WO2022055144A1 - 중금속 저감된 형질전환 식물체 및 이의 제조방법 - Google Patents

중금속 저감된 형질전환 식물체 및 이의 제조방법 Download PDF

Info

Publication number
WO2022055144A1
WO2022055144A1 PCT/KR2021/011059 KR2021011059W WO2022055144A1 WO 2022055144 A1 WO2022055144 A1 WO 2022055144A1 KR 2021011059 W KR2021011059 W KR 2021011059W WO 2022055144 A1 WO2022055144 A1 WO 2022055144A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
pcs
plant
crispr
sequence
Prior art date
Application number
PCT/KR2021/011059
Other languages
English (en)
French (fr)
Inventor
서효석
이영기
이정헌
김광철
나웅현
오경환
전은영
Original Assignee
주식회사 케이티앤지
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 케이티앤지 filed Critical 주식회사 케이티앤지
Priority to US17/642,050 priority Critical patent/US20240052360A1/en
Publication of WO2022055144A1 publication Critical patent/WO2022055144A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/06—Processes for producing mutations, e.g. treatment with chemicals or with radiation
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/82—Solanaceae, e.g. pepper, tobacco, potato, tomato or eggplant
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/82—Solanaceae, e.g. pepper, tobacco, potato, tomato or eggplant
    • A01H6/823—Nicotiana, e.g. tobacco
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/104—Aminoacyltransferases (2.3.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/02—Aminoacyltransferases (2.3.2)
    • C12Y203/02015—Glutathione gamma-glutamylcysteinyltransferase (2.3.2.15), i.e. phytochelatin synthase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • It relates to a transgenic plant with reduced heavy metal and a method for producing the same.
  • Heavy metals such as lead, cadmium, and mercury are pollutants derived from the environment and are exposed through food, water, air, and soil.
  • the general public mainly consumes heavy metals through food, and trace amounts of heavy metals absorbed into the body accumulate in organs such as bones and kidneys and are known to adversely affect health.
  • the Ministry of Food and Drug Safety (MFDS) tracked changes in the concentration of heavy metals in the body from 2010 to 2015 and analyzed the relationship between food intake and lifestyle. done.
  • Smoking is known to increase the concentration of heavy metals in the body because the absorption rate through inhalation is higher than the absorption rate through ingestion. Accordingly, there is a demand for the development of tobacco plants capable of reducing the heavy metal content in tobacco plants or the absorption rate of heavy metals from soil during cultivation.
  • Cd cadmium
  • the present inventors have found that by inducing mutations in the phytochelatin synthase (NtPCS) gene of tobacco plants, the heavy metal content or the degree of heavy metal absorption compared to wild-type tobacco plants is significantly reduced while maintaining excellent growth characteristics. By confirming that there is, the present invention was completed.
  • NtPCS phytochelatin synthase
  • One aspect provides a plant cell in which the expression or activity of a PCS (Phytochelatin synthase) gene or a protein encoded by the PCS gene is reduced compared to the parental cell.
  • PCS Physical tochelatin synthase
  • Another aspect provides a plant with a reduced amount of heavy metal uptake, including plant cells in which the expression or activity of a PCS (Phytochelatin synthase) gene or a protein encoded by the PCS gene is reduced compared to parental cells.
  • PCS Physical tochelatin synthase
  • Another aspect provides a method for reducing heavy metals in a plant, comprising the step of reducing the expression or activity of a PCS gene or a protein encoded by the PCS gene compared to the parental cells of the plant.
  • Another aspect provides a CRISPR-Cas9 recombinant vector comprising a single guide RNA targeting the PCS gene.
  • Another aspect is a method for producing a plant with a reduced amount of heavy metal uptake comprising transforming the plant cell with a CRISPR-Cas9 recombinant vector comprising a single guide RNA targeting the PCS gene to provide.
  • One aspect is to provide a plant cell in which the expression or activity of a PCS (Phytochelatin synthase) gene or a protein encoded by the PCS gene is reduced compared to parental cells.
  • PCS Physical tochelatin synthase
  • parent cell refers to a cell that has not been artificially manipulated to reduce the expression or activity of a PCS gene or a protein encoded by the PCS gene, and refers to a cell freshly isolated from a plant or a cell cultured therewith. can mean
  • the term "phytochelatin synthase (PCS: phytochelatin synthase)” is glutathione gamma-glutamylcysteinyltransferase (glutathione gamma-glutamylcysteinyltransferase), gamma-glutamylcysteine dipeptidyl transpeptidase (gamma- Also called glutamylcysteine dipeptidyl transpeptidase), it is an enzyme that produces two products, Gly and [Glu(-Cys)]n+1-Gly, with two substrates of glutathione and [Glu(-Cys)]n-Gly.
  • PCS phytochelatin synthase
  • the PCS gene may be a PCS gene (NtPCSs) derived from Nicotiana sylvestris , a PCS gene (NtPCSt) derived from Nicotiana tomentosiformis , or a combination thereof (NtPCSst). there is.
  • the plant cell may be genetically engineered to reduce the expression or activity of a PCS gene or a protein encoded by the PCS gene.
  • genetic engineering or “genetically engineered” refers to the act of introducing one or more genetic modifications into a cell or a cell made thereby. there is.
  • the genetic manipulation may be induced by modification in the nucleotide sequence of the PCS gene by a physical method.
  • the physical method may be, for example, X-ray irradiation, gamma-ray irradiation, or the like.
  • the genetic manipulation may be induced by a change in the nucleotide sequence of the PCS gene or a change in the expression of the gene by a chemical method.
  • the chemical method may be, for example, ethyl methanesulfonate treatment, dimethyl sulfate treatment, or the like.
  • the genetic manipulation may be induced by modification in the nucleotide sequence of the PCS gene by a gene editing system.
  • the gene editing system may be, for example, a Meganuclease system, a zinc finger nuclease system, a TALEN (Transcription Activator-Like Effector Nuclease) system, a CRISPR/Cas9 system, and the like.
  • the genetic manipulation may be induced by a change in gene expression by binding to mRNA transcribed from a PCS gene by an RNA interference (RNAi) system.
  • RNAi RNA interference
  • the plant cell can reduce the expression or activity of a PCS gene or a protein encoded by the PCS gene by the CRISPR/Cas9 system.
  • the expression or activity of the PCS gene or a protein encoded by the PCS gene is about 20% or more, about 30% or more, about 40% or more, about 50% or more, than the expression or activity of the original non-engineered plant cell. % or more, about 55% or more, about 60% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, or about 100% or more.
  • Genetically engineered plant cells with reduced expression or activity of a PCS gene or a protein encoded by a PCS gene can be identified using any method known in the art.
  • activation may mean that a gene that is not expressed at all or a protein that has no activity even if it is expressed is generated.
  • depression may mean that the PCS gene is expressed at a low level compared to unengineered plant cells, or that the activity of the PCS gene is low even when the protein encoded by the PCS gene is expressed.
  • Another aspect relates to a plant with reduced heavy metal absorption, including the plant cell.
  • Specific details of the plant cells and the like are the same as described above.
  • the plant may be a cultivated tobacco (Nicotiana tabacum), specifically, may be a xanth species, a Bury species, a native species, a black tobacco or an Orient species, and more specifically may be a Bury species or a yellow species.
  • cultivated tobacco Naturala tabacum
  • the plant includes a plant cell in which the expression or activity of a PCS gene or a protein encoded by the PCS gene is reduced, so that the heavy metal content or heavy metal absorption amount is reduced in the same generation as well as in subsequent generations. Thereby, it is possible to continuously obtain a plant with reduced heavy metals.
  • Another aspect is to provide a method for reducing heavy metals in a plant, comprising the step of reducing the expression or activity of a PCS gene or a protein encoded by the PCS gene compared to the parental cells of the plant.
  • Specific details of the parental cells, PCS, plant cells, reduction in expression or activity, etc. are the same as described above.
  • the decrease in the expression or activity of the PCS gene or PCS protein may be due to mutation, substitution, deletion, or insertion of one or more bases into the gene, in which some or all of the gene encoding the PCS is mutated, PCS gene correction means may be due to
  • RNA interference RNA interference
  • a meganuclease system a zinc finger nuclease system , selected from the group consisting of TALEN (Transcription Activator-Like Effector Nuclease) system, CRISPR/Cas9 system, X-ray irradiation, gamma irradiation, ethyl methanesulfonate treatment, dimethyl sulfate treatment It may be to perform at least one of the TALEN (Transcription Activator-Like Effector Nuclease) system, CRISPR/Cas9 system, X-ray irradiation, gamma irradiation, ethyl methanesulfonate treatment, dimethyl sulfate treatment It may be to perform at least one of the TALEN (Transcription Activator-Like Effector Nuclease) system, CRISPR/Cas9 system, X-ray irradiation, gam
  • the genetic manipulation artificially performed to reduce the expression or activity of the PCS gene or the protein encoded by the PCS gene may be such that the protein encoded from the PCS gene is not expressed in the form of a protein having an original function.
  • the genetic manipulation may be induced by one or more of the following: 1) All or part deletion of the PCS gene, such as 1 bp or more nucleotides of the PCS gene, such as 1 to 30, 1 to 27, 1 to 25 deletion of 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3, or 1 nucleotide; 2) 1 bp or more nucleotides of the PCS gene, such as 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5 , substitution of 1 to 3, or 1 nucleotide with a nucleotide different from the original (wild-type); 3) one or more nucleotides, such as 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1
  • the modified part of the PCS gene ('target site') is 1 bp or more, 3 bp or more, 5 bp or more, 7 bp or more, 10 bp or more, 12 bp or more, 15 bp or more, 17 bp or more, 20 bp or more, such as 1 bp to 30 bp, 3bp to 30bp, 5bp to 30bp, 7bp to 30bp, 10bp to 30bp, 12bp to 30bp, 15bp to 30bp, 17bp to 30bp, 20bp to 30bp, 1bp to 27bp, 3bp to 27bp, 5bp to 27bp, 7bp to 27bp, 10bp to 27bp, 12bp to 27bp, 15bp to 27bp, 17bp to 27bp, 20bp to 27bp, 1bp to 25bp, 3bp to 25bp, 5bp to 25bp, 7bp to
  • a genome editing system comprising a rare-cutting endonuclease that cuts a rare gene sequence having a very low abundance in the genome as a genome editing technology to produce PCS knockout plant cells.
  • a genome editing system comprising a rare-cutting endonuclease that cuts a rare gene sequence having a very low abundance in the genome as a genome editing technology to produce PCS knockout plant cells.
  • the expression of the targeted gene, the PCS gene may be reduced.
  • Nucleic acid strand breaks catalyzed by the rare cleavage endonuclease can be repaired through mechanisms such as homologous recombination or non-homologous end joining (NHEJ).
  • the rare cleavage endonuclease is from the group consisting of meganuclease, zinc finger nuclease, CRISPR/Cas9 (Cas9 protein), CRISPR-Cpf1 (Cpf1 protein) and TALE-nuclease It may be one or more selected.
  • the heavy metal may be one or more selected from the group consisting of cadmium, arsenic, antimony, lead, mercury, chromium, tin, zinc, barium, bismuth, nickel, cobalt, manganese, iron, copper, and vanadium.
  • reducing the expression or activity of the PCS gene or a protein encoded by the PCS gene it may be to reduce the cadmium content or cadmium absorption in the plant.
  • Another aspect is to provide a CRISPR-Cas9 recombinant vector comprising a single guide RNA targeting the PCS gene.
  • Specific details of the PCS gene and plant cells are the same as described above.
  • single guide RNA refers to “chimeric RNA”, “chimeric guide RNA”, “guide RNA”, “single guide RNA (sgRNA)” and “ “Synthetic guide RNA” may be used interchangeably.
  • sgRNA single guide RNA
  • guide sequence refers to a sequence of about 20 bp within a guide RNA that directs a target site, and may be used interchangeably with the terms “guide” or “spacer”.
  • tracr mate sequence may be used interchangeably with the term “direct repeat(s)”.
  • the guide RNA may be composed of two RNAs, that is, CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA), or a single-stranded RNA comprising portions of crRNA and tracrRNA and hybridizing with the target DNA. (single-chain RNA, sgRNA).
  • the PSC gene targeted by the sgRNA may be a PCS gene (NtPCSs) derived from Nicotiana sylvestris , or a PCS gene (NtPCSt) derived from Nicotiana tomentosiformis .
  • the sgRNA targeting the NtPCSs gene may consist of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and the sgRNA targeting the NtPCSt gene may consist of the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 4,
  • the sgRNA targeting both the NtPCSs gene and the NtPCSt gene may consist of the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 6.
  • a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and induce sequence-specific binding of the CRISPR complex to the target sequence.
  • any nucleotide sequence that can be used for genetic manipulation to reduce the expression or activity of a PCS gene or a protein expressed by the PCS gene can be used as a guide RNA without limitation, for example, the nucleotide sequence is a sequence capable of hybridizing with the PCS gene.
  • a portion of the guide RNA nucleotide sequence may be modified in order to modify/enhance the function of the guide RNA.
  • the degree of complementarity between a guide sequence and its corresponding target sequence when optimally aligned using an appropriate alignment algorithm, is about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or more.
  • Optimal alignment can be determined using any algorithm suitable for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, the Burroughs- Algorithms based on the Burrows-Wheeler Transform (eg Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies) ), ELAND (Illumina, San Diego, CA), SOAP (available at soap.genomics.org.cn) and Maq (available at maq.sourceforge.net).
  • any algorithm suitable for aligning sequences include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, the Burroughs- Algorithms based on the Burrows-Wheeler Transform (eg Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies) ), ELAND (Illumina, San Diego, CA), SOAP (available at
  • the guide sequence is, such as about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75 or more nucleotides in length. In some embodiments, the guide sequence can be no more than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12 nucleotides in length.
  • the ability of a guide sequence to induce sequence-specific binding of a CRISPR complex to a target sequence can be assessed by any suitable assay. For example, components of the CRISPR system sufficient to form a CRISPR complex comprising the guide sequence to be tested can be obtained, eg, after transfection with a vector encoding a component of the CRISPR sequence, eg, as described herein.
  • cleavage of the target polynucleotide sequence provides components of the CRISPR complex comprising the target sequence, the guide sequence being tested, and a control guide sequence that is different from the test guide sequence, and binding or cleavage between the test and control guide sequence reactions at the target sequence. By comparing the ratios can be evaluated in vitro. Other assays are possible and will be readily available to those skilled in the art.
  • the sgRNA may bind to the PCS gene of at least one allele in the plant cell, and specifically bind to the PCS gene of all alleles.
  • the guide RNA binds to the PCS gene of all alleles to knock out the PCS gene, heavy metal uptake and movement may be inhibited in plant cells of the same generation as well as subsequent generations.
  • the target sequence used to knock out the PCS gene in the plant cell may be, for example, at least one of Exon 1 and Exon 2 of the PCS gene.
  • the plant cell is a plant cell in which a specific target region of the PCS gene is cleaved by sgRNA and the gene is knocked out. According to the knockout, heavy metal uptake and movement of the plant cell may be suppressed.
  • the gene knockout may refer to the regulation of gene activity by deletion, substitution, and/or insertion of one or more nucleotides, eg, inactivation, of all or part of a gene (eg, one or more nucleotides).
  • the gene inactivation refers to a modification to encode a protein that has lost its original function or suppressed or downregulated the expression of a gene.
  • gene regulation involves structural modification of proteins obtained by deletion of exon sites due to simultaneous targeting of both intron sites surrounding one or more exons of the target gene, dominant negative protein expression, soluble form of competitive inhibitor expression, etc. It may mean a change in the function of a gene as a result.
  • vector refers to a means for expressing a target gene in a host cell.
  • examples include viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenoviral vectors, retroviral vectors and adeno-associated viral vectors.
  • Vectors that can be used as the recombinant vector include plasmids often used in the art (eg, V1k_GE, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1). , pHV14, pGEX series, pET series and pUC19, etc.), phage or virus (eg, SV40, etc.).
  • a gene encoding a guide RNA binding to the PCS gene, a gene encoding the Cas9 protein, and a gene encoding the NLS may be operably linked to a promoter.
  • the term “operatively linked” refers to a functional linkage between a nucleotide expression control sequence (eg, a promoter sequence) and another nucleotide sequence. Such regulatory sequences may be "operatively linked" to control the transcription and/or translation of other nucleotide sequences.
  • a polynucleotide (P_U6) consisting of the nucleotide sequence of SEQ ID NO: 43 is bound to the 5'-end of the gene encoding the guide RNA binding to the PCS gene, and at the 3'-end When five consecutive thymines are bound, the unstable guide RNA may be stabilized.
  • the vector can be constructed, typically as a vector for cloning or as a vector for expression.
  • the expression vector may be a conventional vector used to express a foreign protein in plants, animals, or microorganisms in the art.
  • the vector can be constructed through various methods known in the art.
  • the vector may be constructed using a prokaryotic cell or a eukaryotic cell as a host.
  • a prokaryotic cell is used as a host, a strong promoter (eg, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.) , a ribosome binding site for initiation of translation and a transcription/translation termination sequence.
  • a strong promoter eg, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.
  • the replication origin operating in the eukaryotic cell contained in the vector includes the f1 origin of replication, the SV40 origin of replication, the pMB1 origin of replication, the adeno origin of replication, the AAV origin of replication and the BBV origin of replication. It is not limited.
