WO2018182334A1 - 파이토엔 고생산능을 갖는 변이 균주의 제조방법 및 상기 방법으로 제조된 변이 균주 - Google Patents

파이토엔 고생산능을 갖는 변이 균주의 제조방법 및 상기 방법으로 제조된 변이 균주 Download PDF

Info

Publication number
WO2018182334A1
WO2018182334A1 PCT/KR2018/003725 KR2018003725W WO2018182334A1 WO 2018182334 A1 WO2018182334 A1 WO 2018182334A1 KR 2018003725 W KR2018003725 W KR 2018003725W WO 2018182334 A1 WO2018182334 A1 WO 2018182334A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
strain
seq
phytoene
prepared
Prior art date
Application number
PCT/KR2018/003725
Other languages
English (en)
French (fr)
Inventor
최용준
정선욱
김주아
임영훈
홍은경
조광진
Original Assignee
서울시립대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울시립대학교 산학협력단 filed Critical 서울시립대학교 산학협력단
Priority to EP18776574.8A priority Critical patent/EP3611267A4/en
Priority to US16/498,269 priority patent/US11142777B2/en
Publication of WO2018182334A1 publication Critical patent/WO2018182334A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/02—Preparation of hydrocarbons or halogenated hydrocarbons acyclic
    • C12P5/026—Unsaturated compounds, i.e. alkenes, alkynes or allenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y103/00—Oxidoreductases acting on the CH-CH group of donors (1.3)
    • C12Y103/99—Oxidoreductases acting on the CH-CH group of donors (1.3) with other acceptors (1.3.99)
    • C12Y103/99031—Phytoene desaturase (lycopene-forming) (1.3.99.31)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2523/00—Culture process characterised by temperature
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Definitions

