WO2017036580A1 - Artificial nucleic acid molecules - Google Patents
Artificial nucleic acid molecules Download PDFInfo
- Publication number
- WO2017036580A1 WO2017036580A1 PCT/EP2016/001417 EP2016001417W WO2017036580A1 WO 2017036580 A1 WO2017036580 A1 WO 2017036580A1 EP 2016001417 W EP2016001417 W EP 2016001417W WO 2017036580 A1 WO2017036580 A1 WO 2017036580A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- utr
- nucleic acid
- acid molecule
- seq
- artificial nucleic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Definitions
- the invention relates to artificial nucleic acid molecules comprising an open reading frame, a 3'-untranslated region element (3'-UTR element) and/or a 5'-untranslated region element (5'-UTR element) and optionally a poly(A) sequence and/or a polyadenylation-signal.
- the invention relates further to a vector comprising a 3'-UTR element and/or a 5'-UTR element, to a cell comprising the artificial nucleic acid molecule or the vector, to a pharmaceutical composition comprising the artificial nucleic acid molecule or the vector and to a kit comprising the artificial nucleic acid molecule, the vector and/or the pharmaceutical composition, preferably for use in the field of gene therapy and/or genetic vaccination.
- Gene therapy and genetic vaccination belong to the most promising and quickly developing methods of modern medicine. They may provide highly specific and individual options for therapy of a large variety of diseases. Particularly, inherited genetic diseases but also autoimmune diseases, cancerous or tumour-related diseases as well as inflammatory diseases may be the subject of such treatment approaches. Also, it is envisaged to prevent early onset of such diseases by these approaches.
- the main conceptual rational behind gene therapy is appropriate modulation of impaired gene expression associated with pathological conditions of specific diseases. Pathologically altered gene expression may result in lack or overproduction of essential gene products, for example, signalling factors such as hormones, housekeeping factors, metabolic enzymes, structural proteins or the like.
- Altered gene expression may not only be due to mis- regulation of transcription and/or translation, but also due to mutations within the ORF coding for a particular protein.
- Pathological mutations may be caused by e.g. chromosomal aberration, or by more specific mutations, such as point or frame-shift-mutations, all of them resulting in limited functionality and, potentially, total loss of function of the gene product.
- misregulation of transcription or translation may also occur, if mutations affect genes encodi ng proteins which are involved in the transcriptional or translational machinery of the cel l. Such mutations may lead to pathological up- or down-regulation of genes which are - as such - functional.
- Genes encoding gene products which exert such regulati ng functions may be, e.g., transcription factors, signal receptors, messenger proteins or the like. However, loss of function of such genes encoding regulatory proteins may, under certain circumstances, be reversed by artificial i ntroduction of other factors acting further downstream of the impaired gene product. Such gene defects may also be compensated by gene therapy via substitution of the affected gene itself.
- Genetic vaccines i.e. vaccines for genetic vaccination, are usually understood as "third generation” vaccines. They are typical ly composed of genetical ly engineered nucleic acid molecules which al low expression of peptide or protein (antigen) fragments characteristic for a pathogen or a tumor antigen in vivo. Genetic vaccines are expressed upon administration to a patient after uptake by target cel ls. Expression of the admi nistered nucleic acids results i n production of the encoded protei ns. In the event these proteins are recognized as foreign by the patient's immune system, an immune response is triggered.
- both methods, gene therapy and genetic vacci nation are essentially based on the administration of nucleic acid molecules to a patient and subsequent transcription and/or translation of the encoded genetic information.
- genetic vaccination or gene therapy may also comprise methods which include isolation of specific body cel ls from a patient to be treated, subsequent in ex vivo transfection of such cel ls, and re-administration of the treated cel ls to the patient.
- DNA as well as RNA may be used as nucleic acid molecules for administration in the context of gene therapy or genetic vaccination.
- DNA is known to be relatively stable and easy to handle.
- the use of DNA bears the risk of undesired insertion of the administered DNA-fragments into the patient's genome potential ly resulti ng mutagenic events such as in loss of function of the impaired genes.
- the undesired generation of anti-DNA antibodies has emerged.
- Another drawback is the limited expression level of the encoded peptide or protein that is achievable upon DNA admi nistration because the DNA must enter the nucleus in order to be transcribed before the resulting mRNA can be translated.
- RNA is considered to be a rather unstable molecular species which may readi ly be degraded by ubiquitous RNAses.
- RNA degradation contributes to the regulation of the RNA half-life time. That effect was considered and proven to fi ne tune the regulation of eukaryotic gene expression (Friedel et a/., 2009. conserveed principles of mammalian transcriptional regulation revealed by RNA half-life, Nucleic Acid Research 37(1 7): 1 -1 2).