  • promoters derived from the genome of mammalian cells eg, metallotionine promoter
  • mammalian viruses eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV
  • CRISPR/Cas9 system may include single guide RNA (sgRNA) including crRNA (CRISPR RNA) and tracrRNA (transactivating crRNA).
  • sgRNA single guide RNA
  • CRISPR RNA CRISPR RNA
  • tracrRNA transactivating crRNA
  • the CRISPR/Cas9 system may include a CRISPR associated protein 9 (Cas9) protein or a gene encoding a Cas9 protein and a Nuclear Localization Signal (NLS) protein or a gene encoding the NLS protein.
  • Cas9 CRISPR associated protein 9
  • NLS Nuclear Localization Signal
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • a tracr-mate sequence including “direct repeats” and tracrRNA-processing portion direct repeats in the context of an endogenous CRISPR system
  • a guide sequence also referred to as a "spacer” in the context of an endogenous CRISPR system
  • a guide RNA or CRISPR locus refers to transcripts and other elements involved in the expression of, or inducing activity of, CRISPR-associated (Cas) genes, including other sequences and transcripts from In some embodiments, one or more elements of the CRISPR system are from a type I, type II, or type III CRISPR system.
  • one or more elements of the CRISPR system are derived from a particular organism comprising the endogenous CRISPR system, eg, Streptococcus pyogenes .
  • CRISPR systems are characterized by elements that promote the formation of CRISPR complexes at the site of the target sequence (also referred to as protospacers in the context of endogenous CRISPR systems).
  • target sequence or “target gene” refers to a sequence in which a guide sequence is designed to have complementarity, wherein hybridization between the target sequence and the guide sequence enhances the formation of the CRISPR complex.
  • the target sequence may comprise any polynucleotide, eg, a DNA or RNA polynucleotide.
  • the target sequence is located in the nucleus or cytoplasm of a cell.
  • the target sequence may be present in an organelle of a eukaryotic cell, such as a mitochondrion or chloroplast.
  • Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx3, Csx10, Csx3, Csx10, Csx1, Csf2, Csf3, Csf4, homologue
  • the amino acid sequence of the Streptococcus pyogenes Cas9 protein can be obtained from the SwissProt database under accession number Q99ZW2.
  • the unmodified CRISPR enzyme eg, Cas9, has DNA cleavage activity.
  • the CRISPR enzyme is a Cas9 protein, wherein the Cas9 protein is a Streptococcus pyogenes -derived Cas9 protein, a Campylobacter jejuni -derived Cas9 protein, Streptococcus thermophiles )-derived Cas9 protein, Streptococcus aureus -derived Cas9 protein and Neisseria meningitidis -derived Cas9 protein It may be at least one Cas9 protein selected from the group consisting of, specifically Streptococcus p. It may be a Cas9 protein derived from Yogenes ( Streptococcus pyogenes ).
  • the Cas9 protein is codon-optimized for expression in a eukaryotic cell, and when using the Streptococcus pyogenes -derived Cas9 protein, the expression of the PCS gene or the protein expressed by the PCS gene or Activity can be reduced to a maximum.
  • the Cas9 protein may include a nuclear localization sequence or signal (NLS) at 5'- or 3'- or both terminal portions of the Cas9 protein for localization in the nucleus in a eukaryotic cell, wherein the NLS is It can be one or more.
  • NLS nuclear localization sequence or signal
  • nuclear localization sequence or signal refers to an amino acid sequence that serves to transport a specific substance (eg, protein) into a cell nucleus, and is generally a nuclear pore. (Nuclear Pore) serves to transport into the nucleus of the cell.
  • the nuclear localization sequence is not required for CRISPR complex activity in eukaryotes, but the inclusion of this sequence enhances the activity of the system, particularly nucleic acid molecules in the nucleus is believed to target
  • RNA-guided CRISPR clustered regularly interspaced short palindrome repeats
  • CRISPR clustered regularly interspaced short palindrome repeats
  • sgRNA single guide RNA
  • Cas9 (or Cpf1) protein refers to an essential protein element in the CRISPR/Cas9 system, and information on the Cas9 (or Cpf1) gene and protein can be obtained from GenBank of the National Center for Biotechnology Information (NCBI). However, the present invention is not limited thereto.
  • the CRISPR-associated gene encoding the Cas (or Cpf1) protein is known to exist in about 40 or more different Cas (or Cpf1) protein families, and according to the specific combination of the cas gene and the repeat structure, 8 CRISPR subtypes (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apern, and Mtube) can be defined. Therefore, each of the CRISPR subtypes can form a repeating unit to form a polyribonucleotide-protein complex.
  • the DNA may generally (but not necessarily) include regulatory elements (eg, a promoter) operable in a target cell.
  • the promoter for Cas9 expression may be, for example, a CMV, EF-1 a, EFS, MSCV, PGK, or CAG promoter.
  • a promoter for gRNA expression may be, for example, a HI, EF-la, tRNA or U6 promoter.
  • the promoter may have tissue specificity or cell specificity.
  • Another aspect is a method for producing a plant with a reduced amount of heavy metal uptake comprising transforming the plant cell with a CRISPR-Cas9 recombinant vector comprising a single guide RNA targeting the PCS gene
  • a CRISPR-Cas9 recombinant vector comprising a single guide RNA targeting the PCS gene
  • Specific details of the PCS gene, single guide RNA, CRISPR-Cas9 system, vector, plant cell, and the like are the same as described above.
  • the transformation step is not particularly limited as long as it is a transformation method well known in the art that enables transformation of tobacco genes.
  • Agrobacterium-mediated transformation method polyethylene glycol (PEG)-mediated protoplast transformation method, gene gun method, electrode transformation method, vacuum infiltration transformation method and silicon carbide fiber-mediated transformation method.
  • PEG polyethylene glycol
  • plant cells are transformed with a recombinant vector including a single guide RNA targeting the PCS gene through Agrobacterium-mediated transformation may have been converted.
  • Plant cells with reduced expression or activity of the PCS (Phytochelatin synthase) gene or the protein encoded by the PCS gene according to an aspect bind to heavy metal ions in plant cells and absorb, store, or move heavy metals. The pathway is inhibited, plants There is an effect that can reduce the content or absorption of heavy metals in cells or plants containing the same.
  • PCS Physical Chemogen synthase
  • Plant cells with reduced expression or activity of the PCS gene or the protein encoded by the PCS gene according to another aspect can solve the growth inhibition phenomenon, which is a limitation of the existing heavy metal-reduced plants.
  • FIG. 1 is a view showing a state in which a part of the published reference sequence and the NtHMA gene sequence of KB108 are aligned.
  • A a diagram showing the result of comparing exon 2 sites in the NtHMA ⁇ gene (gRNA_A4_e2: a region specific to the NtHMA ⁇ gene, designed to bind sgRNA) and
  • B comparing the exon 2 sites in the NtHMA ⁇ gene
  • a diagram showing the results gRNA_B4_e2: a region specific to the NtHMA ⁇ gene, designed to bind sgRNA.
  • FIG. 2 is a diagram showing the structure of a gene scissors expression carrier containing two sgRNAs.
  • FIG. 3 is a view showing step-by-step photographs of plant tissue culture after transformation by the Agrobacterium-mediated transformation method. Specifically, (A) cutting the leaf tissue and culturing with Agrobacterium for transformation, (B) inducing callus differentiation and shoot differentiation, (C) inducing root differentiation, (D) differentiation It is a drawing showing the state of the completed news object.
  • FIG. 4 is a view showing the results of electrophoresis by amplifying each target gene site targeting gDNA of 24 tissue cultures to confirm the presence and appearance of mutations (Lane M: 1kb DNA marker, lanes 1 to 7: NtHMA ⁇ site Amplification result, lane 9-15: NtHMA ⁇ region amplification result, lane 17-21: NtPCSs region amplification result, lane 23-27: NtPCSt region amplification result, lane 8, 16, 22, 28: NTC (Non-template control))
  • FIG. 5 is a diagram showing the results of NtHMA ⁇ site sequencing of wild type KB108 and mutants. Specifically, (A) KB108 nucleotide sequence (B) is a diagram showing the analysis result of the nucleotide sequence of the mutant, and compared to the wild-type nucleotide sequence, the portion where the adenine nucleotide is inserted is indicated by a red arrow.
  • FIG. 6 is a view showing the electrophoresis results after performing a gene amplification reaction to check whether the transgene is inherited in the F 1 plant.
  • FIG. 7 is a graph showing the relative value based on the cadmium content of the control group by synthesizing the results of primary and secondary cadmium content analysis performed at the nutrient solution cultivation facility.
  • Example 1 Cadmium-reduced tobacco production using the CRISPR/Cas9 system targeting the NtPCS gene
  • NtHMA ⁇ and NtHMA ⁇ genes encoding proteins that act as gates that open and close when transporting divalent metal ions absorbed by roots to other tissues
  • NtPCS which is a gene encoding a protein involved in the storage and movement of metal ions by binding to metal ions in cells, two types of genes related to cadmium absorption and movement in tobacco were selected.
  • PCSs_KB108 (KT&G) PCSs_TN90 (NW_015845165.1) PCSs_Nsyl (NW_009518934.1) PCSs_KB108 (KT&G) ID 1.000 1.000 PCSs_TN90(NW_015845165.1) 1.000 ID 1.000 PCSs_Nsyl(NW_009518934.1) 1.000 ID
  • PCSt gene homology comparison PCSt_KB108 (KT&G) PCSt_TN90 (NW_015825368.1) PCSt_Ntom (NW_008939610.1) PCSt_KB108 (KT&G) ID 1.000 0.986 PCSt_TN90 (NW_015825368.1) 1.000 ID 0.986 PCSt_Ntom(NW_008939610.1) 0.986 0.986 ID
  • the nucleotide sequences of the NtPCSs gene derived from Nicotiana sylvestris and the NtPCSt gene derived from Nicotiana tomentosiformis were compared with the N. tabacum (TN90) reference genome sequence. As confirmed in 2 and 3, 100% agreement was confirmed. In addition, it was confirmed that the NtPCSs gene (provided that some sequences) were 100% identical to the N. sylvestris reference genome data, and the NtPCSt gene was approximately 98.6% identical to the N. tometosiformis reference genome data.
  • Example 1-(1) By comparing the nucleotide sequences of the NtHMA ⁇ , NtHMA ⁇ , NtPCSs, and NtPCSt genes obtained in Example 1-(1), a portion specific to each gene was selected as a gene scissors leader (sgRNA). A total of five recombinant carriers were completed by cloning the selected gene scissors expression block into a gene carrier expressed in plants.
  • sgRNA gene scissors leader
  • the gene carrier information including each of the six sgRNAs capable of specifically binding to the NtHMA ⁇ and NtHMA ⁇ genes is shown in Table 4 below.
  • pBI121 is a binary vector that can be replicated in E. coli and agrobacterium, and is widely used for plant transformation, and pBI121 was cut with HindIII and EcoRI to clone the GE_block required for the CRISPR/Cas9 system.
  • GE_block is CaMV 35S promoter with dual enhancer (P_35Sd), multi cloning site (MCS) for cloning Cas9 block, CaMV 35S terminator (T_35S), linker sequence, and multi cloning site (MCS) for cloning sgRNA block. It is composed of and at both ends, the recognition sequences of HindIII and EcoRI are added.
  • GE_block Each block of GE_block was prepared by DNA synthesis and was completed by sequential cloning.
  • a recombinant carrier (V1k_GE) was prepared by ligation of pBI121 and GE_block cut with HindIII and EcoRI.
  • CRISPR/Cas9_block is composed of Cas9 coding sequence (CDS) and C-terminus nuclear localization sequence (NLS), and BamHI and SacI recognition sequences are added to both ends of the block (Cas9_block); and a block composed of a U6 promoter (P_U6, SEQ ID NO: 43), sgRNA, and poly T as a block (sgRNA_PMT) in which sgRNA can be expressed.
  • NtPCSs and/or NtPCSt gene Two types of sgRNA blocks capable of specifically binding to the NtPCS gene (NtPCSs and/or NtPCSt gene) were linked into one continuous DNA through overlap extension PCR technique to complete sgRNA_PMT. Recognition sequences for SalI and SpeI exist at both ends of sgRNA_PMT.
  • V1k_GE and CRISPR/Cas9_block cut with BamHI and SacI were spliced together through a ligation reaction, cut with SalI and SpeI, and sgRNA_PMT was inserted to prepare a gene carrier.
  • the plant carrier was transformed into the Agrobacterium LBA4404 strain by the freeze-thaw method.
  • the Agrobacterium strain was inoculated in YEP liquid medium (yeast extract 10 g, BactoTM peptone 10 g, NacCl 5 g), and then cultured with shaking at 28° C. and 250 rpm for 16 hours. Cells were separated by centrifugation of the culture medium at a speed of 3,000 g and 4° C. conditions for 20 minutes, and suspended in 20 mM CaCl 2 to make soluble cells (competent cells). After adding 5 ⁇ L of plasmid DNA (vegetable carrier) to 100 ⁇ L of soluble cells, incubated in liquid nitrogen for 5 minutes and at 37°C for 5 minutes.
  • YEP liquid medium yeast extract 10 g, BactoTM peptone 10 g, NacCl 5 g
  • YEP broth 1 mL of YEP broth was added and incubated with shaking for 2 hours at 28°C and 250 rpm. 100 ⁇ L of the culture medium was spread on YEP solid medium containing 100 mg/L of kanamycin, and then cultured at 28° C. for 3 days. After passage of each single colony, it was confirmed by PCR whether the plasmid DNA was transformed.
  • the Agrobacterium strain whose gene carrier transformation was confirmed in Example 1-(2) was cultured in YEP liquid medium (including 70 mg/L kanamycin and 70 mg/L streptomycin) at 28° C. for 24 hours. .
  • YEP liquid medium including 70 mg/L kanamycin and 70 mg/L streptomycin
  • Agrobacter Tobacco leaf slices were prepared by evenly spraying 1 mL of the lysium strain culture solution. Then, it was incubated for 48 hours at 25° C. in dark conditions.
  • the rooting medium (MS medium, including 200 mg/L cefotaxime)
  • the rooting medium was plated by culturing at 25 ° C., 16 hours / 8 hours photoperiod conditions.
  • each target gene region was amplified through PCR reaction.
  • 50 tissue cultures with mutations in the NtHMA gene and 60 tissue cultures with mutations in the NtPCS gene were selected.
  • gDNA was extracted and purified using a commercial kit (eg, Nucleospin 96 plant II, Macherey Nagel, Germany) using a silica column. 4 shows the results of electrophoresis by amplifying each target gene region targeting the gDNA of 24 tissue cultures in order to confirm the presence and pattern of mutations.
  • FIG. 5 an example of performing nucleotide sequence analysis by amplifying a target gene site through PCR after extracting/purifying gDNA from leaf tissue is shown in FIG. 5 .
  • FIG. 5 as a result of sequencing of wild-type KB108 and the NtHMA ⁇ site of the mutant, it was confirmed that the mutant had an adenine base inserted compared to the wild-type base sequence.
  • the mutation rate was 44% to 48% at the positions of gRNA_HMA_A4 and gRNA_HMA_B4 targeted for exon 2, and exon 2 of the NtHMA gene It was confirmed that the mutation occurred the most at the position.
  • F 1 generation seeds were obtained through self-fertilization to remove the gene block introduced for CRISPR/Cas9 expression. F 1st generation seeds were sown in a 128-neck tray and grown for 30 days, then the leaves were collected and ground uniformly, using a silica column and a commercial kit (eg Nucleospin 96 plant II, Macherey Nagel, Germany). gDNA was extracted and purified. PCR was performed using the 35S promoter and primers specifically amplifying the Cas9 DNA block. The sequences of the primers are shown in Table 8 below.
  • plants in which the 535S promoter and the Cas9 DNA block were not detected were selected.
  • the finally selected F1 plant did not include a transgene, and was a plant in which homozygous mutations were performed in the NtHMA gene and the NtPCS gene, respectively.
  • the genotypes of the final plants mutated in each of the NtHMA gene and the NtPCS gene are shown in Table 9 below.
  • gDNA nucleotide sequence, CDS nucleotide sequence, and amino acid sequence of the PCSs gene and PCst gene of the control plant (KB108) and the plant mutated in the NtPCSs and NtPCSt genes (PCSst) are summarized and shown in Table 10 below.
  • amino acid sequences of SEQ ID NO: 39 and SEQ ID NO: 42 are as follows.
  • SEQ ID NO: 39 MAMAGLYRRV LPSPPAVDFA STEGKQLFLE AIQNGNNGRI FQVDLLFSDT V*TGLLWFG* PFHGLECPCY *SRKKMER
  • the flower stalks of the plants grown for 80 days were cut, and all leaves of the plants were harvested 2 weeks later, and the harvested leaves were dried in a dry oven at 65°C for 48 hours. , was put in a container containing glass beads and pulverized using a gyro-shaker.
  • the experiment was carried out by dividing the first and second phases according to the time of securing the mutant plant.
  • Cadmium content of KB108 (wild type, control) and mutant was quantitatively analyzed by GC/MS analysis technique. The results of the two experiments were expressed as a relative amount compared to the cadmium absorption amount of the control plant.
  • plants mutated in the NtHMA ⁇ gene or the NtHMA ⁇ gene had a 25% or 2% decrease in the cadmium content in the leaves compared to the control group, and both the NtHMA ⁇ gene and the NtHMA ⁇ gene were mutated.
  • the cadmium content in the leaves was reduced by 64% compared to the control group.
  • plants in which both the NtPCSs gene and the NtPCSt gene were mutated showed a significant cadmium reduction effect by reducing the cadmium content in the leaves by 85% compared to the control group. This shows an excellent cadmium reduction effect compared to plants in which both the NtHMA ⁇ gene and the NtHMA ⁇ gene are mutated.
  • a cadmium absorption experiment was performed in a greenhouse environment. Specifically, after transplanting the germinated plant into a pot in a greenhouse environment, cutting the flower stalk of the plant grown for 60 days, and harvesting all the leaves (lower leaf, upper leaf, or whole leaf) of the plant two weeks later, After the harvested leaves were dried in a dry oven at 65° C. for 48 hours, they were placed in a container containing glass beads and pulverized using a gyro-shaker. Cadmium content of KB108 (wild type, control) and mutant was quantitatively analyzed by GC/MS analysis technique.
  • plants in which mutations were induced in both the NtPCSs gene and the NtPCSt gene showed a significant cadmium reduction effect by reducing the cadmium content in the leaves by about 87% compared to the control group.
  • the cadmium content in the leaves of plants mutated in both the NtPCSs gene and the NtPCSt gene was reduced by 86% compared to the control in the nutrient solution environment and by 87% compared to the control in the soil environment, showing the greatest cadmium reduction effect.
  • plants mutated in the NtHMA ⁇ gene and/or the NtHMA ⁇ gene, and plants mutated in both the NtPCSs gene and the NtPCSt gene were compared to controls. Specifically, the plant height, the number of leaves, and the leaf weight of five individuals for each plant type were measured and compared.
  • the NtHMA ⁇ mutant showed a level of growth inhibition observed with the naked eye compared to the control, whereas the NtPCSst mutant did not show a significant difference in growth status compared to the control.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Physiology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