  • the present invention relates to a method for producing a mutant strain having high phytoene production capacity and a mutant strain prepared by the above method.
  • Microbial metabolic engineering is a technique to improve the genome of microorganisms and the like to utilize for the desired purpose.
  • Useful metabolites can be obtained from genetic information and metabolic circuits of microorganisms, and more useful metabolites or techniques are being developed through manipulation of microbial genes.
  • site-specific recombination techniques such as Flp / FRT and cre / lox in metabolic engineering have been applied to various life models such as plants, yeast and microorganisms.
  • Deinococcus radiodurans is known to be resistant to ionizing radiation that can directly damage the DNA or protein of an organism.
  • the strain can repair DNA damage caused by ionizing radiation in a short time and has the ability to effectively remove free radicals (ROS) generated in cells by enzymatic or non-enzymatic systems. Due to these characteristics, Deinococus radiodurance is used for the purification of radioactive waste. In addition, it is expected that there will be an increase in the number of cases where Dayokocus radiodurance is applied in various fields such as medicine, health care and biotechnology.
  • carotenoids are C-40 isoprenoid compounds that have antioxidant activity and are generic names of a group of pigments widely distributed in nature. There are over 600 carotenoids known to date, each of which is in a different form. Recently, genes encoding enzymes involved in the biosynthesis of carotenoids have been studied. As a result, genes and cDNAs encoding enzymes associated with many carotenoid biosynthesis have been found in bacteria, algae, strains and higher plants such as tobacco, tomatoes and peppers. Due to the importance of such carotenoids, research on genes encoding enzymes involved in carotenoid biosynthesis in higher plants has attracted attention. Phytoene, one of the carotenoids, is known as an effective ingredient for skin whitening, and is used as an ultraviolet absorber, an antioxidant, and an anti-inflammatory agent.
  • Korean Patent No. 10-0813284 discloses that the production of carotenoid components is increased by continuously expressing the phytoene biosynthetic enzyme ( PSY ) gene of citrus in rapeseed plants transformed by the Agrobacterium-transformation method. It is starting.
  • PSY phytoene biosynthetic enzyme
  • the present inventors are trying to prepare a strain of the genus Dinococcus capable of producing high phytoene by introducing a metabolic method, while modifying the cre-lox system of the Dinococcus radiodurance that is missing the DR0861 gene Variant strain, Variant strains of Dinococcus radiodurans, with the deletion of the DR0861 gene and overexpressing the DR0862, DR1087, DR1395, or DR1475 genes, and Dinococcus radiodurans with the deletion of the DR0861 and DR2250 genes and overexpressing the DR0862 and DR1475 genes.
  • the present invention was completed by preparing a mutant strain and confirming that the mutant strain had excellent phytoene-producing ability.
  • Another object of the present invention is to provide a method for producing phytoene using the mutant strain.
  • the present invention introduces a DNA construct in which the upper and lower fragments of the DR0861 gene are fused to both ends of a lox nucleic acid fragment comprising a first selection marker, respectively, into a strain of genus Deukokocus, thereby deleting the DR0861 gene.
  • the present invention provides a strain of the genus Deinococcus having a phytoene-producing ability deleted from the DR0861 gene prepared by the above method.
  • the present invention also provides a phytoene production method comprising the step of culturing the variant strain.
  • Deinococcus radiodurans mutant strain having a high phytoene production capacity produced by the method of the present invention does not have an artificially introduced antibiotic resistance gene, even though it was prepared by introducing a metabolic method, and has excellent production ability of phytoene, Mutant strain prepared by the method can be usefully used for mass production of phytoene.
  • Figure 1a is a diagram illustrating the manufacturing process of the pAM1 plasmid.
  • Figure 1b is a diagram illustrating the preparation of the pAM2 plasmid.
  • Figure 2 is a schematic diagram of the structure of the prepared pAM1 plasmid.
  • 3 is a diagram showing the structure of the prepared pAM2 plasmid.
  • FIG. 4 is a diagram illustrating a process of deleting the DR0861 gene in the genome of the Deinococcus radiodurans strain.
  • FIG. 6 is a photograph showing the result of screening all of the strains of the Deinococcus radiodurans mutant in which the antibiotic resistance gene was removed and the DR0861 gene was deleted.
  • Figure 7a is a graph confirming the phytoene-producing ability of the Deinococcus radiodurans mutant strain deleted the DR0861 gene prepared according to the method of the present invention by HPLC.
  • Figure 7b is a graph showing the phytoene production amount of the Daytococcus radiodurans mutant strain lacking the DR0861 gene prepared according to the method of the present invention compared to the wild type strain.
  • FIG 8 is a graph confirming the phytoene-producing ability of the Denococcus radiodurans mutant strain deleted by the DR0861 gene prepared according to the method of the present invention (STD: phytoene of the standard; DC: wild-type Denococcus radio Durance: ⁇ DR0861: Daynococcus radiodurans mutant strain that lacks the DR0861 gene; ⁇ DR0862: Daynococcus radiodurance variant strain that lacks the DR0862 gene).
  • FIG. 9 is a diagram showing the structure of a plasmid expressing the DR0862 gene.
  • FIG. 10 is a diagram showing the structure of a plasmid expressing the DR0862 and DR1475 genes at the same time.
  • 11 is a calibration curve graph created using 15-cis-phytoene of a standard product.
  • FIG. 12 is an HPLC result chromatogram performed using 15-cis-pytoene as standard.
  • FIG. 13 is a graph quantifying the phytoene production amount of the mutant strains prepared in Examples 6 to 13 by HPLC (None: Example 6; dr0862 + : Example 7; dr1087 + : Example 8; dr1395 + : Example 9; dr1475 + Example 10; dr0862 + , dr1087 + : Example 11; dr0862 + , dr1395 + : Example 12; dr0862 + , dr1475 + : Example 13).
  • Example 14 is a graph showing the results of confirming the phytoene production amount of the mutant strain prepared in Example 13 by time.
  • Example 15 is a graph quantifying by confirming the phytoene production amount of the mutant strains prepared in Examples 6, 13, 14 and Comparative Example 3 by HPLC ( ⁇ dr0861: Example 6; ⁇ dr0861, ⁇ dr2250: Comparative Example 3; ⁇ dr0861, dr0862 + , dr1475 + : Example 13; ⁇ dr0861, ⁇ dr2250, dr0862 + , dr1475 + : Example 14).
  • 16 is a graph showing the results of confirming the phytoene production amount of the mutant strain prepared in Example 14 by time.
  • FIG. 17 is a graph illustrating a result of comparing phytoene production amount of the mutant strain prepared in Example 14 with the growth curve of the strain and the consumption ratio of the carbon source included in the culture medium.
  • the present invention comprises the steps of introducing a DNA structure in which the upper and lower fragments of the DR0861 gene fused to both ends of the lox nucleic acid fragment containing the first selection marker to the strain of the genus Deinococcus to delete the DR0861 gene; Deleting a first selection marker by introducing a DNA vector comprising a groE promoter, a gene encoding a cre recombinase, a second selection marker, and a temperature sensitive repUts, to the strain from which the DR0861 gene is deleted; And culturing the obtained mutant strain to remove a vector comprising a second selection marker, thereby providing a method for producing a mutant strain of genus Dinococcus which has deleted the DR0861 gene using the cre-lox system.
  • cre-lox system refers to a site-specific recombinant enzyme technique used to perform deletions, insertions, translocations, and inversions at specific sites of DNA.
  • the cre-lox system can be used to induce mutations from genes of eukaryotic and prokaryotic organisms. It consists of a single enzyme cre recombination enzyme and recombines the short target lox sequence. By appropriately placing the lox sequence at the position where the mutation is to be caused, the target gene may be activated or inhibited or replaced with another gene.
  • lox P is a bacteriophage P1 site consisting of 34 bases, contains an asymmetric 8 bp base sequence, and has two pairs of palimdromic structures, 13 bp in size except two bases in the center ( ATAACTTCGTATA-NNNTANNN-TATACGAAGTTAT).
  • selection marker refers to the product of a particular gene.
  • the microorganism comprising the product has a special trait that does not appear in microorganisms that do not contain it, thereby making it possible to distinguish microorganisms.
  • the selection marker may be an antibiotic resistance gene.
  • the antibiotic resistance gene may be any one or more selected from the group consisting of kanamycin, chloramphenicol, spectinomycin and streptomycin, specifically, any one or more selected from the group consisting of kanamycin and chloramphenicol.
  • the strains of the genus Deinococus are D. radiodurans , D. indicus , D. caeni , D. caeni , D. decocous aquaticus . aquaticus ), D. depolymerans , D. decorans ( D. grandis ), D. daejeonensis ( D. daejeonensis ), D. decocous D. radiotolerans , D. geothermalis , D. ruber , D. ancuscticus , D. proteolyticus , Dinococus selected from the group consisting of radio pugeu nonce (D. radiopugnans), Day Noko kusu radio pillar's (D.
  • the present invention provides a step of introducing a DNA construct in which the upper and lower fragments of the DR0861 gene are fused to both ends of a lox nucleic acid fragment comprising a first selection marker, respectively, into a strain of genus Deukocacus, thereby deleting the DR0861 gene.
  • the term "DR0861" gene is a phytoene dehydrogenase, which serves to convert phytoene into zeta-carotene by introducing a double bond at the C11 and C11 'positions of the phytoene. ) Is a gene encoding.
  • the phytoene dehydrogenase is also called phytoene desaturase.
  • the DR0861 gene may be a polynucleotide consisting of any sequence known in the art. Specifically, the DR0861 gene may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 22.
  • the upper and lower fragments of the DR0861 gene may comprise a length of 0.5 to 1.2 kb, specifically 0.6 to 1.1 kb, more specifically 0.7 to 1.0 kb from the 5 'or 3' end in the full length DR0861 gene sequence.
  • the fragment may be included for homologous recombination with the DR0861 gene present in the genome of the genus Deinococcus.
  • the term "lox nucleic acid fragment” is a fragment for removing a desired gene from the genome of the Deinococcus radiodurans strain using the cre-lox system.
  • the lox The nucleic acid fragment may comprise a first selection marker having lox fragments at both ends.
  • the lox nucleic acid fragment may include any one or more lox genes selected from the group consisting of lox71 and lox66 at both ends of the fragment.
  • the lox nucleic acid fragment may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 17.
  • the present invention also provides a step of deleting a first selection marker by introducing a vector comprising a groE promoter, a gene encoding a cre recombinase, a second selection marker and a temperature sensitive repUts, to a strain from which the DR0861 gene is deleted. .
  • the groE promoter may be operably linked with cre recombinase.
  • operably linked means that the sequence regulating the expression of the nucleic acid and the nucleic acid sequence encoding the protein of interest are possibly linked. Operationally linking in the production of recombinant vectors can be carried out by methods well known to those skilled in the art.
  • the groE promoter may be a polynucleotide comprising 299 bp of an upstream portion of the groES gene (NCBI GeneBank ID: 1800077), specifically, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 18.
  • the second selection marker may be operatively connected with the Kat promoter.
  • the Kat promoter may be a polynucleotide including 138 bp of an upstream portion of the KatE1 gene (NCBI GeneBank ID: 1800077), specifically, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19.
  • temperature sensitive repUts refers to the repU gene, a gene that allows plasmids to replicate only within a certain range of temperatures (HH Nguyen et al. al . , Molecular Microbiology , 2009, 73 (2), 240-252).
  • the plasmid containing the gene is replicated at a culture temperature of 28 ° C. to maintain the plasmid in the host cell, but at the culture temperature of 37 ° C., the plasmid does not replicate and is removed from the host cell.
  • the repU gene and plasmid containing the same are well known in the art.
  • Deleting the first selection marker may remove the first selection marker from the genome of the genus Deinococcus by cutting the lox genes bound to both ends of the first selection marker by a recombination enzyme and cleaving these sites. Can be.
  • a vector comprising a groE promoter, a gene encoding a cre recombination enzyme, a second selection marker, and a temperature sensitive repUts may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 21.
  • the present invention provides a step of culturing the obtained variant strain to remove the vector comprising the second selection marker.
  • the removal of the second selection marker may use a characteristic that a vector including the second selection marker is not replicated within a specific temperature range by repUts, which is a temperature sensitivity marker. Therefore, the step may remove the vector comprising the second selection marker by culturing the variant strain for a period of time within a specific temperature range.
  • the temperature for the culture may be 30 to 40 °C, specifically 31 to 39 °C, more specifically 33 to 38 °C.
  • the mutant strain obtained by the above step may be selected based on the characteristics that do not grow in the medium containing antibiotics by removing both the first and second selection markers.
  • the present invention may further comprise the step of introducing a plasmid expressing each one or more genes selected from the group consisting of DR0862, DR1087, DR1395 and DR1475.
  • the term "DR0862" gene is a gene encoding a phytoene synthase, the phytoene synthase is a phyto substrate based on the precursor of geranylgeranyl pyrophosphate (geranylgeranyl pyrophosphate) Yen can be synthesized.
  • the DR0862 gene may be a polynucleotide consisting of any sequence known in the art. Specifically, the DR0862 gene may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 41.
  • DR1087 gene is a gene encoding isopentenyl pyrophosphate isomerase, which isomerizes isopentenyl pyrophosphate with dimethylallyl pyrophosphate. can do.
  • the DR1087 gene may be a polynucleotide consisting of any sequence known in the art. Specifically, the DR1087 gene may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 42.
  • the term “DR1395” gene is a gene encoding geranylgeranyl pyrophosphate synthase, which uses geresyl pyrophosphate as a substrate to produce geranyl geranyl. Pyrophosphate can be synthesized.
  • the DR1395 gene may be a polynucleotide consisting of any sequence known in the art. Specifically, the DR1395 gene may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 43.
  • the term "DR1475" gene is a gene encoding 1-deoxy-D-xylulose-5-phosphate synthase, which is a pyru Pyruvate and glucose-3-phosphate can be used as substrates to synthesize 1-deoxy-D-xylulose-5-phosphate.
  • the DR1475 gene may be a polynucleotide consisting of any sequence known in the art. Specifically, the DR1475 gene may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 44.
  • the method according to the invention may further comprise introducing a plasmid expressing one, two or more of the DR0862, DR1087, DR1395 or DR1475 gene.
  • the introduction may be performed using a plasmid designed to express one, two or more genes, respectively, or may be performed using one, two or more of each plasmid expressing one gene.
  • Methods for engineering to overexpress one, two or more genes in a strain are well known in the art.
  • Plasmids each expressing one or more genes selected from the group consisting of DR0862, DR1087, DR1395 and DR1475 can be prepared according to methods well known in the art. The method of introducing the prepared plasmid into the strain may also be appropriately performed by a person skilled in the art.
  • the present invention may further comprise the step of deleting the DR2250 gene.
  • DR2250 gene is a gene encoding methoxyneurosporene dehydrogenase, which is a carotenoid 3 ', 4' desaturase. Neurosporene dehydrogenase can introduce double bonds at the C3 'and C4' positions of the carotenoids.
  • the DR2250 gene may be a polynucleotide consisting of any sequence known in the art. Specifically, the DR2250 gene may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 45.
  • the method of deleting the DR2250 gene may be performed by any method known in the art.
  • the deletion of the DR2250 gene may be performed in the same manner as the method for deleting the DR0861 gene described above.
  • Polynucleotides according to the methods of the present invention may include variants or fragments having different sequences by deletion, insertion, substitution or addition of bases, within a range that does not affect the function of the encoding protein.
  • the gene may have a homology of 70%, 80%, 90%, 95% or 99% or more with a polynucleotide consisting of a known nucleotide sequence.
  • a plasmid containing lox fragments at both ends and comprising chloramphenicol as the first selection marker see FIG. 1A.
  • a plasmid containing a temperature-sensitive repUts was prepared, comprising a second selection marker in which the expression of the cre gene is controlled by the groE promoter (see FIG. 1B).
  • the present inventors introduced the plasmids expressing the DR0862, DR1087, DR1395, DR1475, DR0862 and DR1087, DR0862 and DR1395, or DR0862 and DR1475 genes in the Deinococcus radiodurans strain, in which the DR0861 gene was deleted.
  • Denococcus variant strains overexpressing the DR0862, DR1087, DR1395, DR1475, DR0862 and DR1087, DR0862 and DR1395, or DR0862 and DR1475 genes were deleted (see FIGS. 9 and 10).
  • the inventors have produced a daynococcus variant strain which deletes the DR0861 and DR2250 genes and overexpresses the DR0862 and DR1475 genes.
  • the present invention provides a strain of the genus Deinococcus having a phytoene-producing ability deleted from the DR0861 gene prepared by the above method.
  • the genus Deinococcus strain may be prepared according to the method described above. Specifically, the strains of the genus Deukokokusu are D. radiodurans , D. indicus , D. indicus , D. caeni , D. caeni , D. deucoccus aquaticus ( D. aquaticus ), D. depolymerans ( D. depolymerans ), D. deucoccus grandis ( D. grandis ), D. daejeonensis ( D. daejeonensis ), D. coccus radiotolerance ( D. aquaticus ) . radiotolerans ), D. geothermalis , D. ruber , D. ruber , D.
  • D. proteolyticus Consisting of D. radiopugnans , D. radiophilus , D. cellulosilyticus , and D. swuensis At least one selected from the group Typically it can be two-day Noko Syracuse Radio Esperance.
  • Variant strains of the genus Deinococcus that lack the DR0861 gene may have excellent phytoene production capacity.
  • the inventors confirmed by HPLC and TLC analysis that the Deinococcus radiodurans strain lacking the DR0861 gene prepared according to the method of the present invention shows excellent phytoene production capacity (Fig. 7 and 8).
  • the inventors have shown that the Denococcus mutant strain overexpressing the DR0862, DR1087, DR1395, DR1475, DR0862 and DR1087, DR0862 and DR1395, or DR0862 and DR1475 genes at the same time that the DR0861 gene is deleted, in particular, exhibits excellent phytoene production capacity.
  • Denococcus mutant strains overexpressing the DR0861 gene and overexpressing the DR0862 and DR1475 genes showed the highest phytoene production capacity (see FIG. 13).
  • the mutant strains in which the DR0861 gene was deleted and overexpressed the DR0862 and DR1475 genes showed the highest phytoene-producing ability at 72 hours of culture (see FIG. 14).
  • the present inventors have made a variant strain in which the DR0861 and DR2250 genes are deleted and overexpresses the DR0862 and DR1475 genes, so that the strain is more pronounced than the variant strain in which the DR0861 genes are deleted and overexpresses the DR0862 and DR1475 genes. It was confirmed that a (see Fig. 15).
  • the mutant strains in which the DR0861 and DR2250 genes were deleted and overexpressed the DR0862 and DR1475 genes showed the highest phytoene-producing ability at 72 hours of culture (see FIG. 16).
  • the present invention also provides a phytoene production method comprising the step of culturing the variant strain according to the present invention having the above characteristics.
  • the culturing can be carried out according to suitable medium and culture conditions well known in the art.
  • the culture may be a batch, continuous or fed-batch culture.
  • the phytoene production method may further comprise the step of obtaining phytoene from the culture obtained by culturing the variant strain.
  • the obtaining of the phytoene can be appropriately performed by a person skilled in the art.
  • Plasmids containing lox66 and lox71 genes at both ends of the kanamycin resistance gene were prepared as follows (FIG. 1A).
  • the pKatAPH3 plasmid (Satoh K. et al . , Microbiology , 152: 3217-3226, 2006) using Lox66F (SEQ ID NO: 1) and Lox71R (SEQ ID NO: 2) primers having the nucleotide sequences shown in Table 1 below to have lox66 and lox71 genes at both ends.
  • the kanamycin resistance gene was amplified.
  • a mixture of 1 ⁇ l of pKatAPH3, 1 ⁇ l of lox66F and lox71R primers (10 pmole / ⁇ l) and 17 ⁇ l of sterile distilled water was added to the pfu polymerase Bioneer, followed by T-100 Thermal cycler DNA. It was performed using an amplifier (Bio-rad). PCR was performed by reacting at 95 ° C. for 5 minutes, repeating 30 times with one reaction of 95 ° C. 30 seconds, 60 ° C. 30 seconds, and 72 ° C. for 1 minute.