- Accordi ngly each natural ly occurring mRNA has its individual half-l ife dependi ng on the gene from which the mRNA is derived and in which cel l type it is expressed. It contributes to the regulation of the expression level of this gene. Unstable RNAs are important to realize transient gene expression at disti nct points i n time.
- RNAs may be associated with accumulation of distinct proteins or continuous expression of genes.
- the half-life of mRNAs may also be dependent on environmental factors, such as hormonal treatment, as has been shown, e.g., for insulin-like growth factor I, actin, and albumin mRNA (Johnson et a/., Newly synthesized RNA: Simultaneous measurement in intact cells of transcription rates and RNA stability of insulin-like growth factor I, actin, and albumin in growth hormone- stimulated hepatocytes, Proc. Natl. Acad. Sci., Vol. 88, pp. 5287-5291 , 1 991 ).
- RNA For gene therapy and genetic vaccination, usually stable RNA is desired. This is, on the one hand, due to the fact that it is usually desired that the product encoded by the RNA sequence accumulates in vivo. On the other hand, the RNA has to maintain its structural and functional integrity when prepared for a suitable dosage form, in the course of its storage, and when administered. Thus, efforts were made to provide stable RNA molecules for gene therapy or genetic vaccination in order to prevent them from being subject to early degradation or decay.
- nucleic acids comprising an increased amount of guanine (G) and/or cytosine (C) residues may be functionally more stable than nucleic acids containing a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides.
- WO02/098443 provides a pharmaceutical composition containing an mRNA that is stabilised by sequence modifications in the coding region. Such a sequence modification takes advantage of the degeneracy of the genetic code.
- RNA stabi lization is limited by the provisions of the specific nucleotide sequence of each single RNA molecule which is not allowed to leave the space of the desired amino acid sequence. Also, that approach is restricted to coding regions of the RNA.
- mRNA stabilisation As an alternative option for mRNA stabilisation, it has been found that naturally occurring eukaryotic mRNA molecules contain characteristic stabilising elements. For example, they may comprise so-called untranslated regions (UTR) at their 5'-end (5'-UTR) and/or at their 3'-end (3'-UTR) as well as other structural features, such as a 5'-cap structure or a 3'- poly(A) tail. Both, 5'-UTR and 3'-UTR are typically transcribed from the genomic DNA and are, thus, an element of the premature mRNA.
- UTR untranslated regions
- Characteristic structural features of mature mRNA such as the 5'-cap and the 3'-poly(A) tai l (also called poly(A) tai l or poly(A) sequence) are usual ly added to the transcribed (premature) mRNA duri ng mRNA processing.
- a 3 '-poly(A) tai l is typical ly a monotonous sequence stretch of adenosine nucleotides added to the 3 '-end of the transcribed mRNA. It may comprise up to about 400 adenosine nucleotides. It was found that the length of such a 3 '-poly(A) tai l is a potential ly critical element for the stabi lity of the individual mRNA.
- ot-globi n mRNA may be an important factor for the well-known stability of a-globi n mRNA (Rodgers et al., Regulated a-globi n mRNA decay is a cytoplasmic event proceedi ng through 3'-to-5' exosome-dependent decapping, RNA, 8, pp. 1 526-1 537, 2002).
- the 3'-UTR of ⁇ -globin mRNA is apparently involved in the formation of a specific ribonucleoprotein-complex, the a-complex, whose presence correlates with mRNA stabi lity in vitro (Wang et al, An mRNA stabi l ity complex functions with poly(A)-binding protein to stabi lize mRNA in vitro, Molecular and Cellular biology, Vol 1 9, No. 7, July 1 999, p. 4552-4560).
- ribosomal proteins which are typically transcribed i n a constant manner so that some ribosomal protei n mRNAs such as ribosomal protein S9 or ribosomal protein L32 are referred to as housekeepi ng genes (Janovick-Guretzky et al., Housekeepi ng Gene Expression in Bovi ne Liver is Affected by Physiological State, Feed Intake, and Dietary Treatment, J. Dairy Sci ., Vol . 90, 2007, p. 2246-2252).
- the growth -associated expression pattern of ribosomal proteins is thus mainly due to regulation on the level of translation.
- WO 201 4/1 64253 A1 describes some specific nucleic acid molecules havi ng 5'-UTRs and/or 3'-UTRs, without detai li ng on translation efficiency of such molecules. Irrespective of factors influencing mRNA stability, effective translation of the administered nucleic acid molecules by the target cells or tissue is crucial for any approach using nucleic acid molecules for gene therapy or genetic vaccination. As can be seen from the examples cited above, along with the regulation of stability, also translation of the majority of mRNAs is regulated by structural features like UTRs, 5'-cap and 3'-poly(A) tai l. In this context, it has been reported that the length of the poly(A) tail may play an important role for translation efficiency as well. Stabilizing 3'-elements, however, may also have an attenuating effect on translation.
