WO2021256703A1 - 데이노잔틴 고생산능을 갖는 변이 균주의 제조방법 및 온도제어를 이용한 데이노잔틴 대량생산 방법 - Google Patents

데이노잔틴 고생산능을 갖는 변이 균주의 제조방법 및 온도제어를 이용한 데이노잔틴 대량생산 방법 Download PDF

Info

Publication number
WO2021256703A1
WO2021256703A1 PCT/KR2021/005715 KR2021005715W WO2021256703A1 WO 2021256703 A1 WO2021256703 A1 WO 2021256703A1 KR 2021005715 W KR2021005715 W KR 2021005715W WO 2021256703 A1 WO2021256703 A1 WO 2021256703A1
Authority
WO
WIPO (PCT)
Prior art keywords
deinococcus
deinoxanthin
mutant strain
gene
strain
Prior art date
Application number
PCT/KR2021/005715
Other languages
English (en)
French (fr)
Inventor
최용준
정선욱
Original Assignee
서울시립대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울시립대학교산학협력단 filed Critical 서울시립대학교산학협력단
Publication of WO2021256703A1 publication Critical patent/WO2021256703A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes

Definitions

  • the invention of day No xanthine suffering relates to a method of producing mutant and over-expression of a carotenoid gene with a temperature control promoter and day No xanthine how mass production with sanneung, carotenoid gene using the groESL promoter thermal shock resistance protein crtB and It relates to a method of inducing overexpression of dxs and ultimately increasing the productivity of deinoxanthin.
  • Metabolic engineering technology is a technology used to improve biosynthesis and productivity of target substances by redesigning metabolic circuits by improving genomes of microorganisms. Metabolism refers to a series of actions in which cells absorb energy sources from the outside and synthesize various metabolites necessary for growth and cell differentiation through various biosynthetic pathways. Most natural products used in humans are metabolites with various functions as a result of cell metabolism. Recently, synthetic biology and metabolic engineering that increase the production of useful metabolites by changing the metabolic flux of cells through manipulation of microbial genes, or biosynthesis of substances that are difficult to obtain in nature ) techniques are being developed.
  • site-specific genetic recombination technologies such as CRISPR/Cas9, Flp/FRT, and cre/ lox have been applied to various living models such as plants, yeast, and microorganisms and are used for mass production of specific metabolites. have.
  • Deinococcus radiodurans known as a representative extreme-environmental microorganism, is known to be able to grow in environments where life is difficult to survive, such as space and radioactively contaminated areas. It protects cells from direct DNA damage caused by radiation and secondary generated reactive oxygen species (ROS) due to the efficient DNA repair system and antioxidant enzymes and non-enzymatic metabolites of the strain. This is because a mechanism has been developed that can protect and restore normal cells in a short period of time against lethal cell damage. In particular, it is known that the microorganism can produce deinoxanthin, a new carotenoid having a strong scavenging activity against ROS, which causes great inhibition of cell metabolism and survival.
  • ROS reactive oxygen species
  • Deinoxanthin is known to have higher antioxidant activity than other colored carotenoids with antioxidant activity such as lycopene, beta-carotene and lutein, HepG2, HT-29 and PC-3, etc. It has been confirmed by a recent research report that it also has an anticancer function that effectively inhibits the differentiation and growth of cancer cells.
  • the material is known to have a very wide range of uses, such as an antibiotic effect that can inhibit the growth of microalgae, which is a major cause of algal blooms and algal blooms in reservoirs.
  • the gene overexpression step used in normal cases, including the strain production method developed above involves the overexpression process of the foreign gene by a plasmid, it is expensive as a selective marker during culture and fermentation of improved cells. Antibiotic administration is essential. In addition, the productivity of the final product may be reduced due to the instability of the intracellular plasmid.
  • an isoproqylthiogalactoside IPTG-inducible promoter
  • IPTG-inducible promoter such as the lac promoter and the tac promoter
  • the present inventors introduced a metabolic engineering method while trying to produce a Deinococcus radiodurans strain capable of mass-producing deinoxanthin by introducing a modified Cre-loxP system and heat tolerance using a conventional gene introduction method DR0862 (crtB ) and DR1475 ( dxs ) gene monomers linked to the promoter (promoter) sequence of the gene groE (DR0606) were inserted into the genome, respectively, to prepare a mutant strain of Deinococcus radiodurans.
  • DR0862 crtB
  • DR1475 dxs gene monomers linked to the promoter (promoter) sequence of the gene groE (DR0606) were inserted into the genome, respectively, to prepare a mutant strain of Deinococcus radiodurans.
  • the present inventors confirmed that deinoxanthin can be produced in large quantities by regulating messenger RNA (mRNA) expression of DR0862 and DR1475 genes by controlling the culture temperature without using an inducer such as IP
  • the main object of the present invention is to use the Cre-loxP system, the DR0862 (crtB ) and DR1475 ( dxs ) genes ligated with the promoter sequence of DR0606 (groE ), a heat resistance gene, are inserted into the genome Deinococcus radiodurans mutation It is to provide a mutant strain having a high production capacity of deinoxanthin prepared by a method and the method for producing a strain.
  • Another object of the present invention is to provide a method for mass production of deinoxanthin from the mutant strain using temperature as an inducer.
  • the present invention provides a Deinococcus genus mutant strain in which the DR0862 ( crtB ) and DR1475 ( dxs ) genes are simultaneously inserted into the genome of the Deinococcus sp.
  • the present invention provides a deinoxanthin production method comprising the step of culturing the mutant strain.
  • the present invention provides a method comprising the steps of: 1) preparing a plasmid in which DR0862 and DR1475 are respectively linked to both ends of a lox nucleic acid fragment containing a first selection marker; 2) introducing the prepared plasmid DNA into the Deinococcus radiodurans strain to insert the DR0862 and DR1475 genes, respectively; 3) removing the first selection marker included in the inserted gene; And 4) culturing the obtained mutant strain provides a method for producing a mutant strain of the genus Deinococcus into which the DR0862 and DR1475 genes are simultaneously inserted, comprising the step of removing the vector containing the second selection marker.
  • Deinococcus radiodurans mutant strain having high production capacity of deinoxanthin prepared by the method of the present invention does not have an artificially introduced antibiotic resistance gene even though it was prepared by introducing a metabolic engineering method.
  • the DR0862 ( crtB ) and DR1475 ( dxs ) genes are simultaneously inserted through the deinococcus genus mutant strain having high productivity of deinoxanthin, without using an inducer such as IPTG, and by controlling the culture temperature, DR0862 And by regulating the messenger RNA (mRNA) expression of the DR1475 gene, it is possible to increase the production of deinoxanthin, and it can be usefully used for mass production of deinoxanthin with high antioxidant capacity in a very economical way.
  • mRNA messenger RNA
  • Figure 1a is a graph confirming the deinoxanthin produced by wild-type Deinococcus radiodurans by HPLC.
  • Figure 1b is a graph confirming deinoxanthin by LC-MS.
  • 2 is a graph showing a calibration curve for each concentration of deinoxanthin.
  • Figure 3a is a schematic diagram of a plasmid preparation method for inserting the DR0862 gene into the genome of Deinococcus radiodurans.
  • Figure 3b is a schematic diagram of a plasmid preparation method for inserting the DR1475 gene into the genome of Deinococcus radiodurans
  • FIG. 4 is a diagram schematically illustrating the process of inserting the DR0862 and DR1475 genes in the genome of the Deinococcus radiodurans strain and the process of removing the first selection marker.
  • Figure 5a is the result of confirming by PCR that the DR0862 and DR1475 genes were inserted into the genome of the Deinococcus radiodurans strain and the first selection marker was removed.
  • Figure 5b is a photograph of the result of selection of the Deinococcus radiodurans mutant strain in which all antibiotic resistance genes are removed and DR0862 and DR1475 genes are inserted in the selective medium.
  • 6a is a graph showing the growth curve of the mutant Deinococcus radiodurans strain into which the DR0862 and DR1475 genes prepared according to the method of the present invention are compared with that of the wild-type strain.
  • Figure 6b is a graph showing the deinoxanthin production of the deinococcus radiodurans mutant strain into which the DR0862 and DR1475 genes prepared according to the method of the present invention are inserted compared with the wild-type strain.
  • Figure 7a is a graph showing the growth curve of each culture temperature of Deinococcus radiodurans wild-type strain.
  • Figure 7b is a graph showing the expression level of the DR0606 (groE ) gene for each culture temperature of Deinococcus radiodurans wild-type strain.
  • 8a is a graph comparing the expression levels of DR0862 and DR1475 genes according to the culture temperature of Deinococcus radiodurans mutant strain (DX) into which DR0862 and DR1475 genes are inserted.
  • Figure 8b is a graph comparing the production of deinoxanthin according to the culture temperature of the DR0862 and DR1475 genes are inserted Deinococcus radiodurans mutant strain (DX).
  • 9 is a graph comparing the DPPH scavenging ability of deinoxanthin and several carotenoids.
  • the present invention provides a Deinococcus genus mutant strain in which the DR0862 and DR1475 genes are simultaneously inserted into the genome of the Deinococcus sp.
  • deinoxanthin is composed of C 40 H 54 O 3 (all-E)-2,1'dihydroxy-3'-4'-didehydro-1',2'- It is a dihydro- ⁇ , ⁇ -carotene-4-one compound and refers to a carotenoid with a red color.
  • the Deinococcus sp. strain is Deinococcus radiodurans ( D. radiodurans ), Deinococcus indicus ( D. indicus ), Deinococcus caeni ( D. caeni ), Deinococcus aquaticus ( D. aquaticus ), Deinococcus depolymerans ( D. depolymerans ), Deinococcus grandis ( D. grandis ), Deinococcus degenesis ( D. daejeonensis ), Deinococcus radiotolerans ( D. radiotolerans ), Deinococcus geothermalis ( D. geothermalis ), Deinococcus ruber ( D. ruber ), Deinococcus antarcticus ( D.
  • the term "DR0862" gene is a gene encoding a phytoene synthase, and the phytoene synthase is a phytoene synthase using a precursor geranylgeranyl pyrophosphate as a substrate. You can synthesize yen.
  • the DR0862 gene may be a polynucleotide consisting of any sequence known in the art. Specifically, the DR0862 gene may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3.
  • the term "DR1475" gene is a gene encoding 1-deoxy-D-xylulose-5-phosphate synthase, pyruvin 1-deoxy-D-xylulose-5-phosphate can be synthesized using pyruvate and glucose-3-phosphate as substrates.
  • the DR1475 gene may be a polynucleotide consisting of any sequence known in the art. Specifically, the DR1475 gene may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4.
  • the DR0862 and DR1475 genes may be linked to any one or more promoters selected from the group consisting of promoters of groE, katE, spac, dr1124 genes and dr2577 genes.
  • GroE protein which is one of the heat-resistant proteins, has molecular chaperone activity and exhibits strong activity in environments such as oxidative and heat-stimulated stress.
  • the groE gene can have strong expression even under general culture conditions of Deinococcus radiodurans, it is very well known as a constitutive promoter in the art. In addition, it has a characteristic that the expression level is increased more than twice in response to a high temperature immediately.
  • the promoter of the groE gene may be operably linked to the DR0862 and DR1475 genes.
  • operably linked means that a sequence controlling the expression of a nucleic acid and a nucleotide sequence encoding a protein of interest are operably linked.
  • the operably linking in the preparation of a recombinant plasmid can be carried out by methods well known by those skilled in the art.
  • the groE promoter may be a polynucleotide including 299 bp of the upstream portion of the groES gene (NCBI GeneBank ID: 1800077), specifically, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5.
  • the DR0826 ( crtB ) gene may be inserted between the DRC0004 and DRC0005 genes in the Deinococcus sp. strain genome, and the DR1475( dxs ) gene may be inserted into the DRC0007 gene in the Deinococcus sp.
  • the DR0826 ( crtB ) gene can be inserted between the 6401 to 6560 nucleotide sequences of DR chromosome 1, and the DR1475 ( dxs ) gene can be inserted between the 4310-4580 nucleotide sequences of DR chromosome 1, but is not limited thereto;
  • the gene insertion site can be inserted into any nucleotide sequence within the limit that is not limited to the nucleotide sequence (open reading frame) encoding a protein having a specific function in the Deinococcus radiodurans genome.
  • the present inventors confirmed deinoxanthin produced by wild-type Deinococcus radiodurans by HPLC and LC-MS (see FIG. 1), and prepared a calibration curve for each concentration of deinoxanthin ( see Fig. 2).
  • each of the plasmids containing the first selection marker and the expression of the DR0862 or DR1475 gene is regulated by the groE promoter (see FIG. 3 ), and a plasmid for inserting the Deinococcus radiodurans genome of the DR0862 gene was prepared After introducing into Deinococcus radiodurans cells, a mutant strain was prepared by inserting the pAM2 plasmid (see Fig. 4a).
  • a plasmid for insertion of the DR1475 gene was prepared and introduced into the Deinococcus radiodurans cells, and then the pAM2 plasmid was inserted to prepare a mutant strain in which the selection marker was removed and DR0862 and DR1475 were simultaneously inserted (Fig. 4b). See), as a result of confirming the mutation of the final strain, it was confirmed that the selection marker was completely removed from the final mutated strain (see FIG. 5).
  • the present inventors have DR0862 (crtB ) and DR1475 ( dxs ) gene monomers linked to the promoter sequence of the heat resistance gene groE (DR0606) prepared according to the above method It was confirmed that the Deinococcus radiodurans strains each inserted into the genome exhibited excellent deinoxanthin production (see FIGS. 6 and 7). In addition, as a result of confirming the antioxidant efficacy of deinoxanthin produced from the Deinococcus radiodurans mutant strain of the present invention, it was confirmed that deinoxanthin had better antioxidant activity than other carotenoids (see FIG. 9 ).
  • the present invention provides a production method comprising the step of culturing the mutant strain according to the present invention having the above-described characteristics.
  • the culture may be performed according to a suitable medium and culture conditions well known in the art. Specifically, the culture may be a batch, continuous or fed-batch culture.
  • the deinoxanthin production method may further include the step of obtaining deinoxanthin from the culture obtained by culturing the mutant strain. Obtaining the deinoxanthin may be appropriately performed by a person skilled in the art.
  • the culturing step may be carried out at 35 to 39 °C, it may be carried out at 36 to 38 °C, preferably it may be carried out at 37 °C.
  • the present inventors found that the mutant Deinococcus radiodurans in which the DR0862 and DR1475 genes were simultaneously inserted using the cre-lox system cultured at 37 ° C. was higher than the mutant strain cultured at 30 ° C. It was confirmed that it exhibits xanthine productivity (see FIG. 8).
  • the present invention provides a method comprising the steps of: 1) preparing a plasmid in which DR0862 and DR1475 are respectively linked to both ends of a lox nucleic acid fragment containing a first selection marker; 2) introducing the prepared plasmid DNA into the Deinococcus radiodurans strain to insert the DR0862 and DR1475 genes, respectively; 3) removing the first selection marker included in the inserted gene; And 4) culturing the mutant strain obtained above to remove the vector containing the second selection marker DR0862 and DR1475 using the cre-lox system, the method of producing a mutant strain of the genus Deinococcus is simultaneously inserted. to provide.
  • Cre-loxP system refers to a conventional site-specific recombinase technique used to perform a deletion at a specific site of DNA.
  • the Cre-loxP system can be used to mutate genes of interest in eukaryotes and prokaryotes. It consists of a single enzyme, Cre recombinase, and recombines the short target sequence, loxP. Accordingly, by arranging the loxP sequence at a position to induce mutation, the target gene may be inactivated or deleted, or may be substituted with another gene.
  • loxP is a bacteriophage P1 site consisting of 34 bases, including an asymmetric 8 bp nucleotide sequence, and excluding two bases in the center, It is characterized by having two pairs of palindromic structures with a size of 13 bp (ATAACTTCGTATA-NNNTANNN-TATACGAAGTTAT).
  • the lox nucleic acid fragment may include a first selection marker having the lox fragment at both ends.
  • the lox nucleic acid fragment may include any one or more lox genes selected from the group consisting of lox66 and lox71 at both ends of the fragment.
  • the lox nucleic acid fragment may be a polynucleotide consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2.
