WO2019235907A1 - Crispr/cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용 - Google Patents

Crispr/cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용 Download PDF

Info

Publication number
WO2019235907A1
WO2019235907A1 PCT/KR2019/006965 KR2019006965W WO2019235907A1 WO 2019235907 A1 WO2019235907 A1 WO 2019235907A1 KR 2019006965 W KR2019006965 W KR 2019006965W WO 2019235907 A1 WO2019235907 A1 WO 2019235907A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
nucleic acid
composition
gene
sequence
Prior art date
Application number
PCT/KR2019/006965
Other languages
English (en)
French (fr)
Inventor
이긍주
도옥화
사미나단
Original Assignee
충남대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020190051273A external-priority patent/KR20190139756A/ko
Application filed by 충남대학교 산학협력단 filed Critical 충남대학교 산학협력단
Priority to US16/973,140 priority Critical patent/US20210254086A1/en
Priority to KR1020207035219A priority patent/KR20210011394A/ko
Publication of WO2019235907A1 publication Critical patent/WO2019235907A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Definitions

  • the present application relates to compositions and their use for editing flavonoid biosynthetic genomes using the CRISPR / Cas9 system.
  • RNP Ribonucleoproteins complex
  • DNA-free non-GMO DNA-free non-GMO breeding technology
  • US USDA allows plant breeding through gene editing such as CRISPR and does not regulate it unlike the existing GMO.
  • the Agency has announced that new technology crops with simple gene deletions are not considered GMOs.
  • TGE Targeted genome editing
  • EN engineered nucleases
  • the present application is derived from the above-mentioned requirements. After the applicants have isolated and extracted the protoplasts of petunias, the present inventors have prepared a complex of guide9 RNA and Cas9 protein that targets the nucleotide sequence of the F3H (Flavone 3-hydroxylase) gene. RNP) was transduced into the extracted protoplasts. Subsequently, high resolution melting (HRM) and targeted deep sequencing analysis of the F3H position using wild-type and transgenic protoplasts revealed that an InDel mutation occurred at the target sequence position of the F3H gene. By confirming that the color variation occurred in the plants differentiated from the protoplasts induced by the mutation, the present application was completed.
  • HRM high resolution melting
  • the present application provides a guide RNA or a nucleic acid sequence encoding the same, which can form a complementary binding to the target sequence in the nucleic acid sequence of a factor related to the synthesis of anthocyanin flavonoids on genomic DNA in plants; And a Cas protein or nucleic acid sequence encoding the Cas protein which forms a complex with the guide RNA to cleave the nucleic acid sequence.
  • a composition comprising:
  • the nucleic acid encoding the guide RNA is a sequence identical or complementary to the target sequence adjacent to the PAM sequence recognized by the Cas protein, wherein the composition is composed of factors related to the synthesis of anthocyanin flavonoids on genomic DNA in the plant.
  • An artificial mutation is introduced in the nucleic acid sequence, and the composition provides a composition characterized by altering one or more color properties selected from the flowers, seeds, fruits, and leaves of the plant.
  • the present application provides a guide RNA or a nucleic acid sequence encoding the same, which can form a complementary binding to the target sequence in the nucleic acid sequence of a factor related to the synthesis of anthocyanin-based flavonoids on genomic DNA in plants; And introducing into the plant cell a composition comprising a Cas protein or a nucleic acid sequence encoding the Cas protein, which forms a complex with the guide RNA and cleaves the nucleic acid sequence. And regenerating the plant cells;
  • the re-differentiated plant cell contains an artificial mutation in the nucleic acid sequence of a factor related to the synthesis of anthocyanin flavonoids on genomic DNA,
  • Factors related to the synthesis of anthocyanin flavonoids is a gene of at least one selected from F3H, F3'H, F3'5'H,
  • the plant provides a method for producing a transformed plant, characterized in that the color characteristics are changed compared to the wild type.
  • the gene editing method of the present application has a small mutation that is indistinguishable from natural mutations and does not include an external gene, and thus, costs and time are different from GMO crops, which are expensive and time-consuming to assess safety and environmental hazards. It is expected to save money.
  • the method of the present application is an improved transient expression system, which can effectively change the color of seeds, fruits, and various organs of plants without the use of the classical transgenic method, and thus can be used in the horticultural field. It can be useful for color correction for functional and functional purposes.
  • Figure 2 shows five F3H (Flavanone 3-hydroxylase) target sgRNA sites determined using CRISPR RGEN Tools.
  • the square box portion represents the 3bp base of the PAM motif.
  • FIG. 3 is a fluorescence picture of petunia protoplasts transduced with a vector (PBI221: GFP) comprising the reporter gene GFP.
  • the triangular portion indicates the portion where GFP is expressed.
  • 9 is representative base mutation information of the F3H locus via targeted deep sequencing of cells inducing genome editing using sgRNA 1-5. Underlined and bold letters are the target sequences of nucleases, the square box portion represents the 3 bp base of the PAM motif, and the shaded portion represents the insertion mutation. An asterisk (*) next to the mutant sequence indicates a high frequency of variant type per sgRNA.
  • FIG 11 shows the results of amino acid analysis of wild type F3H (named WT F3H) and mutant F3H (named # 2 F3H) in Petunia.
  • 12 to 13 are sequencing analysis and indel results of petunia in which RNP mediated transformation of wild type F3Ha and F3Hb (named F3H-A_wt and F3H-B_wt, respectively).
  • FIGS 14-19 sequencing the mutant F3Ha and F3Hb (named F3H-A_1226P1C7, F3H-B_1226P1C7, F3H-A_1226P3C5, F3H-B_1226P3C5, F3H-A_1226P4C4, F3H-B_1226P4C4, respectively) and transfected with PNP. indel result.
  • FIG. 20 is a diagram showing the coloration of RNP mediated transgenic petunia plants with wild type F3H (named WT) and mutant F3H (named Allele # 2).
  • FIG. 21 shows the results of wild type F3H (named WT) and mutant F3H (named Allele # 2) planted in soil for visual evaluation of 0-DPA and 1-DPA colors of RNP mediated transgenic petunia plants.
  • FIG. 22 shows the results of absorbance measurements of anthocyanin contents of 0-DPA and 1-DPA petals of RNP mediated transgenic petunia plants of wild type F3H (named WT) and mutant F3H (named Allele # 2).
  • FIG. 23 shows three weeks of young leaves (A) of P. hybrida Cv midnight, cut into small pieces of about 0.5 ⁇ 0.5 cm (B), explants (C) for Agrobacterium mediated CRISRP / Cas9 transformation. The figure shown.
  • FIG. 24 shows sgRNA target sites (named sg2 target sites) of F3Ha and F3Hb determined using CRISPR RGEN Tools.
  • Figure 25 shows the results of amino acid analysis of wild type (F3H_a WT, F3H_b WT) and mutant (F3H_a Mutant, F3H_b Mutant) of F3Ha and F3Hb in P. hybrida Cv midnight.
  • mutant F3Ha and F3Hb (F3H-A_0324L4-1, F3H-B_0324L4-1, F3H-A_0324L9-1, F3H-B_0324L9-1, F3H-A_0324L9-2, F3H-B_0324L9-2, respectively) Sequencing analysis and indel results of Petunia transformed Agrobacterium mediated.
  • FIG. 32 is a diagram showing the coloration of Agrobacterium mediated transgenic petunia plants with wild type F3H (named Plant 1) and mutant F3H (named Plant 2).
  • the present application relates to methods for regulating the expression of the F3H gene in plants and compositions used therein.
  • the F3H gene affects the formation of various anthocyanin pigments in plants.
  • the F3H gene is a major gene for synthesizing Naringenin, Leucoanthocyanidins, anthocyanidins, etc., and is involved in the production of anthocyanin pigments by converting naringenin to dihydroflavonols.
  • the composition may affect anthocyanin pigment formation at various sites such as seeds, fruits, flowers, stems, leaves, etc. of plants.
  • the composition may affect anthocyanin pigment formation at one or more sites selected from seed, fruit, flower, stem, and leaf of the plant.
  • the composition may change the color of one or more sites selected from seeds, fruits, flowers, stems, and leaves of the plant by regulating the expression of the F3H gene in the plant.
  • the F3H gene herein is a term that includes both the F3'H gene and the F3'5'H gene.
  • Plants having the F3H gene may be, but are not limited to, plants belonging to the family Solanaceae, Rosaceae, Asteraceae.
  • Plants belonging to the family of branches may be, for example, but not limited to eggplant, mandrake, potatoes, tobacco, tomatoes, petunias and the like.
  • Plants belonging to the rosaceae may be rose, white plum, yellow plum, cherry tree, etc., but is not limited thereto.
  • Plants belonging to the Asteraceae may be chrysanthemum, gold fire, forget-me-not, dandelion, etc., but are not limited thereto.
  • the plant may be, but is not limited to, petunia, rose, chrysanthemum, and the like.
  • the specification provides, in one aspect, a method for regulating the expression of the F3H gene in a plant.
  • It provides a method of changing the color characteristics of plants using a method of controlling the expression of the F3H gene.
  • a plant comprising a guide RNA specific for a target nucleotide sequence of the F3H (Flavone 3-hydroxylase) gene or a nucleic acid sequence encoding the same, and an endonuclease protein or a nucleic acid sequence encoding the same. Artificially editing the genome by introducing it into a cell; And
  • It provides a method for producing a plant having a color mutant trait comprising the step of regenerating the plant from the plant cell of the genome edited.
  • it may be performed in the form of a complex of guide RNA and endonuclease protein specific for the target sequence of the F3H (Flavone 3-hydroxylase) gene.
  • F3H Fravone 3-hydroxylase
  • the method may be performed in the form of a vector including a nucleic acid sequence encoding a guide RNA specific for a target sequence of the Flavone 3-hydroxylase (F3H) gene and a nucleic acid sequence encoding an endonuclease protein.
  • F3H Flavone 3-hydroxylase
  • It provides a method for producing a petunia plant having a color change trait, comprising the step of regenerating the petunia plant from the petunia plant cells edited in the genome.
  • the term "genome editing” is a technique capable of introducing or inducing target-directed mutations in the genome sequences of animal and plant cells, including human cells, and deletion of one or more nucleic acid molecules by DNA cleavage.
  • said genome editing may be to introduce mutations into plants, in particular using Cas9 protein and guide RNA. It may be used interchangeably with the term gene editing.
  • target gene or "target genome” refers to some DNA in the genome of a plant to be edited through this application. That is, in principle, it is not limited to the type of the gene, and may include both coding regions and non-coding regions. Those skilled in the art can select the target gene according to the desired mutation for the genome editing plant to be produced according to the purpose.
  • the target gene may be a gene associated with anthocyanin-based flavonoid synthesis.
  • Genes related to anthocyanin-based flavonoid synthesis may be F3H (Flavone 3-hydroxylase), F3'H (Flavone 3-hydroxylase), F3'5'H (flavonoid 3 ', 5'-hydroxylase), etc., but is not limited thereto. .
  • the F3H, F3'H, F3'5'H and the like may be associated with pigment formation such as flowers and fruits.
  • the target gene may be a Petunia (hybrida) -derived F3H (Flavone 3-hydroxylase) gene, preferably a gene consisting of the nucleotide sequence of SEQ ID NO: 36 , but not limited to this.
  • the genome of the plant may have a F3H gene.
  • the F3H gene may be one or more selected from wild type or mutant.
  • the mutant type may have a single nucleotide polymorphism (SNP).
  • SNP single nucleotide polymorphism
  • the genome of the plant in the present application may have a F3H wild type gene.
  • the genome of the plant in the present application may have a mutant gene with F3H SNP.
  • the mutant gene having the F3H SNP may be at least one selected from SEQ ID NOs: 52 to 53.
  • guide RNA refers to RNA specific for DNA encoding a nucleotide sequence of a target gene, and all or a part of the target DNA nucleotide sequence complementarily binds to the target DNA nucleotide sequence. It refers to ribonucleic acid that plays a role in driving the endonuclease protein.
  • the guide RNA includes two RNAs, ie, dual RNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as a component; Or a single chain guide RNA (sgRNA) form comprising a first site comprising a sequence in whole or in part complementary to a nucleotide sequence in a target DNA and a second site comprising a sequence interacting with an RNA-guided nuclease.
  • sgRNA single chain guide RNA
  • the RNA-guided nuclease may be included in the scope of the present application without limitation.
  • the guide RNA according to the present application may preferably be in the form of a single stranded guide RNA, but is not limited thereto, according to the type of endonuclease used or microorganisms derived from the endonuclease, etc. according to techniques known in the art. You can choose appropriately.
  • the guide RNA may be transcribed from a plasmid template or transcribed in vitro (eg, oligonucleotide double strand), but is not limited thereto.
  • the guide RNA is specifically designed for the target nucleotide sequence of the F3H gene
  • the target nucleotide sequence of the F3H gene is SEQ ID NO: 1 to 5, for example It may be at least one selected from the group consisting of the base sequence of. In one embodiment, but may be composed of the nucleotide sequence of SEQ ID NO: 2, but is not limited thereto. Also, as another example, at least one selected from the group consisting of the nucleotide sequence of SEQ ID NO: 37 to 41. In another example, at least one selected from the group consisting of SEQ ID NOs: 49 to 50.
  • the guide RNA may be at least one selected from SEQ ID NOs: 42 to 46.
  • the guide RNA may be at least one selected from SEQ ID NOs: 47 to 51.
  • the guide RNA may be at least one selected from SEQ ID NOs: 56 to 57.
  • the guide RNA may be at least one selected from SEQ ID NO: 60 to 61.
  • the endonuclease protein Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease), ZFN ( Zinc Finger Nuclease) or a functional analog thereof, and one or more selected from the group consisting of, preferably, Cas9 protein, but is not limited thereto.
  • Cas9 protein or gene information can be obtained from known databases such as GenBank of the National Center for Biotechnology Information (NCBI).
  • the Cas9 protein may be a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, Streptococcus thermophilus or Streptococcus thermophilus
  • Cas9 protein from Streptocuccus aureus, Cas9 protein from Neisseria meningitidis, Cas9 protein from Pasteurella multocida, Francisella novicea novicida) may be one or more selected from the group consisting of, for example, Cas9 protein and the like, but is not limited thereto.
  • Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces a double stranded DNA break.
  • a short base consisting of three bases known as Protospacer Adjacent Motif (PAM) must exist next to the base sequence of the target DNA.
  • PAM Protospacer Adjacent Motif
  • the guide RNA and the endonuclease protein form a ribonucleic acid-protein (ribonucleoprotein) complex to operate with RNA-Guided Engineered Nuclease (RGEN).
  • ribonucleoprotein RNA-Guided Engineered Nuclease
  • Plants made by the production method of the present invention are advantageous in that the regulation of the expression of the F3H gene is permanent because the plant is controlled by the expression of the genomic DNA of the F3H gene, rather than the expression of the F3H gene.
  • the CRISPR / Cas9 system used in the present application introduces a double-helix cut at a specific position of a specific gene to be edited to induce an insertion-deletion (InDel) mutation caused by incomplete repair induced by DNA repair.
  • InDel insertion-deletion
  • the guide RNA and the endonuclease protein may be transduced directly into the host cell in the form of a ribonucleic acid-ribonucleoprotein complex, or encoding the guide RNA It may be prepared in the form of a recombinant vector comprising a nucleic acid sequence encoding DNA and endonuclease protein and transduced into a host cell, but is not limited thereto.
  • the method of transducing a complex of the guide RNA and the endonuclease protein to plant cells is a calcium / polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296: 72- 74; Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373), electroporation of protoplasts (Shillito et al., 1985, Bio / Technol. 3: 1099-1102), brown rice to plant elements Injection method (Crossway et al., 1986, Mol. Gen. Genet.
  • plant cell may be any plant cell.
  • Plant cells may include plant cells derived from any part of the plant, such as roots, stems, leaves, flowers, seeds, and the like.
  • plant cells may be cultured cells, cultured tissues, culture organs, and plant cells may be differentiated or undifferentiated plant tissues, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues and cultures.
  • Plant means the whole plant containing the plant cells.
  • the plant cells of the present application can be protoplasts.
  • the plant cell of the present application may be a leaf-derived plant cell.
  • a method for regenerating a genome-edited plant from a genome-edited plant cell may use any method known in the art. Genome-edited plant cells should be re-differentiated into whole plants. Techniques for the regeneration of mature plants from callus or protoplast cultures are well known in the art for numerous different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989 Momillan, N.Y.).
  • Another aspect of the present application relates to a composition for changing the color of a plant.
  • the composition can be used for use in changing the color of parts of plants, such as seeds, fruits, flowers, leaves, stems and the like.
  • the composition may be an expression control composition capable of controlling the expression of factors related to anthocyanin-based flavonoid synthesis.
  • Factors related to the synthesis of the anthocyanin-based flavonoids may be F3H (Flavone 3-hydroxylase), F3'H (flavonoid 3'-hydroxylase), F3'5'H (flavonoid 3 ', 5'-hydroxylase), but not limited thereto. I never do that.
  • composition alters the color of the plant by regulating the synthesis of anthocyanin-based flavonoids involved in the expression of the F3H gene.
  • composition modulates expression of the factor by editing the DNA sequence of the factor associated with the synthesis of anthocyanin flavonoids on genomic DNA present in the plant.
  • Such gene editing refers to the introduction of artificial mutations in the sequence encoding factors related to the synthesis of anthocyanin flavonoids in plant genomic DNA.
  • the artificial mutation includes a mutation that inserts, deletes, substitutes, or reverses one or more nucleic acids in part or all regions of the genomic sequence of a wildtype gene.
