WO2018142364A1 - Compositions and methods for the treatment of hemoglobinopathies - Google Patents
Compositions and methods for the treatment of hemoglobinopathies Download PDFInfo
- Publication number
- WO2018142364A1 WO2018142364A1 PCT/IB2018/050712 IB2018050712W WO2018142364A1 WO 2018142364 A1 WO2018142364 A1 WO 2018142364A1 IB 2018050712 W IB2018050712 W IB 2018050712W WO 2018142364 A1 WO2018142364 A1 WO 2018142364A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- cells
- seq
- population
- grna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
Definitions
- CRISPRs Clustered Regularly Interspaced Short Palindromic Repeats
- RNA is transcribed from a portion of the CRISPR locus that includes the viral sequence. That RNA, which contains sequence complimentary to the viral genome, mediates targeting of a Cas9 protein to the sequence in the viral genome. The Cas9 protein cleaves and thereby silences the viral target.
- SSBs site-specific single
- DSBs double strand breaks
- NHEJ non-homologous end-joining
- HDR homology -directed repair
- CRISPR systems e.g., Cas9 CRISPR systems, e.g., as described herein
- can be used to modify cells e.g., hematopoietic stem and progenitor cells (HSPCs)
- cells e.g., hematopoietic stem and progenitor cells (HSPCs)
- HSPCs hematopoietic stem and progenitor cells
- beta globin e.g., a beta globin gene having a disease-causing mutation
- the modified cells e.g., modified HSPCs
- may be used to treat hemoglobinopathies e.g., sickle cell disease and beta thalassemia.
- HSPCs e.g., HSPCs that comprise one or more indels, for example, as described herein
- HSPCs that comprise one or more indels, for example, as described herein
- these modified HSPCs are capable of being cultured ex vivo, for example, in the presence of a stem cell expander (for example as described herein) under conditions that cause them to expand and proliferate while maintaining sternness.
- a stem cell expander for example as described herein
- the gene editing systems e.g., CRISPR systems, e.g, as described herein
- the modified cells and their progeny surprisingly show not only upregulation of fetal hemoglobin, but also show a significant decrease in sickle beta- globin, and a significant decrease in the number of sickle cells and increase the number of normal red blood cells, relative to unmodified cell populations.
- the invention provides CRISPR systems (e.g., Cas CRISPR systems, e.g., Cas9 CRISPR systems, e.g., S. pyogenes Cas9 CRISPR systems) comprising one or more, e.g., one, gRNA molecule as described herein.
- CRISPR systems e.g., Cas CRISPR systems, e.g., Cas9 CRISPR systems, e.g., S. pyogenes Cas9 CRISPR systems
- the invention provides a gRNA molecule including a tracr and crRNA, wherein the crRNA includes a targeting domain that: a) is complementary with a target sequence of a nondeletional HFPH region (e.g., a human nondeletional HPFH region); b) is complementary with a target sequence within the genomic nucleic acid sequence at
- Chrl 1 :5,249,833 to Chrl 1 :5,250,237, - strand, hg38; c) is complementary with a target sequence within the genomic nucleic acid sequence at
- Chrl 1 :5,254,738 to Chrl 1 :5,255, 164, - strand, hg38; d) is complementary with a target sequence within the genomic nucleic acid sequence at
- Chrl 1 :5,250,094-5,250,237, - strand, hg38; e) is complementary with a target sequence within the genomic nucleic acid sequence at
- Chrl l 5,255,022-5,255,164, - strand, hg38; f) is complementary with a target sequence within the genomic nucleic acid sequence at Chrl 1 : 5,249,833-5,249,927, - strand, hg38; g) is complementary with a target sequence within the genomic nucleic acid sequence at Chrl 1 : 5,254,738-5,254,851, - strand, hg38; h) is complementary with a target sequence within the genomic nucleic acid sequence at
- the targeting domain includes, e.g., consists of, any one of SEQ ID NO: 1 to SEQ ID NO: 72.
- the targeting domain includes, e.g., consists of, any one of SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 28, SEQ ID NO: 34, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 58, SEQ ID NO: 62, SEQ ID NO: 63, or SEQ ID NO: 67.
- the targeting domain includes, e.g., consists of, any one of a) SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 28, SEQ ID NO: 34, SEQ ID NO: 48, SEQ ID NO: 51, or SEQ ID NO: 67; or b) SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 54.
- the gRNA molecule includes a targeting domain which includes, e.g., consists of, SEQ ID NO: 8.
- the gRNA molecule includes a targeting domain which includes, e.g., consists of, SEQ ID NO: 67.
- the gRNA molecule includes a targeting domain which includes (e.g., consists of) a fragment of any of the sequences above. In any of the aforementioned aspects and embodiments, the gRNA molecule may further have regions and/or properties described herein. In embodiments, the gRNA molecule includes a fragment of any of the aforementioned targeting domains. In embodiments, the targeting domain includes, e.g., consists of, 17, 18, 19, or 20 consecutive nucleic acids of any one of the recited targeting domain sequences. In embodiments, the 17, 18, 19, or 20 consecutive nucleic acids of any one of the recited targeting domain sequences are the 17, 18, 19, or 20 consecutive nucleic acids disposed at the 3 ' end of the recited targeting domain sequence.
- the 17, 18, 19, or 20 consecutive nucleic acids of any one of the recited targeting domain sequences are the 17, 18, 19, or 20 consecutive nucleic acids disposed at the 5' end of the recited targeting domain sequence. In other embodiments, the 17, 18, 19, or 20 consecutive nucleic acids of any one of the recited targeting domain sequences do not include either the 5' or 3' nucleic acid of the recited targeting domain sequence. In embodiments, the targeting domain consists of the recited targeting domain sequence.
- a portion of the crRNA and a portion of the tracr hybridize to form a flagpole including SEQ ID NO: 182 or 183.
- the flagpole further includes a first flagpole extension, located 3' to the crRNA portion of the flagpole, wherein said first flagpole extension includes SEQ ID NO: 184.
- the flagpole further includes a second flagpole extension located 3 ' to the crRNA portion of the flagpole and, if present, the first flagpole extension, wherein said second flagpole extension includes SEQ ID NO: 185.
- the tracr includes SEQ ID NO: 224 or SEQ ID NO: 225. In an aspect, including in any of the aforementioned aspects and embodiments, the tracr includes SEQ ID NO: 232, optionally further including, at the 3 ' end, an additional 1, 2, 3, 4, 5, 6, or 7 uracil (U) nucleotides.
- the crRNA includes, from 5' to 3 ', [targeting domain]-: a) SEQ ID NO: 182; b) SEQ ID NO: 183; c) SEQ ID NO: 199; d) SEQ ID NO: 200; e) SEQ ID NO: 201; f) SEQ ID NO: 202; or g) SEQ ID NO: 226.
- the tracr includes, from 5' to 3 ' : a) SEQ ID NO: 187; b) SEQ ID NO: 188; c) SEQ ID NO: 203; d) SEQ ID NO: 204; e) SEQ ID NO: 224; f) SEQ ID NO: 225; g) SEQ ID NO: 232; h) SEQ ID NO: 227; i) (SEQ ID NO:
- the targeting domain and the tracr are disposed on separate nucleic acid molecules.
- the targeting domain and the tracr are disposed on separate nucleic acid molecules, and the nucleic acid molecule including the targeting domain includes SEQ ID NO: 201, optionally disposed immediately 3' to the targeting domain, and the nucleic acid molecule including the tracr includes, e.g., consists of, SEQ ID NO: 224.
- the crRNA portion of the flagpole includes SEQ ID NO: 201 or SEQ ID NO: 202.
- the tracr includes SEQ ID NO: 187 or 188, and optionally, if a first flagpole extension is present, a first tracr extension, disposed 5' to SEQ ID NO: 187 or 188, said first tracr extension including SEQ ID NO: 189.
- the targeting domain and the tracr are disposed on a single nucleic acid molecule, for example, wherein the tracr is disposed 3 ' to the targeting domain.
- the gRNA molecule includes a loop, disposed 3 ' to the targeting domain and 5' to the tracr.
- the loop includes SEQ ID NO: 186.
- the gRNA molecule includes, from 5' to 3 ', [targeting domain]-: (a) SEQ ID NO: 195; (b) SEQ ID NO: 196; (c) SEQ ID NO: 197; (d) SEQ ID NO: 198; (e) SEQ ID NO: 231; or (f) any of (a) to (e), above, further including, at the 3' end, 1, 2, 3, 4, 5, 6 or 7 uracil (U) nucleotides.
- the targeting domain and the tracr are disposed on a single nucleic acid molecule, and wherein said nucleic acid molecule includes, e.g., consists of, said targeting domain and SEQ ID NO: 231, optionally disposed immediately 3 ' to said targeting domain.
- one, or optionally more than one, of the nucleic acid molecules including the gRNA molecule includes: a) one or more, e.g., three, phosphorothioate modifications at the 3' end of said nucleic acid molecule or molecules; b) one or more, e.g., three, phosphorothioate modifications at the 5' end of said nucleic acid molecule or molecules; c) one or more, e.g., three, 2'-0-methyl modifications at the 3' end of said nucleic acid molecule or molecules; d) one or more, e.g., three, 2'-0-methyl modifications at the 5' end of said nucleic acid molecule or molecules; e) a 2' O-methyl modification at each of the 4 th -to-terminal, 3 rd -to-terminal, and 2 nd -to-terminal 3' residues of said nucleic acid molecule or molecules;
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence: (a) a crRNA including, e.g., consisting of, SEQ ID NO: 77, and a tracr including, e.g., consisting of, SEQ ID NO: 224;
- a crRNA including, e.g., consisting of, SEQ ID NO: 78, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence:
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence: (a) a crRNA including, e.g., consisting of. SEQ ID NO: 82, and a tracr including, e.g., consisting of, SEQ ID NO: 224;
- a crRNA including, e.g., consisting of, SEQ ID NO: 82, and a tracr including, e.g., consisting of, SEQ ID NO: 73;
- a crRNA including, e.g., consisting of, SEQ ID NO: 83, and a tracr including, e.g., consisting of, SEQ ID NO: 224; or
- a crRNA including, e.g., consisting of, SEQ ID NO: 83, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence: (a) SEQ ID NO: 84; (b) SEQ ID NO: 85; or (c) SEQ ID NO: 86.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- a crRNA including, e.g., consisting of, SEQ ID NO: 88, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence:
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence: (a) a crRNA including, e.g., consisting of. SEQ ID NO: 92, and a tracr including, e.g., consisting of, SEQ ID NO: 224;
- a crRNA including, e.g., consisting of, SEQ ID NO: 92, and a tracr including, e.g., consisting of, SEQ ID NO: 73;
- a crRNA including, e.g., consisting of, SEQ ID NO: 93, and a tracr including, e.g., consisting of, SEQ ID NO: 224; or
- a crRNA including, e.g., consisting of, SEQ ID NO: 93, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence: (a) SEQ ID NO: 94; (b) SEQ ID NO: 95; or (c) SEQ ID NO: 96.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- a crRNA including, e.g., consisting of, SEQ ID NO: 98, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence: (a) a crRNA including, e.g., consisting of. SEQ ID NO: 102, and a tracr including, e.g., consisting of, SEQ ID NO: 224;
- a crRNA including, e.g., consisting of, SEQ ID NO: 102, and a tracr including, e.g., consisting of, SEQ ID NO: 73;
- a crRNA including, e.g., consisting of, SEQ ID NO: 103, and a tracr including, e.g., consisting of, SEQ ID NO: 224; or
- a crRNA including, e.g., consisting of, SEQ ID NO: 103, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence: (a) SEQ ID NO: 104; (b) SEQ ID NO: 105; or (c) SEQ ID NO: 106.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- a crRNA including, e.g., consisting of, SEQ ID NO: 108, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence: (a) a crRNA including, e.g., consisting of. SEQ ID NO: 112, and a tracr including, e.g., consisting of, SEQ ID NO: 224;
- a crRNA including, e.g., consisting of, SEQ ID NO: 112, and a tracr including, e.g., consisting of, SEQ ID NO: 73;
- a crRNA including, e.g., consisting of, SEQ ID NO: 113, and a tracr including, e.g., consisting of, SEQ ID NO: 224; or
- a crRNA including, e.g., consisting of. SEQ ID NO: 113, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence: (a) SEQ ID NO: 114; (b) SEQ ID NO: 115; or (c) SEQ ID NO: 116.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- a crRNA including, e.g., consisting of, SEQ ID NO: 118, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence: (a) a crRNA including, e.g., consisting of. SEQ ID NO: 122, and a tracr including, e.g., consisting of, SEQ ID NO: 224;
- a crRNA including, e.g., consisting of, SEQ ID NO: 122, and a tracr including, e.g., consisting of, SEQ ID NO: 73;
- a crRNA including, e.g., consisting of, SEQ ID NO: 123, and a tracr including, e.g., consisting of, SEQ ID NO: 224; or
- a crRNA including, e.g., consisting of. SEQ ID NO: 123, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence: (a) SEQ ID NO: 124; (b) SEQ ID NO: 125; or (c) SEQ ID NO: 126.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- a crRNA including, e.g., consisting of, SEQ ID NO: 128, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence: (a) a crRNA including, e.g., consisting of. SEQ ID NO: 132, and a tracr including, e.g., consisting of, SEQ ID NO: 224;
- a crRNA including, e.g., consisting of, SEQ ID NO: 132, and a tracr including, e.g., consisting of, SEQ ID NO: 73;
- a crRNA including, e.g., consisting of, SEQ ID NO: 133, and a tracr including, e.g., consisting of, SEQ ID NO: 224; or
- a crRNA including, e.g., consisting of. SEQ ID NO: 133, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence: (a) SEQ ID NO: 134; (b) SEQ ID NO: 135; or (c) SEQ ID NO: 136.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- a crRNA including, e.g., consisting of, SEQ ID NO: 138, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence: (a) a crRNA including, e.g., consisting of. SEQ ID NO: 142, and a tracr including, e.g., consisting of, SEQ ID NO: 224;
- a crRNA including, e.g., consisting of, SEQ ID NO: 142, and a tracr including, e.g., consisting of, SEQ ID NO: 73;
- a crRNA including, e.g., consisting of, SEQ ID NO: 143, and a tracr including, e.g., consisting of, SEQ ID NO: 224; or
- a crRNA including, e.g., consisting of. SEQ ID NO: 143, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence: (a) SEQ ID NO: 144; (b) SEQ ID NO: 145; or (c) SEQ ID NO: 146.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- a crRNA including, e.g., consisting of, SEQ ID NO: 148, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence: (a) a crRNA including, e.g., consisting of. SEQ ID NO: 152, and a tracr including, e.g., consisting of, SEQ ID NO: 224;
- a crRNA including, e.g., consisting of, SEQ ID NO: 152, and a tracr including, e.g., consisting of, SEQ ID NO: 73;
- a crRNA including, e.g., consisting of, SEQ ID NO: 153, and a tracr including, e.g., consisting of, SEQ ID NO: 224; or
- a crRNA including, e.g., consisting of. SEQ ID NO: 153, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence: (a) SEQ ID NO: 154; (b) SEQ ID NO: 155; or (c) SEQ ID NO: 156.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- a crRNA including, e.g., consisting of, SEQ ID NO: 158, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence: (a) a crRNA including, e.g., consisting of. SEQ ID NO: 162, and a tracr including, e.g., consisting of, SEQ ID NO: 224;
- a crRNA including, e.g., consisting of, SEQ ID NO: 162, and a tracr including, e.g., consisting of, SEQ ID NO: 73;
- a crRNA including, e.g., consisting of, SEQ ID NO: 163, and a tracr including, e.g., consisting of, SEQ ID NO: 224; or
- a crRNA including, e.g., consisting of. SEQ ID NO: 163, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence: (a) SEQ ID NO: 164; (b) SEQ ID NO: 165; or (c) SEQ ID NO: 166.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- a crRNA including, e.g., consisting of, SEQ ID NO: 168, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence:
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence: (a) a crRNA including, e.g., consisting of. SEQ ID NO: 172, and a tracr including, e.g., consisting of, SEQ ID NO: 224;
- a crRNA including, e.g., consisting of, SEQ ID NO: 172, and a tracr including, e.g., consisting of, SEQ ID NO: 73;
- a crRNA including, e.g., consisting of, SEQ ID NO: 173, and a tracr including, e.g., consisting of, SEQ ID NO: 224; or
- a crRNA including, e.g., consisting of, SEQ ID NO: 173, and a tracr including, e.g., consisting of, SEQ ID NO: 73.
- the invention provides a gRNA molecule, including, e.g., consisting of, the sequence: (a) SEQ ID NO: 174; (b) SEQ ID NO: 175; or (c) SEQ ID NO: 176.
- the invention provides a gRNA molecule, including, e.g.. consisting of, the sequence:
- the invention provides a gRNA molecule, wherein: a) when a CRISPR system (e.g., an RNP as described herein) including the gRNA molecule is introduced into a cell, an indel is formed at or near the target sequence complementary to the targeting domain of the gRNA molecule; and/or b) when a CRISPR system (e.g., an RNP as described herein) including the gRNA molecule is introduced into a cell, a deletion is created including sequence, e.g., including substantially all the sequence, between a sequence complementary to the gRNA targeting domain (e.g., at least 90% complementary to the gRNA targeting domain, e.g., fully complementary to the gRNA targeting domain) in the
- the invention provides a gRNA molecule, wherein when a CRISPR system (e.g., an RNP as described herein) including the gRNA molecule is introduced into a population of cells, an indel is formed at or near the target sequence complementary to the targeting domain of the gRNA molecule in at least about 15%, e.g., at least about 17%, e.g., at least about 20%, e.g., at least about 30%, e.g., at least about 40%, e.g., at least about 50%, e.g., at least about 55%, e.g., at least about 60%, e.g., at least about 70%, e.g., at least about 75%, of the cells of the population.
- a CRISPR system e.g., an RNP as described herein
- an indel is formed at or near the target sequence complementary to the targeting domain of the gRNA molecule in at least about 15%, e.g., at least about 17%,
- the indel includes at least one nucleotide of an HBGl promoter region or at least one nucleotide of an HBG2 promoter region. In embodiments, at least about 15% of the cells of the population include an indel which includes at least one nucleotide of an HBGl promoter region and an indel which includes at least one nucleotide of an HBG2 promoter region.
- the percentage of the cells of the population which include an indel which includes at least one nucleotide of an HBGl promoter region differs from percentage of the cells of the population which include an indel which includes at least one nucleotide of an HBG2 promoter region by at least about 5%, e.g., at least about 10%, e.g., at least about 20%, e.g., at least about 30%.
- the indel is as measured by next generation sequencing (NGS).
- the invention provides a gRNA molecule, wherein when a CRISPR system (e.g., an RNP as described herein) including the gRNA molecule is introduced into a cell, expression of fetal hemoglobin is increased in said cell or its progeny, e.g., its erythroid progeny, e.g., its red blood cell progeny.
- a CRISPR system e.g., an RNP as described herein
- the invention provides a gRNA molecule, wherein when a CRISPR system (e.g., an RNP as described herein) including the gRNA molecule is introduced into a cell, expression of fetal hemoglobin is increased in said cell or its progeny, e.g., its erythroid progeny, e.g., its red blood cell progeny.
- the percentage of F cells in said population or population of its progeny is increased by at least about 15%, e.g., at least about 17%, e.g., at least about 20%, e.g., at least about 25%, e.g., at least about 30%, e.g., at least about 35%, e.g., at least about 40%, relative to the percentage of F cells in a population of cells to which the gRNA molecule was not introduced or a population of its progeny, e.g., its erythroid progeny, e.g., its red blood cell progeny.
- said cell or its progeny e.g., its erythroid progeny, e.g., its red blood cell progeny
- said cell or its progeny produces at least about 6 picograms (e.g., at least about 7 picograms, at least about 8 picograms, at least about 9 picograms, at least about 10 picograms, or from about 8 to about 9 picograms, or from about 9 to about 10 picograms) fetal hemoglobin per cell.
- the invention provides a gRNA molecule, wherein when a CRISPR system (e.g., an RNP as described herein) including the gRNA molecule is introduced into a cell, no off-target indels are formed in said cell, e.g., no off-target indels are formed outside of the HBG1 and/or HBG2 promoter regions (e.g., within a gene, e.g., a coding region of a gene), e.g., as detectible by next generation sequencing and/or a nucleotide insertional assay.
- a CRISPR system e.g., an RNP as described herein
- HBG1 and/or HBG2 promoter regions e.g., within a gene, e.g., a coding region of a gene
- the invention provides a gRNA molecule, wherein when a CRISPR system (e.g., an RNP as described herein) including the gRNA molecule is introduced into a population of cells, no off-target indel, e.g., no off-target indel outside of the HBG1 and/or HBG2 promoter regions (e.g., within a gene, e.g., a coding region of a gene), is detected in more than about 5%, e.g., more than about 1%, e.g., more than about 0.1%, e.g., more than about 0.01%, of the cells of the population of cells, e.g., as detectible by next generation sequencing and/or a nucleotide insertional assay.
- a CRISPR system e.g., an RNP as described herein
- the cell is (or population of cells includes) a mammalian, primate, or human cell, e.g., is a human cell, e.g., the cell is (or population of cells includes) an HSPC, e.g., the HSPC is CD34+, e.g., the HSPC is
- the cell is autologous with respect to a patient to be administered said cell. In other embodiments, the cell is allogeneic with respect to a patient to be administered said cell.
- the gRNA molecules, genome editing systems (e.g., CRISPR systems), and/or methods described herein relate to cells, e.g., as described herein, that include or result in one or more of the following properties:
- the cells of a population of cells described herein comprise an indel at or near a genomic DNA sequence complementary to the targeting domain of a gRNA molecule described herein, optionally wherein the indel is selected from an indel listed in Table 2-7, optionally wherein no cell of the population comprises a deletion of a nucleotide disposed between 5,250,092 and 5,249,833, - strand (hg38);
- a cell (e.g., population of cells) described herein is capable of differentiating into a differentiated cell of an erythroid lineage (e.g., a red blood cell), and wherein said differentiated cell exhibits an increased level of fetal hemoglobin, e.g., relative to an unaltered cell (e.g., population of cells);
- a population of cells described herien is capable of differentiating into a population of differentiated cells, e.g., a population of cells of an erythroid lineage (e.g., a population of red blood cells), and wherein said population of differentiated cells has an increased percentage of F cells (e.g., at least about 15%, at least about 20% , at least about 25%, at least about 30%, or at least about 40% higher percentage of F cells) e.g., relative to a population of unaltered cells;
- a cell e.g., population of cells described herein is capable of differentiating into a differentiated cell, e.g., a cell of an erythroid lineage (e.g., a red blood cell), and wherein said differentiated cell
- fetal hemoglobin per cell fetal hemoglobin per cell
- no off-target indels are formed in a cell described herein, e.g., no off-target indels are formed outside of the HBG1 and/or HBG2 promoter regions (e.g., within a gene, e.g., a coding region of a gene), e.g., as detectible by next generation sequencing and/or a nucleotide insertional assay;
- no off-target indel e.g., no off-target indel outside of the HBG1 and/or HBG2 promoter regions (e.g., within a gene, e.g., a coding region of a gene),is detected in more than about 5%, e.g., more than about 1%, e.g., more than about 0.1%, e.g., more than about 0.01%, of the cells of a population of cells described herein, e.g., as detectible by next generation sequencing and/or a nucleotide insertional assay;
- a cell described herien or its progeny is detectible, e.g., detectible in the bone marrow or detectible in the peripheral blood, in a patient to which it is transplanted at more than 16 weeks, more than 20 weeks or more than 24 weeks after transplantation, optionally as detected by detecting an indel at or near a genomic DNA sequence complementary to the targeting domain of a gRNA molecule of any of claims 1-22, optionally wherein the indel is selected from an indel listed in Table 2-7, optionally wherein the indel is a large deletion indel;
- a population of cells described herien is capable of differentiating into a population of differentiated cells, e.g., a population of cells of an erythroid lineage (e.g., a population of red blood cells), and wherein said population of differentiated cells includes a reduced percentage of sickle cells (e.g., at least about 15%, at least about 20% , at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% lower percentage of sickle cells) e.g., relative to a population of unaltered cells; and/or
- a population of differentiated cells e.g., a population of cells of an erythroid lineage (e.g., a population of red blood cells)
- said population of differentiated cells includes a reduced percentage of sickle cells (e.g., at least about 15%, at least about 20% , at least about 25%, at least about 30%, at least about 40%, at least about
- a cell or population of cells described herien is capable of differentiating into a population of differentiated cells, e.g., a population of cells of an erythroid lineage (e.g., a population of red blood cells), and wherein said population of differentiated cells includes cells which produce a reduced level (e.g., at least about 15%, at least about 20% , at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% lower level) of sickle hemoglobin (HbS), e.g., relative to a populaiton of unaltered cells.
- a reduced level e.g., at least about 15%, at least about 20% , at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% lower level
- HbS sickle hemoglobin
- the invention provides a composition including:
- gRNA molecules including a first gRNA molecule described herein, e.g., of any of the aforementioned gRNA aspects and embodiments, and a Cas9 molecule, e.g., described herein; 2) one or more gRNA molecules (including a first gRNA molecule) described herein, e.g., of any of the aforementioned gRNA aspects and embodiments, and nucleic acid encoding a Cas9 molecule, e.g., described herein;
- nucleic acid encoding one or more gRNA molecules (including a first gRNA molecule) described herein, e.g., of any of the aforementioned gRNA aspects and embodiments, and a Cas9 molecule, e.g., described herein;
- nucleic acid encoding one or more gRNA molecules (including a first gRNA molecule) described herein, e.g., of any of the aforementioned gRNA aspects and embodiments, and nucleic acid encoding a Cas9 molecule, e.g., described herein; or
- nucleic acid including sequence encoding a template nucleic acid
- the invention provides a composition including a first gRNA molecule described herein, e.g., of any of the aforementioned gRNA aspects and embodiments, further including a Cas9 molecule, e.g., described herein, e.g., wherein the Cas9 molecule is an active or inactive 5.
- pyogenes Cas9 for example, wherein the Cas9 molecule includes SEQ ID NO: 205.
- the Cas9 molecule includes, e.g., consists of: (a) SEQ ID NO: 233; (b) SEQ ID NO: 234; (c) SEQ ID NO: 235; (d) SEQ ID NO: 236; (e) SEQ ID NO: 237; (f) SEQ ID NO: 238; (g) SEQ ID NO: 239; (h) SEQ ID NO: 240; (i) SEQ ID NO: 241; (j) SEQ ID NO: 242; (k) SEQ ID NO: 243 or (1) SEQ ID NO: 244.