  • the obtained product was confirmed by electrophoresis on 1% agarose gel, which was purified using a DNA fragment purification kit (Intron lifetechnology).
  • the obtained PCR product and pKatAPH3 were digested with EcoRV and BamHI, respectively, and ligated to prepare plasmids containing lox66 and lox71 genes at both ends of the kanamycin resistance gene.
  • the prepared plasmid was named pAM1 (SEQ ID NO: 20) (Fig. 2).
  • a plasmid comprising the cre recombinant enzyme, chloramphenicol resistance gene and groE promoter gene was prepared by the following method (FIG. 1B).
  • a Denococcus radiodurance gene was used as a template, and 0.5 ⁇ l each of the primers of GroEF (SEQ ID NO: 3) and GroER (SEQ ID NO: 4) and AccuPower TM pfu described in Table 1 above.
  • PCR was performed under the same conditions and methods as in Example 1, except that PCR premix mix (Bioneer) was used. As a result, a PCR product of the groE promoter gene was obtained.
  • cre gene a polynucleotide (Bioneer) artificially synthesized with reference to the sequence of NCBI Accession number_ab449974 was used as a template, and the primers of CreF (SEQ ID NO: 5) and CreR (SEQ ID NO: 6) described in Table 1 above were used. PCR was performed under the same conditions and methods as in Example 1 except for using. As a result, a PCR product of cre gene was obtained.
  • PCR products obtained in Examples 2-1 and 2-2 were mixed and used as templates, except that the primers of GroEF (SEQ ID NO: 3) and CreR (SEQ ID NO: 6) described in Table 1 were used. PCR was performed under the same conditions and methods as in Example 1. As a result, a PCR product was obtained in which the groE promoter gene and the cre gene were fused.
  • Example 1 was used to obtain the KatE1 promoter, except that the primers of pKatF (SEQ ID NO: 7) and pKatR (SEQ ID NO: 8) described in Table 1 were used as templates. PCR was performed under the same conditions and methods. As a result, a PCR product of the KatE1 promoter gene was obtained.
  • pRAD1 plasmid (Meima R. et at., Applied and environmental microbiology 66: 3856-3867, 2000) was used as a template, and CmF (SEQ ID NO: 9) and CmR (described in Table 1 above) PCR was performed under the same conditions and methods as in Example 1, except that the primer of SEQ ID NO: 10) was used. As a result, a PCR product of the KatE1 promoter gene was obtained. As a result, a PCR product of the chloramphenicol resistance gene was obtained.
  • PCR products obtained in Examples 2-4 and 2-5 were mixed and used as a template, except that the primers of pKatF (SEQ ID NO: 7) and CmR (SEQ ID NO: 10) described in Table 1 were used. PCR was performed under the same conditions and methods as in Example 1. As a result, a PCR product of the chloramphenicol resistance gene was obtained.
  • PCR products obtained in Examples 2-3 and 2-6 were mixed and used as templates, except that the primers of GroEF (SEQ ID NO: 3) and CmR (SEQ ID NO: 10) described in Table 1 were used. PCR was performed under the same conditions and methods as in Example 2. As a result, a PCR product was obtained in which the groE promoter gene, cre gene, KatE1 promoter gene, and chloramphenicol resistance gene were fused together.
  • Example 2-7 The PCR product obtained in Example 2-7 was subjected to 13840 plasmid (Nguyen, HH et al . , M olecular microbiology, 73: 240-252 , 2009) the one behind, the ligation produced plasmid was cut with NotI and XhoI (Enzynomics) with was named pAM2 (SEQ ID NO: 21) ( Figure 3).
  • a plasmid including a second selection marker in which the expression of the cre gene was controlled by the KatE1 promoter was prepared under the same conditions and methods as in Example 2.
  • Primer 1, 2, 5, and 6 (SEQ ID NOs: 11, 12, 15, and 16, respectively), using the DNA of Dinococcus radiodurans as a template, the upper region 1 kb and the lower region 1 kb of the DR0861 gene. PCR was performed under the same conditions and methods as in Example 1, except that primers) were used. As a result, 1 kb of PCR products of the upper and lower regions of the DR0861 gene were obtained, respectively.
  • the kanamycin resistance gene including lox71 and lox66 genes at both ends was used except that primers 3 and 4 (SEQ ID NOs: 13 and 14) described in Table 2 were used. PCR was performed under the same conditions and methods as in Example 1. As a result, a PCR product of the kanamycin resistance gene containing lox71 and lox66 genes at both ends was obtained.
  • PCR products obtained in Examples 3-1 and 3-2 were confirmed by electrophoresis on 1% agarose gel, which was purified using a DNA fragment purification kit (Intron lifetechnology), respectively.
  • the purified PCR product was mixed and used as a template, and primers 1 (SEQ ID NO: 11) and Primer 6 (SEQ ID NO: 16) described in Table 2 were used, except that the reaction was carried out at 72 ° C. for 3 minutes in the PCR process.
  • PCR was performed under the same conditions and methods as in Example 1.
  • a PCR product was obtained in which the kanamycin resistance gene including both the upper and lower portions of the DR0861 gene and the lox gene were fused to each other (FIG. 4).
  • the strains of Daynococcus radiodurans (ATCC 13939, Korea Agricultural Genetic Resource Information Center, Korea) were treated with TGY medium (0.5% (w / v) tryptone, 0.1% (w / v) glucose and 0.3% (w) / v) yeast extract) was incubated at a temperature of 30 °C until the value of OD 600 reached 0.5.
  • the cultured cells were centrifuged and suspended in 2x TGY medium containing 30 mM calcium chloride (CaCl 2 ), and the suspension was allowed to stand on ice for 1 hour.
  • the PCR product obtained in Example 3-3 was electrophoresed on a 1% agarose gel and purified using a DNA fragment purification kit (Intron lifetechnology). 10 ⁇ l of purified PCR product, 50 ⁇ l of Denococcus radiodurans cells and 2 ⁇ TGY medium at 50 ° C. containing 30 mM CaCl 2 , mix the mixture for 30 minutes on ice, and then 32 The reaction was carried out for 1.5 hours at °C. After the reaction, 900 ⁇ l of 2 ⁇ TGY medium was added and it was incubated at 30 ° C. for 12 hours.
  • a DNA fragment purification kit Intron lifetechnology
  • the pAM2 plasmid prepared in Example 2 was transformed into the mutant strain which deleted the DR0861 gene prepared in Example 3 by the methods and conditions described in Examples 3-4.
  • To select strains from which the kanamycin resistance gene was removed from the transformed strains they were plated and cultured in 2 ⁇ TGY solid medium containing 3 ⁇ g / ml of chloramphenicol. DNA was extracted from the cultured strains to determine whether the kanamycin resistance gene was deleted by sequencing, and the final selected strain was named DrAM2.
  • a plasmid comprising a mutant strain having a plasmid containing a second selection marker whose expression of cre protein is controlled by the groE promoter prepared in Example 3 and a second selecting marker whose expression of cre protein is controlled by KatE1 promoter
  • the expression level of cre protein in the introduced strain was confirmed by the following method.
  • the second expression in which the expression amount of cre protein generated in the mutant strain into which the plasmid containing the second selection marker in which the expression of cre protein is controlled by the groE promoter is introduced is included is KatE1 promoter. Plasmids containing markers were higher than the introduced strains (FIG. 5).
  • the pAM2 plasmid prepared in Example 2 is a temperature sensitive plasmid and does not replicate in the Deinococcus radiodurance strain at 37 ° C. Therefore, the pAM2 plasmid was removed from the DrAM2 strain by the following method.
  • DrAM2 strain was prepared by incubating for 24 hours using TGY liquid medium at 37 °C.
  • the prepared DrAM2 strain was diluted to a volume ratio of 1: 10,000 in 2x TGY solid medium and plated, which was incubated at 30 ° C for 2 days.
  • Single colonies formed were inoculated in sterile tips into 2x TGY solid medium with kanamycin or chloramphenicol, or 2x TGY solid medium without antibiotics and incubated at 30 ° C. for 1 day. After incubation, single colonies grown only in the medium containing no antibiotics were finally selected and named DrAM3 (FIG. 6).
  • a Denococcus radiodurans mutant strain was prepared in which the DR0862 gene was deleted under the same conditions and methods as described above, except that the DR0862 gene was deleted instead of the DR0861 gene.
  • the liquid medium was prepared by dissolving in purified water and calibrating pH to 6.5.
  • the prepared liquid medium was autoclaved by dispensing 100 ml into three 500 ml Erlenmeyer flasks, and 1 ml of the mutant strain prepared in Example 6, the mutant strain prepared in Comparative Example 2, or the wild type in sterile liquid medium. Daynococcus radiodurans strains were inoculated. The strain was incubated for 72 hours at 30 °C, 200 rpm conditions.
  • the culture solution was centrifuged at 4 ° C. and 4,000 rpm to recover the powdered cells, and 1 ml of ethyl acetate was added thereto and stirred.
  • the suspension obtained by stirring for 15 minutes was filtered under reduced pressure using a filter paper having a pore size of 0.45 ⁇ m and evaporated to obtain a culture residue.
  • the production amount of phytoene was analyzed by HPLC using the Daynococcus radiodurans strain from which the DR0861 gene obtained in Experimental Example 1-1 was deleted, and the residues obtained from the wild type Daynococcus radiodurance strain.
  • a silica gel plate (TLC silica gel 60, MERCK) for TLC analysis was prepared in a size of 5 ⁇ 6.5 cm.
  • the culture residue obtained in Experimental Example 1-1 was applied to a baseline positioned on the fixed plate of the prepared plate. At this time, the baseline was positioned about 1 to 3 cm away from the bottom of the plate, the sample was applied in the form of spots.
  • the TCL plate to which the sample was applied was fixed to the developing chamber so that the lower end thereof contacted the developing solvent, and the baseline was installed so as not to contact the developing solvent. Thereafter, the lid of the development chamber was closed to close the development chamber, and the development was completed, and the development was terminated when the development solvent was developed up to 1 cm away from the plate. After completion of development, the plate was heated by evaporating all of the developing solvent, applying 10% sulfuric acid, and placing on a hotplate at 120 ° C until a separated sample was identified.
  • a plasmid overexpressing the DR0862 ( crtB ) gene which is well known as a rate-limiting enzyme, was transformed into a Deinococcus radiodurans strain lacking the DR0861 gene, resulting in the deletion of the DR0861 gene and overexpression of the DR0862 gene. Daynococcus radiodurans mutant strains were prepared.
  • the DR0862 gene was 0.5 ⁇ L of primers of each of dr0862F1 (SEQ ID NO: 23) and dr0862R1 (SEQ ID NO: 24) described in Table 3 below, and the AccuPower TM pfu PCR premix mix (Bioneer) using the Denococcus radiodurance gene as a template.
  • a PCR was carried out under the same conditions and methods as in Example 1 except for using).
  • the obtained PCR product was confirmed by electrophoresis on 1% agarose gel, which was purified using a DNA fragment purification kit (Intron lifetechnology).
  • the purified PCR product and the pRADZ3 plasmid (Meima R. and Lidstrom ME, Applied environmental microbiology, 66: 3856-3867) were digested with SpeI and NotI restriction enzymes, respectively, and ligated to the DR0862 gene beneath the groE promoter present in pRADZ3.
  • the plasmid was prepared so that it was expressed (FIG. 9).
  • Example 6 By transforming the prepared plasmid into the strain lacking the DR0861 gene prepared in Example 6 in the same manner and conditions as in Example 3-4, the Denococcus radiodurans mutant strain in which the DR0861 gene was deleted and the DR0862 gene was overexpressed was prepared.
  • Example 8 The DR0861 gene is deleted, DR1087 Preparation of Deinococcus radiodurans mutant strain overexpressed gene
  • Daynococcus radiodurans a strain of Dayococcus radiodurans that lacks the DR0861 gene, was transformed into a plasmid that overexpresses the DR1087 ( idi ) gene, a well known rate limiting enzyme, resulting in the deletion of the DR0861 gene and overexpression of the DR1087 gene. Mutant strains were prepared. The experiment was performed under the same conditions and methods as in Example 7, except that the dr1087F1 (SEQ ID NO: 25) and dr1087R1 (SEQ ID NO: 26) primers described in Table 3 above were used to obtain the DR1087 gene. As a result, a Denococcus radiodurans mutant strain in which the DR0861 gene was deleted and the DR1087 gene was overexpressed was prepared.
  • Daynococcus radiodurans a strain of Deinococcus radiodurans that lacks the DR0861 gene, was transformed into a plasmid that overexpresses the DR1395 ( crtE ) gene, a well known rate limiting enzyme, resulting in the deletion of the DR0861 gene and overexpression of the DR1395 gene. Mutant strains were prepared. The experiment was performed under the same conditions and methods as in Example 7, except that the dr1395F1 (SEQ ID NO: 27) and dr1395R1 (SEQ ID NO: 28) primers described in Table 3 above were used to obtain the DR1395 gene. As a result, a Denococcus radiodurans mutant strain in which the DR0861 gene was deleted and the DR1395 gene was overexpressed was prepared.
  • Daynococcus radiodurans a gene that has been deleted from the DR0861 gene, was transformed into a plasmid that overexpresses the DR1475 ( dxs ) gene, which is well known as a rate-limiting enzyme, resulting in the deletion of the DR0861 gene and overexpression of the DR1475 gene. Mutant strains were prepared. The experiment was performed under the same conditions and methods as in Example 7, except that the dr1475F1 (SEQ ID NO: 29) and dr1475R1 (SEQ ID NO: 30) primers described in Table 3 above were used to obtain the DR1475 gene. As a result, a Denococcus radiodurans mutant strain in which the DR0861 gene was deleted and the DR1475 gene was overexpressed was prepared.
  • Example 11 Preparation of the Deinococcus radiodurans mutant strain with the deletion of the DR0861 gene and overexpression of the DR0862 and DR1087 genes.
  • the Deinococcus radiodurans mutant strain in which the DR0861 gene was deleted and the DR0862 and DR1087 genes were overexpressed was prepared by the following method.
  • PCR was performed using primers. Specifically, PCR was performed by adding a pfu polymerase mix (Bioneer) to a mixture of 1 ⁇ l DNA template, 1 ⁇ l each of primer, and 17 ⁇ l of sterile distilled water, followed by T-100 Thermal cycler DNA amplifier (Bio-rad). ) Was performed. PCR was performed by reacting at 95 ° C. for 5 minutes, repeating 30 times with one reaction of 95 ° C. 30 seconds, 60 ° C. 30 seconds, and 72 ° C. for 1 minute.
  • the obtained PCR product was confirmed by electrophoresis on 1% agarose gel, which was purified using a DNA fragment purification kit (Intron lifetechnology).
  • the pRADZ3 plasmid containing the purified PCR product and the DR0862 gene prepared in Example 7 was digested with NotI and SalI restriction enzymes, and then ligated to express the groE promoter and DR1087 genes below the DR0862 gene included in pRADZ3.
  • the DR0861 gene was deleted, and the Denococcus radiodurans overexpressed the DR0862 and DR1087 genes. Mutant strains were prepared.
  • Example 12 Preparation of a Daynococcus radiodurance mutant strain with deletion of the DR0861 gene and overexpression of the DR0862 and DR1395 genes.
  • a Daynococcus radiodurans mutant strain was prepared in which the DR0861 gene was deleted and the DR0862 and DR1395 genes were overexpressed.
  • the experiment was carried out using the pRADZ3 plasmid containing the DR1395 gene prepared in Example 9 as a template, except that the groF (SEQ ID NO: 31) and dr1395R2 (SEQ ID NO: 33) primers described in Table 4 were used. It was carried out under the same conditions and methods as 11.
  • a Denococcus radiodurance mutant strain in which the DR0861 gene was deleted and the DR0862 and DR1395 genes were overexpressed was prepared.
  • Example 13 Preparation of the Daynococcus radiodurans mutant strain with deletion of the DR0861 gene and overexpression of the DR0862 and DR1475 genes
  • a Daynococcus radiodurance mutant strain was prepared in which the DR0861 gene was deleted and the DR0862 and DR1475 genes were overexpressed.
  • the experiment was carried out using the pRADZ3 plasmid containing the DR1475 gene prepared in Example 10 as a template, except that the groF (SEQ ID NO: 31) and dr1475R2 (SEQ ID NO: 34) primers described in Table 4 were used. It was carried out under the same conditions and methods as 11 (Fig. 10).
  • a Denococcus radiodurance mutant strain in which the DR0861 gene was deleted and the DR0862 and DR1475 genes were overexpressed was prepared.
  • a culture medium containing a composition as described in Table 5 below was corrected to pH 7.0, and prepared by autoclaving.
  • the prepared 50 ml culture medium was placed in a 250 ml Erlenmeyer flask, and 500 ⁇ l of each of the Daynococcus radiodurans mutant strains prepared in Examples 6 to 13 was inoculated.
  • the strain was incubated for 72 hours at 30 °C, 200 rpm conditions.
  • chloramphenicol at a concentration of 3 ⁇ g / ml was added to the culture medium of the strains prepared in Examples 7 to 13.
  • the culture solution was centrifuged at 4 ° C. and 4,000 rpm for 15 minutes to recover cells, and the supernatant was removed.
  • the cells were washed by adding tertiary distilled water to the recovered cells, and the cells were suspended by adding 3 ml of an organic solvent in which methanol and acetone were mixed at a volume ratio of 2: 7.
  • the suspended cells were allowed to stand at room temperature for 15 minutes to allow phytoene to be extracted from the cells. After 15 minutes, the suspended cells were centrifuged for 15 minutes at 4 ° C. and 4,000 rpm to obtain a supernatant.
  • the obtained 1 ml supernatant was filtered using a filter paper having a pore size of 0.2 ⁇ m, whereby a solvent containing phytoene was finally obtained.
  • the amount of phytoene produced was analyzed by HPLC in the same manner as in Experimental Example 1-2, using the residue obtained from the Daynococcus radiodurans mutant strains prepared in Examples 6 to 13 obtained in Experimental Example 2-1. .
  • 15-cis-pytoene > 95%, Toronto Research Chemical
  • Fig. 13 shows the phytoene production amount of the Deinococcus radiodurans mutant strains prepared in Examples 6 to 13, calculated using the prepared calibration curve.
  • the mutant strain of Example 6 produced a higher amount of phytoene in the mutant strains prepared in Examples 7 to 13 as compared to 0.34 ⁇ 0.15 mg / L of phytoene production. It was. In particular, among the mutant strains that overexpress one gene, the mutant strain of Example 7 (dr0862 + ) produced the largest amount of phytoene (1.85 ⁇ 0.18 mg / L). On the other hand, among the mutant strains overexpressing the two genes, the mutant strain of Example 13 (dr0862 + , dr1475 + ) produced the highest amount of phytoene (3.25 ⁇ 0.21 mg / L) (FIG. 13).
  • phytoene production increased rapidly after 24 hours of culture, and reached a peak at 72 hours (3.71 ⁇ 0.1 mg / L), and then decreased slightly afterwards (FIG. 14).
  • Example 14 Preparation of a Daynococcus radiodurance mutant strain with deletions of the DR0861 and DR2250 genes and overexpressing the DR0862 and DR1475 genes
  • PCR was performed under the same conditions and methods as in Example 1, except that the upper region 1 kb and the lower region 1 kb of the DR2250 gene were used in the following Table 6, respectively, and the upper and lower regions of the DR2250 gene were Each 1 kb PCR product was obtained.
  • the obtained PCR product was linked to the kanamycin resistance gene in the same manner as described in Examples 3-2 and 3-3, and used in Example 3-4 using the mutant strain from which the DDR0861 gene prepared in Example 6 was deleted.
  • Mutant strains with deletions of the DR0861 and DR2250 genes were prepared under the same conditions and methods as described. Plasmids comprising the DR0862 and DR1475 genes were transformed into the prepared strains in the same manner as described in Examples 3-4, and finally, the Denococcus radiodue, in which the DR0861 and DR2250 genes were deleted, and the DR0862 and DR1475 genes were overexpressed. Preparation of Lance variant strains.
  • Example 3-4 The same conditions as described in Example 3-4 using the PCR product comprising the kanamycin resistance gene obtained in Example 14 and the upper and lower regions of the DR2250 gene and the mutant strain deleted with the DR0861 gene prepared in Example 6, and By using the method, the Deinococcus radiodurance mutant strains in which the DR0861 and DR2250 genes were deleted were prepared.
  • the mutant strains prepared in Examples 6, 13, 14 and Comparative Example 3 were used to confirm the effect of phytoene production under the same conditions and methods as described in Experimental Example 2. As a result, the phytoene production amount of the mutant strains prepared in Example 6, Example 13, Example 13 and Comparative Example 3 is shown in Figure 15.
  • the variant strains of Examples 13 and 14 showed higher phytoene production.
  • the mutant strain of Example 14 (4.5 ⁇ 0.2 mg / L) phytoene production was increased by about 21% than the mutant strain of Example 13 (3.5 ⁇ 0.24 mg / L) (Fig. 15).
  • the mutant strain of Example 13 was used to produce the most phytoene at 72 hours of culture similarly to the result of confirming the amount of phytoene production over time (Fig. 16).
  • 17 shows the results of comparing and analyzing the growth curve of the strain, the consumption ratio of the carbon source used during the growth, and the amount of phytoene produced.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명을 파이토엔 고생산능을 갖는 변이 균주의 제조방법 및 상기 방법으로 제조된 변이 균주에 관한 것이다. 구체적으로, 본 발명의 방법으로 제조된 파이토엔 고생산능을 갖는 데이노코쿠스 라디오두란스 변이 균주는 대사공학적 방법을 도입하여 제조되었음에도 인위적으로 도입된 항생제 내성 유전자를 갖지 않고, 파이토엔을 생산능이 우수함으로써, 상기 방법으로 제조된 변이 균주는 파이토엔의 대량생산에 유용하게 사용될 수 있다.