모세포에 비하여 PCS (Phytochelatin synthase) 유전자 또는 상기 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 감소된 식물 세포, 상기 식물 세포를 포함하는 중금속 흡수량이 저감된 식물, 식물체의 모세포에 비하여 PCS 유전자 또는 상기 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성을 감소시키는 단계를 포함하는 식물체 내 중금속을 저감시키는 방법, PCS 유전자를 표적으로 하는 단일 가이드 RNA를 포함하는 크리스퍼-카스9 (CRISPR-Cas9) 재조합 벡터, 및 상기 재조합 벡터로 식물 세포를 형질전환시키는 단계를 포함하는 중금속이 저감된 식물체를 제조하는 방법에 관한 것이다.

Description

중금속 저감된 형질전환 식물체 및 이의 제조방법
중금속 저감된 형질전환 식물체 및 이의 제조방법에 관한 것이다.
납, 카드뮴, 수은 등　중금속은 환경으로부터 유래된 오염물질로 식품, 물, 대기, 토양 등을 통해 노출된다. 일반인은 주로 식품을 통해서 중금속을 섭취하게 되며 체내로 흡수된 미량의 중금속은 뼈, 신장 등의 장기에 축적되며 건강에 악영향을 끼치는 것으로 알려져 있다. 식품의약품안전처에서 2010년부터 2015년까지 우리 국민의 체내 중금속 농도 변화를 추적조사하고, 식품 섭취나 생활 습관과의 관련성을 분석한 결과 음주와 흡연, 식습관이 체내 중금속 농도와 관련성이 있는 것으로 확인됐다. 흡연은 섭취를 통한 체내 흡수율보다 흡입을 통한 흡수율이 높기 때문에 담배 자체가 가지는 중금속 등 유해물질이 체내로 들어와 체내 중금속 농도를 높이는 것으로 알려져 있다. 따라서, 담배 식물체 내의 중금속 함량 또는 재배시 토양으로부터의 중금속 흡수율을 저감시킬 수 있는 담배 식물체의 개발이 요구되고 있다.
또한, 많은 중금속은 토양에 천연 상태로 존재하고, 식물에 상이한 정도로 흡수된다. 망간 또는 아연과 같은 일부 중금속은 효소 활성에 요구된 공동 인자를 나타내기 때문 식물에 대해 필수적이지만, 다른 중금속은 식물에 대해 필수적이지 않으므로, 중금속의 농도를 감소시키는 것이 유익하다. 예를 들어, 카드뮴(Cd)은 식물 또는 인간 발육에 있어 유익한 효과가 없는 중금속으로 보고된 바 있으며, 인간 발암　물질로서 분류된다. Cd가 식물에서 과하게 축적되는 경우, 잎 표면이 감소하고, 건중량, 물 함량, 엽록소 함량, 및 카로티노이드 함량이 감소하는 등의 유해한 효과를 나타낸다.
특히, 담배는 뿌리에서보다 순(shoot)에서 Cd를 4배 더 높은 수준으로 축적할 수 있는 능력을 특징으로 하는 식물 종이므로, 담배와 같은 식물체에서 Cd의 축적을 감소시키는 것이 바람직하다. 이와 관련하여, 카드뮴 축적이 감소된 담배 식물체로서, NtHMA 유전자의 감소된 발현 또는 활성을 갖는 돌연변이 식물체를 제조하는 방법이 알려져 있으나 (국내 특허공개공보 제10-2018-0107123호), 상기 방법에 의해 제조된 돌연변이 담배 식물체는 야생형 담배 식물체에 비해 정상적인 생육이 불가능하다는 문제점이 있다.
이러한 배경 하에, 본 발명자들은 담배 식물체의 파이토켈라틴 합성 효소 (NtPCS: phytochelatin synthase) 유전자에 돌연변이를 유발함으로써, 야생형 담배 식물체에 비해 중금속 함량 또는 중금속 흡수 정도가 현저히 저감되면서도, 우수한 생육 특성을 유지할 수 있음을 확인하여 본 발명을 완성하였다.
일 양상은 모세포에 비하여 PCS (Phytochelatin synthase) 유전자 또는 상기 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 감소된 식물 세포를 제공한다.
다른 양상은 모세포에 비하여 PCS (Phytochelatin synthase) 유전자 또는 상기 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 감소된 식물 세포를 포함하는 중금속 흡수량이 저감된 식물을 제공한다.
또 다른 양상은 식물체의 모세포에 비하여 PCS 유전자 또는 상기 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성을 감소시키는 단계를 포함하는 식물체 내 중금속을 감소시키는 방법을 제공한다.
또 다른 양상은 PCS 유전자를 표적으로 하는 단일 가이드 RNA를 포함하는 크리스퍼-카스9 (CRISPR-Cas9) 재조합 벡터를 제공한다.
또 다른 양상은 PCS 유전자를 표적으로 하는 단일 가이드 RNA를 포함하는 크리스퍼-카스9 (CRISPR-Cas9) 재조합 벡터로 식물 세포를 형질전환시키는 단계를 포함하는 중금속 흡수량이 저감된 식물체를 제조하는 방법을 제공한다.
일 양상은 모세포에 비하여 PCS (Phytochelatin synthase) 유전자 또는 상기 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 감소된 식물 세포를 제공하는 것이다.
본 명세서에서 사용되는 용어, “모세포”는 PCS 유전자 또는 상기 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 감소되도록 인위적인 조작을 수행하지 않은 세포로서, 식물체에서 갓 분리된 세포 또는 이를 배양한 세포를 의미할 수 있다.
본 명세서에서 사용되는 용어, "파이토켈라틴 합성 효소 (PCS: phytochelatin synthase)"는 글루타티온 감마-글루타밀시스테이닐트랜스퍼라제 (glutathione gamma-glutamylcysteinyltransferase), 감마-글루타밀시스테인 디펩티딜 트랜스펩티다아제 (gamma-glutamylcysteine dipeptidyl transpeptidase)로도 불리는 효소로서, 글루타티온 및 [Glu(-Cys)]n-Gly의 2개 기질로 Gly 및 [Glu(-Cys)]n+1-Gly의 2개의 산물을 생성하는 효소이다. 담배 식물체 내에서는 세포 내의 금속 이온과 결합하여 저장 및 이동에 관여하는 단백질로서, 구체적으로 카드뮴, 아연 등을 포함한 중금속의 세포 내 원거리 이동에 관여할 것으로 예상되는 단백질이다.
상기 PCS 유전자는 실베스트리스 꽃담배 (Nicotiana sylvestris)로부터 유래된 PCS 유전자 (NtPCSs), 토멘토시포르미스 꽃담배 (Nicotiana tomentosiformis)로부터 유래된 PCS 유전자 (NtPCSt), 또는 이들의 조합(NtPCSst)일 수 있다.
상기 식물 세포는 PCS 유전자 또는 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 감소되도록 유전적으로 조작되는 것일 수 있다. 본 명세서에서 용어 "유전적 조작 (genetic engineering)" 또는 "유전적으로 조작된 (genetically engineered)"은 세포에 대하여 하나 이상의 유전적 변형 (genetic modification)을 도입하는 행위 또는 그에 의하여 만들어진 세포를 의미할 수 있다.
상기 유전적 조작은 물리적인 방법에 의해 PCS 유전자의 염기 서열 내 변형으로 유도되는 것일 수 있다. 상기 물리적인 방법은 예를 들어, X-선 조사, 감마선 조사 등일 수 있다.
상기 유전적 조작은 화학적인 방법에 의해 PCS 유전자의 염기 서열 내 변형 또는 유전자의 발현의 변화로 유도되는 것일 수 있다. 상기 화학적 인 방법은 예를 들어, 에틸 메탄설포네이트(ethyl methanesulfonate) 처리, 다이메틸 설페이트(dimethyl sulfate) 처리 등일 수 있다.
상기 유전적 조작은 유전자 편집 시스템에 의해 PCS 유전자의 염기 서열 내 변형으로 유도되는 것일 수 있다. 상기 유전자 편집 시스템은 예를 들어, 메가뉴클레아제(Meganuclease) 시스템, 징크핑거 뉴클레아제(Zinc finger nuclease) 시스템, 탈렌(TALEN; Transcription Activator-Like Effector Nuclease) 시스템, CRISPR/Cas9 시스템 등일 수 있다. 예를 들어, 상기 유전적 조작은 RNA 간섭(RNAi; RNA interference) 시스템에 의해 PCS 유전자로부터 전사된 mRNA에 결합하여 유전자 발현의 변화로 유도되는 것일 수 있다.
일 구체예에 있어서, 상기 식물 세포는 CRISPR/Cas9 시스템에 의해 PCS 유전자 또는 PCS 유전자에 의해 코딩된 단백질의 발현 또는 활성을 감소시킬 수 있다.
용어 PCS 유전자 또는 PCS 유전자에 의해 코딩되는 단백질의 "발현 또는 활성이 감소" 또는 PCS 유전자의 "불활성화", PCS 단백질의 "발현 또는 활성이 감소" 또는 PCS 유전자의 "불활성화"된 유전적으로 조작된 식물 세포는 상기 PCS 유전자 또는 PCS 유전자에 의해 코딩되는 단백질이 비교 가능한 동일 종의 식물 세포 또는 그의 모세포에서 측정된 PCS 유전자 또는 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성 수준보다 낮은 정도로 발현 또는 활성이 나타내거나 발현 또는 활성이 없는 것을 의미한다. 즉, 식물 세포에 있어서 PCS 유전자 또는 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 본래 조작되지 않은 식물 세포의 발현 또는 활성보다 약 20% 이 상, 약 30% 이상, 약 40% 이상, 약 50% 이상, 약 55% 이상, 약 60% 이상, 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85% 이상, 약 90% 이상, 약 95% 이상, 또는 약 100% 감소된 것일 수 있다. PCS 유전자 또는 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 감소된 유전적으로 조작된 식물 세포는 당업계에 공지된 임의의 방법을 사용하여 확인될 수 있다. 용어 "불활성화 (inactivation)"는 전혀 발현이 되지 않는 유전자 또는 발현이 되더라도 그 활성이 없는 단백질이 생성되는 것을 의미할 수 있다. 용어 "감소 (depression)"는 PCS 유전자가 조작되지 않은 식물 세포에 비하여 낮은 수준으로 발현되거나, 또는 PCS 유전자에 의해 코딩되는 단백질이 발현이 되더라도 그 활성이 낮은 것을 의미할 수 있다.
다른 양상은 상기 식물 세포를 포함하는 중금속 흡수량이 저감된 식물에 관한 것이다. 상기 식물 세포 등의 구체적인 내용은 전술한 바와 같다.
상기 식물은 재배담배(Nicotiana tabacum)일 수 있고, 구체적으로 황색종, 버어리종, 재래종, 흑담배 또는 오리엔트종일 수 있고, 보다 구체적으로는 버어리종 또는 황색종일 수 있다.
일 구체예에 있어서, 상기 식물은 PCS 유전자 또는 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성을 감소시킨 식물 세포를 포함함으로써, 동일 세대뿐만 아니라 후 세대에서도 중금속 함량 또는 중금속 흡수량이 감소된 식물일 수 있고, 이에 따라 계속해서 중금속 저감화된 식물을 얻을 수 있다.
또 다른 양상은 식물체의 모세포에 비하여 PCS 유전자 또는 상기 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성을 감소시키는 단계를 포함하는 식물체 내 중금속을 감소시키는 방법을 제공하는 것이다. 상기 모세포, PCS, 식물 세포, 발현 또는 활성의 감소 등의 구체적인 내용은 전술한 바와 같다.
상기 PCS 유전자 또는 PCS 단백질의 발현 또는 활성이 감소되는 것은 상기 PCS를 코딩하는 유전자의 일부 또는 전부가 변이, 치환, 삭제되거나 상기 유전자에 하나 이상의 염기가 삽입되는 것에 의한 것일 수 있으며, PCS 유전자 교정 수단에 의한 것일 수 있다.
상기 PCS 유전자 또는 PC 유전자에 의해 코딩되는 단백질의 발현 또는 활성을 감소시키는 단계에서 RNA 간섭(RNAi; RNA interference) 시스템, 메가뉴클레아제(Meganuclease) 시스템, 징크핑거 뉴클레아제(Zinc finger nuclease) 시스템, 탈렌(TALEN; Transcription Activator-Like Effector Nuclease) 시스템, CRISPR/Cas9 시스템, X-선 조사, 감마선 조사, 에틸 메탄설포네이트(ethyl methanesulfonate) 처리, 다이메틸 설페이트(dimethyl sulfate) 처리로 이루어진 군으로부터 선택되는 적어도 하나를 수행하는 것일 수 있다.
상기 PCS 유전자 또는 PCS 유전자에 의해 코딩된 단백질의 발현 또는 활성이 감소되도록 인위적으로 수행하는 유전자 조작은 PCS 유전자로부터 코딩되는 단백질이 본래의 기능을 갖는 단백질 형태로 발현되지 않도록 하는 것일 수 있다. 상기 유전자 조작은 다음 중 하나 이상에 의하여 유도된 것일 수 있다: 1) PCS 유전자의 전부 또는 일부 결실, 예컨대, PCS 유전자의 1bp 이상의 뉴클레오티드, 예컨대, 1 내지 30개, 1 내지 27개, 1 내지 25개, 1 내지 23개, 1 내지 20개, 1 내지 15개, 1 내지 10개, 1 내지 5개, 1 내지 3개, 또는 1개의 뉴클레오티드의 결실; 2) PCS 유전자의 1bp 이상의 뉴클레오티드, 예컨대, 1 내지 30개, 1 내지 27개, 1 내지 25개, 1 내지 23개, 1 내지 20개, 1 내지 15개, 1 내지 10개, 1 내지 5개, 1 내지 3개, 또는 1개의 뉴클레오티드의 원래(야생형)와 상이한 뉴클레오티드로의 치환; 3) 하나 이상의 뉴클레오티드, 예컨대, 1 내지 30개, 1 내지 27개, 1 내지 25개, 1 내지 23개, 1 내지 20개, 1 내지 15개, 1 내지 10개, 1 내지 5개, 1 내지 3개, 또는 1개의 뉴클레오티드 (각각 독립적으로 A, T, C 및 G 중에서 선택됨)의 타겟 유전자의 임의의 위치에의 삽입; 및 4) 상기 1) 내지 3) 중에서 선택된 2 가지 이상의 조합.
상기 PCS 유전자의 변형되는 일부 ('타겟 부위')는 상기 유전자 중의 1bp 이상, 3bp 이상, 5bp 이상, 7bp 이상, 10bp 이상, 12bp 이상, 15bp 이상, 17bp 이상, 20bp 이상, 예컨대, 1bp 내지 30bp, 3bp 내지 30bp, 5bp 내지 30bp, 7bp 내지 30bp, 10bp 내지 30bp, 12bp 내지 30bp, 15bp 내지 30bp, 17bp 내지 30bp, 20bp 내지 30bp, 1bp 내지 27bp, 3bp 내지 27bp, 5bp 내지 27bp, 7bp 내지 27bp, 10bp 내지 27bp, 12bp 내지 27bp, 15bp 내지 27bp, 17bp 내지 27bp, 20bp 내지 27bp, 1bp 내지 25bp, 3bp 내지 25bp, 5bp 내지 25bp, 7bp 내지 25bp, 10bp 내지 25bp, 12bp 내지 25bp, 15bp 내지 25bp, 17bp 내지 25bp, 20bp 내지 25bp, 1bp 내지 23bp, 3bp 내지 23bp, 5bp 내지 23bp, 7bp 내지 23bp, 10bp 내지 23bp, 12bp 내지 23bp, 15bp 내지 23bp, 17bp 내지 23bp, 20bp 내지 23bp, 1bp 내지 20bp, 3bp 내지 20bp, 5bp 내지 20bp, 7bp 내지 20bp, 10bp 내지 20bp, 12bp 내지 20bp, 15bp 내지 20bp, 17bp 내지 20bp, 21bp 내지 25bp, 18bp 내지 22bp, 또는 21bp 내지 23bp의 연속하는 염기 서열 부위일 수 있다.
또한, 일 예로, PCS 넉아웃 식물 세포를 제조하기 위하여 유전체 교정 기술로서 유전체 중 존재 비율이 매우 낮은 희귀 유전자 서열을 절단하는 희귀 절단 엔도뉴클레아제(rare-cutting endonuclease)를 포함하는 유전체 교정 시스템에 의하여 타겟된 유전자 내의 특정 부위의 단일가닥 또는 이중가닥 절단 (cleavage)을 촉매화하여 타겟된 유전자인 PCS 유전자를 발현을 감소시키는 것일 수 있다. 상기 희귀 절단 엔도뉴클라아제에 의하여 촉매되는 핵산가닥 손상 (breaks)은 상동 재조합 (homologous recombination) 또는 비상동 말단 연결 (NHEJ: non-homologous end joining) 등의 메커니즘들을 통하여 수선될 수 있다. 상기 희귀 절단 엔도뉴클레아제는 메가뉴클레아제(meganuclease), 징크핑거(Zinc finger) 뉴클레아제,　CRISPR/Cas9 (Cas9 단백질), CRISPR-Cpf1 (Cpf1 단백질) 및 TALE-뉴클레아제로 이루어진 군에서 선택된 하나 이상일 수 있다.