- the first gRNA molecule and Cas9 molecule are present in a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- the invention provides a composition further including a second gRNA molecule; a second gRNA molecule and a third gRNA molecule; or a second gRNA molecule, optionally, a third gRNA molecule, and, optionally, a fourth gRNA molecule, wherein the second gRNA molecule, the optional third gRNA molecule, and the optional fourth gRNA molecule are a gRNA molecule described herein, e.g., are a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments, and wherein each gRNA molecule of the composition is complementary to a different target sequence.
- two or more of the first gRNA molecule, the second gRNA molecule, the optional third gRNA molecule, and the optional fourth gRNA molecule are complementary to target sequences within the same gene or region.
- the first gRNA molecule, the second gRNA molecule, the optional third gRNA molecule, and the optional fourth gRNA molecule are complementary to target sequences not more than 6000 nucleotides, not more than 5000 nucleotides, not more than 500, not more than 400 nucleotides, not more than 300, not more than 200 nucleotides, not more than 100 nucleotides, not more than 90 nucleotides, not more than 80 nucleotides, not more than 70 nucleotides, not more than 60 nucleotides, not more than 50 nucleotides, not more than 40 nucleotides, not more than 30 nucleotides, not more than 20 nucleotides or not more than 10 nucleotides apart.
- two or more of the first gRNA molecule, the second gRNA molecule, the optional third gRNA molecule, and the optional fourth gRNA molecule include at least one gRNA molecule which includes a targeting domain complementary to a target sequence of an HBG1 promoter region and at least one gRNA molecule which includes a targeting domain complementary to a target sequence of an HBG2 promoter region.
- the composition includes (e.g., consists of) a first gRNA molecule and a second gRNA molecule, wherein the first gRNA molecule and second gRNA molecule are: (a) independently selected and target a nondeletional HPFH region, e.g., described herein, and are complementary to different target sequences; (b) independently selected from the gRNA molecules of Table 1, and are complementary to different target sequences; c) independently selected from the gRNA molecules of Table 2, and are complementary to different target sequences; or (d) independently selected from the gRNA molecules of Table 3a and are complementary to different target sequences, (e) independently selected from the gRNA molecules of Table 3b and are complementary to different target sequences; or (f) independently selected from the gRNA molecules of any of the aforementioned aspects and embodiments, and are complementary to different target sequences.
- first gRNA molecule and second gRNA molecule are: (a) independently selected and target a nondeletional HPFH region, e.g.
- the composition includes a first gRNA molecule and a second gRNA molecule, wherein: a) the first gRNA molecule is complementary to a target sequence including at least 1 nucleotide (e.g., including 20 consecutive nucleotides) within: i) Chrl 1:5,249,833 to Chrl 1:5,250,237 (hg38); ii) Chrl 1:5,250,094-5,250,237 (hg38); iii) Chrl l: 5,249,833-5,249,927 (hg38); or iv) Chrl l:5,250,139-5,250,237 (hg38); b) the second gRNA molecule is complementary to a target sequence including at least 1 nucleotide (e.g., comprising 20 consecutive nucleotides) within: i) Chrl 1:5,254,738 to Chrl l:5,255,164 (
- the composition consists of a first gRNA molecule and a second gRNA molecule.
- each of said gRNA molecules is in a ribonuclear protein complex (RNP) with a Cas9 molecule, e.g., described herein.
- RNP ribonuclear protein complex
- the composition includes a template nucleic acid, wherein the template nucleic acid includes a nucleotide that corresponds to a nucleotide at or near the target sequence of the first gRNA molecule.
- the template nucleic acid includes nucleic acid encoding: (a) human beta globin, e.g., human beta globin including one or more of the mutations G16D, E22A and T87Q, or fragment thereof; or (b) human gamma globin, or fragment thereof.
- the composition is formulated in a medium suitable for electroporation.
- each of said gRNA molecules of said composition is in a RNP with a Cas9 molecule described herein, and wherein each of said RNP is at a concentration of less than about lOuM, e.g., less than about 3uM, e.g., less than about luM, e.g., less than about 0.5uM, e.g., less than about 0.3uM, e.g., less than about 0. luM.
- the RNP is at a concentration of about luM.
- the RNP is at a concentration of about 2uM. In embodiments, said concentration is the concentration of RNP in a composition comprising the cells, e.g., as described herein, optionally wherein the composition comprising the cells and the RNP is suitable for electroporation.
- the invention provides a nucleic acid sequence that encodes one or more gRNA molecules described herein, e.g., of any of the aforementioned gRNA molecule aspects and embodiments.
- the nucleic acid includes a promoter operably linked to the sequence that encodes the one or more gRNA molecules, for example, the promoter is a promoter recognized by an RNA polymerase II or RNA polymerase III, or, for example, the promoter is a U6 promoter or an HI promoter.
- the nucleic acid further encodes a Cas9 molecule, for example, a Cas9 molecule that includes, e.g., consists of, any of SEQ ID NO: 205, SEQ ID NO: 233, SEQ ID NO: 234, SEQ ID NO: 235, SEQ ID NO: 236, SEQ ID NO: 237, SEQ ID NO: 238, SEQ ID NO: 239, SEQ ID NO: 240, SEQ ID NO: 241, SEQ ID NO: 242, SEQ ID NO: 243 or SEQ ID NO: 244.
- a Cas9 molecule that includes, e.g., consists of, any of SEQ ID NO: 205, SEQ ID NO: 233, SEQ ID NO: 234, SEQ ID NO: 235, SEQ ID NO: 236, SEQ ID NO: 237, SEQ ID NO: 238, SEQ ID NO: 239, SEQ ID NO: 240, SEQ ID NO: 241, SEQ ID NO: 242, SEQ ID NO: 243 or
- said nucleic acid includes a promoter operably linked to the sequence that encodes a Cas9 molecule, for example, an EF-1 promoter, a CMV IE gene promoter, an EF-1 a promoter, an ubiquitin C promoter, or a
- PGK phosphoglycerate kinase
- the invention provides a vector including the nucleic acid of any of the aforementioned nucleic acid aspects and embodiments.
- the vector is selected from the group consisting of a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a herpes simplex virus (HS V) vector, a plasmid, a minicircle, a nanoplasmid, and an RNA vector.
- the invention provides a method of altering a cell (e.g., a population of cells), (e.g., altering the structure (e.g., sequence) of nucleic acid) at or near a target sequence within said cell, including contacting (e.g., introducing into) said cell (e.g., population of cells) with: 1) one or more gRNA molecules described herein (e.g., of any of the aforementioned gRNA molecule aspects and embodiments) and a Cas9 molecule, e.g., described herein;
- nucleic acid encoding a Cas9 molecule e.g., described herein
- nucleic acid encoding one or more gRNA molecules described herein e.g., of any of the aforementioned gRNA molecule aspects and embodiments
- Cas9 molecule e.g., described herein
- nucleic acid encoding one or more gRNA molecules described herein e.g., of any of the aforementioned gRNA molecule aspects and embodiments
- nucleic acid encoding a Cas9 molecule e.g., described herein;
- nucleic acid including sequence encoding a template nucleic acid
- composition described herein e.g., a composition of any of the aforementioned composition aspects and embodiments; or
- a vector described herein e.g., a vector of any of the aforementioned vector aspects and embodiments.
- the gRNA molecule or nucleic acid encoding the gRNA molecule, and the Cas9 molecule or nucleic acid encoding the Cas9 molecule are formulated in a single composition.
- the gRNA molecule or nucleic acid encoding the gRNA molecule, and the Cas9 molecule or nucleic acid encoding the Cas9 molecule are formulated in more than one composition. In an aspect, the more than one composition are delivered simultaneously or sequentially.
- the cell is an animal cell, for example, the cell is a mammalian, primate, or human cell, for example, the cell is a hematopoietic stem or progenitor cell (HSPC) (e.g., a population of HSPCs), for example, the cell is a CD34+ cell, for example, the cell is a CD34+CD90+ cell.
- HSPC hematopoietic stem or progenitor cell
- the cell is a CD34+ cell
- the cell is a CD34+CD90+ cell.
- the cell is disposed in a composition including a population of cells that has been enriched for CD34+ cells.
- the cell e.g.
- the cell is autologous or allogeneic, e.g., autologous, with respect to a patient to be administered said cell.
- a) the altering results in an indel at or near a genomic DNA sequence complementary to the targeting domain of the one or more gRNA molecules; or b) the altering results in a deletion including sequence, e.g., substantially all the sequence, between a sequence complementary to the targeting domain of the one or more gRNA molecules (e.g., at least 90% complementary to the gRNA targeting domain, e.g., fully complementary to the gRNA targeting domain) in the HBG1 promoter region and a sequence complementary to the targeting domain of the one or more gRNA molecules (e.g., at least 90% complementary to the gRNA targeting domain, e.g., fully complementary to the gRNA targeting domain) in the HBG2 promoter region.
- sequence complementary to the targeting domain of the one or more gRNA molecules e.g., at least 90% complementary to the gRNA targeting domain, e.g., fully complementary to the gRNA targeting domain
- the indel is an insertion or deletion of less than about 40 nucleotides, e.g., less than 30 nucleotides, e.g., less than 20 nucleotides, e.g., less than 10 nucleotides, for example, is a single nucleotide deletion.
- the method results in a population of cells wherein at least about 15%, e.g., at least about 17%, e.g., at least about 20%, e.g., at least about 30%, e.g., at least about 40%, e.g., at least about 50%, e.g., at least about 55%, e.g., at least about 60%, e.g., at least about 70%, e.g., at least about 75% of the population have been altered, e.g., include an indel.
- the altering results in a cell (e.g., population of cells) that is capable of differentiating into a differentiated cell of an erythroid lineage (e.g., a red blood cell), and wherein said differentiated cell exhibits an increased level of fetal hemoglobin, e.g., relative to an unaltered cell (e.g., population of cells).
- a cell e.g., population of cells
- an erythroid lineage e.g., a red blood cell
- an unaltered cell e.g., population of cells
- the altering results in a population of cells that is capable of differentiating into a population of differentiated cells, e.g., a population of cells of an erythroid lineage (e.g., a population of red blood cells), and wherein said population of differentiated cells has an increased percentage of F cells (e.g., at least about 15%, at least about 20% , at least about 25%, at least about 30%, or at least about 40% higher percentage of F cells) e.g., relative to a population of unaltered cells.
- a population of differentiated cells e.g., a population of cells of an erythroid lineage (e.g., a population of red blood cells)
- F cells e.g., at least about 15%, at least about 20% , at least about 25%, at least about 30%, or at least about 40% higher percentage of F cells
- the altering results in a cell that is capable of differentiating into a differentiated cell, e.g., a cell of an erythroid lineage (e.g., a red blood cell), and wherein said differentiated cell produces at least about 6 picograms (e.g., at least about 7 picograms, at least about 8 picograms, at least about 9 picograms, at least about 10 picograms, or from about 8 to about 9 picograms, or from about 9 to about 10 picograms) fetal hemoglobin per cell.
- the invention provides a cell, altered by a method described herein, for example, a method of any of the aforementioned method aspects and embodiments.
- the invention provides a cell, obtainable by a method described herein, for example, a method of any of the aforementioned method aspects and embodiments.
- the invention provides a cell, including a first gRNA molecule described herein, e.g., of any of the aforementioned gRNA molecule aspects or embodiments, or a composition described herein, e.g., of any of the aforementioned composition aspects or embodiments, a nucleic acid described herein, e.g., of any of the aforementioned nucleic acid aspects or embodiments, or a vector described herein, e.g., of any of the aforementioned vector aspects or embodiments.
- the cell further includes a Cas9 molecule, e.g., described herein, e.g., a Cas9 molecule that includes any one of SEQ ID NO: 205, SEQ ID NO: 233, SEQ ID NO: 234, SEQ ID NO: 235, SEQ ID NO: 236, SEQ ID NO: 237, SEQ ID NO: 238, SEQ ID NO: 239, SEQ ID NO: 240, SEQ ID NO: 241, SEQ ID NO: 242, SEQ ID NO: 243 or SEQ ID NO: 244.
- a Cas9 molecule e.g., described herein, e.g., a Cas9 molecule that includes any one of SEQ ID NO: 205, SEQ ID NO: 233, SEQ ID NO: 234, SEQ ID NO: 235, SEQ ID NO: 236, SEQ ID NO: 237, SEQ ID NO: 238, SEQ ID NO: 239, SEQ ID NO: 240, SEQ ID NO: 241, SEQ ID
- the cell includes, has included, or will include a second gRNA molecule described herein, e.g., of any of the aforementioned gRNA molecule aspects or embodiments, or nucleic acid encoding said gRNA molecule, wherein the first gRNA molecule and second gRNA molecule include nonidentical targeting domains.
- expression of fetal hemoglobin is increased in said cell or its progeny (e.g., its erythroid progeny, e.g., its red blood cell progeny) relative to a cell or its progeny of the same cell type that has not been modified to include a gRNA molecule.
- progeny e.g., its erythroid progeny, e.g., its red blood cell progeny
- the cell is capable of differentiating into a differentiated cell, e.g., a cell of an erythroid lineage (e.g., a red blood cell), and wherein said differentiated cell exhibits an increased level of fetal hemoglobin, e.g., relative to a cell of the same type that has not been modified to include a gRNA molecule.
- a differentiated cell e.g., a cell of an erythroid lineage (e.g., a red blood cell)
- said differentiated cell exhibits an increased level of fetal hemoglobin, e.g., relative to a cell of the same type that has not been modified to include a gRNA molecule.
- the differentiated cell e.g., cell of an erythroid lineage, e.g., red blood cell
- the differentiated cell produces at least about 6 picograms (e.g., at least about 7 picograms, at least about 8 picograms, at least about 9 picograms, at least about 10 picograms, or from about 8 to about 9 picograms, or from about 9 to about 10 picograms) fetal hemoglobin, e.g., relative to a differentiated cell of the same type that has not been modified to include a gRNA molecule.
- the cell has been contacted, e.g., contacted ex vivo, with a stem cell expander, for example, a stem cell expander selected from: a) (lr,4r)-N 1 -(2-benzyl-7-(2-methyl-2H-tetrazol-5-yl)- 9H-pyrirmdo[4,5-b]indol-4-yl)cyclohexane-l,4-diamine; b) methyl 4-(3-piperidin-l-ylpropylamino)- 9H-pyrimido[4,5-b]indole-7-carboxylate; c) 4-(2-(2-(benzo[b]thiophen-3-yl)-9-isopropyl-9H-purin-6- ylamino)ethyl)phenol; d) (S)-2-(6-(2-(lH-ind
- the stem cell expander is (S)-2-(6-(2-(lH-indol-3-yl)ethylamino)-2-(5-fluoropyridin-3-yl)-9H-purin-9-yl)propan-l- ol.
- the cell includes: a) an indel at or near a genomic DNA sequence complementary to the targeting domain of a gRNA molecule described herein, e.g., of any of the aforementioned gRNA molecule aspects or embodiments; or b) a deletion including sequence, e.g., substantially all the sequence, between a sequence complementary to the targeting domain of a gRNA molecule described herein, e.g., of any of the aforementioned gRNA molecule aspects or embodiments (e.g., at least 90% complementary to the gRNA targeting domain, e.g., fully complementary to the gRNA targeting domain) in the HBG1 promoter region and a sequence complementary to the targeting domain of a gRNA molecule described herein, e.g., of any of the aforementioned gRNA molecule aspects or embodiments (e.g., at least 90% complementary to the gRNA targeting domain, e.g., at least 90% complementary to the gRNA targeting domain, e.g.
- the indel is an insertion or deletion of less than about 40 nucleotides, e.g., less than 30 nucleotides, e.g., less than 20 nucleotides, e.g., less than 10 nucleotides, for example, the indel is a single nucleotide deletion.
- the cell is an animal cell, for example, the cell is a mammalian, a primate, or a human cell.
- the cell is a hematopoietic stem or progenitor cell (HSPC) (e.g., a population of HSPCs), e.g., the cell is a CD34+ cell, e.g., the cell is a CD34+CD90+ cell.
- HSPC hematopoietic stem or progenitor cell
- the cell e.g. population of cells
- the cell has been isolated from bone marrow, mobilized peripheral blood, or umbilical cord blood.
- the cell is autologous with respect to a patient to be administered said cell.
- the cell is allogeneic with respect to a patient to be administered said cell.
- the invention provides a population of cells described herein, e.g., a population of cells that include a cell described herein, e.g., a cell of any of the aforementioned cell aspects and embodiments.
- the invention provides a population of cells, wherein at least about 50%, e.g., at least about 60%, e.g., at least about 70%, e.g., at least about 80%, e.g., at least about 90% (e.g., at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%) of the cells of the population are a cell described herein, e.g., a cell of any of the aforementioned cell aspects and embodiments.
- the population of cells (e.g., a cell of the population of cells) is capable of differentiating into a population of differentiated cells, e.g., a population of cells of an erythroid lineage (e.g., a population of red blood cells), and wherein said population of differentiated cells has an increased percentage of F cells (e.g., at least about 15%, at least about 17%, at least about 20%, at least about 25%, at least about 30%, or at least about 40% higher percentage of F cells) e.g., relative to a population of unmodified cells of the same type.
- a population of differentiated cells e.g., a population of cells of an erythroid lineage (e.g., a population of red blood cells)
- F cells e.g., at least about 15%, at least about 17%, at least about 20%, at least about 25%, at least about 30%, or at least about 40% higher percentage of F cells
- the F cells of the population of differentiated cells produce an average of at least about 6 picograms (e.g., at least about 7 picograms, at least about 8 picograms, at least about 9 picograms, at least about 10 picograms, or from about 8 to about 9 picograms, or from about 9 to about 10 picograms) fetal hemoglobin per cell.
- at least about 6 picograms e.g., at least about 7 picograms, at least about 8 picograms, at least about 9 picograms, at least about 10 picograms, or from about 8 to about 9 picograms, or from about 9 to about 10 picograms
- fetal hemoglobin per cell fetal hemoglobin per cell.
- the invention provides population of cells, including: 1) at least le6 CD34+ cells/kg body weight of the patient to whom the cells are to be administered; 2) at least 2e6 CD 34+ cells/kg body weight of the patient to whom the cells are to be administered; 3) at least 3e6 CD 34+ cells/kg body weight of the patient to whom the cells are to be administered; 4) at least 4e6 CD34+ cells/kg body weight of the patient to whom the cells are to be administered; or 5) from 2e6 to 10e6 CD34+ cells/kg body weight of the patient to whom the cells are to be administered.
- At least about 40%, e.g., at least about 50%, (e.g., at least about 60%, at least about 70%, at least about 80%, or at least about 90%) of the cells of the population are CD34+ cells.
- at least about 5%, e.g., at least about 10%, e.g., at least about 15%, e.g., at least about 20%, e.g., at least about 30% of the cells of the population are CD34+CD90+ cells.
- the population of cells is derived from umbilical cord blood, peripheral blood (e.g., mobilized peripheral blood), or bone marrow, e.g., is derived from bone marrow.
- the population of cells includes, e.g., consists of, mammalian cells, e.g., human cells.
- the population of cells is autologous relative to a patient to which it is to be administered. In other embodiments, the population of cells is allogeneic relative to a patient to which it is to be administered.
- the invention provides a composition including a cell described herein, e.g., a cell of any of the aforementioned cell aspects and embodiments, or a population of cells described herein, e.g., a population of cells of any of the aforementioned population of cell aspects and embodiments.
- the composition includes a pharmaceutically acceptable medium, e.g., a pharmaceutically acceptable medium suitable for cryopreservation.
- the invention provides a method of treating a hemoglobinopathy, including administering to a patient a cell described herein, e.g., a cell of any of the aforementioned cell aspects and embodiments, a population of cells described herein, e.g., a population of cells of any of the aforementioned population of cell aspects and embodiments, or a composition described herein, e.g., a composition of any of the aforementioned composition aspects and embodiments.
- a cell described herein e.g., a cell of any of the aforementioned cell aspects and embodiments
- a population of cells described herein e.g., a population of cells of any of the aforementioned population of cell aspects and embodiments
- a composition described herein e.g., a composition of any of the aforementioned composition aspects and embodiments.
- the invention provides a method of increasing fetal hemoglobin expression in a mammal, including administering to a patient a cell described herein, e.g., a cell of any of the aforementioned cell aspects and embodiments, a population of cells described herein, e.g., a population of cells of any of the aforementioned population of cell aspects and embodiments, or a composition described herein, e.g., a composition of any of the aforementioned composition aspects and embodiments.
- the hemoglobinopathy is beta-thalassemia.
- the hemoglobinopathy is sickle cell disease.
- the invention provides a method of preparing a cell (e.g., a population of cells) including: (a) providing a cell (e.g., a population of cells) (e.g., a HSPC (e.g., a population of HSPCs));
- a first gRNA molecule e.g., described herein, e.g., a first gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments; a nucleic acid molecule encoding a first gRNA molecule; a composition described herein, e.g., a composition of any of the aforementioned composition aspects and embodiments; or a vector described herein, e.g., a vector of any of the aforementioned aspects and embodiments.
- said cell e.g., population of cells
- a differentiated cell e.g., population of differentiated cells
- a differentiated cell e.g., a cell of an erythroid lineage (e.g., population of cells of an erythroid lineage), e.g., a red blood cell (e.g., a population of red blood cells)
- said differentiated cell e.g., population of differentiated cells
- produces increased fetal hemoglobin e.g., relative to the same cell which has not been subjected to step (c).
- the stem cell expander is: a) (lr,4r)-Nl-(2-benzyl-7-(2-methyl-2H-tetrazol-5-yl)-9H- pyrimido[4,5-b]indol-4-yl)cyclohexane-l,4-diamine; b) methyl 4-(3-piperidin-l-ylpropylamino)-9H- pyrimido[4,5-b]indole-7-carboxylate; c) 4-(2-(2-(benzo[b]thiophen-3-yl)-9-isopropyl-9H-purin-6- ylamino)ethyl)phenol; d) (S)-2-(6-(2-(lH-indol-3-yl)ethylamino)-2-(5-fluoropyridin-3-yl)-9H-purin-9- yl)propan-l-ol; or e) combinations
- the stem cell expander is (S)-2-(6-(2-(lH-indol-3-yl)ethylamino)-2-(5-fluoropyridin-3-yl)-9H-purin-9-yl)propan-l- ol.
- the cell culture medium includes thrombopoietin (Tpo), Flt3 ligand (Flt-3L), and human stem cell factor (SCF).
- the cell culture medium further includes human interleukin- 6 (IL-6).
- the cell culture medium includes thrombopoietin (Tpo), Flt3 ligand (Flt-3L), and human stem cell factor (SCF) each at a concentration ranging from about 10 ng/niL to about 1000 ng/mL, for example, each at a concentration of about 50 ng/niL, for example, each at a concentration of 50 ng/mL.
- the cell culture medium includes human interleukin-6 (IL-6) at a concentration ranging from about 10 ng/mL to about 1000 ng/mL, for example, at a concentration of about 50 ng/mL, for example, at a concentration of 50 ng/mL.
- IL-6 human interleukin-6
- the cell culture medium includes a stem cell expander at a concentration ranging from about 1 nM to about 1 niM, for example, at a concentration ranging from about 1 uM to about 100 nM, for example, at a concentration ranging from about 500 nM to about 750 nM.
- the cell culture medium includes a stem cell expander at a concentration of about 500 nM, e.g., at a concentration of 500 nM.
- the cell culture medium includes a stem cell expander at a concentration of about 750 nM, e.g., at a concentration of 750 nM.
- the culturing of step (b) includes a period of culturing before the introducing of step (c), for example, the period of culturing before the introducing of step (c) is at least 12 hours, e.g., is for a period of about 1 day to about 12 days, e.g., is for a period of about 1 day to about 6 days, e.g., is for a period of about 1 day to about 3 days, e.g., is for a period of about 1 day to about 2 days, e.g., is for a period of about 2 days.
- the period of culturing before the introducing of step (c) is at least 12 hours, e.g., is for a period of about 1 day to about 12 days, e.g., is for a period of about 1 day to about 6 days, e.g., is for a period of about 1 day to about 3 days, e.g., is for a period of about 1 day to about 2 days,
- the culturing of step (b) includes a period of culturing after the introducing of step (c), for example, the period of culturing after the introducing of step (c) is at least 12 hours, e.g., is for a period of about 1 day to about 12 days, e.g., is for a period of about 1 day to about 6 days, e.g., is for a period of about 2 days to about 4 days, e.g., is for a period of about 2 days or is for a period of about 3 days or is for a period of about 4 days.
- the population of cells is expanded at least 4-fold, e.g., at least 5- fold, e.g, at least 10-fold, e.g., relative to cells which are not cultured according to step (b).
- the introducing of step (c) includes an electroporation.
- the electroporation includes 1 to 5 pulses, e.g., 1 pulse, and wherein each pulse is at a pulse voltage ranging from 700 volts to 2000 volts and has a pulse duration ranging from 10 ms to 100 ms.
- the electroporation includes, e.g., consists of, 1 pulse.
- the pulse (or more than one pulse) voltage ranges from 1500 to 1900 volts, e.g., is 1700 volts.
- the pulse duration of the one pulse or more than one pulse ranges from 10 ms to 40 ms, e.g., is 20 ms.
- the cell (e.g., population of cells) provided in step (a) is a human cell (e.g., a population of human cells).
- the cell (e.g., population of cells) provided in step (a) is isolated from bone marrow, peripheral blood (e.g., mobilized peripheral blood) or umbilical cord blood.
- the cell (e.g., population of cells) provided in step (a) is isolated from bone marrow, e.g., is isolated from bone marrow of a patient suffering from a hemoglobinopathy.
- the population of cells provided in step (a) is enriched for CD 34+ cells.
- the cell e.g., population of cells
- the cell subsequent to the introducing of step (c), is cryopreserved.
- the cell includes: a) an indel at or near a genomic DNA sequence
- a sequence complementary to the targeting domain of the first gRNA molecule e.g., at least 90% complementary to the gRNA targeting domain, e.g., fully complementary to the gRNA targeting domain
- a cell e.g., a population of cells
- at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% of the cells of the population of cells include an indel at or near a genomic DNA sequence complementary to the targeting domain of the first gRNA molecule.
- the invention provides a cell (e.g., population of cells), obtainable by a method of preparing a cell (e.g., a population of cells) described herein, e.g., described in any of the aforementioned method of preparing a cell aspects and embodiments.
- the invention provides a method of treating a hemoglobinopathy in a human patient, including administering to a human patient a composition including a cell described herein, e.g., a cell of any of the aforementioned cell aspects and embodiments; or a population of cells described herein, e.g., a population of cells of any of the aforementioned population of cell aspects and embodiments.
- the hemoglobinopathy is beta-thalassemia.
- the hemoglobinopathy is sickle cell disease.
- the invention provides a method of increasing fetal hemoglobin expression in a human patient, including administering to said human patient a composition including a cell described herein, e.g., a cell of any of the aforementioned cell aspects and embodiments; or a population of cells described herein, e.g., a population of cells of any of the aforementioned population of cell aspects and embodiments.
- a composition including a cell described herein, e.g., a cell of any of the aforementioned cell aspects and embodiments; or a population of cells described herein, e.g., a population of cells of any of the aforementioned population of cell aspects and embodiments.