  • the composition may reduce or increase the expression of the factor by deleting a part of the DNA sequence of the factor related to the synthesis of anthocyanin flavonoids present in the plant.
  • the composition may reduce or increase the expression of a corresponding factor by inserting an exogenous DNA sequence into a factor related to the synthesis of anthocyanin-based flavonoids present in the plant.
  • the composition may reduce or increase the expression of a corresponding factor by forming an indel in the DNA sequence of a factor related to the synthesis of anthocyanin-based flavonoids present in the plant.
  • the composition may reduce or increase the expression of a corresponding factor by replacing a part of a DNA sequence of a factor related to the synthesis of anthocyanin-based flavonoids present in a plant.
  • the composition can reduce or increase the expression of the factor by inverting a portion of the DNA sequence of the factor involved in the synthesis of anthocyanin flavonoids present in the plant.
  • the artificial mutation can be introduced onto the plant genome using an engineered nuclease.
  • the artificial nuclease may include zinc-finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs), clustered regularly interspaced short palindromic repeats (CRISPR-associated sequences), and the like.
  • ZFNs zinc-finger nucleases
  • TALENs transcriptional activator-like effector nucleases
  • CRISPR-associated sequences clustered regularly interspaced short palindromic repeats
  • the expression control composition of the present application may be a composition using CRISPR / Cas.
  • the expression control composition in one embodiment of the present specification, the expression control composition,
  • the expression control composition in one embodiment, is the expression control composition
  • Cas proteins that cleave or modify a targeting site in a nucleic acid sequence can be included. That is, the composition may be in the form of a ribonucleoprotein (RNP).
  • RNP ribonucleoprotein
  • the guideRNA may bind complementary to the target sequence of a factor related to the synthesis of anthocyanin-based flavonoids.
  • the target sequence is a nucleotide sequence existing in the target gene or nucleic acid, and has complementarity with the sequence of the guideRNA.
  • the target sequence since the double strand of the target gene or nucleic acid, the target sequence may be part or all of the double strand.
  • the target sequence may be a nucleic acid sequence of an exon, intron, or a combination of factors related to the synthesis of anthocyanin flavonoids.
  • the guide RNA may bind complementary to the exon of F3H.
  • the guide RNA may bind complementary to the exon of F3'H.
  • the guide RNA may bind complementary to the exon of F3'5'H.
  • the target sequence may be variously selected based on the PAM sequence in the guide nucleic acid design step.
  • a guide nucleic acid capable of forming a complementary binding to a target region of a gene may be obtained by collecting nucleotide sequence data of a gene using a target nucleic acid or a nucleotide sequence of a gene using a database (eg, NCBI).
  • the site where the PAM sequence (for example, 5'-NGG-3 ') exists in the base sequence can be found, and a base sequence of ⁇ 20 bp can be selected and designed from the PAM sequence.
  • the "proto-spacer-adjacent Motif (PAM) sequence” is a nucleotide sequence that can be recognized by Cas protein. Different PAM sequences can be derived from Cas.
  • the PAM sequence may be one or more of the following sequences (described in the 5 'to 3' direction).
  • N is A, T, C or G
  • N is each independently A, T, C or G, R is A or G, and Y is C or T;
  • NNAGAAW N is each independently A, T, C or G, and W is A or T;
  • N are each independently A, T, C, or G;
  • NNGRR (T), wherein each N is independently A, T, C or G, and R is A or G;
  • TTN (N is A, T, C or G).
  • the guide RNA may be a dual guide RNA including crRNA (CRISPR RNA) and / or tracrRNA (trans-activating crRNA), respectively, or a form in which the crRNA and a specific site of the tracrRNA are fused. sinlge-chain guide RNA).
  • CRISPR RNA CRISPR RNA
  • tracrRNA trans-activating crRNA
  • the Cas protein may be Cas9 or Cpf1.
  • the Cas9 is Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dasonville , Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporium roseum (Streptosporangium) , Streptosporangium roseum, AlicyclobacHlus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireduceus bacillus bacilli Exiguobacterium sibiricum, Lactobacillus Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaramonas naphthalenican boran (Polaromonas na polarans) Poloromonas sp.,
  • the Cpf1 is Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacterium, Rectolibacterium, Clostriac Pr.
  • Cpf1 derived from Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Methylobacterium or Acidaminococcus.
  • the Cas9 may be spCas9 derived from Streptococcus pyogenes.
  • the target sequence may be one or more selected from SEQ ID NOs: 1 to 5.
  • the guide RNA may be one or more selected from SEQ ID NOs: 42 to 46.
  • the target sequence may be one or more selected from SEQ ID NOs: 37 to 41.
  • the guide RNA may be one or more selected from SEQ ID NOs: 47 to 51.
  • the target sequence may be one or more selected from SEQ ID NOs: 54 to 55.
  • the guide RNA may be one or more selected from SEQ ID NOs: 56 to 57.
  • the target sequence may be one or more selected from SEQ ID NOs: 58 to 59.
  • the guide RNA may be at least one selected from SEQ ID NO: 60 to 61.
  • the expression control composition may be provided in the form of a vector.
  • Such vectors include nonviral vectors and viral vectors.
  • the viral vector may be, but is not limited to, an adenovirus vector, a retrovirus vector, a binary vector, a lentiviral vector, an adeno-associated virus (AAV) vector, a vaccinia virus vector, a poxvirus vector, a herpes simplex virus, and the like.
  • the non-viral vector may be a plasmid, naked DNA, liposome, or the like, but is not limited thereto.
  • the expression control composition may be provided to the plant cells in a variety of ways that can typically transport the gene.
  • electroporation for example, electroporation, gene guns, ultrasound, self-injection, polyethylene glycol (PEG), Agrobacterium, transient cell compression or squeezing, lipid-mediated transfection, nanoparticles, silica And the like.
  • PEG polyethylene glycol
  • Agrobacterium for example, electroporation, gene guns, ultrasound, self-injection, polyethylene glycol (PEG), Agrobacterium, transient cell compression or squeezing, lipid-mediated transfection, nanoparticles, silica And the like.
  • the expression control composition can be used to control the expression of these factors by editing factors related to the synthesis of anthocyanin-based flavonoids on the genomic DNA in the plant.
  • the editing may be one or more selected from knock-out, knock-in, and knock-down.
  • the color of a plant for example, the color of a plant, can be altered by inhibiting (or reducing or inactivating) or promoting (or enhancing or activating) the expression of a factor associated with flavonoid synthesis.
  • composition of the present application and a method of using the same have the following advantages.
  • the RNAi is used as a means of regulating post transcription gene expression and does not substantially change the sequence of the genome. Therefore, when the transfer amount of the above factors in the plant is changed due to the influence of the environment, it is difficult to maintain the consistency of the color representation, and there is a high possibility that an unintended phenotype is generated by the continuous off-target effect.
  • foreign gene insertion since foreign gene insertion is essential, it is classified as GMO and thus there is a limitation in commercialization.
  • factors related to the synthesis of anthocyanin-based flavonoids on plant genomic DNA for example, F3H (Flavone 3-hydroxylase), F3′3-hydroxylase, F3′5′H
  • F3H flavone 3-hydroxylase
  • F3′3-hydroxylase F3′5′H
  • One embodiment of the present application provides a composition for changing the color of petunia and a method of changing the petunia color.
  • the present invention provides a genome-edited petunia plant having a color shift trait produced by the production method of the present application, and a seed in which the genome of the plant is edited.
  • Genome-edited petunia plants with color-mutated traits are edited F3H genes of flavonoid biosynthetic pathways affecting anthocyanin pigment using the CRISPR / Cas9 system. to be.
  • the genome editing petunia plant according to the embodiment of the present application is characterized in that the anthocyanin content of the petal is significantly reduced compared to the wild type petunia, the petal of the wild type petunia is dark purple while the petal of the genome editing petunia is light pink.
  • the present application also provides a composition for editing a genome for mutating the color of a petunia plant, which contains a complex of an endonuclease protein and a guide RNA specific for a target sequence of a petunia-derived F3H gene.
  • the genome editing composition of the present application includes a complex of an endonuclease protein and a guide RNA specific for the target nucleotide sequence of the F3H gene.
  • the guide RNA and the endonuclease Complexes of proteins can work with RNA gene shears to edit target genes.
  • 250 ⁇ l of plasma cells (2.5 ⁇ 10 5 cells / ml) were mixed with 50 ⁇ g of plasmid vector PBI221 containing the GFP coding gene (PBI221 :: GFP). Then, 270 ⁇ l of a pre-prepared PEG solution [40% (w / v) PEG4000 (Sigma Aldrich), 0.4M mannitol, 0.1MCa (NO3) 2] was added thereto, followed by well mixing and incubation at room temperature for 20 minutes. Thereafter, 250 ⁇ l of a washing solution (CPW 9% (w / v) mannitol) was added to rinse the PEG solution, mixed well, and reacted at room temperature for 10 minutes.
  • a washing solution CPW 9% (w / v) mannitol
  • the recombinant Cas9 protein (160kD) used in the experiment was purchased from Tulsen (Korea), and the F3H locus of petunia 'midnight' was amplified and sequenced based on gene information (GenBank accession no. AF022142.1).
  • the CRISPR RGEN Tools http://rgenome.net/) were then used to target the first and second exons of the F3H gene and to determine the target sites of five different F3H sgRNAs with high out-of-frame scores. ( Figure 2, Table 1).
  • 20 ⁇ l of a reaction solution consisting of 2 ⁇ l of Cas9 protein buffer, 27 ⁇ g of Cas9 protein, 80 ⁇ g of sgRNA, and deionized water was prepared.
  • the reaction solution was uniformly mixed with the protoplast suspended in 300 ⁇ l MaMg solution (0.5 mM MES, 0.4 M mannitol, 15 mM MgCl 2), and then reacted with the prepared PEG solution for 20 minutes at room temperature. Subsequent washing procedures are identical to GFP plasmid transformation based on PEG.
  • Genomic DNA was extracted from the transformed protoplasts using the i-genomic plant DNA extraction mini kit (Intronbio, Seoul, Korea). In order to detect site-directed mutations induced by RNP at the F3H locus, high resolution melt curve analysis was performed. To this end, Phusion® High-Fidelity PCR Kit (NEB, USA) and nested PCR primers (Table 3) were used to amplify the target genomic region of the F3H locus from wild-type (WT) and sgRNA transformants according to the manufacturer's protocol.
  • WT wild-type
  • sgRNA transformants according to the manufacturer's protocol.
  • HRM analysis was performed using a 2 x HRM Master mix with 2.5mM MgCl2 and Eva Green dye (PhileKorea, Daejeon, Korea), 100 ng of pre-amplified template, and a total reaction volume of 10 ⁇ l containing 0.2 ⁇ M of each forward and reverse primer.
  • PCR amplification was performed by combining an initial denaturation step (95 ° C. 2 min) followed by 40 cycles of 10 seconds at 95 ° C., annealing and stretching steps at 60 ° C. for 30 seconds. Final cycle of 15 seconds at 95 ° C., 15 seconds at 55 ° C. and 15 seconds at 95 ° C.
  • the extracted petunia (2.5 ⁇ 10 5 cells) was transfected with 50 ⁇ g of a vector (PBI221) containing the reporter gene GFP using 40% PEG4000. After 24 hours, GFP expression was confirmed as shown in FIG. 3, while the previous study showed 50% of expression, while the present application showed a higher expression of 55%.
  • PEG4000 was used in comparison with the previous studies, and the incubation time was reduced to 20 minutes to increase the viability and vitality of the petunia protoplasts with high reproducibility. The results suggest that the enhanced transient expression system could be useful for future studies in petunias and other branches, as well as target gene mutations.
  • sgRNAs F3H1, F3H2, F3H3, F3H4 and F3H5 were designed at the corresponding target sites in the F3H locus (FIG. 2).
  • the designed sgRNA has 23 nucleotides (including 3 bp of PAM) and pairs with 20 corresponding nucleotides at the target site of the F3H locus to help CRSPR / Cas9 create a site specific double strand break (DSB).
  • the CRISPR / Cas9 system has been considered more effective in terms of preparation, delivery and generation in causing target specific mutations.
  • Direct delivery of DNA-free proteins, such as the RNP complex (Cas9-sgRNA) to living cells is not limited by GMO rules and reduces off-target effects.
  • RNP complex purified Cas9 protein + sgRNA synthesized in vitro
  • petunia protoplasts to mutate the endogenous F3H gene as described in previous studies (Subburaj et al., 2016 Plant Cell Rep. 35: 1535)
  • An introduction was attempted (FIG. 1).
  • HRM High resolution melting
  • Targeted deep sequencing was performed to identify the transformed cells and morphology of the target gene F3H in RNP-introduced protoplasts.
  • F3H1-F3H5 DNA was extracted from the protoplast cells transformed with the RNP combination using five sgRNAs, and then amplified first using the primers shown in Table 2. Mutations did not occur in the protoplast cells transformed with the control (WT) and Cas9 proteins alone, whereas the mutations such as insertion and deletion occurred in the five RNP binding sites targeting the F3H gene. According to the guide RNA binding site, the mutation rate was 0.8 ⁇ 49.3%, and the average mutation rate of F3H locus was about 20.8% (Table 4).
  • a means the number of inserted nucleotide sequences among the mutation rate
  • b means the number of deleted nucleotide sequences
  • c means mean and standard deviation error values calculated for F3H1 to F3H5 only.
  • the ratio of deletion and insertion was 45.4: 54.6.
  • the base deletion size was 1 to 7 bp, and the size of the base insertion was found to be induced to 2 bp induced cells (FIG. 9).
  • Mutant F3H allele # 2 caused a frameshift, causing in-frame immature stop codons at the amino acid at position 78, resulting in the generation of a large number of cleavage proteins during translation of mRNA, resulting in morphine synthesis N-terminal non- Activation of haemdioxygenase (DIOX_N) ultimately predicted total or partial loss of F3H function (FIG. 11).
  • FIGS. 14 to 19 sequencing analysis results and indel results of R3 mediated transformation of gene sequences F3Ha and F3Hb having SNPs in petunias are shown in FIGS. 14 to 19 (each taget gene is named 1226 P1C7, 1226 P3C5, 1226 P4C4). ). It can be seen that the T base inserted mutation was also confirmed in F3Ha or F3Hb having SNP, and compared to wild-type F3Ha and F3Hb of FIGS. 12 to 13, the indel was 95% or more in the mutant F3Ha and F3Hb of FIGS. It was.
  • the absorbance value of the petal extract of the plant with the mutant F3H allele # 2 showed a significantly lower value than the absorbance of the petal extract of the wild type plants, the knockout of F3H inhibits the production of anthocyanin, the petal color It was found that the change of.
  • deep target sequencing was performed. Of the 8 plants tested, a single mutation (2.1%), a putative homozygous with 1 bp of base inserted into the F3H2 target site on the F3H locus, was found and no specific InDel mutation rate was identified in the remaining plants compared to the wild type.
  • Petunia (Petunia x hybrida), a hybrid of P. axillaris and P. integrifolia, has a single copy of F3H (AF022142, Houwelingen et al. 1997).
  • gRNA designed a single target specific site through which the first (FIG. 24) exon of the F3Ha and F3Hb genes are conserved via the CRISPR RGEN Tools website (http://rgenome.net/) (Bae et al. 2014).
  • pBAtC Karl et al., 2016
  • PhF3H-sgRNA the synthesized sgRNA oligo was annealed and inserted into the AarI site of the pBAtC vector.
  • Protocols for Agrobacterium mediated transformation are described by Kim et al. It was performed with reference to the method of 2016. For simplicity, the petunias were cut into small pieces of about 0.5 ⁇ 0.5 cm (FIG. 23B) and transformed into Agrobacterium and co-culture methods.
  • Extruded sections were obtained from explants by selective incubation with basta until transformation.
  • Agrobacterium tumefaciens was obtained from solid YEP media [Spectinomycin 75 mg / L, Rifampicin 25 mg / L, Peptone 10 g / L, NaCl 5 g / L, yeast extract 5 g / L, 1.5% (w / v) agar (pH 7.0)] and a single colony produced by incubating at 28 ° C. in liquid YEP medium containing the same antibiotic It was added to 10 mL and stirred at 220 rpm at 28 ° C until the OD650 became 0.6 ⁇ 0.8.
  • Agrobacterium tumerfaciens pellets in each tube were transferred to a liquid CCM (co-cultivation medium; B5 salt 0.32 g / L, BA 1.67 mg / L, MES 20 mM, GA3 0.25 mg / L, acetosyrincon 0.2 mM, L-Cysteine 3.3 mM, sodium thiosulfate 1.0 mM, DTT 1.0 mM, sucrose 3%, pH 5.4) 15 mL was prepared. About 50 sections were placed in a 15 mL coculture / Agrobacterium tumer faciens and inoculated for 30 minutes after sonication for 20 seconds. Each section was removed from the tube, placed on a sterile filter paper, drained, and then placed on a solid CCM (same as liquid CCM, agar (0.7%), with one sheet of filter paper and 10 pieces placed thereon.
  • CCM co-cultivation medium
  • the transformed regenerated plants were then transplanted into growth chambers with photoperiod of 16 hours (25 ⁇ 1 ° C./8 hours (20 ⁇ 1 ° C.) and subjected to phenotypic analysis (FIG. 23C).
  • the genomic DNA of the transformed plant was extracted with i-genomic plant DNA extraction kit (Intronbio, Seoul, Korea). F3H target sites with indel mutations were detected by PCR amplification using primers (SEQ ID NOs: 53-59) and target deep sequencing using the Illumina MiSeq platform.
  • the transformed mutations also confirmed that both alleles were positive mutations that mutated to homozygotes in both the F3a and F3Hb loci.
  • Plant plant 1 (T0) Total count Insertion Deletion Indel Indel ratio Mutation Pattern Genotype allele_a 7612 0 6 6 0.08% - Homozygous allele_b 5008 4 3 7 0.14% - Homozygous Flower color Purple violet (WT) Plant plant 2 (T0) Total count Insertion Deletion Indel Indel ratio Mutation Pattern Genotype allele_a 8770 8574 151 8725 99.49% 1 bp ins Homozygous allele_b 8003 14 7984 7998 99.94% 2 bp del Homozygous Flower color Purple spotted White (Mutant)
  • FIGS. 26 to 31 sequencing analysis results and indel results of Agrobacterium mediated transformation of the gene sequences F3Ha and F3Hb having SNPs in petunias are shown in FIGS. 26 to 31 (each taget gene name is 0324 L4-1, 0324 L9- 1, named 0324 L9-2).
  • the present application can provide a composition for editing a flavonoid biosynthetic gene using the CRISPR / Cas9 system and a method of using the same.
  • It relates to a target sequence, guideRNA sequence, primer sequence for editing the flavonoid biosynthesis gene.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