상기 중금속은 카드뮴, 비소, 안티몬, 납, 수은, 크롬, 주석, 아연, 바륨, 비스무트, 니켈, 코발트, 망간, 철, 구리 및 바나듐으로 이루어진 군으로부터 선택된 하나 이상일 수 있다. 일 구체예에 있어서, PCS 유전자 또는 PCS 유전자에 의해 코딩된 단백질의 발현 또는 활성을 감소시킴으로써, 식물체 내 카드뮴 함량 또는 카드뮴 흡수량을 감소시키는 것일 수 있다.
또 다른 양상은 PCS 유전자를 표적으로 하는 단일 가이드 RNA를 포함하는 크리스퍼-카스9 (CRISPR-Cas9) 재조합 벡터를 제공하는 것이다. 상기 PCS 유전자, 식물 세포 등의 구체적인 내용은 전술한 바와 같다.
본 명세서에서 사용되는 용어, "단일 가이드 RNA(sgRNA: single guide RNA)"는 "키메라 RNA", "키메라 가이드 RNA", "가이드 RNA", "단일 가이드 RNA(single guide RNA, sgRNA)" 및 "합성 가이드 RNA"는 상호 교환가능하게 사용될 수 있다. 가이드 서열, tracr 서열 및/또는 tracr 메이트 서열을 포함하는 폴리뉴클레오티드 서열을 지칭한다. 용어 "가이드 서열"은 표적 부위를 지정하는 가이드 RNA 내의 약 20bp 서열을 지칭하며, 용어 "가이드" 또는 "스페이서"와 상호교환가능하게 사용될 수 있다. 또한, 용어 "tracr 메이트 서열"은 용어 "직접 반복부 (들)"와 상호교환가능하게 사용될 수 있다. 상기 가이드 RNA는 두 개의 RNA, 즉, CRISPR RNA (crRNA) 및 트랜스 활성화 crRNA (transactivating crRNA, tracrRNA)로 이루어져 있는 것일 수 있으며, 또는 crRNA 및 tracrRNA의 부분을 포함하고 상기 표적 DNA와 혼성화하는 단일 사슬 RNA (single-chain RNA, sgRNA)일 수 있다.
상기 sgRNA가 표적으로 하는 PSC 유전자는 실베스트리스 꽃담배 (Nicotiana sylvestris)로부터 유래된 PCS 유전자 (NtPCSs), 또는 토멘토시포르미스 꽃담배 (Nicotiana tomentosiformis)로부터 유래된 PCS 유전자 (NtPCSt)일 수 있다.
상기 NtPCSs 유전자를 표적으로 하는 sgRNA는 서열번호 1 또는 서열번호 2의 염기서열로 이루어진 것일 수 있고, 상기 NtPCSt 유전자를 표적으로 하는 sgRNA는 서열번호 3 또는 서열번호 4의 염기서열로 이루어진 것일 수 있고, 상기 NtPCSs 유전자 및 NtPCSt 유전자 모두를 표적으로 하는 sgRNA는 서열번호 5 또는 서열번호 6의 염기서열로 이루어진 것일 수 있다.
일반적으로, 가이드 서열은 표적 서열과 혼성화하고, 표적 서열로의 CRISPR 복합체의 서열-특이적 결합을 유도하기에 충분한, 표적 폴리뉴클레오티드 서열과의 상보성을 갖는 임의의 폴리뉴클레오티드 서열이다. 또한 PCS 유전자 또는 PCS 유전자가 발현하는 단백질의 발현 또는 활성을 감소시키기 위한 유전자 조작에 이용할 수 있는 염기 서열이라면 제한 없이 가이드 RNA로 이용할 수 있으며, 예컨대 상기 염기 서열은 PCS 유전자와 혼성화할 수 있는 서열일 수 있다. 또한 상기 가이드 RNA의 기능을 변형/증진시키기 위하여 가이드 RNA 염기 서열의 일부분을 변형할 수 있다. 또한 일부 구현 예에서, 가이드 서열과 그의 상응하는 표적 서열 간의 상보성의 정도는 적절한 정렬 알고리즘을 사용하여 최적으로 정렬되는 경우, 약 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% 이상이다. 최적의 정렬은 서열을 정렬하기에 적절한 임의의 알고리즘의 사용으로 결정될 수 있으며, 그의 비제한적인 예는 스미스-워터만 (Smith-Waterman) 알고리즘, 니들만-분쉬 (Needleman-Wunsch) 알고리즘, 버로우즈-휠러 트랜스폼(Burrows-Wheeler Transform)에 기초한 알고리즘(예를 들어, 버로우즈 휠러 얼라이너(Burrows Wheeler Aligner)), ClustalW, Clustal X, BLAT, 노보얼라인(Novoalign)(노보크라 프트 테크놀로지즈(Novocraft Technologies), ELAND(일루미나(Illumina), 미국 캘 리포니아주 샌디에고), SOAP(soap.genomics.org.cn에서 이용가능) 및 Maq(maq.sourceforge.net에서 이용가능)를 포함한다.
일부 구현 예에서, 가이드 서열은 예컨대 약 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75개 이상의 뉴클레오티드 길이일 수 있다. 일부 구현 예에서, 가이드 서열은 약 75, 50, 45, 40, 35, 30, 25, 20, 15, 12개 이하의 뉴클레오티드 길이일 수 있다. 표적 서열로의 CRISPR 복합체의 서열-특이적 결합을 유도하는 가이드 서열의 능력은 임의의 적절한 검정에 의해 평가될 수 있다. 예를 들어, 시험되는 가이드 서열을 포함하는 CRISPR 복합체를 형성하기에 충분한 CRISPR 시스템의 성분은 예를 들어, CRISPR 서열의 성분을 인코딩하는 벡터로의 트랜스펙션 후에, 예를 들어, 본원에 기술된 바와 같은 서베이어 검정에 의한 표적 서열 내의 우선적인 절단의 평가에 의해서와 같이, 상응하는 표적 서열을 갖는 숙주 세포로 제공될 수 있다. 유사하게, 표적 폴리뉴클레오티드 서열의 절단은 표적 서열, 시험되는 가이드 서열 및 시험 가이드 서열과 상이한 대조군 가이드 서열을 포함하는 CRISPR 복합체의 성분을 제공하고, 표적 서열에서 시험 및 대조군 가이드 서열 반응 간의 결합 또는 절단 비율을 비교함으로써 시험관에서 평가될 수 있다. 다른 검정이 가능하며, 당업자에게 용이하게 사용될 수 있을 것이다.
일 구체예에 있어서, sgRNA는 상기 식물 세포 내 적어도 하나의 대립유전자의 PCS 유전자에 결합되는 것일 수 있으며, 구체적으로 모든 대립유전자의 PCS 유전자에 결합되는 것일 수 있다. 모든 대립유전자의 PCS 유전자에 가이드 RNA가 결합하여 PCS 유전자를 넉아웃시키는 경우, 동일 세대 뿐만아니라 후 세대의 식물 세포에서도 중금속 흡수 및 이동이 억제될 수 있다.
일 구체예에 있어서, 상기 식물 세포에서 PCS 유전자를 넉아웃 시키기 위하여 사용한 타겟 시퀀스는 예컨대 PCS 유전자의 Exon 1 및 Exon 2 중 적어도 하나의 부위일 수 있다. 또한, 일 구체예에 있어서, 상기 식물 세포에서 PCS 유전자의 Exon 2를 표적으로 제작한 sgRNA가 돌연변이를 가장 많이 유발할 수 있음을 확인하였다.
일 구체예에 있어서, 상기 식물 세포는 sgRNA에 의해 PCS 유전자의 특정 타겟 부위가 절단되어 상기 유전자가 넉아웃된 식물 세포로서, 넉아웃에 의하면 식물 세포의 중금속 흡수 및 이동이 억제될 수 있다.
상기 유전자 넉아웃은 유전자의 전부 또는 일부 (예컨대, 하나 이상의 뉴클레오티드)의 결실, 치환, 및/또는 하나 이상의 뉴클레오티드의 삽입에 의한 유전자의 활성 조절, 예컨대, 불활성화를 의미하는 것일 수 있다. 상기 유전자 불활성화는 유전자의 발현 억제 또는 발현 감소 (downregulation) 또는 본래의 기능을 상실한 단백질을 코딩하도록 변형된 것을 의미한다. 또한 유전자 조절은 타겟 유전자의 하나 이상의 Exon을 둘러싸고 있는 양쪽 intron 부위를 동시에 타겟팅함으로 인한 Exon 부위의 결실로 인해 얻어지는 단백질의 구조 변형, Dominant negative 형태의 단백질 발현, soluble 형태로 분비되는 경쟁적 저해제 발현 등의 결과에 의한 유전자의 기능 변화를 의미하는 것일 수 있다.
본 명세서에서 사용되는 용어 "벡터(vector)"는 숙주 세포에서 목적 유전자를 발현시키기 위한 수단을 의미한다. 예를 들어, 플라스미드 벡터, 코즈미드 벡터 및 박테리오파아지 벡터, 아데노바이러스 벡터, 레트로바이러스 벡터 및 아데노-연관 바이러스 벡 터와 같은 바이러스 벡터를 포함한다. 상기 재조합 벡터로 사용될 수 있는 벡터는 당업계에서 종종 사용되는 플라스미드 (예를 들면, V1k_GE, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX 시리즈, pET 시리즈 및 pUC19 등), 파지 또는 바이러스 (예를 들면, SV40 등)를 조작하여 제작될 수 있다.
상기 벡터에서 상기 PCS 유전자에 결합하는 가이드 RNA를 코딩하는 유전자, 상기 Cas9 단백질을 코딩하는 유전자 및 상기 NLS를 코딩하는 유전자는 프로모터에 작동 가능하게 연결될 수 있다. 용어 "작동 가능하게 연결된(operatively linked)"은 뉴클레오타이드 발현 조절 서열(예를 들어, 프로모터 서열)과 다른 뉴클레오타이드 서열 사이의 기능적인 결합을 의미한다. 상기 조절 서열은 "작동 가능하게 연결(operatively linked)"됨으로써 다른 뉴클레오타이드 서열의 전사 및/또는 해독을 조절할 수 있다.
일 구체예에 있어서, 상기 벡터는 상기 PCS 유전자에 결합하는 가이드 RNA를 코딩하는 유전자의 5'-말단에 서열번호 43의 염기 서열로 이루어진 폴리뉴클레오티드 (P_U6)가 결합되어 있고, 3'-말단에 5개의 연속된 티민 (Thymine)이 결합되어 있는 경우, 불안정한 가이드 RNA가 안정화될 수 있다.
상기 벡터는, 전형적으로 클로닝을 위한 벡터 또는 발현을 위한 벡터로서 구축될 수 있다. 상기 발현용 벡터는 당업계에서 식물, 동물 또는 미생물에서 외래의 단백질을 발현하는 데 사용되는 통상의 것을 사용할 수 있다. 상기 벡터는 당업계에 공지된 다양한 방법을 통해 구축될 수 있다.
상기 벡터는 원핵 세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다. 예를 들어, 사용되는 벡터가 발현 벡터이고, 원핵 세포를 숙주로 하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터(예를 들어, CMV 프로모터, trp 프로모터, lac 프로모터, tac 프로모터, T7 프로모터 등), 해독의 개시를 위한 라이보 좀 결합 자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다. 진핵 세포를 숙주로 하는 경우에는, 벡터에 포함되는 진핵 세포에서 작동하는 복제원점은 f1 복제원점, SV40 복제원점, pMB1 복제원점, 아데노 복제원점, AAV 복제원점 및 BBV 복제원점 등을 포함하나, 이에 한정되는 것은 아니다. 또한, 포유동물 세포의 게놈으로부터 유래된 프로모터(예를 들어, 메탈로티오닌 프로모터) 또는 포유동물 바이러스로부터 유래된 프로모터(예를 들어, 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, 사이토메갈로바이러스 프로모터 및 HSV의 tk프로모터)가 이용될 수 있으며, 전사 종결 서열로서 폴리아데닐화 서열을 일반적으로 갖는다.
본 명세서에서 사용되는 용어, "CRISPR/Cas9 시스템"은 crRNA(CRISPR RNA) 및 tracrRNA(transactivating crRNA)를 포함하는 sgRNA(single guide RNA)를 포함할 수 있다. 또한, 상기 CRISPR/Cas9 시스템은 Cas9(CRISPR associated protein 9) 단백질 또는 Cas9 단백질을 코딩하는 유전자 및 NLS(Nuclear Localization Signal) 단백질 또는 NLS 단백질을 코딩하는 유전자를 포함할 수 있다.
일반적으로, 널리 알려진 유전자 교정 수단인 "CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats) 시스템"은 집합적으로 Cas 유전자를 코딩하는 서열, tracr(트랜스-활성화 CRISPR) 서열(예를 들어, tracrRNA 또는 활성 부분 tracrRNA), tracr-메이트 서열(내인성 CRISPR 시스템의 맥락에서 "직접 반복부" 및 tracrRNA-가공 부분 직접 반복부 포함), 가이드 서열(내인성 CRISPR 시스템의 맥락에서 "스페이서"로도 지칭), 가이드 RNA 또는 CRISPR 유전자좌로부터의 기타 서열 및 전사물을 포함하는 CRISPR-관련(CRISPR-associated; 이하 Cas) 유전자의 발현에 수반되거나, 그의 활성을 유도하는 전사물 및 다른 요소를 지칭한다. 일부 구현 예에서, CRISPR 시스템의 하나 이상의 요소는 I형, II형 또는 III형 CRISPR 시스템으로부터 유래된다. 일부 구현 예에서, CRISPR 시스템의 하나 이상의 요소는 내인성 CRISPR 시스템을 포함하는 특정 유기체, 예를 들어, 스트렙토코커스 피요게네스(Streptococcus pyogenes)로부터 유래된다. 일반적으로, CRISPR 시스템은 표적 서열의 부위에서 CRISPR 복합체의 형성을 증진시키는 요소 (내인성 CRISPR 시스템의 맥락에서 프로토스페이서로도 지칭)를 특징으로 한다. CRISPR 복합체의 형성의 맥락에서, "표적 서열" 또는 "표적 유전자"는 가이드 서열 이 상보성을 갖도록 설계된 서열을 지칭하며, 여기서, 표적 서열과 가이드 서열 간의 혼성화는 CRISPR 복합체의 형성을 증진시킨다. 본질적으로 완전한 상보성이 필요하지 않지만, 혼성화를 야기하고, CRISPR 복합체의 형성을 증진시키는 충분한 상보성이 존재한다. 표적 서열은 임의의 폴리뉴클레오티드, 예를 들어, DNA 또는 RNA 폴리뉴클레오티드를 포함할 수 있다. 일부 구현 예에서, 표적 서열은 세포의 핵 또는 세포질 내에 위치한다. 일부 구현 예에서, 표적 서열은 진핵 세포의 세포기관, 예를 들어, 미토콘드리아 또는 엽록체 내에 존재할 수 있다.
상기 Cas 단백질은 CRISPR RNA(crRNA) 및 트랜스-활성화 crRNA(trans-activating crRNA, tracrRNA)로 불리는 두 RNA와 복합체를 형성할 때, 활성 엔도뉴클레아제 또는 니카아제(nickase)를 형성한다. 상기 Cas 단백질의 비제한적인 예는 Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9(Csn1 및 Csx12로도 알려짐), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, 그의 상동체 또는 그의 변형된 버전을 포함한다. 이들 효소가 알려져 있으며; 예를 들어, 스트렙토코커스 피오게네스 Cas9 단백질의 아미노산 서열은 수탁 번호 Q99ZW2 하에 스위스프로트(SwissProt) 데이터베이스에서 얻을 수 있다. 일부 구현 예에서, 비변형 CRISPR 효소, 예를 들어, Cas9는 DNA 절단 활성을 갖는다.
일부 구현 예에서, CRISPR 효소는 Cas9 단백질이며, 상기 Cas9 단백질은 스트렙토코커스 피요게네스 (Streptococcus pyogenes) 유래 Cas9 단백질, 캄필 로박터 제주니 (Campylobacter jejuni) 유래 Cas9 단백질, 스트렙토코커스 써모필러스 (Streptococcus thermophiles) 유래 Cas9 단백질, 스트렙토코커스 아우레우스 (Streptocuccus aureus) 유래 Cas9 단백질 및 네이세리아 메닝기디티스 (Neisseria meningitidis) 유래 Cas9 단백질로 이루어진 군에서 선택되는 적어도 하나의 Cas9 단백질일 수 있고, 구체적으로 스트렙토코커스 피요게네스 (Streptococcus pyogenes) 유래 Cas9 단백질일 수 있다. 일부 구현 예에서, Cas9 단백질은 진핵 세포에서의 발현을 위해 코돈-최적화되며, 상기 스트렙토코커스 피요게네스 (Streptococcus pyogenes) 유래 Cas9 단백질을 사용하는 경우, PCS 유전자 또는 PCS 유전자가 발현하는 단백질의 발현 또는 활성이 최대로 감소될 수 있다.
일부 구현 예에서, Cas9 단백질은 진핵 세포 내의 핵 내에 위치하기 위하여 Cas9 단백질의 5'- 또는 3'-, 또는 양 말단 부분에 NLS(nuclear localization sequence or signal)를 포함하는 것일 수 있으며, 상기 NLS는 하나 또는 그 이상일 수 있다.