Description

파이토엔 고생산능을 갖는 변이 균주의 제조방법 및 상기 방법으로 제조된 변이 균주
본 발명을 파이토엔 고생산능을 갖는 변이 균주의 제조방법 및 상기 방법으로 제조된 변이 균주에 관한 것이다.
미생물 대사공학은 미생물 등의 유전체를 개량하여 원하는 목적에 맞게 활용하는 기술이다. 유용 대사산물은 미생물의 유전정보와 대사회로로부터 얻을 수 있으며, 미생물 유전자의 조작을 통해서 더 유용한 대사물질이나 그 특성을 개선시킬 수 있는 기술들이 개발되고 있다. 특히, 대사공학분야에서 Flp/FRT 및 cre/lox와 같은 위치-특이적 재조합 기술은 식물, 효모, 미생물과 같은 다양한 생명체 모델에 적용되고 있다.
한편, 데이노코쿠스 라디오두란스는 생물체의 DNA 또는 단백질에 직접 손상을 입할 수 있는 이온화 방사선에 대해 내성을 갖는 것으로 알려져 있다. 상기 균주는 이온화 방사선에 의한 DNA 손상을 빠른 시간 내에 복구할 수 있고, 효소적 또는 비효소적 시스템에 의하여 세포 내에 생성된 활성산소종(ROS)를 효과적으로 제거할 수 있는 능력을 지니고 있다. 이와 같은 특성 때문에 데이노코쿠스 라디오두란스는 방사성 폐기물의 정화에 사용되고 있다. 또한, 의약, 보건, 생명공학 등의 다양한 분야에서 데이노코쿠스 라디오두란스를 적용한 기술의 사례가 증가할 것으로 전망된다.
현재까지 보고된 바에 의하면, 데이노코쿠스 라디오두란스의 대사공학적 제어를 위해, 다른 미생물의 유전자를 세포 내로 도입시키거나, 상동적 재조합 방법을 이용한 돌연변이 균주의 제작 기술이 고안되었다. 그러나, 이러한 돌연변이 제작 기술은 반복적인 유전자 클로닝 과정으로 인해 많은 시간이 소요될뿐만 아니라, 돌연변이 균주를 선별하기 위한 항생제 마커의 제한성으로 다중 돌연변이 균주를 제작하는데 어려움이 있다.
한편, 카로티노이드는 항산화 활성을 가지고 있는 C-40 이소프레노이드 화합물로서, 자연계에 널리 분포되어 있는 한 군의 색소의 총칭이다. 현재까지 알려진 카로티노이드는 6백여 종에 이르며, 이들은 각각 다른 형태로 존재한다. 최근 카로티노이드의 생합성에 관여하는 효소들을 코딩하는 유전자들이 연구되어 왔다. 그 결과, 많은 카로티노이드 생합성과 연관된 효소를 암호화하는 유전자 및 cDNA가 박테리아, 조류, 균주와 담배, 토마토, 고추와 같은 고등식물에서 특성이 발견되었다. 이와 같은 카로티노이드의 중요성 때문에 고등식물에서 카로티노이드 생합성에 관련된 효소를 암호화하는 유전자에 대한 연구가 주목받고 있다. 카로티노이드의 하나인 파이토엔(phytoene)은 피부 미백에 효과적인 성분으로 알려져 있어, 자외선 흡수제, 산화 방지제 및 소염제 등으로 사용된다.
이와 관련하여, 대한민국 등록특허 제10-0813284호는 아그로박테리움-형질전환 방법으로 형질전환된 유채 식물체에서 감귤의 파이토엔 생합성효소(PSY) 유전자를 연속적으로 발현시키면 카로티노이드 성분의 생성이 증가함을 개시하고 있다.
이에, 본 발명자들은 대사공학적 방법을 도입하여 파이토엔을 고생산할 수 있는 데이노코커스 속 균주를 제조하기 위해 노력하던 중, cre-lox 시스템을 변형시켜 DR0861 유전자가 결실된 데이노코커스 라디오두란스의 변이 균주, DR0861 유전자가 결실되고 DR0862, DR1087, DR1395 또는 DR1475 유전자가 과발현된 데이노코커스 라디오두란스의 변이 균주, 및 DR0861 및 DR2250 유전자가 결실되고 DR0862 및 DR1475 유전자가 과발현된 데이노코커스 라디오두란스의 변이 균주를 제조하고, 상기 변이 균주가 우수한 파이토엔 생성능이 있음을 확인함으로써, 본 발명을 완성하였다.
본 발명의 목적은 cre-lox 시스템을 이용하여 DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주를 제조하는 방법 및 상기 방법으로 제조된 변이 균주를 제공하는 것이다.
본 발명의 다른 목적은 상기 변이 균주를 이용하여 파이토엔을 생산하는 방법을 제공하는 것이다.
상기 목적을 달성하기 위해, 본 발명은 제1 선택마커를 포함하는 lox 핵산 단편의 양 말단에 DR0861 유전자의 상부 및 하부 단편이 각각 융합된 DNA 구조체를 데이노코쿠스 속 균주에 도입하여 DR0861 유전자를 결실시키는 단계; 상기 DR0861 유전자가 결실된 균주에 groE 프로모터, cre 재조합 효소를 코딩하는 유전자, 제2 선택마커 및 온도 감수성 repUts를 포함하는 벡터를 도입하여 제1 선택마커를 결실시키는 단계; 및 상기 수득된 변이 균주를 배양하여 제2 선택마커를 포함하는 벡터를 제거하는 단계를 포함하는, cre-lox 시스템을 이용한 DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법을 제공한다.
또한, 본 발명은 상기 방법으로 제조된 DR0861 유전자가 결실된 파이토엔 생산능을 갖는 데이노코쿠스 속 변이 균주를 제공한다.
또한, 본 발명은 상기 변이 균주를 배양하는 단계를 포함하는 파이토엔 생산 방법을 제공한다.
본 발명의 방법으로 제조된 파이토엔 고생산능을 갖는 데이노코쿠스 라디오두란스 변이 균주는 대사공학적 방법을 도입하여 제조되었음에도 인위적으로 도입된 항생제 내성 유전자를 갖지 않고, 파이토엔을 생산능이 우수함으로써, 상기 방법으로 제조된 변이 균주는 파이토엔의 대량생산에 유용하게 사용될 수 있다.
도 1a는 pAM1 플라스미드의 제조 과정을 도식화한 그림이다.
도 1b는 pAM2 플라스미드의 제조 과정을 도식화한 그림이다.
도 2는 제조된 pAM1 플라스미드의 구조를 도식화한 그림이다.
도 3은 제조된 pAM2 플라스미드의 구조를 도식화한 그림이다.
도 4는 데이노코쿠스 라디오두란스 균주의 유전체에서 DR0861 유전자를 결실시키는 과정을 도식화한 그림이다.
도 5는 cre 유전자의 발현을 조절하는 플라스미드에 따른 cre 재조합 효소의 발현량을 확인한 결과이다.
도 6은 항생제 내성 유전자가 모두 제거되고, DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 변이 균주를 선별한 결과 사진이다.
도 7a는 본 발명의 방법에 따라 제조된 DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 변이 균주의 파이토엔 생성능을 HPLC로 확인한 그래프이다.
도 7b는 본 발명의 방법에 따라 제조된 DR0861 유전자가 결실된 데이토코쿠스 라디오두란스 변이 균주의 파이토엔 생성량을 야생형 균주와 비교하여 나타낸 그래프이다.
도 8은 본 발명의 방법에 따라 제조된 DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 변이 균주의 파이토엔 생성능을 TLC로 확인한 그래프이다(STD: 표준품의 파이토엔; DC: 야생형의 데이노코쿠스 라디오두란스; ΔDR0861: DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 변이 균주; ΔDR0862: DR0862 유전자가 결실된 데이노코쿠스 라디오두란스 변이 균주).
도 9는 DR0862 유전자를 발현하는 플라스미드의 구조를 도식화한 그림이다.
도 10은 DR0862 및 DR1475 유전자를 동시에 발현하는 플라스미드의 구조를 도식화한 그림이다.
도 11은 표준품의 15-cis-파이토엔을 이용하여 작성된 검량선 그래프이다.
도 12는 표준품의 15-cis-파이토엔을 이용하여 수행된 HPLC 결과 크로마토그램이다.
도 13은 실시예 6 내지 13에서 제조된 변이 균주의 파이토엔 생성량을 HPLC로 확인하여 정량화한 그래프이다(None: 실시예 6; dr0862+: 실시예 7; dr1087+: 실시예 8; dr1395+: 실시예 9; dr1475+ 실시예 10; dr0862+, dr1087+: 실시예 11; dr0862+, dr1395+: 실시예 12; dr0862+, dr1475+: 실시예 13).
도 14는 실시예 13에서 제조된 변이 균주의 파이토엔 생성량을 시간별로 확인한 결과 그래프이다.
도 15는 실시예 6, 13, 14 및 비교예 3에서 제조된 변이 균주의 파이토엔 생성량을 HPLC로 확인하여 정량화한 그래프이다(Δdr0861: 실시예 6; Δdr0861, Δdr2250: 비교예 3; Δdr0861, dr0862+, dr1475+: 실시예 13; Δdr0861, Δdr2250, dr0862+, dr1475+: 실시예 14).
도 16은 실시예 14에서 제조된 변이 균주의 파이토엔 생성량을 시간별로 확인한 결과 그래프이다.
도 17은 실시예 14에서 제조된 변이 균주의 파이토엔 생성량을 균주의 성장곡선 및 배양 배지에 포함되는 탄소원의 소모비와 비교 분석한 결과 그래프이다.
이하, 본 발명을 상세히 설명한다.
본 발명은 제1 선택마커를 포함하는 lox 핵산 단편의 양 말단에 DR0861 유전자의 상부 및 하부 단편이 각각 융합된 DNA 구조체를 데이노코쿠스 속 균주에 도입하여 DR0861 유전자를 결실시키는 단계; 상기 DR0861 유전자가 결실된 균주에 groE 프로모터, cre 재조합 효소를 코딩하는 유전자, 제2 선택마커 및 온도 감수성 repUts를 포함하는 DNA 벡터를 도입하여 제1 선택마커를 결실시키는 단계; 및 상기 수득된 변이 균주를 배양하여 제2 선택마커를 포함하는 벡터를 제거하는 단계를 포함하는, cre-lox 시스템을 이용한 DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법을 제공한다.
본 명세서에서 사용된 용어, "cre-lox 시스템"은 DNA의 특정 부위에서 결실, 삽입, 전좌 및 역위를 수행하는데 사용되는 위치특이적 재조합 효소기술을 의미한다. 상기 cre-lox 시스템은 진핵 및 원핵 생물의 유전자로부터 돌연변이를 유발시키는데 사용가능하다. 이는 단일 효소인 cre 재조합 효소로 구성되어 있고, 짧은 표적 서열인 lox 서열을 재조합한다. 돌연변이를 유발시키고자 하는 위치에 lox 서열을 적절히 배치함으로써, 표적 유전자가 활성화 또는 억제되거나, 다른 유전자와 치환될 수도 있다. 일반적으로 lox P는 34개의 염기로 구성된 박테리오파지 P1 부위로 비대칭인 8 bp의 염기 서열을 포함하고, 중앙에 2개의 염기를 제외하고는, 13 bp 크기인 2쌍의 회문구조(palimdromic)를 갖는다(ATAACTTCGTATA-NNNTANNN-TATACGAAGTTAT).
본 명세서에서 사용된 용어, "선택 마커"는 특정 유전자의 산물을 의미한다. 상기 산물을 포함하는 미생물은 이를 포함하지 않는 미생물에는 나타나지 않는 특별한 형질을 가짐으로써, 이에 의해 미생물의 구별을 가능하게 한다. 상기 선택 마커는 항생제 내성 유전자일 수 있다. 상기 항생제 내성 유전자는 카나마이신, 클로람페니콜, 스펙티노마이신 및 스트렙토마이신으로 구성된 군으로부터 선택되는 어느 하나 이상, 구체적으로, 카나마이신 및 클로람페니콜로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있다.
상기 데이노코쿠스 속 균주는 데이노코쿠스 라디오두란스(D. radiodurans), 데이노코쿠스 인디쿠스(D. indicus), 데이노코쿠스 카에니(D. caeni), 데이노코쿠스 아쿠아티쿠스(D. aquaticus), 데이노코쿠스 디폴리머란스(D. depolymerans), 데이노코쿠스 그란디스(D. grandis), 데이노코쿠스 데죠네시스(D. daejeonensis), 데이노코쿠스 라디오톨러란스(D. radiotolerans), 데이노코쿠스 지오써말리스(D. geothermalis), 데이노코쿠스 루버(D. ruber), 데이노코쿠스 안타티커스(D. antarcticus), 데이노코쿠스 프로테오리티쿠스(D. proteolyticus), 데이노코쿠스 라디오푸그난스(D. radiopugnans), 데이노코쿠스 라디오필러스(D. radiophilus), 데이노코쿠스 셀룰로실리티쿠스(D. cellulosilyticus) 및 데이노코쿠스 스웬시스(D. swuensis)로 구성된 군으로부터 선택되는 어느 하나 이상, 구체적으로는 데이노코쿠스 라디오두란스일 수 있다.
본 발명은 제1 선택마커를 포함하는 lox 핵산 단편의 양 말단에 DR0861 유전자의 상부 및 하부 단편이 각각 융합된 DNA 구조체를 데이노코쿠스 속 균주에 도입하여 DR0861 유전자를 결실시키는 단계를 제공한다.
본 명세서에서 사용된 용어, "DR0861" 유전자는 파이토엔의 C11 및 C11' 위치에 이중 결합을 도입하여 파이토엔을 제타-카로텐(ξ-carotene)으로 전환하는 역할을 하는, 파이토엔 탈수소효소(dehydrogenase)를 암호화하는 유전자이다. 상기 파이토엔 탈수소효소는 파이토엔 불포화효소로도 불린다. 상기 DR0861 유전자는 통상의 기술분야에 알려진 어떠한 서열로 구성되는 폴리뉴클레오티드일 수 있다. 구체적으로, 상기 DR0861 유전자는 서열번호 22의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
상기 DR0861 유전자의 상부 및 하부 단편은 전장의 DR0861 유전자 서열에서 5' 또는 3' 말단으로부터 0.5 내지 1.2 kb, 구체적으로 0.6 내지 1.1 kb, 더욱 구체적으로 0.7 내지 1.0 kb의 길이를 포함할 수 있다. 상기 단편은 데이노코쿠스 속 균주의 유전체에 존재하는 DR0861 유전자와의 상동재조합을 위해 포함될 수 있다.
본 명세서에서 사용된 용어, "lox 핵산 단편"은 cre-lox 시스템을 이용하여 데이노코쿠스 라디오두란스 균주의 유전체로부터 원하는 유전자를 제거하기 위한 단편으로서, 본 발명의 일 실시예에 따르면, 상기 lox 핵산 단편은 lox 단편을 양 말단에 갖는 제1 선택마커를 포함할 수 있다. 상기 lox 핵산 단편은 lox71 및 lox66으로 구성된 군으로부터 선택되는 어느 하나 이상의 lox 유전자를 단편의 양 말단에 포함할 수 있다. 구체적으로, 상기 lox 핵산 단편은 서열번호 17의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
또한, 본 발명은 상기 DR0861 유전자가 결실된 균주에 groE 프로모터, cre 재조합 효소를 코딩하는 유전자, 제2 선택마커 및 온도 감수성 repUts를 포함하는 벡터를 도입하여 제1 선택마커를 결실시키는 단계를 제공한다.
상기 groE 프로모터는 cre 재조합 효소와 작동가능하게 연결될 수 있다. 상기 용어, "작동가능하게 연결된"은 핵산의 발현을 조절하는 서열과 목적하는 단백질을 코딩하는 핵산 서열이 가능적으로 연결되어 있는 것을 의미한다. 재조합 벡터의 제조에서 작동가능하게 연결하는 것은 통상의 기술자에 의해 잘 알려진 방법으로 수행될 수 있다. 상기 groE 프로모터는 groES 유전자(NCBI GeneBank ID: 1800077)의 상위(upstream) 부분의 299 bp를 포함하는 폴리뉴클레오티드, 구체적으로 서열번호 18의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
한편, 상기 제2 선택마커는 Kat 프로모터와 작동가능하게 연결될 수 있다. 이때, 상기 Kat 프로모터는 KatE1 유전자(NCBI GeneBank ID: 1800077)의 상위(upstream) 부분의 138 bp를 포함하는 폴리뉴클레오티드, 구체적으로 서열번호 19의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
본 명세서에서 사용된 용어, "온도 감수성 repUts"는 특정 범위의 온도 내에서만 플라스미드가 복제가 가능하게 하는 유전자인 repU 유전자를 의미한다(H. H. Nguyen et al ., Molecular Microbiology, 2009, 73(2), 240-252). 상기 유전자를 포함하는 플라스미드는 28℃의 배양 온도에서는 복제되어 숙주세포 내에서 플라스미드의 유지를 가능하게 하지만, 37℃의 배양 온도에서는 상기 플라스미드가 복제되지 않아 숙주세포 내에서 제거된다. 상기 repU 유전자 및 이를 포함하는 플라스미드는 통상의 기술분야에 잘 알려져 있다.
상기 제1 선택마커를 결실시키는 단계는 제1 선택마커의 양 말단에 결합한 lox 유전자가 cre 재조합 효소에 의해 인식되어 이들 부위를 절단함으로써, 제1 선택마커를 데이노코쿠스 속 균주의 유전체로부터 제거할 수 있다.
상기 단계에서 groE 프로모터, cre 재조합 효소를 코딩하는 유전자, 제2 선택마커 및 온도 감수성 repUts를 포함하는 벡터는 서열번호 21의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
또한, 본 발명은 상기 수득된 변이 균주를 배양하여 제2 선택마커를 포함하는 벡터를 제거하는 단계를 제공한다.