본 출원은 CRISPR/Cas9 시스템을 이용하여 플라보노이드 생합성 유전체 편집세포를 유도하는 방법에 관한 것이다.

Description

CRISPR/CAS9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용
본 출원은 CRISPR/Cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용에 관한 것이다.
유전자가위 기술은 1세대 ZFN(Zinc-finger nuclease)과 2세대 TALEN 을 거쳐, 2013년에는 세균이나 고세균에서 작동하는 CRISPR/Cas 시스템을 이용하여 동물뿐만 아니라, 식물의 세포에서 원하는 유전자만 타겟할 수 있는 3세대 유전자 가위 기술인 RNP(ribonucleoproteins complex)가 보고되었다. RNP은 기존의 ZFN, TALEN과 달리 절단하고자 하는 DNA에 따라 단백질을 매번 만들 필요가 없고, 하나의 단백질만 이용하여 가이드 RNA(guide RNA)만 바꿔줌으로써 원하는 유전자를 편집할 수 있다는 큰 장점이 있고, 기존 GMO 기술과 달리 DNA가 없는 non-GMO(DNAfree non-GMO) 품종육성 기술로 최근 미국 USDA에서는 CRISPR 등 유전자편집을 통한 식물육종을 허용하고, 기존 GMO와 달리 규제하지 않는다고 발표했고, 호주, 뉴질랜드 식품 표준청에서는 간단한 유전자 삭제가 일어난 신기술 작물은 GMO로 간주되지 않는다고 발표했다.
유전자가위(engineered nucleases, EN)를 이용한 타겟 게놈 편집(targeted genome editing, TGE)은 밀, 옥수수, 쌀, 콩 등 다양한 식량 작물의 특성을 수정하는 것으로 증명되었다. 보다 최근에는 CRISPR/Cas9 기술과 같은 유전자가위 중 하나가 토마토와 감자를 포함한 가지과(Solanaceae) 작물에도 성공적으로 적용되었다. CRISPR/Cas9를 이용한 원형질체 일시 발현 시스템은 다양한 식물의 게놈 편집을 위한 다목적 방법으로 채택되어 왔다.
본 발명자는 Petunia×hybrida에 대한 CRISPR/Cas9 RNP의 일과성 발현 시스템을 위한 효율적인 프로토콜을 개발하고 표준화했다. 본 출원에서는 관상식물에서 DNA-free 유전자 편집 플라보노이드 생합성 관여 유전자 변이체를 생산하기 위해 페튜니아 원형질체에서 CRISPR/Cas9 기반 F3H (Flavone 3-hydroxylase) 유전자의 돌연변이 유발을 수행하여 화색이 변경됨을 확인함으로써 본 출원을 완성하였다.
본 출원은 상기와 같은 요구에 의해 도출된 것으로서, 본 출원자들은 페튜니아의 원형질체를 분리 및 추출한 후, F3H (Flavone 3-hydroxylase) 유전자의 염기서열을 표적으로 하는 가이드 RNA와 Cas9 단백질의 복합체(ribonucleoprotein, RNP)를 상기 추출한 원형질체에 형질도입 하였다. 그 후, 야생형과 형질도입 원형질체를 이용하여 F3H 위치를 HRM(high resolution melting) 및 targeted deep sequencing 분석한 결과, F3H 유전자의 표적 염기서열 위치에서 삽입결실(InDel) 돌연변이가 발생하였음을 관찰할 수 있었으며, 상기 돌연변이가 유도된 원형질체로 부터 분화한 식물체에서 화색의 변이가 발생하였음을 확인함으로써, 본 출원을 완성하였다.
상기 과제를 해결하기 위해, 본 출원은 식물체 내의 게놈 DNA상에서 안토시아닌계 플라보노이드의 합성과 관련된 인자의 핵산 서열 내 표적서열에 상보적인 결합을 형성할 수 있는 가이드 RNA 또는 이를 암호화하는 핵산서열; 및 상기 가이드 RNA와 복합체를 형성하여 상기 핵산 서열을 절단시키는 Cas단백질 또는 이를 암호화하는 핵산서열; 을 포함하는 조성물로서,
상기 가이드 RNA를 암호화하는 핵산은 상기 Cas단백질이 인식하는 PAM 서열에 인접해 있는 표적서열과 동일하거나 상보적인 서열이고, 이 때, 상기 조성물은 식물체 내의 게놈 DNA상에서 안토시아닌계 플라보노이드의 합성과 관련된 인자의 핵산 서열 내 인위적인 돌연변이를 도입시키며, 상기 조성물은 식물의 꽃, 종자, 과실, 잎 중 선택되는 1 이상의 색깔 특성을 변경시키는 것을 특징으로 하는 조성물을 제공한다.
또한, 상기 과제를 해결하기 위하여, 본 출원은 식물체 내의 게놈 DNA상에서 안토시아닌계 플라보노이드의 합성과 관련된 인자의 핵산 서열 내 표적서열에 상보적인 결합을 형성할 수 있는 가이드 RNA 또는 이를 암호화하는 핵산서열; 및 상기 가이드 RNA와 복합체를 형성하여 상기 핵산 서열을 절단시키는 Cas단백질 또는 이를 암호화하는 핵산서열을 포함하는 조성물을 식물세포에 도입함; 및 상기 식물세포를 재분화함;
을 포함하는 식물체 제조방법으로,
이 때, 상기 재분화된 식물세포는 게놈 DNA상에서 안토시아닌계 플라보노이드의 합성과 관련된 인자의 핵산 서열 내 인위적인 돌연변이를 포함하고,
상기 안토시아닌계 플라보노이드 합성과 관련된 인자는 F3H, F3′H, F3′5′H 중 선택되는 1 이상인 유전자이며,
상기 식물체는 야생형과 비교하여 색깔 특성이 변경된 것을 특징으로 하는, 형질전환 식물체 제조방법을 제공한다.
본 출원의 유전자 편집 방법은 외부 유전자가 삽입되어 있지 않고 자연적 변이와 구별할 수 없는 작은 변이만 가지고 있어, 안전성과 환경 유해성 여부를 평가하기 위해 막대한 비용과 시간이 소모되는 GMO 작물과 달리 비용과 시간을 절약할 수 있을 것으로 기대된다. 또한, 본 출원의 방법은 향상된 일시발현시스템(transient expression system)으로, 고전적인 transgenic 방법을 사용하지 않고 작물의 화색은 물론 종자, 과일 및 식물체 여러 기관의 색을 효과적으로 변화시킬 수 있어 원예 분야에서 관상적 및 기능적 목적의 색 교정에 유용하게 사용 될 수 있을 것이다.
도 1은 페튜니아 원형질체 추출 및 CRISPR/Cas9 시스템을 이용한 유전체 편집 세포의 유도 과정을 나타낸다.
도 2는 CRISPR RGEN Tools을 사용하여 결정된 5개의 F3H (Flavanone 3-hydroxylase) 타겟 sgRNA 부위를 나타낸다. 네모박스 부분은 PAM 모티프의 3bp 염기를 나타낸다.
도 3은 리포터 유전자 GFP를 포함하는 벡터(PBI221:GFP)로 형질도입된 페튜니아 원형질체의 형광 사진이다. 삼각형 부분은 GFP가 발현되는 부분을 나타낸다.
도 4 내지 8은 야생형과 유전체 편집 원형질체로부터 분리된 게노믹 DNA의 HRM(high resolution melting) 분석 결과이다.
도 9는 sgRNA 1 내지 5를 이용하여 유전체 편집을 유도한 세포의 targeted deep sequencing을 통한 F3H 좌의 대표적인 염기 돌연변이 정보이다. 밑줄 및 굵은 글씨는 핵산분해효소의 표적 서열이고, 네모박스 부분은 PAM 모티프의 3bp 염기를 나타내며, 음영 부분은 삽입 돌연변이를 의미한다. 돌연변이 염기서열 옆 별표(*)는 sgRNA 별로 많은 빈도의 변이형태 유형을 표시하고 있다.
도 10은 RNP 매개 형질전환된 재분화된 T0 페튜니아에서의 돌연변이 확인을 위한 HRM(high resolution melting) 분석 결과이다.
도 11은 페튜니아에서 야생형의 F3H(WT F3H로 명명)와 돌연변이형 F3H (#2 F3H로 명명)의 아미노산 분석 결과이다.
도 12 내지 13은 야생형의 F3Ha 및 F3Hb(각각 F3H-A_wt 및 F3H-B_wt로 명명)를 RNP 매개 형질전환한 페튜니아의 시퀀싱 분석 및 indel 결과이다.
도 14 내지 19는 돌연변이형의 F3Ha 및 F3Hb(각각 F3H-A_1226P1C7, F3H-B_1226P1C7, F3H-A_1226P3C5, F3H-B_1226P3C5, F3H-A_1226P4C4, F3H-B_1226P4C4로 명명)를 RNP 매개 형질전환한 페튜니아의 시퀀싱 분석 및 indel 결과이다.
도 20은 야생형 F3H(WT으로 명명)와 돌연변이형 F3H(Allele #2로 명명)가 RNP 매개 형질전환된 페튜니아 식물체의 화색을 나타낸 도면이다.
도 21은 야생형 F3H(WT으로 명명)와 돌연변이형 F3H(Allele #2로 명명)가 RNP 매개 형질전환된 페튜니아 식물체의 0-DPA 및 1-DPA 화색의 시각적 평가를 위해 토양에 식재한 결과이다.
도 22는 야생형 F3H(WT으로 명명)와 돌연변이형 F3H(Allele #2로 명명)가 RNP 매개 형질전환된 페튜니아 식물체의 0-DPA 및 1-DPA 꽃잎의 안토시아닌 함량의 흡광도 측정 결과이다.
도 23은 P. hybrida Cv midnight의 3주된 어린잎(A), 아그로박테리움법 매개 CRISRP/Cas9 형질전환을 위해 약 0.5 × 0.5 cm의 작은 조각으로 절단(B), Explants된 상태(C)를 나타낸 도면이다.
도 24는 CRISPR RGEN Tools을 사용하여 결정된 F3Ha 및 F3Hb의 sgRNA 타겟 부위(sg2 target site로 명명)를 나타낸 도면이다.
도 25는 P. hybrida Cv midnight에서 F3Ha 및 F3Hb의 야생형(F3H_a WT, F3H_b WT) 및 돌연변이형(F3H_a Mutant, F3H_b Mutant)의 아미노산 분석 결과이다.
도 26 내지 31은 돌연변이형의 F3Ha 및 F3Hb(각각 F3H-A_0324L4-1, F3H-B_0324L4-1, F3H-A_0324L9-1, F3H-B_0324L9-1, F3H-A_0324L9-2, F3H-B_0324L9-2로 명명)를 아그로박테리움법 매개 형질전환한 페튜니아의 시퀀싱 분석 및 indel 결과이다.
도 32는 야생형 F3H(Plant 1로 명명)와 돌연변이형 F3H(Plant 2로 명명)가 아그로박테리움법 매개 형질전환된 페튜니아 식물체의 화색을 나타낸 도면이다.
본 출원은 식물체 내에서 F3H 유전자의 발현을 조절하는 방법 및 이에 이용되는 조성물에 관한 것이다.
상기 F3H 유전자는 식물에서 다양한 안토시아닌 색소 형성에 영향을 끼친다. F3H 유전자는 Naringenin, Leucoanthocyanidins, anthocyanidins 등을 합성하기 위한 주요 유전자로, 나린제닌(naringenin)이 디히드로플라보놀(dihydroflavonols)로의 전환에 의해 안토시아닌 색소 생성에 관여한다.
상기 조성물은 식물의 종자, 과실, 꽃, 줄기, 잎 등의 다양한 부위에서 안토시아닌 색소 형성에 영향을 끼칠 수 있다.
예를 들어, 상기 조성물은 식물의 종자, 과실, 꽃, 줄기, 잎 중에서 선택되는 1 이상의 부위에서 안토시아닌 색소 형성에 영향을 끼칠 수 있다.
임의의 구체예로, 상기 조성물은 식물체 내에서 F3H 유전자의 발현을 조절하여 식물의 종자, 과실, 꽃, 줄기, 잎 중에서 선택되는 1 이상의 부위의 색깔을 변화시킬 수 있다.
본원에서 상기 F3H 유전자는 F3'H 유전자와 F3'5'H 유전자를 모두 포함하는 용어이다.
F3H 유전자를 가지는 식물은 가지과(Solanaceae), 장미과(Rosaceae), 국화과(Asteraceae)에 속하는 식물일 수 있으나, 이에 제한하지 않는다.
가지과에 속하는 식물은 예를 들어, 가지, 맨드레이크, 감자, 담배, 토마토, 페튜니아 등일 수 있으나 이에 제한하지 않는다.
장미과에 속하는 식물은 장미, 백매, 황매화, 벚나무 등일 수 있으나 이에 제한하지 않는다.
국화과에 속하는 식물은 국화, 금불초, 개망초, 민들레 등일 수 있으나 이에 제한하지 않는다.
구체적인 예를 들어, 상기 식물은 페튜니아, 장미, 국화 등일 수 있으나 이에 제한하지 않는다.
본원 명세서는 일 양태로 식물체 내에서 F3H 유전자의 발현을 조절하는 방법을 제공한다.
상기 F3H 유전자의 발현을 조절하는 방법을 이용하여 식물의 색깔 특성을 변경시키는 방법을 제공한다.
일 예로서,
F3H (Flavone 3-hydroxylase) 유전자의 표적 염기서열에 특이적인 가이드 RNA(guide RNA) 또는 이를 코딩하는 핵산서열, 및 엔도뉴클레아제(endonuclease) 단백질 또는 이를 코딩하는 핵산서열을 포함하는 조성물을 대상 식물세포에 도입하여 유전체를 인위적으로 편집하는 단계; 및
상기 유전체가 편집된 대상 식물세포로부터 식물을 재분화하는 단계를 포함하는, 화색 변이 형질을 가지는 식물체의 제조방법을 제공한다.
예를 들어, F3H (Flavone 3-hydroxylase) 유전자의 표적 염기서열에 특이적인 가이드 RNA(guide RNA)와 엔도뉴클레아제(endonuclease) 단백질의 복합체 형태로 실시할 수 있다.
다른 예로, F3H (Flavone 3-hydroxylase) 유전자의 표적 염기서열에 특이적인 가이드 RNA를 코딩하는 핵산서열 및 엔도뉴클레아제(endonuclease) 단백질을 코딩하는 핵산서열을 포함하는 벡터의 형태로 실시할 수 있다.
구체적인 일 예로서,
페튜니아(Petunia×hybrida) 유래 F3H (Flavone 3-hydroxylase) 유전자의 표적 염기서열에 특이적인 가이드 RNA(guide RNA) 또는 이를 코딩하는 핵산서열, 및 엔도뉴클레아제(endonuclease) 단백질 또는 이를 코딩하는 핵산서열을 포함하는 조성물을 페튜니아 식물세포에 도입하여 유전체를 인위적으로 편집하는 단계; 및
상기 유전체가 편집된 페튜니아 식물세포로부터 페튜니아 식물을 재분화하는 단계를 포함하는, 화색 변이 형질을 가지는 페튜니아 식물체의 제조방법을 제공한다.
본 명세서에서 용어 "유전체 편집(genome editing)"은, 인간 세포를 비롯한 동·식물 세포의 유전체 염기서열에 표적지향형 변이를 도입 또는 유도할 수 있는 기술로서, DNA 절단에 의한 하나 이상의 핵산 분자의 결실, 삽입, 치환 등에 의하여 특정 유전자를 녹-아웃(knock-out) 또는 녹-인(knockin)하거나, 단백질을 생성하지 않는 비-코딩 DNA 서열에도 변이를 도입할 수 있는 기술을 말한다. 본 출원의 목적상 상기 유전체 편집은 특히 Cas9 단백질 및 가이드 RNA를 이용하여 식물체에 변이를 도입하는 것일 수 있다. 유전자 편집(gene editing)이라는 용어와 혼용하여 사용될 수 있다.
또한, 용어 "표적 유전자" 또는 "표적 유전체"는 본 출원을 통해 편집하고자 하는 식물체의 유전체 내에 있는 일부 DNA를 의미한다. 즉, 원칙적으로 그 유전자의 종류에 제한되지 않으며, 코딩 영역 및 비-코딩(non-coding) 영역을 모두 포함할 수 있다. 당업자는 그 목적에 따라, 제조하고자 하는 유전체 편집 식물체에 대하여 원하는 변이에 따라 상기 표적 유전자를 선별할 수 있다.
상기 표적 유전자는 안토시아닌계 플라보노이드 합성과 관련된 유전자일 수 있다.
상기 안토시아닌계 플라보노이드 합성과 관련된 유전자는 F3H(Flavone 3-hydroxylase), F3′H(Flavone 3-hydroxylase), F3′5′H(flavonoid 3′,5′-hydroxylase) 등일 수 있으나, 이에 제한하지 않는다. 상기 F3H, F3'H, F3'5'H 등은 꽃, 과실 등의 색소 형성과 관련이 있을 수 있다.
본 출원의 일 구현 예에 따른 제조방법에 있어서, 표적 유전자는 페튜니아(Petunia×hybrida) 유래 F3H (Flavone 3-hydroxylase) 유전자일 수 있고, 바람직하게는 서열번호 36의 염기서열로 이루어진 유전자일 수 있으나, 이에 제한 되지 않는다.
본 출원의 일 실시예에 있어서, 식물체의 게놈은 F3H 유전자를 가지고 있을 수 있다.
상기 F3H 유전자는 야생형 또는 돌연변이형 중 선택되는 1 이상일 수 있다.
예를 들어, 상기 돌연변이형은 SNP(Single nucleotide polymorphism)를 가지고 있을 수 있다.
구체예에 있어서, 본 출원에서 식물체의 게놈은 F3H 야생형 유전자를 가지고 있을 수 있다.
구체예에 있어서, 본 출원에서 식물체의 게놈은 F3H SNP를 가진 돌연변이형 유전자를 가지고 있을 수 있다.
예를 들어, 상기 F3H SNP를 가진 돌연변이형 유전자는 서열번호 52 내지 53 중 선택되는 1 이상일 수 있다.
본 명세서에서 용어 "가이드 RNA(guide RNA)"는 표적 유전자의 염기서열을 암호화하는 DNA에 특이적인 RNA를 의미하며, 표적 DNA 염기서열과 전부 또는 일부가 상보적으로 결합하여 해당 표적 DNA 염기서열로 엔도뉴클레아제(endonuclease) 단백질을 이끄는 역할을 하는 리보핵산을 의미한다. 상기 가이드 RNA는 두 개의 RNA, 즉, crRNA(CRISPR RNA) 및 tracrRNA(trans-activating crRNA)를 구성 요소로 포함하는 이중 RNA(dual RNA); 또는 표적 DNA 내 염기서열과 전부 또는 일부 상보적인 서열을 포함하는 제1 부위 및 RNA-가이드 뉴클레아제와 상호작용하는 서열을 포함하는 제2 부위를 포함하는 단일 사슬 가이드 RNA(sgRNA) 형태를 말하나, RNA-가이드 뉴클레아제가 표적 염기서열에서 활성을 가질 수 있는 형태라면 제한 없이 본 출원의 범위에 포함될 수 있다. 본 출원에 따른 가이드 RNA는 바람직하게는, 단일 가닥 가이드 RNA 형태일 수 있으나, 이에 제한되지 않으며, 사용된 엔도뉴클레아제의 종류 또는 엔도뉴클레아제의 유래 미생물 등에 당업계의 공지된 기술에 따라서 적절히 선택할 수 있다.