본 명세서에서 사용되는 용어, “핵 위치화 서열 또는 신호(Nuclear localization sequence or signal, NLS)"는 특정물질(예컨대, 단백질)을 세포 핵 내로 운반하는 역할을 하는 아미노산 서열을 의미하며, 대체적으로 핵공(Nuclear Pore)을 통하여 세포 핵 내로 운반하는 작용을 한다. 상기 핵 위치화 서열은 진핵생물에서 CRISPR 복합체 활성에 필요하지 않지만, 이러한 서열을 포함하여, 시스템의 활성을 증진시켜, 특히 핵 내의 핵산 분자를 표적화하는 것으로 여겨진다.
또한 RNA 유전자 가위(RNA-guided CRISPR)(clustered regularly interspaced short palindrome repeats)-연관된 뉴클레아제 Cas9는 표적 유전자의 넉아웃, 전사 활성화 및 single guide RNA(sgRNA)(즉, crRNA-tracrRNA 융합 전사체)를 이용한 억제에 대한 획기적인 기술을 제공하며, 이 기술은 수많은 유전자 위치를 타겟팅하는 것으로 알려져 있다.
Cas9 (또는 Cpf1) 단백질은 CRISPR/Cas9 시스템에서 필수적인 단백질 요소를 의미하고, 상기 Cas9 (또는 Cpf1) 유전자 및 단백질의 정보는 국립생명공학정보센터(national center for biotechnology information, NCBI)의 GenBank에서 구할 수 있으나, 이에 제한되지 않는다. Cas (또는 Cpf1)단백질을 암호화하는 CRISPR-연관 유전자는 약 40 개 이상의 서로 다른 Cas (또는 Cpf1) 단백질 패밀리가 존재하는 것으로 알려져 있으며, cas 유전자 및 반복 구조(repeat structure)의 특정 조합에 따라 8개의 CRISPR 하위 유형 (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apern, 및 Mtube)을 정의할 수 있다. 따라서 상기 각 CRISPR 하위 유형이 반복단위를 이루어 폴리리보뉴클레오티드-단백질 복합체를 형성할 수 있다.
상기 Cas9가 DNA로 암호화되어 개체 또는 세포로 전달되는 경우, 상기 DNA는 일반적으로 (그러나 필수적이지는 않음) 타겟 세포에서 작동 가능한 조절 요소 (예컨대, 프로모터)를 포함할 수 있다. 상기 Cas9 발현을 위한 프로모터는, 예컨대, CMV, EF-l a, EFS, MSCV, PGK, 또는 CAG 프로모터일 수 있다. gRNA 발현을 위한 프로모터는, 예컨대, HI, EF-la, tRNA 또는 U6 프로모터일 수 있다. 상기 프로모터는 조직 특이성 또는 세포 특이성을 갖는 것일 수 있다.
또 다른 양상은 PCS 유전자를 표적으로 하는 단일 가이드 RNA를 포함하는 크리스퍼-카스9 (CRISPR-Cas9) 재조합 벡터로 식물 세포를 형질전환시키는 단계를 포함하는 중금속 흡수량이 저감된 식물체를 제조하는 방법을 제공하는 것이다. 상기 PCS 유전자, 단일 가이드 RNA, 크리스퍼-카스9 시스템, 벡터, 식물 세포 등의 구체적인 내용은 전술한 바와 같다.
상기 형질전환시키는 단계에 있어서, 당업계에 주지된 형질전환 방법으로서 담배의 유전자의 형질전환이 가능한 방법이라면 특별히 제한되지 않는다. 예를 들어, 아그로박테리움-매개 형질전환법, 폴리에틸렌글리콜(Polyethylene glycol; PEG)-매개 프로토플라스트 형질전환법, 유전자총법, 전극(electrode) 형질전환법, 진공 침윤(Vacuum infiltration) 형질전환법 및 탄화규소 섬유-매개 형질전환법으로 이루어진 군에서 선택된 하나에 의해 수행되는 것일 수 있다.
일 구체예에 있어서, 담배의 특성 및 형질전환율 등을 고려할 때 아그로박테리움-매개 형질전환법 (Agrobacterium-mediated transformation)을 통해 PCS 유전자를 표적으로 하는 단일 가이드 RNA를 포함한 재조합 벡터를 식물 세포에 형질전환시킨 것일 수 있다.
일 양상에 따른 PCS (Phytochelatin synthase) 유전자 또는 상기 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 감소된 식물 세포는 식물 세포 내의 중금속 이온과 결합하여 중금속 흡수, 저장 또는 이동시키는 경로가 저해되어, 식물 세포 또는 이를 포함하는 식물 내의 중금속 함량 또는 흡수량을 감소시킬 수 있는 효과가 있다.
다른 양상에 따른 PCS 유전자 또는 상기 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 감소된 식물 세포는 기존의 중금속 저감 식물체의 한계점인 생육 저해 현상을 해결할 수 있다.
도 1은 공개된 레퍼런스 염기서열과 KB108의 NtHMA 유전자 염기서열의 일부를 정렬한 모습을 나타낸 도면이다. 구체적으로, (A) NtHMAα 유전자 내 exon 2 부위를 비교한 결과를 나타낸 도면 (gRNA_A4_e2: NtHMAα 유전자에 특이적인 부분으로 sgRNA가 결합하도록 디자인한 부위) 및 (B) NtHMAβ 유전자 내 exon 2 부위를 비교한 결과를 나타낸 도면 (gRNA_B4_e2: NtHMAβ 유전자에 특이적인 부분으로 sgRNA가 결합하도록 디자인한 부위)이다.
도 2는 sgRNA 2개가 포함된 유전자 가위 발현 운반체의 구조를 나타낸 도면이다.
도 3은 아그로박테리움 매개된 형질전환 방법으로 형질전환시킨 후 식물 조직 배양의 단계별 사진을 나타낸 도면이다. 구체적으로, (A) 잎 조직을 잘라 아그로박테리움과 함께 배양하여 형질전환시키는 단계, (B) 캘러스 분화 및 shoot 분화를 유도하는 단계, (C) root 분화를 유도하는 단계, (D) 분화가 완료된 소식물체 상태를 나타낸 도면이다.
도 4는 돌연변이 여부 및 양상을 확인하기 위하여 조직 배양체 24 개체의 gDNA를 대상으로 각 목표 유전자 부위를 증폭하여 전기영동한 결과를 나타낸 도면이다 (Lane M: 1kb DNA marker, lane 1~7: NtHMAα 부위 증폭 결과, lane 9~15: NtHMAβ 부위 증폭 결과, lane 17~21: NtPCSs 부위 증폭 결과, lane 23~27: NtPCSt 부위 증폭 결과, lane 8, 16, 22, 28: NTC (Non-template control))
도 5는 야생형 (wild type) KB108와 돌연변이체의 NtHMAβ 부위 염기서열 분석 결과를 나타낸 도면이다. 구체적으로, (A) KB108 염기서열 (B) 돌연변이체의 염기서열의 분석 결과를 나타낸 도면으로, 야생형 염기서열에 비해 아데닌 염기가 삽입된 부분을 빨간색 화살표로 표시하였음
도 6은 F1 식물체 내 도입 유전자 유전 여부를 확인하기 위한 유전자 증폭 반응 수행 후 전기영동 결과를 나타낸 도면이다.
도 7은 양액 재배시설에서 수행한 1차 및 2차 카드뮴 함량 분석 결과를 종합하여 대조군의 카드뮴 함량을 기준으로 한 상대값을 나타낸 그래프이다.
도 8은 온실 토양 환경에서 재배한 식물체의 카드뮴 함량을 분석한 결과이다.
도 9는 대조군 KB108 대비 NtHMAαβ 돌연변이체와 NtPCSst 돌연변이체의 생육 특성을 비교한 그래프이다 (Height: 식물체의 높이, # of leaves: 잎의 수, Weight: 잎의 중량).
도 10은 대조군 KB108 대비 NtHMAαβ 돌연변이체와 NtPCSst 돌연변이체의 생육 상태를 육안으로 비교한 사진이다.
이하 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1. NtPCS 유전자를 타겟으로 한 CRISPR/Cas9 시스템을 이용한 카드뮴 저감 담배 생산
(1) 유전자 운반체 제작
(1.1) 중금속 관련 유전자 (NtHMA 및 NtPCS) 염기 서열 확인
뿌리에 흡수된 2가 금속 이온을 다른 조직으로 이동시킬 때 열리고 닫히는 관문 역할을 하는 단백질을 코딩하는 유전자인 NtHMAα 및　NtHMAβ; 및 세포 내의 금속 이온과 결합하여 금속 이온의 저장과 이동에 관여하는 단백질을 코딩하는 유전자인 NtPCS를 포함하는, 담배에서 카드뮴 흡수 및 이동에 관련된 2종의 유전자를 선정하였다.
연구 대상 식물체인 버어리(burley)종 담배 (KB108) 내 NtHMA 및 NtPCS 유전자 염기서열을 확인하기 위해, NCBI (National Center for Biotechnology Information) 데이터베이스에 공개된 염기 서열 정보를 바탕으로 각 유전자에 특이적인 프라이머를 제작하고, 유전자 증폭 반응 (PCR: Polymerase Chain Reaction)을 수행하였다. 각 유전자에 특이적인 프라이머의 서열 및 PCR 조건은 하기 표 1에 나타내었다.
프라이머 명칭 염기서열 (5'→3') 증폭크기(bp) PCR 조건 서열번호
Anealing Tmp Extention time Cycles
F_HMAα GAAACAAAGAAGTTGAGCAAGAGCTATT 2937 62 ℃ 90 sec 35 7
R_HMAα AGCCTTAGTGAGATGATTTATAACACAA 8
F_HMAβ GACACAAAGAATCTGAGCAAGAGCTATT 2374 62 ℃ 90 sec 35 9
R_HMAβ AGCTAGAGTAGGACCACACATTAATTCT 10
F_PCSs AAATGGCGATGGCGGGTTTGTAT 927 68 ℃ 90 sec 35 11
R_PCSs GTCGGGAAGGATTAGAACACAAATTCAC 12
F_PCSt AATGGCGATGGCGGGTTTATATC 2731 68 ℃ 90 sec 35 13
R_PCSt AGTCCGGAAGGATAGGAACACAGATT 14
도 1에 나타낸 바와 같이, KB108 품종의 gDNA 영역을 증폭하여 염기 서열을 분석한 결과 공개된 염기서열과 대부분 일치하였다. 구체적으로, 공개된 레퍼런스 염기서열들 (Database accession No. HF675180.1, HF937054.1)과 KB108의 NtHMA 유전자 염기서열의 일부를 정렬하여 비교한 결과, NtHMAα 유전자 (A) 및 NtHMAβ 유전자 (B) 내 exon 2 부위를 각각 비교한 결과 대부분 일치함을 확인하였고, 각각의 유전자에 특이적인 부분으로 sgRNA가 결합하도록 디자인한 부위를 나타내었다.
KB108 품종의 NtPCSs 유전자 (단, 일부 서열), N. tabacum (TN90) 레퍼런스 지놈 염기서열 및 N. sylvestris 레퍼런스 지놈 염기서열 데이터의 상동성을 확인한 결과를 하기 표 2에, KB108 품종의 NtPCSt 유전자를 N. tabacum (TN90) 레퍼런스 지놈 염기서열 및 N. tometosiformis 레퍼런스 지놈 염기서열 데이터의 상동성을 확인한 결과를 하기 표 3에 나타내었다.
PCSs 유전자 상동성 비교 PCSs_KB108
(KT&G)		 PCSs_TN90
(NW_015845165.1)		 PCSs_Nsyl
(NW_009518934.1)
PCSs_KB108(KT&G) ID 1.000 1.000
PCSs_TN90(NW_015845165.1) 1.000 ID 1.000
PCSs_Nsyl(NW_009518934.1) 1.000 1.000 ID
PCSt 유전자 상동성 비교 PCSt_KB108
(KT&G)		 PCSt_TN90
(NW_015825368.1)		 PCSt_Ntom
(NW_008939610.1)
PCSt_KB108(KT&G) ID 1.000 0.986
PCSt_TN90(NW_015825368.1) 1.000 ID 0.986
PCSt_Ntom(NW_008939610.1) 0.986 0.986 ID
실베스트리스 꽃담배 (Nicotiana sylvestris)로부터 유래된 NtPCSs 유전자 및 토멘토시포르미스 꽃담배 (Nicotiana tomentosiformis)로부터 유래된 NtPCSt 유전자의 염기서열을 N. tabacum (TN90) 레퍼런스 지놈 염기서열과 비교한 결과 상기 표 2 및 3에서 확인한 바와 같이, 100% 일치함을 확인하였다. 또한, NtPCSs 유전자 (단, 일부 서열)는 N. sylvestris 레퍼런스 지놈 데이터와 100% 일치하고, NtPCSt 유전자는 N. tometosiformis 레퍼런스 지놈 데이터와는 약 98.6% 일치함을 확인하였다.
(1.2) 유전자 가위 블록 디자인 및 운반체 재조합
상기 실시예 1-(1)에서 확보된 NtHMAα, NtHMAβ, NtPCSs 및 NtPCSt 유전자의 염기 서열을 비교하여 각각의 유전자에 특이적인 부분을 유전자 가위 인솔자 (sgRNA)로 선정하였다. 식물에서 발현되는 유전자 운반체에 선정된 유전자 가위 발현 블록을 클로닝하여 총 5종의 재조합 운반체를 완성하였다.
NtHMAα 및 NtHMAβ 유전자에 특이적으로 결합할 수 있는 6개의 sgRNA를 각각 포함한 유전자 운반체 정보는 하기 표 4에 나타내었다.
벡터 sgRNA 표적 위치 서열 서열번호
Vlk_HMA_A6 gRNA_A1 HMAα Exon 1 TCTTTCTTACCAATTTGTTG 15
gRNA_A2 Intron 1 TGTTTGTACAAGCTTTTAGA 16
gRNA_A3 Intron 1 ATGGTAACTTCAATAATTATA 17
gRNA_A4 Exon 2 AAGCAAGCATAAGAGTGAA 18
gRNA_A5 Exon 2 CCACACCTCTAAAAATAAT 19
gRNA_A6 Intron 2 TCATATAAATTGGGACAAA 20
Vlk_HMA_B6 gRNA_B1 HMAβ Exon 1 CAATTTGTTGCTGAGAAATG 21
gRNA_B2 Intron 1 AGTGGAGAAAAGATGAAGAA 22
gRNA_B3 Intron 1 ATGGTAACTACAATAATTATA 23
gRNA_B4 Exon 2 AAGCAAGTATAAGAGTGAA 24
gRNA_B5 Exon 2 GATTCCTCCAATTATTTTT 25
gRNA_B6 Exon 2 CCACACCCCTAAAAATAAT 26
NtPCSs 및 NtPCSt 유전자에 특이적으로 결합할 수 있는 2개의 sgRNA를 각각 포함한 유전자 운반체 정보는 하기 표 5에 나타내었다.
[표 5]
Figure PCTKR2021011059-appb-I000001
구체적으로, pBI121은 E. coli와 agrobacterium에서 복제 가능한 binary vector이며 식물 형질전환에 널리 쓰이고 있는 벡터로서, pBI121을 HindIII와 EcoRI으로 절단하여 CRISPR/Cas9 시스템에 필요한 GE_block을 클로닝할 수 있도록 준비하였다. GE_block은 차례대로 CaMV 35S promoter with dual enhancer (P_35Sd), Cas9 블록을 클로닝하기 위한 multi cloning site (MCS), CaMV 35S terminator (T_35S), linker sequence, 그리고 sgRNA 블록을 클로닝하기 위한 multi cloning site (MCS)로 구성되어 있으며 양 끝에는 HindIII와 EcoRI의 인식 염기서열이 추가되어 있다. GE_block의 각 블록들은 DNA 합성으로 준비되었으며 순차적으로 클로닝하여 완성하였다. HindIII와 EcoRI으로 절단된 pBI121과 GE_block을 ligation하여 재조합 운반체 (V1k_GE)를 제작하였다. CRISPR/Cas9_block은 Cas9 coding sequence (CDS), C-terminus nuclear localization sequence (NLS)로 구성되고, 양 말단에는 BamHI과 SacI 인식 염기서열이 추가된 블록 (Cas9_block); 및 sgRNA가 발현될 수 있는 블록(sgRNA_PMT)으로서 U6 promoter(P_U6, 서열번호 43)와 sgRNA, 그리고 poly T로 구성된 블록;으로 이루어져 있다. NtPCS 유전자 (NtPCSs 및/또는 NtPCSt 유전자)에 특이적으로 결합할 수 있는 2 종류의 sgRNA 블록을 overlap extension PCR 기법을 통해 하나의 연속된 DNA로 연결하여 sgRNA_PMT를 완성하였다. sgRNA_PMT의 양 끝에는 SalI, SpeI의 인식 염기서열이 존재한다.
도 2에 나타낸 바와 같이, BamHI과 SacI으로 절단된 V1k_GE와 CRISPR/Cas9_block을 ligation 반응을 통해 이어 붙인 후, SalI과 SpeI으로 절단하여 sgRNA_PMT를 삽입하여 유전자 운반체를 제작하였다.