- the human patients has beta-thalassemia.
- the human patient has sickle cell disease.
- the human patient is administered a composition including at least about le6 cells (e.g., cells as described herein) per kg body weight of the human patient, e.g., at least about le6 CD34+ cells (e.g., cells as described herein) per kg body weight of the human patient.
- le6 cells e.g., cells as described herein
- le6 CD34+ cells e.g., cells as described herein
- the human patient is administered a composition including at least about 2e6 cells (e.g., cells as described herein) per kg body weight of the human patient, e.g., at least about 2e6 CD34+ cells (e.g., cells as described herein) per kg body weight of the human patient.
- a composition including at least about 2e6 cells (e.g., cells as described herein) per kg body weight of the human patient, e.g., at least about 2e6 CD34+ cells (e.g., cells as described herein) per kg body weight of the human patient.
- the human patient is administered a composition including about 2e6 cells (e.g., cells as described herein) per kg body weight of the human patient, e.g., about 2e6 CD34+ cells (e.g., cells as described herein) per kg body weight of the human patient.
- a composition including about 2e6 cells (e.g., cells as described herein) per kg body weight of the human patient, e.g., about 2e6 CD34+ cells (e.g., cells as described herein) per kg body weight of the human patient.
- the human patient is administered a composition including at least about 3e6 cells (e.g., cells as described herein) per kg body weight of the human patient, e.g., at least about 3e6 CD34+ cells (e.g., cells as described herein) per kg body weight of the human patient.
- 3e6 cells e.g., cells as described herein
- 3e6 CD34+ cells e.g., cells as described herein
- the human patient is administered a composition including about 3e6 cells (e.g., cells as described herein) per kg body weight of the human patient, e.g., about 3e6 CD34+ cells (e.g., cells as described herein) per kg body weight of the human patient.
- 3e6 cells e.g., cells as described herein
- 3e6 CD34+ cells e.g., cells as described herein
- the human patient is administered a composition including from about 2e6 to about 10e6 cells (e.g., cells as described herein) per kg body weight of the human patient, e.g., from about 2e6 to about 10e6 CD34+ cells (e.g., cells as described herein) per kg body weight of the human patient.
- a composition including from about 2e6 to about 10e6 cells (e.g., cells as described herein) per kg body weight of the human patient, e.g., from about 2e6 to about 10e6 CD34+ cells (e.g., cells as described herein) per kg body weight of the human patient.
- the invention provides: a gRNA molecule described herein, e.g., a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments; a composition described herein, e.g., a composition of any of the aforementioned composition aspects and embodiments, a nucleic acid described herein, e.g., a nucleic acid of any of the aforementioned nucleic acid aspects and embodiments; a vector described herein, e.g., a vector of any of the aforementioned vector aspects and embodiments; a cell described herein, e.g., a cell of any of the aforementioned cell aspects and embodiments; or a population of cells described herein, e.g., a population of cells of any of the aforementioned population of cells aspects and embodiments, for use as a medicament.
- a gRNA molecule described herein e.g., a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments
- the invention provides: a gRNA molecule described herein, e.g., a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments; a composition described herein, e.g., a composition of any of the aforementioned composition aspects and embodiments, a nucleic acid described herein, e.g., a nucleic acid of any of the aforementioned nucleic acid aspects and embodiments; a vector described herein, e.g., a vector of any of the aforementioned vector aspects and embodiments; a cell described herein, e.g., a cell of any of the aforementioned cell aspects and embodiments; or a population of cells described herein, e.g., a population of cells of any of the aforementioned population of cells aspects and embodiments, for use in the manufacture of a medicament.
- a gRNA molecule described herein e.g., a gRNA molecule of any of the aforementioned gRNA molecule aspects
- the invention provides: a gRNA molecule described herein, e.g., a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments; a composition described herein, e.g., a composition of any of the aforementioned composition aspects and embodiments, a nucleic acid described herein, e.g., a nucleic acid of any of the aforementioned nucleic acid aspects and embodiments; a vector described herein, e.g., a vector of any of the aforementioned vector aspects and embodiments; a cell described herein, e.g., a cell of any of the aforementioned cell aspects and embodiments; or a population of cells described herein, e.g., a population of cells of any of the aforementioned population of cells aspects and embodiments, for use in the treatment of a disease.
- a gRNA molecule described herein e.g., a gRNA molecule of any of the aforementioned gRNA molecule aspects
- the invention provides: a gRNA molecule described herein, e.g., a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments; a composition described herein, e.g., a composition of any of the aforementioned composition aspects and embodiments, a nucleic acid described herein, e.g., a nucleic acid of any of the aforementioned nucleic acid aspects and embodiments; a vector described herein, e.g., a vector of any of the aforementioned vector aspects and embodiments; a cell described herein, e.g., a cell of any of the aforementioned cell aspects and embodiments; or a population of cells described herein, e.g., a population of cells of any of the aforementioned population of cells aspects and embodiments, for use in the treatment of a disease, wherein the disease is a hemoglobinopathy, for example, beta-thalassemia or sickle cell disease.
- a hemoglobinopathy for example,
- Fig 1 HbF induction 7 days after editing.
- the gRNA G8 against exon 2 of BCLl 1A serves as a positive control.
- a dotted line at 17% indicates the threshold level chosen for the analysis.
- Various grey shading, as indicated in the legend relate the degree of HbF induction to the degree of editing in the HBGl or HBG2 target loci.
- Fig 2 Editing efficiency at the HBGl target locus. For each gRNA tested the percentage of indels detected by NGS is shown as mean with error bar indicating standard deviation. The gRNA G8 against exon 2 of BCLl 1 A serves as a positive control. Two guides for which no NGS data was obtained are indicated by arrowheads.
- Fig 3 Editing efficiency at the HBG2 target locus. For each gRNA tested the percentage of indels detected by NGS is shown as mean with error bar indicating standard deviation. The gRNA G8 against exon 2 of BCLl 1 A serves as a positive control. Sixteen guides for which no NGS data was obtained are indicated by arrowheads.
- Fig 4 Overview of the location of high performing gRNA target sequences (e.g., >17% HbF upregulation at Day 7), known non-deletional HPFH polymorphisms and transcription factor binding sites in the HBGl promoter area.
- Figure discloses SEQ ID NOS 293-312, respectively, in order of appearance.
- Fig 5 Overview of the location of high-performing gRNA target sequences (e.g., >17% HbF upregulation at Day 7), known non-deletional HPFH polymorphisms and transcription factor binding sites in the HBG2 promoter area.
- Figure discloses SEQ ID NOS 313-332, respectively, in order of appearance.
- Fig. 6 Editing efficiency at targeted B2M locus in CD34+ HSPCs by different Cas9 variants, as evaluated by NGS and Flow cytometry.
- NLS SV40 NLS
- His6 SEQ ID NO: 247) or His8 (SEQ ID NO: 248) refers to 6 (SEQ ID NO: 247) or 8 (SEQ ID NO: 248) histidine residues, respectively
- TEV tobacco etch virus cleavage site
- Cas9 wild type S. pyogenes Cas9 - mutations or variants are as indicated).
- Fig. 7 Detection and quantification of HbF positive cells by flow cytometry at 7 (black bars), 14
- Fig. 9 Visualization of PCR products from the indicated reaction: PI, P2 or P3, as described in the Examples, from cells following electroporation with RNPs containing sgRNA of the indicated targeting domain or control cells not treated with sgRNA. Expected products are as follows. P 1 : 7.7 kb for wild type/small indel allele or 4.9 kb inversion allele, 2.8 kb for 4.9 kb deleted allele. P2: 3.8 kb for wild type/small indel allele, no product for 4.9 kb deletion or 4.9 kb inversion allele.
- Fig. 10 Schematic indicating genomic location of primer and probe binding sites for the digital droplet PCR assay to quantify 4.9 kb deletions.
- the primers (5.2 kb Fwd and 5.2 kb Rev) and probe (FAM probe) bind to an intergenic site downstream of HBG2 and upstream of HBGl.
- the probe has a second binding site upstream of HBG2, but that region is not bound by the primers.
- the areas in which the targeting domains in the HBGl and HBG2 promotors are located are indicated. If the sequence interviening the two targeting domain regions is deleted, the primer/probe binding site between HBGl and HBG2 would be lost.
- FIG. 12 Percent editing of sorted HSPC subpopulations following electroporation with RNPs containing sgRNA of the GCR-0067 targeting domain.
- HBGl indel and HBG2 indel indicates the percentage of small insertions and deletions identified by next generation sequencing of PCR amplicons at or near the HBGl or HBG2 promotor region targeting domain, respectively (note that alleles with the previously described 4.9 kb deletion or inversion are not amplified).
- HBG1-HBG2 deletion indicates the percentage of alleles with the 4.9 kb deletion, as determined by the digital droplet PCR assay described in the Examples. Total editing is an approximation calculated by the percentage of HBG1-HBG2 deletion added to the percentage without HBG1-HBG2 deletion times the percentage HBG2 indel. Fig.
- Figure 13A shows the sum of all indels observed at the HBG1 locus in the stated cell type after introduction of sgRNA comprising the targeting domain of GCR-0067. Indels are arranged with most frequently observed indels at the top of each bar. Not quantified in this assay is the fraction of cells comprising the large 4.9kb deletion between HBG1 and HBG2 loci. The number within the bar of each of the most prevalent indels indicates the number of nucleotide differences from the wild-type genomic sequence (- indicates deletion; + indicates insertion).
- Figure 13B shows the sum of all indels observed at the HBG2 locus in the stated cell type after introduction of sgRNA comprising the targeting domain of GCR-0067.
- Indels are arranged with most frequently observed indels at the top of each bar. Not quantified in this assay is the fraction of cells comprising the large 4.9kb deletion between HBG1 and HBG2 loci. The number within the bar of each of the most prevalent indels indicates the number of nucleotide differences from the wild-type genomic sequence (- indicates deletion; + indicates insertion).
- CMP CD34+CD45RA-CD38+ cells
- MPP CD34+CD45RA-CD38- CD90-CD49f- cells
- ST-HSC CD34+CD45RA-CD38-CD90-CD49f+ cells
- LT-HSC CD34+CD45RA-CD38-CD90+CD49f+ cells.
- Fig. 15 Fold proliferation of total nucleated cells (TNC), CD34 positive cells (CD34+) and CD34 and CD90 dual positive cells (CD34+CD90+), as indicated, in medium comprising compound 4, following electroporation with RNPs containing sgRNA of the GCR-0067 targeting domain or control cultures not treated with sgRNA.
- Fig. 16 Representative gating of cellular populations by flow cytometry. Dot plots of cellular fluorescence following immuno staining targeted to the indicated cell surface markers, or isotype control (isotype), are shown. Gates indicated with the bold boxes were used to quantify the percentage of the indicated population and were set to exclude isotype control labeled cells. Only viable cells pre-gated as DAPI negative and within the cellular forward scatter and side scatter gates are shown and are derived from donor C electroporated with Cas9 alone. Fig.
- Fig. 18A CE-MS quantification of globin subunits in mock edited HSCs derived from sickle cell disease patient (SCD1) mock edited with Cas9 and no sgRNA. After cells are differentiated into erythroid lineage, cells showed normal level of a-globin, no normal b-globin due to sickle homozygosity, high level of sickle b-globin subunit, and low level of fetal g-globin.
- Fig. 18B CE-MS quantification of globin subunits in genome-editied HSPCs derived from sickle cell patients (SCD1). After editing the HSCs, erythroid cells derived from the sample patient demonstrated 40% upregulation of fetal g-globin and a concurrent 50% downregulation of sickle b- globin subunit.
- Fig. 19 Schematic protocol for studying engraftment of gene edited cells.
- Five hundred thousand human CD34+ cells were either mock edited with gRNA or gene edited with sgl 128, followed by injection into 2 Gy irradiated NOD.Cg-/Wc sc '3 ⁇ 42rg im7w? 7SzJ (NSG) recipients.
- Mice were bled at 4, 8, 12, 16 weeks and bone marrow cells were harvested at 16 weeks post- transplant.
- Fig. 20 Bone marrow reconstitution at 16 weeks post-transplant using the experimental protocol shown in Figure 19.
- Fig. 22 Schematic diagram of transplant study to evaluate stem cell function of HSCs edited with sgRNAs from the gamma globin promoter region (sg-G0008, sg-G0051, sg-GOOlO, sg-G0048, sg- G0067) in comparison to gRNA from the erythroid-specific enhancer region of the BCLl 1 A gene (sg- Gl 128; also referred to as sgl 128).
- Cells were left in culture 24 hours post electroporation. Culture conditions both before and after electroporation were StemSpan SFEM+IL6, SCF, TPO, Flt3L; 750 nM Compound 4.
- Fig. 23 Human engraftment and lineage analysis over 20 weeks in NSG mice. Figure 23A)
- Bone marrow analysis Figure 23C) Bone marrow analysis of human cells at week 9; Figure 23D) human CD45+ engraftment and lineage distribution of human cells in bone marrow at week 9; Figure 23E) human CD45+ engraftment in bone marrow at week 20 post engraftment; Figure 23F) Lineage distribution of engrafted cells in the bone marrow at 20 weeks.
- Fig. 26 High editing efficiency was maintained pre- and post-transplantation.
- Pre-Xpt editing efficiency and indel pattern of individual sgRNA in human CD34+ cells as measured by NGS upon editing but prior to transplantation.
- 8 wks Post-Xpt editing efficiency and indel pattern in human CD34+ cells 8 weeks after bone marrow transplantation in mice as measured by NGS.
- 20 wks Post- Xpt editing efficiency and indel pattern in human CD34+ cells 20 weeks after bone marrow transplantation in mice as measured by NGS. Electroporation performed in triplicate per group, data from one representative experiment.
- “indel” refers to sum of all indels of less than 200 nt;
- large deletion refers to the deletion of sequence between the predicted HBG1 and HBG2 binding sites for each gRNA.
- FIG. 27 NGS analysis of CD34+ cells post-editing with RNPs. sgRNA targeting specific regions are indicated on the x-axis.
- Figure 27A NGS analysis of CD34+ cells at day 2 post-electroporation of RNPs.
- Figure 27B NGS analysis of whole bone marrow from NSG mice transplanted with edited bone marrow CD34+ cells at (27B) week 9 post-transplantation.
- Figure 27C NGS analysis of whole bone marrow from NSG mice transplanted with edited bone marrow CD34+ cells at week 20 posttransplantation.
- Insertion indels are indicated in black, deletion indels (excluding large deletions comprising an excision of the region between binding HBG1 and HBG2 target sequences for each of gRNA sg-G51, sg-G48 and sg-G67) are indicated in grey.
- Fig. 28 Gene-edited, long-term engrafted human HSCs were capable to producing increased level of HbF upon erythroid cell differentiation.
- Fifty thousand human CD34+ cells were sorted from the bone marrow of 8-week or 20-week transplanted NSG mice. Sorted cells were seeded into erythroid differentiation medium for 14-21 days. Mature red blood cells in culture were assayed for HbF expression and to enumerate the number of HbF+ cell by flow cytometry.
- Off-target activity for HBG1 and/or HBG2 guide RNAs was assessed using an dsDNA oligo- insertion method in Cas9-overexpressing HEK-293 cells.
- the on-target site (open circle) and the potential off-target sites (closed circles) detected are indicated; y-axis indicates frequency of detection. All gRNAs were tested in dgRNA format with the targeting domain indicated by the CRxxxxxx identifier. Fig. 30.
- Off-target activity for HBG1 and/or HBG2 guide RNAs was assessed using an dsDNA oligo- insertion method in Cas9-overexpressing HEK-293 cells.
- the on-target site (open circle) and the potential off-target sites (closed circles) detected are indicated; y-axis indicates frequency of detection.
- gRNAs were tested in either dgRNA format with the targeting domain indicated by the CRxxxxx identifier, or in sgRNA format with the targeting domain indicated by the Gxxxxxx identifier.
- Figure 31A CD34+ cell count of cells derived from mobilized peripheral blood of healthy individuals upon gene-editing. Cells were thawed on day 0, cultured for 3 days prior to
- Figure 31B CD34+ cell expansion of cells derived from mobilized peripheral blood of healthy individuals upon gene-editing. Cells were thawed on day 0, cultured for 3 days prior to
- Figure 31C CD34+ cell viability of cells derived from mobilized peripheral blood of healthy individuals upon gene-editing. Cells were thawed on day 0, cultured for 3 days prior to
- Figure 32B Editing efficiency of sgl 128 and sg0067 in CD34+ cells mobilized from the peripheral blood of healthy individuals.
- A The percentage of INDELs captured by NGS upon editing using sg0067 (targeting the HbG-1 and HbG-2 gene cluster). Shown is the total editing efficiency and editing pattern of sg0067.
- Figure 33 Editing efficiency of sgl 128 and sg0067 in CD34+ cells mobilized from the peripheral blood of healthy individuals.
- FIG. 34 Enumeration of HbF+ cells from healthy individuals upon gene editing.
- CD34+ cells derived from the mobilized peripheral blood of healthy donors were edited by CRISPR and differentiated into the erythroid lineage in vitro as described in previous procedures.
- At day 10 of erythroid differentiation cells were stained with anti-HbF-FITC antibody to enumerate HbF+ cells by flow cytometry.
- Figure 35B Expansion and viability of CD34+ cells derived from the peripheral blood of sickle cell disease individuals upon gene-editing. Cells were cultured for 6-10 days prior to electroporation. DO refers to the day of electroporation.
- Figure 36 Editing efficiency of sgl 128 and sg0067 in CD34+ cells from sickle cell disease patient samples. Editing pattern of sg0067 was denoted by large deletion (grey) and sum of small indels (black). Data show mean+SEM of four independent editing experiments performed in duplicates with CD34+ cells from four different sickle cell disease patients (SCDl-4).
- Figure 37 In vitro multi-lineage differentiation capacity of HSPCs as measured by colony -forming unit assay.
- BFU-E blast-forming unit, erythroid
- CFU-GM colony -forming unit, granulocyte, monocyte
- CFU-GEMM colony-forming unit, granulocyte, erythroid, monocyte, megakaryocyte.
- Graph shows three independent experiments from CD34+ cells from three different sickle cell disease patients (SCDl-3). Experiments were performed in triplicates. Data represent mean+SEM.
- Figure 38 Fold change of g-globin transcript in erythroid cells from patient samples upon CRISPR knockdown of BCL11 A or indel/deletion formation at g-globin gene cluster.
- CD34+ cells derived from 3 sickle cell disease patients (SCD l-3) were edited by CRISPR and differentiated into the erythroid lineage in vitro as described in the Examples. At day 11 of erythroid differentiation, cells were harvested from culture and subjected to qPCR to measure g-globin and b-globin transcripts, normalizing to GAPDH. Experiment was performed in duplicate. Data show mean+SEM of pooled donors.
- FIG 39 Enumeration of HbF+ cells in sickle cell disease patient samples upon gene editing.
- CD34+ cells derived from 3 sickle cell disease patients (SCDl-3) were edited by CRISPR and differentiated into the erythroid lineage in vitro as described in the Examples.
- SCDl-3 results from 3 sickle cell disease patients
- SCD-1 and SCD-2 results from SCD-1 and SCD-2
- SCD-2 and SCD-3 results from SCD-2 and SCD-3.
- Figure 40 Measurement of fetal hemoglobin expression in gene-edited sickle cell disease patient samples by flow cytometry.
- CD34+ cells derived from 3 sickle cell disease patients (SCDl-3) were edited by CRISPR and differentiated into the erythroid lineage in vitro as described in the Examples.
- SCDl-3 3 sickle cell disease patients
- SCD-1 and SCD-2 were edited by CRISPR and differentiated into the erythroid lineage in vitro as described in the Examples.
- SCDl-3 3 sickle cell disease patients
- FIG 41 Enumeration of the number of sickle cells versus normal cells upon CRISPR editing of patient samples.
- CD 34+ cells derived from 3 sickle cell disease patients (SCDl-3) were edited by
- FIG. 41 A shows change in the number of sickle cells in gene-edited patient samples as enumerated by single cell imaging.
- Figure 41B shows change in the number of normal cells after gene editing in patient samples as enumerated by single cell imaging.
- Three independent experiments were performed, with each experiment in duplicate. Forty thousand single cell images were enumerated from each patient. Graph show mean+SEM from pooled data.
- CRISPR system refers to a set of molecules comprising an RNA-guided nuclease or other effector molecule and a gRNA molecule that together are necessary and sufficient to direct and effect modification of nucleic acid at a target sequence by the RNA-guided nuclease or other effector molecule.
- a CRISPR system comprises a gRNA and a Cas protein, e.g., a Cas9 protein.
- Cas9 systems Such systems comprising a Cas9 or modified Cas9 molecule are referred to herein as “Cas9 systems” or “CRISPR/Cas9 systems.”
- the gRNA molecule and Cas molecule may be complexed, to form a ribonuclear protein (RNP) complex.
- RNP ribonuclear protein
- guide RNA refers to a set of nucleic acid molecules that promote the specific directing of a RNA-guided nuclease or other effector molecule (typically in complex with the gRNA molecule) to a target sequence.
- said directing is accomplished through hybridization of a portion of the gRNA to DNA (e.g., through the gRNA targeting domain), and by binding of a portion of the gRNA molecule to the RNA-guided nuclease or other effector molecule (e.g., through at least the gRNA tracr).
- a gRNA molecule consists of a single contiguous polynucleotide molecule, referred to herein as a "single guide RNA” or “sgRNA” and the like.
- a gRNA molecule consists of a plurality, usually two, polynucleotide molecules, which are themselves capable of association, usually through hybridization, referred to herein as a "dual guide RNA” or “dgRNA,” and the like.
- gRNA molecules are described in more detail below, but generally include a targeting domain and a tracr.
- the targeting domain and tracr are disposed on a single polynucleotide. In other embodiments, the targeting domain and tracr are disposed on separate polynucleotides.
- targeting domain is the portion of the gRNA molecule that recognizes, e.g., is complementary to, a target sequence, e.g., a target sequence within the nucleic acid of a cell, e.g., within a gene.
- crRNA as the term is used in connection with a gRNA molecule, is a portion of the gRNA molecule that comprises a targeting domain and a region that interacts with a tracr to form a flagpole region.
- target sequence refers to a sequence of nucleic acids complimentary, for example fully complementary, to a gRNA targeting domain.
- the target sequence is disposed on genomic DNA.
- the target sequence is adjacent to (either on the same strand or on the complementary strand of DNA) a protospacer adjacent motif (PAM) sequence recognized by a protein having nuclease or other effector activity, e.g., a PAM sequence recognized by Cas9.
- the target sequence is a target sequence within a gene or locus that affects expression of a globin gene, e.g., that affects expression of beta globin or fetal hemoglobin (HbF).
- the target sequence is a target sequence within a nondeletional HPFH region, for example, is within a HBG1 and/or HBG2 promoter region.
- flagpole refers to the portion of the gRNA where the crRNA and the tracr bind to, or hybridize to, one another.
- tracr refers to the portion of the gRNA that binds to a nuclease or other effector molecule.
- the tracr comprises nucleic acid sequence that binds specifically to Cas9.
- the tracr comprises nucleic acid sequence that forms part of the flagpole.
- Cas9 or “Cas9 molecule” refer to an enzyme from bacterial Type II CRISPR/Cas system responsible for DNA cleavage. Cas9 also includes wild-type protein as well as functional and non- functinal mutants thereof.
- the Cas9 is a Cas9 of S. pyogenes.
- complementary refers to the pairing of bases, A with T or U, and G with C.
- complementary refers to nucleic acid molecules that are completely complementary, that is, form A to T or U pairs and G to C pairs across the entire reference sequence, as well as molecules that are at least 80%, 85%, 90%, 95%, 99% complementary.
- Temporal Nucleic Acid refers to nucleic acid to be inserted at the site of modification by the CRISPR system donor sequence for gene repair (insertion) at site of cutting.
- an “indel,” as the term is used herein, refers to a nucleic acid comprising one or more insertions of nucleotides, one or more deletions of nucleotides, or a combination of insertions and delections of nucleotides, relative to a reference nucleic acid, that results after being exposed to a composition comprising a gRNA molecule, for example a CRISPR system. Indels can be determined by sequencing nucleic acid after being exposed to a composition comprising a gRNA molecule, for example, by NGS.
- an indel is said to be "at or near" a reference site (e.g., a site complementary to a targeting domain of a gRNA molecule) if it comprises at least one insertion or deletion within about 10, 9 , 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) of the reference site, or is overlapping with part or all of said refrence site (e.g., comprises at least one insertion or deletion overlapping with, or within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucelotides of a site complementary to the targeting domain of a gRNA molecule, e.g., a gRNA molecule described herein).
- a reference site e.g., a site complementary to a targeting domain of a gRNA molecule
- the indel is a large deletion, for example, comprising more than about 1 kb, more than about 2kb, more than about 3kb, more than about 4 kb, more than about 5 kb, more than about 6kb, or more than about 10 kb of nucleic acid.
- the 5 ' end, the 3 ' end, or both the 5 ' and 3 ' ends of the large deletion are disposed at or near a target sequence of a gRNA molecule described herein.
- the large deletion comprises about 4.9 kb of DNA disposed between a target sequence of a gRNA molecule, e.g., described herein, disposed within the HBG1 promoter region and a target sequence of a gRNA molecule, e.g., described herein, disposed within the HBG2 promoter region.
- an “indel pattern,” as the term is used herein, refers to a set of indels that results after exposure to a composition comprising a gRNA molecule.
- the indel pattern consists of the top three indels, by frequency of appearance.
- the indel pattern consists of the top five indels, by frequency of appearance.
- the indel pattern consists of the indels which are present at greater than about 1% frequency relative to all sequencing reads.
- the indel pattern consists of the indels which are present at greater than about 5% frequency relative to all sequencing reads.
- the indel pattern consists of the indels which are present at greater than about 10% frequency relative to to total number of indel sequencing reads (i.e., those reads that do not consist of the unmodified reference nucleic acid sequence). In an embodiment, the indel pattern includes of any 3 of the top five most frequently observed indels. The indel pattern may be determined, for example, by methods described herein, e.g., by sequencing cells of a population of cells which were exposed to the gRNA molecule.
- off-target indel refers to an indel at or near a site other than the target sequence of the targeting domain of the gRNA molecule.
- sites may comprise, for example, 1, 2, 3, 4, 5 or more mismatch nucleotides relative to the sequence of the targeting domain of the gRNA.
- such sites are detected using targeted sequencing of in silico predicted off-target sites, or by an insertional method known in the art.
- examples of off-target indels are indels formed at sequences outside of the HBG1 and/or HBG2 promoter regions.
- the off-target indel is formed in a sequence of a gene, e.g., within a coding sequence of a gene.
- the term "a” and “an” refers to one or to more than one (i.e., to at least one) of the grammatical object of the article.
- an element means one element or more than one element.