또한, 상기 가이드 RNA는 플라스미드 주형으로부터 전사된 것 또는 생체 외(in vitro)에서 전사된(transcribed) 것(예컨대, 올리고뉴클레오티드 이중가닥)일 수 있으나, 이에 제한되지 않는다.
본 출원의 일 구현 예에 따른 제조방법에 있어서, 가이드 RNA(guide RNA)는 F3H 유전자의 표적 염기서열에 특이적으로 고안된 것으로, 상기 F3H 유전자의 표적 염기서열은 예를 들어, 서열번호 1 내지 5의 염기서열로 이루어진 군으로부터 선택되는 하나 이상일 수 있다. 일 실시예로서, 서열번호 2의 염기서열로 이루어진 것일 수 있으나, 이에 제한되지 않는다. 또한 다른 예로, 서열번호 37 내지 41의 염기서열로 이루어진 군으로부터 선택되는 하나 이상일 수 있다. 또한 다른 예로, 서열번호 49 내지 50의 염기서열로 이루어진 군으로부터 선택되는 하나 이상일 수 있다.
표적 염기서열 1 내지 5의 염기서열에 대하여, 상기 가이드 RNA는 서열번호 42 내지 46 중 선택되는 1 이상일 수 있다.
표적 염기서열 37 내지 41의 염기서열에 대하여, 상기 가이드 RNA는 서열번호 47 내지 51 중 선택되는 1 이상일 수 있다
표적 염기서열 54 내지 55의 염기서열에 대하여, 상기 가이드 RNA는 서열번호 56 내지 57 중 선택되는 1 이상일 수 있다.
표적 염기서열 58 내지 59의 염기서열에 대하여, 상기 가이드 RNA는 서열번호 60 내지 61 중 선택되는 1 이상일 수 있다.
본 출원의 일 구현 예에 따른 제조방법에 있어서, 상기 엔도뉴클레아제 단백질은 Cas9(CRISPR associated protein 9), Cpf1(CRISPR from Prevotella and Francisella 1), TALEN(Transcription activator-like effector nuclease), ZFN(Zinc Finger Nuclease) 또는 이의 기능적 유사체로 이루어진 군으로부터 선택되는 하나 이상일 수 있고, 바람직하게는 Cas9 단백질일 수 있으나, 이에 제한되지 않는다.
Cas9 단백질 또는 유전자 정보는 NCBI(National Center for Biotechnology Information)의 GenBank와 같은 공지의 데이터베이스에서 얻을 수 있다. 예컨대, 상기 Cas9 단백질은 스트렙토코커스 피요제네스(Streptococcus pyogenes) 유래의 Cas9 단백질, 캠필로박터 제주니(Campylobacter jejuni) 유래의 Cas9 단백질, 스트렙토코커스 써모필러스(Streptococcus thermophilus) 또는 스트
렙토코커스 아우레우스(Streptocuccus aureus) 유래의 Cas9 단백질, 네이쎄리아 메닝기티디스(Neisseria meningitidis) 유래의 Cas9 단백질, 파스투렐라 물토시다(Pasteurella multocida) 유래의 Cas9 단백질, 프란시셀라 노비시다(Francisella novicida) 유래의 예컨대 Cas9 단백질 등으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다.
Cas9 단백질은 RNA-guided DNA 엔도뉴클레아제 효소로, 이중 가닥 DNA 절단(double stranded DNA break)을 유도한다. Cas9 단백질이 정확하게 표적DNA의 염기서열에 결합하여 DNA 가닥을 잘라내기 위해서는 PAM(Protospacer Adjacent Motif)이라 알려진 3개의 염기로 이루어진 짧은 염기서열이 표적 DNA의 염기서열 옆에 존재해야 하며, Cas9 단백질은 PAM 서열(NGG)로부터 3번째와 4번째 염기쌍 사이를 추정하여 절단한다.
본 출원의 일 구현 예에 따른 제조방법에 있어서, 상기 가이드 RNA와 엔도뉴클레아제 단백질은 리보핵산-단백질(ribonucleoprotein) 복합체를 형성하여 RNA 유전자 가위(RNA-Guided Engineered Nuclease, RGEN)로 작동한다.
본 방명의 제조방법으로 만들어진 식물은 F3H 유전자의 발현을 일시적으로 조절하는 것이 아닌, F3H 유전자의 지노믹 DNA의 발현을 조절한 것이기 때문에, F3H 유전자의 발현의 조절이 영구적인 점에서 이점이 있다.
본 출원에서 사용된 CRISPR/Cas9 시스템은 편집하고자 하는 특정 유전자의 특정위치에 이중나선 절단을 도입하여 DNA 수선 과정에서 유도되는 불완전수선에 의한 삽입-결실(insertion-deletion, InDel) 돌연변이를 유도시키는 NHEJ(non-homologous end joining) 기작에 의한 유전체 편집 방법이다.
본 출원의 일 구현 예에 따른 제조방법에 있어서, 상기 가이드 RNA와 엔도뉴클레아제 단백질은 리보핵산-단백질(ribonucleoprotein) 복합체 형태로 직접 숙주세포 내로 형질도입될 수 있거나, 또는 상기 가이드 RNA를 암호화하는 DNA 및 엔도뉴클레아제 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터의 형태로 제조되어 숙주세포 내로 형질도입될 수 있으나, 이에 제한되지 않는다.
본 출원에 따른 제조방법에 있어서, 상기 가이드 RNA와 엔도뉴클레아제 단백질의 복합체를 식물세포에 형질도입하는 방법은 원형질체에 대한 칼슘/폴리에틸렌 글리콜 방법(Krens et al., 1982, Nature 296: 72-74; Negrutiu et al.,1987, Plant Mol. Biol. 8: 363-373), 원형질체의 전기천공법(Shillito et al.,1985, Bio/Technol. 3: 1099-1102), 식물 요소로의 현미주사법(Crossway et al.,1986, Mol. Gen. Genet. 202: 179-185), 각종 식물 요소의(DNA 또는 RNA-코팅된) 입자 충격법(Klein et al.,1987, Nature 327: 70), 아그로박테리움 튜메파시엔스(Agrobacterium tumefaciens) 매개된 유전자 전이에서(비완전성) 바이러스에 의한 감염(EP 0 301 316호) 등으로부터 적당하게 선택될 수 있다.
상기 "식물세포"는 어떤 식물세포도 된다. 식물세포는 식물체의 어떤 부위 예를 들어 뿌리, 줄기, 잎, 꽃, 종자 등에서 유래된 식물세포를 포함할 수 있다. 또한, 식물세포는 배양 세포, 배양 조직, 배양기관 또한, 식물세포는 분화된 또는 미분화된 식물의 조직, 예를 들면 이에 한정되지는 않으나, 뿌리, 줄기, 잎, 꽃가루, 종자, 암 조직 및 배양에 이용되는 다양한 형태의 세포들, 즉 단일세포, 원형질체(protoplast), 싹 및 캘러스 조직을 포함한다. “식물체”는 상기 식물세포를 포함하고 있는 전체식물을 의미한다.
예를 들어, 본 출원의 식물세포는 원형질체일 수 있다.
또 다른 예를 들어, 본 출원의 식물세포는 잎 유래 식물세포일 수 있다.
본 출원의 제조방법에 있어서, 유전체가 편집된 식물세포로부터 유전체가 편집된 식물을 재분화하는 방법은 당업계에 공지된 임의의 방법을 이용할 수 있다. 유전체가 편집된 식물세포는 전식물로 재분화되어야 한다. 캘러스 또는 원형질체 배양으로부터 성숙한 식물의 재분화를 위한 기술은 수많은 여러 가지 종에 대해서 당업계에 주지되어 있다(Handbook of Plant Cell Culture, 1-5권, 1983-1989 Momillan, N.Y.).
본 출원의 다른 양태는 식물의 색깔을 변경시키는 조성물에 관한 것이다.
상기 조성물은 식물의 부위 예를 들어, 종자, 과일, 꽃, 잎, 줄기 등의 색깔을 변경시키는 용도에 사용될 수 있다.
상기 조성물은 안토시아닌계 플라보노이드 합성과 관련된 인자의 발현을 조절할 수 있는 발현 조절용 조성물일 수 있다.
상기 안토시아닌계 플라보노이드의 합성과 관련된 인자는 F3H(Flavone 3-hydroxylase), F3′H(flavonoid 3′-hydroxylase), F3′5′H(flavonoid 3′,5′-hydroxylase)등일 수 있으나, 이에 제한하지 않는다.
특히, 본 조성물은 F3H 유전자의 발현과 관련된 안토시아닌계 플라보노이드의 합성을 조절함으로써 식물의 화색을 변경시킨다.
상기 조성물은 식물체 내에 존재하는 게놈 DNA 상에서 안토시아닌계 플라보노이드의 합성과 관련된 인자의 DNA 서열을 편집함으로써 해당 인자의 발현을 조절한다.
이러한 유전자 편집은 식물체 게놈 DNA 내에 안토시아닌계 플라보노이드의 합성과 관련된 인자를 코딩하는 서열 내 인위적 돌연변이를 도입하는 것을 의미한다. 상기 인위적 돌연변이는 야생 형태(wildtype) 유전자의 게놈 서열 중 일부 또는 전부 영역에, 하나 이상의 핵산을 삽입, 결실, 치환, 또는 역위 등을 시키는 돌연변이를 포함한다.
예를 들어, 본 출원에서 상기 조성물은 식물체 내에 존재하는 안토시아닌계 플라보노이드의 합성과 관련된 인자의 DNA 서열의 일부를 결실시킴으로써 해당 인자의 발현을 감소 또는 증가시킬 수 있다.
예를 들어, 본 출원에서 상기 조성물은 식물체 내에 존재하는 안토시아닌계 플라보노이드의 합성과 관련된 인자에 외래(exogenous) DNA 서열을 삽입함으로써 해당 인자의 발현을 감소 또는 증가시킬 수 있다.
예를 들어, 본 출원에서 상기 조성물은 식물체 내에 존재하는 안토시아닌계 플라보노이드의 합성과 관련된 인자의 DNA 서열에 인델(indel)을 형성함으로써 해당 인자의 발현을 감소 또는 증가시킬 수 있다.
예를 들어, 본 출원에서 상기 조성물은 식물체 내에 존재하는 안토시아닌계 플라보노이드의 합성과 관련된 인자의 DNA 서열의 일부를 치환시킴으로써 해당 인자의 발현을 감소 또는 증가시킬 수 있다.
예를 들어, 본 출원에서 상기 조성물은 식물체 내에 존재하는 안토시아닌계 플라보노이드의 합성과 관련된 인자의 DNA 서열의 일부를 역위시킴으로써 해당 인자의 발현을 감소 또는 증가시킬 수 있다.
상기 인위적 돌연변이는 인위적 뉴클레아제(engineered nuclease)를 이용하여 식물체 게놈 상에 도입될 수 있다.
예를 들어, 상기 인위적 뉴클레아제는 ZFN(Zinc-finger nucleases), TALEN(transcription activator-like effector nucleases), CRISPR/Cas(Clustered Regularly Interspaced Short Palindromic Repeats/ CRISPR-associated sequences)의 등을 포함할 수 있으나, 특정 DNA부위를 자르는데 사용하는 인공 효소를 이용하여 유전자의 표적 부위를 편집할 수 있는 기술이라면 이에 제한하지 않는다.
구체적인 예를 들어, 본 출원의 상기 발현 조절용 조성물은 CRISPR/Cas을 이용하는 조성물일 수 있다.
본원 명세서의 일 실시예에서, 상기 발현 조절용 조성물은,
안토시아닌계 플라보노이드의 합성과 관련된 인자의 핵산 서열 내 표적서열에 상보적인 결합을 형성할수 있는 가이드 RNA 또는 이를 암호화하는 핵산서열 중 선택되는 1 이상; 및
상기 안토시아닌계 플라보노이드의 합성과 관련된 인자의 핵산 서열 중 표적하는 부위를 절단 또는 변형시키는 Cas단백질 또는 이를 암호화하는 핵산서열 중 선택되는 1 이상;
을 포함할 수 있다.
예를 들어, 본 출원에서 상기 발현 조절용 조성물은,
F3H, F3′H, F3′5′H 중 선택되는 1 이상의 핵산 서열 내 표적서열에 상보적인 결합을 형성할 수 있는 가이드 RNA 또는 이를 암호화하는 핵산 서열 중 선택되는 1 이상; 및
상기 F3H, F3′H, F3′5′H 중 선택되는 1 이상의 핵산 서열 중 표적하는 부위를 절단 또는 변형시키는 Cas단백질 또는 이를 암호화하는 핵산서열 중 선택되는 1 이상;
을 포함할 수 있다.
일 실시예에서, 상기 발현 조절용 조성물은,
F3H, F3′H, F3′5′H 중 선택되는 1 이상의 핵산 서열 내 표적서열에 상보적인 결합을 형성할 수 있는 가이드 RNA 및 상기 가이드 RNA와 복합체를 형성하여 안토시아닌계 플라보노이드의 합성과 관련된 인자의 핵산 서열 중 표적하는 부위를 절단 또는 변형시키는 Cas단백질을 포함할 수 있다. 즉, RNP(ribonucleoprotein)형태의 조성물일 수 있다.
상기 가이드RNA는 안토시아닌계 플라보노이드의 합성과 관련된 인자의 표적서열에 상보적인 결합을 할 수 있다.
상기 표적서열은 표적 유전자 또는 핵산 내에 존재하는 염기서열로, 가이드RNA의 서열과 상보성을 가진다. 또한, 상기 표적 유전자 또는 핵산의 이중가닥을 가지기 때문에 표적서열은 이중가닥의 일부 또는 전체일 수 있다.
상기 표적 서열은 안토시아닌계 플라보노이드의 합성과 관련된 인자의 엑손, 인트론 또는 이의 조합의 핵산 서열일 수 있다.
예를 들어, 상기 가이드 RNA는 F3H의 엑손에 상보적인 결합을 할 수 있다.
예를 들어, 상기 가이드 RNA는 F3'H의 엑손에 상보적인 결합을 할 수 있다.
예를 들어, 상기 가이드 RNA는 F3'5'H의 엑손에 상보적인 결합을 할 수 있다.
상기 표적서열은 가이드핵산 설계 단계에서 PAM서열을 기준으로 다양하게 선택될 수 있다.
예를 들어, 유전자의 표적 영역에 상보적인 결합을 형성할 수 있는 가이드 핵산은 표적 핵산 또는 유전자의 염기서열을 데이터베이스(예를 들어, NCBI 등)를 사용하여 유전자의 염기서열 데이터를 수집하여, 상기 염기서열 중 PAM 서열(예를 들어, 5'-NGG-3')이 있는 부위를 찾고, 그 PAM 서열로부터 ~20bp의 염기서열을 선정하여 설계할 수 있다.
상기 “PAM(proto-spacer-adjacent Motif)서열”은 Cas단백질이 인식할 수 있는 뉴클레오타이드 서열이다. Cas의 유래마다 PAM 서열은 다를 수 있다.
예를 들어, 상기 PAM 서열은 하기의 서열 중 1 이상일 수 있다(5'에서 3'방향으로 기재함).
NGG(N은 A, T, C 또는 G임);
NNNNRYAC(N은 각각 독립적으로 A, T, C 또는 G이고, R은 A또는 G이고, Y는 C또는 T임);
NNAGAAW(N은 각각 독립적으로 A, T, C 또는 G이고, W는 A 또는 T임);
NNNNGATT(N은 각각 독립적으로 A, T, C 또는 G임);
NNGRR(T)(N은 각각 독립적으로 A, T, C 또는 G이고, R은 A 또는 G임); 및
TTN(N은 A, T, C 또는 G임).
상기 가이드 RNA는 crRNA(CRISPR RNA) 또는/및 tracrRNA(trans-activating crRNA)를 각각을 포함하는 듀얼(dual) 가이드 RNA일 수 있고, 또는 상기 crRNA와 상기 tracrRNA의 특정 부위가 융합된 형태를 sgRNA(sinlge-chain guide RNA)일 수 있다.
본원 명세서에서, 상기 Cas단백질은 Cas9 또는 Cpf1일 수 있다.