  • the term "selectable marker” refers to the product of a specific gene. Microorganisms containing the product have special traits that do not appear in microorganisms that do not contain the product, thereby enabling the selection of a desired microorganism.
  • the selection marker may be an antibiotic resistance gene.
  • the antibiotic resistance gene may be any one or more selected from the group consisting of kanamycin, chloramphenicol, spectinomycin and streptomycin, specifically, any one or more selected from the group consisting of kanamycin and chloramphenicol.
  • Genes DR0862 and DR1475 for overexpression in the present invention are known to encode major enzymes (rate-limiting enzyme) that determine the flow of metabolism in the carotenoid biosynthesis metabolic pathway of Deinococcus radiodurans, and when both genes are overexpressed at the same time It has been reported that the flow of carotenoids increased in the direction of biosynthesis and metabolism and thus the productivity of target carotenoids was improved.
  • the present invention provides a method for overexpressing the DR0862 and DR1475 genes of Deinococcus radiodurans in a cell without introduction of an external plasmid.
  • the present invention provides a step of preparing a plasmid ligated with the promoter of the groE gene, which is a heat-resistant protein, to the DR0862 and DR1475 genes for overexpression in Deinococcus radiodurans.
  • GroE protein which is one of the heat-resistant proteins, has molecular chaperone activity and exhibits strong activity in environments such as oxidative and heat-stimulated stress.
  • the groE gene can have strong expression even under general culture conditions of Deinococcus radiodurans, it is very well known as a constitutive promoter in the art. In addition, it has a characteristic that the expression level is increased more than twice in response to a high temperature immediately.
  • the promoter of the groE gene may be operably linked to the DR0862 and DR1475 genes.
  • operably linked means that a sequence controlling the expression of a nucleic acid and a nucleotide sequence encoding a protein of interest are operably linked.
  • the operably linking in the preparation of a recombinant plasmid can be carried out by methods well known by those skilled in the art.
  • the groE promoter may be a polynucleotide including 299 bp of the upstream portion of the groES gene (NCBI GeneBank ID: 1800077), specifically, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5.
  • the method for producing the Deinococcus radiodurans mutant strain having high deinoxanthin production capacity may include inserting the DR0862 and DR1475 genes into the genome of Deinococcus radiodurans at the same time.
  • the selection marker is removed by the Cre-loxP system, and the DR0862 and DR1475 genes can be overexpressed by the groE promoter.
  • Methods of manipulating one, two or more genes in one strain to be inserted into the genome of a target organism are well known in the art.
  • the method can be suitably performed by a person skilled in the art.
  • the present invention introduces a vector including a groE promoter, a gene encoding a cre recombinase, a second selection marker, and temperature-sensitive repUts into the strain in which the DR0862 and DR1475 genes are simultaneously inserted, thereby deleting the first selection marker.
  • the groE promoter may be operably linked with cre recombinase.
  • the second selectable marker may be operably linked to the Kat promoter.
  • the Kat promoter may be a polynucleotide including 138 bp of the upstream portion of the KatE1 gene (NCBI GeneBank ID: 1800077).
  • temperature-sensitive repUts refers to a repU gene, which is a gene that allows a plasmid to replicate only within a specific temperature range (HH Nguyen et al, Molecular Microbiology, 2009, 73(2), 240). -252)
  • the plasmid containing the gene is replicated at a culture temperature of 28° C. to enable maintenance of the plasmid in the host cell, but at a culture temperature of 37° C., the plasmid does not replicate and is removed from the host cell.
  • repU gene and a plasmid comprising the same are well known in the art.
  • the lox gene bound to both ends of the first selectable marker is recognized by the cre recombinase, and these sites are cut, thereby removing the first selectable marker from the genome of the Deinococcus spp. can
  • the present invention provides a step of removing the vector containing the second selection marker by culturing the obtained mutant strain.
  • the removal of the second selection marker may use a characteristic that the vector including the second selection marker is not replicated within a specific temperature range by repUts, which is a temperature sensitive marker. Accordingly, in the above step, the vector including the second selection marker can be removed by culturing the mutant strain within a specific temperature range for a certain period of time. Specifically, the temperature for the incubation may be 30 to 40 °C, specifically 31 to 39 °C, more specifically 33 to 38 °C.
  • the mutant strain obtained according to the above step may be selected based on the characteristic that it cannot grow in a medium containing an antibiotic by removing both the first and second selection markers.
  • Example 1 Identification of deinoxanthin through HPLC and LC-MS analysis of wild-type Deinococcus radiodurans strain (ATCC13939) culture product
  • a TGY liquid medium was prepared by dissolving 5 g of tryptone (BD, France), 3 g of yeast extract (BD, France), and 1 g of glucose (Duksan, Korea) in 1 liter of purified water, and then 121 ° C. was autoclaved for 15 minutes. 3 ml of the prepared liquid medium was dispensed into a 14 ml test tube, and the Deinococcus radiodurans strain (ATCC13939) was inoculated and cultured with stirring at 30° C. and 200 rpm for 24 hours.
  • a Zorbax Eclipse XDB-C18 5 ⁇ m (4.6 x 150 mm) column was used, the temperature was set to 30° C., the flow rate was set to 0.5 ml/min, and the UV wavelength was set to 470 nm, and analysis was performed for 15 minutes. Meanwhile, 5 ⁇ l of the extract prepared in ⁇ Example 1-1> was injected.
  • the mobile phase a mixture of acetonitrile, methanol and isopropanol in a ratio of 40:50:10 was used.
  • the Deinococcus radiodurans extract confirmed that each peak was detected at retention times of 5.944 min, 6.585 min, 7.003 min, 8.004 min, 13.262 min, and 14.29 min. did In particular, it was confirmed that the highest peak was detected at a retention time of 5.944.
  • the extract extracted in ⁇ Example 1-1> was concentrated at 60° C. and 80 rpm for 1 hour using an evaporator, and the concentrated extract was powdered using a freeze dryer. to dry completely.
  • the dried powder was weighed to 10 mg with a balance and completely dissolved in 10 ml of methanol to prepare a standard product with a final concentration of 1 g/L.
  • a standard curve was prepared by serial dilution of each standard with methanol, and the R 2 value of the prepared calibration curve was 0.9998, confirming that the reliability of the result was very appropriate (FIG. 2).
  • the DR0862 and DR1475 genes were dr0862F1 (SEQ ID NO: 10) and dr0862R1 (SEQ ID NO: 11) primer pairs shown in Table 1 below using Deinococcus radiodurans chromosomal DNA as a template and dr1475F1 (SEQ ID NO: 12) and PCR was performed using each of the dr1475R1 (SEQ ID NO: 13) primer pairs.
  • the obtained PCR product was confirmed by electrophoresis on a 1% agarose gel, and it was purified using a DNA fragment purification kit (Intron lifetechnology).
  • the purified DR0862 or DR1475 PCR product and the pRADZ3 plasmid (Meima R.
  • pRADZ3 A plasmid (pRADZ::DR0862, pRADZ::DR1475; SEQ ID NO: 6, SEQ ID NO: 7)) was prepared such that the DR0862 or DR1475 gene was cloned into the (Fig. 3).
  • the DR0862 gene bound to the groE promoter was amplified, respectively, and then the plasmid pAM1 containing the lox66 and lox71 genes at both ends of the kanamycin resistance gene (Korea Registered Patent: No. 10- 1835852), each cloned upstream of the kanamycin gene.
  • a DNA fragment for inserting the DR0862 gene into Deinococcus radiodurans was obtained using a homologous recombination process, and the DNA fragment obtained in the above process (DR0862, kanamycin resistance gene, lox66 and lox71 base sequences) between the fragments.
  • a plasmid for ligation with this bound was constructed.
  • the upper region 930 bp and the lower region 914 bp including some of the nucleotide sequences of the DRC0006 (hypothetical protein) gene and the DRC0007 (hypothetical protein) gene were amplified by PCR, respectively.
  • the final plasmid to introduce the DR0862 gene into the genome of Deinococcus radiodurans by cutting the DNA fragment containing the plasmid and DR0862 prepared from the above process and the loxP sequence and the kanamycin resistance gene with stuI, respectively, and ligating them ( pgroDR0862, SEQ ID NO: 8) was prepared ( FIG. 4A ).
  • a mutant strain was prepared by introducing the plasmid finally prepared in ⁇ Example 4-1> into Deinococcus radiodurans cells.
  • Deinococcus radiodurans ATCC 13939, Agricultural Genetic Resources Information Center, Korea
  • TGY medium 0.5% (w/v) tryptone, 0.1% (w/v) glucose and 0.3% ( w/v) yeast extract
  • the cultured cells were centrifuged and suspended in 2x TGY medium containing 30 mM calcium chloride (CaCl 2 ), and the suspension was left on ice for 1 hour.
  • Cells were prepared using the mutant strain obtained from the above process in the same manner as the Deinococcus radiodurans competent cell production method, and pAM2 plasmid DNA at a concentration of 1 ⁇ g (Korea Registered Patent: No. 10-1835852) Ho) was added to transform it, and a transformed Deinococcus radiodurans strain was obtained from 2X TGY solid medium containing chloramphenicol (3 ⁇ g/ml) as a second selection marker.
  • the mutant strain was inoculated in TGY broth and cultured at 37° C. for 24 hours to remove the pAM2 plasmid from the mutant strain, to prepare a Deinococcus radiodurans mutant strain in which DR0862 was additionally inserted and the selection marker was removed.
  • a DNA fragment for introducing the DR1475 gene into the Deinococcus radiodurans genome was obtained using the same method as in ⁇ Example 4-1>, and the DNA fragment obtained in the above process (DR1475, A plasmid was constructed for ligation with the kanamycin resistance gene, lox66 and lox71 base sequences were bound.
  • DR1475 A plasmid was constructed for ligation with the kanamycin resistance gene, lox66 and lox71 base sequences were bound.
  • 1,150 bp of the upper region and 910 bp of the lower region, including some of the nucleotide sequences of the DRC0004 gene (thiopurine S-methyltransferase) and DRC0007 (resolvase) gene were amplified by PCR, respectively.
  • Each PCR amplification product was purified after treatment with restriction enzymes KpnI and XhoI and BamHI and SphI, respectively, and the pAM1 plasmid into which the DR1475 gene sequence prepared in the above process was inserted was sequentially ligated to pAM1 treated with the same restriction enzyme, A final plasmid (pgroDR1475, SEQ ID NO: 9) was prepared to introduce the DR1475 gene into the genome of Deinococcus radiodurans (Fig. 4b).
  • a soluble cell (competent cell) of the Deinococcus radiodurans mutant strain in which the selection marker was removed and the DR0862 gene was additionally inserted was prepared, and in ⁇ Example 4-3>
  • the same method as in the transformation method of ⁇ Example 4-3> was performed to obtain a Deinococcus radiodurans mutant strain into which the DR1475 gene was additionally inserted.
  • pAM2 plasmid was inserted into the mutant strain in the same manner as in ⁇ Example 4-3>, and the selection marker was removed as the final strain in the present invention. and DR0862 and DR1475 were additionally introduced into the genome of the strain to prepare a Deinococcus radiodurans mutant strain.
  • the strain was inoculated in 3 ml TGY broth and cultured with shaking at 30°C and 200 rpm for 24 hours. After incubation, 10 ⁇ l of the culture solution was taken and dropped into TGY solid medium and TGY medium containing 25 ⁇ g/ml of kanamycin, respectively, and then cultured at 30° C. to confirm cell growth.
  • the selection marker was completely removed from the genome of the final mutant strain, and it was named the DX strain.
  • each Deinococcus radiodurans strain was cultured under the same conditions and method as in ⁇ Example 1-1> with the wild type.
  • UV-vis spectrophotometer Biotek, USA
  • absorbance OD 600
  • the DX strain appeared to show the same growth rate as that of the wild-type during the culture time of 30 hours, and after that, it was confirmed that although it decreased slightly compared to the growth rate of the wild-type, it continued to grow until 48 hours.
  • the Deinococcus radiodurans wild-type strain and the DX strain showed OD values of 18.6 and 15.2, respectively.
  • the production of deinoxanthin was confirmed from the deinococcus radiodurans strain cultured for 48 hours.
  • 10 ml of the culture solution of the strain cultured for 48 hours in the above process was transferred to a 15 ml tube, centrifuged at 4,000 rpm and 4° C. for 20 minutes to recover the cells and washed twice with 10 ml of sterile distilled water. Then, the cells were dried for 12 hours using a freeze dryer. After measuring the weight of the dried cells, 1 ml of MeOH was added to the suspension, and the cells were homogenized for 1 minute using a sonicator.
  • the extract was centrifuged at 4,000 rpm and 4°C for 20 minutes to separate from the cell lysate, and then the methanol extract containing deinoxanthin was filtered through a 0.2 ⁇ m PTPE injection filter, and 2 ml It was put in a brown HPLC tube, and HPLC analysis was performed under the same conditions and method as in ⁇ Example 1-2>.
  • the deinoxanthin concentration was converted by substituting the area of the detected peak into the prepared calibration curve, and the deinoxanthin production amount extracted from the radiodurans strain as Deinococcus was confirmed.
  • the DX strain was shown to produce deinoxanthin (112.38 mg/L) at a concentration about 3 times higher than that of the wild-type strain (37.25 mg/L), and 1 g of It was confirmed that there is a deinoxanthin production capacity of about 2.2 mg per dry cell weight (DCW). This shows a 4.5-fold increase in productivity compared to the wild-type (0.496 mg/g DCW) ( FIG. 6b ).
  • the TGY liquid medium prepared in ⁇ Example 1-1> was dispensed in 14 ml test tubes 3 ml each, and the Deinococcus radiodurans strain (ATCC13939) was inoculated and stirred at 30° C. and 200 rpm for 24 hours. cultured.
  • 1% of the culture solution was mixed with 10 g of tryptone per liter, 5 g of yeast extract, 10 g of glucose, 10 g of sodium glutamate (Daejung, Korea), 12 g of HEPES (Sigma, USA), 0.5 g of magnesium sulfate (Daejung, Korea) and 0.001 g of manganese chloride (Sigma, USA) were re-inoculated in 25 ml of HEPES broth prepared by dissolving, and incubated with stirring at 30°C and 200 rpm for 24 hours. , after which the temperature was changed to 30 °C, 32 °C, 37 °C and 40 °C and further incubated for 48 hours. And the cell growth rate was measured at intervals of 6 hours.
  • RNA precipitate RNA precipitate RNA precipitate.
  • 1 ml of 75% ethanol was added to wash impurities, and DNaseI (Takara, Japan) was treated to remove residual DNA, followed by reaction at 37° C. for 1 hour.
  • Pure RNA was obtained using RNAeasy clean up kit (Quiagene, USA), and the concentration of RNA was quantified at 1 ⁇ g, and then reacted at 50° C. for 1 hour using TOPscript cDNA synthesis kit (Engenomics, Korea). cDNA was synthesized.
  • the DR1343 gene was used as the house keeping gene, and the primer pairs RTDR1343F (SEQ ID NO: 32) and RTDR1343R (SEQ ID NO: 33) shown in Table 6 below were used, and the experimental method and conditions were the same as in the above experiment. .
  • the expression levels of groE, DR0862, and DR1475 genes of the DX strain were measured at a culture temperature of 37° C. set based on the expression pattern of the groE gene and the growth rate of the Deinococcus radiodurans wild-type strain shown in ⁇ Experimental Example 2-2>. .
  • RTDR0862F SEQ ID NO: 34
  • RTDR0862R SEQ ID NO: 35
  • real-time PCR was performed in the same manner as in ⁇ Experimental Example 2-2>, except that RTDR1475F (SEQ ID NO: 36) and RTDR1475R (SEQ ID NO: 37) primer pairs were used.
  • deinoxanthin was extracted from 10 ml of the DX strain under the above culture conditions, and the production of deinoxanthin was confirmed through HPLC analysis.
  • the DX strain cultured at 37 ° C was 159.9 mg/L, and about 31.4% higher deinoxanthin productivity than the DX strain (109.74 mg/L) cultured at 30 ° C.
  • the DX strain cultured at 37 ° C was 159.9 mg/L, and about 31.4% higher deinoxanthin productivity than the DX strain (109.74 mg/L) cultured at 30 ° C.
  • an increase in deinoxanthin production of about 42.3% was confirmed compared to the culture condition at 30° C. (2.1 mg/g DCW) ( FIG. 8b ).
  • Deinoxanthin was extracted from Deinococcus radiodurans mutant strain DX with high deinoxanthin production ability and the antioxidant scavenging ability of deinoxanthin was investigated using 2,2-Diphenyl-1-picrylhydrazyl (DPPH), an oxidative stress-inducing substance. Identified and compared with other carotenoids.
  • DPPH 2,2-Diphenyl-1-picrylhydrazyl
  • the DX strain was cultured in the same culture medium and culture conditions as the experimental conditions of ⁇ Experimental Example 2-1>, deinoxanthin was extracted from it using methanol, and then this was obtained to a concentration of 20 mg/L. was quantified.
  • standard products were used, and astaxanthin (cayman, USA), lycopene (Sigma, USA), beta-carotene (Sigma, USA), and phytoene (TRC, Canada) were each used at 20 mg/L.
  • deinoxanthin was found to have about 21.7% to 50.1% better antioxidant activity than other carotenoids ( FIG. 9 ).

