WO2023003177A1 - 유전자 교정을 이용한 병 저항성이 조절된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체 - Google Patents

유전자 교정을 이용한 병 저항성이 조절된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체 Download PDF

Info

Publication number
WO2023003177A1
WO2023003177A1 PCT/KR2022/008352 KR2022008352W WO2023003177A1 WO 2023003177 A1 WO2023003177 A1 WO 2023003177A1 KR 2022008352 W KR2022008352 W KR 2022008352W WO 2023003177 A1 WO2023003177 A1 WO 2023003177A1
Authority
WO
WIPO (PCT)
Prior art keywords
tomato
slsrfr1
gene
genome
plant
Prior art date
Application number
PCT/KR2022/008352
Other languages
English (en)
French (fr)
Inventor
김상희
손건희
김재연
Original Assignee
경상국립대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경상국립대학교산학협력단 filed Critical 경상국립대학교산학협력단
Publication of WO2023003177A1 publication Critical patent/WO2023003177A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/12—Processes for modifying agronomic input traits, e.g. crop yield
    • A01H1/122—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • A01H1/1245—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, e.g. pathogen, pest or disease resistance
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/06—Processes for producing mutations, e.g. treatment with chemicals or with radiation
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/10—Seeds
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/82—Solanaceae, e.g. pepper, tobacco, potato, tomato or eggplant
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/82—Solanaceae, e.g. pepper, tobacco, potato, tomato or eggplant
    • A01H6/825—Solanum lycopersicum [tomato]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance

Definitions

  • the present invention relates to a method for preparing a tomato plant with controlled disease resistance using gene editing and a tomato plant produced by the method.
  • the Arabidopsis SRFR1 ( SUPPRESSOR OF rps4-RLD 1 ) gene was discovered through suppressor screening using wild-type RLD Arabidopsis thaliana, which has a missense mutation in the RPS4 ( Ribosomal protein S4 ) gene.
  • the mutation of SRFR1 in Arabidopsis thaliana Pseudomonas syringae pv .
  • tomato ( Pto ) DC3000 Pseudomonas syringae pv. tomato ( Pto ) DC3000
  • resistance was increased when the corresponding R genes, RPS4 and RPS6 , were mutated, respectively.
  • SRFR1 Since the recessive srfr1 mutant showed similar susceptibility to Pto DC3000 as wild-type RLD, SRFR1 was identified as a negative regulator in ETI. SRFR1 functions as an adapter protein that forms a complex with proteins such as the immune regulator EDS1 (Enhanced disease susceptibility 1) and the TNL-type resistance proteins RPS4, RPS6, and SNC1 (suppressor of npr1-1, constitutive 1). SRFR1 has a TPR (tetratricopeptide repeat) domain similar in nucleotide sequence to Saccharomyces cerevisiae Ssn6 protein, known as a transcriptional repressor regulator.
  • EDS1 Enhanced disease susceptibility 1
  • RPS4, RPS6, and SNC1 uppressor of npr1-1, constitutive .
  • SRFR1 has a TPR (tetratricopeptide repeat) domain similar in nucleotide sequence to Saccharomyces cerevisiae
  • SRFR1 protein interacts with immune chaperone SGT1b (Suppressor of G2 allele of SKP1 homolog B) and TCP family transcription factors. These results support the role of the SRFR1 protein as an adapter protein that negatively regulates the ETI-related transcriptional immune response.
  • the CRISPR/Cas9 system has a very high target specificity and can recognize methylated DNA as a target, so it can be applied to a wide variety of genes, and it is passed on to offspring according to Mendel's genetic law, enabling generational fixation of traits.
  • sgRNA single guide RNA
  • Korean Patent Registration No. 2264215 discloses 'a method for producing tomato plants with increased ascorbic acid content using gene editing and tomato plants produced by the method'
  • Korean Patent Publication No. 2019-0043841 discloses 'Method for reducing ethylene production by LeMADS-RIN gene editing using CRISPR/Cas9 system in plants' is disclosed, but method for producing tomato plants with controlled disease resistance using gene editing of the present invention and the above method There is nothing described about tomato plants prepared by.
  • the present invention was derived from the above needs, and the present inventors prepared a tomato SRFR1 mutant ( slsrfr1 ) using sgRNA and CRISPR / Cas9 targeting two regions of tomato SRFR1 genomic DNA, and the mutant It was confirmed that the expression of a pathogen-related (PR) gene involved in salicylic acid signaling was increased, and it was confirmed that the mutant had increased resistance to Pto DC3000 compared to unmodified tomato plants. However, the necrotrophic fungus Fusarium oxysporum f. sp. It was confirmed that resistance to Lycopersici ( Fusarium oxysporum f. sp. lycopersici ) was reduced compared to unmodified tomato plants. Through this, by confirming that SRFR1 is involved in regulating resistance to parasitic trophic (biotrophic) pathogens and parasitic pathogens in tomato plants, the present invention was completed.
  • PR pathogen-related
  • the present invention is tomato-derived SRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1 ) DNA encoding a guide RNA specific to the target sequence of the gene and an endonuclease recombinant vectors containing nucleic acid sequences encoding proteins; Or a complex of guide RNA and endonuclease protein specific for the target sequence of the SlSRFR1 gene (ribonucleoprotein); to provide a genome editing composition for regulating disease resistance of tomato plants, containing as an active ingredient.
  • SRFR1 Solanum lycopersicum SUPPRESSOR OF rps4-RLD1
  • SlSRFR1 Solanum lycopersicum SUPPRESSOR OF rps4-RLD1
  • SlSRFR1 Solanum lycopersicum SUPPRESSOR OF rps4-RLD1
  • SlSRFR1 Solanum lycopersi
  • the present invention (a) tomato-derived SRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1 ) Guide RNA and endonuclease protein specific to the target sequence of the gene are introduced into tomato plant cells to correct the genome ; and (b) regenerating tomato plants from the genome-corrected tomato plant cells.
  • tomato-derived SRFR1 Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1
  • Guide RNA and endonuclease protein specific to the target sequence of the gene are introduced into tomato plant cells to correct the genome ; and (b) regenerating tomato plants from the genome-corrected tomato plant cells.
  • the present invention provides a genome-corrected tomato plant with controlled disease resistance prepared by the above method and a genome-corrected seed thereof.
  • Mutation induction through SlSRFR1 gene editing presented in the present invention can be usefully used to develop tomato plants with controlled disease resistance.
  • the method according to the present invention induces mutations that are indistinguishable from natural mutations, cost and time are saved, unlike GMO (Genetically Modified Organism) crops, which require enormous costs and time to evaluate safety and environmental hazards. Expect to be able to do it.
  • Figure 1a shows the genomic structure and gRNA target location (Target 1, 2) of tomato SRFR1
  • Figure 1b is the target sequence of gRNA
  • Figure 1c is a T-DNA schematic diagram of the pSlSRFR-GE construct
  • Figure 1d is As a result of CAPS analysis of SlSRFR1 sgRNA1- and sgRNA2 -induced G1 mutants, white arrows indicate homozygous mutants.
  • Figure 2 is the result of analyzing the target site in the tomato G0 plant. Vertical dotted lines indicate the site of cleavage by SpCas9 for each sgRNA.
  • 3 is a result of analyzing the genome editing pattern of the target site in tomato G1 plants.
  • Figure 5 is a parasitic trophic (biotrophic) pathogen of the G1 generation slsrfr1 plants Pseudomonas syringae pv.
  • tomato DC3000 Pseudomonas syringae pv. tomato DC3000
  • (a) is a photograph showing the disease on the leaves 5 days after inoculation
  • (b) is the result of measuring the number of bacteria. *; P ⁇ 0.01 .
  • the present invention is tomato-derived SRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1 ) DNA encoding a guide RNA specific to the target sequence of the gene and an endonuclease ( endonuclease) recombinant vectors containing nucleic acid sequences encoding proteins; Or a complex of guide RNA and endonuclease protein specific for the target sequence of the SlSRFR1 gene (ribonucleoprotein); to provide a genome editing composition for regulating disease resistance of tomato plants, containing as an active ingredient.
  • SRFR1 Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1
  • DNA DNA encoding a guide RNA specific to the target sequence of the gene and an endonuclease ( endonuclease) recombinant vectors containing nucleic acid sequences encoding proteins; Or
  • the plant disease may be a plant disease caused by a biotrophic pathogen or a plant disease caused by a necrotrophic pathogen
  • the biotrophic pathogen is preferably The Pseudomonas cold dog pv. Tomato ( Pto ) DC3000 ( Pseudomonas syringae pv. tomato ( Pto ) DC3000)
  • the necrotrophic pathogen is preferably Fusarium oxysporum f. sp. It may be Lycopersici ( Fusarium oxysporum f. sp. lycopersici ), but is not limited thereto.
  • the term "genome/gene editing” refers to a technology capable of introducing target-directed mutations into genomic sequences of animal and plant cells, including human cells, and includes one or more nucleic acid molecules by cutting DNA. Knock-out or knock-in of a specific gene by deletion, insertion, substitution, etc., or non-coding that does not produce a protein Coding refers to a technology that can introduce mutations into DNA sequences.
  • the genome editing may be to introduce mutations into plants using an endonuclease, such as Cas9 (CRISPR associated protein 9) protein and guide RNA.
  • 'gene editing' may be used interchangeably with 'gene editing'.
  • target gene refers to some DNA in the genome of a plant to be corrected through the present invention, and is not limited to the type of gene, and may include both a coding region and a non-coding region. A person skilled in the art can select the target gene according to the desired mutation for the genome editing plant to be produced, depending on the purpose.
  • the tomato-derived SlSRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1 ) gene encodes the SlSRFR1 protein consisting of the amino acid sequence of SEQ ID NO: 3, preferably the genomic DNA of SlSRFR1 is It may be the nucleotide sequence represented by SEQ ID NO: 1, and the cDNA of SlSRFR1 may be the nucleotide sequence represented by SEQ ID NO: 2.
  • guide RNA refers to a short single-stranded RNA, which is specific for a target DNA among base sequences encoding a target gene, and binds to the target DNA base sequence in whole or in part complementarily. It means ribonucleic acid that serves to guide the endonuclease protein to the target DNA base sequence.
  • the guide RNA is a dual RNA comprising two RNAs, that is, crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; or a single chain comprising a first region comprising a sequence complementary in whole or in part to a base sequence in a target gene and a second region comprising a sequence interacting with an endonuclease (particularly, an RNA-guided nuclease).
  • CRISPR RNA CRISPR RNA
  • tracrRNA trans-activating crRNA
  • RNA single guide RNA, sgRNA
  • sgRNA single guide RNA
  • the endonuclease can be active in the target sequence, it can be included in the scope of the present invention without limitation, and the type of endonuclease used together or endo It can be prepared and used according to known techniques in the art in consideration of the microorganism derived from the nuclease.
  • the guide RNA may be a guide RNA transcribed from a plasmid template, transcribed in vitro (eg, oligonucleotide duplex), or synthesized guide RNA, but is not limited thereto.
  • the target nucleotide sequence of the SlSRFR1 gene may be the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5, more preferably the nucleotide sequence of SEQ ID NO: 4 However, it is not limited thereto.
  • the endonuclease protein is Cas9, Cpf1 (also known as Cas12a), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) or a functional analogue thereof It may be one or more selected from the group consisting of, preferably an RNA-guided nuclease such as Cas9 or Cpf1, more preferably a Cas9 protein, but is not limited thereto.
  • the Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes , a Cas9 protein derived from Campylobacter jejuni , a Cas9 protein derived from Streptococcus thermophilus ( S. thermophilus ) or Streptococcus aureus ( S. aureus ) derived Cas9 protein, Neisseria meningitidis ( Neisseria meningitidis ) derived Cas9 protein, Pasteurella multocida ( Pasteurella multocida ) derived Cas9 protein, Francisella novicida ( Francisella novicida ) derived Cas9 protein, etc.
  • Cas9 protein or genetic information thereof can be obtained from known databases such as GenBank of National Center for Biotechnology Information (NCBI).
  • NCBI National Center for Biotechnology Information
  • a known sequence may be used as it is or a sequence optimized for the codon of a target (organism) to be transduced may be used, but is not limited thereto.
  • the Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double stranded DNA breaks.
  • a short sequence consisting of three bases known as PAM (Protospacer Adjacent Motif) must be present next to the target sequence, and the Cas9 protein has a PAM sequence (NGG) It is cut by estimating between the 3rd and 4th base pairs from .
  • the guide RNA and the endonuclease protein form a ribonucleoprotein complex to operate as RNA-Guided Engineered Nuclease (RGEN).
  • RGEN RNA-Guided Engineered Nuclease
  • the CRISPR/Cas9 system used introduces a double helix break at a specific position of a specific gene to be corrected to insert-deletion (insertion-deletion) caused by incomplete repair induced in the DNA repair process.
  • InDel It is a gene editing method by NHEJ (non-homologous end joining) mechanism that induces mutations.
  • the present invention also relates to the present invention.
  • Tomato-derived SRFR1 Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1
  • Guide RNA specific to the target sequence of the gene and endonuclease protein are introduced into tomato plant cells to correct the genome doing;
  • introducing the guide RNA and endonuclease protein of step (a) into tomato plant cells is DNA encoding the guide RNA specific to the target sequence of the SlSRFR1 gene and endonuclease protein.
  • a recombinant vector comprising a nucleic acid sequence encoding a nuclease protein; Or a complex of a guide RNA specific to the target sequence of the SlSRFR1 gene and an endonuclease protein (ribonucleoprotein); may be used, but is not limited thereto.
  • the target nucleotide sequence of the SlSRFR1 gene may be composed of the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5, more preferably the nucleotide sequence of SEQ ID NO: 4 It may, but is not limited thereto.
  • a recombinant vector containing DNA encoding a guide RNA specific to the target sequence and a nucleic acid sequence encoding an endonuclease protein into plant cells refers to a transformation method. Transformation of plant species is now common for plant species including both dicotyledonous as well as monocotyledonous plants. In principle, any transformation method can be used to introduce the recombinant vectors according to the invention into suitable progenitor cells.
  • the recombinant vector when transformed into a plant cell, it binds to an endonuclease protein having DNA binding and cutting activity and the endonuclease protein, and converts the endoplasmic recombinant vector into a target sequence.
  • the sgRNA leading to the nuclease protein is also expressed.
  • the method for transducing the complex of the guide RNA and the endonuclease protein into plant cells is the calcium/polyethylene glycol method for protoplasts (Negrutiu et al., 1987, Plant Mol. Biol. 8:363-373), electroporation of protoplasts, microinjection into plant elements (Crossway et al., 1986, Mol. Gen. Genet. 202:179-185), various plant elements (DNA or RNA).
  • -coated) particle bombardment method Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) It can be suitably selected from infection by bacteria in (incomplete) mediated gene transfer, and the like.
  • the term "recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a protein encoded by a heterologous peptide or a heterologous nucleic acid.
  • Recombinant cells can express genes or gene segments not found in the cell's native form, either in sense or antisense form.
  • a recombinant cell may also express a gene found in the cell in its natural state, but the gene has been reintroduced into the cell by artificial means as a modified one.
  • vector is used to refer to DNA fragment(s) or nucleic acid molecules that are delivered into cells. Vectors replicate DNA and can reproduce independently in host cells.
  • delivery vehicle is often used interchangeably with “vector”.
  • expression vector refers to a recombinant DNA molecule comprising a coding sequence of interest and appropriate nucleic acid sequences necessary to express the operably linked coding sequence in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.
  • the "plant cell” into which the target sequence-specific guide RNA and endonuclease protein are introduced can be any plant cell.
  • a plant cell is a cultured cell, cultured tissue, cultured organ or whole plant.
  • Plant tissue refers to differentiated or undifferentiated plant tissue, including, but not limited to, roots, stems, leaves, pollen, microspores, ovules, seeds, and various types of cells used in culture, i.e., single cells, Includes protoplast, shoot and callus tissues. Plant tissue may be in planta or may be in organ culture, tissue culture or cell culture.
  • any method known in the art may be used as a method for regenerating genome-corrected plants from genome-corrected plant cells.
  • the genome-corrected plant cell must regenerate into a whole plant.
  • Techniques for regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species.
  • the present invention also provides a genome-corrected tomato plant with controlled disease resistance prepared by the above method and a genome-corrected seed thereof.
  • the genome-corrected tomato plant with disease resistance control is one in which the SlSRFR1 ( Solanum lycopersicum SUPPRESSOR OF rps4-RLD1 ) gene is corrected using the CRISPR/Cas9 system, and the tomato-derived SlSRFR1 gene is knocked out and the genome is corrected It is a genome-edited tomato plant with disease resistance regulated compared to untreated tomato plants.
  • the genome corrected tomato plant is characterized by increased resistance to plant diseases caused by biotrophic pathogens and reduced resistance to plant diseases caused by necrotrophic pathogens compared to the wild type.
  • the target site of the SpCas9-gRNA complex was investigated at the N-terminal region of SlSRFR1 using the CRIPSR -P v2.0 program (http://crispr.hzau.edu.cn/CRISPR2/).
  • two gRNAs were selected considering the on-score, which is a numerical value that can cause genome editing, the secondary structure of gRNA, the GC nucleotide content of the target site, and the off-target sequence.
  • the two gRNAs were linked with the Arabidopsis U6 promoter (originated from Addgene #46968), scafford RNA and poly T through primer dimerization, and the entire gRNA was Level 1 plasmid through the Golden Gate cloning system.
  • Each gRNA module created was cloned into pAGM4723 using the Golden Gate cloning system along with a plant selectable marker (Addgene #51144), SpCas9 (Addgene #49771), and a linker (Addgene #48019) to prepare a construct.
  • the site was named pSlSRFR1-GE.
  • Tomato transformation and plant selection were performed with reference to previous studies (Plant Cell Rep. 2021 Jun; 40(6):999-1011).
  • Tomato cultivar M82 Solanum lycopersicum cv. M82
  • the pSlSRFR1-GE plasmid was transformed into Agrobacterium tumefaciens GV3101 (MP90) by electroporation.
  • Agrobacterium having pSlSRF1-GE cultured at 28 ° C for 18 hours was transferred to 30 ml of LB medium (including 50 mg L -1 kanamycin and 10 mg L -1 gentamicin), and the OD 600 value was about 0.8 to 1 cultured until The Agrobacterium was centrifuged at 3,000 rpm for 15 minutes and the pellet was washed in 30 ml of ABM-MS [1.106 g K 2 HPO 4 , 0.565 g KH 2 ] containing 200 ⁇ M acetosyringone (#D134406, Sigma, USA).
  • Tomatoes were transformed by incubating the suspension for one hour at 28° C. and co-incubating tomato cotyledon explants with Agrobacterium for 20 minutes. Tomato cotyledon explants were transferred to ABM-MS containing 200 ⁇ M acetosyringone and cultured for 2 days at 25° C. in the dark.
  • Agrobacterium attached to the explants was washed by stirring in 500 mg ⁇ L -1 timementin solution for 2 minutes. The water remaining on the explants was completely removed using Whatman paper, and the selective medium [SEL4-70; 4.4g MS salts + B5, 30g maltose, 0.05mg IAA, 0.976g MES, 0.5mg zeatin ribose trans-isomer, 70mg kanamycin, 300mg timentin, 1mM putrescine (pH 5.7), 8g agar for 1L] to induce callus Callus was transferred to a new selection medium (SEL4-70) every 2 weeks until complete stems appeared.
  • the explants from which the stems emerged are rooted induction medium [RIM; 2.2g MS salts + B5, 20g sucrose, 0.1mg NAA, 0.3mg IBA, 300mg Timentin (pH 5.7), 8g agar for 1L] and cultured until roots were induced. Healthy plants are grown at 25°C, 16 hours light/8 hours dark conditions.
  • Genomic DNA isolation was performed by referring to Pater et al. (Plant Biotechnol J. 2009 Oct; 7(8):821-835). Using a cork borer No. 5, two leaf pieces from G0 and G1 generation tomato plants were put into a tube, frozen in liquid nitrogen, and ground using beads in a mixer mill (#MM301, Retsch, Germany) for 1 minute. . 300 ⁇ l of 2X CTAB extraction buffer (0.1M Tris, 2% CTAB, 1.4M NaCl, and 20mM EDTA) was added to the powder and reacted at 65° C. for 20 minutes. 300 ⁇ l of chloroform was additionally added to the tube, mixed vigorously, and centrifuged at 14,000 rpm for 5 minutes.
  • 2X CTAB extraction buffer 0.1M Tris, 2% CTAB, 1.4M NaCl, and 20mM EDTA
  • the SlSRFR1 target region was amplified by PCR in G0 or G1 generation tomatoes and sequencing was performed.
  • the above results were confirmed by ICE (Inference of CRISPR Edits, https://ice.synthego.com/#/) analysis to see how many Indel mutations occurred in G0 or G1 generation tomatoes.
  • ICE Inference of CRISPR Edits, https://ice.synthego.com/#/
  • Miseq sequencing was performed and analyzed with the Cas-Analyzer program (http://www.rgenome.net/).
  • a 945 bp PCR fragment was amplified using the SlSRFR1-F1/SlSRFR1-R2 primer set, and primers (MiSeq-1-F2/MiSeq-1-R2 and MiSeq-1-R2 and MiSeq-2-F2/MiSeq-2-R2) were used to amplify DNA fragments of 155bp and 150bp in size through secondary PCR.
  • the tertiary PCR fragment was amplified using dual index adapter (a combination of D501-D508 and D701-D712) primers provided by the MiSeq sequencing service (MiniSeqTM System, Illumina, USA), and the degree of indel mutation was analyzed by Miseq sequencing.
  • Pseudomonas cold dog pv. Pathogenesis analysis by tomato DC3000 was performed according to a previous study (Scalschi, L. et al ., PLoS One 2014, 9:e106429).
  • Pto DC3000 containing the pVSP61 empty vector grown in Pseudomonas medium was diluted to 2x10 8 CFU/ml, and the third or fourth leaf of a 6-week-old tomato plant was treated with the diluted solution for 30 seconds and maintained at high humidity. To do this, it was wrapped in a plastic bag and maintained for 5 days.
  • Fusarium oxysporum f. sp. Pathogenesis analysis by Fusarium oxysporum f. sp. lycopersici (hereinafter referred to as FOL) was performed according to a previous study (Kostov, K. et al ., Biotechnol. Biotechnol. Equip. 2009, 23:1121-1125). . After culturing FOL in potato dextrose (#254920, BD Difco, USA) in the dark at 30 ° C, it was grown for 5 days at 25 ° C for 16 hours light / 8 hours in the dark and used for the experiment. Using Corkborder No. 1, a fungus grown in the medium was made into a plug and placed on 6-week-old tomato leaves, and left at 25 ° C. for 3-8 days under 16-hour light / 8-hour dark conditions.
  • FOL Fusarium oxysporum f. sp. Pathogenesis analysis by Fusarium oxysporum
  • the dyed leaves were soaked in 99% ethanol for one day to remove the pigment.
  • the degree of development of fungal hyphae was visualized using a fluorescence microscope.
  • Protein immunoblot analysis was performed using ⁇ -PR1 antibody (1:10,000 dilution, #AS10 687, Agrisera, SWEDEN) or ⁇ -Actin antibody (1:10,000 dilution, #AS13 2640, Agrisera), and Clarity Western ECL Substrate (#1705061, Bio-Rad, USA) and SuperSignalTM West Femto Maximum Sensitivity Substrate (#34094, Thermo Scientific, USA).
  • SRFR1 is a single-copy gene in Arabidopsis thaliana, and Arabidopsis SRFR1 is mainly composed of 11 TPR (tetratricopeptide repeat) domains involved in protein-protein interactions.
  • the Blast algorithm was used to annotate the tomato proteome, and Solyc02g09280 (SlSRFR1) with 65% similarity to Arabidopsis SRFR1 was identified.
  • SlSRFR1 encodes a protein consisting of 1,055 amino acids, with two TPR domains located at the N-terminus and nine TPR domains located at the center.
  • sgRNA was designed based on standard conditions, and the 5' end of the open reading frame (ORF) of SlSRFR1 was selected as a site for correction (Table 2).
  • gRNA target site for SlSRFR1 correction Name gRNAs Target position on genome Number of off-targets ( ⁇ 4MMs) sgRNA1 GTAACTTTCGACGCCATCG (SEQ ID NO: 4) 5'UTR and CDS One sgRNA2 ATTGACTATAGCAAAACGCT (SEQ ID NO: 5) CDS 3
  • a 1 bp or 11 bp deletion of the TPR domain resulted in a premature stop codon.
  • mutations in slsrfr1-2 and slsrfr1-4 were identified in the initiation codon.
  • Sanger sequencing analysis of the purified PCR amplicons revealed that off-target sites were not identified in all subjects.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Chemical & Material Sciences (AREA)
  • Environmental Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physiology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