상기 Cas9은 스트렙토코커스 피오게네스(Streptococcus pyogenes), 스트렙토코커스 써모필러스(Streptococcus thermophilus), 스트렙토코커스 속(Streptococcus sp.), 황색포도상구균(Staphylococcus aureus), 노카르디옵시스 다손빌레이(Nocardiopsis dassonvillei), 스트렙토마이세스 프리스티네스피랄리스(Streptomyces pristinaespiralis), 스트렙토마이세스 비리도크로모게네스(Streptomyces viridochromogenes), 스트렙토마이세스 비리도크로모게네스(Streptomyces viridochromogenes), 스트렙토스포랑기움 로세움(Streptosporangium roseum), 스트렙토스포랑기움 로세움(Streptosporangium roseum), 알리사이클로바클루스 아시도칼다리우스(AlicyclobacHlus acidocaldarius), 바실러스 슈도마이코이데스(Bacillus pseudomycoides), 바실러스 셀레니티레두센스(Bacillus selenitireducens), 엑시구오박테리움 시비리쿰(Exiguobacterium sibiricum), 락토바실러스 델브루에키이(Lactobacillus delbrueckii), 락토바실러스 살리바리우스(Lactobacillus salivarius), 미크로스 킬라 마리나(Microscilla marina), 부르크홀데리아레스 박테리움(Burkholderiales bacterium), 폴라로모나스 나프탈레니보란스(Polaromonas naphthalenivorans), 폴라로모나스 속(Polaromonas sp.), 크로코스파에라 와트소니이(Crocosphaera watsonii), 시아노테세 속(Cyanothece sp.), 마이크로시스티스 아에루기노사(Microcystis aeruginosa), 시네코코커스 속(Synechococcus sp.), 아세토할로비움 아라바티쿰(Acetohalobium arabaticum), 암모니펙스 데겐시이(Ammonifex degensii), 칼디셀룰로시럽토 베시이(Caldicelulosiruptor bescii), 칸디다투스 데술포루디스(Candidatus Desulforudis), 클로스트리듐 보툴리눔(Clostridium botulinum), 클로스트리듐 디피실레(Clostridium difficile), 피네골디아 마그나(Finegoldia magna), 나트라나에로비우스 써모필러스 (Natranaerobius thermophilus), 펠로토마쿨럼 써모프로피오니쿰(Pelotomaculum thermopropionicum), 아시디티오바실러스 칼두스(Acidithiobacillus caldus), 아시디티오바실러스 페로옥시단스(Acidithiobacillus ferrooxidans), 알로크로마티움 비노숨(Allochromatium vinosum), 마리노박터 속(Marinobacter sp.), 니트로소코커스 할로필러스(Nitrosococcus halophilus), 니트로소코커스 와트소니(Nitrosococcus watsoni), 슈도알테로 모나스 할로플란크티스(Pseudoalteromonas haloplanktis), 크테도노박테르 라세미페르(Ktedonobacter racemifer), 메타노할로비움 에베스티가툼(Methanohalobium evestigatum), 아나베나 바리아빌리스(Anabaena variabilis), 노둘라리아 스푸미게나(Nodularia spumigena), 노스톡 속(Nostoc sp.), 아르트로스피라 맥시마(Arthrospira maxima), 아르트로스피라 플라텐시스(Arthrospira platensis), 아르트로스피라 속(Arthrospira sp.), 링비아속(Lyngbya sp.), 마이크로콜레우스 크토노플라스테스(Microcoleus chthonoplastes), 오실라토리아 속(Oscillatoria sp.), 페트로토가 모빌리스(Petrotoga mobilis), 써모시포 아프리카누스(Thermosipho africanus) 또는 아카리오클로리스 마리나(Acaryochloris marina) 등 다양한 미생물 유래의 Cas9일 수 있다. 일 실시예에서 스트렙토코커스 피요게네스(Streptococcus pyogenes) 유래의 Cas9 단백질을 이용할 수 있다.
또한, 상기 Cpf1은 Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Methylobacterium 또는 Acidaminococcus 유래의 Cpf1일 수 있다.
본 출원의 일 실시예에서 상기 Cas9은 스트렙토코커스 피오게네스(Streptococcus pyogenes) 유래 의 spCas9일 수 있다.
상기 spCas9을 이용할 때,
일 구체예로, 상기 표적서열은 서열번호 1 내지 5 중 선택되는 1 이상일 수 있다. 이 때, 가이드 RNA는 서열번호 42 내지 46 중 선택되는 1 이상일 수 있다.
다른 구체예로, 상기 표적서열은 서열번호 37 내지 41 중 선택되는 1 이상일 수 있다. 이 때, 가이드 RNA는 서열번호 47 내지 51 중 선택되는 1 이상일 수 있다
또 다른 구체예로, 상기 표적서열은 서열번호 54 내지 55 중 선택되는 1 이상일 수 있다. 이 때, 가이드 RNA는 서열번호 56 내지 57 중 선택되는 1 이상일 수 있다.
또 다른 구체예로, 상기 표적서열은 서열번호 58 내지 59 중 선택되는 1 이상일 수 있다. 이 때, 가이드 RNA는 서열번호 60 내지 61 중 선택되는 1 이상일 수 있다.
본원 명세서에서, 상기 발현 조절용 조성물은 벡터의 형태로 제공될 수 있다.
상기 벡터는 비바이러스 벡터 및 바이러스 벡터를 포함한다.
상기 바이러스 벡터는 아데노바이러스 벡터, 레트로바이러스 벡터, 바이너리 벡터, 렌티바이러스 벡터, 아데노-연관 바이러스(AAV) 벡터, 백시니아바이러스 벡터, 폭스바이러스 벡터, 단순포진바이러스 등일 수 있으나, 이에 제한하지는 않는다. 상기 비바이러스 벡터는 플라스미드(Plasmid), 네이키드 DNA(naked DNA), 리포좀(Liposome) 등일 수 있으나, 이에 제한하지는 않는다.
또한, 상기 발현 조절용 조성물은 통상적으로 유전자를 운반할 수 있는 다양한 방법으로 식물세포에 제공될 수 있다.
예를 들어, 전기천공법, 유전자총, 초음파천공법, 자기주입법, PEG(Polyethylene glycol), 아그로박테리움법(Agrobacterium), 일시적인 세포의 압축 또는 스퀴징, 지질-매개 형질감염, 나노입자, 실리카 등의 방법을 포함할 수 있다.
상기 발현 조절용 조성물은 식물체 내의 지노믹 DNA 상에서 안토시아닌계 플라보노이드의 합성과 관련된 인자를 편집하여 이러한 인자들의 발현을 조절하는데 사용될 수 있다.
상기 편집은 넉아웃(Knock-out), 넉인(Knock-in), 넉다운(Knock-down) 중 선택되는 어느 하나 이상일 수 있다. 예를 들어, 플라보노이드 합성과 관련된 인자의 발현을 억제(또는 감소 또는 비활성화), 또는 촉진(또는 증진 또는 활성화)시킴으로써 식물의 색깔, 예를 들어 화색을 변경시킬 수 있다.
이러한 본 출원의 조성물 및 이를 이용하는 방법은 하기와 같은 장점을 가진다.
종래 RNAi를 이용하여 화색을 변경하는 기술과 비교하면, 상기 RNAi는 전사 후(post transcription) 유전자 발현을 조절하는 수단으로 이용되는 것이고, 실질적으로 유전체의 서열을 변경시키지 않는다. 그러므로, 환경 등의 영향으로 식물체 내 상기 인자들의 전사량이 달라지는 경우 색깔 표현의 일관성이 유지되기 어려운 단점이 있고, 지속적인 표적이탈효과 (off-target effect) 발생으로 의도치 않은 표현형이 생길 가능성이 높다. 특히, 꽃의 색깔 변경과 관련하여, 외래 유전자 삽입이 필수적이므로 GMO로 분류되어 상용화에 제한이 있다.
반면, 본 출원의 조성물을 사용하는 경우는, 식물체의 지노믹 DNA 상에서 안토시아닌계 플라보노이드의 합성과 관련된 인자, 예를 들어 F3H(Flavone 3-hydroxylase), F3′3-hydroxylase), F3′5′H(flavonoid 3′′를 코딩하는 서열에 인위적 돌연변이를 직접적으로 형성시키기 때문에, 영구적으로 이러한 인자들의 발현을 조절할 수 있다. 그러므로 식물체의 색깔 특성이 변경된 표현형이 일관적으로 나타나게 된다.
본 출원의 일 실시예에서는 페튜니아의 화색을 변경시키기 위한 조성물 및 페튜니아 화색을 변경시키는 방법을 제공한다.
또한, 본 출원의 제조방법에 의해 제조된 화색 변이 형질을 가지는 유전체 편집 페튜니아 식물체 및 상기 식물체의 유전체가 편집된 종자를 제공한다.
본 출원에 따른 화색 변이 형질을 가지는 유전체 편집 페튜니아 식물체는 안토시아닌 색소에 영향을 미치는 플라보노이드 생합성 경로의 F3H 유전자를 CRISPR/Cas9 시스템을 이용하여 편집한 것으로, 페튜니아 유래 F3H 유전자가 녹-아웃된 유전체 편집 식물체이다.
본 출원의 일 구현 예에 따른 유전체 편집 페튜니아 식물체는 야생형 페튜니아에 비해 꽃잎의 안토시아닌 함량이 현저히 감소되어, 야생형 페튜니아의 꽃잎이 짙은 보라색인 반면 유전체 편집 페튜니아의 꽃잎은 옅은 분홍색인 것이 특징이다.
본 출원은 또한, 페튜니아 유래 F3H 유전자의 표적 염기서열에 특이적인 가이드 RNA와 엔도뉴클레아제 단백질의 복합체를 유효성분으로 함유하는, 페튜니아 식물체의 화색을 변이시키기 위한 유전체 편집용 조성물을 제공한다. 본 출원의 유전체 편집용 조성물은 F3H 유전자의 표적 염기서열에 특이적인 가이드 RNA와 엔도뉴클레아제 단백질의 복합체를 포함하고 있어, 상기 조성물을 페튜니아 식물체에 처리할 경우, 상기 가이드 RNA와 엔도뉴클레아제 단백질의 복합체가 RNA 유전자 가위로 작동하여 표적 유전자를 편집할 수 있다.
재료 및 방법
I. RNP 매개 형질전환
1. 페튜니아 원형질체 준비 및 추출
기내에서 종자를 발아시켜 얻은 페튜니아 '미드나이트'('midnight': PanAmerican Seed, USA)의 배양묘를 3주간 생육시킨 후 어린 잎을 취하여 13% 만니톨 CPW(cell protoplast washing)에 전처리 후 효소 분해를 위해 각각 VCP 효소(Viscozyme + Pectinex + Celluclast)와 MC 효소(Macrozyme +
Cellulase)에 침지처리하였다. 원형질체 수집을 위하여 암상태 25℃에서 40rpm으로 3시간동안 진탕배양 후 600rpm에서 5분동안 원심분리를 수행하였으며, 25% 수크로스가 포함된 CPW (w/v) 용액에 재부유 및 원심분리를 통하여 정제를 추가 진행하였다. 실험은 원형질체에 효소처리와 수율을 최적화하기 위하여 생물학적 및 기술적으로 3 반복 수행하였다.
2. GFP 형광 유전자를 이용한 형질전환 효율의 결정
본 출원에서는 페튜니아의 원형질체에 형질도입율을 높이기 위하여 다른 PEG(polyethylene glycol) 농도와 배양기간을 처리하였고 GFP(green fluorescent protein) 발현을 통하여 이를 확인하여 최적화하고자 하였다. 정제된 원형질체를 CPW 9%(w/v) 만니톨 용액에 재현탁시킨 후 4℃에서 1시간 동안 안정화 시켰다. 이후 600rpm에서 5분간 원심분리를 통하여 원형질체를 수집하였으며, 300㎕ MaMg 용액(0.5mM MES, 0.4M 만니톨, 15mM MgCl2)을 사용하여 세포 밀도를 106cells/㎖로 조정하였다. 250㎕의 원형질 세포 (2.5×105 cells/㎖)를 GFP 코딩 유전자(PBI221::GFP)를 포함하는 플라스미드 벡터 PBI221 50㎍과 혼합하였다. 그리고 미리 준비된 PEG 용액[40% (w/v) PEG4000 (시그마 알드리치), 0.4M 만니톨, 0.1MCa(NO3)2] 270㎕를 첨가하여 잘 섞어준 후 실온에서 20분 동안 인큐베이션하였다. 이후 PEG 용액을 씻어내기 위하여 세척 용액(CPW 9%(w/v) 만니톨) 250㎕를 첨가하여 잘 혼합한 후 10 분간 실온에서 반응시켰다. 위와 같은 방법으로 500㎕, 1㎖, 2㎖ 및 3㎖의 세척 용액을 차례로 첨가한 후 10분 간격으로 인큐베이션 하여 추가세척을 하였고, 최종적으로 600rpm에서 5분간 원심분리하여 얻어진 원형질체 펠렛은 1㎖의 콜로니 유도 배지로 옮겨 25℃에서 암배양시켰다. 형질전환율은 24시간 후 녹색형광현미경을 통하여 GFP로 형질전환된 세포의 수에 기초하여 계산되었다 (도 1 및 도 3).
3. Cas9 단백질 재조합과 가이드 RNA 설계 및 RNP 형질 도입
실험에 사용된 재조합 Cas9 단백질(160kD)은 툴젠(Korea)으로부터 구매하여 사용하였고, 페튜니아 '미드나이트'의 F3H 유전자좌는 유전자 정보(GenBank accession no. AF022142.1)를 기반으로 하여 증폭 및 시퀀싱되었다. 그 후 CRISPR RGEN Tools (http://rgenome.net/)를 사용하여 F3H 유전자의 첫 번째 및 두 번째 엑손을 표적으로, high out-of-frame scores로 5개의 다른 F3H sgRNA의 타겟 부위를 결정했다(도 2, 표 1).
Target sgRNA Sequence (5' -3') (서열번호) Strnad Direction Position (bp)
F3H1 F3H1-RGEN TTGGGATCTCATTGCTGAATTGG(1) - 158-180
F3H2 F3H2-RGEN GTTAAGGCATGTGAAGATTGGGG(2) + 428-450
F3H3 F3H3-RGEN CTGCGGTTTGACATGTCTGGTGG(3) + 586-608
F3H4 F3H4-RGEN GGCCAGACAAACCAGAAGGATGG(4) + 765-787
F3H5 F3H5-RGEN TTCAGTCCAAGGGT AAGGTCAGG(5) - 1431-1453
세포내 sgRNA 표적부위의 증폭은 표 2에 개시된 프라이머로 수행되었다. 페튜니아 원형질체를 이용한 유전자가위 복합체는 Cas9:sgRNA=1.5:3의 분자비로 만들었다. 준비된 복합체를 원형질체 세포로 도입하기 위해서 Cas9 단백질 완충액 2㎕, Cas9 단백질 27㎍, sgRNA 80㎍ 및 탈이온수(deionized water)로 구성된 반응액 20㎕를 준비하였다. 이 반응액을 300㎕ MaMg 용액(0.5mM MES, 0.4M 만니톨, 15mM MgCl2)에 현탁해 놓은 원형질체와 균일하게 혼합한 뒤에 준비해 둔 PEG용액과 상온에서 20분 동안 반응시켰다. 이후의 세척 과정은 PEG를 기반으로 한 GFP 플라스미드 형질전환과 동일하다.
4. F3H 유전자좌에서 돌연변이 빈도의 검출과 예측
게놈 DNA는 i-게놈 식물 DNA 추출 미니 키트(Intronbio, Seoul, Korea)를 사용하여 형질전환된 원형질체에서 추출하였다. F3H 유전자좌에서 RNP에 의해 유도된 부위 특이적 돌연변이(site-directed mutations)를 검출하기 위해, 고해상도 용해 곡선(high resolution melt curve) 분석을 수행하였다. 이를 위해 제조사의 프로토콜에 따라 Phusion®High-Fidelity PCR Kit (NEB, USA)와 nested PCR 프라이머(표 3)를 사용하여 야생형(WT)과 sgRNA 형질전환체로부터 F3H 좌위의 타겟 게놈 영역을 증폭시켰다. HRM 분석은 2.5mM MgCl2 및 Eva Green dye (PhileKorea, Daejeon, Korea)가 첨가된 2 x HRM Master mix, 미리 증폭된 주형 100 ng, 그리고 각각의 정방향 및 역방향 프라이머 0.2μM 포함한 총 반응 부피 10㎕를 사용하여 Illumina Eco Real-Time PCR System (Illumina, CA, USA)에서 수행되었다. PCR 증폭은 초기 변성 단계(95℃2분)에 이어 95℃에서 10초간 40 사이클, 60℃에서 30초간 어닐링 및 신장 단계를 조합하여 수행하였다. Eco Real-Time 장비의 프리세트파라미터를 사용하여 PCR 산물의 올리고뉴클레오티드 어닐링의 특이성과 해리상수(dissociation kinetics)를 확인하기 위해 95℃에서 15초, 55℃에서 15초 및 95℃에서 15초로 최종 사이클의 온도를 구배(55-95℃조건에서 해리시켰다. 사용된 모든 시료의 실험은 3 반복으로 수행되었으며, WT와 sgRNA 샘플 간의 용해 곡선 프로파일을 비교하여 유전형을 지정했다. 형질전환된 원형질체에서 RGENs에 의해 생성된 InDel(Insertion/Deletion)의 돌연변이 빈도를 확인하고 평가하기 위해 F3H 유전자 타겟부위를 nested PCR 프라이머(표 2)로 증폭시키고 Illumina MiSeq 플랫폼에 따라 염기서열을 결정하였다. 그 결과 RGEN 절단 부위 주변의 InDel 돌연변이가 관찰되었고 돌연변이 빈도는 각각의 F3H-RGEN 형질 도입체로 계산되었다.
[표 2]
Figure PCTKR2019006965-appb-I000001
실시예 1. 페튜니아에서의 향상된 일시발현 시스템
페튜니아의 원형질체 분리 및 일시적 발현 시스템은 이전의 연구에 의해 충분히 조사되지 않았고, 이용 가능한 방법 중 일부는 30년 동안 개선되지 않았다. 수율, 생존력 및 효율적인 형질 도입은 먼저 원형질체의 성공적인 분리가 선행되어야 한다. 원형질체의 분리는 외식편의 종류와 효소의 농도, 배양 시간 및 완충액 조성 등 다양한 인자에 의해 영향을 받는다. 본 출원에서는 페튜니아의 원형질체 분리 방법과 일시적 발현 시스템을 추가 및 개선했다. 이전 페튜니아 원형질체 기반 실험(Subburaj et al. 2016 Plant Cell Rep. 35:1535)과 거의 유사한 세포효소 1.5%와 마세로자임(Macerozyme) 0.25%를 사용한 효소 조합(MC)에서 1.52±0.23×106 cell/g의 신선한 무게의 최대 원형질 수율이 관찰되었다. 그러나 셀루클래스트(Celluclast, 0.6%), 펙티넥스(Pectinex, 0.6%) 및 비스코자임(Viscozyme, 1.2%)을 포함하는 수정된 효소 조합(VCP)을 사용했을 때, 3 시간 배양으로 최고 6.90±0.18×106 cells의 높은 원형질체 분리 수율을 확인했다. 또한 VCP로 얻은 원형질체는 형광 염료인 FDA(fluorescein diacetate) 검사에서 원형질체의 생존율이 94%에 이르러, MC 효소 조합보다 높은 것으로 확인되었다(표 3). 이를 통해, 본 출원의 결과는 페튜니아의 일시적 유전자 발현 연구에서 손상되지 않고 살아있는 원형질체의 분리와 수율을 크게 향상시킬 것이라 사료된다.
[표 3]
Figure PCTKR2019006965-appb-I000002
형질 도입의 확인을 위하여 추출된 페튜니아의 원형질체(2.5×105 cells)에 40% PEG4000를 사용하여 리포터 유전자 GFP를 포함하는 벡터 (PBI221) 50㎍으로 형질 도입시켰다. 도 3과 같이 24시간 후 GFP 발현을 확인하였고, 이전의 연구에서 50%의 발현을 보인 반면 본 출원에서는 더 높은 55%의 발현을 확인했다. 본 출원에서는 이전의 연구와 비교하여 PEG4000을 사용하였으며 배양 시간을 20분으로 단축하여 높은 재현성과 함께 페튜니아 원형질체의 생존력과 활력을 높였을 것이라 사료된다. 이 연구결과로 향상된 일시발현시스템(Transient expression system)은 추후 페튜니아와 다른 가지과 식물에서의 연구 및 타겟 유전자 돌연변이 연구에 도움이 될 것이라 사료된다.