Landscapes

  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 데이노잔틴 고생산능을 갖는 변이 균주의 제조방법 및 온도제어를 이용한 데이노잔틴 대량생산 방법에 관한 것으로, 본 발명의 방법으로 제조된 데이노잔틴 고생산능을 갖는 데이노코쿠스 라디오두란스 변이 균주는 대사공학적 방법을 도입하여 제조되었음에도 인위적으로 도입된 항생제 내성 유전자를 갖지 않는다. 또한, 상기 DR0862 ( crtB) 및 DR1475 ( dxs) 유전자가 동시 삽입된 데이노잔틴 고생산능을 갖는 데이노코쿠스 속 변이 균주를 통해, IPTG와 같은 유도물질을 이용하지 않고, 배양 온도를 제어함에 따라 DR0862 및 DR1475 유전자의 메신져 RNA (mRNA)발현을 조절함으로써 데이노잔틴의 생산량을 증대시킬 수 있는 바, 매우 경제적인 방법으로 고항산화능을 가진 데이노잔틴의 대량생산에 유용하게 사용될 수 있다.

Description

데이노잔틴 고생산능을 갖는 변이 균주의 제조방법 및 온도제어를 이용한 데이노잔틴 대량생산 방법
본 발명은 데이노잔틴 고생산능을 갖는 변이 균주의 제조방법과 온도조절 프로모터를 이용한 카로티노이드 유전자의 과발현 및 데이노잔틴 대량생산 방법에 관한 것으로, 열충격 내성 단백질인 groESL promoter를 이용하여 카로티노이드 유전자인 crtB와 dxs의 과발현을 유도하여 궁극적으로는 데이노잔틴의 생산성을 증대시키는 방법에 관한 것이다.
대사공학 (metabolic engineering)기술은 미생물 등의 유전체를 개량하여 대사회로를 재설계함으로써 목적물질의 생합성 및 생산성의 증대를 위하여 활용되는 기술이다. 대사 (metabolism)란 세포가 외부로부터 에너지원을 흡수하고, 생장 및 세포분화에 필요한 여러 대사산물을 다양한 생합성 경로를 통해 합성하는 일련의 작용을 통칭한다. 인류에 사용되는 대부분의 천연물은 세포 대사작용의 결과물로 다양한 기능을 가진 대사체 (metabolite)이다. 최근, 미생물 유전자의 조작을 통해서 세포 대사의 흐름 (metabolic flux)을 변경하여 유용한 대사물질의 생산량을 증대시키거나, 자연계에서 수득하기 어려운 물질을 생합성하는 합성생물학 (synthetic biology) 및 대사공학 (metabolic engineering) 기법 등이 개발되고 있다. 특히, 최근 대사공학 분야에서 CRISPR/Cas9, Flp/ FRT 및 cre/ lox와 같은 위치-특이적 유전자 재조합 기술은 식물, 효모, 미생물과 같은 다양한 생명체 모델에 적용되어 특정 대사산물의 대량생산에 이용되고 있다.
한편, 대표적인 극한환경 미생물로 알려진 데이노코쿠스 라디오두란스는 우주 및 방사능 오염지역과 같은 생명체가 생존하기 어려운 환경에서도 생장할 수 있는 것으로 알려져 있다. 이는 상기 균주의 효율적인 DNA 복구 시스템 (DNA repair system) 및 항산화 효소 그리고 비효소적 대사산물 등으로 인해 방사선에 의한 직접적 DNA 손상과 2차적으로 발생되는 활성산소종 (reactive oxygen species, ROS)으로부터 세포를 보호하고, 치명적인 세포손상에 대해 빠른 시간내에 정상적으로 복구할 수 있는 메카니즘이 발달되었기 때문이다. 특히, 상기 미생물은 세포대사 및 생존에 큰 저해를 유발하는 ROS에 대하여 강력한 소거능력 (scavenging activity)을 가진 신종 카로티노이드인 데이노잔틴 (Deinoxanthin)을 생산할 수 있다고 알려져 있다. 데이노잔틴은 라이코펜 (lycopene), 베타 카로틴 (beta-carotene) 및 루테인 (lutein) 등과 같은 항산화능이 있는 다른 유색 카로티노이드보다 더 높은 항산화력을 가진 것으로 알려져 있으며, HepG2, HT-29 및 PC-3등의 암세포의 분화 (proliferation) 및 생장 (growth)을 효과적으로 저해하는 항암기능도 포함하고 있음이 최근 연구보고에 의해 규명된 바 있다. 또한, 상기 물질은 저수지 등에서 녹조 및 홍조 현상 (algal bloom)을 일으키는 주요원인인 미세조류 (microalgae)의 생장을 저해할 수 있는 항생효과도 보고되는 등 그의 이용범위가 매우 넓은 것으로 알려져 있다.
현재까지의 선행연구결과들로부터 데이노코쿠스 라디오두란스 균주의 카로티노이드 생합성 유전자 및 데이노잔틴 대사회로가 보고된 바 있고, 상기 균주의 효율적인 유전체 개량을 위한 Cre-loxP 시스템 기반 분자유전학적 도구 (genetic tool)가 본 발명자로부터 개발된 바 있어 (대한민국 등록특허 제10-1835852호), 유전자 삽입 및 결실 등의 유전체 편집이 용이하다. 또한, 본 발명자들은 상기 방법을 이용하여 무색 카로티노이드이자 모든 카로티노이드의 전구체인 파이토엔 (phytoene)의 대량생산을 위한 돌연변이 균주 제조방법 개발에 성공한 바 있다 (대한민국 등록특허 제 10-1927892호). 그러나 상기에서 개발된 균주제조 방법을 포함하여 통상의 경우에 사용되는 유전자 과발현 단계는 플라스미드에 의한 외부유전자의 과발현과정이 수반되기 때문에 개량된 균체의 배양 및 발효시 선택마커 (selective marker)로써 고가의 항생제 투여가 필수적이다. 또한, 세포내 플라스미드의 불안정성 (plasmid instability)으로 인하여 최종 산물의 생산성 저하가 초래될 수 있다. 한편, 유전자 과발현을 위한 발현시스템으로써 주로 사용되는 lac 프로모터 및 tac 프로모터와 같은 IPTG (isoproqylthiogalactoside)유도 프로모터 (IPTG-inducible promoter)를 사용하게 되는데, 이는 고가의 유도물질 (inducer)을 사용하게 됨으로써 생산성과 경제성 측면에서 매우 불리하다.
이에, 본 발명자들은 대사공학적 방법을 도입하여 데이노잔틴을 대량생산할 수 있는 데이노코쿠스 라디오두란스 균주를 제조를 위해 노력하던 중 변형된 Cre-loxP 시스템 및 통상의 유전자 도입 방법을 이용하여 열내성 유전자 groE (DR0606)의 프로모터 (promoter) 염기서열과 연결된 DR0862 ( crtB) 및 DR1475 ( dxs) 유전자단량체 (monomer)가 각각 유전체에 삽입된 데이노코쿠스 라디오두란스의 변이 균주를 제조하였다. 또한, 본 발명자들은 IPTG와 같은 유도물질을 이용하지 않고, 배양 온도를 제어함에 따라 DR0862 및 DR1475 유전자의 메신져 RNA (mRNA)발현을 조절함으로써 데이노잔틴을 대량으로 제조할 수 있음을 확인하고, 본 발명을 완성하였다.
본 발명의 주된 목적은 Cre-loxP 시스템을 이용하여 열 내성 유전자인 DR0606( groE)의 프로모터 염기서열과 결찰된 DR0862 ( crtB) 및 DR1475 ( dxs) 유전자가 유전체 내로 삽입된 데이노코쿠스 라디오두란스 변이 균주를 제조하는 방법 및 상기 방법으로 제조된 데이노잔틴 고생산능을 가진 변이 균주를 제공하는 것이다.
본 발명의 또 다른 목적은 온도를 유도인자로 사용하여 상기 변이 균주로부터 데이노잔틴을 대량으로 생산하는 방법을 제공하는 것이다.
상기 목적을 달성하기 위해, 본 발명은 데이노코쿠스 속 균주의 유전체 내에 DR0862 ( crtB) 및 DR1475 ( dxs) 유전자가 동시 삽입된 데이노코쿠스 속 변이 균주를 제공한다.
또한, 본 발명은 상기 변이 균주를 배양하는 단계를 포함하는 데이노잔틴 생산 방법을 제공한다.
또한, 본 발명은 1) 제1 선택마커를 포함하는 lox 핵산 단편의 양 말단에 DR0862 및 DR1475가 각각 연결된 플라스미드를 제조하는 단계; 2) 상기 제조된 플라스미드 DNA를 데이노코쿠스 라디오두란스 균주에 도입하여 DR0862 및 DR1475유전자를 각각 삽입시키는 단계; 3) 상기 삽입 유전자에 포함된 제1 선택마커를 제거하는 단계; 및 4) 상기 수득된 변이 균주를 배양하여 제2 선택마커를 포함하는 벡터를 제거하는 단계를 포함하는 DR0862 및 DR1475 유전자가 동시 삽입된 데이노코쿠스 속 변이 균주의 제조방법을 제공한다.
본 발명의 방법으로 제조된 데이노잔틴 고생산능을 갖는 데이노코쿠스 라디오두란스 변이 균주는 대사공학적 방법을 도입하여 제조되었음에도 인위적으로 도입된 항생제 내성 유전자를 갖지 않는다. 또한, 상기 DR0862 ( crtB) 및 DR1475 ( dxs) 유전자가 동시 삽입된 데이노잔틴 고생산능을 갖는 데이노코쿠스 속 변이 균주를 통해, IPTG와 같은 유도물질을 이용하지 않고, 배양 온도를 제어함에 따라 DR0862 및 DR1475 유전자의 메신져 RNA (mRNA)발현을 조절함으로써 데이노잔틴의 생산량을 증대시킬 수 있는 바, 매우 경제적인 방법으로 고항산화능을 가진 데이노잔틴의 대량생산에 유용하게 사용될 수 있다.
도 1a는 야생형 데이노코쿠스 라디오두란스가 생산하는 데이노잔틴을 HPLC로 확인한 그래프이다.
도 1b는 데이노잔틴을 LC-MS로 확인한 그래프이다.
도 2는 데이노잔틴의 농도별 검량선을 나타낸 그래프이다.
도 3a는 DR0862유전자를 데이노코쿠스 라디오두란스의 유전체에 삽입하기 위한 플라스미드 제조방법을 도식화한 그림이다.
도 3b는 DR1475유전자를 데이노코쿠스 라디오두란스의 유전체에 삽입하기 위한 플라스미드 제조방법을 도식화한 그림이다
도 4는 데이노코쿠스 라디오두란스 균주의 유전체에서 DR0862 및 DR1475 유전자를 삽입시키는 과정 및 제 1 선택마커 제거과정을 도식화한 그림이다.
도 5a는 데이노코쿠스 라디오두란스 균주의 유전체에 DR0862와 DR1475유전자가 삽입되고 제 1 선택마커가 제거되었음을 PCR로 확인한 결과이다.
도 5b은 항생제 내성 유전자가 모두 제거되고, DR0862 및 DR1475 유전자가 삽입된 데이노코쿠스 라디오두란스 변이 균주를 선택배지에서 선별한 결과 사진이다.
도 6a는 본 발명의 방법에 따라 제조된 DR0862 및 DR1475 유전자가 삽입된 데이노코쿠스 라디오두란스 변이 균주의 생장곡선을 야생형 균주와 비교하여 나타낸 그래프이다.
도 6b는 본 발명의 방법에 따라 제조된 DR0862 및 DR1475 유전자가 삽입된 데이노코쿠스 라디오두란스 변이 균주의 데이노잔틴 생산량을 야생형 균주와 비교하여 나타낸 그래프이다.
도 7a은 데이노코쿠스 라디오두란스 야생형 균주의 배양온도별 생장곡선을 나타낸 그래프이다.
도 7b는 데이노코쿠스 라디오두란스 야생형 균주의 배양온도별 DR0606 ( groE)유전자의 발현량을 나타낸 그래프이다.
도 8a은 DR0862 및 DR1475 유전자가 삽입된 데이노코쿠스 라디오두란스 변이 균주 (DX)의 배양온도에 따른 DR0862 및 DR1475 유전자의 발현량을 비교한 그래프이다.
도 8b은 DR0862 및 DR1475 유전자가 삽입된 데이노코쿠스 라디오두란스 변이 균주 (DX)의 배양온도에 따른 데이노잔틴 생산량을 비교한 그래프이다.
도 9은 데이노잔틴 및 여러 카로티노이드의 DPPH 소거능을 비교한 그래프이다.
이하, 본 발명을 상세히 설명한다.
본 발명은 데이노코쿠스 속 균주의 유전체 내에 DR0862 및 DR1475 유전자가 동시 삽입된 데이노코쿠스 속 변이 균주를 제공한다.
본 명세서에서 사용된 용어, “데이노잔틴(deinoxanthin)”은 C 40H 54O 3로 구성된 (all-E)-2,1' dihydroxy-3'-4'-didehydro-1',2'-dihydro-β,ψ-carotene-4-one 화합물로 붉은 색을 띄는 카로티노이드를 말한다.
상기 데이노코쿠스 속 균주는 데이노코쿠스 라디오두란스( D. radiodurans), 데이노코쿠스 인디쿠스( D. indicus), 데이노코쿠스 카에니( D. caeni), 데이노코쿠스 아쿠아티쿠스( D. aquaticus), 데이노코쿠스 디폴리머란스( D. depolymerans), 데이노코쿠스 그란디스( D. grandis), 데이노코쿠스 데죠네시스( D. daejeonensis), 데이노코쿠스 라디오톨러란스( D. radiotolerans), 데이노코쿠스 지오써말리스( D. geothermalis), 데이노코쿠스 루버( D. ruber), 데이노코쿠스 안타티커스( D. antarcticus), 데이노코쿠스 프로테오리티쿠스( D. proteolyticus), 데이노코쿠스 라디오푸그난스( D. radiopugnans), 데이노코쿠스 라디오필러스( D. radiophilus), 데이노코쿠스 셀룰로실리티쿠스( D. cellulosilyticus) 및 데이노코쿠스 스웬시스( D. swuensis)로 구성된 군으로부터 선택되는 어느 하나 이상, 구체적으로는 데이노코쿠스 라디오두란스( Deinococcus radiodurans)일 수 있다.
본 명세서에서 사용된 용어, "DR0862" 유전자는 파이토엔 합성효소(phytoene synthase)를 암호화하는 유전자로서, 상기 파이토엔 합성효소는 전구체인 제라닐제라닐 파이로포스페이트(geranylgeranyl pyrophosphate)를 기질로 하여 파이토엔을 합성할 수 있다. 상기 DR0862 유전자는 통상의 기술분야에 알려진 어떠한 서열로 구성되는 폴리뉴클레오티드일 수 있다. 구체적으로, 상기 DR0862 유전자는 서열번호 3의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
본 명세서에서 사용된 용어, "DR1475" 유전자는 1-디옥시-D-자일룰로스-5-포스페이트 합성효소(1-deoxy-D-xylulose-5-phosphate synthase)를 암호화하는 유전자로서, 피루빈산염(pyruvate) 및 글루코즈-3-포스페이트(glucose-3-phosphate)를 기질로 사용하여 1-디옥시-D-자일룰로스-5-포스페이트를 합성할 수 있다. 상기 DR1475 유전자는 통상의 기술분야에 알려진 어떠한 서열로 구성되는 폴리뉴클레오티드일 수 있다. 구체적으로, 상기 DR1475 유전자는 서열번호 4의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
상기 DR0862 및 DR1475 유전자는 groE, katE, spac, dr1124 유전자 및 dr2577 유전자의 프로모터로 구성된 군으로부터 선택된 어느 하나 이상의 프로모터와 연결될 수 있다.
열내성 단백질 중 하나인 GroE 단백질은 분자적 샤페론 (molecular chaperone) 활성을 가지며, 산화 및 열자극 스트레스 등의 환경에서 강한 활성을 나타낸다. 또한, groE 유전자는 데이노코쿠스 라디오두란스의 일반적인 배양 조건에서도 강한 발현력을 갖을 수 있으므로, 통상의 기술분야에서 구성 프로모터 (constitutive promoter)로 매우 잘 알려진 바 있다. 또한, 높은 온도에 즉시 반응하여 그 발현량이 2배 이상 증대되는 특징을 가지고 있다.