본 발명은 유전자 교정을 이용한 병 저항성이 조절된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체에 관한 것으로, 보다 상세하게는 토마토 유래 식물면역조절인자 SRFR1 (SUPPRESSOR OF rps4-RLD1) 유전자를 CRISPR/Cas 시스템을 이용하여 교정한 기생영양(biotrophic) 및/또는 사물기생성 병원균에 대한 저항성이 조절된 토마토 식물체에 관한 것이다.

Description

유전자 교정을 이용한 병 저항성이 조절된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체
본 발명은 유전자 교정을 이용한 병 저항성이 조절된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체에 관한 것이다.
본 결과물은 농촌진흥청의 "바이오그린연계농생명혁신기술개발(PJ01575601)" 사업 및 "차세대농작물신육종기술개발(PJ01653202)" 사업의 지원을 받아 연구되었습니다.
애기장대 SRFR1 (SUPPRESSOR OF rps4-RLD 1) 유전자는 RPS4 (Ribosomal protein S4) 유전자에 과오 돌연변이(missense mutation)를 가지고 있는 야생형 RLD 애기장대를 이용한 억제제 스크리닝(suppressor screening)을 통해서 발견되었다. 애기장대에서 SRFR1의 돌연변이는 이펙터인 avrRPS4 또는 hopA1을 발현하는 슈도모나스 시린개 pv. 토마토 (Pto) DC3000 (Pseudomonas syringae pv. tomato (Pto) DC3000)에 대해, 각각 상응되는 R 유전자인 RPS4 및 RPS6가 돌연변이되었을 때 저항성을 증가시켰다. 열성 형질의 srfr1 돌연변이체는 야생형 RLD처럼 Pto DC3000에 유사한 감수성을 보이므로 SRFR1은 ETI에서 음성조절자로 확인되었다. SRFR1은 면역조절자인 EDS1 (Enhanced disease susceptibility 1)과 TNL 종류의 저항성 단백질인 RPS4, RPS6, SNC1 (suppressor of npr1-1, constitutive 1)과 같은 단백질과 복합체를 형성하는 어댑터 단백질로써 기능을 한다. SRFR1은 전사억제조절자로 알려져 있는 사카로미세스 세레비지애(Saccharomyces cerevisiae) Ssn6 단백질과 염기서열이 유사한 TPR (tetratricopeptide repeat) 도메인을 가지고 있다. 그리고 애기장대 srfr1 돌연변이체에서 면역관련유전자의 발현이 증가되는 것이 확인되었다. 게다가, SRFR1 단백질은 면역 샤페론인 SGT1b (Suppressor of G2 allele of SKP1 homolog B)와 TCP 패밀리 전자사조절인자들과 상호작용한다. 이러한 결과들은 SRFR1 단백질이 ETI 관련 전사면역반응을 음성으로 조절하는 어댑터 단백질로써의 역할을 뒷받침한다.
우수한 형질의 식물체를 개발하기 위해 EMS (ethyl methane sulfonate) 또는 감마선 처리 등을 이용하여 자연적 돌연변이를 유도하거나 우수한 양친을 교배하는 전통적 육종방법이 주로 이용되어져 왔으나, 이 방법의 경우 원하는 목표 형질만 바꾸는데 어려움이 있어，최근에는 목표 형질만 대입하기 위해 TALENs, ZFNs, CRISPR/Cas9 등을 이용한 신육종 방법이 적용되고 있다. 그러나 TALENs 또는 ZFNs의 경우 인공적인 뉴클레아제 설계 및 제작에 많은 시간과 비용이 소요되고，다수의 유전자를 편집하기 어려운 단점을 가진다. 그러나 CRISPR/Cas9 시스템은 매우 높은 표적 특이성을 가지고 있고 메틸화된 DNA도 표적으로 인지할 수 있기 때문에 매우 다양한 유전자에 적용할 수 있으며 멘델의 유전법칙에 따라 자손에게 전달되어 형질의 세대고정이 가능하다는 장점이 있다. 또한, Cas9 단백질과 sgRNA (single guide RNA)만을 필요로 하기 때문에 위의 두 방법에 비해 적은 비용으로 목표 형질의 도입이 가능하다는 장점이 있어 최근 동물 및 식물 등에서 널리 적용되어지고 있는 신육종 기술이다.
한편, 한국등록특허 제2264215호에는 '유전자 교정을 이용한 아스코르브산 함량이 증가된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체'가 개시되어 있고, 한국공개특허 제2019-0043841호에는 '식물체에서 CRISPR/Cas9 시스템을 이용하여 LeMADS-RIN 유전자 편집에 의해 에틸렌 생산을 감소시키는 방법'이 개시되어 있으나, 본 발명의 유전자 교정을 이용한 병 저항성이 조절된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체에 대해서는 기재된 바가 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 토마토 SRFR1 게노믹 DNA의 두 영역을 표적으로 하는 sgRNA와 CRISPR/Cas9을 이용하여 토마토 SRFR1 돌연변이체(slsrfr1)를 제조하였고, 상기 돌연변이체에서 살리실산 신호전달에 관여하는 병원체 관련(pathogen-related, PR) 유전자의 발현이 증가하는 것을 확인하였으며, 상기 돌연변이체가 비교정 토마토 식물체에 비해 Pto DC3000에 대한 저항성이 증진되었음을 확인하였다. 하지만 사물기생성(necrotrophic) 곰팡이인 푸사리움 옥시스포럼 f. sp. 라이코페르시씨(Fusarium oxysporum f. sp. lycopersici)에 대한 저항성은 비교정 토마토 식물체에 비해 감소되었음을 확인할 수 있었다. 이를 통해, SRFR1이 토마토 식물체에서 기생영양(biotrophic) 병원균과 사물기생성 병원균에 대한 저항성을 조절하는 데 관여함을 확인함으로써, 본 발명을 완성하였다.
상기 과제를 해결하기 위해, 본 발명은 토마토 유래 SRFR1 (Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1) 유전자의 표적 염기서열에 특이적인 가이드 RNA(guide RNA)를 암호화하는 DNA 및 엔도뉴클레아제(endonuclease) 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터; 또는 SlSRFR1 유전자의 표적 염기서열에 특이적인 가이드 RNA와 엔도뉴클레아제 단백질의 복합체(ribonucleoprotein);를 유효성분으로 함유하는, 토마토 식물체의 병 저항성을 조절하기 위한 유전체 교정용 조성물을 제공한다.
또한, 본 발명은 (a) 토마토 유래 SRFR1 (Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1) 유전자의 표적 염기서열에 특이적인 가이드 RNA 및 엔도뉴클레아제 단백질을 토마토 식물세포에 도입하여 유전체를 교정하는 단계; 및 (b) 상기 유전체가 교정된 토마토 식물세포로부터 토마토 식물체를 재분화하는 단계;를 포함하는, 병 저항성이 조절된 유전체 교정 토마토 식물체의 제조방법을 제공한다.
또한, 본 발명은 상기 방법에 의해 제조된 병 저항성이 조절된 유전체 교정 토마토 식물체 및 이의 유전체가 교정된 종자를 제공한다.
본 발명에서 제시한 SlSRFR1 유전자 편집을 통한 돌연변이 유도는 병 저항성이 조절된 토마토 식물체를 개발하는데 유용하게 이용할 수 있다. 또한, 본 발명에 따른 방법은 자연적 변이와 구별할 수 없는 변이를 유도하므로, 안전성과 환경 유해성 여부를 평가하기 위해 막대한 비용과 시간이 소모되는 GMO(Genetically Modified Organism) 작물과 달리 비용과 시간을 절약할 수 있을 것으로 기대된다.
도 1a는 토마토 SRFR1의 게놈 구조 및 gRNA 표적 위치(Target 1, 2)를 보여주고, 도 1b는 gRNA의 표적 서열이고, 도 1c는 pSlSRFR-GE 컨스트럭트의 T-DNA 모식도이며, 도 1d는 SlSRFR1 sgRNA1- 및 sgRNA2-유도 G1 돌연변이체의 CAPS 분석 결과로, 하얀색 화살표는 동형접합 돌연변이체를 나타낸다.
도 2는 토마토 G0 식물체에서 표적 부위를 분석한 결과이다. 수직 점선은 각 sgRNA에 대해 SpCas9에 의한 절단 부위를 나타낸다.
도 3은 토마토 G1 식물체에서 표적 부위의 유전체 교정 양상을 분석한 결과이다.
도 4는 토마토 SRFR1 돌연변이체(slsrfr1)의 생장모습이며(a), 상기 돌연변이체에서 식물방어기작에 관여하는 유전자의 발현 정도를 qRT-PCR을 통해서 확인한 결과(b)이다. *; P<0.01.
도 5는 G1 세대 slsrfr1 식물체의 기생영양(biotrophic) 병원균인 슈도모나스 시린개 pv. 토마토 DC3000 (Pseudomonas syringae pv. tomato DC3000)에 대한 반응을 보여주는 것으로, (a)는 접종 5일 후의 잎에서 나타난 병증을 보여주는 사진이고, (b)는 균수를 측정한 결과이다. *; P<0.01.
도 6은 G1 세대 slsrfr1 식물체의 사물기생 병원균인 푸사리움 옥시스포럼 f. sp. 라이코페르시씨(Fusarium oxysporum f. sp. lycopersici)에 대한 반응을 보여주는 것으로, (a)는 접종 3일 후의 잎 사진이고, (b)는 트립판 블루 염색 이미지이며, (c)는 병변 부위의 직경을 측정한 결과이다. *; P<0.01.
본 발명의 목적을 달성하기 위하여, 본 발명은 토마토 유래 SRFR1 (Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1) 유전자의 표적 염기서열에 특이적인 가이드 RNA(guide RNA)를 암호화하는 DNA 및 엔도뉴클레아제(endonuclease) 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터; 또는 SlSRFR1 유전자의 표적 염기서열에 특이적인 가이드 RNA와 엔도뉴클레아제 단백질의 복합체(ribonucleoprotein);를 유효성분으로 함유하는, 토마토 식물체의 병 저항성을 조절하기 위한 유전체 교정용 조성물을 제공한다.
본 발명에 따른 유전체 교정용 조성물에 있어서, 상기 식물병은 기생영양(biotrophic) 병원균에 의한 식물병 또는 사물기생성(necrotrophic) 병원균에 의한 식물병일 수 있고, 상기 기생영양(biotrophic) 병원균은 바람직하게는 슈도모나스 시린개 pv. 토마토 (Pto) DC3000 (Pseudomonas syringae pv. tomato (Pto) DC3000)일 수 있으며, 상기 사물기생성(necrotrophic) 병원균은 바람직하게는 푸사리움 옥시스포럼 f. sp. 라이코페르시씨(Fusarium oxysporum f. sp. lycopersici)일 수 있으나, 이에 제한되지 않는다.