실시예 2. 페튜니아 원형질체 연구에서 F3H 유전자의 타겟 돌연변이 유발을 위한 RGEN RNP의 Direct delivery
페튜니아 F3H에서 타겟 부위 돌연변이를 일으키기 위해, F3H 유전자 좌위의 상응하는 타겟 부위에 sgRNA(F3H1, F3H2, F3H3, F3H4 및 F3H5)를 설계하였다(도 2). 설계된 sgRNA는 23개의 뉴클레오티드(3bp의 PAM 포함)를 가지고 있고, CRSPR/Cas9가 부위 특이적 DSB(double strand break)를 만드는 것을 돕기 위해 F3H 유전자좌의 타겟 부위에서 상응하는 20 개의 뉴클레오타이드와 쌍을 이룬다.
다른 게놈 편집 도구(ZFN 또는 TALENS)와 비교하여 CRISPR/Cas9 시스템은 타겟 특정 돌연변이를 일으키는데 준비, 전달 및 생성 측면에서 보다 효과적이라고 여겨 왔다. RNP 복합체(Cas9-sgRNA)와 같은 DNA-free 단백질을 살아있는 세포에 직접 전달하는 것은 GMO 규칙에 의해 제한되지 않고 오프 타겟(off-target)효과를 줄인다. 따라서 본 출원에서는 이전 연구(Subburaj 등, 2016 Plant Cell Rep. 35:1535)에서 설명한 것과 같이 내생 F3H 유전자를 돌연변이시키기 위해 페튜니아 원형질체에서 RNP 복합체(정제된 Cas9 단백질 + in vitro에서 합성된 sgRNA)의 직접 도입을 시도했다(도 1).
원형질체에서 CRISPR/Cas9 유도 돌연변이 중 F3H에 Indel 변이가 있는지를 찾기 위해 고해상도 용해(high resolution melting, HRM) 곡선 분석을 사용했다. 이를 위해 RNP가 도입되지 않은 대조구와 RNP로 형질전환된 원형질체에서 DNA 샘플의 HRM 커브를 비교했다. 원형질체에서 F3H 유전자좌의 RGEN 타겟 부위는 부위 특이적 중첩 PCR 프라이머(site specific nested PCR primers)를 사용하여 증폭되었다. 도 4 내지 8에서 볼 수 있듯이 HRM 분석은 미분 곡선의 모양에 따라 F3H의 5개 표적 부위 모두에서 WT 및 sgRNA에 의한 돌연변이체(삼각형으로 표시) 사이의 구분을 명확히 할 수 있어, 원형질 세포에서 CRISPR/Cas9 유도 돌연변이를 간단하고 효율적인 방식으로 확인할 수 있었다(도 4 내지 8).
실시예 3. Targeted Deep Sequencing에 의한 페튜니아 F3H 유전자에서의 RGEN RNPs 유도성 형질전환 세포 및 변이형태 확인
RNP가 도입된 원형질체에서 타겟 유전자 F3H의 형질전환 세포와 변이형태를 확인하기 위하여 targeted deep sequencing을 실시하였다. F3H1~F3H5 5개의 sgRNA를 이용한 RNP 조합으로 형질전환된 원형질체 세포들로부터 DNA를 추출한 후 표 2에 개시된 프라이머를 이용하여 우선 증폭하였다. 대조구(WT)과 Cas9 단백질만으로 형질전환된 원형질체 세포에서는 변이가 일어나지 않은 반면에, F3H 유전자를 타겟으로 제작된 5개의 RNP 결합부위에서는 삽입 및 결실 등의 변이형태가 일어나고 있음을 확인할 수 있었다. 제작된 guide RNA 결합부위에 따라 변이율은 0.8~49.3%로 발생하였고, F3H 유전자좌의 평균 변이율은 약 20.8%가 유도되었다(표 4).
표 4 내에 a는 변이율 중 삽입된 염기서열의 개수를 의미하며, b는 삭제된 염기서열의 개수를 의미하고, c는 F3H1 내지 F3H5에 대해서만 계산된 평균 및 표준편차 오류값을 의미한다.
[표 4]
Figure PCTKR2019006965-appb-I000003
이는 본 출원자가 동일한 페튜니아 품종과 원형질체를 이용한 기존NR(nitrate reductase) 유전자를 타겟으로 CRISPR/Cas9를 적용하여 편집을 시도한 예와 비교해 볼 때(Subburaj et al., 2016), 평균 변이유도율(NR 14.9% vs. F3H 20.8%) 및 최대 변이율(NR 34.7% vs. F3H 49.3%) 면에서 높은 변이효율을 가져온 기술적 발전이라고 할 수 있다.
F3H 유전자좌에서 발생한 변이형태는 제작된 5개의 RNP를 평균해서 조사해 본 결과 결실과 삽입 변이체의 비율이 45.4:54.6으로 타겟부위에 새로운 염기가 첨가되는 형태의 변이가 약간 높게 나타남을 알 수 있었다. 제작된 RNP에 따라 차이가 있기는 하지만 염기 결실크기는 1~7 bp였고, 염기삽입의 크기는 2 bp까지 유도된 세포가 발생하는 것을 알 수 있었다(도 9).
실시예 4. 재분화된 T0 페튜니아 식물체에서 CRISPR/Cas9 매개 돌연변이 및 유전형 분석
RNP로 형질도입한 원형질체의 세포 군집을 캘러스 유도 배지에서 배양한 후 약 2주차에 녹색의 캘러스가 나타나기 시작하였다. 캘러스의 islet를 절개하여 서브배양하여 신초형성을 유도하였다. 동일한 캘러스 islet으로부터 생장한 묘목을 독립적인 T0 식물체로 간주하였다. F3H1~F3H5 5개의 sgRNA를 이용한 F3HRGEN으로부터 각각 39, 48, 62, 57 및 35개의 T0 식물체를 획득하였다. CRISPR/Cas9에 의해 유도된 돌연변이를 확인하기 위해서, 각 식물체로부터 DNA 시료를 준비하고 표적 자리에서 HRM 분석을 수행하였다(도 10). 그 결과는 도 6에 도시하였고, 삼각형으로 표시된 곡선은 돌연변이형을 지칭한다. F3H2의 표적 위치에서 48개의 식물체 중 8개의 식물체 DNA 시료에서 구별되는 HRM 곡선을 보여주어 돌연변이가 유발되었음을 알 수 있었으나, F3H1, F3H3~F3H5의 표적 위치에서는 야생형과 구별되는 특별한 HRM 곡선이 확인되지 않았다. 상기 돌연변이를 정확하게 검증하기 위해서, 상기 별개의 HRM 곡선을 보여준 8개 식물체의 F3H2 표적 위치를 증폭하여 direct Sanger 시퀀싱으로 분석하였다. DNA 크로마토그램 결과, 8개의 식물체 중 1개의 식물체에서 야생형의 F3H(allele #1)의 CDS(coding sequences)에서 200번째 위치에 T 염기가 삽입된 돌연변이 F3H 대립유전자(allele #2)가 확인되었다. 돌연변이 F3H allele #2는 프레임시프트(frameshift)를 야기하여, 78번째 위치의 아미노산에서 인프레임 비성숙 종결코돈을 유발하였고, mRNA의 번역 동안에 절단체 단백질이 많이 생성되어, morphine synthesis N-말단의 non-haemdioxygenase (DIOX_N)의 활성 파괴에 따라 궁극적으로 F3H의 기능을 전적으로 혹은 일부 상실시키는 것으로 예측되었다(도 11).
또한, 페튜니아에 SNP를 가진 유전자 염기서열인 F3Ha 및 F3Hb를 RNP 매개 형질전환하여 시퀀싱 분석 결과 및 indel 결과는 도 14 내지 19에 도시화하였다(각 taget gene 명칭은 1226 P1C7, 1226 P3C5, 1226 P4C4로 명명). SNP를 가진 F3Ha 또는 F3Hb에서도 T 염기가 삽입된 돌연변이가 확인됨을 알 수 있었고, 도 12 내지 13의 야생형 F3Ha 및 F3Hb에 비해, 도 14 내지 19의 돌연변이형 F3Ha 및 F3Hb에서 indel이 95% 이상임을 확인하였다.
화색 표현형의 시각적 평가를 위해, 재분화된 식물체를 토양에 식재 하였다. 개화는 약 4주후에 시작되었으며, 야생형의 페튜니아가 violet-blue의 화색을 가진 것에 반해, 돌연변이 F3H allele #2를 가진 식물체는 명확하게 변형된 화색을 보여주었다(도 20, 21). 상기 결과는 CRISPR/Cas9에 의해 F3H의 단일 유전자 카피가 돌연변이될 수 있음을 시사하였다. 본 출원자는 야생형과 돌연변이 F3H allele #2를 가진 식물체의 0 및 1 DPA 꽃잎에서 상대적인 안토시아닌 함량을 측정하였다(도 22). 도 18에서 볼 수 있듯이, 돌연변이 F3H allele #2를 가진 식물체의 꽃잎 추출물의 흡광도 값이 야생형 식물체의 꽃잎 추출물의 흡광도에 비해 현저히 낮은 값을 보여주었고, F3H의 녹아웃이 안토시아닌의 생성을 억제하여 꽃잎 색의 변화를 초래하였음을 알 수 있었다. T0 식물체에서 F3H2의 표적 자리에 유전형 및 돌연변이율을 확인하기 위해, deep target sequencing을 수행하였다. 테스트한 8개의 식물체 중에서 F3H 좌의 F3H2 표적 자리에 1bp의 염기가 삽입된 putative 동형접합인 단일 돌연변이 (2.1%)가 발견되었고, 나머지 식물체에서는 야생형과 비교하여 특별한 InDel 돌연변이율이 확인되지 않았다.
II. 아그로박테리움법 매개 형질전환
P. axillaris와 P. integrifolia의 잡종에서 유래 한 Petunia (Petunia x hybrida)는 F3H의 싱글 카피(single copy)를 가지고 있다 (AF022142, Houwelingen et al. 1997).
최근에 본 출원자들은 P. hybrida Cv "midnight"에서 SNP와 코딩 서열의 결실에 의한 F3H 상동성 유전자의 여분의 복사본을 발견했다(NCBI: AF022142).
본 실시예에서는 이들 유전자를 F3Ha 및 F3Hb로 명명하여 본 실험에 사용하였다.
1. 페튜니아 준비
3주 된 P. hybrida cv. 'midnight' (PanAmerican Seed, IL)의 어린잎을 사용(도 23의 A) 배양하여 실험을 진행하였다.
2. sgRNA 설계 및 벡터 구축
gRNA는 CRISPR RGEN Tools 웹 사이트 (http://rgenome.net/)를 통해 F3Ha 및 F3Hb 유전자의 첫 번째(도 24) 엑손이 보존되는 단일 표적 특정 부위를 설계하였다(Bae et al. 2014). 그리고 high-throughput binary vector인 pBAtC (Kim et al., 2016)는 Toolgen Inc.으로부터 수득하였다. pBAtc::PhF3H-sgRNA를 제작하기 위해 합성된 sgRNA 올리고를 어닐링하고 pBAtC 벡터의 AarI 사이트에 삽입하였다.
3. 형질전환 및 배양
아그로박테리움 매개 형질전환을 위한 프로토콜은 Kim et al. 2016의 방법을 참고하여 수행하였다. 간단하게 설명하자면, 페튜니아를 약 0.5 × 0.5 cm의 작은 조각으로 절단(도 23의 B)하여 아그로박테리움과 공배양(co-culture) 방법으로 형질전환하여 사용하였다.
절단한 절편(Explant)은 형질전환 때까지 basta와 선택적으로 배양하여 explant로부터 수득하였다.아그로박테리움(Agrobacterium tumefaciens)은 고체 YEP 배지[스펙티노마이신 75 ㎎/L, 리팜피신 25 ㎎/L, 펩톤 10 g/L, NaCl 5g/L, 효모 추출물 5 g/L, 1.5%(w/v) 아가 (pH 7.0)]에 긁은 후 28℃에서 배양하여 생성된 단일 콜로니를 같은 항생제가 들어있는 액체 YEP 배지 10 mL에 넣고 OD650이 0.6 ~ 0.8이 될 때까지 28℃에서 220 rpm으로 교반하였다.
다 자란 배양균에 30% 글리세롤 스톡 10 mL을 넣고 섞은 뒤, 1.5 mL 튜브에 1 mL씩 분주하여 액체 질소로 급속 냉각하여 -70℃에서 보관하였다. 접종 하루 전에 항생제가 들어있는 액체 YEP 배지 200 mL에 -70℃에서 보관해 놓은 아그로박테리움 튜머파시엔스 스톡을 1 mL 넣고 OD650이 0.6~0.8이 될 때까지 25℃에서 250 rpm으로 배양기에서 흔들어 주었다. 접종 당일에 액체 YEP 배지 200 mL를 50 mL씩 나눠서 20℃3,270 g에서 10분 동안 원심분리하였다. 각각의 튜브에 있는 아그로박테리움 튜머파시엔스 펠렛을 액체 CCM (co-cultivation medium; B5 염 0.32 g/L, BA 1.67 ㎎/L, MES 20 mM, GA3 0.25 ㎎/L, 아세토시린콘 0.2 mM, L-Cysteine 3.3 mM, 소듐 티오설페이트 1.0mM, DTT 1.0 mM, 수크로스 3%, pH 5.4) 15 mL을 넣어 준비하였다. 대략 50개 정도의 절편체를 15 mL 공배양/아그로박테리움 튜머파시엔스에 넣고 초음파 분해 처리(sonication)를 20초 처리를 한 뒤 30분 동안 접종시켰다. 각각의 절편체를 튜브에서 꺼내 멸균한 여과지 위에 놓고 물기를 제거한 뒤, 고체 CCM (액체 CCM과 동일, 아가(0.7%)에도 여과지를 한 장 깔고 10개체를 올려두었다.
그 후, 형질 전환된 재생 식물을 16 시간 (25 ± 1 ℃/ 8 시간 (20 ± 1 ℃의 광주기를 가진 성장 실에 이식하고 표현형 분석을 수행 하였다(도 23의 C).
4. 유전자형 및 돌연변이 검출 확인
형질전환 된 식물체의 지노믹 DNA는 i-genomic plant DNA extraction kit (Intronbio, Seoul, Korea)로 추출하였다. 인델(indel) 돌연변이가 있는 F3H 표적부위는 프라이머(서열번호 53 내지 59)를 이용하여 PCR 증폭 및 Illumina MiSeq platform을 이용한 표적 deep 시퀀싱에 의해서 검출하였다.
T0 독립 재생 식물에서 F3Ha 및 F3Hb 좌위의 FT2 표적 부위의 표적 심층 DNA 시퀀싱을 하였다.그 결과는 [표 4]에 기재하였다. 이 때, 야생형(plant 1로 명명)과 돌연변이형(plant 2로 명명)으로 표시하였다. 두 대립 유전자 모두 99 % 이상 인델이 형성되었음을 확인하였다 (표 5).
또한, 형질 전환된 돌연변이는 양쪽 대립 형질이 F3a 및 F3Hb 유전자좌 모두 동형 접합체로 돌연 변이된 양성 돌연변이 인 것으로 확인하였다.
추가로, 상기 핵산의 돌연변이에 의해 아미노산 레벨에서의 변경이 일어났는지를 확인하기 위해서, WT(F3H_a WT, F3H_b WT로 각각 명명) 및 F3Ha 및 F3Hb인 돌연변이(F3H_a Mutant, F3H_b Mutant로 각각 명명)에서 유래된 sgRNA2의 표적 부위의 아미노산 서열을 정렬한 결과를 도 25에 도시하였다.
이러한 결과로부터, morphine synthesis N-말단의 non-haem dioxygenase (DIOX_N) 도메인 영역에서, WT과 비교하여 돌연변이 타입에서 많은 아미노산의 변경이 이루어졌음을 알 수 있었다. 따라서, 상기 영역의 변경에 의해 효소 활성의 감소에 따라, 궁극적으로 F3H의 기능을 전적으로 혹은 일부 상실시키는 것으로 예측할 수 있었다.
Plant plant 1
(T0) Total count Insertion Deletion InDel Indel ratio Mutation Pattern Genotype
allele_a 7612 0 6 6 0.08% -　 Homozygous
allele_b 5008 4 3 7 0.14% -　 Homozygous
Flower color Purple violet (WT)
Plant plant 2
(T0) Total count Insertion Deletion InDel Indel ratio Mutation Pattern Genotype
allele_a 8770 8574 151 8725 99.49% 1 bp ins Homozygous
allele_b 8003 14 7984 7998 99.94% 2 bp del Homozygous
Flower color Purple spotted White (Mutant)
또한, 페튜니아에 SNP를 가진 유전자 염기서열인 F3Ha 및 F3Hb를 아그로박테리움 매개 형질전환하여 시퀀싱 분석 결과 및 indel 결과는 도 26 내지 31에 도시화 하였다(각 taget gene 명칭은 0324 L4-1, 0324 L9-1, 0324 L9-2로 명명).
그 결과, SNP를 가진 F3Ha 및 F3Hb에서도 본 출원의 조성물에 의해 높은 비율로 indel 돌연변이가 생성되었음을 확인할 수 있었다.
이러한 결과를 통해, 앞서 실시했던 RNP 매개 형질전환 방법뿐만 아니라 아그로박테리움을 이용한 형질전환 방법도 효과적임을 알 수 있었다.
한편, 본 실시예에서 사용한 야생형과 돌연변이형의 페튜니아의 화색을 비교하여 도 32에 나타냈다. 상기 도 32에서 알 수 있듯이, 야생형(Plant 1로 명명)에서는 보라색을 가지지만, 돌연변이형(Plant 2로 명명)에서는 Purple spotted White를 가져 명백하게 페튜니아의 화색이 변경되었음을 알 수 있다.
상기 결과들은 본 출원의 CRISPR/Cas9 조성물에 의해 F3H 유전자에 돌연변이가 효과적으로 도입 될 수 있음을 보여주었으며, 그 결과 F3H 유전자가 KO(Knock-out)되어 발현이 감소됨으로써, 페튜니아의 화색을 변경시킬 수 있음을 보여주었다.
본 출원은 CRISPR/Cas9 시스템을 이용하여 플라보노이드 생합성 유전자를 편집하기 위한 조성물 및 이의 이용방법을 제공할 수 있다.
플라보노이드 생합성 유전자를 편집하기 위한 표적서열, 가이드RNA 서열, 프라미어 서열에 관한 것이다.