본 발명에서 상기 groE 유전자의 프로모터는 DR0862 및 DR1475 유전자가 작동가능하게 연결될 수 있다.
상기 용어, "작동가능하게 연결된"은 핵산의 발현을 조절하는 서열과 목적하는 단백질을 코딩하는 염기 서열이 가능적으로 연결되어 있는 것을 의미한다. 재조합 플라스미드의 제조에서 작동가능하게 연결하는 것은 통상의 기술자에 의해 잘 알려진 방법으로 수행될 수 있다. 상기 groE 프로모터는 groES 유전자(NCBI GeneBank ID: 1800077)의 상위(upstream) 부분의 299 bp를 포함하는 폴리뉴클레오티드, 구체적으로 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
상기 열내성 유전자 groE (DR0606)의 프로모터 (promoter) 염기서열과 연결된 DR0862 ( crtB) 및 DR1475 ( dxs) 유전자단량체 (monomer)가 각각 유전체에 삽입된 데이노코쿠스 라디오두란스 균주는 우수한 데이노잔틴 생산능을 가진다.
상기 DR0826( crtB) 유전자는 데이노코쿠스 속 균주 유전체 내의 DRC0004와 DRC0005 유전자 사이에 삽입될 수 있고, DR1475( dxs) 유전자는 데이노코쿠스 속 균주 유전체 내의 DRC0007 유전자 내에 삽입될 수 있고, 바람직하게는 상기 DR0826( crtB) 유전자는 DR chromosome 1의 6401 내지 6560 번째 염기서열 사이에 삽입될 수 있고, DR1475( dxs) 유전자는 DR chromosome 1의 4310-4580번째 염기서열 사이에 삽입될 수 있으나 이에 한정되지 않으며, 상기 유전자 삽입 위치는 데이노코쿠스 라디오두란스 유전체내에서 특정기능을 가진 단백질을 암호화하고 있는 염기서열 (open reading frame)에 제한되지 않는 한도 내에서 어느 염기서열 부위라도 삽입이 가능하다.
본 발명의 구체적인 실시예에서, 본 발명자들은 야생형 데이노코쿠스 라디오두란스가 생산하는 데이노잔틴을 HPLC 및 LC-MS로 확인하였고(도 1 참조), 데이노잔틴의 농도별 검량선을 작성하였다(도 2 참조). 또한, 제1 선택마커를 포함하고, groE 프로모터에 의해 DR0862 또는 DR1475 유전자의 발현이 조절되는 플라스미드를 각각 제조하고(도 3 참조), DR0862 유전자의 데이노코쿠스 라디오두란스 유전체 삽입을 위한 플라스미드를 제조하여 데이노코쿠스 라디오두란스 세포로 도입한 후 pAM2 플라스미드를 삽입하여 변이 균주를 제조하였다(도 4a 참조). DR1475 유전자의 삽입을 위한 플라스미드를 제조하여 상기 데이노코쿠스 라디오두란스 세포로 도입한 후 pAM2 플라스미드를 삽입하여 최종 균주로 선택마커가 제거되고 DR0862와 DR1475가 동시 삽입된 변이 균주를 제조하였으며(도 4b 참조), 최종 균주의 변이를 확인한 결과 선택마커가 최종 변이 균주에서 완전히 제거됨을 확인하였다(도 5 참조).
또한, 본 발명의 구체적인 실시예에서, 본 발명자들은 상기의 방법에 따라 제조된 열내성 유전자 groE (DR0606)의 프로모터 (promoter) 염기서열과 연결된 DR0862 ( crtB) 및 DR1475 ( dxs) 유전자단량체 (monomer)가 각각 유전체에 삽입된 데이노코쿠스 라디오두란스 균주가 우수한 데이노잔틴 생산능을 나타내는 것을 확인하였다(도 6 및 도 7 참조). 또한, 본 발명의 데이노코쿠스 라디오두란스 변이 균주로부터 생산된 데이노잔틴의 항산화 효능을 확인한 결과, 데이노잔틴이 다른 카로티노이드에 비해 더 우수한 항산화능을 가진 것을 확인하였다(도 9 참조).
또한, 본 발명은 상술한 특징을 갖는 본 발명에 따른 변이 균주를 배양하는 단계를 포함하는 생산 방법을 제공한다.
상기 배양은 통상의 기술분야에 잘 알려진 적당한 배지 및 배양 조건에 따라 수행될 수 있다. 구체적으로, 상기 배양은 회분식, 연속식 또는 유가식 배양일 수 있다. 상기 데이노잔틴 생산 방법은 변이 균주를 배양하여 수득된 배양물로부터 데이노잔틴을 수득하는 단계를 추가로 포함할 수 있다. 상기 데이노잔틴의 수득은 통상의 기술자에 의해 적절히 수행될 수 있다.
상기 배양하는 단계는 35 내지 39℃에서 수행될 수 있고, 36 내지 38℃에서 수행될 수 있고, 바람직하게는 37℃에서 수행될 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 37℃에서 배양한 cre-lox 시스템을 이용한 DR0862 및 DR1475 유전자가 동시 삽입된 데이노코쿠스 라디오두란스 변이 균주가 30℃에서 배양된 변이 균주보다 높은 데이노잔틴 생산성을 나타냄을 확인하였다(도 8 참조).
또한, 본 발명은 1) 제1 선택마커를 포함하는 lox 핵산 단편의 양 말단에 DR0862 및 DR1475가 각각 연결된 플라스미드를 제조하는 단계; 2) 상기 제조된 플라스미드 DNA를 데이노코쿠스 라디오두란스 균주에 도입하여 DR0862 및 DR1475유전자를 각각 삽입시키는 단계; 3) 상기 삽입 유전자에 포함된 제1 선택마커를 제거하는 단계; 및 4) 상기 수득된 변이 균주를 배양하여 제2 선택마커를 포함하는 벡터를 제거하는 단계를 포함하는 cre-lox 시스템을 이용한 DR0862 및 DR1475 유전자가 동시 삽입된 데이노코쿠스 속 변이 균주의 제조방법을 제공한다.
본 명세서에서 사용된 용어, "Cre-loxP 시스템"은 DNA의 특정 부위에서 결실을 수행하는데 이용되는 통상의 위치특이적 재조합 효소기술을 의미한다. 상기 Cre-loxP 시스템은 진핵 및 원핵 생물에 대하여 목적하는 유전자를 돌연변이시키는데에 사용가능하다. 이는 단일 효소인 Cre 재조합 효소 (recombinase)로 구성되어 있고, 짧은 표적 서열인 loxP 서열을 재조합한다. 따라서, 변이를 유발시키고자 하는 위치에 loxP 서열을 배치함으로써, 목적 유전자가 불활성화 또는 결실되거나, 다른 유전자와 치환될 수도 있다. 일반적으로 loxP는 34개의 염기로 구성된 박테리오파지 P1 부위로 비대칭성 8 bp의 염기서열을 포함하고, 중앙에 2개의 염기를 제외하고는, 13 bp 크기인 2쌍의 회문구조(palindromic)를 갖는 것이 특징으로 알려져 있다 (ATAACTTCGTATA-NNNTANNN-TATACGAAGTTAT).
본 발명의 일 실시예에 따르면, 상기 lox 핵산 단편은 lox 단편을 양 말단에 갖는 제1 선택마커를 포함할 수 있다. 상기 lox 핵산 단편은 lox66 및 lox71으로 구성된 군으로부터 선택되는 어느 하나 이상의 lox 유전자를 단편의 양 말단에 포함할 수 있다. 구체적으로, 상기 lox 핵산 단편은 서열번호 1 및 2의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
본 명세서에서 사용된 용어, "선택 마커"는 특정 유전자의 산물을 의미한다. 상기 산물을 포함하는 미생물은 이를 포함하지 않는 미생물에는 나타나지 않는 특별한 형질을 가짐으로써, 이에 의해 목적하는 미생물의 선별을 가능하게 한다. 상기 선택 마커는 항생제 내성 유전자일 수 있다. 상기 항생제 내성 유전자는 카나마이신, 클로람페니콜, 스펙티노마이신 및 스트렙토마이신으로 구성된 군으로부터 선택되는 어느 하나 이상, 구체적으로, 카나마이신 및 클로람페니콜로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있다.
본 발명에서 과발현하기 위한 유전자 DR0862와 DR1475는 데이노코쿠스 라디오두란스의 카로티노이드 생합성 대사경로에서 대사의 흐름을 결정짓는 주요 효소 (rate-limiting enzyme)를 암호화하는 것으로 알려져 있으며, 두 유전자의 동시 과발현 시 카로티노이드 생합성 대사의 방향으로 그 흐름이 증가하여 목적하는 카로티노이드의 생산성이 향상된 선행 연구결과가 보고된 바 있다. 본 발명에서는 데이노코쿠스 라디오두란스의 DR0862와 DR1475 유전자를 외부 플라스미드의 도입없이 세포내에서 과발현시키기 위한 방법을 제공한다.
또한, 본 발명은 데이노코쿠스 라디오두란스 내의 과발현을 위해 상기 DR0862 및 DR1475 유전자에 열내성 단백질인 groE 유전자의 프로모터와 결찰된 플라스미드를 제조하는 단계를 제공한다.
열내성 단백질 중 하나인 GroE 단백질은 분자적 샤페론 (molecular chaperone) 활성을 가지며, 산화 및 열자극 스트레스 등의 환경에서 강한 활성을 나타낸다. 또한, groE 유전자는 데이노코쿠스 라디오두란스의 일반적인 배양 조건에서도 강한 발현력을 갖을 수 있으므로, 통상의 기술분야에서 구성 프로모터 (constitutive promoter)로 매우 잘 알려진 바 있다. 또한, 높은 온도에 즉시 반응하여 그 발현량이 2배 이상 증대되는 특징을 가지고 있다.
본 발명에서 상기 groE 유전자의 프로모터는 DR0862 및 DR1475 유전자가 작동가능하게 연결될 수 있다.
상기 용어, "작동가능하게 연결된"은 핵산의 발현을 조절하는 서열과 목적하는 단백질을 코딩하는 염기 서열이 가능적으로 연결되어 있는 것을 의미한다. 재조합 플라스미드의 제조에서 작동가능하게 연결하는 것은 통상의 기술자에 의해 잘 알려진 방법으로 수행될 수 있다. 상기 groE 프로모터는 groES 유전자(NCBI GeneBank ID: 1800077)의 상위(upstream) 부분의 299 bp를 포함하는 폴리뉴클레오티드, 구체적으로 서열번호 5의 염기서열로 구성되는 폴리뉴클레오티드일 수 있다.
구체적으로, 본 발명에 따른 데이노잔틴 고생산능을 가진 데이노코쿠스 라디오두란스 변이균주의 제조방법은 DR0862 및 DR1475 유전자를 동시에 데이노코쿠스 라디오두란스의 유전체에 삽입하는 것을 포함할 수 있다. 이때, 상기 도입된 균주는 Cre-loxP 시스템에 의하여 선택마커가 제거되고, groE 프로모터에 의해 DR0862 및 DR1475 유전자가 과발현될 수 있다. 한 균주에서 하나, 둘 또는 그 이상의 유전자를 목적 생명체의 유전체 내에 삽입되도록 조작하는 방법은 통상의 기술분야에 잘 알려져 있다. 또한, 상기 방법은 통상의 기술자에 의해 적절히 수행될 수 있다.
또한, 본 발명은 상기 DR0862 및 DR1475 유전자가 동시 삽입된 균주에 groE 프로모터, cre 재조합 효소를 코딩하는 유전자, 제2 선택마커 및 온도 감수성 repUts를 포함하는 벡터를 도입하여 제1 선택마커를 결실시키는 단계를 제공한다.
상기 groE 프로모터는 cre 재조합 효소와 작동가능하게 연결될 수 있다.
한편, 상기 제2 선택마커는 Kat 프로모터와 작동가능하게 연결될 수 있다. 이때, 상기 Kat 프로모터는 KatE1 유전자(NCBI GeneBank ID: 1800077)의 상위(upstream) 부분의 138 bp를 포함하는 폴리뉴클레오티드일 수 있다.
본 명세서에서 사용된 용어, "온도 감수성 repUts"는 특정 범위의 온도 내에서만 플라스미드가 복제가 가능하게 하는 유전자인 repU 유전자를 의미한다(H H Nguyen et al, Molecular Microbiology, 2009, 73(2), 240-252) 상기 유전자를 포함하는 플라스미드는 28℃의 배양 온도에서는 복제되어 숙주세포 내에서 플라스미드의 유지를 가능하게 하지만, 37℃의 배양 온도에서는 상기 플라스미드가 복제되지 않아 숙주세포 내에서 제거된다.
상기 repU 유전자 및 이를 포함하는 플라스미드는 통상의 기술분야에 잘 알려져 있다.
상기 제1 선택마커를 결실시키는 단계는 제1 선택마커의 양 말단에 결합한 lox 유전자가 cre 재조합 효소에 의해 인식되어 이들 부위를 절단함으로써, 제1 선택마커를 데이노코쿠스 속 균주의 유전체로부터 제거할 수 있다.
또한, 본 발명은 상기 수득된 변이 균주를 배양하여 제2 선택마커를 포함하는 벡터를 제거하는 단계를 제공한다.
상기 제2 선택마커의 제거는, 온도 감수성 마커인 repUts에 의하여 제2 선택마커를 포함하는 벡터가 특정 온도 범위 내에서는 복제되지 않는 특성을 사용할 수 있다. 따라서, 상기 단계는 변이 균주를 특정 온도 범위 내에서 일정 기간 동안 배양함으로써 제2 선택마커를 포함하는 벡터를 제거할 수 있다. 구체적으로, 상기 배양을 위한 온도는 30 내지 40℃, 구체적으로 31 내지 39℃, 더욱 구체적으로 33 내지 38℃일 수 있다.
상기 단계에 따라 수득된 변이 균주는 제1 및 제2 선택마커가 모두 제거됨으로써 항생제가 포함된 배지에서는 성장하지 못하는 특성에 기초하여 선별될 수 있다.
이하, 본 발명을 하기 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명이 이들에 의해 제한되는 것은 아니다.
<실시예 1> 야생형 데이노코쿠스 라디오두란스 균주 (ATCC13939) 배양 산물의 HPLC 및 LC-MS분석을 통한 데이노잔틴의 확인
1-1. 균주의 배양 및 배양 산물의 수득
먼저, 5 g의 트립톤(BD, 프랑스), 3 g의 효모 추출물(BD, 프랑스), 1 g의 포도당(Duksan, 한국)을 1 ℓ의 정제수에 용해하여 TGY 액체 배지를 제조한 후 121℃에서 15분 동안 가압멸균하였다. 상기 제조된 액체 배지를 14 ㎖ 테스트 튜브에 3 ㎖씩 분주하고, 데이노코쿠스 라디오두란스 균주 (ATCC13939)를 접종하여 30℃, 200 rpm의 조건으로 24시간 동안 교반하며 배양하였다. 배양 후, 1%의 배양액을 리터당 10 g의 트립톤, 5 g의 효모 추출물, 10 g의 포도당, 10 g의 소듐 글루타메이드 (Daejung, 한국), 12 g의 HEPES (Sigma, 미국), 0.5 g의 마그네슘 설페이트 (Daejung, 한국), 0.001 g의 망간클로라이드 (Sigma, 미국)를 용해하여 제조한 HEPES 액체배지에 50 ㎖에 재접종하여 30℃, 200 rpm의 조건으로 48시간 동안 교반하며 배양하였다. 배양 후, 배양액을 15분간, 4℃, 4,000 rpm의 조건으로 원심분리하여 세포를 회수하고, 여기에 5 ㎖의 메탄올를 첨가하여 현탁하였다. 1분 동안 초음파분쇄기 (ultrasonicator)로 분쇄한 후 상기와 같은 방법으로 세포로부터 추출물을 수득하였다. 수득된 추출물은 0.25 ㎛의 포어(pore) 크기를 갖는 여과지를 이용하여 여과하여 세포잔여물이 최종 제거된 순수 추출물을 수득하였다.
1-2. 고성능 액체크로마토그래피(HPLC) 분석을 통한 데이노잔틴 성상 분석
<실시예 1-1>에서 수득된 추출물을 이용하여 고성능 액체크로마토그래피(HPLC)를 통해 데이노잔틴 성상을 분석하였다.