본 명세서에서 용어 "유전체/유전자 교정(genome/gene editing)"은, 인간 세포를 비롯한 동·식물 세포의 유전체 염기서열에 표적지향형 변이를 도입할 수 있는 기술로서, DNA 절단에 의한 하나 이상의 핵산 분자의 결실(deletion), 삽입(insertion), 치환(substitutions) 등에 의하여 특정 유전자를 녹-아웃(knock-out) 또는 녹-인(knock-in)하거나, 단백질을 생성하지 않는 비-코딩(non-coding) DNA 서열에도 변이를 도입할 수 있는 기술을 말한다. 본 발명의 목적상 상기 유전체 교정은 특히 엔도뉴클레아제(endonuclease) 예컨대, Cas9 (CRISPR associated protein 9) 단백질 및 가이드 RNA를 이용하여 식물체에 변이를 도입하는 것일 수 있다. 또한, '유전자 교정'은 '유전자 편집'과 혼용되어 사용될 수 있다.
또한, 용어 "표적 유전자"는 본 발명을 통해 교정하고자 하는 식물체의 유전체 내에 있는 일부 DNA를 의미하며, 그 유전자의 종류에 제한되지 않으며, 코딩 영역 및 비-코딩 영역을 모두 포함할 수 있다. 당업자는 그 목적에 따라, 제조하고자 하는 유전체 교정 식물체에 대하여 원하는 변이에 따라 상기 표적 유전자를 선별할 수 있다.
본 발명의 일 구현 예에 따른 조성물에 있어서, 상기 토마토 유래 SlSRFR1 (Solanum lycopersicum SUPPRESSOR OF rps4-RLD1) 유전자는 서열번호 3의 아미노산 서열로 이루어진 SlSRFR1 단백질을 암호화하는 것으로, 바람직하게는 SlSRFR1의 게놈 DNA는 서열번호 1로 표시되는 염기서열일 수 있고, SlSRFR1의 cDNA는 서열번호 2로 표시되는 염기서열일 수 있다.
또한, 용어 "가이드 RNA(guide RNA)"는 짧은 단일 가닥의 RNA로, 표적 유전자를 암호화하는 염기서열 중 표적 DNA에 특이적인 RNA를 의미하며, 표적 DNA 염기서열과 전부 또는 일부가 상보적으로 결합하여 해당 표적 DNA 염기서열로 엔도뉴클레아제 단백질을 이끄는 역할을 하는 리보핵산을 의미한다. 상기 가이드 RNA는 두 개의 RNA, 즉, crRNA (CRISPR RNA) 및 tracrRNA (trans-activating crRNA)를 구성 요소로 포함하는 이중 RNA (dual RNA); 또는 표적 유전자 내 염기서열과 전부 또는 일부 상보적인 서열을 포함하는 제1 부위 및 엔도뉴클레아제(특히, RNA-가이드 뉴클레아제)와 상호작용하는 서열을 포함하는 제2 부위를 포함하는 단일 사슬 가이드 RNA(single guide RNA, sgRNA) 형태를 말하나, 엔도뉴클레아제가 표적 염기서열에서 활성을 가질 수 있는 형태라면 제한없이 본 발명의 범위에 포함될 수 있으며, 함께 사용된 엔도뉴클레아제의 종류 또는 엔도뉴클레아제의 유래 미생물 등을 고려하여 당업계의 공지된 기술에 따라 제조하여 사용할 수 있다.
또한, 상기 가이드 RNA는 플라스미드 주형으로부터 전사된 것, 생체 외(in vitro)에서 전사된(transcribed) 것(예컨대, 올리고뉴클레오티드 이중가닥) 또는 합성한 가이드 RNA 등일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 조성물에 있어서, 상기 SlSRFR1 유전자의 표적 염기서열은 서열번호 4 또는 서열번호 5의 염기서열로 이루어진 것일 수 있으며, 보다 바람직하게는 서열번호 4의 염기서열로 이루어진 것일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명에 따른 유전체 교정용 조성물에 있어서, 상기 엔도뉴클레아제 단백질은 Cas9, Cpf1 (also known as Cas12a), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) 또는 이의 기능적 유사체로 이루어진 군으로부터 선택되는 하나 이상일 수 있고, 바람직하게는 RNA-가이드 뉴클레아제인 Cas9 또는 Cpf1 등일 수 있으며, 더욱 바람직하게는 Cas9 단백질일 수 있으나, 이에 제한되지 않는다.
또한, 상기 Cas9 단백질은 스트렙토코커스 피요제네스(Streptococcus pyogenes) 유래의 Cas9 단백질, 캠필로박터 제주니(Campylobacter jejuni) 유래의 Cas9 단백질, 스트렙토코커스 써모필러스(S. thermophilus) 또는 스트렙토코커스 아우레우스(S. aureus) 유래의 Cas9 단백질, 네이쎄리아 메닝기티디스(Neisseria meningitidis) 유래의 Cas9 단백질, 파스투렐라 물토시다(Pasteurella multocida) 유래의 Cas9 단백질, 프란시셀라 노비시다(Francisella novicida) 유래의 Cas9 단백질 등으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 제한되지 않는다. Cas9 단백질 또는 이의 유전자 정보는 NCBI(National Center for Biotechnology Information)의 GenBank와 같은 공지의 데이터베이스에서 얻을 수 있다. 상기 Cas9 유전자 정보는 공지된 서열을 그대로 사용할 수도 있고, 형질도입되는 대상(유기체)의 코돈에 최적화된 서열을 사용할 수 있으나, 이에 제한되지 않는다.
Cas9 단백질은 RNA-guided DNA 엔도뉴클레아제 효소로, 이중 가닥 DNA 절단(double stranded DNA break)을 유도한다. Cas9 단백질이 정확하게 표적 염기서열에 결합하여 DNA 가닥을 잘라내기 위해서는 PAM (Protospacer Adjacent Motif)이라 알려진 3개의 염기로 이루어진 짧은 염기서열이 표적 염기서열 옆에 존재해야 하며, Cas9 단백질은 PAM 서열(NGG)로부터 3번째와 4번째 염기쌍 사이를 추정하여 절단한다.
본 발명에 따른 유전체 교정용 조성물에 있어서, 상기 가이드 RNA와 엔도뉴클레아제 단백질은 리보핵산-단백질(ribonucleoprotein) 복합체를 형성하여 RNA 유전자 가위(RNA-Guided Engineered Nuclease, RGEN)로 작동할 수 있다.
본 발명에 따른 유전체 교정용 조성물에 있어서, 사용된 CRISPR/Cas9 시스템은 교정하고자 하는 특정 유전자의 특정위치에 이중나선 절단을 도입하여 DNA 수선 과정에서 유도되는 불완전 수선에 의한 삽입-결실(insertion-deletion, InDel) 돌연변이를 유도시키는 NHEJ(non-homologous end joining) 기작에 의한 유전자 교정 방법이다.
본 발명은 또한,
(a) 토마토 유래 SRFR1 (Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1) 유전자의 표적 염기서열에 특이적인 가이드 RNA(guide RNA) 및 엔도뉴클레아제(endonuclease) 단백질을 토마토 식물세포에 도입하여 유전체를 교정하는 단계; 및
(b) 상기 유전체가 교정된 토마토 식물세포로부터 토마토 식물체를 재분화하는 단계;를 포함하는, 병 저항성이 조절된 유전체 교정 토마토 식물체의 제조방법을 제공한다.
본 발명에 따른 제조방법에 있어서, 상기 (a) 단계의 가이드 RNA 및 엔도뉴클레아제 단백질을 토마토 식물세포에 도입하는 것은, SlSRFR1 유전자의 표적 염기서열에 특이적인 가이드 RNA를 암호화하는 DNA 및 엔도뉴클레아제 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터; 또는 SlSRFR1 유전자의 표적 염기서열에 특이적인 가이드 RNA와 엔도뉴클레아제 단백질의 복합체(ribonucleoprotein);를 이용하는 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 제조방법에 있어서, 상기 SlSRFR1 유전자의 표적 염기서열은 서열번호 4 또는 서열번호 5의 염기서열로 이루어진 것일 수 있으며, 보다 바람직하게는 서열번호 4의 염기서열로 이루어진 것일 수 있으나, 이에 제한되지 않는다.
상기 표적 염기서열에 특이적인 가이드 RNA를 암호화하는 DNA 및 엔도뉴클레아제 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터를 식물세포에 도입하는 것은 형질전환 방법을 의미한다. 식물 종의 형질전환은 이제는 쌍자엽 식물뿐만 아니라 단자엽 식물 양자를 포함한 식물 종에 대해 일반적이다. 원칙적으로, 임의의 형질전환 방법은 본 발명에 따른 재조합 벡터를 적당한 선조 세포로 도입시키는데 이용될 수 있다.
본 발명의 일 구현 예에 따른 제조방법에 있어서, 상기 재조합 벡터가 식물 세포에 형질전환되면, DNA 결합 및 절단 활성이 있는 엔도뉴클레아제 단백질과 상기 엔도뉴클레아제 단백질에 결합되며 표적 서열로 엔도뉴클레아제 단백질을 이끄는 sgRNA가 함께 발현되게 된다.
또한, 본 발명에 따른 제조방법에 있어서, 상기 가이드 RNA와 엔도뉴클레아제 단백질의 복합체를 식물세포에 형질도입하는 방법은 원형질체에 대한 칼슘/폴리에틸렌 글리콜 방법(Negrutiu et al., 1987, Plant Mol. Biol. 8:363-373), 원형질체의 전기천공법, 식물 요소로의 현미주사법(Crossway et al., 1986, Mol. Gen. Genet. 202:179-185), 각종 식물 요소의(DNA 또는 RNA-코팅된) 입자 충격법, 아그로박테리움 튜메파시엔스(Agrobacterium tumefaciens) 매개된 유전자 전이에서(비완전성) 박테리아에 의한 감염 등으로부터 적당하게 선택될 수 있다.
본 명세서에서 용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 코딩된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 재도입된 것이다.
또한, 용어 "벡터"는 세포 내로 전달하는 DNA 단편(들), 핵산 분자를 지칭할 때 사용된다. 벡터는 DNA를 복제시키고, 숙주세포에서 독립적으로 재생산될 수 있다. 용어 "전달체"는 흔히 "벡터"와 호환하여 사용된다. 용어 "발현 벡터"는 목적한 코딩 서열과, 특정 숙주 생물에서 작동가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미한다. 진핵세포에서 이용 가능한 프로모터, 인핸서, 종결신호 및 폴리아데닐레이션 신호는 공지되어 있다.