- antigen refers to a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically - competent cells, or both.
- antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an "antigen" as that term is used herein.
- an antigen need not be encoded solely by a full length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to encode polypeptides that elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a "gene" at all. It is readily apparent that an antigen can be synthesized or can be derived from a biological sample, or might be macromolecule besides a polypeptide. Such a biological sample can include, but is not limited to a tissue sample, a cell or a fluid with other biological components.
- autologous refers to any material derived from the same individual into whom it is later to be re-introduced.
- allogeneic refers to any material derived from a different animal of the same species as the individual to whom the material is introduced. Two or more individuals are said to be allogeneic to one another when the genes at one or more loci are not identical. In some aspects, allogeneic material from individuals of the same species may be sufficiently unlike genetically to interact antigenically
- xenogeneic refers to a graft derived from an animal of a different species. "Derived from” as that term is used herein, indicates a relationship between a first and a second molecule. It generally refers to structural similarity between the first molecule and a second molecule and does not connotate or include a process or source limitation on a first molecule that is derived from a second molecule.
- encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (e.g., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
- a gene, cDNA, or RNA encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system.
- Both the coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
- nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence.
- the phrase nucleotide sequence that encodes a protein or a RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
- an effective amount or “therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result.
- endogenous refers to any material from or produced inside an organism, cell, tissue or system.
- exogenous refers to any material introduced from or produced outside an organism, cell, tissue or system.
- transfer vector refers to a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell.
- Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphihc compounds, plasmids, and viruses.
- transfer vector includes an autonomously replicating plasmid or a virus.
- the term should also be construed to further include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, a polylysine compound, liposome, and the like.
- viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
- expression vector refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
- An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system.
- Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
- homologous refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules.
- two nucleic acid molecules such as, two DNA molecules or two RNA molecules
- polypeptide molecules between two polypeptide molecules.
- a subunit position in both of the two molecules is occupied by the same monomelic subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous or identical at that position.
- the homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous.
- isolated means altered or removed from the natural state.
- nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.”
- An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
- operably linked or transcriptional control refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter.
- a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
- a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
- Operably linked DNA sequences can be contiguous with each other and, e.g., where necessary to join two protein coding regions, are in the same reading frame.
- parenteral administration of an immunogenic composition includes, e.g., subcutaneous (s.c), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection, intratumoral, or infusion techniques.
- nucleic acid or “polynucleotide” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon
- degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).
- peptide refers to a compound comprised of amino acid residues covalently linked by peptide bonds.
- a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence.
- Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds.
- the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
- Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others.
- a polypeptide includes a natural peptide, a recombinant peptide, or a combination thereof.
- promoter refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.
- promoter/regulatory sequence refers to a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
- constitutive promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.
- inducible promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.
- tissue-specific promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide encodes or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
- a 5' cap As used herein in connection with a messenger RNA (mRNA), a 5' cap (also termed an RNA cap, an RNA 7-methylguanosine cap or an RNA m7G cap) is a modified guanine nucleotide that has been added to the "front" or 5' end of a eukaryotic messenger RNA shortly after the start of transcription.
- the 5' cap consists of a terminal group which is linked to the first transcribed nucleotide. Its presence is critical for recognition by the ribosome and protection from RNases. Cap addition is coupled to transcription, and occurs co-transcriptionally, such that each influences the other.
- in vitro transcribed RNA refers to RNA, preferably mRNA, that has been synthesized in vitro. Generally, the in vitro transcribed RNA is generated from an in vitro transcription vector.
- the in vitro transcription vector comprises a template that is used to generate the in vitro transcribed RNA.
- poly(A) is a series of adenosines attached by polyadenylation to the mRNA.
- the polyA is between 50 and 5000 (SEQ ID NO: 190), preferably greater than 64, more preferably greater than 100, most preferably greater than 300 or 400.
- poly(A) sequences can be modified chemically or enzymatically to modulate mRNA functionality such as localization, stability or efficiency of translation.
- polyadenylation refers to the covalent linkage of a polyadenylyl moiety, or its modified variant, to a messenger RNA molecule.
- mRNA messenger RNA
- the 3' poly(A) tail is a long sequence of adenine nucleotides (often several hundred) added to the pre-mRNA through the action of an enzyme, polyadenylate polymerase.
- poly(A) tail is added onto transcripts that contain a specific sequence, the polyadenylation signal.
- Polyadenylation is also important for transcription termination, export of the mRNA from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after transcription of DNA into RNA, but additionally can also occur later in the cytoplasm.
- the mRNA chain is cleaved through the action of an endonuclease complex associated with RNA polymerase.
- the cleavage site is usually characterized by the presence of the base sequence AAUAAA near the cleavage site.
- adenosine residues are added to the free 3' end at the cleavage site.
- transient refers to expression of a non-integrated transgene for a period of hours, days or weeks, wherein the period of time of expression is less than the period of time for expression of the gene if integrated into the genome or contained within a stable plasmid replicon in the host cell.
- the terms “treat”, “treatment” and “treating” refer to the reduction or amelioration of the progression, severity and/or duration of a disorder, e.g., a hemoglobinopathy, or the amelioration of one or more symptoms (preferably, one or more discernible symptoms) of a disorder, e.g., a hemoglobinopathy, resulting from the administration of one or more therapies (e.g., one or more therapeutic agents such as a gRNA molecule, CRISPR system, or modified cell of the invention).
- the terms “treat”, “treatment” and “treating” refer to the amelioration of at least one measurable physical parameter of a hemoglobinopathy disorder, not discernible by the patient.
- the terms “treat”, “treatment” and “treating” refer to the inhibition of the progression of a disorder, either physically by, e.g., stabilization of a discernible symptom, physiologically by, e.g., stabilization of a physical parameter, or both.
- the terms “treat”, “treatment” and “treating” refer to the reduction or stabilization of a symptom of a hemoglobinopathy, e.g., sickle cell disease or beta-thalassemia.
- signal transduction pathway refers to the biochemical relationship between a variety of signal transduction molecules that play a role in the transmission of a signal from one portion of a cell to another portion of a cell.
- cell surface receptor includes molecules and complexes of molecules capable of receiving a signal and transmitting signal across the membrane of a cell.
- subject is intended to include living organisms in which an immune response can be elicited (e.g., mammals, human).
- substantially purified cell refers to a cell that is essentially free of other cell types.
- a substantially purified cell also refers to a cell which has been separated from other cell types with which it is normally associated in its naturally occurring state.
- a population of substantially purified cells refers to a homogenous population of cells. In other instances, this term refers simply to cell that have been separated from the cells with which they are naturally associated in their natural state.
- the cells are cultured in vitro. In other aspects, the cells are not cultured in vitro.
- terapéutica as used herein means a treatment.
- a therapeutic effect is obtained by reduction, suppression, remission, or eradication of a disease state.
- prophylaxis means the prevention of or protective treatment for a disease or disease state.
- transfected or transformed or transformed refers to a process by which exogenous nucleic acid and/or ptotein is transferred or introduced into the host cell.
- transfected or transformed or transformed refers to a process by which exogenous nucleic acid and/or ptotein is transferred or introduced into the host cell.
- transformed or transduced cell is one which has been transfected, transformed or transduced with exogenous nucleic acid and/or protein.
- the cell includes the primary subject cell and its progeny.
- binding partner e.g., a protein or nucleic acid
- bioequivalent refers to an amount of an agent other than the reference compound, required to produce an effect equivalent to the effect produced by the reference dose or reference amount of the reference compound.
- Refractory refers to a disease, e.g., a hemoglobinopathy, that does not respond to a treatment.
- a refractory hemoglobinopathy can be resistant to a treatment before or at the beginning of the treatment. In other embodiments, the refractory hemoglobinopathy can become resistant during a treatment.
- a refractory hemoglobinopathy is also called a resistant
- hemoglobinopathy refers to the return of a disease (e.g., hemoglobinopathy) or the signs and symptoms of a disease such as a hemoglobinopathy after a period of improvement, e.g., after prior treatment of a therapy, e.g., hemoglobinopathy therapy.
- a disease e.g., hemoglobinopathy
- a therapy e.g., hemoglobinopathy therapy.
- a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range.
- description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6.
- a range such as 95-99% identity includes something with 95%, 96%, 97%, 98% or 99% identity, and includes subranges such as 96-99%, 96-98%, 96-97%, 97-99%, 97-98% and 98-99% identity. This applies regardless of the breadth of the range.
- BCLl la refers to B-cell lymphoma/leukemia 11 A, a RNA polymerase II core promoter proximal region sequence-sepecific DNA binding protein, and the gene encoding said protein, together with all introns and exons. This gene encodes a C2H2 type zinc -finger protein. BCLl 1 A has been found to play a role in the suppression of fetal hemoglobin production.
- BCL 1 la is also known as B-Cell CLL/Lymphoma 11A (Zinc Finger Protein), CTIP1, EVI9, Ecotropic Viral Integration Site 9 Protein Homolog, COUP-TF-Interacting Protein 1, Zinc Finger Protein 856, KIAA1809, BCL-11 A, ZNF856, EVI-9, and B-Cell CLL/Lymphoma 11 A.
- the term encompasses all isoforms and splice variants of BLCl la.
- the human gene encoding BCLl la is mapped to chromosomal location 2pl6.1 (by Ensembl).
- the human and murine amino acid and nucleic acid sequences can be found in a public database, such as GenBank, UniProt and Swiss-Prot, and the genomic sequence of human BCL 1 la can be found in GenBank at NC 000002.12.
- GenBank GenBank
- UniProt UniProt
- Swiss-Prot the genomic sequence of human BCL 1 la
- the BCL 1 la gene refers to this genomic location, including all introns and exons.
- the sequence of mRNA encoding isoform 1 of human BCL 1 la can be found at NM 022893.
- the peptide sequence of isoform 1 of human BCLl la is:
- VLSSMQHFSE AFHQVLGEKH KRGHLAEAEG HRDTCDEDSV AGESDRIDDG
- SEQ ID NO: 245 (Identifier Q9H165-1; and NM 022893.3; and accession ADL14508.
- BCLI la protein isoforms are provided at:
- a human BCL1 la protein also encompasses proteins that have over its full length at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with BCL1 la isolorm 1-6, wherein such proteins still have at least one of the functions of BCL 1 la.
- globin locus refers to the region of human chromosome 11 comprising genes for embryonic ( ⁇ ), fetal (G(y) and ⁇ ( ⁇ )), adult globin genes ( ⁇ and ⁇ ), locus control regions and DNase I hypersensitivity sites.
- complementary refers to the pairing of bases, A with T or U, and G with C.
- complementary refers to nucleic acid molecules that are completely complementary, that is, form A to T or U pairs and G to C pairs across the entire reference sequence, as well as molecules that are at least 80%, 85%, 90%, 95%, 99% complementary.
- Nondeletional HPFH refers to a mutation that does not comprise an insertion or deletion of one or more nucleotides, which results in hereditary persistence of fetal hemoglobin, and is characterized in increased fetal hemoglobin in adult red blood cells.
- the nondeletional HPFH is a mutation described in Nathan and Oski's Hematology and Oncology of Infancy and Childhood, 8 th Ed., 2015, Orkin SH, Fisher DE, Look T, Lux SE, Ginsburg D, Nathan DG, Eds., Elsevier Saunders, the entire contents of which is incorporated herein by reference, for example the nondeltional HPFH mutations described at Table 21-5.
- Nondeletional HPFH region refers to a genomic site which comprises or is near a nondeletional HPFH.
- the nondeletional HPFH region is the nucleic acid sequence of the HBG1 promoter region (Chrl 1:5,249,833 to Chrl 1 :5,250,237, hg38; - strand), the nucleic acid sequence of the HBG2 promoter region (Chrl 1:5,254,738 to Chrl 1 :5,255, 164, hg38; - strand), or combinations thereof.
- the nondeletional HPFH region includes one or more of the nondeletional HPFH described in Nathan and Oski's Hematology and Oncology of Infancy and Childhood, 8 th Ed., 2015, Orkin SH, Fisher DE, Look T, Lux SE, Ginsburg D, Nathan DG, Eds., Elsevier Saunders (e.g., described in Table 21-5 therein).
- the nondeletional HPFH region is the nucleic acid sequence at chrl 1 :5,250,094-5,250,237, - strand, hg38; or the nucleic acid sequence at chrl l:5,255,022-5,255, 164, - strand, hg38; or the nucleic acid sequence at chrl l : 5,249,833- 5,249,927, - strand, hg38; or the nucleic acid sequence at chrl l : 5,254,738-5,254,851, - strand, hg38; or the nucleic acid sequence at chrl 1 :5,250, 139-5,250,237, - strand, hg38; or combinations thereof.
- BCL 11a enhancer refers to nucleic acid sequence which affects, e.g., enhances, expression or function of BCL 11 a. See e.g., Bauer et al., Science, vol. 342, 2013, pp. 253- 257.
- the BCL1 la enhancer may be, for example, operative only in certain cell types, for example, cells of the erythroid lineage.
- BCL 1 la enhancer is the nucleic acid sequence between exon 2 and exon 3 of the BCL1 la gene gene (e.g., the nucleic acid at or corresponding to positions +55: Chr2:60497676- 60498941; +58: Chr2:60494251- 60495546; +62: Chr2:60490409- 60491734 as recorded in hg38).
- the BCL1 la Enhancer is the +62 region of the nucleic acid sequence between exon 2 and exon 3 of the BCL1 la gene.
- the BCL1 la Enhancer is the +58 region of the nucleic acid sequence between exon 2 and exon 3 of the BCL1 la gene.
- the BCL1 la Enhancer is the +55 region of the nucleic acid sequence between exon 2 and exon 3 of the BCL1 la gene.
- hematopoietic stem and progenitor cell or "HSPC” are used interchangeably, and refer to a population of cells comprising both hematopoietic stem cells (“HSCs”) and hematopoietic progenitor cells (“HPCs"). Such cells are characterized, for example, as CD34+.
- HSPCs are isolated from bone marrow.
- HSPCs are isolated from peripheral blood.
- HSPCs are isolated from umbilical cord blood.
- HSPCs are characterized as CD34+/CD38-/CD90+/CD45RA-.
- the HSPCs are characterized as CD34+/CD90+/CD49f+ cells.
- the HSPCs are characterized as CD34+ cells.
- the HSPC s are characterized as CD34+ cells.
- the HSPC s are characterized as
- CD34+/CD90+ cells are CD34+/CD90+ cells.
- the HSPCs are characterized as CD34+/CD90+/CD45RA- cells.
- Ste cell expander refers to a compound which causes cells, e.g., HSPCs, HSCs and/or HPCs to proliferate, e.g., increase in number, at a faster rate relative to the same cell types absent said agent.
- the stem cell expander is an inhibitor of the aryl hydrocarbon receptor pathway. Additional examples of stem cell expanders are provided below.
- the proliferation e.g., increase in number, is accomplished ex vivo.
- Engraftment refers to the incorporation of a cell or tissue, e.g., a population of HSPCs, into the body of a recipient, e.g., a mammal or human subject.
- engraftment includes the growth, expansion and/or differention of the engrafted cells in the recipient.
- engraftment of HSPCs includes the differentiation and growth of said HSPCs into erythroid cells within the body of the recipient.
- Hematopoietic progenitor cells refers to primitive hematopoietic cells that have a limited capacity for self-renewal and the potential for multilineage differentiation (e.g., myeloid, lymphoid), mono-lineage differentiation (e.g., myeloid or lymphoid) or cell-type restricted differentiation (e.g., erythroid progenitor) depending on placement within the hematopoietic hierarchy (Doulatov et al., Cell Stem Cell 2012).
- multilineage differentiation e.g., myeloid, lymphoid
- mono-lineage differentiation e.g., myeloid or lymphoid
- cell-type restricted differentiation e.g., erythroid progenitor
- Hematopoietic stem cells refer to immature blood cells having the capacity to self-renew and to differentiate into more mature blood cells comprising granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, erythrocytes), thrombocytes (e.g., megakaryoblasts, platelet producing megakaryocytes, platelets), and monocytes (e.g., monocytes, macrophages).
- HSCs are interchangeably described as stem cells throughout the specification. It is known in the art that such cells may or may not include CD34+ cells.
- CD34+ cells are immature cells that express the CD34 cell surface marker. CD34+ cells are believed to include a subpopulation of cells with the stem cell properties defined above. It is well known in the art that HSCs are multipotent cells that can give rise to primitive progenitor cells (e.g., multipotent progenitor cells) and/or progenitor cells committed to specific hematopoietic lineages (e.g., lymphoid progenitor cells). The stem cells committed to specific hematopoietic lineages may be of T cell lineage, B cell lineage, dendritic cell lineage, Langerhans cell lineage and/or lymphoid tissue-specific macrophage cell lineage.
- progenitor cells e.g., multipotent progenitor cells
- progenitor cells committed to specific hematopoietic lineages may be of T cell lineage, B cell lineage, dendritic cell lineage, Langerhans cell lineage and/or lymphoid
- HSCs also refer to long term HSC (LT-HSC) and short term HSC (ST-HSC).
- ST-HSCs are more active and more proliferative than LT-HSCs.
- LT-HSC have unlimited self renewal (i.e., they survive throughout adulthood), whereas ST-HSC have limited self renewal (i.e., they survive for only a limited period of time). Any of these HSCs can be used in any of the methods described herein.
- ST-HSCs are useful because they are highly proliferative and thus, quickly increase the number of HSCs and their progeny.
- Hematopoietic stem cells are optionally obtained from blood products.
- a blood product includes a product obtained from the body or an organ of the body containing cells of hematopoietic origin.
- sources include un-fractionated bone marrow, umbilical cord, peripheral blood (e.g., mobilized peripheral blood, e.g., moblized with a mobilization agent such as G-CSF or Plerixafor® (AMD3100), or a combination of G-CSF and
- HSCs are characterized as CD34+/CD38- /CD90+/CD45RA-.
- the HSCs are characterized as CD34+/CD90+/CD49f+ cells.
- the HSCs are characterized as CD34+ cells.
- the HSCs are characterized as CD34+/CD90+ cells.
- the HSCs are characterized as CD34+/CD90+ cells.
- CD34+/CD90+/CD45RA- cells CD34+/CD90+/CD45RA- cells.
- “Expansion” or “Expand” in the context of cells refers to an increase in the number of a characteristic cell type, or cell types, from an initial cell population of cells, which may or may not be identical.
- the initial cells used for expansion may not be the same as the cells generated from expansion.
- Cell population refers to eukaryotic mammalian, preferably human, cells isolated from biological sources, for example, blood product or tissues and derived from more than one cell.
- CD34+ cells refers to cells that express at their surface CD34 marker. CD34+ cells can be detected and counted using for example flow cytometry and fluorescently labeled anti-CD34 antibodies.
- CD34+ cells “Enriched in CD34+ cells” means that a cell population has been selected based on the presence of CD34 marker. Accordingly, the percentage of CD34+ cells in the cell population after selection method is higher than the percentage of CD 34+ cells in the initial cell population before selecting step based on CD34 markers.
- CD34+ cells may represent at least 50%, 60%, 70%, 80% or at least 90% of the cells in a cell population enriched in CD34+ cells.
- F cell and "F-cell” refer to cells, ususally erythrocytes (e.g., red blood cells) which contain and/or produce (e.g., express) fetal hemoglobin.
- an F-cell is a cell that contains or produces detectible levels of fetal hemoglobin.
- an F-cell is a cell that contains or produces at least 5 picograms of fetal hemoglobin.
- an F-cell is a cell that contains or produces at least 6 picograms of fetal hemoglobin.
- an F-cell is a cell that contains or produces at least 7 picograms of fetal hemoglobin.
- an F-cell is a cell that contains or produces at least 8 picograms of fetal hemoglobin. In another example, an F-cell is a cell that contains or produces at least 9 picograms of fetal hemoglobin. In another example, an F- cell is a cell that contains or produces at least 10 picograms of fetal hemoglobin. Levels of fetal hemoglobin may be measured using an assay described herein or by other method known in the art, for example, flow cytometry using an anti-fetal hemoglobin detection reagent, high performance liquid chromatography, mass spectrometry, or enzyme-linked immunoabsorbent assay.
- the gRNA molecules, compositions and methods described herein relate to genome editing in eukaryotic cells using the CRISPR/Cas9 system.
- the gRNA molecules, compositions and methods described herein relate to regulation of globin levels and are useful, for example, in regulating expression and production of globin genes and protein.
- the gRNA molecules, compositions and methods can be useful in the treatment of hemoglobinopathies.
- a gRNA molecule may have a number of domains, as described more fully below, however, a gRNA molecule typically comprises at least a crRNA domain (comprising a targeting domain) and a tracr.
- the gRNA molecules of the invention used as a component of a CRISPR system, are useful for modifying (e.g., modifying the sequence) DNA at or near a target site. Such modifications include deletions and or insertions that result in, for example, reduced or eliminated expression of a functional product of the gene comprising the target site.
- a unimolecular, or sgRNA comprises, preferably from 5' to 3' : a crRNA (which contains a targeting domain complementary to a target sequence and a region that forms part of a flagpole (i.e., a crRNA flagpole region)); a loop; and a tracr (which contains a domain complementary to the crRNA flagpole region, and a domain which additionally binds a nuclease or other effector molecule, e.g., a Cas molecule, e.g., aCas9 molecule), and may take the following format (from 5' to 3'):
- the tracr nuclease binding domain binds to a Cas protein, e.g., a Cas9 protein.
- a bimolecular, or dgRNA comprises two polynucleotides; the first, preferably from 5' to 3': a crRNA (which contains a targeting domain complementary to a target sequence and a region that forms part of a flagpole; and the second, preferrably from 5' to 3 ' : a tracr (which contains a domain complementary to the crRNA flagpole region, and a domain which additionally binds a nuclease or other effector molecule, e.g., a Cas molecule, e.g., Cas9 molecule), and may take the following format (from 5' to 3'):
- crRNA Polynucleotide 1 (crRNA): [targeting domain] - [crRNA flagpole region] - [optional first flagpole extension] - [optional second flagpole extension]
- the tracr nuclease binding domain binds to a Cas protein, e.g., a Cas9 protein.
- the targeting domain comprises or consists of a targeting domain sequence described herein, e.g., a targeting domain described in Table 1, or a targeting domain comprising or consisting of 17, 18, 19, or 20 (preferably 20) consecutive nucleotides of a targeting domain sequence described in Table 1.
- the flagpole e.g., the crRNA flagpole region, comprises, from 5' to 3':
- the flagpole e.g., the crRNA flagpole region, comprises, from 5' to 3':
- the loop comprises, from 5' to 3' : GAAA (SEQ ID NO: 186). In some aspects the tracr comprises, from 5' to 3':
- UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGC (SEQ ID NO: 187) and is preferably used in a gRNA molecule comprising SEQ ID NO 182.
- the tracr comprises, from 5' to 3':
- UAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGC (SEQ ID NO: 188) and is preferably used in a gRNA molecule comprising SEQ ID NO 183.
- the gRNA may also comprise, at the 3 ' end, additional U nucleic acids.
- the gRNA may comprise an additional 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 U nucleic acids (SEQ ID NO: 249) at the 3 ' end.
- the gRNA comprises an additional 4 U nucleic acids at the 3 ' end.
- one or more of the polynucleotides of the dgRNA e.g., the polynucleotide comprising the targeting domain and the polynucleotide comprising the tracr
- one or more of the polynucleotides of the dgRNA may comprise an additional 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 U nucleic acids (SEQ ID NO: 249) at the 3 ' end.
- one or more of the polynucleotides of the dgRNA comprises an additional 4 U nucleic acids at the 3 ' end.
- only the polynucleotide comprising the tracr comprises the additional U nucleic acid(s), e.g., 4 U nucleic acids.
- only the polynucleotide comprising the targeting domain comprises the additional U nucleic acid(s).
- both the polynucleotide comprising the targeting domain and the polynucleotide comprising the tracr comprise the additional U nucleic acids, e.g., 4 U nucleic acids.
- the gRNA may also comprise, at the 3 ' end, additional A nucleic acids.
- the gRNA may comprise an additional 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 A nucleic acids (SEQ ID NO: 250) at the 3 ' end.
- the gRNA comprises an additional 4 A nucleic acids at the 3 ' end.
- one or more of the polynucleotides of the dgRNA e.g., the polynucleotide comprising the targeting domain and the polynucleotide comprising the tracr
- one or more of the polynucleotides of the dgRNA may comprise an additional 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 A nucleic acids (SEQ ID NO: 250) at the 3 ' end.
- one or more of the polynucleotides of the dgRNA comprises an additional 4 A nucleic acids at the 3 ' end.
- only the polynucleotide comprising the tracr comprises the additional A nucleic acid(s), e.g., 4 A nucleic acids.
- only the polynucleotide comprising the targeting domain comprises the additional A nucleic acid(s).
- both the polynucleotide comprising the targeting domain and the polynucleotide comprising the tracr comprise the additional U nucleic acids, e.g., 4 A nucleic acids.
- one or more of the polynucleotides of the gRNA molecule may comprise a cap at the 5' end.
- a unimolecular, or sgRNA comprises, preferably from 5' to 3': a crRNA (which contains a targeting domain complementary to a target sequence; a crRNA flagpole region; first flagpole extension; a loop; a first tracr extension (which contains a domain complementary to at least a portion of the first flagpole extension); and a tracr (which contains a domain complementary to the crRNA flagpole region, and a domain which additionally binds a Cas9 molecule).
- the targeting domain comprises a targeting domain sequence described herein, e.g., a targeting domain described in Table 1, or a targeting domain comprising or consisting of 17, 18, 19, or 20 (preferably 20) consecutive nucleotides of a targeting domain sequence described in Table 1, for example the 3 ' 17, 18, 19, or 20 (preferably 20) consecutive nucleotides of a targeting domain sequence described in Table 1.
- the flagpole, loop and tracr sequences may be as described above.
- any first flagpole extension and first tracr extension may be employed, provided that they are complementary.
- the first flagpole extension and first tracr extension consist of 3, 4, 5, 6, 7, 8, 9, 10 or more complementary nucleotides.
- the first flagpole extension comprises, from 5' to 3 ': UGCUG (SEQ ID NO: 184). In some aspects, the first flagpole extension consists of SEQ ID NO: 184.
- the first tracr extension comprises, from 5' to 3 ' : CAGCA (SEQ ID NO: 189). In some aspects, the first tracr extension consists of SEQ ID NO: 189.
- a dgRNA comprises two nucleic acid molecules.
- the dgRNA comprises a first nucleic acid which contains, preferably from 5' to 3' : a targeting domain complementary to a target sequence; a crRNA flagpole region; optionally a first flagpole extension; and, optionally, a second flagpole extension; and a second nucleic acid (which may be referred to herein as a tracr), and comprises at least a domain which binds a Cas molecule, e.g., a Cas9 molecule) comprising preferably from 5 ' to 3 ' : optionally a first tracr extension; and a tracr (which contains a domain complementary to the crRNA flagpole region, and a domain which additionally binds a Cas, e.g., Cas9, molecule).
