테로머 저해제들 및 이의 용도
JP7621972B2 (ja) 新規な選択的ackr3調節性物質及びその使用
HK40062725A (en) Gpcr heteromer inhibitors and uses thereof
WO2022131889A1 (ko) Taci 단백질의 용도
KR101026016B1 (ko) T 세포 접착 분자 및 이에 대한 항체
WO2020117017A1 (ko) 항 c-met 아고니스트 항체 및 이의 용도
WO2025005692A1 (ko) 항-cxcr2 항체 및 이의 용도
WO2024205282A1 (ko) Igsf1 특이적 결합 단백질 및 이의 용도
WO2026038869A1 (ko) 암 생존자 유래의 당쇄 특이적 항암 항체
WO2026059014A1 (ko) 인간 메소텔린에 대한 항체 및 이의 용도
HK40108869A (zh) 抗癌和免疫增强的新靶点

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18892135

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 122022025463

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2020535043

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3086337

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20207019080

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018388302

Country of ref document: AU

Date of ref document: 20181218

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018892135

Country of ref document: EP

Effective date: 20200720

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020012075

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112020012075

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200616

WWC Wipo information: continuation of processing after refusal or withdrawal

Ref document number: 1020207019080

Country of ref document: KR