상기 제2 선택마커의 제거는, 온도 감수성 마커인 repUts에 의하여 제2 선택마커를 포함하는 벡터가 특정 온도 범위 내에서는 복제되지 않는 특성을 사용할 수 있다. 따라서, 상기 단계는 변이 균주를 특정 온도 범위 내에서 일정 기간 동안 배양함으로써 제2 선택마커를 포함하는 벡터를 제거할 수 있다. 구체적으로, 상기 배양을 위한 온도는 30 내지 40℃, 구체적으로 31 내지 39℃, 더욱 구체적으로 33 내지 38℃일 수 있다.
상기 단계에 따라 수득된 변이 균주는 제1 및 제2 선택마커가 모두 제거됨으로써 항생제가 포함된 배지에서는 성장하지 못하는 특성에 기초하여 선별될 수 있다.
또한, 본 발명은 DR0862, DR1087, DR1395 및 DR1475로 구성된 군으로부터 선택되는 어느 하나 이상의 유전자를 각각 발현하는 플라스미드를 도입하는 단계를 추가로 포함할 수 있다.
본 명세서에서 사용된 용어, "DR0862" 유전자는 파이토엔 합성효소(phytoene synthase)를 암호화하는 유전자로서, 상기 파이토엔 합성효소는 전구체인 제라닐제라닐 파이로포스페이트(geranylgeranyl pyrophosphate)를 기질로 하여 파이토엔을 합성할 수 있다. 상기 DR0862 유전자는 통상의 기술분야에 알려진 어떠한 서열로 구성되는 폴리뉴클레오티드일 수 있다. 구체적으로, 상기 DR0862 유전자는 서열번호 41의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
본 명세서에서 사용된 용어, "DR1087" 유전자는 이소펜테닐 파이로포스페이트 이성화효소(isopentenyl pyrophosphate isomerase)를 암호화하는 유전자로서, 이소펜테닐 파이로포스페이트를 디메틸알릴 파이로포스페이트(demethylally pyrophosphate)로 이성질화할 수 있다. 상기 DR1087 유전자는 통상의 기술분야에 알려진 어떠한 서열로 구성되는 폴리뉴클레오티드일 수 있다. 구체적으로, 상기 DR1087 유전자는 서열번호 42의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
본 명세서에서 사용된 용어, "DR1395" 유전자는 제라닐제라닐 파이로포스페이트 합성효소(geranylgeranyl pyrophosphate synthase)를 암호화하는 유전자로서, 파네실 파이로포스페이트(fanesyl pyrophosphate)를 기질로 사용하여 제라닐제라닐 파이로포스페이트를 합성할 수 있다. 상기 DR1395 유전자는 통상의 기술분야에 알려진 어떠한 서열로 구성되는 폴리뉴클레오티드일 수 있다. 구체적으로, 상기 DR1395 유전자는 서열번호 43의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
본 명세서에서 사용된 용어, "DR1475" 유전자는 1-디옥시-D-자일룰로스-5-포스페이트 합성효소(1-deoxy-D-xylulose-5-phosphate synthase)를 암호화하는 유전자로서, 파이루베이트(pyruvate) 및 글루코즈-3-포스페이트(glucose-3-phosphate)를 기질로 사용하여 1-디옥시-D-자일룰로스-5-포스페이트를 합성할 수 있다. 상기 DR1475 유전자는 통상의 기술분야에 알려진 어떠한 서열로 구성되는 폴리뉴클레오티드일 수 있다. 구체적으로, 상기 DR1475 유전자는 서열번호 44의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
구체적으로, 본 발명에 따른 방법은 DR0862, DR1087, DR1395 또는 DR1475 유전자를 하나, 둘 또는 그 이상으로 발현하는 플라스미드를 추가로 도입하는 것을 포함할 수 있다. 이때, 상기 도입은 하나, 둘 또는 그 이상의 유전자가 각각 발현되도록 제작된 플라스미드를 사용하여 수행되거나, 또는 하나의 유전자를 발현하는 각각의 플라스미드를 하나, 둘 또는 그 이상 사용하여 수행될 수 있다. 한 균주에서 하나, 둘 또는 그 이상의 유전자를 과발현하도록 조작하는 방법은 통상의 기술분야에 잘 알려져 있다.
상기 DR0862, DR1087, DR1395 및 DR1475로 구성된 군으로부터 선택되는 어느 하나 이상의 유전자를 각각 발현하는 플라스미드는 통상의 기술분야에 잘 알려진 방법에 따라 제조될 수 있다. 상기 제조된 플라스미드를 균주에 도입하는 방법 또한 통상의 기술자에 의해 적절히 수행될 수 있다.
또한, 본 발명은 DR2250 유전자를 결실시키는 단계를 추가로 포함할 수 있다.
본 명세서에서 사용된 용어, "DR2250" 유전자는 카로테노이드 3',4' 불포화 효소(carotenoid 3',4' desaturase)인 메톡시뉴로스포렌 탈수소효소(methoxyneurosporene dehydrogenase)를 암호화하는 유전자로서, 상기 메톡시뉴로스포렌 탈수소효소는 카로테노이드의 C3' 및 C4' 위치에 이중결합을 도입할 수 있다. 상기 DR2250 유전자는 통상의 기술분야에 알려진 어떠한 서열로 구성되는 폴리뉴클레오티드일 수 있다. 구체적으로, 상기 DR2250 유전자는 서열번호 45의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
상기 DR2250 유전자를 결실시키는 방법은 통상의 기술분야에 알려진 어떠한 방법으로도 수행될 수 있다. 일례로, DR2250 유전자의 결실은 상술한 DR0861 유전자를 결실시키는 방법과 동일한 방법으로 수행될 수 있다.
본 발명의 방법에 따른 폴리뉴클레오티드는 암호화하고 있는 단백질의 기능에 영향을 미치지 않는 범위 내에서, 염기의 결실, 삽입, 치환 또는 추가에 의해 상이한 서열을 갖는 변이체 또는 단편을 포함할 수 있다. 또한, 상기 유전자는 공지된 염기서열로 구성되는 폴리뉴클레오티드와 70%, 80%, 90%, 95% 또는 99% 이상의 상동성을 가질 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 lox 단편을 양 말단에 포함하고, 제1 선택마커로서 클로람페니콜을 포함하는 플라스미드를 제조하였다(도 1a 참조). 또한, groE 프로모터에 의해 cre 유전자의 발현이 조절되는 제2 선택마커를 포함하고, 온도 감수성 repUts를 포함하는 플라스미드를 제조하였다(도 1b 참조).
상기 제1 선택마커를 포함하는 DNA 구조체에 표적 유전자인 DR0861 유전자의 상부 및 하부 단편을 융합시키고, 이를 먼저 데이노코쿠스 라디오두란스 균주에 도입하여 DR0861 유전자가 결실된 균주를 선별하였다(도 4 참조). 상기 선별된 균주로부터 제1 선택마커를 제거하기 위해 cre 재조합 효소를 발현하는 제2 선택마커를 포함하는 벡터를 도입하고, 제1 선택마커가 제거된 균주를 선별하였다. 또한, 제1 선택마커가 제거된 균주에서 제2 선택마커를 제거하기 위해, 상기 균주를 37℃의 온도에서 배양한 뒤, 배양된 균주 중에서 항생제가 포함되지 않은 배지에서만 성장하는 균주를 선별함으로써, 모든 선택마커가 제거되고 DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 균주를 선별하였다(도 6 참조).
또한, 본 발명자들은 상기 DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 균주에 DR0862, DR1087, DR1395, DR1475, DR0862 및 DR1087, DR0862 및 DR1395, 또는 DR0862 및 DR1475 유전자를 발현하는 플라스미드를 도입하여, DR0861 유전자가 결실된 동시에 DR0862, DR1087, DR1395, DR1475, DR0862 및 DR1087, DR0862 및 DR1395, 또는 DR0862 및 DR1475 유전자를 과발현하는 데이노코쿠스 변이 균주를 제조하였다(도 9 및 10 참조). 나아가, 본 발명자들은 DR0861 및 DR2250 유전자가 결실되고, DR0862 및 DR1475 유전자를 과발현하는 데이노코쿠스 변이 균주를 제조하였다.
또한, 본 발명은 상기 방법으로 제조된 DR0861 유전자가 결실된 파이토엔 생산능을 갖는 데이노코쿠스 속 변이 균주를 제공한다.
상기 데이노코쿠스 속 변이 균주는 상술한 방법에 따라 제조될 수 있다. 구체적으로, 상기 데이노코쿠스 속 균주는 데이노코쿠스 라디오두란스(D. radiodurans), 데이노코쿠스 인디쿠스(D. indicus), 데이노코쿠스 카에니(D. caeni), 데이노코쿠스 아쿠아티쿠스(D. aquaticus), 데이노코쿠스 디폴리머란스(D. depolymerans), 데이노코쿠스 그란디스(D. grandis), 데이노코쿠스 데죠네시스(D. daejeonensis), 데이노코쿠스 라디오톨러란스(D. radiotolerans), 데이노코쿠스 지오써말리스(D. geothermalis), 데이노코쿠스 루버(D. ruber), 데이노코쿠스 안타티커스(D. antarcticus), 데이노코쿠스 프로테오리티쿠스(D. proteolyticus), 데이노코쿠스 라디오푸그난스(D. radiopugnans), 데이노코쿠스 라디오필러스(D. radiophilus), 데이노코쿠스 셀룰로실리티쿠스(D. cellulosilyticus) 및 데이노코쿠스 스웬시스(D. swuensis)로 구성된 군으로부터 선택되는 어느 하나 이상, 구체적으로는 데이노코쿠스 라디오두란스일 수 있다.
DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주는 우수한 파이토엔 생성능을 가질 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 본 발명의 방법에 따라 제조된 DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 균주가 우수한 파이토엔 생산능을 나타내는 것을 HPLC 및 TLC 분석 방법으로 확인하였다(도 7 및 8 참조).
또한, 본 발명자들은 DR0861 유전자가 결실된 동시에 DR0862, DR1087, DR1395, DR1475, DR0862 및 DR1087, DR0862 및 DR1395, 또는 DR0862 및 DR1475 유전자를 과발현하는 데이노코쿠스 변이 균주도 우수한 파이토엔 생산능을 나타내고, 특히 DR0861 유전자가 결실되고, DR0862 및 DR1475 유전자를 과발현하는 데이노코쿠스 변이 균주가 가장 우수한 파이토엔 생산능을 나타냄을 확인하였다(도 13 참조). 또한, 상기 DR0861 유전자가 결실되고, DR0862 및 DR1475 유전자를 과발현하는 변이 균주는 배양 72시간에 가장 높은 파이토엔 생성능을 나타내었다(도 14 참조). 나아가, 본 발명자들은 DR0861 및 DR2250 유전자가 결실되고, DR0862 및 DR1475 유전자를 과발현하는 변이 균주를 제조하여, 상기 균주가 DR0861 유전자가 결실되고, DR0862 및 DR1475 유전자를 과발현하는 변이 균주보다 더욱 현저한 파이토엔 생성능을 나타냄을 확인하였다(도 15 참조). 또한, 상기 DR0861 및 DR2250 유전자가 결실되고, DR0862 및 DR1475 유전자를 과발현하는 변이 균주는 배양 72시간에 가장 높은 파이토엔 생성능을 나타내었다(도 16 참조).
또한, 본 발명은 상술한 특징을 갖는 본 발명에 따른 변이 균주를 배양하는 단계를 포함하는 파이토엔 생산 방법을 제공한다.
상기 배양은 통상의 기술분야에 잘 알려진 적당한 배지 및 배양 조건에 따라 수행될 수 있다. 구체적으로, 상기 배양은 회분식, 연속식 또는 유가식 배양일 수 있다. 상기 파이토엔 생산 방법은 변이 균주를 배양하여 수득된 배양물로부터 파이토엔을 수득하는 단계를 추가로 포함할 수 있다. 상기 파이토엔의 수득은 통상의 기술자에 의해 적절히 수행될 수 있다.
이하, 본 발명을 하기 실시에에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명이 이들에 의해 제한되는 것은 아니다.
실시예 1. 제1 선택마커를 포함하는 플라스미드의 제작
카나마이신 내성 유전자의 양 말단에 lox66 및 lox71 유전자를 포함하는 플라스미드를 다음과 같은 방법을 제조하였다(도 1a).
먼저, pKatAPH3 플라스미드(Satoh K. et al ., Microbiology, 152:3217-3226, 2006)를 주형으로 하여 하기 표 1에 기재된 염기서열을 갖는 Lox66F(서열번호 1) 및 Lox71R(서열번호 2) 프라이머를 이용하여 lox66 및 lox71 유전자를 양 말단에 갖도록 카나마이신 내성 유전자를 증폭시켰다. 구체적으로, 1 ㎕의 pKatAPH3, 각각 1 ㎕의 lox66F 및 lox71R 프라이머(10 pmole/㎕) 및 17 ㎕의 멸균증류수의 혼합물을 pfu 폴리머라제 믹스(Bioneer)에 첨가한 뒤, 이를 T-100 Thermal cycler DNA 증폭기(Bio-rad)를 이용하여 수행하였다. PCR은 95℃에서 5분 동안 반응시킨 뒤, 95℃ 30초, 60℃ 30초 및 72℃ 1분의 반응과정을 1회로 하여 이를 30회 반복함으로써 수행되었다.
서열번호 이름 서열(5'→3')
서열번호 1 Lox66F gcttgatatctaccgttcgtatagcatacattatacgaagttat
서열번호 2 Lox71R tagaggatcctaccgttcgtataatgtatgctatacgaagttat
서열번호 3 GroEF cgtggcggccgctcggcttggaagcacgtatt
서열번호 4 GroER tacgggcagtaaattggacatatccactagtaacggccgcc
서열번호 5 CreF ggcggccgttactagtggatatgtccaatttactgcccgta
서열번호 6 CreR agcttatcgataccgtcgacctaatcgccatcttccagca
서열번호 7 pKatF tgctggaagatggcgattaggtcgacggtatcgataagct
서열번호 8 pKatR ccagtgatttttttctccatatgctctccttcgcctcgct
서열번호 9 CmF agcgaggcgaaggagagcatatggagaaaaaaatcactgg
서열번호 10 CmR gcgactcgaggtcgactctagaggatcctc
수득된 산물을 1% 아가로즈 겔에서 전기영동하여 확인하고, 이를 DNA fragment purification kit(Intron lifetechnology)를 이용하여 정제하였다. 상기 수득된 PCR 산물과 pKatAPH3를 각각 EcoRV 및 BamHI으로 절단한 뒤, 결찰시켜 카나마이신 내성 유전자의 양 말단에 lox66 및 lox71 유전자를 포함하는 플라스미드를 제조하였다. 상기 제조된 플라스미드를 pAM1(서열번호 20)이라 명명하였다(도 2).
실시예 2. groE 프로모터에 의해 cre 유전자의 발현이 조절되는 제2 선택마커를 포함하는 플라스미드의 제작
cre 재조합 효소, 클로람페니콜 내성 유전자 및 groE 프로모터 유전자를 포함하는 플라스미드를 다음과 같은 방법으로 제조하였다(도 1b).
2-1. groE 프로모터 유전자의 수득
groE 프로모터의 유전자를 수득하기 위해, 데이노코쿠스 라디오두란스 유전자를 주형으로 사용하고, 각각 0.5 ㎕의 상기 표 1에 기재된 GroEF(서열번호 3) 및 GroER(서열번호 4)의 프라이머 및 AccuPower™ pfu PCR premix mix(Bioneer)를 사용한 것을 제외하고는, 상기 실시예 1과 동일한 조건 및 방법으로 PCR을 수행하였다. 그 결과, groE 프로모터 유전자의 PCR 산물을 수득하였다.
2-2. cre 유전자의 수득
cre 유전자를 수득하기 위해, NCBI Accession number_ab449974의 서열을 참고하여 인공적으로 합성한 폴리뉴클레오티드(Bioneer)를 주형으로 사용하고, 상기 표 1에 기재된 CreF(서열번호 5) 및 CreR(서열번호 6)의 프라이머를 사용한 것을 제외하고는, 상기 실시예 1과 동일한 조건 및 방법으로 PCR을 수행하였다. 그 결과, cre 유전자의 PCR 산물을 수득하였다.
2-3. groE 프로모터 유전자 및 cre 유전자의 연결
실시예 2-1 및 2-2에서 수득한 PCR 산물을 혼합하여 주형으로 사용하고, 상기 표 1에 기재된 GroEF(서열번호 3) 및 CreR(서열번호 6)의 프라이머를 사용한 것을 제외하고는, 상기 실시예 1과 동일한 조건 및 방법으로 PCR을 수행하였다. 그 결과, groE 프로모터 유전자 및 cre 유전자가 융합된 형태의 PCR 산물을 수득하였다.
2-4. KatE1 프로모터 유전자의 수득
KatE1 프로모터를 수득하기 위해, 데이노코쿠스 라디오두란스 유전자를 주형으로 사용하고, 상기 표 1에 기재된 pKatF(서열번호 7) 및 pKatR(서열번호 8)의 프라이머를 사용한 것을 제외하고는 상기 실시예 1과 동일한 조건 및 방법으로 PCR을 수행하였다. 그 결과, KatE1 프로모터 유전자의 PCR 산물을 수득하였다.