Claims (19)

  1. 식물체 내의 게놈 DNA상에서 안토시아닌계 플라보노이드의 합성과 관련된 인자의 핵산 서열 내 표적서열에 상보적인 결합을 형성할 수 있는 가이드 RNA 또는 이를 암호화하는 핵산서열; 및
    상기 가이드 RNA와 복합체를 형성하여 상기 핵산 서열을 절단시키는 Cas단백질 또는 이를 암호화하는 핵산서열;
    을 포함하는 조성물로서,
    상기 가이드 RNA를 암호화하는 핵산은 상기 Cas단백질이 인식하는 PAM 서열에 인접해 있는 표적서열과 동일하거나 상보적인 서열이고,
    이 때, 상기 조성물은 식물체 내의 게놈 DNA상에서 안토시아닌계 플라보노이드의 합성과 관련된 인자의 핵산 서열 내 인위적인 돌연변이를 도입시키며,
    상기 조성물은 식물의 꽃, 종자, 과실, 잎 중 선택되는 1 이상의 색깔 특성을 변경시키는 것을 특징으로 하는 조성물.
  2. 제 1항에 있어서,
    상기 안토시아닌계 플라보노이드 합성과 관련된 인자는 F3H, F3′H 및 F3′5′H 중 선택되는 1 이상인 것을 특징으로 하는 조성물.
  3. 제 2항에 있어서,
    상기 안토시아닌계 플라보노이드 합성과 관련된 인자는 F3H 인 것을 특징으로 하는 조성물.
  4. 제 1항에 있어서,
    상기 인위적인 돌연변이는 하나 이상의 핵산이 삽입, 결실, 치환, 또는 역위 중 선택되는 1 인 것을 특징으로 하는 조성물.
  5. 제 1항에 있어서,
    상기 Cas단백질은 스트렙토코커스 피요게네스(Streptococcus pyogenes) 유래의 Cas9 단백질, 캄필로박터 제주니 (Campylobacter jejuni) 유래의 Cas9 단백질, 스트렙토코커스 써모필러스 (Streptococcus thermophilus) 유래의 Cas9 단백질, 스타필로코커스 아우레우스 (Staphylococcus aureus) 유래의 Cas9 단백질, 네이세리아 메닝기디티스 (Neisseria meningitidis)유래의 Cas9 단백질, 및 Cpf1 단백질로 이루어진 군에서 선택된 하나 이상의 단백질 또는 이를 암호화하는 핵산서열 중 선택되는 1이상인 것을 특징으로 하는 조성물.
  6. 제 5항에 있어서,
    상기 Cas단백질은 스트렙토코커스 피요게네스(Streptococcus pyogenes) 유래의 Cas9 단백질인 것을 특징으로 하는 조성물.
  7. 제 1항에 있어서,
    상기 표적서열은 안토시아닌계 플라보노이드의 합성과 관련된 인자의 엑손, 인트론 또는 이의 조합의 서열 중 1 이상의 서열의 일부인 것을 특징으로 하는 조성물.
  8. 제 1항에 있어서,
    상기 표적서열은 서열번호 1 내지 5; 서열번호 37 내지 41; 서열번호 54 내지 55; 및 서열번호 58 내지 59; 중 선택되는 1 이상의 서열인 것을 특징으로 하는 조성물.
  9. 제 1항에 있어서,
    상기 가이드RNA는 서열번호 42 내지 46; 서열번호 47 내지 51; 서열번호 56 내지 57; 및 서열번호 60 내지 61; 중 선택되는 1 이상인 것을 특징으로 하는 조성물.
  10. 제 1항에 있어서,
    상기 식물은 가지과 식물, 장미과 식물, 국화과 식물, 선인장과 식물 중 선택되는 1이상의 식물인 것을 특징으로 하는 식물의 특성을 변경시키는 조성물.
  11. 제 10항에 있어서,
    상기 가지과 식물은 가지, 맨드레이크, 감자, 담배, 토마토, 페튜니아 중 선택되는 1이상인 것을 특징으로 하는 식물의 특성을 변경시키는 조성물.
  12. 식물체 내의 게놈 DNA상에서 안토시아닌계 플라보노이드의 합성과 관련된 인자의 핵산 서열 내 표적서열에 상보적인 결합을 형성할 수 있는 가이드 RNA 또는 이를 암호화하는 핵산서열; 및
    상기 가이드 RNA와 복합체를 형성하여 상기 핵산 서열을 절단시키는 Cas단백질 또는 이를 암호화하는 핵산서열을 포함하는 조성물을 식물세포에 도입함; 및
    상기 식물세포를 재분화함;
    을 포함하는 식물체 제조방법으로,
    이 때, 상기 재분화된 식물세포는 게놈 DNA상에서 안토시아닌계 플라보노이드의 합성과 관련된 인자의 핵산 서열 내 인위적인 돌연변이를 포함하고,
    상기 안토시아닌계 플라보노이드 합성과 관련된 인자는 F3H, F3′H, F3′5′H 중 선택되는 1 이상인 유전자이며,
    상기 식물체는 야생형과 비교하여 색깔 특성이 변경된 것을 특징으로 하는, 형질전환 식물체 제조방법.
  13. 제 12항에 있어서,
    상기 도입은 전기천공법, 유전자총, 초음파천공법, 자기주입법, PEG(Polyethylene glycol), 아그로박테리움법(Agrobacterium), 일시적인 세포의 압축 또는 스퀴징, 지질-매개 형질감염, 나노입자법 중 선택되는 1 이상의 방법으로 수행되는 것을 특징으로 하는 방법.
  14. 제 12항에 있어서,
    상기 식물세포는 뿌리, 줄기, 잎, 꽃 또는 종자 유래인 것을 특징으로 하는 방법.
  15. 제 12항에 있어서,
    상기 식물세포는 원형질체 형태인 것을 특징으로 하는 식물체 제조방법.
  16. 제 12항에 있어서,
    상기 식물체는 가지과 식물, 장미과 식물, 국화과 식물, 선인장과 식물 중 선택되는 1이상의 식물체인 것을 특징으로 하는 방법.
  17. 제 16항에 있어서,
    상기 가지과 식물은 가지, 맨드레이크, 감자, 담배, 토마토, 페튜니아 중 선택되는 1이상인 것을 특징으로 하는 식물체 제조방법.
  18. 제 12항에 있어서,
    상기 재분화는 상기 조성물이 도입된 식물세포를 배양하여 캘러스를 형성시키고, 상기 캘러스를 추가적으로 더 배양하여 식물체를 형성시키는 것을 포함하는 방법.
  19. 제 12항 내지 18항 중 어느 한 항의 제조방법에 의해 제조된,
    게놈 DNA상에서 안토시아닌계 플라보노이드의 합성과 관련된 인자인 F3H, F3′H, F3′5H′중 선택되는 1 이상인 유전자의 핵산 서열 내 인위적인 돌연변이를 포함하고,야생형과 비교하여 안토시아닌 함량이 감소되고 색깔 특성이 변경된 식물체.
PCT/KR2019/006965 2018-06-08 2019-06-10 Crispr/cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용 WO2019235907A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US16/973,140 US20210254086A1 (en) 2018-06-08 2019-06-10 Composition For Editing Flavonoid Biosynthetic Gene By Using CRISPR/CAS9 System, And Use Thereof
KR1020207035219A KR20210011394A (ko) 2018-06-08 2019-06-10 Crispr/cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2018-0065923 2018-06-08
KR20180065923 2018-06-08
KR1020190051273A KR20190139756A (ko) 2018-06-08 2019-05-02 페튜니아 원형질체에서 CRISPR/Cas9 시스템을 이용한 플라보노이드 생합성 유전자 교정세포를 배양하여 형질교정 재분화체를 유도하는 방법
KR10-2019-0051273 2019-05-02