- nucleic acid molecules which may be suitable for application in gene therapy and/or genetic vaccination.
- an artificial nucleic acid molecule preferably an mRNA, which is characterized by high translation efficiency.
- One particular object of the invention is the provision of an mRNA, wherein the efficiency of translation (ribosomal production of the respective encoded protein) is enhanced, e.g. with reference to a reference nucleic acid molecule (reference mRNA).
- Another object of the present invention is to provide nucleic acid molecules coding for such a superior mRNA species which may be amenable for use in gene therapy and/or genetic vaccination. It is a further object of the present invention to provide a pharmaceutical composition for use in gene therapy and/or genetic vaccination. In summary, it is the object of the present invention to provide improved nucleic acid species which overcome the above discussed disadvantages of the prior art by a cost- effective and straight-forward approach.
- the present inventors identified UTR elements (5'-UTR elements and 3'-UTR elements) which provide high translation efficiency. It is a common aspect of preferred nucleic acid molecules of this invention that they are al l characterized by a translation efficiency which is higher than the translation efficiency of previously known nucleic acid molecules. An assay for determining high translation efficiency, with reference to a reference nucleic acid molecule, is also provided.
- the present invention was made with support from the US Government under Agreement No. HR001 1 -1 1 -3-0001 awarded by DARPA. The US Government has certain rights in the invention.
- the adaptive immune response is typically understood to be an antigen-specific response of the immune system. Antigen specificity allows for the generation of responses that are tailored to specific pathogens or pathogen- infected cells. The ability to mount these tailored responses is usually maintained in the body by "memory cells". Should a pathogen infect the body more than once, these specific memory cells are used to quickly eliminate it.
- the first step of an adaptive immune response is the activation of naive antigen-specific T cells or different immune cells able to induce an antigen-specific immune response by antigen-presenting cel ls. This occurs in the lymphoid tissues and organs through which naive T cells are constantly passing.
- dendritic cells The three cell types that may serve as antigen-presenting cells are dendritic cells, macrophages, and B cells. Each of these cells has a distinct function in eliciting immune responses.
- Dendritic cells may take up antigens by phagocytosis and macropinocytosis and may become stimulated by contact with e.g. a foreign antigen to migrate to the local lymphoid tissue, where they differentiate into mature dendritic cells.
- Macrophages ingest particulate antigens such as bacteria and are induced by infectious agents or other appropriate stimuli to express MHC molecules.
- the unique ability of B cells to bind and internalize soluble protein antigens via their receptors may also be important to induce T cells.
- MHC-molecules are, typically, responsible for presentation of an antigen to T-cells. Therein, presenting the antigen on MHC molecules leads to activation of T cells which induces their proliferation and differentiation into armed effector T cells.
- effector T cells The most important function of effector T cells is the killing of infected cells by CD8+ cytotoxic T cells and the activation of macrophages by Th1 cells which together make up cell-mediated immunity, and the activation of B cel ls by both Th2 and Th1 cells to produce different classes of antibody, thus driving the humoral immune response.
- T cells recognize an antigen by their T cell receptors which do not recognize and bind the antigen directly, but instead recognize short peptide fragments e.g. of pathogen-derived protein antigens, e.g. so-called epitopes, which are bound to MHC molecules on the surfaces of other cells.
- the adaptive immune system is essentially dedicated to eliminate or prevent pathogenic growth. It typically regulates the adaptive immune response by providing the vertebrate immune system with the ability to recognize and remember specific pathogens (to generate immunity), and to mount stronger attacks each time the pathogen is encountered.
- the system is highly adaptable because of somatic hypermutation (a process of accelerated somatic mutations), and V(D)J recombination (an irreversible genetic recombination of antigen receptor gene segments). This mechanism allows a small number of genes to generate a vast number of different antigen receptors, which are then uniquely expressed on each individual lymphocyte.
- Adjuvant/adjuvant component An adjuvant or an adjuvant component in the broadest sense is typically a pharmacological and/or immunological agent that may modify, e.g. enhance, the effect of other agents, such as a drug or vaccine. It is to be interpreted in a broad sense and refers to a broad spectrum of substances. Typically, these substances are able to increase the immunogenicity of antigens.
- adjuvants may be recognized by the innate immune systems and, e.g., may elicit an innate immune response. "Adjuvants” typically do not elicit an adaptive immune response. Insofar, “adjuvants” do not qualify as antigens. Their mode of action is distinct from the effects triggered by antigens resulting in an adaptive immune response.
- Antigen refers typically to a substance which may be recognized by the immune system, preferably by the adaptive immune system, and is capable of triggering an antigen-specific immune response, e.g. by formation of antibodies and/or antigen-specific T cells as part of an adaptive immune response.
- an antigen may be or may comprise a peptide or protein which may be presented by the MHC to T-cells.