- the second nucleic acid may additionally comprise, at the 3 ' end (e.g., 3 ' to the tracr) additional U nucleic acids.
- the tracr may comprise an additional 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 U nucleic acids (SEQ ID NO: 249) at the 3 ' end (e.g., 3 ' to the tracr).
- the second nucleic acid may additionally or alternately comprise, at the 3 ' end (e.g., 3' to the tracr) additional A nucleic acids.
- the tracr may comprise an additional 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 A nucleic acids (SEQ ID NO: 250) at the 3 ' end (e.g., 3 ' to the tracr).
- the targeting domain comprises a targeting domain sequence described herein, e.g., a targeting domain described in Table 1, or a targeting domain comprising or consisting of 17, 18, 19, or 20 (preferably 20) consecutive nucleotides of a targeting domain sequence described in Table 1.
- the crRNA flagpole region, optional first flagpole extension, optional first tracr extension and tracr sequences may be as described above.
- the optional second flagpole extension comprises, from 5' to 3 ' : UUUUG (SEQ ID NO: 185).
- the 3 ' 1, 2, 3, 4, or 5 nucleotides, the 5' 1, 2, 3, 4, or 5 nucleotides, or both the 3' and 5' 1, 2, 3, 4, or 5 nucleotides of the gRNA molecule are modified nucleic acids, as described more fully in section XIII, below.
- the targeting domain comprises a nucleotide sequence that is complementary, e.g., at least 80, 85, 90, 95, or 99% complementary, e.g., fully complementary, to the target sequence on the target nucleic acid.
- the targeting domain is part of an RNA molecule and will therefore comprise the base uracil (U), while any DNA encoding the gRNA molecule will comprise the base thymine (T). While not wishing to be bound by theory, it is believed that the complementarity of the targeting domain with the target sequence contributes to specificity of the interaction of the gRNA molecule/Cas9 molecule complex with a target nucleic acid. It is understood that in a targeting domain and target sequence pair, the uracil bases in the targeting domain will pair with the adenine bases in the target sequence.
- the targeting domain is 5 to 50, e.g., 10 to 40, e.g., 10 to 30, e.g., 15 to 30, e.g., 15 to 25 nucleotides in length. In an embodiment, the targeting domain is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. In an embodiment, the targeting domain is 16 nucleotides in length. In an embodiment, the targeting domain is 17 nucleotides in length. In an embodiment, the targeting domain is 18 nucleotides in length. In an embodiment, the targeting domain is 19 nucleotides in length. In an embodiment, the targeting domain is 20 nucleotides in length.
- the aforementioned 16, 17, 18, 19, or 20 nucleotides comprise the 5'- 16, 17, 18, 19, or 20 nucleotides from a targeting domain described in Table 1. In embodiments, the aforementioned 16, 17, 18, 19, or 20 nucleotides comprise the 3 '- 16, 17, 18, 19, or 20 nucleotides from a targeting domain described in Table 1.
- the 8, 9, 10, 11 or 12 nucleic acids of the targeting domain disposed at the 3 ' end of the targeting domain is important for targeting the target sequence, and may thus be referred to as the "core" region of the targeting domain.
- the core domain is fully complementary with the target sequence.
- the strand of the target nucleic acid with which the targeting domain is complementary is referred to herein as the target sequence.
- the target sequence is disposed on a chromosome, e.g., is a target within a gene.
- the target sequence is disposed within an exon of a gene.
- the target sequence is disposed within an intron of a gene.
- the target sequence comprises, or is proximal (e.g., within 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1000 nucleic acids) to a binding site of a regulatory element, e.g., a promoter or transcription factor binding site, of a gene of interest.
- a regulatory element e.g., a promoter or transcription factor binding site
- Some or all of the nucleotides of the domain can have a modification, e.g., modification found in Section XIII herein.
- the flagpole contains portions from both the crRNA and the tracr.
- the crRNA flagpole region is complementary with a portion of the tracr, and in an embodiment, has sufficient complementarity to a portion of the tracr to form a duplexed region under at least some physiological conditions, for example, normal physiological conditions.
- the crRNA flagpole region is 5 to 30 nucleotides in length.
- the crRNA flagpole region is 5 to 25 nucleotides in length.
- the crRNA flagpole region can share homology with, or be derived from, a naturally occurring portion of the repeat sequence from a bacterial CRISPR array. In an embodiment, it has at least 50% homology with a crRNA flagpole region disclosed herein, e.g., an S. pyogenes, or S. thermophilus, crRNA flagpole region.
- the flagpole e.g., the crRNA flagpole region
- the flagpole comprises SEQ ID NO: 182.
- the flagpole, e.g., the crRNA flagpole region comprises sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 99% homology with SEQ ID NO: 182.
- the flagpole, e.g., the crRNA flagpole region comprises at least 5, 6, 7, 8, 9, 10, or 11 nucleotides of SEQ ID NO: 182.
- the flagpole, e.g., the crRNA flagpole region comprises SEQ ID NO: 183.
- the flagpole comprises sequence having at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 99% homology with SEQ ID NO: 183.
- the flagpole e.g., the crRNA flagpole region, comprises at least 5, 6, 7, 8, 9, 10, or 11 nucleotides of SEQ ID NO: 183.
- Some or all of the nucleotides of the domain can have a modification, e.g., modification described in Section XIII herein.
- the crRNA may comprise a first flagpole extension.
- any first flagpole extension and first tracr extension may be employed, provided that they are complementary.
- the first flagpole extension and first tracr extension consist of 3, 4, 5, 6, 7, 8, 9, 10 or more complementary nucleotides.
- the first flagpole extension may comprise nucleotides that are complementary, e.g., 80%, 85%, 90%, 95% or 99%, e.g., fully complementary, with nucleotides of the first tracr extension.
- the first flagpole extension nucleotides that hybridize with complementary nucleotides of the first tracr extension are contiguous.
- the first flagpole extension nucleotides that hybridize with complementary nucleotides of the first tracr extension are discontinuous, e.g., comprises two or more regions of hybridization separated by nucleotides that do not base pair with nucleotides of the first tracr extension.
- the first flagpole extension comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides. In some aspects, the first flagpole extension comprises, from 5' to 3 ' : UGCUG (SEQ ID NO: 184). In some aspects, the first flagpole extension consists of SEQ ID NO: 184. In some aspects the first flagpole extension comprises nucleic acid that is at least 80%, 85%, 90%, 95% or 99% homology to SEQ ID NO: 184.
- nucleotides of the first tracr extension can have a modification, e.g., modification found in Section XIII herein.
- a loop serves to link the crRNA flagpole region (or optionally the first flagpole extension, when present) with the tracr (or optionally the first tracr extension, when present) of a sgRNA.
- the loop can link the crRNA flagpole region and tracr covalently or non-covalently.
- the linkage is covalent.
- the loop covalently couples the crRNA flagpole region and tracr.
- the loop covalently couples the first flagpole extension and the first tracr extension.
- the loop is, or comprises, a covalent bond interposed between the crRNA flagpole region and the domain of the tracr which hybridizes to the crRNA flagpole region.
- the loop comprises one or more, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.
- dgRNA molecules the two molecules can be associated by virtue of the hybridization between at least a portion of the crRNA (e.g., the crRNA flagpole region) and at least a portion of the tracr (e.g., the domain of the tracr which is complementary to the crRNA flagpole region).
- a wide variety of loops are suitable for use in sgRNAs. Loops can consist of a covalent bond, or be as short as one or a few nucleotides, e.g., 1 , 2, 3, 4, or 5 nucleotides in length. In an embodiment, a loop is 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or more nucleotides in length.
- a loop is 2 to 50, 2 to 40, 2 to 30, 2 to 20, 2 to 10, or 2 to 5 nucleotides in length.
- a loop shares homology with, or is derived from, a naturally occurring sequence.
- the loop has at least 50% homology with a loop disclosed herein.
- the loop comprises SEQ ID NO: 186.
- nucleotides of the domain can have a modification, e.g., modification described in Section XIII herein.
- a dgRNA can comprise additional sequence, 3' to the crRNA flagpole region or, when present, the first flagpole extension, referred to herein as the second flagpole extension.
- the second flagpole extension is, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, or 2-4 nucleotides in length.
- the second flagpole extension is 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides in length.
- the second flagpole extension comprises SEQ ID NO: 185.
- the tracr is the nucleic acid sequence required for nuclease, e.g., Cas9, binding. Without being bound by theory, it is believed that each Cas9 species is associated with a particular tracr sequence. Tracr sequences are utilized in both sgRNA and in dgRNA systems. In an embodiment, the tracr comprises sequence from, or derived from, an S. pyogenes tracr.
- the tracr has a portion that hybridizes to the flagpole portion of the crRNA, e.g., has sufficient complementarity to the crRNA flagpole region to form a duplexed region under at least some physiological conditions (sometimes referred to herein as the tracr flagpole region or a tracr domain complementary to the crRNA flagpole region).
- the domain of the tracr that hybridizes with the crRNA flagpole region comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides that hybridize with complementary nucleotides of the crRNA flagpole region.
- the tracr nucleotides that hybridize with complementary nucleotides of the crRNA flagpole region are contiguous.
- the tracr nucleotides that hybridize with complementary nucleotides of the crRNA flagpole region are discontinuous, e.g., comprises two or more regions of hybridization separated by nucleotides that do not base pair with nucleotides of the crRNA flagpole region.
- the portion of the tracr that hybridizes to the crRNA flagpole region comprises, from 5' to 3 ' :
- the portion of the tracr that hybridizes to the crRNA flagpole region comprises, from 5' to 3 ' : UAGCAAGUUUAAA (SEQ ID NO: 192).
- the sequence that hybridizes with the crRNA flagpole region is disposed on the tracr 5'- to the sequence of the tracr that additionally binds a nuclease, e.g., a Cas molecule, e.g., a Cas9 molecule.
- the tracr further comprises a domain that additionally binds to a nuclease, e.g., a Cas molecule, e.g., a Cas9 molecule.
- a nuclease e.g., a Cas molecule
- Cas9 molecule e.g., a Cas9 molecule.
- the tracr comprises sequence that binds to a S. pyogenes Cas9 molecule.
- the tracr comprises sequence that binds to a Cas9 molecule disclosed herein.
- the domain that additionally binds a Cas9 molecule comprises, from 5' to 3 ' : UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 193). In some aspects the domain that additionally binds a Cas9 molecule comprises, from 5' to 3 ' :
- the tracr comprises SEQ ID NO: 187. In some embodiments, the tracr comprises SEQ ID NO: 188.
- the nucleotides of the tracr can have a modification, e.g., modification found in Section XIII herein.
- the gRNA e.g., the sgRNA or the tracr and/or crRNA of a dgRNA
- the gRNA comprises an inverted abasic residue at the 5 ' end, the 3 ' end or both the 5 ' and 3 ' end of the gRNA.
- the gRNA (e.g., the sgRNA or the tracr and/or crRNA of a dgRNA), e.g., any of the gRNA or gRNA components described above, comprises one or more phosphorothioate bonds between residues at the 5' end of the polynucleotide, for example, a phosphrothioate bond between the first two 5' residues, between each of the first three 5' residues, between each of the first four 5' residues, or between each of the first five 5' residues.
- a phosphrothioate bond between the first two 5' residues, between each of the first three 5' residues, between each of the first four 5' residues, or between each of the first five 5' residues.
- the gRNA or gRNA component may alternatviely or additionally comprise one or more phosphorothioate bonds between residues at the 3 ' end of the polynucleotide, for example, a phosphrothioate bond between the first two 3 ' residues, between each of the first three 3 ' residues, between each of the first four 3 ' residues, or between each of the first five 3 ' residues.
- the gRNA (e.g., the sgRNA or the tracr and/or crRNA of a dgRNA), e.g., any of the gRNA or gRNA components described above, comprises a phosphorothioate bond between each of the first four 5' residues (e.g., comprises, e.g., consists of, three phosphorothioate bonds at the 5' end(s)), and a phosphorothioate bond between each of the first four 3 ' residues (e.g., comprises, e.g., consists of, three phosphorothioate bonds at the 3 ' end(s)).
- a phosphorothioate bond between each of the first four 5' residues e.g., comprises, e.g., consists of, three phosphorothioate bonds at the 5' end(s)
- a phosphorothioate bond between each of the first four 3 ' residues e.g.
- any of the phosphorothioate modificaitons described above are combined with an inverted abasic residue at the 5' end, the 3' end, or both the 5' and 3' ends of the polynucleotide.
- the inverted abasic nucleotide may be linked to the 5' and/or 3 ' nucelotide by a phosphate bond or a phosphorothioate bond.
- the gRNA e.g., the sgRNA or the tracr and/or crRNA of a dgRNA
- any of the gRNA or gRNA components described above comprises one or more nucleotides that include a 2' O-methyl modification.
- each of the first 1, 2, 3, or more of the 5' residues comprise a 2' O-methyl modification. In embodiments, each of the first 1, 2, 3, or more of the 3 ' residues comprise a 2' O-methyl modification. In embodiments, the 4 th -to- terminal, 3 rd -to-terminal, and 2 nd -to-terminal 3' residues comprise a 2' O-methyl modification. In embodiments, each of the first 1, 2, 3 or more of the 5' residues comprise a 2' O-methyl modification, and each of the first 1, 2, 3 or more of the 3 ' residues comprise a 2' O-methyl modification.
- each of the first 3 of the 5' residues comprise a 2' O-methyl modification, and each of the first 3 of the 3' residues comprise a 2' O-methyl modification. In embodiments, each of the first 3 of the 5' residues comprise a 2' O-methyl modification, and the 4 th -to-terminal, 3 rd -to-terminal, and 2 nd -to-terminal 3 ' residues comprise a 2' O-methyl modification.
- any of the 2' O- methyl modfications may be combined with one or more phosphorothioate modifications, e.g., as described above, and/or one or more inverted abasic modifications, e.g., as described above.
- the gRNA (e.g., the sgRNA or the tracr and/or crRNA of a dgRNA), e.g., any of the gRNA or gRNA components described above, comprises, e.g., consists of, a phosphorothioate bond between each of the first four 5' residues (e.g., comprises, e.g., consists of three phosphorothioate bonds at the 5' end of the polynucleotide(s)), a phosphorothioate bond between each of the first four 3 ' residues (e.g., comprises, e.g., consists of three phosphorothioate bonds at the 5' end of the polynucleotide(s)), a 2' O-methyl modification at each of the first three 5' residues, and a 2' O-methyl modification at each of the first three 3 ' residues.
- the gRNA (e.g., the sgRNA or the tracr and/or crRNA of a dgRNA), e.g., any of the gRNA or gRNA components described above, comprises, e.g., consists of, a phosphorothioate bond between each of the first four 5' residues (e.g., comprises, e.g., consists of three phosphorothioate bonds at the 5' end of the polynucleotide(s)), a phosphorothioate bond between each of the first four 3 ' residues (e.g., comprises, e.g., consists of three phosphorothioate bonds at the 5' end of the polynucleotide(s)), a 2' O-methyl modification at each of the first three 5' residues, and a 2' O-methyl modification at each of the 4 th -to-terminal, S ⁇ -to-terminal, and 2 nd -to
- the gRNA (e.g., the sgRNA or the tracr and/or crRNA of a dgRNA), e.g., any of the gRNA or gRNA components described above, comprises, e.g., consists of, a phosphorothioate bond between each of the first four 5' residues (e.g., comprises, e.g., consists of three
- phosphorothioate bonds at the 5' end of the polynucleotide(s) a phosphorothioate bond between each of the first four 3 ' residues (e.g., comprises, e.g., consists of three phosphorothioate bonds at the 5' end of the polynucleotide(s)), a 2' O-methyl modification at each of the first three 5' residues, a 2' O- methyl modification at each of the first three 3 ' residues, and an additional inverted abasic residue at each of the 5' and 3 ' ends.
- a phosphorothioate bond between each of the first four 3 ' residues e.g., comprises, e.g., consists of three phosphorothioate bonds at the 5' end of the polynucleotide(s)
- a 2' O-methyl modification at each of the first three 5' residues a 2' O- methyl modification at each of the first three 3
- the gRNA (e.g., the sgRNA or the tracr and/or crRNA of a dgRNA), e.g., any of the gRNA or gRNA components described above, comprises, e.g., consists of, a phosphorothioate bond between each of the first four 5' residues (e.g., comprises, e.g., consists of three
- phosphorothioate bonds at the 5' end of the polynucleotide(s) a phosphorothioate bond between each of the first four 3 ' residues (e.g., comprises, e.g., consists of three phosphorothioate bonds at the 5' end of the polynucleotide(s)), a 2' O-methyl modification at each of the first three 5' residues, and a 2' O-methyl modification at each of the 4 th -to-terminal, 3 rd -to-terminal, and 2 nd -to-terminal 3 ' residues, and an additional inverted abasic residue at each of the 5' and 3' ends.
- a phosphorothioate bond between each of the first four 3 ' residues e.g., comprises, e.g., consists of three phosphorothioate bonds at the 5' end of the polynucleotide(s)
- the gRNA is a dgRNA and comprises, e.g., consists of:
- m indicates a base with 2'0-Methyl modification
- * indicates a phosphorothioate bond
- N's indicate the residues of the targeting domain, e.g., as described herein, (optionally with an inverted abasic residue at the 5' and/or 3 ' terminus);
- the gRNA is a dgRNA and comprises, e.g., consists of:
- m indicates a base with 2'0-Methyl modification
- * indicates a phosphorothioate bond
- N's indicate the residues of the targeting domain, e.g., as described herein, (optionally with an inverted abasic residue at the 5' and/or 3 ' terminus);
- the gRNA is a dgRNA and comprises, e.g., consists of:
- crRNA mN*mN*mN*NNNNNNNNNNNNNNNGUUUU
- N indicate the residues of the targeting domain, e.g., as described herein, (optionally with an inverted abasic residue at the 5' and/or 3 ' terminus);
- the gRNA is a dgRNA and comprises, e.g., consists of:
- mN*mN*mN*N*N*NNNNNNNNNNNNNGU (SEQ ID NO: 252), where m indicates a base with 2'0-Methyl modification, * indicates a phosphorothioate bond, and N's indicate the residues of the targeting domain, e.g., as described herein, (optionally with an inverted abasic residue at the 5' and/or 3 ' terminus); and
- the gRNA is a dgRNA and comprises, e.g., consists of:
- N's indicate the residues of the targeting domain, e.g., as described herein, (optionally with an inverted abasic residue at the 5' and/or 3 ' terminus);
- the gRNA is a sgRNA and comprises, e.g., consists of: N NN NN NN NN NN NGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUA GUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 254), where m indicates a base with 2'0-Methyl modification, * indicates a phosphorothioate bond, and N's indicate the residues of the targeting domain, e.g., as described herein, (optionally with an inverted abasic residue at the 5 ' and/or 3 ' terminus).
- the gRNA is a sgRNA and comprises, e.g., consists of:
- the gRNA is a sgRNA and comprises, e.g., consists of:
- the tracr may comprise a first tracr extension.
- the first tracr extension may comprise nucleotides that are complementary, e.g., 80%, 85%, 90%, 95% or 99%, e.g., fully complementary, with nucleotides of the first flagpole extension.
- the first tracr extension nucleotides that hybridize with complementary nucleotides of the first flagpole extension are contiguous.
- the first tracr extension nucleotides that hybridize with complementary nucleotides of the first flagpole extension are discontinuous, e.g., comprises two or more regions of hybridization separated by nucleotides that do not base pair with nucleotides of the first flagpole extension.
- the first tracr extension comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides.
- the first tracr extension comprises SEQ ID NO: 189.
- the first tracr extension comprises nucleic acid that is at least 80%, 85%, 90%, 95% or 99% homology to SEQ ID NO: 189.
- nucleotides of the first tracr extension can have a modification, e.g., modification found in Section XIII herein.
- the sgRNA may comprise, from 5' to 3', disposed 3' to the targeting domain: a)
- a sgRNA of the invention comprises, e.g., consists of, from 5' to 3' : [targeting domain] -
- a sgRNA of the invention comprises, e.g., consists of, from 5' to 3' : [targeting domain] -
- the dgRNA may comprise:
- a crRNA comprising, from 5' to 3', preferrably disposed directly 3 ' to the targeting domain: a) GUUUUAGAGCUA (SEQ ID NO: 182);
- a tracr comprising, from 5' to 3 ' :
- sequence of k), above comprises the 3' sequence UUUUU, e.g., if a U6 promoter is used for transcription.
- sequence of k), above comprises the 3' sequence UUUU, e.g., if an HI promoter is used for transcription.
- sequence of k), above comprises variable numbers of 3' U's depending, e.g., on the termination signal of the pol-III promoter used.
- the sequence of k), above comprises variable 3' sequence derived from the DNA template if a T7 promoter is used.
- the sequence of k), above comprises variable 3' sequence derived from the DNA template, e.g., if in vitro transcription is used to generate the RNA molecule.
- the sequence of k), above comprises variable 3' sequence derived from the DNA template, e.g, if a pol-II promoter is used to drive transcription.
- the crRNA comprises, e.g., consists of, a targeting domain and, disposed 3 ' to the targeting domain (e.g., disposed directly 3 ' to the targeting domain), a sequence comprising, e.g., consisting of, SEQ ID NO: 201, and the tracr comprises, e.g., consists of
- the crRNA comprises, e.g., consists of, a targeting domain and, disposed 3 ' to the targeting domain (e.g., disposed directly 3 ' to the targeting domain), a sequence comprising, e.g., consisting of, SEQ ID NO: 202, and the tracr comprises, e.g., consists of, AACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCUUUUUU (SEQ ID NO: 225).
- the crRNA comprises, e.g., consists of, a targeting domain and, disposed 3' to the targeting domain (e.g., disposed directly 3' to the targeting domain), a sequence comprising, e.g., consisting of, GUUUUAGAGCUAUGCU (SEQ ID NO: 226), and the tracr comprises, e.g., consists of,
- the crRNA comprises, e.g., consists of, a targeting domain and, disposed 3' to the targeting domain (e.g., disposed directly 3' to the targeting domain), a sequence comprising, e.g., consisting of, GUUUUAGAGCUAUGCU (SEQ ID NO: 226), and the tracr comprises, e.g., consists of,
- the crRNA comprises, e.g., consists of, a targeting domain and, disposed 3 ' to the targeting domain (e.g., disposed directly 3' to the targeting domain), a sequence comprising, e.g., consisting of, GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 201), and the tracr comprises, e.g., consists of,
- targeting domains directed to nondeletional HPFH regions for gRNA molecules of the present invention, and for use in the various aspects of the present invention, for example, in altering expression of globin genes, for example, a fetal hemoglobin gene or a hemoglobin beta gene.
- Table 1 gRNA targeting domains directed to nondeletional HPFH regions.
- SEQ ID NO:s refer to the gRNA targeting domain sequence.
- Table 2 shows those targeting domains which, when included in a gRNA molecule, result in at least a 17% increase in fetal hemoglobin (e.g., in erythroid cells differentiated from modified HSPCs) at 7 days according to the methods described in the Examples.
- gRNA molecules comprising any of these targeting domains are collectively referred to herein as Tier 2 gRNA molecules.
- Table 3a and Table 3b, below, show those targeting domains which, when included in a gRNA molecule, result in the highest increase in fetal hemoglobin (e.g., in erythroid cells differentiated from modified HSPCs) at 7 days according to the methods described in the Examples.
- gRNA molecules comprising these targeting domains are collectively referred to herein as Tier 1 (e.g., Tirr la or Tier lb) gRNA molecules.
- Tier 1 e.g., Tirr la or Tier lb
- Methods for designing gRNAs are described herein, including methods for selecting, designing and validating target sequences.
- Exemplary targeting domains are also provided herein.
- Targeting Domains discussed herein can be incorporated into the gRNAs described herein.
- a software tool can be used to optimize the choice of gRNA within a user's target sequence, e.g., to minimize total off-target activity across the genome.
- Off target activity may be other than cleavage.
- the tool can identify all off-target sequences (e.g., preceding either NAG or NGG PAMs) across the genome that contain up to certain number (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) of mismatched base-pairs.
- the cleavage efficiency at each off-target sequence can be predicted, e.g., using an experimentally -derived weighting scheme.
- Each possible gRNA is then ranked according to its total predicted off-target cleavage; the top-ranked gRNAs represent those that are likely to have the greatest on-target and the least off-target cleavage.
- Other functions e.g., automated reagent design for CRISPR construction, primer design for the on- target Surveyor assay, and primer design for high-throughput detection and quantification of off-target cleavage via next-gen sequencing, can also be included in the tool.
- Candidate gRNA molecules can be evaluated by art-known methods or as described herein.
- gRNA molecules typically require screening in specific cell lines, e.g., primary human cell lines, e.g., human HSPCs, e.g., human CD34+ cells, to determine, for example, cutting efficiency, indel formation, cutting specificity and change in desired phenotype. These properties may be assayed by the methods described herein.