본 발명에 따른 제조방법에 있어서, 상기 표적 염기서열에 특이적인 가이드 RNA 및 엔도뉴클레아제 단백질이 도입되는 "식물세포"는 어떤 식물세포도 된다. 식물세포는 배양 세포, 배양 조직, 배양 기관 또는 전체 식물이다. "식물 조직"은 분화된 또는 미분화된 식물의 조직, 예를 들면 이에 한정되진 않으나, 뿌리, 줄기, 잎, 꽃가루, 소포자, 난세포, 종자 및 배양에 이용되는 다양한 형태의 세포들, 즉 단일 세포, 원형질체(protoplast), 싹 및 캘러스 조직을 포함한다. 식물 조직은 인 플란타(in planta)이거나 기관 배양, 조직 배양 또는 세포 배양 상태일 수 있다.
본 발명의 제조방법에 있어서, 유전체가 교정된 식물세포로부터 유전체가 교정된 식물을 재분화하는 방법은 당업계에 공지된 임의의 방법을 이용할 수 있다. 유전체가 교정된 식물세포는 전식물로 재분화되어야 한다. 캘러스 또는 원형질체 배양으로부터 성숙한 식물의 재분화를 위한 기술은 수많은 여러 가지 종에 대해서 당업계에 주지되어 있다.
본 발명은 또한, 상기 방법에 의해 제조된 병 저항성이 조절된 유전체 교정 토마토 식물체 및 이의 유전체가 교정된 종자를 제공한다.
본 발명에 따른 병 저항성이 조절된 유전체 교정 토마토 식물체는 SlSRFR1 (Solanum lycopersicum SUPPRESSOR OF rps4-RLD1) 유전자를 CRISPR/Cas9 시스템을 이용하여 교정한 것으로, 토마토 유래 SlSRFR1 유전자가 녹-아웃되어, 유전체를 교정하지 않은 토마토 식물체에 비해 병 저항성이 조절된 형질을 가지는 유전체 교정 토마토 식물체이다. 상기 유전체 교정 토마토 식물체는 야생형에 비해 기생영양(biotrophic) 병원균에 의한 식물병에 대한 저항성이 증가되고, 사물기생성(necrotrophic) 병원균에 의한 식물병에 대한 저항성이 감소된 것을 특징으로 한다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
재료 및 방법
1. 토마토 형질 전환을 위한 벡터 구축
CRIPSR-P v2.0 프로그램 (http://crispr.hzau.edu.cn/CRISPR2/)을 이용하여 SlSRFR1의 N-말단 부위에서 SpCas9-gRNA 복합체의 타켓부위를 조사하였다. 그리고 유전체 교정을 일으킬 수 있는 수치인 on-score, gRNA의 2차 구조, 타켓 부위의 GC 뉴클레오티드 함량 및 off-target 서열을 고려하여 두 개의 gRNA를 선정하였다. 두 개의 gRNA는 애기장대 U6 프로모터 (originated from Addgene #46968), scafford RNA와 poly T를 프라이머 이합체화반응(dimerization) 방법을 통해 서로 연결하였고, 상기 gRNA 전체는 Golden Gate 클로닝 시스템을 통해서 레벨1 플라스미드인 pICH47751 및 pICH47761에 각각 클로닝 하였다. 만들어진 각 gRNA 모듈은 식물 선별마커 (Addgene #51144), SpCas9 (Addgene #49771), 링커 (Addgene #48019)와 함께 Golden Gate 클로닝 시스템을 통해서 pAGM4723 내부로 클로닝하여 컨스트럭트를 제조하였으며, 상기 컨스트럭트를 pSlSRFR1-GE로 명명하였다.
2. 아그로박테리움을 이용한 토마토 형질전환 및 CRISPR/Cas9으로 유전체 교정이 일어난 식물체 선별
토마토 형질전환 및 식물체 선별은 이전 연구를 참고하여 수행하였다 (Plant Cell Rep. 2021 Jun;40(6):999-1011). 토마토 품종 M82 (Solanum lycopersicum cv. M82)를 25℃, 16시간 명/8시간 암조건에서 1/2 MSO 배지(2.2g MS salts + B5, 20g sucrose, 0.5g MES (pH=5.7), 7.5g agar for 1L)에 7일동안 키운 후 칼을 이용하여 자엽(cotyledon) 외식편들을 만들어 PREMC 배지(2.2g MS salts + B5, 30g maltose, 0.1g Ascorbic acid, 1.952g MES, 0.2mg IAA (pH=5.5), 7.5g agar for 1L; 상기 혼합물을 멸균한 후, 1.0mg Zeatin trans-isomer, 1㎖ Putrescine(1mM), acetosyringone(AS) 100μM 첨가) 위에 올려 25℃ 암조건에서 하루동안 보관한다. pSlSRFR1-GE 플라스미드는 전기천공법을 통해 아그로박테리움 튜머파시엔스(Agrobacterium tumefaciens) GV3101 (MP90)으로 형질전환시켰다. 28℃에서 18시간동안 배양한 pSlSRF1-GE를 보유한 아그로박테리움 3㎖을 30㎖의 LB 배지(50mg·L-1 kanamycin 및 10mg·L-1 gentamicin 포함)로 옮겨 OD600 값이 0.8~1 정도될 때까지 배양하였다. 아그로박테리움을 3,000rpm으로 15분동안 원심분리하고 펠렛은 200μM 아세토시린곤(acetosyringone, #D134406, Sigma, USA)을 함유한 30㎖의 ABM-MS [1.106g K2HPO4, 0.565g KH2PO4, 0.748g NH4NO3, 0.0745g KCl, 0.154g MgSO4, 0.0075g CaCl2, 0.0015g FeSO4, 20g glucose, 1.952g MES, 1.1g MS salts + B5, 2.5g sucrose (pH 5.5) for 1L]에 현탁시켰다. 현탁액을 한시간동안 28℃에서 배양하고 토마토 자엽(cotyledon) 외식편을 아그로박테리움과 20분동안 공동배양하여 토마토를 형질전환시켰다. 토마토 자엽 외식편을 200 μM 아세토시린곤을 함유하고 있는 ABM-MS에 옮겨 25℃ 암조건에서 2일동안 배양하였다. 외식편에 붙은 아그로박테리움은 500mg·L-1 티멘틴(timentin) 용액에 2분간 저어서 세척하였다. 외식편에 남아있는 물은 와트만(Whatman) 페이퍼를 이용하여 완전히 없애주고, 선별배지[SEL4-70; 4.4g MS salts + B5, 30g maltose, 0.05mg IAA, 0.976g MES, 0.5mg zeatin ribose trans-isomer, 70mg kanamycin, 300mg timentin, 1mM putrescine (pH 5.7), 8g agar for 1L]에 올려놓고 캘러스를 유도하며 완전한 줄기가 나오기까지 2주마다 캘러스를 새 선별배지(SEL4-70)에 옮겨주었다. 줄기가 나온 외식편은 뿌리유도배지[RIM; 2.2g MS salts + B5, 20g sucrose, 0.1mg NAA, 0.3mg IBA, 300mg Timentin (pH 5.7), 8g agar for 1L]에 옮기고 뿌리가 유도될 때까지 배양하였다. 건강한 식물체는 25℃, 16시간 명/8시간 암조건에서 키운다.
3. 토마토에서 게노믹 DNA 분리
게노믹(genomic) DNA 분리는 Pater 등(Plant Biotechnol J. 2009 Oct; 7(8):821-835)을 참고하여 수행하였다. 콜크보러(cork borer) 5호를 이용하여 G0와 G1세대 토마토 식물체에서 두 장의 잎 조각을 튜브에 넣고 액체질소에 얼려 구슬을 이용하여 mixer mill (#MM301, Retsch, Germany)에서 1분동안 분쇄하였다. 상기 분말에 300㎕의 2X CTAB extraction buffer (0.1M Tris, 2% CTAB, 1.4M NaCl, and 20mM EDTA)를 넣고 65℃에서 20분간 반응시켰다. 튜브에 300㎕ 클로로포름을 추가로 넣어주고 강하게 섞어준 다음 14,000rpm으로 5분간 원심분리하였다. 상등액 200㎕를 취하여 새 튜브로 옮기고 200㎕의 이소프로판올을 상등액에 넣어 섞고 상온에서 2분간 반응시켰다. 그 후, 14,000rpm으로 5분간 원심분리한 후 1㎖의 70% 에탄올을 이용하여 펠렛을 씻어주었다. 14,000rpm으로 1분간 원심분리하여 DNA 펠렛을 회수하고, 상기 펠렛을 상온에서 10분간 건조시키고 50㎕의 삼차증류수를 넣어 녹였다. 이 중 2㎕의 게노믹 DNA를 이용하여 25㎕ 부피의 PCR 반응에 사용하였다.
4. 시퀀싱을 통한 유전체교정 분석
G0이나 G1 세대 토마토에서 SlSRFR1 타켓부위를 PCR을 통해서 증폭시키고 시퀀싱을 수행하였다. 상기 결과를 ICE (Inference of CRISPR Edits, https://ice.synthego.com/#/) 분석을 통해서 G0이나 G1 세대 토마토에서 Indel 돌연변이가 얼마나 일어났는지 확인하였다. G1 세대 토마토에서 좀 더 명확한 결과를 확인하기 위해서는 Miseq 시퀀싱을 수행하여 Cas-Analyzer 프로그램 (http://www.rgenome.net/)으로 분석하였다. SlSRFR1-F1/SlSRFR1-R2 프라이머 세트를 이용하여 945bp 크기의 PCR 단편을 증폭하고 유전자 특이적 염기서열과 어댑터(adaptor) 프라이머 일부 서열을 공유하는 프라이머(MiSeq-1-F2/MiSeq-1-R2 and MiSeq-2-F2/MiSeq-2-R2)를 이용하여 2차 PCR 을 통해 155bp 와 150bp 크기의 DNA 단편을 증폭하였다. MiSeq sequencing service (MiniSeqTM System, Illumina, USA)에서 제공하는 dual Index adapter (D501~D508과 D701~D712의 조합) 프라이머를 이용하여 3차 PCR 단편을 증폭하여 Miseq 시퀀싱을 통해 Indel 돌연변이 정도를 분석하였다.
5. Cleaved Amplified Polymorphic Sequence (CAPS) 연구
G1 세대 유전자변형 토마토에서 동형(homozygous) 식물체를 찾기 위해서 유전자의 다형성(polymorphism)을 이용한 CAPS 분석을 수행하였다. SlSRFR1-sgRNA1과 SlSRFR1-sgRNA2에서 일어난 돌연변이 양상을 구별하기 위해서 SlSRFR1-F1/SlSRFR1-Bcc-R2와 SlSRFR1-F1/SlSRFR1-R2를 이용하여 DNA 단편을 증폭하였다. 이 DNA에 BccI과 BcgI을 각각 처리하고 37℃에서 3-4시간 반응시켰다. 이후 상기 혼합물을 아가로스 겔에 로딩하여 전기영동을 수행하고 G1 세대의 유전형(genotype)을 선별하였다.
6. 박테리아와 곰팡이 병원균에 의한 발병 분석