Publications (1)

Publication Number Publication Date
WO2019235907A1 true WO2019235907A1 (ko) 2019-12-12

Family

ID=68769360

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/006965 WO2019235907A1 (ko) 2018-06-08 2019-06-10 Crispr/cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용

Country Status (1)

Country Link
WO (1) WO2019235907A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111718912A (zh) * 2020-05-20 2020-09-29 华中农业大学 黄烷酮-3-羟化酶抗原表位肽及其抗体与应用
CN112029770A (zh) * 2020-09-17 2020-12-04 湖北省农业科学院经济作物研究所 一种CRISPR/Cas9基因编辑体系的建立方法及其应用
CN112708627A (zh) * 2021-02-01 2021-04-27 中国农业科学院作物科学研究所 一种通过花色识别转基因大豆植株的方法

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110045961A (ko) * 2009-10-28 2011-05-04 삼성전기주식회사 회로기판의 이물 제거 장치
KR20150145282A (ko) * 2014-06-18 2015-12-30 경희대학교 산학협력단 C1／r―s 형질전환 벼 유래의 신규 플라보노이드들
KR101832457B1 (ko) * 2016-01-05 2018-02-27 순천대학교 산학협력단 핑크 과색을 나타내는 토마토의 유전자형 판별용 분자마커 및 이를 이용한 핑크 과색을 나타내는 토마토 선별방법
KR20180034404A (ko) * 2015-06-18 2018-04-04 더 브로드 인스티튜트, 인코퍼레이티드 표적외 효과를 감소시키는 crispr 효소 돌연변이

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110045961A (ko) * 2009-10-28 2011-05-04 삼성전기주식회사 회로기판의 이물 제거 장치
KR20150145282A (ko) * 2014-06-18 2015-12-30 경희대학교 산학협력단 C1／r―s 형질전환 벼 유래의 신규 플라보노이드들
KR20180034404A (ko) * 2015-06-18 2018-04-04 더 브로드 인스티튜트, 인코퍼레이티드 표적외 효과를 감소시키는 crispr 효소 돌연변이
KR101832457B1 (ko) * 2016-01-05 2018-02-27 순천대학교 산학협력단 핑크 과색을 나타내는 토마토의 유전자형 판별용 분자마커 및 이를 이용한 핑크 과색을 나타내는 토마토 선별방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KLIMEK-CHODACKA, M. ET AL.: "Efficient CRISPR/Cas9-based genome editing in carrot cells", PLANT CEIL REPORTS, vol. 37, 13 January 2018 (2018-01-13), pages 575 - 586, XP036457161, DOI: 10.1007/s00299-018-2252-2 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111718912A (zh) * 2020-05-20 2020-09-29 华中农业大学 黄烷酮-3-羟化酶抗原表位肽及其抗体与应用
CN111718912B (zh) * 2020-05-20 2021-11-02 华中农业大学 黄烷酮-3-羟化酶抗原表位肽及其抗体与应用
CN112029770A (zh) * 2020-09-17 2020-12-04 湖北省农业科学院经济作物研究所 一种CRISPR/Cas9基因编辑体系的建立方法及其应用
CN112708627A (zh) * 2021-02-01 2021-04-27 中国农业科学院作物科学研究所 一种通过花色识别转基因大豆植株的方法

Similar Documents

Publication Publication Date Title
Santosh Kumar et al. CRISPR-Cas9 mediated genome editing of drought and salt tolerance (OsDST) gene in indica mega rice cultivar MTU1010
KR102107735B1 (ko) 식물 원형질체로부터 식물체를 제조하는 방법
Jeong et al. Generation of early-flowering Chinese cabbage (Brassica rapa spp. pekinensis) through CRISPR/Cas9-mediated genome editing
WO2019235907A1 (ko) Crispr/cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용
KR20170098953A (ko) 일시적인 유전자 발현을 통해 완전한 식물에서 부위-특이적인 변형을 수행하는 방법
Moon et al. Rice RHC encoding a putative cellulase is essential for normal root hair elongation
WO2019143077A1 (ko) 식물체에서 상동재조합 기반의 유전자 편집 효율을 증가시키는 방법
BR112019025498A2 (pt) Planta de banana e sua parte, método para produção e aumento da meia-vida de banana, fruto, construto de ácido nucleico, planta ou método ou produtos processados
CN114854768B (zh) 一种鸭茅春化基因DgPAPS4及其应用
WO2022114692A1 (ko) CRISPR/Cas9 시스템을 이용한 갈변 억제 감자 식물체의 제조방법
CN107326035B (zh) 一种调控水稻粒型和叶色的去泛素化酶基因ubp5及其应用
WO2023191428A1 (ko) 반수체 식물을 유도하는 pPLAⅡη 유전자 및 이의 용도
CN113265403A (zh) 大豆Dt1基因编辑位点及其应用
Biswal et al. An efficient transformation method for genome editing of elite bread wheat cultivars
CN114717241B (zh) 一种水稻耐盐相关基因OsMSRFP及其编码蛋白质和应用
KR20200066967A (ko) Ft 유전자를 교정하여 만추성 형질을 가지는 유전체 교정 배추 식물체의 제조방법 및 그에 따른 식물체
US20210254086A1 (en) Composition For Editing Flavonoid Biosynthetic Gene By Using CRISPR/CAS9 System, And Use Thereof
WO2020166943A1 (ko) 유전자 총법을 이용한 미세조류의 교정 방법
US11608506B2 (en) Delivery of developmental regulators to plants for the induction of meristematic tissue with genetic alterations
WO2023140722A1 (ko) 7-디하이드로콜레스테롤이 고농도로 함유된 토마토 및 이의 제조 방법
Pinski et al. Efficient Agrobacterium-mediated transformation and genome editing of Fagopyrum tataricum
WO2020184764A1 (ko) 벼 유래의 ak102606 유전자의 항산화능, 환경 스트레스 및 수확량 조절자로서의 용도
WO2022139463A1 (ko) 토마토 열매의 아스코르브산 함량을 조절하는 토마토 유래 apx4 유전자 및 이의 용도
WO2022270788A1 (ko) Qpt 유전자가 조작된 식물 세포 및 이의 이용 방법
WO2022055144A1 (ko) 중금속 저감된 형질전환 식물체 및 이의 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19814366

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 20207035219

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19814366

Country of ref document: EP

Kind code of ref document: A1