- primary human cell lines e.g., human HSPCs, e.g., human CD34+ cells
- a gRNA comprising the targeting domain of GCR-0001 (SEQ ID NO: 1, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
- crRNA AGUCCUGGUAUCCUCUAUGAGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 77) tracr:
- crRNA mA*rriG*rriU*CCUGGUAUCCUCUAUGAGUUUUAGAGCUAUGCUGUU*mU*mU*rriG (SEQ ID NO: 78)
- crRNA mA*rriG*rriU*CCUGGUAUCCUCUAUGAGUUUUAGAGCUAUGCUGUU*mU*mU*rriG (SEQ ID NO: 78)
- any of the gRNA molecules described herein, e.g., described above, is complexed with a Cas9 molecule, e.g., as described herein, to form a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- a gRNA comprising the targeting domain of GCR-0006 (SEQ ID NO: 6, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
- crRNA AAAAACUGGAAUGACUGAAUGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 82) tracr:
- any of the gRNA molecules described herein, e.g., described above, is complexed with a Cas9 molecule, e.g., as described herein, to form a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- a gRNA comprising the targeting domain of GCR-0008 (SEP ID NP: 8, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
- crRNA GGAGAAGGAAACUAGCUAAAGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 87) tracr:
- any of the gRNA molecules described herein, e.g., described above, is complexed with a Cas9 molecule, e.g., as described herein, to form a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- a gRNA comprising the targeting domain of GCR-009 (SEQ ID NO: 9, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
- crRNA GUUUCCUUCUCCCAUCAUAGGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 92) tracr:
- dgRNA GCR-0009 #2 crRNA: mG*mU*mU*UCCUUCUCCCAUCAUAGGUUUUAGAGCUAUGCUGUU*mU*mU*mG (SEQ ID NO: 93)
- crRNA mG*mU*mU*UCCUUCUCCCAUCAUAGGUUUUAGAGCUAUGCUGUU*mU*mU*mG (SEQ ID NO: 93)
- any of the gRNA molecules described herein, e.g., described above, is complexed with a Cas9 molecule, e.g., as described herein, to form a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- a gRNA comprising the targeting domain of GCR-0010 (SEQ ID NO: 10, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
- crRNA GGGAGAAGGAAACUAGCUAAGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 97) tracr:
- any of the gRNA molecules described herein, e.g., described above, is complexed with a Cas9 molecule, e.g., as described herein, to form a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- a gRNA comprising the targeting domain of GCR-0011 (SEQ ID NO: 11, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
- crRNA CACUGGAGCUAGAGACAAGAGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 102)
- any of the gRNA molecules described herein, e.g., described above, is complexed with a Cas9 molecule, e.g., as described herein, to form a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- a gRNA comprising the targeting domain of GCR-0012 (SEQ ID NO: 12, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
- any of the gRNA molecules described herein, e.g., described above, is complexed with a Cas9 molecule, e.g., as described herein, to form a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- a gRNA comprising the targeting domain of GCR-0028 (SEQ ID NO: 28, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
- crRNA GGCUAGGGAUGAAGAAUAAAGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 112) tracr:
- any of the gRNA molecules described herein, e.g., described above, is complexed with a Cas9 molecule, e.g., as described herein, to form a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- a gRNA comprising the targeting domain of GCR-0034 (SEQ ID NO: 34, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
- crRNA AAAAAUUGGAAUGACUGAAUGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 117)
- any of the gRNA molecules described herein, e.g., described above, is complexed with a Cas9 molecule, e.g., as described herein, to form a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- a gRNA comprising the targeting domain of GCR-0045 (SEQ ID NO: 45, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
- dgRNA GCR-0045 #1
- dgRNA GCR-0045 #3 crRNA:
- any of the gRNA molecules described herein, e.g., described above, is complexed with a Cas9 molecule, e.g., as described herein, to form a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- a gRNA comprising the targeting domain of GCR-0046 (SEQ ID NO: 46, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
- crRNA GGGAGAAGAAAACUAGCUAAGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 127) tracr:
- any of the gRNA molecules described herein, e.g., described above, is complexed with a Cas9 molecule, e.g., as described herein, to form a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- a gRNA comprising the targeting domain of GCR-0047 (SEQ ID NO: 47, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
- sgRNA GCR-0047 #2 mG*mG*mC*AAGGCUGGCCAACCCAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAA GGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*mU*mU*mU (SEQ ID NO: 130)
- crRNA GGCAAGGCUGGCCAACCCAUGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 132)
- crRNA mG*mG*mC*AAGGCUGGCCAACCCAUGUUUUAGAGCUAUGCUGUU*mU*mU*mG (SEQ ID NO: 133)
- crRNA mG*mG*mC*AAGGCUGGCCAACCCAUGUUUUAGAGCUAUGCUGUU*mU*mU*mG (SEQ ID NO: 133)
- any of the gRNA molecules described herein, e.g., described above, is complexed with a Cas9 molecule, e.g., as described herein, to form a ribonuclear protein complex (RNP).
- RNP ribonuclear protein complex
- a gRNA comprising the targeting domain of GCR-0048 (SEQ ID NO: 48, unmodified sequence underlined below), e.g., one of the gRNA molecules described below, is useful in the CRISPR systems, methods, cells and other aspects and embodiments of the invention, including in aspects involving more than one gRNA molecule, e.g., described herein:
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Diabetes (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Hematology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Epidemiology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Medicinal Preparation (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (24)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2019127919A RU2834231C2 (ru) | 2017-02-06 | 2018-02-05 | Композиции и способы, предназначенные для лечения гемоглобинопатий |
| CN202410988194.4A CN119286853A (zh) | 2017-02-06 | 2018-02-05 | 用于治疗血红蛋白病的组合物和方法 |
| EP18708204.5A EP3577223A1 (en) | 2017-02-06 | 2018-02-05 | Compositions and methods for the treatment of hemoglobinopathies |
| CN201880020201.4A CN110546262B (zh) | 2017-02-06 | 2018-02-05 | 用于治疗血红蛋白病的组合物和方法 |
| KR1020247002710A KR20240017098A (ko) | 2017-02-06 | 2018-02-05 | 혈색소병증의 치료를 위한 조성물 및 방법 |
| KR1020197026089A KR102630217B1 (ko) | 2017-02-06 | 2018-02-05 | 혈색소병증의 치료를 위한 조성물 및 방법 |
| BR112019016205-4A BR112019016205B1 (pt) | 2017-02-06 | 2018-02-05 | Molécula de grna, composição, uso desta e métodos para alteração e para preparação de uma célula tronco hematopoiética ou célula progenitora hematopoiética (hpc) |
| MX2019009361A MX2019009361A (es) | 2017-02-06 | 2018-02-05 | Composiciones y metodos para el tratamiento de hemoglobinopatias. |
| AU2018215726A AU2018215726B2 (en) | 2017-02-06 | 2018-02-05 | Compositions and methods for the treatment of hemoglobinopathies |
| CA3052275A CA3052275A1 (en) | 2017-02-06 | 2018-02-05 | Compositions and methods for the treatment of hemoglobinopathies |
| MYPI2019004488A MY203407A (en) | 2017-02-06 | 2018-02-05 | Compositions and methods for the treatment of hemoglobinopathies |
| IL268406A IL268406B2 (en) | 2017-02-06 | 2018-02-05 | Compositions and methods for the treatment of hemoglobinopathies |
| US16/484,046 US11466271B2 (en) | 2017-02-06 | 2018-02-05 | Compositions and methods for the treatment of hemoglobinopathies |
| IL311222A IL311222A (en) | 2017-02-06 | 2018-02-05 | Preparations and methods for treating hemoglobin diseases |
| JP2019542456A JP2020505934A (ja) | 2017-02-06 | 2018-02-05 | 異常ヘモグロビン症の治療用組成物及び方法 |
| SG11201907056XA SG11201907056XA (en) | 2017-02-06 | 2018-02-05 | Compositions and methods for the treatment of hemoglobinopathies |
| EA201991862A EA201991862A1 (ru) | 2017-02-06 | 2018-02-05 | Композиции и способы, предназначенные для лечения гемоглобинопатий |
| MX2025012712A MX2025012712A (es) | 2017-02-06 | 2019-08-06 | Composiciones utiles para el tratamiento de hemoglobinopatias |
| PH12019501812A PH12019501812A1 (en) | 2017-02-06 | 2019-08-06 | Compositions and methods for the treatment of hemoglobinopathies |
| AU2022200457A AU2022200457A1 (en) | 2017-02-06 | 2022-01-25 | Compositions and methods for the treatment of hemoglobinopathies |
| US17/808,802 US12559748B2 (en) | 2017-02-06 | 2022-06-24 | Compositions and methods for the treatment of hemoglobinopathies |
| JP2023001013A JP2023052242A (ja) | 2017-02-06 | 2023-01-06 | 異常ヘモグロビン症の治療用組成物及び方法 |
| AU2024205089A AU2024205089A1 (en) | 2017-02-06 | 2024-07-25 | Compositions and methods for the treatment of hemoglobinopathies |
| JP2025074171A JP2025134087A (ja) | 2017-02-06 | 2025-04-28 | 異常ヘモグロビン症の治療用組成物及び方法 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762455464P | 2017-02-06 | 2017-02-06 | |
| US62/455,464 | 2017-02-06 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/484,046 A-371-Of-International US11466271B2 (en) | 2017-02-06 | 2018-02-05 | Compositions and methods for the treatment of hemoglobinopathies |
| US17/808,802 Division US12559748B2 (en) | 2017-02-06 | 2022-06-24 | Compositions and methods for the treatment of hemoglobinopathies |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018142364A1 true WO2018142364A1 (en) | 2018-08-09 |
Family
ID=61526837
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2018/050712 Ceased WO2018142364A1 (en) | 2017-02-06 | 2018-02-05 | Compositions and methods for the treatment of hemoglobinopathies |
Country Status (17)
| Country | Link |
|---|---|
| US (2) | US11466271B2 (https=) |
| EP (1) | EP3577223A1 (https=) |
| JP (3) | JP2020505934A (https=) |
| KR (2) | KR102630217B1 (https=) |
| CN (2) | CN110546262B (https=) |
| AR (1) | AR110962A1 (https=) |
| AU (3) | AU2018215726B2 (https=) |
| CA (1) | CA3052275A1 (https=) |
| EA (1) | EA201991862A1 (https=) |
| IL (2) | IL311222A (https=) |
| MX (2) | MX2019009361A (https=) |
| MY (1) | MY203407A (https=) |
| PH (1) | PH12019501812A1 (https=) |
| SA (1) | SA519402400B1 (https=) |
| SG (1) | SG11201907056XA (https=) |
| TW (1) | TW201839136A (https=) |
| WO (1) | WO2018142364A1 (https=) |
Cited By (54)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019003193A1 (en) * | 2017-06-30 | 2019-01-03 | Novartis Ag | METHODS FOR TREATING DISEASES USING GENE EDITING SYSTEMS |
| WO2019079347A1 (en) * | 2017-10-16 | 2019-04-25 | The Broad Institute, Inc. | USES OF BASIC EDITORS ADENOSINE |
| WO2019087113A1 (en) | 2017-11-01 | 2019-05-09 | Novartis Ag | Synthetic rnas and methods of use |
| CN110106203A (zh) * | 2019-05-24 | 2019-08-09 | 中国医学科学院血液病医院(血液学研究所) | 一种新型hbb过表达载体及其设计方法和应用 |
| WO2020113112A1 (en) * | 2018-11-29 | 2020-06-04 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| WO2020112195A1 (en) * | 2018-11-30 | 2020-06-04 | Yale University | Compositions, technologies and methods of using plerixafor to enhance gene editing |
| US10704021B2 (en) | 2012-03-15 | 2020-07-07 | Flodesign Sonics, Inc. | Acoustic perfusion devices |
| US10785574B2 (en) | 2017-12-14 | 2020-09-22 | Flodesign Sonics, Inc. | Acoustic transducer driver and controller |
| WO2020221291A1 (zh) * | 2019-04-30 | 2020-11-05 | 博雅辑因(北京)生物科技有限公司 | 一种血红蛋白病治疗有效性预测方法 |
| CN111939271A (zh) * | 2019-04-30 | 2020-11-17 | 博雅辑因(北京)生物科技有限公司 | 一种血红蛋白病治疗有效性预测方法 |
| US10975368B2 (en) | 2014-01-08 | 2021-04-13 | Flodesign Sonics, Inc. | Acoustophoresis device with dual acoustophoretic chamber |
| US11142760B2 (en) | 2019-02-13 | 2021-10-12 | Beam Therapeutics Inc. | Compositions and methods for treating hemoglobinopathies |
| US11214789B2 (en) | 2016-05-03 | 2022-01-04 | Flodesign Sonics, Inc. | Concentration and washing of particles with acoustics |
| US20220025403A1 (en) * | 2018-12-05 | 2022-01-27 | Fred Hutchinson Cancer Research Center | Reduced and minimal manipulation manufacturing of genetically-modified cells |
| US11242525B2 (en) | 2014-03-26 | 2022-02-08 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating sickle cell disease |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11377651B2 (en) | 2016-10-19 | 2022-07-05 | Flodesign Sonics, Inc. | Cell therapy processes utilizing acoustophoresis |
| US11390884B2 (en) | 2015-05-11 | 2022-07-19 | Editas Medicine, Inc. | Optimized CRISPR/cas9 systems and methods for gene editing in stem cells |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11708572B2 (en) | 2015-04-29 | 2023-07-25 | Flodesign Sonics, Inc. | Acoustic cell separation techniques and processes |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| WO2023164636A1 (en) * | 2022-02-25 | 2023-08-31 | Vor Biopharma Inc. | Compositions and methods for homology-directed repair gene modification |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| EP4054710A4 (en) * | 2019-11-06 | 2023-12-06 | Syros Pharmaceuticals, Inc. | Compositions and methods for treating sickle cell disease |
| US11851690B2 (en) | 2017-03-14 | 2023-12-26 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| US11866726B2 (en) | 2017-07-14 | 2024-01-09 | Editas Medicine, Inc. | Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11911415B2 (en) | 2015-06-09 | 2024-02-27 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for improving transplantation |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11963982B2 (en) | 2017-05-10 | 2024-04-23 | Editas Medicine, Inc. | CRISPR/RNA-guided nuclease systems and methods |
| US12031132B2 (en) | 2018-03-14 | 2024-07-09 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
| US12133884B2 (en) | 2018-05-11 | 2024-11-05 | Beam Therapeutics Inc. | Methods of substituting pathogenic amino acids using programmable base editor systems |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| WO2024254566A3 (en) * | 2023-06-08 | 2025-01-09 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| US12215365B2 (en) | 2013-12-12 | 2025-02-04 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| WO2025128871A2 (en) | 2023-12-13 | 2025-06-19 | Renagade Therapeutics Management Inc. | Lipid nanoparticles comprising coding rna molecules for use in gene editing and as vaccines and therapeutic agents |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12473573B2 (en) | 2013-09-06 | 2025-11-18 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| US12559748B2 (en) | 2017-02-06 | 2026-02-24 | Novartis Ag | Compositions and methods for the treatment of hemoglobinopathies |
| US12584118B2 (en) | 2013-09-06 | 2026-03-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20220033856A1 (en) * | 2018-09-11 | 2022-02-03 | Université de Paris | Methods for increasing fetal hemoglobin content in eukaryotic cells and uses thereof for the treatment of hemoglobinopathies |
| GB2632565B (en) * | 2020-04-09 | 2025-06-04 | Verve Therapeutics Inc | Base editing of PCSK9 and methods of using same for treatment of disease |
| CN111575306B (zh) * | 2020-06-11 | 2022-08-05 | 南方医科大学 | 一种激活红细胞中γ珠蛋白基因表达的方法 |
| EP4196260A4 (en) * | 2020-08-14 | 2025-04-30 | Navan Technologies, Inc. | METHODS AND APPARATUS FOR DELIVERING BIOMOLECULES TO PRIMARY HUMAN HEMATOPOIETIC STEM CELLS USING NANOSTRAWS |
| EP4288541A1 (en) | 2021-02-05 | 2023-12-13 | Christiana Care Gene Editing Institute, Inc. | Methods of and compositions for reducing gene expression and/or activity |
| CN115851706A (zh) * | 2021-09-24 | 2023-03-28 | 华东师范大学 | 一种碱基编辑系统及其应用 |
| IL322419A (en) * | 2023-02-01 | 2025-09-01 | Prime Medicine Inc | Genome editing agents and methods for treating cystic fibrosis |
| CN116445402B (zh) * | 2023-05-09 | 2025-04-25 | 中国科学院生态环境研究中心 | 红系祖细胞的扩增培养基、扩增培养方法及应用 |
| WO2025174765A1 (en) | 2024-02-12 | 2025-08-21 | Renagade Therapeutics Management Inc. | Lipid nanoparticles comprising coding rna molecules for use in gene editing and as vaccines and therapeutic agents |
Citations (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1993021956A1 (en) | 1992-05-05 | 1993-11-11 | Cytel Corporation | Antibodies to p-selectin and their uses |
| WO1995034324A1 (en) | 1994-06-14 | 1995-12-21 | Protein Design Labs, Inc. | Cross-reacting monoclonal antibodies specific for e-selectin and p-selectin |
| US5800815A (en) | 1903-05-05 | 1998-09-01 | Cytel Corporation | Antibodies to P-selectin and their uses |
| US6667036B2 (en) | 1991-02-05 | 2003-12-23 | The Board Of Regents Of The University Of Oklahoma | Methods of treatment using antibodies to P-selectin glycoprotein ligand |
| WO2005060697A2 (en) | 2003-12-19 | 2005-07-07 | Chiron Corporation | Cell transfecting formulations of small interfering rna, related compositions and methods of making and use |
| WO2005100402A1 (en) | 2004-04-13 | 2005-10-27 | F.Hoffmann-La Roche Ag | Anti-p-selectin antibodies |
| WO2008069999A2 (en) | 2006-12-01 | 2008-06-12 | Selexys Pharmaceuticals Corporation | Anti-p-selectin antibodies and methods of using the same to treat inflammatory diseases |
| WO2010059401A2 (en) | 2008-10-30 | 2010-05-27 | Irm Llc | Compounds that expand hematopoietic stem cells |
| WO2011076807A2 (en) | 2009-12-23 | 2011-06-30 | Novartis Ag | Lipids, lipid compositions, and methods of using them |
| US20110293617A1 (en) | 2006-12-01 | 2011-12-01 | Scott Rollins | Anti-p-selectin antibodies and methods of their use and identification |
| WO2012006378A1 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Liposomes with lipids having an advantageous pka- value for rna delivery |
| WO2012031046A2 (en) | 2010-08-31 | 2012-03-08 | Novartis Ag | Lipids suitable for liposomal delivery of protein-coding rna |
| WO2013006825A1 (en) | 2011-07-06 | 2013-01-10 | Novartis Ag | Liposomes having useful n:p ratio for delivery of rna molecules |
| WO2013059343A1 (en) | 2011-10-17 | 2013-04-25 | Massachusetts Institute Of Technology | Intracellular delivery |
| WO2013103467A1 (en) | 2012-01-06 | 2013-07-11 | Alcon Research, Ltd. | Interfering rna delivery system and uses thereof |
| WO2013110198A1 (en) | 2012-01-27 | 2013-08-01 | Université de Montréal | Pyrimido[4,5-b]indole derivatives and use thereof in the expansion of hematopoietic stem cells |
| WO2013126794A1 (en) * | 2012-02-24 | 2013-08-29 | Fred Hutchinson Cancer Research Center | Compositions and methods for the treatment of hemoglobinopathies |
| WO2014130955A1 (en) | 2013-02-25 | 2014-08-28 | Sangamo Biosciences, Inc. | Methods and compositions for enhancing nuclease-mediated gene disruption |
| WO2014136086A1 (en) | 2013-03-08 | 2014-09-12 | Novartis Ag | Lipids and lipid compositions for the delivery of active agents |
| WO2014140211A1 (en) | 2013-03-15 | 2014-09-18 | Novartis Ag | Rna purification methods |
| WO2014150256A1 (en) | 2013-03-15 | 2014-09-25 | Global Blood Therapeutics, Inc. | Compositions and methods for the modulation of hemoglobin (s) |
| US20140295558A1 (en) | 2012-01-03 | 2014-10-02 | City University Of Hong Kong | Method and apparatus for delivery of molecules to cells |
| WO2015023982A1 (en) | 2013-08-16 | 2015-02-19 | Massachusetts Institute Of Technology | Selective delivery of material to cells |
| WO2015089486A2 (en) * | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Systems, methods and compositions for sequence manipulation with optimized functional crispr-cas systems |
| WO2015095340A1 (en) | 2013-12-19 | 2015-06-25 | Novartis Ag | Lipids and lipid compositions for the delivery of active agents |
| WO2015095346A1 (en) | 2013-12-19 | 2015-06-25 | Novartis Ag | Lipids and lipid compositions for the delivery of active agents |
| US9068001B2 (en) | 2006-12-01 | 2015-06-30 | Selexys Pharmaceuticals | Anti-P-selectin antibodies |
| WO2016103233A2 (en) * | 2014-12-24 | 2016-06-30 | Dana-Farber Cancer Institute, Inc. | Systems and methods for genome modification and regulation |
| WO2016135558A2 (en) * | 2015-02-23 | 2016-09-01 | Crispr Therapeutics Ag | Materials and methods for treatment of hemoglobinopathies |
| WO2017160890A1 (en) * | 2016-03-14 | 2017-09-21 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating beta hemoglobinopathies |
Family Cites Families (219)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5213796A (en) | 1991-05-06 | 1993-05-25 | Dana Farber Cancer Institute | Assay for polyomavirus in humans and uses thereof |
| US5726014A (en) | 1991-06-27 | 1998-03-10 | Genelabs Technologies, Inc. | Screening assay for the detection of DNA-binding molecules |
| US5578444A (en) | 1991-06-27 | 1996-11-26 | Genelabs Technologies, Inc. | Sequence-directed DNA-binding molecules compositions and methods |
| US7910624B1 (en) | 1995-03-03 | 2011-03-22 | The Trustees Of Boston University | Compositions for the treatment of blood disorders |
| WO1995011699A1 (en) | 1993-10-29 | 1995-05-04 | The Trustees Of Boston University | Physiologically stable compositions of butyric acid, and butyric acid salts and derivatives as anti-neoplastic agents |
| US6599692B1 (en) | 1999-09-14 | 2003-07-29 | Sangamo Bioscience, Inc. | Functional genomics using zinc finger proteins |
| US6534261B1 (en) | 1999-01-12 | 2003-03-18 | Sangamo Biosciences, Inc. | Regulation of endogenous gene expression in cells using zinc finger proteins |
| US6453242B1 (en) | 1999-01-12 | 2002-09-17 | Sangamo Biosciences, Inc. | Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites |
| US7013219B2 (en) | 1999-01-12 | 2006-03-14 | Sangamo Biosciences, Inc. | Regulation of endogenous gene expression in cells using zinc finger proteins |
| US7070934B2 (en) | 1999-01-12 | 2006-07-04 | Sangamo Biosciences, Inc. | Ligand-controlled regulation of endogenous gene expression |
| US20020164575A1 (en) | 1999-09-14 | 2002-11-07 | Sangamo Biosciences, Inc., A Delaware Corporation | Gene identification |
| US6780590B2 (en) | 1999-09-14 | 2004-08-24 | Sangamo Biosciences, Inc. | Gene identification |
| CA2394850C (en) | 1999-12-06 | 2012-02-07 | Sangamo Biosciences, Inc. | Methods of using randomized libraries of zinc finger proteins for the identification of gene function |
| IT1320168B1 (it) | 2000-03-13 | 2003-11-18 | Univ Ferrara | Oligonucleotidi sintetici in grado di indurre il differenziamentoeritroide. |
| WO2001085765A2 (en) | 2000-05-12 | 2001-11-15 | Merck Patent Gmbh | Identification of mfq-110, a human c2h2-type zinc finger protein |
| EP1416972B1 (en) | 2000-11-09 | 2012-02-08 | Cold Spring Harbor Laboratory | Chimeric molecules to modulate gene expression |
| WO2002044386A2 (en) | 2000-12-01 | 2002-06-06 | Sangamo Biosciences, Inc. | Targeted regulation of gene expression |
| CA2444691A1 (en) | 2001-04-18 | 2002-10-31 | Protein Design Labs, Inc. | Methods of diagnosis of lung cancer, compositions and methods of screening for modulators of lung cancer |
| CA2461290C (en) | 2001-09-24 | 2014-11-25 | Sangamo Biosciences, Inc. | Modulation of stem cells using zinc finger proteins |
| EP2806025B1 (en) | 2002-09-05 | 2019-04-03 | California Institute of Technology | Use of zinc finger nucleases to stimulate gene targeting |
| DE60333487D1 (de) | 2002-12-13 | 2010-09-02 | Genetix Pharmaceuticals Inc | Therapeutische retrovirus-vektoren für gentherapie |
| US20050025753A1 (en) | 2003-04-30 | 2005-02-03 | Wei Han | Methods for production of non-disease causing hemoglobin by ex vivo oligonucleotide gene editing of human stem/progenitor cells |
| JP4555292B2 (ja) | 2003-08-08 | 2010-09-29 | サンガモ バイオサイエンシズ インコーポレイテッド | 標的化された切断及び組換えの方法及び組成物 |
| US7888121B2 (en) | 2003-08-08 | 2011-02-15 | Sangamo Biosciences, Inc. | Methods and compositions for targeted cleavage and recombination |
| US8409861B2 (en) | 2003-08-08 | 2013-04-02 | Sangamo Biosciences, Inc. | Targeted deletion of cellular DNA sequences |
| US20050244851A1 (en) | 2004-01-13 | 2005-11-03 | Affymetrix, Inc. | Methods of analysis of alternative splicing in human |