슈도모나스 시린개 pv. 토마토 DC3000 (Pseudomonas syringae pv. tomato DC3000, 이하 Pto DC3000)에 의한 발병 분석은 이전의 연구를 따라 수행하였다(Scalschi, L. et al., PLoS One 2014, 9:e106429). 슈도모나스 배지에서 자란 pVSP61 공벡터(empty vector)가 들어있는 Pto DC3000을 2x108 CFU/㎖로 희석하고 6주된 토마토 식물의 세 번째 또는 네 번째 잎에 상기 희석액을 30초동안 처리한 후 높은 습도를 유지하기 위해서 플라스틱백으로 감싸서 5일동안 유지하였다. 슈도모나스균이 처리된 식물에서 콜크보더 5호를 이용하여 두 장의 잎 조각을 10 mM 염화마그네슘 용액에 넣어 분쇄한 후 단계희석하여 슈도모나스 배지에 도말한 뒤 30℃에서 배양시키며 자라난 박테리아 수를 관찰하였다.
푸사리움 옥시스포럼 f. sp. 라이코페르시씨(Fusarium oxysporum f. sp. lycopersici, 이하 FOL)에 의한 발병 분석은 이전의 연구(Kostov, K. et al., Biotechnol. Biotechnol. Equip. 2009, 23:1121-1125)를 따라 수행하였다. 30℃ 암조건의 potato dextrose (#254920, BD Difco, USA)에서 FOL을 배양한 후, 25℃ 16시간 명/8시간 암조건에서 5일동안 키워 실험에 사용하였다. 콜크보더 1호를 사용하여 배지에서 자란 곰팡이를 플러그를 만들어 6주된 토마토 잎 위에 얹고, 25℃, 16시간 명/8시간 암조건에서 3-8일동안 두었다.
7. Trypan Blue 염색
곰팡이가 감염된 토마토 잎 조각을 트립판 블루(trypan blue) 용액 (1:1:1=85%(w/v) lactic acid:phenol (pH 8.0):glycerol(≥ 99%), 10mg/㎖ trypan blue)에 1시간동안 담가두었다. 염색된 잎을 99% 에탄올에 하루 담궈 색소를 제거하였다. 형광현미경을 이용하여 곰팡이 균사의 발달정도를 시각화하였다.
8. RNA 분리와 cDNA 합성
G1 세대 slsrfr1 돌연변이체에서 콜크보더 5호를 이용하여 잎 조각 3장을 뚫어 2㎖의 튜브에 넣고 액체질소에 얼린다음 mixer mill을 이용하여 분쇄하였다. RiboEx (#301-001, GeneAll, Korea) 프로토콜을 따라 50㎕ 총 RNA를 분리하고 TURBO DNA-free kit (#AM1907, Invitrogen, USA)를 사용하여 총 RNA로부터 섞여있는 genomic DNA를 제거하였다. SuperiorScrippt Ⅲ cDNA synthesis kit (#EZ405S, Enzynomics, SouthKorea)를 이용하여 cDNA를 합성한 다음 그 중에서 1㎕를 qRT-PCR 반응에 사용하였다.
9. qRT-PCR을 통하여 유전자 발현 분석
확인하고자 하는 유전자의 프라이머와 QuantiNova SYBR® Green PCR Kit (#208054, Qiagen, Germantown, USA)를 이용하여 CFX384 system (BioRad, Hercules, USA) 기계에서 95℃ 2분, 40 cycle (95℃ 5초, 60℃ 15초) 조건으로 DNA를 증폭하였다. SlACT와 SlGAPH를 이용하여 상대적인 유전자 발현정도를 분석하였다.
Figure PCTKR2022008352-appb-img-000001
10. 단백질 면역 블랏 분석
콜크보더 5호를 이용하여 토마토 잎 조각 2개를 튜브에 넣고 50㎕의 8M 우레아(urea)를 튜브에 넣어 막자를 이용하여 분쇄하였다. 12,000rpm으로 10분간 두 번 원심분리하여 상층액을 12%의 폴리아크릴아미드 겔에 로딩하였다. 단백질 면역 블랏 분석은 α-PR1 antibody (1:10,000 dilution, #AS10 687, Agrisera, SWEDEN) 또는 α-Actin antibody (1:10,000 dilution, #AS13 2640, Agrisera)를 이용하여 수행하였으며, Clarity Western ECL Substrate (#1705061, Bio-Rad, USA)와 SuperSignal™ West Femto Maximum Sensitivity Substrate (#34094, Thermo Scientific, USA)을 이용하여 시각화하였다.
실시예 1. 표적 선발 및 SlSRFR1 교정을 위한 벡터 구축
SRFR1는 애기장대에서 단일 카피 유전자로, 애기장대 SRFR1는 주로 단백질-단백질 상호작용에 관여하는 11개의 TPR (tetratricopeptide repeat) 도메인으로 구성되어 있다. 토마토 프로테옴에 주석을 달기위해 블라스트(Blast) 알고리즘을 사용하였고, 애기장대 SRFR1와 65%의 유사성을 가지는 Solyc02g09280 (SlSRFR1)을 확인하였다. 애기장대 SRFR1과 서열 정렬을 통해 SlSRFR1이 1,055개의 아미노산으로 이루어진 단백질을 암호화하며, 두 개의 TPR 도메인이 N-말단에 위치하고, 9개의 TPR 도메인이 중앙에 위치함을 알 수 있었다.
본 발명자는 SlSRFR1의 기능을 분석하기 위해, CRISPR/Cas 시스템을 이용하여 돌연변이체를 제조하였다. 표준 조건에 기반하여 sgRNA를 디자인하였고, SlSRFR1의 ORF (open reading frame)의 5' 말단쪽 위치를 교정을 위한 자리로 선정하였다(표 2).
SlSRFR1 교정을 위한 gRNA 표적 위치
Name gRNA Target position
on genome		 Number of off-targets
(<4 MMs)
sgRNA1 GTAACTTTCGACGCCATCG
(서열번호 4)		 5' UTR and CDS 1
sgRNA2 ATTGACTATAGCAAAACGCT
(서열번호 5)		 CDS 3
실시예 2. CRISPR/Cas9에 의해 생성된 SlSRFR1 대립유전자 분석
G0 세대에서, 37개 식물체가 형질전환된 자엽으로부터 재분화되었다. 생성된 식물체로부터 분리한 게노믹 DNA를 통해 잠재적인 게놈 교정 이벤트를 입증하였다. 표적 DNA 부위를 유전자 특이적 프라이머를 통해 증폭하고 아가로스 겔에 로딩하여 비교한 결과, 비교정 식물체 M82와 증폭산물의 크기가 유사하게 확인되어 표적 영역에서 큰 결실은 일어나지 않았음을 알 수 있었다. 또한, 증폭된 부위를 ICE (Inference of CRISPR Edits) 프로그램을 사용하여 분석한 결과, 14개의 G0 식물체에서 InDel 변이가 확인되어, CRISPR/Cas9 매개 교정 효율은 37.84%임을 알 수 있었다(도 2). 특히, 서열번호 4의 sgRNA (Target 1) 표적 부위가 서열번호 5의 sgRNA (Target 2) 표적 부위에 비해 InDel 돌연변이가 많이 발생하였음을 알 수 있었다.
모든 InDel 변이는 절단 위치에서 발생하였다. SRFR1-sgRNA1 표적 자리에서는 1 bp 삽입(G0-5, G0-6, G0-7, G0-8, 및 G0-9) 및 3 bp 결실(G0-10 및 G0-11)이 주로 관찰되었으며, 다섯 개의 독립적인 이벤트(G0-5 to 9)에서 유사한 교정 패턴을 나타냈다. ICE-기반 decomposition 분석에서 나타난 혼재된 피크는 G0 세대에서 이형접합의(heterozygous) slsrfr1 돌연변이체의 존재를 확인시켜 주었다. 그래서, 3개의 G0 계통(G0-1, G0-2, G0-3)을 동형접합의 식물체를 획득하기 위해 다음 세대(G1)로 진전시켜 분석하였다. G1 세대 식물체로부터 분리한 DNA를 사용하여 PCR 반응을 수행하고, CAPS 분석을 진행하여 동형접합의 G1 식물체를 확인하였다(도 1d).
또한, CAPS 분석을 통해 동형접으로 확인된 G1 식물체 모두를 대상으로 Deep sequencing 또는 Sanger sequencing 분석을 수행하였다. 그 결과, 2종의 monoallelic 동형접합체 (11 bp 결실 in TPR domain, slsrfr1-1; 및 1 bp 삽입 in TPR domain, slsrfr1-3), 1종의 multiallelic 동형접합체 (1, 4, 및 4 bp 결실, slsrfr1-2), 1종의 biallelic 동형접합체 (22 bp 결실 및 4 bp 결실 removing the start codon, slsrfr1-4)을 포함하는 4 유형의 대립유전자를 가진 G1 식물체가 생산되었음을 알 수 있었다(도 3). TPR 도메인의 1 bp 또는 11 bp 결실은 조기 종결코돈을 생성하였다. 또한, slsrfr1-2 및 slsrfr1-4의 돌연변이는 개시 코돈에서 확인되었다. 또한, 정제된 PCR 앰플리콘의 Sanger sequencing 분석을 통해 모든 대상에서 off-target site가 확인되지 않았음을 알 수 있었다.
실시예 3. slsrfr1 돌연변이 식물체의 형태 및 방어 마커 유전자 발현 분석
slsrfr1 G1 세대 식물체는 야생형 M82 식물체와 비교하여 약한 성장 감소가 확인되었으나, 심각한 왜화는 나타나지 않았다(도 4a). 또한, 야생형 M82 식물체와 비교하여 식물방어기작에 관여하는 유전자인 SlPR1 (Solyc09g007010.1), SlPR2 (Solyc01g008620.2), SlPR5(Solyc08g080640), 및 TomloxD (Solyc03g122340.2) 유전자의 발현 수준이 증가되어 있음을 확인할 수 있었고(도 4b), 이 결과는 CRISPR/Cas9 매개 SlSRFR1의 돌연변이는 살리실산 의존 방어 유전자의 발현 수준을 상향 조절하고 자스몬산 신호 마커 유전자(TomloxD)의 발현도 유도함을 의미하였다.
실시예 4. slsrfr1 돌연변이 식물체의 병 저항성 분석
애기장대 srfr1 돌연변이체는 식물방어기작에 관여하는 유전자들이 항시적으로 상향 조절되었으나 병독성의 Pto DC3000에 대한 증진된 저항성이 없는 것으로 보고되었으나(Kim, S.H. et al., Plant Signal Behav. 2009, 4;149-150), 6주령의 slsrfr1 G1 세대 식물체는 야생형 M82 식물체에 비해 Pto DC3000에 대한 저항성이 증진되었음을 알 수 있었다(도 5). 반면, 사물기생 병원균인 푸사리움 옥시스포럼 f. sp. 라이코페르시씨(Fusarium oxysporum f. sp. lycopersici)에 대해서는 애기장대에서와 같이 slsrfr1 G1 세대 식물체가 야생형 M82 식물체에 비해 감수성이 더욱 증가되었음을 확인할 수 있었다(도 6).