(2) 유전자 전달 미생물 (Agrobacterium) 내 재조합 운반체 도입
동결-해동법 (Freeze-thaw method)으로 식물용 운반체를 아그로박테리움 LBA4404 균주에 형질전환시켰다.
구체적으로, 상기 아그로박테리움 균주를 YEP 액체 배지 (효모 추출물 10 g, Bacto™ peptone 10 g, NacCl 5 g)에 접종한 후, 16시간 동안 28℃, 250 rpm 조건으로 진탕 배양하였다. 배양액을 3,000 g의 속도 및 4℃ 조건으로 20분간 원심분리하여 세포를 분리하고, 20 mM CaCl2에 부유시켜서 수용성 세포 (competent cell)를 만들었다. 수용성 세포 100 μL에 플라스미드 DNA (식물용 운반체) 5 μL를 첨가한 후, 액체 질소에서 5분간, 37℃ 온도에서 5분간 배양하였다. YEP 액체배지 1 mL를 첨가하여 28℃, 250 rpm 조건으로 2시간 동안 진탕 배양하였다. 100 μL 배양액을 카나마이신 100 mg/L가 포함된 YEP 고체배지에 spreading 한 후, 28℃ 온도에서 3일 동안 배양하였다. 단일 콜로니들을 각각 계대배양한 후, 플라스미드 DNA가 형질전환되었는지 PCR을 통해 확인하였다.
(3) 식물 조직배양
(3.1) 식물 형질전환
상기 실시예 1-(2)에서 유전자 운반체의 형질전환이 확인된 아그로박테리움 균주를 YEP 액체 배지 (70 mg/L 카나마이신, 70 mg/L 스트렙토마이신 포함)에서 28℃ 조건에서 24시간 동안 배양하였다. 또한, 발아된지 1달된 식물체의 잎을 70% 에탄올과 락스로 멸균한 후, 3 mm X 3 mm 크기의 절편으로 자르고, MS 액체 배지가 5 ml 담겨 있는 페트리 디쉬에 절편을 올려 놓은 뒤, 아그로박테리움 균주 배양액 1 mL을 골고루 뿌려줌으로써 담배 잎 절편을 준비하였다. 이후 25℃, 암 조건에서 48 시간 동안 배양시켰다.
(3.2) 식물 조직배양
잎 절편을 멸균 증류수(200 ug/ml 세포탁심 (cefotaxim) 포함)에 4 회 세척한 후, shooting 배지(MS 배지, 2 mg/L BA, 0.1 mg/L NAA, 200 mg/L 세포탁심, 100 mg/L 카나마이신 포함)에 치상하여 25℃, 16시간/8시간 광주기 조건에서 배양하며, 2주 마다 새로운 배지로 계대배양함으로써 세척 및 선별 배지 치상을 수행하였다.
또한, 잎 절편에서 분화된 shoot을 절단하여 rooting 배지(MS 배지, 200 mg/L 세포탁심 포함)에 치상하여 25℃, 16시간/8시간 광주기 조건에서 배양함으로써 Rooting 배지 치상을 수행하였다.
그 결과, 도 3에 나타낸 바와 같이, 아그로박테리움 균주가 매개된 형질전환 (Agrobacterium mediated transformation) 방법으로 담배 잎 조직에 형질전환 시킨 후, 캘러스 분화, 잎 분화, 뿌리 분화가 차례로 잘 이루어졌음을 확인하였다. 조직배양을 통해 잎, 줄기, 뿌리를 갖춘 조직배양 소식물체 102 개체를 확보하였다.
(4) 돌연변이체 선별
(4.1) 목표 유전자 내 돌연변이 발생 여부 및 양상 확인
상기 실시예 1-(3)에서 확보된 조직 배양체의 잎 일부를 채취하여 gDNA를 추출한 후, 각 목표 유전자 부위를 PCR 반응을 통해 증폭하였다. 증폭된 유전자 산물에 대해 염기서열을 분석하여 NtHMA 유전자에 돌연변이가 발생한 조직배양체 50개와 NtPCS 유전자에 돌연변이가 일어난 조직배양체 60개를 선별하였다.
구체적으로, 건강한 잎 조직 100 mg을 샘플링하여 균일하게 분쇄한 후, silica column을 이용하는 상용화 키트 (예: Nucleospin 96 plant II, Macherey Nagel, 독일)를 이용하여 gDNA를 추출 및 정제하였다. 돌연변이 여부 및 양상을 확인하기 위하여 조직 배양체 24개체의 gDNA를 대상으로 각 목표 유전자 부위를 증폭하여 전기영동한 결과를 도 4에 나타내었다.
또한, 잎 조직에서 gDNA를 추출/정제한 후, PCR을 통해 목표 유전자 부위를 증폭하여 염기 서열 분석을 수행한 예시를 도 5에 나타내었다. 도 5에 나타낸 바와 같이, 야생형 KB108과 돌연변이체의 NtHMAβ 부위의 염기서열 분석 결과, 야생형 염기서열에 비해 아데닌 염기가 삽입된 돌연변이체임을 확인하였다.
NtHMA 유전자에 돌연변이가 일어난 패턴을 위치별로 분류해본 결과, 하기 표 6에 나타낸 바와 같이, exon 2를 표적으로 제작한 gRNA_HMA_A4 및 gRNA_HMA_B4의 위치에서 돌연변이 발생률이 44% 내지 48%로, NtHMA 유전자의 exon 2 위치에서 돌연변이가 가장 많이 일어나는 것으로 확인하였다.
[표 6]
Figure PCTKR2021011059-appb-I000002
NtPCS 유전자에 돌연변이가 일어난 패턴을 위치별로 분류해본 결과, 하기 표 7에 나타낸 바와 같이, exon 2를 표적으로 제작한 gRNA_PCSs_e2, gRNA_PCSt_e2, 및 gRNA_PCSst_e2의 위치에서 돌연변이 발생률이 45% 내지 70%로, NtPCS 유전자의 exon 2 위치에서 돌연변이가 가장 많이 일어나는 것을 확인하였다.
[표 7]
Figure PCTKR2021011059-appb-I000003
(4.2) F1 세대 종자 확보 및 도입 유전자 제거 식물체 선별
돌연변이가 확인된 NtHMA 유전자 돌연변이체 50 개체 및 NtPCS 유전자 돌연변이체 60 개체를 상토가 담긴 화분으로 이식하여 온실에서 재배하였다. CRISPR/Cas9 발현을 위해 도입된 유전자 블록을 제거하기 위하여 자가 수정을 통해 F1 세대 종자를 확보하였다. F1 세대 종자를 128구 트레이에 파종하여 30일 동안 기른 후, 잎을 채취하여 균일하게 분쇄한 후, silica column을 이용하여 상용화 키트 (예: Nucleospin 96 plant II, Macherey Nagel, 독일)를 이용하여 gDNA를 추출 및 정제하였다. 35S 프로모터와 Cas9 DNA 블록을 특이적으로 증폭하는 프라이머를 이용하여 PCR을 진행하였다. 프라이머의 서열은 하기 표 8에 나타내었다.
프라이머 서열 PCR length Note 서열번호
F_C9 GACCATCCTGGACTTCCTGAAGAGC 420 bp Cas 9 검출 27
R_C9 TGCAGGTAGTACAGGTACAGCTTCTCG 28
F_35S GCTCCTACAAATGCCATCA 195 bp 35S 프로모터 검출 29
R_35S GATAGTGGGATTGTGCGTCA 30
그 결과, 도 6에 나타낸 바와 같이, 535S 프로모터와 Cas9 DNA 블록이 검출되지 않는 식물체를 선별하였다.
(4.3) 최종 선별 식물체의 유전형 정보
최종 선별한 F1 식물(108_PMTm_F1)은 도입 유전자를 포함하지 않으며, NtHMA 유전자 및 NtPCS 유전자들에 각각 동형접합 돌연변이(homozygous mutation)가 일어난 식물이었다. NtHMA 유전자 및 NtPCS 유전자 각각에 돌연변이가 유발된 최종 식물체의 유전형을 하기 표 9에 나타내었다.
표적 돌연변이 위치 돌연변이 양상
A6_02 HMAα Exon 2 GT del
B6_02 HMAβ Exon 2 T ins
AB_01 HMAα Exon 2 GTGA del
HMAβ Intron 1 T del
Exon 2 A ins
Exon 2 T ins
T_05 PCSt Exon 2 T ins
ST_01 PCSs Exon 2 A ins
PCSt Exon 2 A ins
또한, 대조군 식물체 (KB108), 및 NtPCSs 및 NtPCSt 유전자에 돌연변이가 유발된 식물체 (PCSst)의 PCSs 유전자 및 PCst 유전자의 gDNA 염기 서열, CDS 염기서열, 및 아미노산 서열을 하기 표 10에 정리하여 나타내었다.
[표 10]
Figure PCTKR2021011059-appb-I000004
(아미노산 서열 중 *는 stop codon을 의미하며, 아미노산의 서열 중간에 존재하는 stop codon은 핵산 서열에 돌연변이가 존재하여 발생한 early stop codon을 의미하는 것이다.)
참고로, 상기 서열번호 39 및 서열번호 42의 아미노산 서열은 아래와 같다.
서열번호 39 : MAMAGLYRRV LPSPPAVDFA STEGKQLFLE AIQNGNNGRI FQVDLLFSDT V*TGLLWFG* PFHGLECPCY *SRKKMER
서열번호 42 :MAMAGLYRRV LPSPPAVDFA STEGKQLFLE AIQNGNNGRI FQVDLLFSDT V*TGLLWFG* PFYGLECPCY *SRKKMERAL EMV**IYVGL L*ASGEG*S* RDLFWESGMF GSLCRSEGRS FSL*S*YY** LP*TSHGLHY ***LSSDLII S*RPF*ADRF GPLFAYWWLS RGKGYGTDSR CCEV*ISSSL GSPPSPLGSH EHN**SYRIT *GVYANY*AS QSSCTAIYPE L*T*ELGHYL KAFDG*SSCP VKF*ECEGHK RCSLYCSFKS TFKFC*IHKV DSGSSKARGE WSKFE*RGER KASYQGRGIE TSAGHSSL*A CHKHFIFKKF YLPVKSSIRQ QFG*CCRKHL LPRSRSFCRK IWFIG*VLLS PNMC*MLQSY RGQFCYSGVW DSCKWEWGAG G*CSGPYISS KD*LLSLRAS WLLANAPCK* RCADSTIAGI TSTYMVSNKR YEGLAGNREP CLSREPASFA ARRDFAPART VPPPQEMQG* QGRRRFSCTS LL
실시예 2. NtPCS 유전자에 돌연변이가 유발된 담배 식물체의 카드뮴 함량 분석
(1) 양액 재배시설을 이용한 카드뮴 함유량 분석
발아된 식물을 양액 재배 시설로 옮겨심은 후, 80일 동안 재배한 식물체의 꽃대를 자른 뒤, 2주 후에 식물체의 모든 잎을 수확하였고, 수확한 잎을 65℃ 드라이 오븐에서 48 시간 동안 건조시킨 후, 글라스 비드가 담긴 용기에 담아 gyro-shaker를 이용하여 분쇄하였다. 돌연변이 식물체의 확보 시기에 따라 1차 및 2차로 나누어 실험을 진행하였다. GC/MS 분석 기법으로 KB108 (야생형, 대조군)과 돌연변이체의 카드뮴 함량을 정량 분석하였다. 2회의 실험 결과를 대조군 식물체의 카드뮴 흡수량 대비 상대량으로 나타내었다.
그 결과, 도 7 및 하기 표 11에 나타낸 바와 같이, NtHMAα 유전자 또는 NtHMAβ 유전자에 돌연변이가 유발된 식물체는 대조군 대비 잎 내 카드뮴 함량이 25% 또는 2% 감소하였고, NtHMAα 유전자 및 NtHMAβ 유전자 모두에 돌연변이가 유발된 식물체는 대조군 대비 잎 내 카드뮴 함량이 64% 감소하였다. 특히, NtPCSs 유전자 및 NtPCSt 유전자 모두에 돌연변이가 유발된 식물체는 대조군 대비 잎 내 카드뮴 함량을 85% 감소시켜 현저한 카드뮴 저감 효과를 나타내었다. 이는 NtHMAα 유전자 및 NtHMAβ 유전자 모두에 돌연변이가 유발된 식물체에 비해서도 우수한 카드뮴 저감 효과를 나타내는 것이다.
식물체 카드뮴 (상대값)
KB108 (대조군) 1.00
NtHMAα 0.75
NtHMAβ 0.98
NtHMAαβ 0.36
NtPCSt 1.25
NtPCSst 0.15
(2) 온실 환경에서의 카드뮴 함유량 분석
NtPCS 유전자에 돌연변이가 유발된 식물체의 카드뮴 흡수 저감 효과가 토양 환경에서도 유지되는지 확인하기 위하여, 온실 환경에서 카드뮴 흡수 실험을 수행하였다. 구체적으로, 발아된 식물을 온실 환경의 화분으로 옮겨 심은 후, 60일 동안 재배한 식물체의 꽃대를 자른 뒤, 2주 후에 식물체의 모든 잎 (하부 잎, 상부 잎, 또는 전체 잎)을 수확하였고, 수확한 잎을 65℃ 드라이 오븐에서 48 시간 동안 건조시킨 후, 글라스 비드가 담긴 용기에 담아 gyro-shaker를 이용하여 분쇄하였다. GC/MS 분석 기법으로 KB108 (야생형, 대조군)과 돌연변이체의 카드뮴 함량을 정량 분석하였다.
그 결과, 도 8 및 하기 표 12에 나타낸 바와 같이, 카드뮴 처리를 하지 않은 대조군 (KB108_NC)에서는 카드뮴이 거의 확인되지 않은 반면에, 카드뮴 처리를 한 대조군 (KB108_PC)에서는 분석법의 정량 한계 (LOQ) 이상으로 매우 높은 카드뮴 함량이 검출되었다. NtHMAα 유전자 또는 NtHMAβ 유전자에 돌연변이가 유발된 식물체는 대조군 대비 잎 내 카드뮴 함량이 약 26% 감소하였고, NtHMAα 유전자 및 NtHMAβ 유전자 모두에 돌연변이가 유발된 식물체는 대조군 대비 잎 내 카드뮴 함량이 약 77% 감소하였다. 특히, NtPCSs 유전자 및 NtPCSt 유전자 모두에 돌연변이가 유발된 식물체는 대조군 대비 잎 내 카드뮴 함량을 약 87% 감소시켜 현저한 카드뮴 저감 효과를 나타내었다. 이는 NtHMAα 유전자 및 NtHMAβ 유전자 모두에 돌연변이가 유발된 식물체에 비해서도 우수한 카드뮴 저감 효과를 나타내는 것이다.
식물체 하부 잎
카드뮴 함량
(㎍/g)		 상부 잎
카드뮴 함량
(㎍/g)		 전체 잎
카드뮴 함량
(㎍/g)
KB108_NC
(음성 대조군)		 0.08 0.04 0.13
KB108_PC
(양성 대조군)		 2.44 2.13 4.57
NtHMAα 1.05 2.27 3.31
NtHMAβ 1.19 1.48 2.67
NtHMAαβ 0.68 0.48 1.16
NtPCSst 0.23 0.26 0.49
종합하면, NtPCSs 유전자 및 NtPCSt 유전자 모두에 돌연변이가 유발된 식물체의 잎 내 카드뮴 함량이 양액 환경에서는 대조군 대비 86% 감소되고, 토양 환경에서는 대조군 대비 87% 감소되어, 카드뮴 저감 효과가 가장 크게 나타났다.
실시예 3. NtPCS 유전자에 돌연변이가 유발된 담배 식물체의 생육 특성 확인
NtPCS 돌연변이 식물체가 NtHMA 돌연변이 식물체의 한계점인 생육 저해 현상을 해결할 수 있는지 확인하기 위해, NtHMAα 유전자 및/또는 NtHMAβ 유전자에 돌연변이가 유발된 식물체, 및 NtPCSs 유전자 및 NtPCSt 유전자 모두에 돌연변이가 유발된 식물체의 생육 특성을 대조군과 비교하였다. 구체적으로, 각각 식물체의 종류별로 5개 개체의 식물체 높이, 잎의 수, 및 잎의 중량을 측정하여 비교하였다.
그 결과, 도 9 및 하기 표 13에 나타낸 바와 같이, NtHMAα 유전자 및 NtHMAβ 유전자 모두에 돌연변이가 유발된 식물체는 대조군 대비 식물체 높이가 30% 감소하고, 잎의 수는 유의미한 차이는 없었으나 잎의 중량이 16% 감소하였다. 상기 결과로부터 NtHMAα 유전자 및 NtHMAβ 유전자에 돌연변이가 유발된 식물체는 생육 저해가 나타남을 알 수 있다. 이와 달리, NtPCSs 유전자 및 NtPCSt 유전자 모두에 돌연변이가 유발된 식물체는 대조군 대비 식물체 높이는 15% 감소하여 다소 낮아졌으나, 잎의 수 및 잎의 중량에 있어서 유의미한 변화를 나타내지 않아, 생육 저해가 나타나지 않음을 확인하였다.
번호 식물체 높이 (cm) 잎 수 (개) 잎 중량 (g)
1 KB108
(대조군)		 62 12 145.5
2 66 13 149.0
3 63 13 142.0
4 68 13 142.0
5 67 12 129.0
평균 65.2 12.6 141.5
1 NtHMAα
돌연변이체		 45 13 146.0
2 55 13 167.0
3 53 13 154.0
4 52 13 156.0
5 53 13 163.0
평균 51.6 13 157.2
1 NtHMAβ
돌연변이체		 58 12 144.6
2 51 14 169.0
3 57 13 176.0
4 58 14 172.0
5 54 13 160.0
평균 55.6 13.2 164.32
1 NtHMAαβ
돌연변이체		 50 11 108.5
2 50 12 157.5
3 40 14 123.0
4 41 12 107.0
5 47 13 99.0
평균 45.6 12.4 117.0
1 NtPCSst
돌연변이체		 61 13 145.0
2 60 13 158.0
3 57 13 149.0
4 54 13 142.0
5 47 12 138.0
평균 55.8 12.8 146.4
또한, 도 10에 나타낸 바와 같이, NtHMAαβ 돌연변이체는 대조군과 비교하여 육안으로 관찰되는 수준의 생육 저해를 나타낸 반면, NtPCSst 돌연변이체는 대조군과 비교하여 유의미한 생육 상태 차이를 나타내지 않았다.