2-5. 클로람페니콜 내성 유전자의 수득
클로람페니콜 내성 유전자를 수득하기 위해, pRAD1 플라스미드(Meima R. et at., Applied and environmental microbiology 66:3856-3867, 2000)를 주형으로 사용하고, 상기 표 1에 기재된 CmF(서열번호 9) 및 CmR(서열번호 10)의 프라이머를 사용한 것을 제외하고는, 상기 실시예 1과 동일한 조건 및 방법으로 PCR을 수행하였다. 그 결과, KatE1 프로모터 유전자의 PCR 산물을 수득하였다. 그 결과, 클로람페니콜 내성 유전자의 PCR 산물을 수득하였다.
2-6. KatE1 프로모터 유전자 및 클로람페니콜 내성 유전자의 연결
실시예 2-4 및 2-5에서 수득한 PCR 산물을 혼합하여 주형으로 사용하고, 상기 표 1에 기재된 pKatF(서열번호 7) 및 CmR(서열번호 10)의 프라이머를 사용한 것을 제외하고는, 상기 실시예 1과 동일한 조건 및 방법으로 PCR을 수행하였다. 그 결과, 클로람페니콜 내성 유전자의 PCR 산물을 수득하였다.
2-7. groE 프로모터 유전자, cre 유전자, KatE1 프로모터 유전자 및 클로람페니콜 내성 유전자의 연결
실시예 2-3 및 2-6에서 수득한 PCR 산물을 혼합하여 주형으로 사용하고, 상기 표 1에 기재된 GroEF(서열번호 3) 및 CmR(서열번호 10)의 프라이머를 사용한 것을 제외하고는, 상기 실시예 2와 동일한 조건 및 방법으로 PCR을 수행하였다. 그 결과, groE 프로모터 유전자, cre 유전자, KatE1 프로모터 유전자 및 클로람페니콜 내성 유전자가 융합된 형태의 PCR 산물을 수득하였다.
2-8. 제2 선택마커를 포함하는 플라스미드의 제작
실시예 2-7에서 수득한 PCR 산물을 13840 플라스미드(Nguyen, H. H. et al ., Molecular microbiology, 73:240-252, 2009)와 함께 NotI 및 XhoI(Enzynomics)으로 절단한 뒤, 결찰시켜 제조된 플라스미드를 pAM2(서열번호 21)라고 명명하였다(도 3).
비교예 1. KatE1 프로모터에 의해 cre 유전자의 발현이 조절되는 제2 선택마커를 포함하는 플라스미드의 제작
groE 프로모터의 위치에 KatE1 프로모터를 삽입한 것을 제외하고는, 상기 실시예 2와 동일한 조건 및 방법으로 KatE1 프로모터에 의해 cre 유전자의 발현이 조절되는 제2 선택마커를 포함하는 플라스미드를 제작하였다.
실시예 3. DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 변이 균주의 제조
3-1. DR0861 유전자의 상위 및 하위 부위의 수득
데이노코쿠스 라디오두란스의 DNA를 주형으로 하여, DR0861 유전자의 상위 부위 1 kb 및 하위 부위 1 kb를 각각 하기 표 2에 기재된 프라이머 1, 2, 5 및 6(서열번호 11, 12, 15 및 16)의 프라이머를 사용한 것을 제외하고는, 상기 실시예 1과 동일한 조건 및 방법으로 PCR을 수행하였다. 그 결과, DR0861 유전자의 상위 및 하위 부위의 1 kb의 PCR 산물을 각각 수득하였다.
서열번호 이름 서열(5'→3')
서열번호 11 프라이머 1 catagtgaaagaaacgtctg
서열번호 12 프라이머 2 agcttatcgataccgtcgacgacagtaaacctcggaagtc
서열번호 13 프라이머 3 gacttccgaggtttactgtcgtcgacggtatcgataagct
서열번호 14 프라이머 4 ttaagcggaatccgtatgaccatgcctgcaggtcgactct
서열번호 15 프라이머 5 agagtcgacctgcaggcatggtcatacggattccgcttaa
서열번호 16 프라이머 6 ttggtccacatgctggtgca
3-2. lox 유전자를 양쪽에 포함하는 카나마이신 내성 유전자의 증폭
실시예 1에서 제작된 pAM1 플라스미드를 주형으로 하여, lox71 및 lox66 유전자를 양 말단에 포함하는 카나마이신 내성 유전자를 상기 표 2에 기재된 프라이머 3 및 4(서열번호 13 및 14)의 프라이머를 사용한 것을 제외하고는, 상기 실시예 1과 동일한 조건 및 방법으로 PCR을 수행하였다. 그 결과, lox71 및 lox66 유전자를 양 말단에 포함하는 카나마이신 내성 유전자의 PCR 산물을 수득하였다.
3-3. DR0861 유전자의 상위 및 하위 부위와 lox 유전자를 양쪽에 포함하는 카나마이신 내성 유전자의 연결
먼저, 실시예 3-1 및 3-2에서 수득된 PCR 산물을 1% 아가로즈 겔에서 전기영동하여 확인하고, 이를 DNA fragment purification kit(Intron lifetechnology)를 이용하여 각각 정제하였다. 정제된 PCR 산물을 혼합하여 주형으로 사용하고, 상기 표 2에 기재된 프라이머 1(서열번호 11) 및 프라이머 6(서열번호 16)의 프라이머를 사용하였으며, PCR 과정에서 72℃ 3분 동안 반응시킨 것을 제외하고는, 상기 실시예 1과 동일한 조건 및 방법으로 PCR을 수행하였다. 그 결과, DR0861 유전자의 상위 및 하위 부위와 lox 유전자를 양쪽에 포함하는 카나마이신 내성 유전자가 융합된 형태의 PCR 산물을 수득하였다(도 4).
3-4. DR0861 유전자가 결실된 변이 균주의 제조
먼저, 데이노코쿠스 라디오두란스(ATCC 13939, 농업유전자원정보센터, 한국) 균주를 TGY 배지(0.5%(w/v)의 트립톤, 0.1%(w/v)의 글루코스 및 0.3%(w/v)의 효모 추출물)를 이용하여 30℃의 온도에서 OD600의 값이 0.5에 도달할 때까지 배양하였다. 배양한 세포를 원심분리하여 30 mM의 칼슘클로라이드(CaCl2)가 포함된 2x TGY 배지에 현탁한 뒤, 현탁액을 얼음에서 1시간 동안 정치시켰다. 이를 다시 원심분리하여 상등액을 제거하고 30 mM의 CaCl2 및 10%(v/v) 글리세롤이 포함된 50 ㎕의 TGY 배지를 첨가하여 재현탁한 뒤, 멸균된 1.5 ㎖ 튜브에 50 ㎕ 씩 분주하여 준비하였다.
한편, 실시예 3-3에서 수득된 PCR 산물은 1% 아가로즈 겔에서 전기영동하고, 이를 DNA fragment purification kit(Intron lifetechnology)를 이용하여 정제하였다. 10 ㎕의 정제된 PCR 산물, 50 ㎕의 데이노코쿠스 라디오두란스 세포 및 30 mM의 CaCl2가 포함된 50℃의 2x TGY 배지를 혼합하고, 상기 혼합물을 얼음에서 30분 동안 정치시킨 뒤, 32℃에서 1.5시간 동안 반응시켰다. 반응 후, 900 ㎕의 2x TGY 배지를 첨가하고, 이를 30℃에서 12시간 동안 배양하였다. 배양된 균주를 25 ㎍/㎖의 카나마이신이 포함된 2x TGY 고체 배지에 200 ㎕ 씩 도말하고, 30℃에서 3 내지 4일 동안 배양하였다. 배양된 균주로부터 DNA를 추출하여 DR0861 유전자가 결실되었는지를 염기서열 분석으로 확인하고, 최종 선별된 균주를 DrAM1으로 명명하였다.
실시예 4. DR0861 유전자가 결실된 변이 균주로부터 항생제 내성 유전자의 제거
먼저, 실시예 2에서 제조된 pAM2 플라스미드를 실시예 3-4에 기재된 방법 및 조건으로 실시예 3에서 제조된 DR0861 유전자가 결실된 변이 균주에 형질전환하였다. 형질전환된 균주로부터 카나마이신 내성 유전자가 제거된 균주를 선별하기 위해, 3 ㎍/㎖의 클로람페니콜이 포함된 2x TGY 고체 배지에 도말하여 배양하였다. 배양된 균주로부터 DNA를 추출하여 카나마이신 내성 유전자가 결실되었는지를 염기서열 분석으로 확인하고, 최종 선별된 균주를 DrAM2으로 명명하였다.
실시예 5. groE 또는 KatE1 프로모터에 의한 cre 단백질의 발현량 확인
실시예 3에서 제조된 groE 프로모터에 의해 cre 단백질의 발현이 조절되는 제2 선택마커를 포함하는 플라스미드가 도입된 변이 균주와 KatE1 프로모터에 의해 cre 단백질의 발현이 조절되는 제2 선택마커를 포함하는 플라스미드가 도입된 변이 균주에서 cre 단백질의 발현량을 다음과 같은 방법으로 확인하였다.
구체적으로, groE 프로모터 또는 KatE1 프로모터를 포함하는 플라스미드를 데이노코쿠스 라디오두란스 균주를 TGY 배지를 이용하여 OD=1까지 배양하였다. 상기 배양액으로부터 각각의 프로모터를 포함하는 세포만을 원심분리로 수득하여 용해 완충액을 첨가하고, 초음파 분쇄기를 사용하여 세포를 각각 용해시켰다. 용해된 각각의 세포 용해물을 4,000 rpm, 4℃의 조건에서 20분 동안 원심분리하여 단백질을 포함하는 상등액을 회수하고, 이를 브래드포드 어세이 방법을 사용하여 각각의 상등액에 포함된 단백질의 양을 정량하였다. 정량한 단백질 10 ㎍을 SDS-PAGE 겔을 이용하여 전기영동한 뒤, 이를 코마시블루 염색약으로 염색하여 cre 단백질의 크기인 약 35 kDa에 해당하는 밴드의 변화를 관찰하였다.
그 결과, 도 5에 나타난 바와 같이, groE 프로모터에 의해 cre 단백질의 발현이 조절되는 제2 선택마커를 포함하는 플라스미드가 도입된 변이 균주에서 생성된 cre 단백질의 발현량이 KatE1 프로모터를 포함하는 제2 선택마커를 포함하는 플라스미드가 도입된 변이 균주보다 높았다(도 5).
실시예 6. 항생제 내성 유전자 및 DR0861 유전자가 모두 제거된 데이노코쿠스 라디오두란스 균주의 제조
실시예 2에서 제조된 pAM2 플라스미드는 온도감수성 플라스미드로서 37℃의 조건에서는 데이노코쿠스 라디오두란스 균주 내에서 복제되지 않는다. 따라서, 이를 이용하여 DrAM2 균주로부터 pAM2 플라스미드를 다음과 같은 방법으로 제거하였다.
구체적으로, DrAM2 균주를 37℃에서 TGY 액체 배지를 사용하여 24시간 동안 배양하여 준비하였다. 준비된 DrAM2 균주를 2x TGY 고체 배지에 부피비로 1:10,000이 되도록 희석하여 도말하고, 이를 30℃에서 2일 동안 배양하였다. 형성된 단일 콜로니를 멸균된 팁(tip)을 이용하여 카나마이신 또는 클로람페니콜이 포함된 2x TGY 고체 배지, 또는 항생제를 포함하지 않는 2x TGY 고체 배지에 접종하고, 30℃에서 1일 동안 배양하였다. 배양 후, 항생제를 포함하지 않는 배지에서만 성장한 단일 콜로니를 최종적으로 선별하여 이를 DrAM3로 명명하였다(도 6).
비교예 2. DR0862 유전자가 결실된 데이노코쿠스 라디오두란스 변이 균주의 제조
DR0861 유전자 대신 DR0862 유전자가 결실된 것을 제외하고는, 상기 서술된 것과 동일한 조건 및 방법으로 DR0862 유전자가 결실된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다.
실험예 1. DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 변이 균주의 파이토엔 생산효과 확인
1-1. 균주의 배양 및 배양 산물의 수득
먼저, 10 g의 트립톤(BD, 프랑스), 10 g의 효모 추출물(Acumedia, 미국), 2 g의 포도당(Duksan, 한국) 및 2 g의 K2HPO4(Daejung, 한국)를 1 ℓ의 정제수에 용해시키고 pH를 6.5로 보정하여 액체 배지를 제조하였다. 상기 제조된 액체 배지를 3개의 500 ㎖ 삼각 플라스크에 100 ㎖씩 분주하여 가압멸균하고, 멸균된 액체 배지에 1 ㎖의 실시예 6에서 제조된 변이 균주, 비교예 2에서 제조된 변이 균주 또는 야생형의 데이노코쿠스 라디오두란스 균주를 접종하였다. 상기 균주는 30℃, 200 rpm의 조건으로 72시간 동안 교반하며 배양하였다. 배양 후, 배양액을 4℃, 4,000 rpm의 조건으로 원심분리하여 분말화된 세포를 회수하고, 여기에 1 ㎖의 에틸아세테이트를 첨가하여 교반하였다. 15분 동안 교반하여 수득된 현탁액을 0.45 ㎛의 포어(pore) 크기를 갖는 여과지를 이용하여 감압여과하고, 증발시켜 배양물 잔사를 수득하였다.
1-2. 고성능 액체크로마토그래피(HPLC) 분석을 통한 파이토엔의 생성 확인
실험예 1-1에서 수득된 DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 균주, 및 야생형의 데이노코쿠스 라디오두란스 균주로부터 수득된 잔사를 이용하여 HPLC를 통해 파이토엔의 생성량을 분석하였다.
구체적으로, 컬럼은 Zorbax Eclipse XDB-C18 5 ㎛(4.6x250 ㎜)를 사용하였고, 온도는 35℃, 유속은 2.0 ㎖/min으로 설정하였다. 한편, 실험예 1-1에서 준비된 잔사는 5 ㎕를 주입하였다. 이동상은 아세토니트릴, 메탄올 및 이소프로판올이 40:50:10으로 배합된 것을 사용하였다. 이때, 비교를 위한 표준품으로는 15-cis-파이토엔(>95%, Toronto Research Chemical)을 사용하였다.
그 결과, 도 7a에 나타난 바와 같이, 야생형 균주에서는 파이토엔이 생성되지 않았으나, DR0861 유전자가 결실된 균주에서는 우수한 파이토엔 생성능을 나타냄을 확인하였다(도 7a). 또한, 파이토엔 생성량을 확인한 결과, 도 7b에 나타난 바와 같이, DR0861 유전자가 결실된 균주에서 약 0.4 ㎎/ℓ 이상의 파이토엔이 생성되었다(도 7b).
1-3. 박층크로마토그래피(TLC) 분석을 통한 파이토엔의 생성 확인
먼저, TLC 분석을 위한 실리카겔 플레이트(TLC silica gel 60, MERCK)는 5x6.5 ㎝의 크기로 준비하였다. 준비된 플레이트의 고정상에 위치한 베이스라인에 실험예 1-1에서 수득한 배양물 잔사를 도포하였다. 이때, 베이스라인은 플레이트 하단의 내측으로 약 1~3 ㎝ 떨어진 곳에 위치시키고, 시료는 스팟 형태로 도포하였다. 플로로포름:메탄올:아세톤:아세트산이 부피비로 10:1:0.4:0.2의 비율로 혼합된 혼합액을 전개용매로서 전개용 챔버에 1 ㎝ 이하의 깊이로 첨가하였다. 시료가 도포된 TCL 플레이트를 이의 하단이 전개용매에 닿도록 전개용 챔버에 고정하고, 베이스라인은 전개용매에 닿지 않도록 설치하였다. 이후, 전개용 챔버의 뚜껑을 닫아 전개용 챔버를 밀폐시키고, 전개를 진행하며 전개 용매가 플레이트의 위쪽으로 1 ㎝ 떨어진 곳까지 전개되었을 때 전개를 종료하였다. 전개가 종료된 플레이트는 전개 용매를 모두 휘발시키고 10% 황산을 도포하고 120℃의 핫플레이트 위에 두어 분리된 시료가 확인될때까지 가열하였다.
그 결과, 도 8에 나타난 바와 같이, DR0861 유전자가 결실된 변이 균주에서 우수한 파이토엔 생성능을 나타냄을 확인하였다(도 8).
실시예 7. DR0861 유전자가 결실되고, DR0862 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주의 제조
DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 균주에 속도제한효소(rate-limiting enzyme)로 잘 알려진 DR0862(crtB) 유전자를 과발현하는 플라스미드를 형질전환하여, DR0861 유전자가 결실되고, DR0862 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다.
먼저, DR0862 유전자는 데이노코쿠스 라디오두란스 유전자를 주형으로 사용하여 하기 표 3에 기재된 dr0862F1(서열번호 23) 및 dr0862R1(서열번호 24) 각각의 프라이머 0.5 ㎕, 및 AccuPower™ pfu PCR premix mix(Bioneer)를 사용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 PCR을 수행하여 수득하였다.
서열번호 이름 서열(5'→3')
서열번호 23 dr0862F1 aagtactagtatgaggtctagggccggtt
서열번호 24 dr0862R1 ctatgcggccgctcagccgtggaccgcgccca
서열번호 25 dr1087F1 gttaactagtatgcggctggacactgtgtt
서열번호 26 dr1087R1 ctaggcggccgccttgcagaggggtcccttta
서열번호 27 dr1395F1 aagtactagtatgcgtcccgaactgctcgc
서열번호 28 dr1395R1 ataggcggccgctcacttctcccgcgtcgcca
서열번호 29 dr1475F1 ctagactagtgtgaacgaacttcccggcac
서열번호 30 dr1475R1 taacgcggccgcctacacctcaatcggcacgt