| US7972854B2 (en) | 2004-02-05 | 2011-07-05 | Sangamo Biosciences, Inc. | Methods and compositions for targeted cleavage and recombination |
| WO2007014181A2 (en) | 2005-07-25 | 2007-02-01 | Johns Hopkins University | Site-specific modification of the human genome using custom-designed zinc finger nucleases |
| GB0713183D0 (en) | 2007-07-06 | 2007-08-15 | King S College London | Method |
| EP2334794B8 (en) | 2008-09-15 | 2017-04-19 | The Children's Medical Center Corporation | Modulation of bcl11a for treatment of hemoglobinopathies |
| JP5727458B2 (ja) | 2009-04-13 | 2015-06-03 | アプセト ゲゼルシャフト ミット ベシュレンクテル ハフツング ウント コンパニー コマンディトゲゼルシャフトApceth Gmbh & Co. Kg | 改変間葉系幹細胞及びそれを使用した腫瘍の治療方法 |
| ES2578081T5 (es) | 2009-05-01 | 2019-10-16 | Uas Laboratories Llc | Composiciones bacterianas para profilaxis y tratamiento de enfermedades degenerativas |
| EP2327783A1 (en) | 2009-11-27 | 2011-06-01 | Universitätsklinikum Freiburg | Pharmaceutical composition comprising miRNA-100 and its use in the modulation of blood vessel growth |
| WO2012075027A1 (en) | 2010-11-29 | 2012-06-07 | Mount Sinai School Of Medicine | Embedded chimeric peptide nucleic acids for generation of induced pluripotent stem cells |
| WO2011103215A1 (en) | 2010-02-16 | 2011-08-25 | Mount Sinai School Of Medicine | Embedded chimeric peptide nucleic acids and use thereof |
| BR112012021941A2 (pt) | 2010-03-02 | 2022-02-01 | Abbvie Inc | Proteínas terapêuticas de ligação a dll4 |
| WO2012021632A2 (en) | 2010-08-10 | 2012-02-16 | The Johns Hopkins University | Generation and use of pluripotent stem cells |
| EP2627665B1 (en) | 2010-10-12 | 2015-12-16 | The Children's Hospital Of Philadelphia | Methods and compositions for treating hemophilia B |
| EP2648763A4 (en) | 2010-12-10 | 2014-05-14 | Alnylam Pharmaceuticals Inc | COMPOSITIONS AND METHODS FOR EXPRESSION INHIBITION OF GENES KLF-1 AND BCL11A |
| US8822491B2 (en) | 2011-02-18 | 2014-09-02 | Academia Sinica | Methods and compositions for treating β-thalassemia and sickle cell disease |
| DE202011050611U1 (de) | 2011-07-01 | 2012-10-09 | Makita Corporation | Anordnung zum Bereitstellen eines Kraftstoff-Luftgemischs für eine Brennkraftmaschine |
| WO2013019745A1 (en) | 2011-07-29 | 2013-02-07 | Georgia Health Sciences University | Methods and compositions for genetically modifiying cells |
| EP2766041B1 (en) | 2011-10-12 | 2018-12-05 | Children's Medical Center Corporation | Combinatorial compositions and methods of treating hemoglobinopathies |
| WO2013158309A2 (en) | 2012-04-18 | 2013-10-24 | The Board Of Trustees Of The Leland Stanford Junior University | Non-disruptive gene targeting |
| EP3241902B1 (en) | 2012-05-25 | 2018-02-28 | The Regents of The University of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US20150017136A1 (en) | 2013-07-15 | 2015-01-15 | Cellectis | Methods for engineering allogeneic and highly active t cell for immunotherapy |
| KR102437522B1 (ko) | 2012-05-25 | 2022-08-26 | 셀렉티스 | 면역요법을 위한 동종이형 및 면역억제제 저항성인 t 세포의 조작 방법 |
| CN104540382A (zh) | 2012-06-12 | 2015-04-22 | 弗·哈夫曼-拉罗切有限公司 | 用于产生条件性敲除等位基因的方法和组合物 |
| WO2014011901A2 (en) | 2012-07-11 | 2014-01-16 | Sangamo Biosciences, Inc. | Methods and compositions for delivery of biologics |
| KR102530118B1 (ko) | 2012-07-25 | 2023-05-08 | 더 브로드 인스티튜트, 인코퍼레이티드 | 유도 dna 결합 단백질 및 게놈 교란 도구 및 이의 적용 |
| SI2890780T1 (sl) | 2012-08-29 | 2020-11-30 | Sangamo Therapeutics, Inc. | Postopki in sestavki za zdravljenje genetskega stanja |
| CN104769103B (zh) | 2012-09-04 | 2018-06-08 | 塞勒克提斯公司 | 多链嵌合抗原受体和其用途 |
| EP4357457B1 (en) | 2012-10-23 | 2024-10-16 | Toolgen Incorporated | Composition for cleaving a target dna comprising a guide rna specific for the target dna and cas protein-encoding nucleic acid or cas protein, and use thereof |
| SG11201504038XA (en) | 2012-11-27 | 2015-06-29 | Childrens Medical Center | Targeting bcl11a distal regulatory elements for fetal hemoglobin reinduction |
| EP3363902B1 (en) | 2012-12-06 | 2019-11-27 | Sigma Aldrich Co. LLC | Crispr-based genome modification and regulation |
| US8697359B1 (en) | 2012-12-12 | 2014-04-15 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
| CA2894684A1 (en) | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Engineering and optimization of improved crispr-cas systems, methods and enzyme compositions for sequence manipulation in eukaryotes |
| AU2013359262C1 (en) | 2012-12-12 | 2021-05-13 | Massachusetts Institute Of Technology | CRISPR-Cas component systems, methods and compositions for sequence manipulation |
| DK2931898T3 (en) | 2012-12-12 | 2016-06-20 | Massachusetts Inst Technology | CONSTRUCTION AND OPTIMIZATION OF SYSTEMS, PROCEDURES AND COMPOSITIONS FOR SEQUENCE MANIPULATION WITH FUNCTIONAL DOMAINS |
| WO2014093718A1 (en) | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Methods, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
| WO2014093709A1 (en) | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Methods, models, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
| CN105121648B (zh) | 2012-12-12 | 2021-05-07 | 布罗德研究所有限公司 | 用于序列操纵的系统、方法和优化的指导组合物的工程化 |
| DK2931897T3 (en) | 2012-12-12 | 2018-02-05 | Broad Inst Inc | CONSTRUCTION, MODIFICATION AND OPTIMIZATION OF SYSTEMS, PROCEDURES AND COMPOSITIONS FOR SEQUENCE MANIPULATION AND THERAPEUTICAL APPLICATIONS |
| EP2931899A1 (en) | 2012-12-12 | 2015-10-21 | The Broad Institute, Inc. | Functional genomics using crispr-cas systems, compositions, methods, knock out libraries and applications thereof |
| WO2014093694A1 (en) | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Crispr-cas nickase systems, methods and compositions for sequence manipulation in eukaryotes |
| CA2895155C (en) | 2012-12-17 | 2021-07-06 | President And Fellows Of Harvard College | Rna-guided human genome engineering |
| RU2522816C1 (ru) | 2013-02-12 | 2014-07-20 | Российская Федерация, от имени которой выступает Министерство промышленности и торговли Российской Федерации (Минпромторг России) | Композиция для клеточно-заместительной терапии дефектов мягких тканей |
| WO2014134412A1 (en) | 2013-03-01 | 2014-09-04 | Regents Of The University Of Minnesota | Talen-based gene correction |
| WO2014143381A1 (en) | 2013-03-09 | 2014-09-18 | Agilent Technologies, Inc. | Methods of in vivo engineering of large sequences using multiple crispr/cas selections of recombineering events |
| MX374090B (es) | 2013-03-14 | 2025-03-05 | Caribou Biosciences Inc | Composiciones y métodos de ácidos nucleicos dirigidos al ácido nucleico. |
| US9234213B2 (en) | 2013-03-15 | 2016-01-12 | System Biosciences, Llc | Compositions and methods directed to CRISPR/Cas genomic engineering systems |
| US20140273230A1 (en) | 2013-03-15 | 2014-09-18 | Sigma-Aldrich Co., Llc | Crispr-based genome modification and regulation |
| US11332719B2 (en) | 2013-03-15 | 2022-05-17 | The Broad Institute, Inc. | Recombinant virus and preparations thereof |
| US10760064B2 (en) | 2013-03-15 | 2020-09-01 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| WO2014204578A1 (en) | 2013-06-21 | 2014-12-24 | The General Hospital Corporation | Using rna-guided foki nucleases (rfns) to increase specificity for rna-guided genome editing |
| AU2014227653B2 (en) | 2013-03-15 | 2017-04-20 | The General Hospital Corporation | Using RNA-guided foki nucleases (RFNs) to increase specificity for RNA-guided genome editing |
| JP6576904B2 (ja) | 2013-04-04 | 2019-09-18 | トラスティーズ・オブ・ダートマス・カレッジ | HIV−1プロウイルスDNAのinvivo切除のための組成物及び方法 |
| US20150056629A1 (en) | 2013-04-14 | 2015-02-26 | Katriona Guthrie-Honea | Compositions, systems, and methods for detecting a DNA sequence |
| US20160186208A1 (en) | 2013-04-16 | 2016-06-30 | Whitehead Institute For Biomedical Research | Methods of Mutating, Modifying or Modulating Nucleic Acid in a Cell or Nonhuman Mammal |
| MX2015015638A (es) | 2013-05-13 | 2016-10-28 | Cellectis | Metodos para diseñar celulas t altamente activas para inmunoterapia. |
| PL3546572T3 (pl) | 2013-05-13 | 2024-07-22 | Cellectis | Chimeryczny receptor antygenowy swoisty względem cd19 i jego zastosowania |
| CN105683376A (zh) | 2013-05-15 | 2016-06-15 | 桑格摩生物科学股份有限公司 | 用于治疗遗传病状的方法和组合物 |
| CA2907694A1 (en) | 2013-05-24 | 2014-11-27 | Roche Innovation Center Copenhagen A/S | Oligonucleotide modulators of b-cell cll/lymphoma 11a (bcl11a) and uses thereof |
| US11685935B2 (en) | 2013-05-29 | 2023-06-27 | Cellectis | Compact scaffold of Cas9 in the type II CRISPR system |
| WO2014191128A1 (en) | 2013-05-29 | 2014-12-04 | Cellectis | Methods for engineering t cells for immunotherapy by using rna-guided cas nuclease system |
| US20140356956A1 (en) | 2013-06-04 | 2014-12-04 | President And Fellows Of Harvard College | RNA-Guided Transcriptional Regulation |
| EP4596565A3 (en) | 2013-06-04 | 2025-11-05 | President And Fellows Of Harvard College | Rna-guided transcriptional regulation |
| EP3004370B1 (en) | 2013-06-05 | 2024-08-21 | Duke University | Rna-guided gene editing and gene regulation |
| US9593356B2 (en) | 2013-06-11 | 2017-03-14 | Takara Bio Usa, Inc. | Protein enriched microvesicles and methods of making and using the same |
| US20150315252A1 (en) | 2013-06-11 | 2015-11-05 | Clontech Laboratories, Inc. | Protein enriched microvesicles and methods of making and using the same |
| KR20250012194A (ko) | 2013-06-17 | 2025-01-23 | 더 브로드 인스티튜트, 인코퍼레이티드 | 바이러스 구성성분을 사용하여 장애 및 질환을 표적화하기 위한 crispr-cas 시스템 및 조성물의 전달, 용도 및 치료 적용 |
| MX2015017312A (es) | 2013-06-17 | 2017-04-10 | Broad Inst Inc | Suministro y uso de composiciones, vectores y sistemas crispr-cas para la modificación dirigida y terapia hepáticas. |
| KR20160019553A (ko) | 2013-06-17 | 2016-02-19 | 더 브로드 인스티튜트, 인코퍼레이티드 | 유사분열 후 세포의 질병 및 장애를 표적화하고 모델링하기 위한 시스템, 방법 및 조성물의 전달, 유전자 조작 및 최적화 |
| EP3725885A1 (en) | 2013-06-17 | 2020-10-21 | The Broad Institute, Inc. | Functional genomics using crispr-cas systems, compositions methods, screens and applications thereof |
| WO2014204724A1 (en) | 2013-06-17 | 2014-12-24 | The Broad Institute Inc. | Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation |
| WO2014204723A1 (en) | 2013-06-17 | 2014-12-24 | The Broad Institute Inc. | Oncogenic models based on delivery and use of the crispr-cas systems, vectors and compositions |
| EP3011030B1 (en) | 2013-06-17 | 2023-11-08 | The Broad Institute, Inc. | Optimized crispr-cas double nickase systems, methods and compositions for sequence manipulation |
| CN104239331B (zh) | 2013-06-19 | 2018-10-09 | 阿里巴巴集团控股有限公司 | 一种用于实现评论搜索引擎排序的方法和装置 |
| JP2016528890A (ja) | 2013-07-09 | 2016-09-23 | プレジデント アンド フェローズ オブ ハーバード カレッジ | CRISPR/Cas系を用いるゲノム編集の治療用の使用 |
| WO2015006294A2 (en) | 2013-07-10 | 2015-01-15 | President And Fellows Of Harvard College | Orthogonal cas9 proteins for rna-guided gene regulation and editing |
| SMT202100691T1 (it) | 2013-07-11 | 2022-01-10 | Modernatx Inc | Composizioni 5 comprendenti polinucleotidi sintetici che codificano proteine correlate a crispr e sgrna sintetici e metodi d'uso |
| WO2015021426A1 (en) | 2013-08-09 | 2015-02-12 | Sage Labs, Inc. | A crispr/cas system-based novel fusion protein and its application in genome editing |
| CA3109801C (en) | 2013-08-22 | 2024-01-09 | Andrew Cigan | Plant genome modification using guide rna/cas endonuclease systems and methods of use |
| GB201315321D0 (en) | 2013-08-28 | 2013-10-09 | Koninklijke Nederlandse Akademie Van Wetenschappen | Transduction Buffer |
| WO2015034872A2 (en) | 2013-09-05 | 2015-03-12 | Massachusetts Institute Of Technology | Tuning microbial populations with programmable nucleases |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| EP3418379B1 (en) | 2013-09-18 | 2020-12-09 | Kymab Limited | Methods, cells & organisms |
| WO2015048577A2 (en) | 2013-09-27 | 2015-04-02 | Editas Medicine, Inc. | Crispr-related methods and compositions |
| US10822606B2 (en) | 2013-09-27 | 2020-11-03 | The Regents Of The University Of California | Optimized small guide RNAs and methods of use |
| JP5774657B2 (ja) | 2013-10-04 | 2015-09-09 | 国立大学法人京都大学 | エレクトロポレーションを利用した哺乳類の遺伝子改変方法 |
| WO2015052231A2 (en) | 2013-10-08 | 2015-04-16 | Technical University Of Denmark | Multiplex editing system |
| WO2015054507A1 (en) | 2013-10-10 | 2015-04-16 | Pronutria, Inc. | Nutritive polypeptide production systems, and methods of manufacture and use thereof |
| WO2015065964A1 (en) | 2013-10-28 | 2015-05-07 | The Broad Institute Inc. | Functional genomics using crispr-cas systems, compositions, methods, screens and applications thereof |
| US9850497B2 (en) | 2013-11-04 | 2017-12-26 | Regents Of The University Of Minnesota | Gene targeting methods and tools |
| AU2014346559B2 (en) | 2013-11-07 | 2020-07-09 | Editas Medicine,Inc. | CRISPR-related methods and compositions with governing gRNAs |
| HUE044540T2 (hu) | 2013-11-13 | 2019-10-28 | Childrens Medical Center | Nukleáz közvetítette génexpresszió-szabályozás |
| EP3760719A1 (en) | 2013-11-18 | 2021-01-06 | CRISPR Therapeutics AG | Crispr-cas system materials and methods |
| KR102348577B1 (ko) | 2013-11-22 | 2022-01-06 | 셀렉티스 | 면역요법을 위한 화학요법 약물 저항성 t―세포들의 조작 방법 |
| CN106103699B (zh) | 2013-11-28 | 2019-11-26 | 地平线探索有限公司 | 体细胞单倍体人类细胞系 |
| AU2014361834B2 (en) | 2013-12-12 | 2020-10-22 | Massachusetts Institute Of Technology | CRISPR-Cas systems and methods for altering expression of gene products, structural information and inducible modular Cas enzymes |
| WO2015089364A1 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Crystal structure of a crispr-cas system, and uses thereof |
| EP3470089A1 (en) | 2013-12-12 | 2019-04-17 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components |
| US9994831B2 (en) | 2013-12-12 | 2018-06-12 | The Regents Of The University Of California | Methods and compositions for modifying a single stranded target nucleic acid |
| EP3080259B1 (en) | 2013-12-12 | 2023-02-01 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions with new architectures for sequence manipulation |
| AU2014361781B2 (en) | 2013-12-12 | 2021-04-01 | Massachusetts Institute Of Technology | Delivery, use and therapeutic applications of the CRISPR -Cas systems and compositions for genome editing |
| MX2016007325A (es) | 2013-12-12 | 2017-07-19 | Broad Inst Inc | Composiciones y metodos de uso de sistemas crispr-cas en desordenes debidos a repeticion de nucleotidos. |
| BR112016013207A2 (pt) | 2013-12-12 | 2017-09-26 | Massachusetts Inst Technology | administração, uso e aplicações terapêuticas dos sistemas crispr-cas e composições para o hbv e distúrbios e doenças virais |
| US20150165054A1 (en) | 2013-12-12 | 2015-06-18 | President And Fellows Of Harvard College | Methods for correcting caspase-9 point mutations |
| US20150191744A1 (en) | 2013-12-17 | 2015-07-09 | University Of Massachusetts | Cas9 effector-mediated regulation of transcription, differentiation and gene editing/labeling |
| MX2016007797A (es) | 2013-12-19 | 2016-09-07 | Amyris Inc | Metodos para integracion genomica. |
| CA2935032C (en) | 2013-12-26 | 2024-01-23 | The General Hospital Corporation | Multiplex guide rnas |
| US9963689B2 (en) | 2013-12-31 | 2018-05-08 | The Regents Of The University Of California | Cas9 crystals and methods of use thereof |
| CN106133141B (zh) | 2014-01-08 | 2021-08-20 | 哈佛学院董事及会员团体 | Rna引导的基因驱动 |
| JP2017503514A (ja) | 2014-01-24 | 2017-02-02 | ノースカロライナ ステート ユニバーシティーNorth Carolina State University | Cas9ターゲッティングをガイドする配列に関する方法および組成物 |
| WO2015117081A2 (en) | 2014-02-03 | 2015-08-06 | Sangamo Biosciences, Inc. | Methods and compositions for treatment of a beta thalessemia |
| US10287590B2 (en) | 2014-02-12 | 2019-05-14 | Dna2.0, Inc. | Methods for generating libraries with co-varying regions of polynuleotides for genome modification |
| WO2015122967A1 (en) | 2014-02-13 | 2015-08-20 | Clontech Laboratories, Inc. | Methods of depleting a target molecule from an initial collection of nucleic acids, and compositions and kits for practicing the same |
| JP2017506893A (ja) | 2014-02-18 | 2017-03-16 | デューク ユニバーシティ | ウイルス複製不活化組成物並びにその製造方法及び使用 |
| US11186843B2 (en) | 2014-02-27 | 2021-11-30 | Monsanto Technology Llc | Compositions and methods for site directed genomic modification |
| WO2015134812A1 (en) | 2014-03-05 | 2015-09-11 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating usher syndrome and retinitis pigmentosa |
| WO2015138510A1 (en) | 2014-03-10 | 2015-09-17 | Editas Medicine., Inc. | Crispr/cas-related methods and compositions for treating leber's congenital amaurosis 10 (lca10) |
| CA2942915A1 (en) | 2014-03-20 | 2015-09-24 | Universite Laval | Crispr-based methods and products for increasing frataxin levels and uses thereof |
| PL3122766T3 (pl) | 2014-03-24 | 2021-09-13 | IMMCO Diagnostics, Inc. | Ulepszone wykrywanie i diagnostyka przeciwciał przeciwjądrowych dla układowych i nieukładowych zaburzeń autoimmunologicznych |
| CA2943622A1 (en) | 2014-03-25 | 2015-10-01 | Editas Medicine Inc. | Crispr/cas-related methods and compositions for treating hiv infection and aids |
| US11242525B2 (en) | 2014-03-26 | 2022-02-08 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating sickle cell disease |
| WO2015148860A1 (en) | 2014-03-26 | 2015-10-01 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating beta-thalassemia |
| WO2015152305A1 (ja) | 2014-03-31 | 2015-10-08 | 株式会社サイエンス・ラスター | 造血細胞の増殖ペプチドおよびその用途 |
| WO2015153791A1 (en) | 2014-04-01 | 2015-10-08 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating herpes simplex virus type 2 (hsv-2) |
| WO2015153789A1 (en) | 2014-04-01 | 2015-10-08 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating herpes simplex virus type 1 (hsv-1) |
| US12460231B2 (en) | 2014-04-02 | 2025-11-04 | Editas Medicine, Inc. | Crispr/CAS-related methods and compositions for treating primary open angle glaucoma |
| EP3126503A1 (en) | 2014-04-03 | 2017-02-08 | Massachusetts Institute Of Technology | Methods and compositions for the production of guide rna |
| EP3556858A3 (en) | 2014-04-09 | 2020-01-22 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating cystic fibrosis |
| WO2015159068A1 (en) | 2014-04-14 | 2015-10-22 | Nemesis Bioscience Ltd | Therapeutic |
| CA2945335A1 (en) | 2014-04-18 | 2015-10-22 | Editas Medicine, Inc. | Crispr-cas-related methods, compositions and components for cancer immunotherapy |
| MX375592B (es) | 2014-04-25 | 2025-03-06 | The Children´S Medical Center Corp | Composiciones y su uso para tratar hemoglobinopatias. |
| GB201407852D0 (en) | 2014-05-02 | 2014-06-18 | Iontas Ltd | Preparation of libraries od protein variants expressed in eukaryotic cells and use for selecting binding molecules |
| EP3140403A4 (en) | 2014-05-09 | 2017-12-20 | Université Laval | Prevention and treatment of alzheimer's disease by genome editing using the crispr/cas system |
| WO2015173436A1 (en) | 2014-05-16 | 2015-11-19 | Vrije Universiteit Brussel | Genetic correction of myotonic dystrophy type 1 |
| EP3152221A4 (en) | 2014-05-20 | 2018-01-24 | Regents of the University of Minnesota | Method for editing a genetic sequence |
| RU2550960C1 (ru) | 2014-05-20 | 2015-05-20 | Общество с Ограниченной Ответственностью "НПК ЭХО" | Фармацевтическая композиция, обладающая гамк-ергической активностью |
| EP3152319A4 (en) | 2014-06-05 | 2017-12-27 | Sangamo BioSciences, Inc. | Methods and compositions for nuclease design |
| RS60359B1 (sr) | 2014-06-06 | 2020-07-31 | Regeneron Pharma | Postupci i kompozicije za modifikovanje ciljanog lokusa |
| WO2015191693A2 (en) | 2014-06-10 | 2015-12-17 | Massachusetts Institute Of Technology | Method for gene editing |
| WO2015191911A2 (en) | 2014-06-12 | 2015-12-17 | Clontech Laboratories, Inc. | Protein enriched microvesicles and methods of making and using the same |
| HUE049405T2 (hu) | 2014-06-23 | 2020-09-28 | Regeneron Pharma | Nukleáz-közvetített DNS-összeállítás |
| US20150376586A1 (en) | 2014-06-25 | 2015-12-31 | Caribou Biosciences, Inc. | RNA Modification to Engineer Cas9 Activity |
| WO2015200555A2 (en) | 2014-06-25 | 2015-12-30 | Caribou Biosciences, Inc. | Rna modification to engineer cas9 activity |
| KR102386101B1 (ko) | 2014-06-26 | 2022-04-14 | 리제너론 파마슈티칼스 인코포레이티드 | 표적화된 유전자 변형을 위한 방법 및 그 조성물, 및 사용 방법 |
| US10017770B2 (en) | 2014-07-03 | 2018-07-10 | Ut-Battelle, Llc | TNT cloning system |
| WO2016007948A1 (en) | 2014-07-11 | 2016-01-14 | Pioneer Hi-Bred International, Inc. | Agronomic trait modification using guide rna/cas endonuclease systems and methods of use |
| ES3047792T3 (en) | 2014-07-14 | 2025-12-04 | Univ California | Crispr/cas transcriptional modulation |
| US10975406B2 (en) | 2014-07-18 | 2021-04-13 | Massachusetts Institute Of Technology | Directed endonucleases for repeatable nucleic acid cleavage |
| WO2016022363A2 (en) | 2014-07-30 | 2016-02-11 | President And Fellows Of Harvard College | Cas9 proteins including ligand-dependent inteins |
| CA2960209C (en) | 2014-09-04 | 2023-08-29 | Memorial Sloan-Kettering Cancer Center | Globin gene therapy for treating hemoglobinopathies |
| HUE055583T2 (hu) | 2014-09-16 | 2021-12-28 | Sangamo Therapeutics Inc | Eljárások és készítmények nukleáz által közvetített genommódosításhoz és -javításhoz hematopoetikus õssejtekben |
| WO2016049258A2 (en) | 2014-09-25 | 2016-03-31 | The Broad Institute Inc. | Functional screening with optimized functional crispr-cas systems |
| EP3204496A1 (en) | 2014-10-10 | 2017-08-16 | Editas Medicine, Inc. | Compositions and methods for promoting homology directed repair |
| CA2963820A1 (en) | 2014-11-07 | 2016-05-12 | Editas Medicine, Inc. | Methods for improving crispr/cas-mediated genome-editing |
| RU2578412C1 (ru) | 2014-12-02 | 2016-03-27 | Общество С Ограниченной Ответственностью "Валента - Интеллект" | Фармацевтическая композиция для лечения астении и/или синдрома хронической усталости |
| WO2016094880A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Delivery, use and therapeutic applications of crispr systems and compositions for genome editing as to hematopoietic stem cells (hscs) |
| WO2016094872A1 (en) | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Dead guides for crispr transcription factors |
| WO2016106244A1 (en) | 2014-12-24 | 2016-06-30 | The Broad Institute Inc. | Crispr having or associated with destabilization domains |
| CN107429263A (zh) | 2015-01-15 | 2017-12-01 | 斯坦福大学托管董事会 | 调控基因组编辑的方法 |
| US10350245B2 (en) | 2015-01-21 | 2019-07-16 | Fred Hutchinson Cancer Research Center | Point-of-care and/or portable platform for gene therapy |
| US11311632B2 (en) | 2015-01-21 | 2022-04-26 | Cornell University | Viral vectors for prophylaxis and therapy of hemoglobinopathies |
| EP3247366A4 (en) | 2015-01-21 | 2018-10-31 | Sangamo Therapeutics, Inc. | Methods and compositions for identification of highly specific nucleases |
| US10676726B2 (en) | 2015-02-09 | 2020-06-09 | Duke University | Compositions and methods for epigenome editing |
| WO2016131009A1 (en) | 2015-02-13 | 2016-08-18 | University Of Massachusetts | Compositions and methods for transient delivery of nucleases |
| WO2016135559A2 (en) | 2015-02-23 | 2016-09-01 | Crispr Therapeutics Ag | Materials and methods for treatment of human genetic diseases including hemoglobinopathies |
| WO2016145150A2 (en) | 2015-03-11 | 2016-09-15 | The Broad Institute Inc. | Selective treatment of prmt5 dependent cancer |
| US20180112213A1 (en) | 2015-03-25 | 2018-04-26 | Editas Medicine, Inc. | Crispr/cas-related methods, compositions and components |
| EP3851530A1 (en) | 2015-03-26 | 2021-07-21 | Editas Medicine, Inc. | Crispr/cas-mediated gene conversion |
| LT3277807T (lt) | 2015-03-31 | 2020-01-10 | Glycotope Gmbh | Eukariotiniai ekspresijos vektoriai, apimantys globino genų klasterių reguliavimo elementus |
| EP3280803B1 (en) | 2015-04-06 | 2021-05-26 | The Board of Trustees of the Leland Stanford Junior University | Chemically modified guide rnas for crispr/cas-mediated gene regulation |
| ES2835861T5 (en) | 2015-05-08 | 2025-02-18 | Childrens Medical Ct Corp | Targeting bcl11a enhancer functional regions for fetal hemoglobin reinduction |