Claims (12)

  1. 모세포에 비하여 PCS (Phytochelatin synthase) 유전자 또는 상기 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 감소된 식물 세포.
  2. 청구항 1에 있어서, 상기 PCS 유전자는 실베스트리스 꽃담배 (Nicotiana sylvestris)로부터 유래된 PCS 유전자 (NtPCSs), 토멘토시포르미스 꽃담배 (Nicotiana tomentosiformis)로부터 유래된 PCS 유전자 (NtPCSt), 또는 이들의 조합(NtPCSst)인 것인 식물 세포.
  3. 청구항 1에 있어서, RNA 간섭(RNAi; RNA interference) 시스템, 메가뉴클레아제(Meganuclease) 시스템, 징크핑거 뉴클레아제(Zinc finger nuclease) 시스템, 탈렌(TALEN; Transcription Activator-Like Effector Nuclease) 시스템, CRISPR/Cas9 시스템, X-선 조사, 감마선 조사, 에틸 메탄설포네이트(ethyl methanesulfonate) 처리, 다이메틸 설페이트(dimethyl sulfate) 처리로 이루어진 군으로부터 선택되는 적어도 하나에 의해 유전적으로 조작된 것인 식물 세포.
  4. 청구항 1에 있어서, 상기 식물은 재배담배 (Nicotiana tabacum)인 것인 식물 세포.
  5. 청구항 1 내지 4 중 어느 한 항의 식물 세포를 포함하는 중금속 흡수량이 저감된 식물.
  6. 식물체의 모세포에 비하여 PCS 유전자 또는 상기 PCS 유전자에 의해 코딩되는 단백질의 발현 또는 활성을 감소시키는 단계를 포함하는 식물체 내 중금속을 감소시키는 방법.
  7. 청구항 6에 있어서, 상기 PCS 유전자 또는 PC 유전자에 의해 코딩되는 단백질의 발현 또는 활성을 감소시키는 단계에서 RNA 간섭(RNAi; RNA interference) 시스템, 메가뉴클레아제(Meganuclease) 시스템, 징크핑거 뉴클레아제(Zinc finger nuclease) 시스템, 탈렌(TALEN; Transcription Activator-Like Effector Nuclease) 시스템, CRISPR/Cas9 시스템, X-선 조사, 감마선 조사, 에틸 메탄설포네이트(ethyl methanesulfonate) 처리, 다이메틸 설페이트(dimethyl sulfate) 처리로 이루어진 군으로부터 선택되는 적어도 하나를 수행하는 것인 방법.
  8. 청구항 6에 있어서, 상기 중금속은 카드뮴, 비소, 안티몬, 납, 수은, 크롬, 주석, 아연, 바륨, 비스무트, 니켈, 코발트, 망간, 철, 구리 및 바나듐으로 이루어진 군으로부터 선택된 하나 이상인 것인 방법.
  9. PCS 유전자를 표적으로 하는 단일 가이드 RNA를 포함하는 크리스퍼-카스9 (CRISPR-Cas9) 재조합 벡터.
  10. 청구항 9에 있어서, 상기 PCS 유전자는 실베스트리스 꽃담배 (Nicotiana sylvestris)로부터 유래된 PCS 유전자 (NtPCSs), 또는 토멘토시포르미스 꽃담배 (Nicotiana tomentosiformis)로부터 유래된 PCS 유전자 (NtPCSt)인 것인 재조합 벡터.
  11. 청구항 10에 있어서, 상기 NtPCSs 유전자를 표적으로 하는 sgRNA는 서열번호 1 또는 서열번호 2의 염기서열로 이루어진 것이고, NtPCSt 유전자를 표적으로 하는 sgRNA는 서열번호 3 또는 서열번호 4의 염기서열로 이루어진 것이고, 상기 NtPCSs 유전자 및 NtPCSt 유전자를 표적으로 하는 sgRNA는 서열번호 5 또는 서열번호 6의 염기서열로 이루어진 것인 재조합 벡터.
  12. 청구항 9 내지 11 중 어느 한 항의 재조합 벡터로 식물 세포를 형질전환시키는 단계를 포함하는 중금속 흡수량이 저감된 식물체를 제조하는 방법.
PCT/KR2021/011059 2020-09-08 2021-08-19 중금속 저감된 형질전환 식물체 및 이의 제조방법 WO2022055144A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/642,050 US20240052360A1 (en) 2020-09-08 2021-08-19 Transgenic plant with reduced heavy metals and methods for preparation thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200114891A KR102522125B1 (ko) 2020-09-08 2020-09-08 중금속 저감된 식물체 및 이의 제조방법
KR10-2020-0114891 2020-09-08