구체적으로, 컬럼은 Zorbax Eclipse XDB-C18 5 ㎛(4.6 x 150 ㎜)를 사용하였고, 온도는 30℃, 유속은 0.5 ㎖/min으로 설정하고, UV파장은 470 nm로 설정하여 15분간 분석하였다. 한편, <실시예 1-1>에서 준비된 추출물은 5 ㎕를 주입하였다. 이동상은 아세토니트릴, 메탄올 및 이소프로판올이 40:50:10으로 배합된 것을 사용하였다.
그 결과, 도 1a에 나타낸 것과 같이 데이노코쿠스 라디오두란스 추출물은 5.944 min, 6.585 min, 7.003 min, 8.004 min, 13.262 min, 및 14.29 min의 머무름 시간(retention time)에서 각각의 피크가 검출됨을 확인하였다. 특히, 5.944의 머무름 시간에서 가장 높은 피크가 검출 됨을 확인하였다.
또한, 상기와 같은 조건에서 LC-MS분석 이온 스펙트럼 분석결과 583.9 m/z [M+H], 606.4 m/z [M+Na], 그리고 620.4 m/z [M+K]가 검출됨을 확인하였고, 이는 분자량 582.9 인 데이노잔틴과 일치함을 확인하였다 (도 1b).
따라서, HPLC결과에서 나타난 5.944 min의 머무름시간에 검출된 피크가 데이노잔틴임을 최종적으로 확인하였다.
<실시예 2> 데이노잔틴 정량을 위한 검량선 작성
데이노잔틴의 대한 효능에 관련된 연구들은 수행된 바 있으나, 현재까지 표준품은 출시되지 않은바, 데이노잔틴의 생산능 검증 및 정량분석을 위한 검량선 작성을 실시하였다.
구체적으로, 상기 <실시예 1-1> 에서 추출된 추출물은 회전농축기 (evaporator)를 이용하여 60℃, 80 rpm에서 1시간 동안 농축하고, 농축된 추출물은 동결건조기 (freeze dryer)를 사용하여 분말형태로 완전히 건조하였다. 건조된 분말을 저울로 10 mg으로 계량하여 10 ㎖의 메탄올에 완전용해하여 최종농도 1 g/L 농도의 표준품을 제조하였다. 표준품을 메탄올로 단계적으로 각각 희석 (serial dilution)하여 검량선 (standard curve)을 작성하였고, 작성된 검량선의 R 2값은 0.9998로 그 결과의 신뢰도가 매우 적절함을 확인하였다 (도 2). 또한, 각 농도에 해당되는 검출 피크의 적분값 (area)에 따라 결정된 수식은 y (area) = [3.4246 X 데이노잔틴 농도(mg/L)]+ 2.608로 나타났으며, 추후 실험 예에서의 데이노잔틴 농도는 상기 수식을 기반으로 계산하였다.
<실시예 3> groE 프로모터에 의해 DR0862 또는 DR1475 유전자의 발현이 조절되는 제2 선택마커를 포함하는 플라스미드의 제작
DR0862 및 DR1475 유전자는 데이노코쿠스 라디오두란스 염색체 DNA (chromosomal DNA)를 주형으로 사용하여 하기 표 1에 기재된 dr0862F1(서열번호 10) 및 dr0862R1(서열번호 11) 프라이머쌍과 dr1475F1 (서열번호 12) 및 dr1475R1 (서열번호 13)프라이머쌍 각각을 이용하여 PCR을 수행하였다.
구체적으로, 2 ㎕의 DNA 주형, 각각 1 ㎕의 프라이머(10 pmole/㎕) 및 17 ㎕의 멸균증류수의 혼합물을 AccuPower™ pfu PCR premix mix (Bioneer)에 첨가한 뒤, 이를 T-100 Thermal cycler DNA 증폭기(Bio-rad)를 이용하여 수행하였다. PCR과정은 95℃에서 5분 동안 반응시킨 뒤, 95℃ 30초, 60℃ 30초 및 72℃ 1분의 반응과정을 1회로 하여 이를 25회 반복함으로써 수행되었다.
서열번호 이름 서열(5'→3')
서열번호 10 dr0862F1 aagtactagtatgaggtctagggccggtt
서열번호 11 dr0862R1 ctatgcggccgctcagccgtggaccgcgccca
서열번호 12 dr1475F1 ctagactagtgtgaacgaacttcccggcac
서열번호 13 dr1475R1 taacgcggccgcctacacctcaatcggcacgt
수득된 PCR 산물을 1% 아가로즈 겔에서 전기영동하여 확인하고, 이를 DNA fragment purification kit(Intron lifetechnology)를 이용하여 정제하였다. 정제된 DR0862 또는 DR1475 PCR 산물과 pRADZ3 플라스미드(Meima R. and Lidstrom M. E., Applied environmental microbiology, 66:3856-3867)를 각각 SpeI 및 NotI 제한효소로 절단한 뒤, 결찰시켜 pRADZ3 내에 존재하는 groE 프로모터의 하위에 DR0862 또는 DR1475 유전자가 클로닝되도록 플라스미드 (pRADZ::DR0862, pRADZ::DR1475; 서열번호 6, 서열번호 7))를 제조하였다(도 3).
<실시예 4> 데이노코쿠스 라디오두란스 유전체에 groE 유전자 프로모터와 결합된 DR0862과 DR1475 유전자가 동시 삽입된 데이노코쿠스 라디오두란스 변이 균주의 제조
4-1. DR0862유전자의 데이노코쿠스 라디오두란스 유전체 삽입을 위한 플라스미드 제조
상기 <실시예 3> 에서 수득한 플라스미드를 주형으로 하여 groE 프로모터와 결합된 DR0862 유전자를 각각 증폭한 후 카나마이신 내성 유전자의 양 말단에 lox66 및 lox71 유전자를 포함하는 플라스미드 pAM1 (대한민국 등록특허: 제10-1835852호)의 카나마이신 유전자 상위부위에 각각 클로닝하였다.
구체적으로, DR0862 유전자의 염기서열이 포함된 플라스미드 주형 DNA 1 ㎕와 하기 표2 에 기재된 groEF1 (서열번호 14)와 dr0862R2 (서열번호 15) 프라이머 (10 pmole/㎕) 용액 각각 1 ㎕, 그리고 멸균 증류수 17 ㎕의 혼합물을 AccuPower™ pfu PCR premix mix (Bioneer)에 첨가하고, 상기 <실시예 3> 의 조건으로 PCR을 수행하였다. 수득된 PCR증폭물과 pAM1 플라스미드를 각각 제한효소 KpnI과 EcoRV으로 37℃에서 4시간동안 반응하여 절단하고, <실시예 3>의 조건으로 DNA를 정제한 후, 결찰하여 최종산물로써 pAM1 플라스미드의 염기서열 가운데 카나마이신 유전자 상위부위에 DR0862유전자가 삽입된 플라스미드를 수득하였다 (도 4a).
한편, 상동 재조합과정을 이용하여 DR0862유전자를 데이노코쿠스 라디오두란스에 삽입하기 위한 DNA단편을 수득하고, 이 단편 사이에 상기 과정에서 수득된 DNA단편 (DR0862, 카나마이신 내성유전자, lox66 및 lox71 염기서열이 결합된)과 결찰하기 위한 플라스미드를 구축하였다. 데이노코쿠스 라디오두란스 유전체에서 DRC0006 (hypothetical protein)유전자와 DRC0007 (hypothetical protein) 유전자의 염기서열을 일부 포함하는 상위부위 930 bp와 하위부위 914 bp를 각각 PCR 증폭하였다.
구체적으로는 데이노코쿠스 라디오두란스 2 ㎕와 drc0006-1 (서열번호 16)와 drc0006-2 프라이머 쌍(서열번호 17) 또는 drc0007-1 (서열번호 18)과 drc0007-2 (서열번호 19) 프라이머 쌍 1 ㎕를 첨가하는 것을 제외하고는 상기 <실시예 3> 과 동일한 조건 및 방법으로 PCR을 수행하여 각각의 PCR증폭물을 수득하였다. 그리고 수득된 PCR 증폭물 각각 1 ㎕와 drc0006-1 (서열번호 16)과 drc0007-2 (서열번호 19) 프라이머 쌍 1 ㎕를 첨가하고 역시 상기와 동일한 조건 및 방법으로 PCR을 수행하여 두 증폭물을 1,850 bp크기의 하나의 증폭물로 연결된 최종산물을 수득하였다. 이는 Enzynomic사의 TOP cloner kit에 포함된 T-vector에 결찰하였다. Escherichia coli DH5a 균주에 형질전환하였다. 상기 과정으로부터 제조된 플라스미드와 DR0862를 포함하고 loxP 염기서열과 카나마이신 내성유전자가 포함된 DNA단편을 각각 stuI으로 절단하고 이들을 결찰하여 데이노코쿠스 라디오두란스의 유전체에 DR0862 유전자를 도입하도록 하는 최종 플라스미드 (pgroDR0862, 서열번호 8)를 제조하였다 (도 4a).
서열번호 이름 서열(5'→3')
서열번호 14 groEF1 ctatggtacctcggcttggaagcacgtatt
서열번호 15 dr0862R2 ctatgatatctcagccgtggaccgcgccca
서열번호 16 drc0006-1 ttacctcactgtgccaagca
서열번호 17 drc0006-2 atgcgcaaatcagaccgtgcaggccttgacgacagccacgcactct
서열번호 18 drc0007-1 agagtgcgtggctgtcgtcaaggcctgcacggtctgatttgcgcat
서열번호 19 drc0007-2 gatgagacatttcctgtgta
4-2. 선택마커가 제거되고, DR0862유전자가 삽입된 데이노코쿠스 라디오두란스 변이 균주의 제조
상기 <실시예 4-1> 에서 최종 제조된 플라스미드를 데이노코쿠스 라디오두란스 세포로 도입하여 변이 균주를 제조하였다.
구체적으로, 데이노코쿠스 라디오두란스(ATCC 13939, 농업유전자원정보센터, 한국) 균주를 TGY 배지(0.5%(w/v)의 트립톤, 0.1%(w/v)의 글루코스 및 0.3%(w/v)의 효모 추출물)를 이용하여 30℃의 온도에서 OD 600의 값이 0.5에 도달할 때까지 배양하였다. 배양한 세포를 원심분리하여 30 mM의 칼슘클로라이드(CaCl 2)가 포함된 2x TGY 배지에 현탁한 뒤, 현탁액을 얼음에서 1시간 동안 정치시켰다. 이를 다시 원심분리하여 상등액을 제거하고 30 mM의 CaCl 2 및 10%(v/v) 글리세롤이 포함된 50 ㎕의 TGY 배지를 첨가하여 재현탁한 뒤, 멸균된 1.5 ㎖ 튜브에 50 ㎕ 씩 분주하여 준비하였다. 상기 <실시예 4-1> 에서 제조된 최종 플라스미드 10 ㎕을 분주된 데이노코쿠스 라디오두란스 세포에 넣고 30 mM CaCl 2 100 ㎕를 추가로 첨가한 뒤, ice에서 30분간 정치하고, 32℃에서 1시간 30분 동안 교반없이 배양하였다. 배양 후, 2X TGY액체배지 800㎕를 첨가하고 30℃, 200 rpm에서 12시간동안 배양하였다. 그 후, 배양액 200 ㎕를 취하여 25 ㎍/㎖의 카나마이신 항생제가 포함된 2X TGY 고체배지에 도말하고 30℃에서 3일간 배양한 뒤 생장된 콜로니로부터 선택마커인 카나마이신 내성유전자를 포함하고 DR0862유전자가 추가 삽입된 데이노코쿠스 라디오두란스 변이 균주를 수득하였다.
상기 과정으로부터 수득된 변이 균주를 상기 데이노코쿠스 라디오두란스 컴페턴트 세포 (competent cell)제조 방법과 동일한 방법으로 세포를 제조하고, 1 ㎍농도의 pAM2 플라스미드 DNA (대한민국 등록특허: 제10-1835852호)를 첨가하여 형질전환하고 이를 제2 선택마커 클로람페니콜 (3 ㎍/㎖)이 포함된 2X TGY 고체배지로부터 형질 전환된 데이노코쿠스 라디오두란스 변이 균주를 수득하였다. 상기 변이 균주를 TGY 액체배지에 접종하여 37℃에서 24시간 배양하여 pAM2 플라스미드를 변이 균주로부터 제거하여, DR0862가 추가 삽입되고 선택마커가 제거된 데이노코쿠스 라디오두란스 변이 균주를 제조하였다.
4-3. DR1475유전자의 데이노코쿠스 라디오두란스 유전체 삽입을 위한 플라스미드 제조
상기 <실시예 3> 에서 제조된 DR1475유전자의 염기서열이 포함된 플라스미드 주형 DNA 1 ㎕와 하기 표 2에 기재된 groEF2 (서열번호 20)와 표 3에 기재된 dr1475R2 (서열번호 21) 프라이머 (10 pmole/㎕) 용액 각각 1 ㎕를 첨가하는 것을 제외하고는 상기 <실시예 4-1> 와 동일한 방법 및 조건으로 PCR을 수행하였다. 수득된 PCR증폭물과 pAM1 플라스미드를 각각 제한효소 PstI과 EcoRV으로 37℃에서 4시간동안 반응하여 절단하고, 상기 <실시예 3> 과 동일한 방법으로 DNA정제 후, 결찰하여 pAM1 플라스미드의 염기서열 가운데 카나마이신 유전자 상위부위에 DR1475유전자가 삽입된 플라스미드를 수득하였다 (도 4b).
한편, 상기 <실시예 4-1> 과 동일한 방법을 이용하여 DR1475 유전자를 데이노코쿠스 라디오두란스 유전체에 도입하기 위한 DNA단편을 수득하고, 이 단편 사이에 상기 과정에서 수득된 DNA단편 (DR1475, 카나마이신 내성유전자, lox66 및 lox71 염기서열이 결합된)과 결찰하기 위한 플라스미드를 구축하였다. 데이노코쿠스 라디오두란스 유전체에서 DRC0004 유전자 (thiopurine S-methyltransferase)와 DRC0007 (resolvase) 유전자의 염기서열을 일부 포함하는 상위부위 1,150 bp와 하위부위 910 bp를 각각 PCR 증폭하였다. 구체적으로는 데이노코쿠스 라디오두란스 2 ㎕와 하기 표 3에 기재된 drc0004-1 (서열번호 22)와 drc0004-2 (서열번호 23)프라이머 쌍 또는 drc0005-1 (서열번호 24)과 drc0005-2 (서열번호 25) 프라이머 쌍 1 ㎕를 첨가하는 것을 제외하고는 상기 <실시예 3> 과 동일한 조건 및 방법으로 PCR을 수행하여 각각의 PCR증폭물을 수득하였다. 각각의 PCR 증폭물은 제한효소 KpnI과 XhoI 및 BamHI과 SphI으로 각각 처리 후 정제하고, 상기 과정에서 제조된 DR1475유전자 염기서열이 삽입된 pAM1플라스미드를 동일한 제한효소로 처리된 pAM1에 순차적으로 결찰시켜, 데이노코쿠스 라디오두란스의 유전체에 DR1475 유전자를 도입하도록 하는 최종 플라스미드 (pgroDR1475, 서열번호 9)를 제조하였다 (도 4b).
서열번호 이름 서열(5'→3')
서열번호 20 groEF2 ctcgctgcagtcggcttggaagcacgtatt
서열번호 21 dr1475R2 ctcggatatcctacacctcaatcggcacgt
서열번호 22 drc0004-1 cgtaggtaccgtgtggtaccacgccgatca
서열번호 23 drc0004-2 ccatctcgagctcgctgcagcgcaatcgagttcgtgcgaa
서열번호 24 drc0005-1 ccatggatccactctcacgtcaggccattt
서열번호 25 drc0005-2 ctcggcatgctgcttggcacagtgaggtaa
4-4. 선택마커가 제거된 DR0862및 DR1475 유전자가 동시 삽입된 데이노코쿠스 라디오두란스 변이 균주의 제조