| WO2016182893A1 (en) | 2015-05-08 | 2016-11-17 | Teh Broad Institute Inc. | Functional genomics using crispr-cas systems for saturating mutagenesis of non-coding elements, compositions, methods, libraries and applications thereof |
| AU2016261358B2 (en) | 2015-05-11 | 2021-09-16 | Editas Medicine, Inc. | Optimized CRISPR/Cas9 systems and methods for gene editing in stem cells |
| MX382223B (es) | 2015-05-12 | 2025-03-13 | Sangamo Therapeutics Inc | Regulacion de expresion genica mediada por nucleasa. |
| WO2016201272A1 (en) | 2015-06-12 | 2016-12-15 | King Abdulaziz City For Science And Technology | Method of diagnosing patients with conditions caused by mendelian mutations |
| US11643668B2 (en) | 2015-06-17 | 2023-05-09 | The Uab Research Foundation | CRISPR/Cas9 complex for genomic editing |
| TWI813532B (zh) | 2015-06-18 | 2023-09-01 | 美商博得學院股份有限公司 | 降低脱靶效應的crispr酶突變 |
| US9957501B2 (en) | 2015-06-18 | 2018-05-01 | Sangamo Therapeutics, Inc. | Nuclease-mediated regulation of gene expression |
| WO2017053729A1 (en) | 2015-09-25 | 2017-03-30 | The Board Of Trustees Of The Leland Stanford Junior University | Nuclease-mediated genome editing of primary cells and enrichment thereof |
| EP3356520B1 (en) | 2015-10-02 | 2022-03-23 | The U.S.A. as represented by the Secretary, Department of Health and Human Services | Lentiviral protein delivery system for rna-guided genome editing |
| ES2942309T3 (es) | 2015-11-04 | 2023-05-31 | Vertex Pharma | Materiales y métodos para el tratamiento de hemoglobinopatías |
| EA201891338A1 (ru) | 2015-12-04 | 2018-12-28 | Новартис Аг | Композиции и способы для иммуноонкологии |
| KR102860636B1 (ko) | 2015-12-28 | 2025-09-17 | 노파르티스 아게 | 혈색소병증의 치료를 위한 조성물 및 방법 |
| DK3445388T3 (da) | 2016-04-18 | 2024-06-03 | Vertex Pharma | Materialer og fremgangsmåder til behandling af hæmoglobinopatier |
| WO2017191503A1 (en) | 2016-05-05 | 2017-11-09 | Crispr Therapeutics Ag | Materials and methods for treatment of hemoglobinopathies |
| EP3471743B1 (en) | 2016-06-17 | 2025-08-06 | Fred Hutchinson Cancer Center | Strategies to assess and/or produce cell populations with predictive engraftment potential |
| WO2018009506A1 (en) | 2016-07-07 | 2018-01-11 | St. Jude Children's Research Hospital | Erythroid-specific promoter and method of use thereof |
| JP2019525759A (ja) | 2016-07-25 | 2019-09-12 | ブルーバード バイオ, インコーポレイテッド | Bcl11aホーミングエンドヌクレアーゼバリアント、組成物、および使用方法 |
| MA46018A (fr) | 2016-08-19 | 2019-06-26 | Bluebird Bio Inc | Activateurs d'édition du génome |
| LT3504229T (lt) | 2016-08-24 | 2021-12-10 | Sangamo Therapeutics, Inc. | Genų raiškos reguliavimas, panaudojant rekombinantines nukleazes |
| SG10201913948PA (en) | 2016-08-24 | 2020-03-30 | Sangamo Therapeutics Inc | Engineered target specific nucleases |
| JP2019532672A (ja) | 2016-09-28 | 2019-11-14 | ノバルティス アーゲー | 多孔質膜系巨大分子送達システム |
| TW201839136A (zh) * | 2017-02-06 | 2018-11-01 | 瑞士商諾華公司 | 治療血色素異常症之組合物及方法 |
| WO2019003193A1 (en) | 2017-06-30 | 2019-01-03 | Novartis Ag | METHODS FOR TREATING DISEASES USING GENE EDITING SYSTEMS |
-
2018
- 2018-02-02 TW TW107103865A patent/TW201839136A/zh unknown
- 2018-02-05 MX MX2019009361A patent/MX2019009361A/es unknown
- 2018-02-05 CA CA3052275A patent/CA3052275A1/en active Pending
- 2018-02-05 JP JP2019542456A patent/JP2020505934A/ja not_active Withdrawn
- 2018-02-05 KR KR1020197026089A patent/KR102630217B1/ko active Active
- 2018-02-05 CN CN201880020201.4A patent/CN110546262B/zh active Active
- 2018-02-05 EA EA201991862A patent/EA201991862A1/ru unknown
- 2018-02-05 WO PCT/IB2018/050712 patent/WO2018142364A1/en not_active Ceased
- 2018-02-05 AU AU2018215726A patent/AU2018215726B2/en active Active
- 2018-02-05 EP EP18708204.5A patent/EP3577223A1/en active Pending
- 2018-02-05 IL IL311222A patent/IL311222A/en unknown
- 2018-02-05 CN CN202410988194.4A patent/CN119286853A/zh active Pending
- 2018-02-05 KR KR1020247002710A patent/KR20240017098A/ko active Pending
- 2018-02-05 US US16/484,046 patent/US11466271B2/en active Active
- 2018-02-05 MY MYPI2019004488A patent/MY203407A/en unknown
- 2018-02-05 SG SG11201907056XA patent/SG11201907056XA/en unknown
- 2018-02-05 IL IL268406A patent/IL268406B2/en unknown
- 2018-02-06 AR ARP180100273A patent/AR110962A1/es unknown
-
2019
- 2019-08-06 SA SA519402400A patent/SA519402400B1/ar unknown
- 2019-08-06 MX MX2025012712A patent/MX2025012712A/es unknown
- 2019-08-06 PH PH12019501812A patent/PH12019501812A1/en unknown
-
2022
- 2022-01-25 AU AU2022200457A patent/AU2022200457A1/en not_active Abandoned
- 2022-06-24 US US17/808,802 patent/US12559748B2/en active Active
-
2023
- 2023-01-06 JP JP2023001013A patent/JP2023052242A/ja not_active Withdrawn
-
2024
- 2024-07-25 AU AU2024205089A patent/AU2024205089A1/en active Pending
-
2025
- 2025-04-28 JP JP2025074171A patent/JP2025134087A/ja active Pending
Patent Citations (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5800815A (en) | 1903-05-05 | 1998-09-01 | Cytel Corporation | Antibodies to P-selectin and their uses |
| US6667036B2 (en) | 1991-02-05 | 2003-12-23 | The Board Of Regents Of The University Of Oklahoma | Methods of treatment using antibodies to P-selectin glycoprotein ligand |
| WO1993021956A1 (en) | 1992-05-05 | 1993-11-11 | Cytel Corporation | Antibodies to p-selectin and their uses |
| WO1995034324A1 (en) | 1994-06-14 | 1995-12-21 | Protein Design Labs, Inc. | Cross-reacting monoclonal antibodies specific for e-selectin and p-selectin |
| WO2005060697A2 (en) | 2003-12-19 | 2005-07-07 | Chiron Corporation | Cell transfecting formulations of small interfering rna, related compositions and methods of making and use |
| WO2005100402A1 (en) | 2004-04-13 | 2005-10-27 | F.Hoffmann-La Roche Ag | Anti-p-selectin antibodies |
| US8377440B2 (en) | 2006-12-01 | 2013-02-19 | Selexys Pharmaceuticals Corporation | Anti-P-selectin antibodies and methods of using the same to treat inflammatory diseases |
| WO2008069999A2 (en) | 2006-12-01 | 2008-06-12 | Selexys Pharmaceuticals Corporation | Anti-p-selectin antibodies and methods of using the same to treat inflammatory diseases |
| US8945565B2 (en) | 2006-12-01 | 2015-02-03 | Selexys Pharmaceuticals Corporation | Methods of treating inflammatory or thrombotic conditions with anti-P-selectin antibodies |
| US20110293617A1 (en) | 2006-12-01 | 2011-12-01 | Scott Rollins | Anti-p-selectin antibodies and methods of their use and identification |
| US9068001B2 (en) | 2006-12-01 | 2015-06-30 | Selexys Pharmaceuticals | Anti-P-selectin antibodies |
| WO2010059401A2 (en) | 2008-10-30 | 2010-05-27 | Irm Llc | Compounds that expand hematopoietic stem cells |
| WO2011076807A2 (en) | 2009-12-23 | 2011-06-30 | Novartis Ag | Lipids, lipid compositions, and methods of using them |
| WO2012006378A1 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Liposomes with lipids having an advantageous pka- value for rna delivery |
| WO2012031046A2 (en) | 2010-08-31 | 2012-03-08 | Novartis Ag | Lipids suitable for liposomal delivery of protein-coding rna |
| WO2013006825A1 (en) | 2011-07-06 | 2013-01-10 | Novartis Ag | Liposomes having useful n:p ratio for delivery of rna molecules |
| WO2013059343A1 (en) | 2011-10-17 | 2013-04-25 | Massachusetts Institute Of Technology | Intracellular delivery |
| US20140295558A1 (en) | 2012-01-03 | 2014-10-02 | City University Of Hong Kong | Method and apparatus for delivery of molecules to cells |
| WO2013103467A1 (en) | 2012-01-06 | 2013-07-11 | Alcon Research, Ltd. | Interfering rna delivery system and uses thereof |
| WO2013110198A1 (en) | 2012-01-27 | 2013-08-01 | Université de Montréal | Pyrimido[4,5-b]indole derivatives and use thereof in the expansion of hematopoietic stem cells |
| WO2013126794A1 (en) * | 2012-02-24 | 2013-08-29 | Fred Hutchinson Cancer Research Center | Compositions and methods for the treatment of hemoglobinopathies |
| WO2014130955A1 (en) | 2013-02-25 | 2014-08-28 | Sangamo Biosciences, Inc. | Methods and compositions for enhancing nuclease-mediated gene disruption |
| WO2014136086A1 (en) | 2013-03-08 | 2014-09-12 | Novartis Ag | Lipids and lipid compositions for the delivery of active agents |
| WO2014140211A1 (en) | 2013-03-15 | 2014-09-18 | Novartis Ag | Rna purification methods |
| WO2014150256A1 (en) | 2013-03-15 | 2014-09-25 | Global Blood Therapeutics, Inc. | Compositions and methods for the modulation of hemoglobin (s) |
| WO2015023982A1 (en) | 2013-08-16 | 2015-02-19 | Massachusetts Institute Of Technology | Selective delivery of material to cells |
| WO2015089486A2 (en) * | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Systems, methods and compositions for sequence manipulation with optimized functional crispr-cas systems |
| WO2015095340A1 (en) | 2013-12-19 | 2015-06-25 | Novartis Ag | Lipids and lipid compositions for the delivery of active agents |
| WO2015095346A1 (en) | 2013-12-19 | 2015-06-25 | Novartis Ag | Lipids and lipid compositions for the delivery of active agents |
| WO2016103233A2 (en) * | 2014-12-24 | 2016-06-30 | Dana-Farber Cancer Institute, Inc. | Systems and methods for genome modification and regulation |
| WO2016135558A2 (en) * | 2015-02-23 | 2016-09-01 | Crispr Therapeutics Ag | Materials and methods for treatment of hemoglobinopathies |
| WO2017160890A1 (en) * | 2016-03-14 | 2017-09-21 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating beta hemoglobinopathies |
Non-Patent Citations (65)
| Title |
|---|
| ALTSCHUL ET AL., J MOL BIOL., vol. 215, no. 3, 1990, pages 403 - 10 |
| BAE, BIOINFORMATICS, 2014 |
| BATZER ET AL., NUCLEIC ACID RES., vol. 19, 1991, pages 5081 |
| BAUER ET AL., SCIENCE, vol. 342, 2013, pages 253 - 257 |
| BRADNER JE ET AL., PNAS, vol. 107, no. 28, 2010, pages 12617 - 12622 |
| CARSTEN LEDERER ET AL: "Beta testing: preclinical genome editing in [beta]-globin disorders", CELL AND GENE THERAPY INSIGHTS, vol. 1, no. 2, 10 December 2015 (2015-12-10), XP055462737, ISSN: 2059-7800, DOI: 10.18609/cgti.2015.021 * |
| CHIAPPINI ET AL., NAT. MAT., vol. 14, pages 532 - 39 |
| CHYLINSKI ET AL., RNA BIOLOGY, vol. 10, 2013, pages 5 |
| CHYLINSKI ET AL., RNA BIOLOGY, vol. 10, no. 5, 2013, pages 727 - 737 |
| COCK ET AL., NUCLEIC ACIDS RES., vol. 38, no. 6, 2010, pages 1767 - 71 |
| CONG ET AL., SCIENCE, vol. 399, no. 6121, 2013, pages 819 - 823 |
| DATABASE GenBank [O] Database accession no. NC _000002.12 |
| DEVEAU ET AL., J BACTERIOL, vol. 190, no. 4, 2008, pages 1 390 - 1400 |
| DEVEAU ET AL., J BACTERIOL, vol. 190, no. 4, 2008, pages 1390 - 1400 |
| DOULATOV ET AL., CELL STEM CELL, 2012 |
| ELIZABETH A TRAXLER ET AL: "A genome-editing strategy to treat beta-hemoglobinopathies that recapitulates a mutation associated with a benign genetic condition", NATURE MEDICINE, vol. 22, no. 9, 15 August 2016 (2016-08-15), pages 987 - 990, XP055372350, ISSN: 1078-8956, DOI: 10.1038/nm.4170 * |
| ESVELT, NATURE, vol. 472, no. 7344, 2011, pages 499 - 503 |
| FU ET AL., NAT BIOTECHNOL, 2014 |
| FU Y, NAT BIOTECHNOL, 2014 |
| HAFT, PLOS COMPUTATIONAL BIOLOGY, vol. 1, no. 6, 2005, pages e60 |
| HEIGWER ET AL., NAT METHODS, vol. 11, no. 2, 2014, pages 122 - 3 |
| HOMER ET AL.: "4", PLOS ONE, no. 11, 2009, pages e7767 |
| HORVATH ET AL., SCIENCE, vol. 327, no. 5962, 2010, pages 167 - 170 |
| HOU ET AL., PNAS EARLY EDITION, 2013, pages 1 - 6 |
| HSU ET AL., NAT BIOTECHNOL, vol. 31, no. 9, 2013, pages 827 - 32 |
| HUNTSMAN, BLOOD, vol. 126, no. 13, 24 September 2015 (2015-09-24), pages 1631 - 3 |
| JIANXU ET AL., SCIENCE, vol. 334, 2011, pages 993 |
| JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816 |
| JINEK ET AL., SCIENCE, vol. 337, no. 6096, 2012, pages 816 - 821 |
| JINEK, SCIENCE, vol. 337, no. 6096, 2012, pages 8 16 - 821 |
| KLEINSTIVER ET AL., NATURE, vol. 529, 2016, pages 490 |
| LANGE, J BIOL CHEM., vol. 282, no. 8, 2007, pages 5101 - 5 |
| LETTRE GUILLAUME ET AL: "Fetal haemoglobin in sickle-cell disease: from genetic epidemiology to new therapeutic strategies", THE LANCET (LETTERS TO THE EDITOR), THE LANCET PUBLISHING GROUP, GB, vol. 387, no. 10037, 18 June 2016 (2016-06-18), pages 2554 - 2564, XP029612790, ISSN: 0140-6736, DOI: 10.1016/S0140-6736(15)01341-0 * |
| LI ET AL., BIOINFORMATICS, vol. 25, no. 16, 2009, pages 2078 - 9 |
| LI; DURBIN, BIOINFORMATICS, vol. 25, no. 14, 2009, pages 1754 - 60 |
| MAKAROVA ET AL., NATURE REVIEW MICROBIOLOGY, vol. 9, 2011, pages 467 - 477 |
| MALI ET AL., SCIENCE, vol. 399, no. 6121, 2013, pages 823 - 826 |
| MALI, SCIENCE, vol. 339, no. 6121, 2013, pages 823 - 826 |
| MATTHEW C CANVER ET AL: "Customizing the genome as therapy for the b-hemoglobinopathies", BLOOD, vol. 127, no. 21, 6 April 2016 (2016-04-06), pages 2536 - 2545, XP055462742, DOI: 10.1182/blood-2016-01- * |
| NAM, T. ET AL., CHEMMEDCHEM, vol. 6, 2011, pages 777 - 780 |
| NATHAN; OSKI: "Hematology and Oncology of Infancy and Childhood, 8th ed.", ELSEVIER SAUNDERS |
| NISHIMASU ET AL., CELL, vol. 156, 2014, pages 935 |
| NOTTA, SCIENCE, vol. 333, no. 6039, 8 July 2011 (2011-07-08), pages 218 - 21 |
| OHTSUKA ET AL., J. BIOL. CHEM., vol. 260, 1985, pages 2605 - 2608 |
| PRUITT ET AL., NUCLEIC ACIDS RES., vol. 42, 2014, pages D756 - 63 |
| QUINLAN; HALL, BIOINFORMATICS, vol. 26, no. 6, 2010, pages 841 - 2 |
| RAN, CELL, 2013 |
| RANF. ET AL., NATURE, vol. 520, 2015, pages 186 - 191 |
| ROBINSON ET AL., NAT BIOTECHNOL., vol. 9, no. 1, 2011, pages 24 - 6 |
| ROSSOLINI ET AL., MOL. CELL. PROBES, vol. 8, 1994, pages 91 - 98 |
| SAKSUMA ET AL.: "MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems", NATURE PROTOCOLS, vol. 11, 2016, pages 118 - 133, XP055388413, DOI: doi:10.1038/nprot.2015.140 |
| SAMBROOK ET AL.: "MOLECULAR CLONING: A LABORATORY MANUAL", vol. 1 -4, 2012, COLD SPRING HARBOR PRESS |
| SANKARAN VG ET AL., NEJM, vol. 365, 2011, pages 807 - 814 |
| SHERY ET AL., NUCLEIC ACIDS RES., vol. 29, no. 1, 2001, pages 308 - 11 |
| SLAYMAKER ET AL., SCIENCE EXPRESS, 1 December 2015 (2015-12-01) |
| SLAYMAKER ET AL., SCIENCE, vol. 351, 2015, pages 84 |
| SOROKIN, BIOCHEMISTRY, vol. 72, no. 13, 2007, pages 1439 - 1457 |
| STERNBERG SH, NATURE, 2014 |
| TSAI ET AL., NAT. BIOTECH., vol. 32, 2014, pages 569 - 577 |
| TSAI ET AL., NATURE BIOTECHNOLOGY, vol. 33, 2015, pages 187 - 197 |
| UNTERGASSER ET AL., NUCLEIC ACIDS RES., vol. 40, no. 15, 2012, pages el 15 |
| WANG ET AL., CELL, vol. 153, no. 4, 2013, pages 910 - 918 |
| XIAO A, BIOINFORMATICS, 2014 |
| XIE, ACS NANO, vol. 7, no. 5, pages 4351 - 58 |
| ZHONGWU LAI, LAI ET AL., NUCLEIC ACIDS RES., vol. 44, no. 1 l, 2016, pages el08 |
Cited By (75)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10704021B2 (en) | 2012-03-15 | 2020-07-07 | Flodesign Sonics, Inc. | Acoustic perfusion devices |
| US12584118B2 (en) | 2013-09-06 | 2026-03-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US12473573B2 (en) | 2013-09-06 | 2025-11-18 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US12215365B2 (en) | 2013-12-12 | 2025-02-04 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10975368B2 (en) | 2014-01-08 | 2021-04-13 | Flodesign Sonics, Inc. | Acoustophoresis device with dual acoustophoretic chamber |
| US11242525B2 (en) | 2014-03-26 | 2022-02-08 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating sickle cell disease |
| US11708572B2 (en) | 2015-04-29 | 2023-07-25 | Flodesign Sonics, Inc. | Acoustic cell separation techniques and processes |
| US11390884B2 (en) | 2015-05-11 | 2022-07-19 | Editas Medicine, Inc. | Optimized CRISPR/cas9 systems and methods for gene editing in stem cells |
| US11911415B2 (en) | 2015-06-09 | 2024-02-27 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for improving transplantation |
| US12344869B2 (en) | 2015-10-23 | 2025-07-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
| US11214789B2 (en) | 2016-05-03 | 2022-01-04 | Flodesign Sonics, Inc. | Concentration and washing of particles with acoustics |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US12084663B2 (en) | 2016-08-24 | 2024-09-10 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11377651B2 (en) | 2016-10-19 | 2022-07-05 | Flodesign Sonics, Inc. | Cell therapy processes utilizing acoustophoresis |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US12559748B2 (en) | 2017-02-06 | 2026-02-24 | Novartis Ag | Compositions and methods for the treatment of hemoglobinopathies |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12516308B2 (en) | 2017-03-09 | 2026-01-06 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US12435331B2 (en) | 2017-03-10 | 2025-10-07 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11851690B2 (en) | 2017-03-14 | 2023-12-26 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11963982B2 (en) | 2017-05-10 | 2024-04-23 | Editas Medicine, Inc. | CRISPR/RNA-guided nuclease systems and methods |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| WO2019003193A1 (en) * | 2017-06-30 | 2019-01-03 | Novartis Ag | METHODS FOR TREATING DISEASES USING GENE EDITING SYSTEMS |
| US11866726B2 (en) | 2017-07-14 | 2024-01-09 | Editas Medicine, Inc. | Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US12359218B2 (en) | 2017-07-28 | 2025-07-15 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| WO2019079347A1 (en) * | 2017-10-16 | 2019-04-25 | The Broad Institute, Inc. | USES OF BASIC EDITORS ADENOSINE |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| WO2019087113A1 (en) | 2017-11-01 | 2019-05-09 | Novartis Ag | Synthetic rnas and methods of use |
| US10785574B2 (en) | 2017-12-14 | 2020-09-22 | Flodesign Sonics, Inc. | Acoustic transducer driver and controller |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12031132B2 (en) | 2018-03-14 | 2024-07-09 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| US12133884B2 (en) | 2018-05-11 | 2024-11-05 | Beam Therapeutics Inc. | Methods of substituting pathogenic amino acids using programmable base editor systems |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| WO2020113112A1 (en) * | 2018-11-29 | 2020-06-04 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| WO2020112195A1 (en) * | 2018-11-30 | 2020-06-04 | Yale University | Compositions, technologies and methods of using plerixafor to enhance gene editing |
| US20220025403A1 (en) * | 2018-12-05 | 2022-01-27 | Fred Hutchinson Cancer Research Center | Reduced and minimal manipulation manufacturing of genetically-modified cells |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US11142760B2 (en) | 2019-02-13 | 2021-10-12 | Beam Therapeutics Inc. | Compositions and methods for treating hemoglobinopathies |
| US12016908B2 (en) | 2019-02-13 | 2024-06-25 | Beam Therapeutics Inc. | Compositions and methods for treating hemoglobinopathies |
| US11752202B2 (en) | 2019-02-13 | 2023-09-12 | Beam Therapeutics Inc. | Compositions and methods for treating hemoglobinopathies |
| US11344609B2 (en) | 2019-02-13 | 2022-05-31 | Beam Therapeutics Inc. | Compositions and methods for treating hemoglobinopathies |
| US12509680B2 (en) | 2019-03-19 | 2025-12-30 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12281303B2 (en) | 2019-03-19 | 2025-04-22 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12570972B2 (en) | 2019-03-19 | 2026-03-10 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| CN111939271A (zh) * | 2019-04-30 | 2020-11-17 | 博雅辑因(北京)生物科技有限公司 | 一种血红蛋白病治疗有效性预测方法 |
| CN113785059A (zh) * | 2019-04-30 | 2021-12-10 | 博雅辑因(北京)生物科技有限公司 | 一种血红蛋白病治疗有效性预测方法 |
| JP2022531269A (ja) * | 2019-04-30 | 2022-07-06 | 博雅▲輯▼因(北京)生物科技有限公司 | 異常ヘモグロビン症の治療の有効性を予測するための方法 |
| WO2020221291A1 (zh) * | 2019-04-30 | 2020-11-05 | 博雅辑因(北京)生物科技有限公司 | 一种血红蛋白病治疗有效性预测方法 |
| EP3964579A4 (en) * | 2019-04-30 | 2023-07-26 | EdiGene (GuangZhou) Inc. | Method for predicting effectiveness of treatment of hemoglobinopathy |
| CN110106203A (zh) * | 2019-05-24 | 2019-08-09 | 中国医学科学院血液病医院(血液学研究所) | 一种新型hbb过表达载体及其设计方法和应用 |
| CN110106203B (zh) * | 2019-05-24 | 2023-08-11 | 中国医学科学院血液病医院(血液学研究所) | 一种新型hbb过表达载体及其设计方法和应用 |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| EP4054710A4 (en) * | 2019-11-06 | 2023-12-06 | Syros Pharmaceuticals, Inc. | Compositions and methods for treating sickle cell disease |
| US12031126B2 (en) | 2020-05-08 | 2024-07-09 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| WO2023164636A1 (en) * | 2022-02-25 | 2023-08-31 | Vor Biopharma Inc. | Compositions and methods for homology-directed repair gene modification |
| WO2024254566A3 (en) * | 2023-06-08 | 2025-01-09 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| WO2025128871A2 (en) | 2023-12-13 | 2025-06-19 | Renagade Therapeutics Management Inc. | Lipid nanoparticles comprising coding rna molecules for use in gene editing and as vaccines and therapeutic agents |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12559748B2 (en) | Compositions and methods for the treatment of hemoglobinopathies | |
| JP7844400B2 (ja) | 異常ヘモグロビン症の治療用組成物および方法 | |
| JP7851081B2 (ja) | 異常ヘモグロビン症の治療用組成物および方法 | |
| RU2834231C2 (ru) | Композиции и способы, предназначенные для лечения гемоглобинопатий | |
| US20250127809A1 (en) | Compositions and methods for the treatment of hemoglobinopathies | |
| HK40080440A (en) | Compositions and methods for the treatment of hemoglobinopathies | |
| RU2812491C2 (ru) | Композиции и способы лечения гемоглобинопатий | |
| BR122025008935A2 (pt) | Molécula de grna, método para alteração de uma célula-tronco hematopoiética (hsc) ou uma célula progenitora hematopoiética (hpc), composição, usos das mesmas, e método para preparação de uma célula- tronco hematopoiética (hsc) ou uma célula progenitora hematopoiética (hpc) | |
| BR112019016205B1 (pt) | Molécula de grna, composição, uso desta e métodos para alteração e para preparação de uma célula tronco hematopoiética ou célula progenitora hematopoiética (hpc) | |
| BR122021012669B1 (pt) | Molécula de grna, composições, sequência de ácidos nucleicos, vetor, seus respectivos usos, método de alteração de células ex vivo, uso destas, e método de preparação de população de células | |
| BR112018013065B1 (pt) | Molécula de grna, composições, sequência de ácidos nucléicos, vetor, seus respectivos usos | |
| BR122021012712B1 (pt) | Molécula de grna, composições, sequência de ácidos nucleicos, vetor, seus respectivos usos, método de alteração de células ex vivo, uso destas, e método de preparação de população de células | |
| EA051805B1 (ru) | Композиции и способы лечения гемоглобинопатий |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18708204 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3052275 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2019542456 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2019/009361 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112019016205 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2018215726 Country of ref document: AU Date of ref document: 20180205 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20197026089 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018708204 Country of ref document: EP Effective date: 20190906 |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112019016205 Country of ref document: BR Free format text: COM BASE NA RESOLUCAO 187 DE 27/04/2017, SOLICITA-SE QUE SEJA APRESENTADO, EM ATE 60 (SESSENTA) DIAS, NOVO CONTEUDO DE LISTAGEM DE SEQUENCIA POIS O CONTEUDO APRESENTADO NA PETICAO NO 870190088559 DE 09/09/2019 NAO ESTA NO FORMATO ST.25. |
|
| ENP | Entry into the national phase |
Ref document number: 112019016205 Country of ref document: BR Kind code of ref document: A2 Effective date: 20190805 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 522432763 Country of ref document: SA Ref document number: 519402400 Country of ref document: SA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 519402400 Country of ref document: SA |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2019127919 Country of ref document: RU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 519402400 Country of ref document: SA |
|
| WWG | Wipo information: grant in national office |
Ref document number: MX/A/2019/009361 Country of ref document: MX |