Publications (1)

Publication Number Publication Date
WO2022055144A1 true WO2022055144A1 (ko) 2022-03-17

Family

ID=80630364

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/011059 WO2022055144A1 (ko) 2020-09-08 2021-08-19 중금속 저감된 형질전환 식물체 및 이의 제조방법

Country Status (3)

Country Link
US (1) US20240052360A1 (ko)
KR (1) KR102522125B1 (ko)
WO (1) WO2022055144A1 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10370675B2 (en) * 2016-05-24 2019-08-06 The Trustees Of The University Of Pennsylvania Transgenic plants exhibiting enhanced phytochelatin-based heavy metal tolerance and methods of use thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10370675B2 (en) * 2016-05-24 2019-08-06 The Trustees Of The University Of Pennsylvania Transgenic plants exhibiting enhanced phytochelatin-based heavy metal tolerance and methods of use thereof

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CLEMENS, S.: "Toxic metal accumulation, responses to exposure and mechanisms of tolerance in plants", BIOCHIMIE, MASSON, PARIS, FR, vol. 88, no. 11, 1 November 2006 (2006-11-01), FR , pages 1707 - 1719, XP027919521, ISSN: 0300-9084 *
KAERENLAMPI S , ET AL: "Genetic engineering in the improvement of plants for phytoremediation of metal polluted soils", ENVIRONMENTAL POLLUTION, BARKING, GB, vol. 107, no. 2, 1 January 2000 (2000-01-01), GB , pages 225 - 231, XP002287818, ISSN: 0269-7491, DOI: 10.1016/S0269-7491(99)00141-4 *
LARSSON E HELENE, HAKAN ASP, BORNMAN JANET F: "Influence of prior Cd 2q exposure on the uptake of Cd 2q and other elements in the phytochelatin-deficient mutant, cad1-3, of Arabidopsis thaliana", JOURNAL OF EXPERIMENTAL BOTANY, vol. 53, no. 368, 1 March 2002 (2002-03-01), pages 447 - 453, XP055911016, DOI: 10.1093/jexbot/53.368.447 *
RAI PRABHAT KUMAR; KIM KI-HYUN; LEE SANG SOO; LEE JIN-HONG: "Molecular mechanisms in phytoremediation of environmental contaminants and prospects of engineered transgenic plants/microbes", SCIENCE OF THE TOTAL ENVIRONMENT, ELSEVIER, AMSTERDAM, NL, vol. 705, 6 December 2019 (2019-12-06), AMSTERDAM, NL , XP085994701, ISSN: 0048-9697, DOI: 10.1016/j.scitotenv.2019.135858 *
SEO, H.S: "Mutations of phytochelatin synthase (PCS) genes by CRISPR/Cas9 reduce accumulation of cadmium in tobacco leaves", 13 October 2019 (2019-10-13), pages 1, XP009535738, Retrieved from the Internet <URL:https://www.coresta.org/abstracts/mutations-phytochelatin-synthase-pcs-genes-crisprcas9-reduce-accumulation-cadmium-tobacco> *

Also Published As

Publication number Publication date
KR20220032937A (ko) 2022-03-15
KR102522125B1 (ko) 2023-04-14
US20240052360A1 (en) 2024-02-15

Similar Documents

Publication Publication Date Title
Ren et al. Optimizing the CRISPR/Cas9 system for genome editing in grape by using grape promoters
Ntui et al. Robust CRISPR/Cas9 mediated genome editing tool for banana and plantain (Musa spp.)
WO2020007331A1 (zh) 一种利用CRISPR/Cas9系统对紫花苜蓿基因定点突变的方法
KR20170041641A (ko) 식물 원형질체로부터 식물체를 제조하는 방법
Wang et al. Efficient CRISPR/Cas9-mediated gene editing in an interspecific hybrid poplar with a highly heterozygous genome
Ding et al. Effective reduction in chimeric mutants of poplar trees produced by CRISPR/Cas9 through a second round of shoot regeneration
AU2018275356A1 (en) Compositions and methods for increasing shelf-life of banana
Odahara et al. Suppression of repeat-mediated gross mitochondrial genome rearrangements by RecA in the moss Physcomitrella patens
Bottero et al. Efficient CRISPR/Cas9 genome editing in alfalfa using a public germplasm
WO2019235907A1 (ko) Crispr/cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용
Wang et al. Positive–Negative selection for homologous recombination in Arabidopsis
WO2022055144A1 (ko) 중금속 저감된 형질전환 식물체 및 이의 제조방법
KR102516522B1 (ko) 반수체 식물을 유도하는 pPLAⅡη 유전자 및 이의 용도
WO2022270788A1 (ko) Qpt 유전자가 조작된 식물 세포 및 이의 이용 방법
May et al. Multi-allelic gene editing in an apomictic, tetraploid turf and forage grass (Paspalum notatum Flüggé) using CRISPR/Cas9
WO2020243361A1 (en) Methods and compositions for generating dominant short stature alleles using genome editing
KR102247646B1 (ko) 현사시나무의 유전체 교정 방법
KR102247547B1 (ko) CRISPR/Cas9 시스템 기반 현사시나무 유전체 교정용 조성물 및 이의 이용
WO2023003177A1 (ko) 유전자 교정을 이용한 병 저항성이 조절된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체
CN117286181B (zh) 一种CRISPR/Cas9介导的四倍体广藿香高效靶向诱变的基因编辑系统
CN114657193B (zh) 一种提高博落回中血根碱含量的方法及应用
WO2022139463A1 (ko) 토마토 열매의 아스코르브산 함량을 조절하는 토마토 유래 apx4 유전자 및 이의 용도
KR102629157B1 (ko) Potato Virus X 벡터를 이용한 토마토 식물체의 유전자 교정용 재조합 벡터 및 이의 용도
US20220195450A1 (en) Methods and compositions for generating dominant short stature alleles using genome editing
WO2023140722A1 (ko) 7-디하이드로콜레스테롤이 고농도로 함유된 토마토 및 이의 제조 방법

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 17642050

Country of ref document: US

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21867010

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21867010

Country of ref document: EP

Kind code of ref document: A1