상기 <실시예 4-2> 와 동일한 방법으로 선택마커가 제거되고 DR0862 유전자가 추가 삽입된 데이노코쿠스 라디오두란스 변이 균주의 수용성 세포 (competent cell)를 제조하고, <실시예 4-3> 에서 제조된 플라스미드 DNA를 첨가하여, 상기 <실시예 4-3> 의 형질전환 방법과 동일한 방법을 수행하여 DR1475 유전자가 추가로 삽입된 데이노코쿠스 라디오두란스 변이 균주를 수득하였다. 수득된 변이 균주로부터 제 1 선택마커 (카나마이신 내성유전자)를 제거하기 위하여 상기 <실시예 4-3> 와 동일한 방법으로 pAM2 플라스미드를 상기 변이 균주에 삽입하여 본 발명에서의 최종균주로써 선택마커가 제거되고 DR0862와 DR1475가 균주의 유전체에 추가 도입된 데이노코쿠스 라디오두란스 변이균주를 제조하였다.
4-5. 데이노잔틴 고생산을 위한 데이노코쿠스 라디오두란스 최종균주의 변이 확인
상기 <실시예 4-4> 에서 최종 수득된 데이노코쿠스 라디오두란스 변이균주에서 DR0862와 DR1475 유전자의 동시 삽입 및 제 1선택마커가 제거됨을 확인하기 위하여 상기 변이균주로부터 DNA를 추출하고 상기 유전자들이 삽입된 부위를 PCR하여 그 사이즈를 비교하였다.
구체적으로, 정제된 최종 변이 균주 DNA 2 ㎕, 하기 표 4에 표기된 diaDR0862F (서열번호 26) 및 diaDR0862R (서열번호 27) 프라이머 쌍 또는 diaDR1475F (서열번호 28) 및 diaDR1475R (서열번호 29) 프라이머 쌍 혼합물 (10 pmole/㎕) 1 ㎕, 그리고 7 ㎕의 멸균 증류수를 AccuPower PCR mix (바이오니아, 한국)에 넣고 초기 변성 조건 95℃에서 5분을 수행하고, 95℃에서 30초, 60℃에서 30초, 72℃ 5분의 조건을 30 번 반복 수행한 뒤 72℃ 5분 동안 반응하여 PCR하였다. 증폭된 산물은 1% 아가로즈겔에 5㎕ 씩 각각 로딩하여 전기영동하고 DNA밴드 크기를 확인하였다 (도 5a).
한편, 선택마커가 최종 변이 균주에서 완전히 제거되었음을 재확인하기 위하여 균주를 3 ㎖ TGY 액체배지에 접종하고 30℃, 200 rpm의 조건에서 24시간 동안 진탕배양하였다. 배양 후, 10 ㎕의 배양액을 취하여 TGY 고체배지와 25 ㎍/㎖의 카나마이신이 포함된 TGY배지에 각각 떨어뜨린 뒤, 30℃에서 배양하여 세포 생장 유무를 확인하였다.
그 결과, 제 1선택마커가 삽입된 각각의 돌연변이 균주만이 카나마이신 항생제가 포함된 TGY배지에서 생장하는 것을 확인하였고, 야생형 균주와 DR0862 및 DR1475 유전자가 추가 삽입되고 선택마커가 제거된 변이 균주는 각각 항생제가 없는 TGY에서만 생장함이 확인하였다.
이를 통해, 최종 변이 균주의 유전체에서 선택마커가 완벽히 제거되었음을 확인하였고, 상기 DX 균주라고 명명하였다.
서열번호 이름 서열(5'→3')
서열번호 26 diaDR0862F aatgggtatacctcagaacg
서열번호 27 diaDR0862R caggcaattactgctccaag
서열번호 28 diaDR1475F tccgaaagtacagtccgcac
서열번호 29 diaDR1475R agcgaggtagaacgaatcgt
실험예 1. 데이노코쿠스 라디오두란스 최종 변이균주로부터 데이노잔틴의 생산효과 확인
1-1. 데이노코쿠스 라디오두란스 야생형 및 변이 균주의 생장 곡선 및 데이노잔틴 생산량 비교
상기 <실시예 4-5> 에서 수득한 DX균주의 생장율 변화를 측정하기 위하여 야생형과 함께 상기 <실시예 1-1> 와 동일한 조건 및 방법으로 각 데이노코쿠스 라디오두란스 균주를 배양하였다. UV-vis spectrophotometer (Biotek, 미국)을 이용하여 48시간의 배양시간 동안 6시간의 간격으로 흡광도 (OD 600)를 측정하였다 (도 6a).
측정결과, DX균주는 30시간의 배양시간 동안은 야생형과 동일한 생장율을 보이는 것으로 나타나며, 그 이후, 야생형의 생장속도에 비해 약간 감소하지만 48시간까지 지속적으로 성장하는 것이 확인되었다. 48시간 동안 데이노코쿠스 라디오두란스 야생형 균주와 DX균주는 각각 18.6 및 15.2의 OD값을 나타내었다.
한편, 48시간동안 배양된 데이노코쿠스 라디오두란스 균주로부터 데이노잔틴 생산량을 확인하였다. 이를 위하여, 상기 과정에서 48시간 동안 배양된 균주의 배양액 10 ㎖을 15 ㎖ 튜브에 옮기고, 4,000 rpm, 4℃에서 20분간 원심분리하여 세포를 회수하고 10 ㎖의 멸균 증류수로 2회 세척하였다. 그런 다음, 동결건조기를 이용하여 12시간 동안 세포를 건조하였다. 건조된 세포의 중량을 측정한 뒤, 1 ㎖의 MeOH를 첨가하여 현탁하고, 초음파분쇄기를 이용하여 1분간 세포를 균질화 (homogenization)하였다. 이 과정을 2회 반복한 후, 추출액은 4,000 rpm, 4℃에서 20분간 원심분리하여 세포파쇄물과 분리한 뒤, 데이노잔틴이 포함된 메탄올추출액을 0.2 ㎛ PTPE 주사필터를 통하여 여과하고, 2 ㎖ 갈색 HPLC튜브에 담아 상기 <실시예 1-2> 와 동일한 조건 및 방법으로 HPLC 분석을 실시하였다. 측정 후, 검출된 피크의 면적을 작성된 검량선에 대입하여 데이노잔틴 농도를 환산하고, 데이노코쿠스로 라디오두란스 균주부터 추출된 데이노잔틴 생산량을 확인하였다.
그 결과 도 6b에 나타난 바와 같이, DX균주는 야생형 균주 (37.25 ㎎/L)에 비해 약 3 배 가량 더 높은 농도의 데이노잔틴 (112.38 ㎎/L)을 생산하는 것으로 나타났으며, 1 g의 세포건조중량 (dry cell weight, DCW) 당 약 2.2 ㎎의 데이노잔틴 생산능이 있음을 확인하였다. 이는 야생형 (0.496 ㎎/g DCW)에 비해 4.5 배 가량 증가된 생산성을 나타낸 것이다 (도 6b).
실험예 2. 배양 온도에 따른 데이노코쿠스 라디오두란스 변이 균주의 데이노잔틴 생산량 확인.
2-1. 데이노코쿠스 라디오두란스 야생형 균주의 배양온도별 생장곡선
상시 <실시예 1-1> 에서 제조된 TGY　액체 배지를 14 ㎖ 테스트 튜브 3 ㎖씩 분주하고 데이노코쿠스 라디오두란스 균주 (ATCC13939)를 접종하여 30℃, 200 rpm의 조건으로 24시간 동안 교반하며 배양하였다. 배양 후, １%의 배양액을 리터당 10 g의 트립톤, 5 g의 효모 추출물, 10 g의 포도당, 10 g의 소듐 글루타메이드 (Daejung, 한국), 12 g의 HEPES (Sigma, 미국), 0.5 g의 마그네슘 설페이트 (Daejung, 한국), 0.001 g의 망간클로라이드 (Sigma, 미국)을 용해하여 제조한 HEPES 액체배지에 25 ㎖에 재접종하여 30℃, 200 rpm의 조건으로 24 시간 동안 교반하며 배양하고, 그 후, 30℃, 32℃, 37℃ 및 40℃로 온도를 변경하여 48 시간 동안 추가 배양하였다. 그리고 6시간의 간격으로 세포의 생장율을 측정하였다.
그 결과 도 7a에 나타난 바와 같이, 상기의 배양조건에서는 32℃의 배양온도가 가장 높은 세포생장율을 나타내었으며 40℃의 경우 가장 낮은 세포생장율을 보였다 (도 7a).
2-2. 데이노코쿠스 라디오두란스 야생형 균주의 배양온도별 DR0606 ( groE ) 유전자의 발현 변화 측정
상기 <실험예 2-1>에서 배양된 야생형 균주 샘플로부터 열내성 유전자인 DR0606 유전자의 mRNA 발현량을 측정하기 위하여, 각 조건의 배양액을 1 ㎖ 씩 취하여 13,000 rpm, 4℃의 조건에서 3분간 원심분리하여 세포를 회수하였다. 그런 다음, RiboEX (진올, 한국) 용액을 1 ㎖ 첨가하여 현탁하고 2분간 상온에서 반응하였다. 세포파쇄를 위하여 bead beater (MP, 미국)를 이용하여 6,000 rpm에서 1분간 상온 조건에서 세포를 파쇄하고, 200 ㎕의 클로로포름 (대정화학, 한국)을 첨가한 뒤, 30초간 강하게 vortex하였다. 이후, 13,000 rpm, 4℃의 조건에서 15분간 원심분리하여 DNA, RNA등이 포함된 상등액 500 ㎕를 취하고, 여기에 이소프로판올 (대정화학, 한국) 500 ㎕를 첨가하여 RNA를 침전하고, 다시 원심분리하여 RNA 침전물을 수득하였다. RNA 정제를 위하여 1 ㎖의 75% 에탄올을 첨가하여 불순물을 세척하고, 잔존하는 DNA를 제거하기 위하여 DNaseI (타카라, 일본)을 처리한 뒤, 37℃에서 1시간동안 반응시켰다. RNAeasy clean up kit (Quiagene, 미국)을 이용하여 순수 RNA를 수득하고, RNA의 농도를 1 ㎍으로 정량한 뒤, TOPscript cDNA synthesis kit (엔지노믹스, 한국)를 이용하여 50℃에서 1시간동안 반응하여 cDNA를 합성하였다.
상기 과정에서 합성된 주형 cDNA 2 ㎕와 하기 표 5에 표기한 RTDR0606F(서열번호 30) 및 RTDR0606R (서열번호 31) 프라이머 쌍 2 ㎕, 그리고 2X SYBR green master mix (엔지노믹스, 한국) 10 ㎕, RNase-free 멸균증류수 6 ㎕를 한 튜브에 혼합하여 넣고, 95℃에서 10분 동안 RNA를 변성하고, 그 후, 95℃에서 10초 60℃에서 30초간 총 40회 반복하여 real-time PCR을 수행하고 이를 ΔCt방법으로 groE 유전자의 발현량을 측정하였다. house keeping 유전자로써 DR1343유전자를 이용하였고 사용된 프라이머는 하기 표 6에 표기한 RTDR1343F (서열번호 32) 및 RTDR1343R (서열번호 33)프라이머 쌍을 이용하였으며, 실험방법과 조건은 상기의 실험과 동일하게 하였다.
그 결과 도 7b에 나타난 바와 같이, 데이노코쿠스 라디오두란스 야생형 균주에서 groE 유전자의 발현은 온도가 증가함에 따라 증가하는 것으로 나타났으며, 30℃의 배양조건을 기준으로 하였을 때, 32℃는 1.11 Fold, 37℃는 4.24 Fold, 그리고 40℃의 배양조건에서는 13.65 Fold로 groE의 발현량이 점차 증가하는 것으로 확인되었다. 상기 실험에서 40℃의 배양조건에서 groE의 발현량이 가장 높으나, 이 조건에서는 데이노코쿠스 라디오두란스의 생장이 온도에 의해 크게 저해됨으로 데이노잔틴의 생산에 영향을 줄 수 있을 것이라 예상된다. 따라서, DX 균주에서 groE 프로모터와 연결된 DR0862 및 DR1475의 발현량을 증가시키며, 동시에 DX 균주의 생장을 용이하게 하기 위하여, 추후 데이노잔틴 고생산을 위한 배양온도 조건은 37℃이 가장 적합할 것으로 파악되였다.
서열번호 이름 서열(5'→3')
서열번호 30 RTDR0606F GTCAAGGAAGGCGACACCGT
서열번호 31 RTDR0606R TCGACAATGGCGAGCAGGTC
서열번호 32 RTDR1343F CAACGACCTGACCGACAACC
서열번호 33 RTDR1343R GGCTGCTTTCGTCGTACTCC
2-3. 배양온도 조절에 따른 DX 균주의 DR0862 및 DR1475 유전자 발현량 측정 및 생산량 비교
상기 <실험예 2-2> 에서 나타난 groE 유전자의 발현패턴 및 데이노코쿠스 라디오두란스 야생형 균주의 생장율을 토대로 설정된 배양온도 37℃에서 DX 균주의 groE, DR0862, 및 DR1475 유전자의 발현량을 측정하였다.
구체적으로, 상기 <실험예 2-2> 와 동일조건 및 방법으로 배양된 DX균주로부터 RNA 추출 및 cDNA합성 후, 이를 주형으로 하기 표5에 표기된 RTDR0862F (서열번호 34) 및 RTDR0862R (서열번호 35) 또는 RTDR1475F (서열번호 36) 및 RTDR1475R (서열번호 37) 프라이머쌍을 사용하는 것을 제외하고는 상기 <실험예 2-2> 와 같은 방법으로 real-time PCR을 수행하였다.
그 결과 도 8a에 나타난 바와 같이, 37℃의 배양조건에서 groE, DR0862, 그리고 DR1475 유전자는 비교군인 30℃의 배양조건에서 보다 각각 5.9 fold, 18.6 fold, 그리고 13.6 fold의 발현량이 증가하는 것으로 나타났다 (도 8a).
한편, 상기와 같은 배양조건의 DX균주 10 ㎖로부터 데이노잔틴을 추출하여, HPLC분석을 통해 데이노잔틴의 생산량을 확인하였다.
그 결과 도 8b에 나타난 바와 같이, 37℃에서 배양한 DX균주는 159.9 ㎎/L로 30℃에서 배양된 DX균주 (109.74 ㎎/L) 에서보다 약 31.4% 더 높은 데이노잔틴 생산성을 나타내었고, 세포건조중량 1 g당 데이노잔틴 3.7 mg을 생산함으로 30℃의 배양조건 (2.1 mg/g DCW) 보다 약 42.3%의 데이노잔틴 생산량의 증대가 확인되었다 (도 8b).
상기의 실험결과로부터 데이노코쿠스 라디오두란스에 의한 데이노잔틴의 생합성에 중요한 역할을 하는 DR0862 및 DR1475 유전자의 과발현은 최종적으로 데이노잔틴의 생산성 증대에 큰 영향을 미치는 것이 확인되었다.
서열번호 이름 서열(5'→3')
서열번호 34 RTDR0862F CAGGCCGTATTCGTCGAGCA
서열번호 35 RTDR0862R AACTCGGTCAGGCGATGCAG
서열번호 36 RTDR1475F CTGCGCGGGATGCTCAAGTA
서열번호 37 RTDR1475R ATTTCAGGTCCGGCCACGTC
실험예 3. 데이노코쿠스 라디오두란스 변이 균주로부터 생산된 데이노잔틴의 항산화 효능 확인
데이노잔틴 고생산능을 가진 데이노코쿠스 라디오두란스 변이 균주 DX로부터 데이노잔틴을 추출하여 산화스트레스 유발 물질인 2,2-Diphenyl-1-picrylhydrazyl (DPPH)를 이용하여 데이노잔틴의 항산화 소거능을 확인하고, 다른 카로티노이드들과 비교하였다.
구체적으로, 상기 <실험예 2-1>의 실험조건과 동일한 배양배지 및 배양조건에서 DX균주를 배양하고, 이로부터 메탄올을 이용하여 데이노잔틴을 추출한 뒤, 20 mg/L의 농도가 되도록 이를 정량하였다. 다른 카로티노이드는 표준품을 사용하였으며, 그 종류는 아스타잔틴 (cayman, 미국), 라이코펜 (Sigma, 미국), 베타-카로틴 (Sigma, 미국), 파이토엔 (TRC, 캐나다)을 각각 20 mg/L 사용하였다. 양성대조군으로 비타민 C 종류중 하나인 10 mg/L 농도의 아스코브산 (대정화금, 한국)을 사용하였고, DPPH (TCI,일본)은 25 mg/L를 에탄올에 용해하여 사용하였다. 200 ㎕의 DPPH 용액을 96 well titer plate에 분주하고, 각 카로티노이드 20 ㎕를 첨가한 뒤, 암조건 (dark condition)에서 30분간, 반응하고 이를 517nm 파장에서 흡광도를 측정하였다. 측정된 흡광도는 일련의 계산식 [(Control A517nm - Sample A517/Control A517nm)X 100]을 통하여 DPPH소거능 (%)을 계산하였다.
그 결과 도 9 에 나타난 바와 같이, 데이노잔틴은 다른 카로티노이드보다 약 21.7% ~ 50.1% 더 우수한 항산화능을 가진 것으로 나타났다(도 9).