Claims (9)

  1. 토마토 유래 SRFR1 (Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1) 유전자의 표적 염기서열에 특이적인 가이드 RNA(guide RNA)를 암호화하는 DNA 및 엔도뉴클레아제(endonuclease) 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터; 또는 SlSRFR1 유전자의 표적 염기서열에 특이적인 가이드 RNA와 엔도뉴클레아제 단백질의 복합체(ribonucleoprotein);를 유효성분으로 함유하는, 토마토 식물체의 병 저항성을 조절하기 위한 유전체 교정용 조성물.
  2. 제1항에 있어서, 상기 SlSRFR1 유전자의 표적 염기서열은 서열번호 4 또는 서열번호 5의 염기서열로 이루어진 것을 특징으로 하는 조성물.
  3. (a) 토마토 유래 SRFR1 (Solanum lycopersicum SUPPRESSOR OF rps4-RLD1; SlSRFR1) 유전자의 표적 염기서열에 특이적인 가이드 RNA(guide RNA) 및 엔도뉴클레아제(endonuclease) 단백질을 토마토 식물세포에 도입하여 유전체를 교정하는 단계; 및
    (b) 상기 유전체가 교정된 토마토 식물세포로부터 토마토 식물체를 재분화하는 단계;를 포함하는, 병 저항성이 조절된 유전체 교정 토마토 식물체의 제조방법.
  4. 제3항에 있어서, 상기 (a) 단계의 가이드 RNA 및 엔도뉴클레아제 단백질을 토마토 식물세포에 도입하는 것은, SlSRFR1 유전자의 표적 염기서열에 특이적인 가이드 RNA를 암호화하는 DNA 및 엔도뉴클레아제 단백질을 암호화하는 핵산 서열을 포함하는 재조합 벡터; 또는 SlSRFR1 유전자의 표적 염기서열에 특이적인 가이드 RNA와 엔도뉴클레아제 단백질의 복합체(ribonucleoprotein);를 이용하는 것을 특징으로 하는 제조방법.
  5. 제3항에 있어서, 상기 SlSRFR1 유전자의 표적 염기서열은 서열번호 4 또는 서열번호 5의 염기서열로 이루어진 것을 특징으로 하는 제조방법.
  6. 제3항에 있어서, 상기 병 저항성은 야생형에 비해 기생영양(biotrophic) 병원균에 의한 식물병에 대한 저항성을 증가시키거나, 사물기생성(necrotrophic) 병원균에 의한 식물병에 대한 저항성을 감소시키는 것을 특징으로 하는 제조방법.
  7. 제3항 내지 제6항 중 어느 한 항의 방법에 의해 제조된 병 저항성이 조절된 유전체 교정 토마토 식물체.
  8. 제7항에 있어서, 상기 유전체 교정 토마토 식물체는 야생형에 비해 기생영양(biotrophic) 병원균에 의한 식물병에 대한 저항성이 증가되거나, 사물기생성(necrotrophic) 병원균에 의한 식물병에 대한 저항성이 감소되는 것을 특징으로 하는 유전체 교정 토마토 식물체.
  9. 제7항에 따른 토마토 식물체의 유전체가 교정된 종자.
PCT/KR2022/008352 2021-07-21 2022-06-14 유전자 교정을 이용한 병 저항성이 조절된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체 WO2023003177A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210095574A KR102675540B1 (ko) 2021-07-21 2021-07-21 유전자 교정을 이용한 병 저항성이 조절된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체
KR10-2021-0095574 2021-07-21