수득된 PCR 산물을 1% 아가로즈 겔에서 전기영동하여 확인하고, 이를 DNA fragment purification kit(Intron lifetechnology)를 이용하여 정제하였다. 정제된 PCR 산물과 pRADZ3 플라스미드(Meima R. and Lidstrom M. E., Applied environmental microbiology, 66:3856-3867)를 각각 SpeI 및 NotI 제한효소로 절단한 뒤, 결찰시켜 pRADZ3 내에 존재하는 groE 프로모터의 하위에 DR0862 유전자가 발현되도록 플라스미드를 제조하였다(도 9). 제조된 플라스미드를 실시예 3-4와 동일한 방법 및 조건으로 실시예 6에서 제조된 DR0861 유전자가 결실된 균주에 형질전환함으로써 DR0861 유전자가 결실되고, DR0862 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다.
실시예 8. DR0861 유전자가 결실되고, DR1087 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주의 제조
DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 균주에 속도제한효소로 잘 알려진 DR1087(idi) 유전자를 과발현하는 플라스미드를 형질전환하여, DR0861 유전자가 결실되고, DR1087 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다. 실험은, DR1087 유전자를 수득하기 위해 상기 표 3에 기재된 dr1087F1(서열번호 25) 및 dr1087R1(서열번호 26) 프라이머를 사용한 것을 제외하고는, 실시예 7과 동일한 조건 및 방법으로 수행되었다. 그 결과, DR0861 유전자가 결실되고, DR1087 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다.
실시예 9. DR0861 유전자가 결실되고, DR1395 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주의 제조
DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 균주에 속도제한효소로 잘 알려진 DR1395(crtE) 유전자를 과발현하는 플라스미드를 형질전환하여, DR0861 유전자가 결실되고, DR1395 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다. 실험은, DR1395 유전자를 수득하기 위해 상기 표 3에 기재된 dr1395F1(서열번호 27) 및 dr1395R1(서열번호 28) 프라이머를 사용한 것을 제외하고는, 실시예 7과 동일한 조건 및 방법으로 수행되었다. 그 결과, DR0861 유전자가 결실되고, DR1395 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다.
실시예 10. DR0861 유전자가 결실되고, DR1475 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주의 제조
DR0861 유전자가 결실된 데이노코쿠스 라디오두란스 균주에 속도제한효소로 잘 알려진 DR1475(dxs) 유전자를 과발현하는 플라스미드를 형질전환하여, DR0861 유전자가 결실되고, DR1475 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다. 실험은, DR1475 유전자를 수득하기 위해 상기 표 3에 기재된 dr1475F1(서열번호 29) 및 dr1475R1(서열번호 30) 프라이머를 사용한 것을 제외하고는, 실시예 7과 동일한 조건 및 방법으로 수행되었다. 그 결과, DR0861 유전자가 결실되고, DR1475 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다.
실시예 11. DR0861 유전자가 결실되고, DR0862 및 DR1087 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주의 제조
DR0861 유전자가 결실되고, DR0862 및 DR1087 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 다음과 같은 방법으로 제조하였다.
먼저, 실시예 8에서 제조된 DR1087 유전자가 포함된 pRADZ3 플라스미드를 주형으로 사용하여, groE 프로모터 및 DR1087 유전자를 포함하는 부분을 하기 표 4에 기재된 바와 같은 groF(서열번호 31) 및 dr1087R2(서열번호 32) 프라이머를 사용하여 PCR을 수행하였다. 구체적으로, PCR은 1 ㎕의 DNA 주형, 1 ㎕의 프라이머 각각, 및 17 ㎕의 멸균 증류수의 혼합물에 pfu 폴리머라제 믹스(Bioneer)를 첨가한 뒤, 이를 T-100 Thermal cycler DNA 증폭기(Bio-rad)를 사용하여 수행하였다. PCR은 95℃에서 5분 동안 반응시킨 뒤, 95℃ 30초, 60℃ 30초 및 72℃ 1분의 반응과정을 1회로 하여 이를 30회 반복함으로써 수행되었다.
서열번호 이름 서열(5'→3')
서열번호 31 groF ataggcggccgctcggcttggaagcacgtatt
서열번호 32 dr1087R2 gttacctaggcttgcagaggggtcccttta
서열번호 33 dr1395R2 ctaggtcgaccttaagcctaggtcacttctcccgcgtcgcca
서열번호 34 dr1475R2 gttacctaggctacacctcaatcggcacgt
수득된 PCR 산물을 1% 아가로즈 겔에서 전기영동하여 확인하고, 이를 DNA fragment purification kit(Intron lifetechnology)를 이용하여 정제하였다. 정제된 PCR 산물과 실시예 7에서 제조된 DR0862 유전자가 포함된 pRADZ3 플라스미드를 각각 NotI 및 SalI 제한효소로 절단한 뒤, 결찰시켜 pRADZ3 내에 포함된 DR0862 유전자의 하위에 groE 프로모터 및 DR1087 유전자가 발현되도록 플라스미드를 제조하였다. 제조된 플라스미드를 실시예 3-4와 동일한 방법 및 조건으로 실시예 6에서 제조된 DR0861 유전자가 결실된 균주에 형질전환함으로써 DR0861 유전자가 결실되고, DR0862 및 DR1087 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다.
실시예 12. DR0861 유전자가 결실되고, DR0862 및 DR1395 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주의 제조
DR0861 유전자가 결실되고, DR0862 및 DR1395 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다. 실험은, 실시예 9에서 제조된 DR1395 유전자가 포함된 pRADZ3 플라스미드를 주형으로 사용하고, 상기 표 4에 기재된 groF(서열번호 31) 및 dr1395R2(서열번호 33) 프라이머를 사용한 것을 제외하고는, 실시예 11과 동일한 조건 및 방법으로 수행되었다. 그 결과, DR0861 유전자가 결실되고, DR0862 및 DR1395 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다.
실시예 13. DR0861 유전자가 결실되고, DR0862 및 DR1475 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주의 제조
DR0861 유전자가 결실되고, DR0862 및 DR1475 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다. 실험은, 실시예 10에서 제조된 DR1475 유전자가 포함된 pRADZ3 플라스미드를 주형으로 사용하고, 상기 표 4에 기재된 groF(서열번호 31) 및 dr1475R2(서열번호 34) 프라이머를 사용한 것을 제외하고는, 실시예 11과 동일한 조건 및 방법으로 수행되었다(도 10). 그 결과, DR0861 유전자가 결실되고, DR0862 및 DR1475 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다.
실험예 2. DR0861 유전자가 결실되고, DR0862, DR1087, DR1395 또는 DR1475 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주의 파이토엔 생산효과 확인
2-1. 균주의 배양 및 배양 산물의 수득
먼저, 하기 표 5에 기재된 바와 같은 조성을 포함하는 배양 배지를 pH 7.0으로 보정하고, 이를 고압멸균하여 준비하였다.
성분 최종 농도
인산완충액(phosphate buffer) 20 mM
황산암모늄(ammonium sulfate) 15 mM
MnCl2 5 μM
MgCl2 0.8 mM
CaCl2 0.18 mM
과당(fructose) 10 g/ℓ
비타민 믹스(vitamin mix) 10 ㎎/㎖
L-시스테인(L-cystein) 50 ㎎/ℓ
L-메티오닌(L-methionine) 25 ㎎/ℓ
L-히스티딘(L-histidine) 25 ㎎/ℓ
효모추출물(yeast extract) 1 g/ℓ
준비된 50 ㎖의 배양 배지를 250 ㎖의 삼각 플라스크에 넣고, 여기에 실시예 6 내지 13에서 제조된 데이노코쿠스 라디오두란스 변이 균주를 각각 500 ㎕씩 접종하였다. 상기 균주는 30℃, 200 rpm의 조건으로 72시간 동안 교반하며 배양하였다. 이때, 실시예 7 내지 13에서 제조된 균주의 배양 배지에는 3 ㎍/㎖ 농도의 클로람페니콜을 첨가하였다. 배양 후, 배양 후, 배양액을 4℃, 4,000 rpm의 조건으로 15분 동안 원심분리하여 세포를 회수하고, 상등액을 제거하였다. 회수된 세포에 3차 증류수를 첨가하여 세포를 세척하고, 메탄올과 아세톤이 2:7의 부피비로 혼합된 유기 용매 3 ㎖를 첨가하여 세포를 현탁하였다. 현탁된 세포를 상온에서 15분 동안 정치시켜 세포로부터 파이토엔이 추출되도록 하였다. 15분 후, 현탁된 세포를 4℃, 4,000 rpm의 조건으로 15분 동안 원심분리하여 상등액을 수득하였다. 수득된 1 ㎖의 상등액을 0.2 ㎛의 포어(pore) 크기를 갖는 여과지를 이용하여 여과함으로써, 파이토엔이 포함된 용매를 최종적으로 수득하였다.
2-2. 고성능 액체크로마토그래피(HPLC) 분석을 통한 파이토엔의 생성 확인
실험예 2-1에서 수득된 실시예 6 내지 13에서 제조된 데이노코쿠스 라디오두란스 변이 균주로부터 수득된 잔사를 이용하여 HPLC를 통해 파이토엔의 생성량을 실험예 1-2와 동일한 방법으로 분석하였다. 이때, 비교를 위한 표준품으로는 15-cis-파이토엔(>95%, Toronto Research Chemical)을 사용하였고, 이를 100 ㎎/ℓ부터 6.25 ㎎/ℓ까지의 농도로 희석하여 검량선을 작성하였다(도 11 및 12). 작성된 검량선을 사용하여 계산된, 실시예 6 내지 13에서 제조된 데이노코쿠스 라디오두란스 변이 균주의 파이토엔 생성량을 도 13에 나타내었다.
도 13에 나타난 바와 같이, 실시예 6의 변이 균주(none)가 0.34±0.15 ㎎/ℓ의 파이토엔 생성량을 나타낸 것에 비해 실시예 7 내지 13에서 제조된 변이 균주에서 더 많은 양의 파이토엔을 생성하였다. 특히 한개의 유전자를 과발현하는 변이 균주 중에서는 실시예 7의 변이 균주(dr0862+)에서 가장 많은 양의 파이토엔을 생성하였다(1.85±0.18 ㎎/ℓ). 한편, 두개의 유전자를 과발현하는 변이 균주 중에서는 실시예 13의 변이 균주(dr0862+, dr1475+)가 가장 많은 양의 파이토엔을 생성하였다(3.25±0.21 ㎎/ℓ)(도 13).
2-3. 배양 시간에 따른 파이토엔 생성 확인
실험예 2-2에서 가장 많은 양의 파이토엔을 생성하는 것으로 확인된 실시예 13의 변이균주를 이용하여 배양 시간에 따른 파이토엔 생성량을 확인하였다. 실험은, 배양을 0, 24, 48, 72 및 96시간 동안 수행한 것을 제외하고는 실험예 2-1과 동일한 조건 및 방법으로 배양 산물을 수득하였다. 또한, 실험예 2-2와 동일한 조건 및 방법으로 파이토엔 생성량을 확인하였다.
그 결과, 도 14에 나타난 바와 같이, 파이토엔 생성량을 배양 24시간 경과후에 급증하였으며, 72시간(3.71±0.1 ㎎/ℓ)에 최고점에 달했다가 이후 조금 감소하는 경향을 보였다(도 14).
실시예 14. DR0861 및 DR2250 유전자가 결실되고, DR0862 및 DR1475 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주의 제조
먼저, DR2250 유전자의 상위 부위 1 kb 및 하위 부위 1kb를 각각 하기 표 6에 기재된 프라이머를 사용한 것을 제외하고는, 상기 실시예 1과 동일한 조건 및 방법으로 PCR을 수행하여, DR2250 유전자의 상위 및 하위 부위의 1 kb PCR 산물을 각각 수득하였다.
서열번호 이름 서열(5'→3')
서열번호 35 dr2250-1 catgttcatcaccagccgca
서열번호 36 dr2250-2 agcttatcgataccgtcgactgtagcgggagcagtatcac
서열번호 37 dr2250-3 gtgatactgctcccgctacagtcgacggtatcgataagct
서열번호 38 dr2250-4 aatgccttctcgccatccagcatgcctgcaggtcgactct
서열번호 39 dr2250-5 agagtcgacctgcaggcatgctggatggcgagaaggcatt
서열번호 40 dr2250-6 gatgtcgcgagttcgaatct
상기 수득된 PCR 산물을 실시예 3-2 및 3-3에 기재된 바와 동일한 방법으로 카나마이신 내성 유전자와 연결하고, 실시예 6에서 제조된 DDR0861 유전자가 결실된 변이 균주를 사용하여 실시예 3-4에 기재된 바와 동일한 조건 및 방법으로 DR0861 및 DR2250 유전자가 결실된 변이 균주를 제조하였다. 상기 제조된 균주에 DR0862 및 DR1475 유전자를 포함하는 플라스미드를 실시예 3-4에 기재된 바와 동일한 방법으로 형질전환하여 최종적으로 DR0861 및 DR2250 유전자가 결실되고, DR0862 및 DR1475 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주의 제조하였다.
비교예 3. DR0861 및 DR2250 유전자가 결실된 데이노코쿠스 라디오두란스 변이 균주의 제조
실시예 14에서 수득된 카나마이신 내성 유전자와 DR2250 유전자의 상위 및 하위 부위를 포함하는 PCR 산물과 실시예 6에서 제조된 DR0861 유전자가 결실된 변이 균주를 사용하여 실시예 3-4에 기재된 바와 동일한 조건 및 방법으로 DR0861 및 DR2250 유전자가 결실된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다.
실험예 3. DR0861 및 DR2250 유전자가 결실되고, DR0862 및 DR1475 유전자가 과발현된 데이노코쿠스 라디오두란스 변이 균주의 파이토엔 생산효과 확인
3-1. HPLC 분석을 통한 파이토엔의 생성 확인
실시예 6, 13, 14 및 비교예 3에서 제조된 변이 균주를 사용하여 상기 실험예 2에 기재된 바와 동일한 조건 및 방법으로 파이토엔 생산효과를 확인하였다. 그 결과, 실시예 6, 실시예 13, 실시예 13 및 비교예 3에서 제조된 변이 균주의 파이토엔 생성량을 도 15에 나타내었다.
도 15에 나타난 바와 같이, 실시예 6 및 비교예 3의 변이 균주에 비해, 실시예 13 및 14의 변이 균주는 더 높은 파이토엔 생성량을 보였다. 특히, 실시예 14의 변이 균주(4.5±0.2 ㎎/ℓ)는 실시예 13의 변이 균주(3.5±0.24 ㎎/ℓ)보다 파이토엔 생성량이 약 21% 증가하였다(도 15).
3-2. 배양 시간에 따른 파이토엔 생성 확인
실험예 3-1에서 가장 많은 양의 파이토엔을 생성하는 것으로 확인된 실시예 14의 변이 균주를 이용하여 실험예 2-3과 동일한 조건 및 방법으로 시간에 따른 파이토엔 생성량을 확인하였다.
그 결과, 도 16에 나타난 바와 같이, 실시예 13의 변이 균주를 사용하여 시간에 따른 파이토엔 생성량을 확인한 결과와 유사하게 배양 72시간에 가장 많은 파이토엔을 생성하였다(도 16).
3-3. 균주의 성장, 탄소원 소모 및 파이토엔의 생성 비교 분석
실시예 14의 변이 균주를 이용하여, 상기 균주의 성장곡선, 성장 시 사용하는 탄소원의 소모비 및 파이토엔의 생성량을 비교분석한 결과를 도 17에 나타내었다.
도 17에 나타난 바와 같이, 실시예 14의 균주는 배양 96시간 동안 배양 배지에 포함되는 거의 모든 탄소원을 소모하고, 배양 48시간 동안 최대 세포 성장을 보이며(OD600=5.4±0.1), 배양 72시간에서 파이토엔을 가장 많이 생성하였다(4.3±0.1 ㎎/ℓ)(도 17). 즉, 상기 결과들을 토대로, 실시예 14의 변이 균주는 배양 72시간 동안 시간당 약 600 ㎍/ℓ의 파이토엔을 생성하는 것을 알 수 있었다.