Claims (11)

  1. 데이노코쿠스 속 균주의 유전체 내에 DR0862 및 DR1475 유전자가 동시 삽입된 데이노코쿠스 속 변이 균주.
  2. 제1항에 있어서,
    상기 데이노코쿠스 속 변이 균주는 데이노잔틴 고생산능을 갖는 것을 특징으로 하는, 데이노코쿠스 속 변이 균주.
  3. 제1항에 있어서,
    상기 데이노코쿠스 속 균주가 데이노코쿠스 라디오두란스( Deinococcus radiodurans)인 것을 특징으로 하는, 데이노코쿠스 속 변이 균주.
  4. 제1항에 있어서,
    상기 DR0862 및 DR1475 유전자는 groE, katE, spac, dr1124 유전자 및 dr2577 유전자의 프로모터로 구성된 군으로부터 선택된 어느 하나 이상의 프로모터와 연결된 것을 특징으로 하는, 데이노코쿠스 속 변이 균주.
  5. 제1항의 데이노코쿠스 속 변이 균주를 배양하는 단계를 포함하는 데이노잔틴 생산 방법.
  6. 제5항에 있어서,
    상기 배양하는 단계는 35 내지 39℃에서 수행되는 것을 특징으로 하는, 데이노잔틴 생산 방법.
  7. 1) 제1 선택마커를 포함하는 lox 핵산 단편의 양 말단에 DR0862 및 DR1475가 각각 연결된 플라스미드를 제조하는 단계;
    2) 상기 제조된 플라스미드 DNA를 데이노코쿠스 라디오두란스 균주에 도입하여 DR0862 및 DR1475유전자를 각각 삽입시키는 단계;
    3) 상기 삽입 유전자에 포함된 제1 선택마커를 제거하는 단계; 및
    4) 상기 수득된 변이 균주를 배양하여 제2 선택마커를 포함하는 벡터를 제거하는 단계를 포함하는, DR0862 및 DR1475 유전자가 유전체 내에 동시 삽입된 데이노코쿠스 속 변이 균주의 제조방법.
  8. 제7항에 있어서,
    상기 데이노코쿠스 속 균주가 데이노코쿠스 라디오두란스( Deinococcus radiodurans)인, 데이노코쿠스 속 변이 균주의 제조방법.
  9. 제7항에 있어서,
    상기 lox 핵산 단편이 lox66 및 lox 71으로 구성된 군으로부터 선택되는 어느 하나 이상의 lox 유전자를 단편의 양 말단에 포함하는, 데이노코쿠스 속 변이 균주의 제조방법.
  10. 제7항에 있어서,
    상기 제1 및 제2 선택마커가 항생제 내성 유전자인, 데이노코쿠스 속 변이 균주의 제조방법.
  11. 제10항에 있어서,
    상기 항생제 내성 유전자가 카나마이신, 클로람페니콜, 스펙티노마이신 및 스트렙토마이신으로 구성된 군으로부터 선택되는 어느 하나 이상인, 데이노코쿠스 속 변이 균주의 제조방법.
PCT/KR2021/005715 2020-06-15 2021-05-07 데이노잔틴 고생산능을 갖는 변이 균주의 제조방법 및 온도제어를 이용한 데이노잔틴 대량생산 방법 WO2021256703A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200072482A KR102160203B1 (ko) 2020-06-15 2020-06-15 데이노잔틴 고생산능을 갖는 변이 균주의 제조방법 및 온도제어를 이용한 데이노잔틴 대량생산 방법
KR10-2020-0072482 2020-06-15