Publications (1)

Publication Number Publication Date
WO2023003177A1 true WO2023003177A1 (ko) 2023-01-26

Family

ID=84980332

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/008352 WO2023003177A1 (ko) 2021-07-21 2022-06-14 유전자 교정을 이용한 병 저항성이 조절된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체

Country Status (2)

Country Link
KR (1) KR102675540B1 (ko)
WO (1) WO2023003177A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180000282A (ko) * 2016-06-22 2018-01-02 서울대학교산학협력단 토마토 유래 sra1 유전자를 이용한 식물의 해충 저항성을 증대시키는 방법 및 그에 따른 식물체
KR20190020035A (ko) * 2016-06-20 2019-02-27 키진 엔.브이. 식물 세포에서의 표적된 dna 변경 방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102264215B1 (ko) * 2020-12-23 2021-06-11 전남대학교산학협력단 유전자 교정을 이용한 아스코르브산 함량이 증가된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190020035A (ko) * 2016-06-20 2019-02-27 키진 엔.브이. 식물 세포에서의 표적된 dna 변경 방법
KR20180000282A (ko) * 2016-06-22 2018-01-02 서울대학교산학협력단 토마토 유래 sra1 유전자를 이용한 식물의 해충 저항성을 증대시키는 방법 및 그에 따른 식물체

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "Understanding the mechanisms of plant immune response and application thereof in crop resistance engineering", FINAL REPORT OF NEXT GENERATION BIO GREEN 21, SYSTEMS & SYNTHETIC AGROBIOTECH PROGRAM; INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY; PJ013449, vol. 12, no. 31, 1 February 2021 (2021-02-01), XP093027183 *
DATABASE PROTEIN ANONYMOUS : "suppressor of RPS4-RLD 1 [Solanum lycopersicum]", XP093027182, retrieved from NCBI *
KWON SOON IL, SANG HEE KIM, SAIKAT BHATTACHARJEE, JAE-JONG NOH, WALTER GASSMANN: "SRFR1, a suppressor of effector‐triggered immunity, encodes a conserved tetratricopeptide repeat protein with similarity to transcriptional repressors", THE PLANT JOURNAL, vol. 57, pages 109 - 119, XP093027180, DOI: 10.1111/j.1365-313X.2008.03669.x *
LI YINGZHONG, LI SHUXIN, BI DONGLING, CHENG YU TI, LI XIN, ZHANG YUELIN: "SRFR1 Negatively Regulates Plant NB-LRR Resistance Protein Accumulation to Prevent Autoimmunity", PLOS PATHOGENS, vol. 6, no. 9, 16 September 2010 (2010-09-16), pages e1001111, XP093027178, DOI: 10.1371/journal.ppat.1001111 *
SON GEON HUI, MOON JIYUN, SHELAKE RAHUL MAHADEV, VUONG UYEN THI, INGLE ROBERT A., GASSMANN WALTER, KIM JAE-YEAN, KIM SANG HEE: "Conserved Opposite Functions in Plant Resistance to Biotrophic and Necrotrophic Pathogens of the Immune Regulator SRFR1", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 22, no. 12, 1 January 2021 (2021-01-01), pages 6427, XP093027176, DOI: 10.3390/ijms22126427 *

Also Published As

Publication number Publication date
KR102675540B1 (ko) 2024-06-13
KR20230014337A (ko) 2023-01-30

Similar Documents

Publication Publication Date Title
Wang et al. CRISPR/Cas9-mediated editing of CsWRKY22 reduces susceptibility to Xanthomonas citri subsp. citri in Wanjincheng orange (Citrus sinensis (L.) Osbeck)
WO2020007331A1 (zh) 一种利用CRISPR/Cas9系统对紫花苜蓿基因定点突变的方法
KR102107735B1 (ko) 식물 원형질체로부터 식물체를 제조하는 방법
US9756871B2 (en) TAL-mediated transfer DNA insertion
WO2021169925A1 (zh) 一种融合蛋白及其应用
WO2023202727A1 (zh) 一种制备水稻雄性不育材料的方法及相关基因
CN113801891A (zh) 甜菜BvCENH3基因单倍体诱导系的构建方法与应用
JPWO2003040363A1 (ja) イネのトランスポゾン遺伝子
KR102304761B1 (ko) StSR4 유전자 교정에 의해 병 저항성이 증가된 감자 식물체의 제조방법 및 상기 방법에 의해 제조된 병 저항성이 증가된 유전체 교정 감자 식물체
CN107227303B (zh) 一种OsGA3ox1基因在水稻雄性不育株系创制中的应用
WO2023191428A1 (ko) 반수체 식물을 유도하는 pPLAⅡη 유전자 및 이의 용도
EP3052633B1 (en) Zea mays metallothionein-like regulatory elements and uses thereof
WO2023003177A1 (ko) 유전자 교정을 이용한 병 저항성이 조절된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체
KR20190139756A (ko) 페튜니아 원형질체에서 CRISPR/Cas9 시스템을 이용한 플라보노이드 생합성 유전자 교정세포를 배양하여 형질교정 재분화체를 유도하는 방법
CN113493803B (zh) 紫花苜蓿CRISPR/Cas9基因组编辑系统及其应用
CN116536327A (zh) 一种小麦黄花叶病感病基因TaEIF4E及其应用
Aregawi et al. Pathway to validate gene function in key bioenergy crop, Sorghum bicolor
WO2023003176A1 (ko) 토마토 유래 식물면역조절인자 srfr1 유전자 및 이의 용도
KR20230001450A (ko) CRISPR/Cas 복합체를 이용한 개화지연 양배추 식물체의 제조방법
KR102629157B1 (ko) Potato Virus X 벡터를 이용한 토마토 식물체의 유전자 교정용 재조합 벡터 및 이의 용도
CN117965566B (zh) 一种与烟草叶片衰老相关的基因家族及其应用
WO2022203166A1 (ko) 유전자 교정을 이용한 토마토황화잎말림바이러스에 대한 저항성이 증가된 토마토 식물체의 제조방법 및 상기 제조방법에 의해 제조된 토마토 식물체
CN112194713B (zh) 一种与水稻胚乳淀粉颗粒发育相关的蛋白fse5及其编码基因和应用
CN116445463B (zh) 新型植物碱基编辑器pAYBEs
WO2024143970A1 (ko) 형광 단백질 발현을 이용한 Cas9 과발현 고추 식물체의 제조방법 및 상기 방법에 의해 제조된 형광 단백질 및 Cas9 동시 발현 고추 식물체

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22846049

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22846049

Country of ref document: EP

Kind code of ref document: A1