Claims (17)

1) 제1 선택마커를 포함하는 lox 핵산 단편의 양 말단에 DR0861 유전자의 상부 및 하부 단편이 각각 융합된 DNA 구조체를 데이노코쿠스 속 균주에 도입하여 DR0861 유전자를 결실시키는 단계;
2) 상기 단계 1)의 DR0861 유전자가 결실된 균주에 groE 프로모터, cre 재조합 효소를 코딩하는 유전자, 제2 선택마커 및 온도 감수성 repUts를 포함하는 벡터를 도입하여 제1 선택마커를 결실시키는 단계; 및
3) 상기 단계 2)에서 수득된 변이 균주를 배양하여 제2 선택마커를 포함하는 벡터를 제거하는 단계를 포함하는, cre-lox 시스템을 이용한 DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항에 있어서, 상기 DR0861 유전자가 서열번호 22의 염기서열로 구성되는 폴리뉴클레오티드인, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항에 있어서, 상기 단계 3)의 배양이 30 내지 40℃의 온도에서 수행되는, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항에 있어서, 상기 데이노코쿠스 속 균주가 데이노코쿠스 라디오두란스인, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항에 있어서, 상기 DR0861 유전자의 상부 및 하부 단편이 0.5 내지 1.2 kb의 길이를 갖는, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항에 있어서, 상기 lox 핵산 단편이 lox71 및 lox66으로 구성된 군으로부터 선택되는 어느 하나 이상의 lox 유전자를 단편의 양 말단에 포함하는, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항에 있어서, 상기 lox 핵산 단편이 서열번호 17의 염기서열로 구성되는 폴리뉴클레오티드인, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항에 있어서, 상기 groE 프로모터가 서열번호 19의 염기서열로 구성되는 폴리뉴클레오티드인, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항에 있어서, 상기 제1 및 제2 선택마커가 항생제 내성 유전자인, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제9항에 있어서, 상기 항생제 내성 유전자가 카나마이신, 클로람페니콜, 스펙티노마이신 및 스트렙토마이신으로 구성된 군으로부터 선택되는 어느 하나 이상인, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항에 있어서, 상기 제1 선택마커가 cre 재조합 효소의 발현에 의해 제거되는, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항에 있어서, 상기 단계 2)의 벡터가 서열번호 21의 염기서열로 구성되는 폴리뉴클레오티드인, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항에 있어서, DR0862, DR1087, DR1395 및 DR1475로 구성된 군으로부터 선택되는 어느 하나 이상의 유전자를 각각 발현하는 플라스미드를 도입하는 단계를 추가로 포함하는, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제13항이 있어서, DR0862 및 DR1475 유전자를 각각 발현하는 플라스미드를 모두 도입하는 단계를 추가로 포함하는, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항, 제13항 및 제14항 중 어느 한 항에 있어서, DR2250 유전자를 결실시키는 단계를 추가로 포함하는, DR0861 유전자가 결실된 데이노코쿠스 속 변이 균주의 제조방법.
제1항의 방법으로 제조된 DR0861 유전자가 결실된 파이토엔 생산능을 갖는 데이노코쿠스 속 변이 균주.
제16항의 변이 균주를 배양하는 단계를 포함하는 파이토엔 생산 방법.
PCT/KR2018/003725 2017-03-30 2018-03-29 파이토엔 고생산능을 갖는 변이 균주의 제조방법 및 상기 방법으로 제조된 변이 균주 WO2018182334A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP18776574.8A EP3611267A4 (en) 2017-03-30 2018-03-29 PROCESS FOR PREPARING A MUTANT STRAIN HAVING HIGH PRODUCTIVITY OF PHYTOENE AND MUTANT STRAIN THUS PREPARED
US16/498,269 US11142777B2 (en) 2017-03-30 2018-03-29 Method for preparing mutant strain having high producibility of phytoene and mutant strain prepared thereby

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170040806 2017-03-30
KR10-2017-0040806 2017-03-30

Publications (1)

Publication Number Publication Date
WO2018182334A1 true WO2018182334A1 (ko) 2018-10-04

Family

ID=63678081

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/003725 WO2018182334A1 (ko) 2017-03-30 2018-03-29 파이토엔 고생산능을 갖는 변이 균주의 제조방법 및 상기 방법으로 제조된 변이 균주

Country Status (4)

Country Link
US (1) US11142777B2 (ko)
EP (1) EP3611267A4 (ko)
KR (1) KR101927892B1 (ko)
WO (1) WO2018182334A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102194368B1 (ko) * 2019-06-05 2020-12-24 서울시립대학교 산학협력단 미생물의 유전체를 개량하기 위한 변이 균주, 이의 제조방법 및 이를 이용한 미생물의 유전체 개량 방법

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100813284B1 (ko) 2006-04-28 2008-03-13 제주대학교 산학협력단 감귤 피토엔 생합성 효소 ｐｓｙ 유전자가 형질전환된유채식물체
KR20110032375A (ko) * 2009-09-22 2011-03-30 한국과학기술원 클로스트리듐 속 미생물 유전자를 불활성화시키는 방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5684238A (en) * 1990-03-02 1997-11-04 Amoco Corporation Biosynthesis of zeaxanthin and glycosylated zeaxanthin in genetically engineered hosts

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100813284B1 (ko) 2006-04-28 2008-03-13 제주대학교 산학협력단 감귤 피토엔 생합성 효소 ｐｓｙ 유전자가 형질전환된유채식물체
KR20110032375A (ko) * 2009-09-22 2011-03-30 한국과학기술원 클로스트리듐 속 미생물 유전자를 불활성화시키는 방법

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
"NCBI GeneBank", Database accession no. 1800077
CHOW, K.-S.: "Insights into rubber biosynthesis from transcriptome analysis of Hevea brasiliens is latex", JOURNAL OF EXPERIMENTAL BOTANY, 2007, pages 2429 - 2440, XP002521158, DOI: doi:10.1093/JXB/ERM093 *
DATABASE NUCLEOTIDE 6 May 2016 (2016-05-06), ANONYMOUS: "Deinococcus radiodurans R1 chromosome 1, complete sequence", XP055612524, retrieved from NCBI Database accession no. CP015081 *
H. H. NGUYEN ET AL., MOLECULAR MICROBIOLOGY, vol. 73, no. 2, 2009, pages 240 - 252
MEIMA R., APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 66, 2000, pages 3856 - 3867
MEIMA R.LIDSTROM M. E., APPLIED ENVIRONMENTAL MICROBIOLOGY, vol. 66, pages 3856 - 3867
NGUYEN, H. H. ET AL., MOLECULAR MICROBIOLOGY, vol. 73, 2009, pages 240 - 252
NGUYEN, H. H.: "The essential histone-like protein HU plays a major role in Deinococcus radiodurans nucleoid compaction", MOLECULAR MICROBIOLOGY, vol. 73, no. 2, 28 June 2009 (2009-06-28) - 10 July 2009 (2009-07-10), pages 240 - 252, XP055612519 *
SATOH K. ET AL., MICROBIOLOGY, vol. 152, 2006, pages 3217 - 3226
SATOH, K.: "Development of versatile shuttle vectors for Deinococcus grandis", PLASMID, vol. 62, no. 1, 9 January 2009 (2009-01-09), pages 1 - 9, XP026145052 *
See also references of EP3611267A4
TIAN, B.: "Carotenoid biosynthesis in extremophilic Deinococcus-Thermus bacteria", TRENDS IN MICROBIOLOGY, vol. 18, no. 11, November 2010 (2010-11-01), pages 512 - 520, XP027435068 *
XU, Z.: "Identification and functional analysis of a phytoene desaturase gene from the extremely radioresistant bacterium Deinococcus radiodurans", MICROBIOLOGY, 2007, pages 1642 - 1652, XP055347525, DOI: doi:10.1099/mic.0.2006/002857-0 *

Also Published As

Publication number Publication date
US20200102579A1 (en) 2020-04-02
KR20180111664A (ko) 2018-10-11
EP3611267A1 (en) 2020-02-19
EP3611267A4 (en) 2020-05-13
KR101927892B1 (ko) 2019-02-26
US11142777B2 (en) 2021-10-12

Similar Documents

Publication Publication Date Title
WO2020027362A1 (ko) 신규 아데닐로석시네이트 신세타아제 및 이를 이용한 퓨린 뉴클레오티드 생산방법
WO2019117673A2 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
WO2019117671A1 (ko) 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법
WO2019190192A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2018182354A1 (ko) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
WO2019135639A1 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
WO2014142453A1 (ko) 램프 기능이 포함된 범용 단백질 과발현 태그와 그 활용
WO2021167414A1 (ko) 퓨린 뉴클레오티드를 생산하는 미생물 및 이를 이용한 퓨린 뉴클레오티드의 생산방법
WO2019147059A1 (ko) L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산방법
WO2020235830A1 (ko) 부반응성이 낮은 리불로스-인산 3-에피머화 효소의 모티프 및 이를 포함하는 효소
WO2012046924A1 (ko) 아라비노스 대사경로가 도입된 자일리톨 생산균주 및 이를 이용한 자일리톨 생산방법
WO2020196993A1 (ko) 변이형 포스포리보실피로포스페이트 아미도트랜스퍼라아제 및 이를 이용한 퓨린 뉴클레오티드 제조방법
WO2015093831A1 (ko) Ｄ（－）２，３－부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 ｄ（－）２，３－부탄디올의 생산 방법
WO2023068472A1 (ko) 신규한 당전이효소 및 이의 용도
WO2015163682A1 (ko) 2，3－부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2，3－부탄디올의 생산 방법
WO2018182334A1 (ko) 파이토엔 고생산능을 갖는 변이 균주의 제조방법 및 상기 방법으로 제조된 변이 균주
WO2019235907A1 (ko) Crispr/cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용
WO2020075943A1 (ko) 고활성의 말산 탈수소효소가 도입된 숙신산 생성용 변이 미생물 및 이를 이용한 숙신산 제조방법
WO2013019051A2 (ko) 미생물로부터 레티노이드를 생산하는 방법
WO2018182361A1 (ko) CRISPR/Cas 시스템과 재조합 효소 및 단일가닥 올리고디옥시리보핵산을 이용한 코리네박테리움 변이균주 제조방법
WO2016013844A1 (ko) 페닐아세틸 호모세린 락톤 유도체의 생산 방법
WO2021054545A1 (ko) 7-adca 제조를 위한 데아세트옥시세팔로스포린 c의 고농도 생산 재조합 아크레모니움 크리소제눔 균주의 제조방법 및 이 방법으로 제조된 균주
WO2019235680A1 (ko) 5'-크산틸산을 생산하는 미생물 및 이를 이용한 5'-크산틸산의 제조방법
WO2021256703A1 (ko) 데이노잔틴 고생산능을 갖는 변이 균주의 제조방법 및 온도제어를 이용한 데이노잔틴 대량생산 방법
WO2023022490A1 (ko) 폴리 a 테일을 안정적으로 유지하는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18776574

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018776574

Country of ref document: EP

Effective date: 20191030