Publications (1)

Publication Number Publication Date
WO2021256703A1 true WO2021256703A1 (ko) 2021-12-23

Family

ID=72707702

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/005715 WO2021256703A1 (ko) 2020-06-15 2021-05-07 데이노잔틴 고생산능을 갖는 변이 균주의 제조방법 및 온도제어를 이용한 데이노잔틴 대량생산 방법

Country Status (2)

Country Link
KR (1) KR102160203B1 (ko)
WO (1) WO2021256703A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102633212B1 (ko) 2020-12-07 2024-02-02 고려대학교 산학협력단 빛 조사 및 농부산물을 이용한 다이노잔틴의 대량생산방법 및 상기 방법으로 제조된 다이노잔틴을 유효성분으로 포함하는 녹조 제거용 조성물

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104152389A (zh) * 2014-08-29 2014-11-19 厦门大学 高效抑藻活性化合物Deinoxanthin及其制备方法与应用
JP2015502169A (ja) * 2011-12-23 2015-01-22 ディノベＤｅｉｎｏｖｅ 細菌及びその使用
KR20160062169A (ko) * 2013-10-11 2016-06-01 글리코박신 아게 숙주 세포 변형 방법
KR101835852B1 (ko) * 2016-12-27 2018-04-19 서울시립대학교 산학협력단 Cre-lox 시스템을 이용한 데이노코쿠스 속 미생물의 개량 방법
KR101961564B1 (ko) * 2017-10-30 2019-03-25 서울시립대학교 산학협력단 카로티노이드 생합성능이 향상된 변이 균주 및 상기 변이 균주의 제조 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2015502169A (ja) * 2011-12-23 2015-01-22 ディノベＤｅｉｎｏｖｅ 細菌及びその使用
KR20160062169A (ko) * 2013-10-11 2016-06-01 글리코박신 아게 숙주 세포 변형 방법
CN104152389A (zh) * 2014-08-29 2014-11-19 厦门大学 高效抑藻活性化合物Deinoxanthin及其制备方法与应用
KR101835852B1 (ko) * 2016-12-27 2018-04-19 서울시립대학교 산학협력단 Cre-lox 시스템을 이용한 데이노코쿠스 속 미생물의 개량 방법
KR101961564B1 (ko) * 2017-10-30 2019-03-25 서울시립대학교 산학협력단 카로티노이드 생합성능이 향상된 변이 균주 및 상기 변이 균주의 제조 방법

Also Published As

Publication number Publication date
KR102160203B1 (ko) 2020-09-25

Similar Documents

Publication Publication Date Title
EP0691405B1 (en) Materials and methods for hypersecretion of amino acids
EP0789073B1 (en) Production of tryptophan by the bacterium Escherichia coli
WO2017061805A1 (ko) 식물 원형질체로부터 유전체 교정 식물체를 고효율로 제조하는 방법
WO2018124440A2 (ko) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2019117398A1 (ko) 5&#39;-이노신산을 생산하는 미생물 및 이를 이용한 5&#39;-이노신산의 생산 방법
WO2021256703A1 (ko) 데이노잔틴 고생산능을 갖는 변이 균주의 제조방법 및 온도제어를 이용한 데이노잔틴 대량생산 방법
WO2019190193A1 (ko) 글라이신 생산능이 증가된 미생물 및 이를 이용한 발효 조성물 생산 방법
Kato et al. A point mutation in ftmD blocks the fumitremorgin biosynthetic pathway in Aspergillus fumigatus strain Af293
WO2023158175A9 (ko) 수송단백질 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법
Furuichi et al. Novel one-step cloning vector with a transposable element: application to the Myxococcus xanthus genome
WO2017034165A1 (ko) L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
WO2020196993A1 (ko) 변이형 포스포리보실피로포스페이트 아미도트랜스퍼라아제 및 이를 이용한 퓨린 뉴클레오티드 제조방법
WO2017034164A1 (ko) L-라이신 생산능을 가지는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신 생산방법
WO2015133678A1 (ko) 향상된 전환 활성을 가지는 l-아라비노스 이성화효소 변이체 및 이를 이용한 d-타가토스의 생산 방법
WO2019132510A2 (ko) 세포 소기관이 변이된 재조합 효모 및 이를 이용한 아이소프레노이드 생산 방법
Wang et al. An upp-based markerless gene replacement method for genome reduction and metabolic pathway engineering in Pseudomonas mendocina NK-01 and Pseudomonas putida KT2440
CZ288247B6 (en) DNA fragment, vector a microorganism containing genes for metabolic transformation of butyrobetaine/crotonobetaine-L-carnitine and process for preparing L-carnitine
EP1368480B1 (de) Verfahren zur veränderung des genoms von gram-positiven bakterien mit einem neuen konditional negativ dominanten markergen
WO2014137148A1 (ko) 향상된 전환 활성을 가지는 l-아라비노스 이성화효소 변이체 및 이를 이용한 d-타가토스의 생산 방법
WO2021125493A1 (ko) 다중약물 수송체의 활성을 증가시키는 유전적 변형을 포함하는 미생물, 및 그를 이용한 트립토판 대사체의 생산 방법
Ishihara et al. Cloning of a gene from Streptomyces species complementing argG mutations
US11142777B2 (en) Method for preparing mutant strain having high producibility of phytoene and mutant strain prepared thereby
Filkowski et al. Dissimilar mutation and recombination rates in Arabidopsis and tobacco
Bartolucci et al. Characterization and functional complementation of a nonlethal deletion in the chromosome of a β-glycosidase mutant of Sulfolobus solfataricus
WO2020116941A2 (ko) 디카르복시산 생산을 위한 미생물 및 이를 이용한 디카르복시산 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21826095

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21826095

Country of ref document: EP

Kind code of ref document: A1