- an antigen may be the product of translation of a provided nucleic acid molecule, preferably an mRNA as defined herein.
- fragments, variants and derivatives of peptides and proteins comprising at least one epitope are understood as antigens.
- tumour antigens and pathogenic antigens as defined herein are particularly preferred.
- an artificial nucleic acid molecule may be understood as a non-natural nucleic acid molecule. Such nucleic acid molecule may be non-natural due to its individual sequence (which does not occur naturally) and/or due to other modifications, e.g. structural modifications of nucleotides which do not occur naturally.
- An artificial nucleic acid molecule may be a DNA molecule, an RNA molecule or a hybrid-molecule comprising DNA and RNA portions.
- artificial nucleic acid molecules may be designed and/or generated by genetic engineering methods to correspond to a desired artificial sequence of nucleotides (heterologous sequence). In this context an artificial sequence is usually a sequence that may not occur naturally, i.e.
- wild-type may be understood as a sequence occurring in nature.
- artificial nucleic acid molecule is described herein to be “based on” any particular wild-type nucleic acid molecule, then said artificial nucleic acid molecule differs from said wild-type nucleic acid molecule by at least one nucleotide.
- artificial nucleic acid molecule is not restricted to mean “one single molecule” but is, typically, understood to comprise an ensemble of identical molecules. Accordingly, it may relate to a plurality of identical molecules contained in an aliquot.
- Bicistronic RNA, multicistronic RNA A bicistronic or multicistronic RNA is typically an RNA, preferably an mRNA that typically may have two (bicistronic) or more (multicistronic) open reading frames (ORF).
- An open reading frame in this context is a sequence of codons that is translatable into a peptide or protein.
- Carrier / polymeric carrier A carrier in the context of the invention may typically be a compound that facilitates transport and/or complexation of another compound (cargo).
- a polymeric carrier is typically a carrier that is formed of a polymer.
- a carrier may be associated to its cargo by covalent or non-covalent interaction.
- a carrier may transport nucleic acids, e.g. RNA or DNA, to the target cells.
- the carrier may - for some embodiments - be a cationic component.
- Cationic component typically refers to a charged molecule, which is positively charged (cation) at a pH value typically from 1 to 9, preferably at a pH value of or below 9 (e.g. from 5 to 9), of or below 8 (e.g. from 5 to 8), of or below 7 (e.g. from 5 to 7), most preferably at a physiological pH, e.g. from 7.3 to 7.4.
- a cationic component may be any positively charged compound or polymer, • preferably a cationic peptide or protein which is positively charged under physiological conditions, particularly under physiological conditions in vivo.
- a "cationic peptide or protein” may contain at least one positively charged amino acid, or more than one positively charged amino acid, e.g. selected from Arg, His, Lys or Orn. Accordingly, "polycationic" components are also withi n the scope exhibiting more than one positive charge under the conditions given.
- a 5 '-cap is an entity, typically a modified nucleotide entity, which generally "caps" the 5'-end of a mature mRNA.
- a 5 '-cap may typical ly be formed by a modified nucleotide, particularly by a derivative of a guanine nucleotide.
- the 5'-cap is li nked to the 5'-terminus via a 5 '-5 '-triphosphate linkage.
- a 5'-cap may be methylated, e.g. m7GpppN, wherein N is the terminal 5' nucleotide of the nucleic acid carrying the 5'-cap, typical ly the 5'-end of an RNA.
- 5'cap structures include glyceryl, inverted deoxy abasic residue (moiety), 4', 5' methylene nucleotide, 1 -(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, 1 ,5-anhydrohexitol nucleotide, L-nucleotides, alpha-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'- seco nucleotide, acycl ic 3,4-dihydroxybutyl nucleotide, acyclic 3,5 dihydroxypentyl nucleotide, 3 '-3 '-inverted nucleotide moiety, 3 '-3 '-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3
- Cel lular immunity relates typical ly to the activation of macrophages, natural ki ller cel ls (NK), antigen-specific cytotoxic T- lymphocytes, and the release of various cytokines in response to an antigen.
- cellular immunity is not based on antibodies, but on the activation of cel ls of the immune system.
- a cellular immune response may be characterized e.g. by activating antigen-specific cytotoxic T-lymphocytes that are able to induce apoptosis i n cells, e.g.
- cel ls l ike dendritic cel ls or other cel ls, displaying epitopes of foreign antigens on their surface.
- Such cells may be virus-infected or i nfected with intracel lular bacteria, or cancer cel ls displaying tumor antigens. Further characteristics may be activation of macrophages and natural ki ller cel ls, enabl i ng them to destroy pathogens and stimulation of cel ls to secrete a variety of cytokines that influence the function of other cel ls i nvolved in adaptive immune responses and innate immune responses.
- DNA is the usual abbreviation for deoxy-ribonucleic acid. It is a nucleic acid molecule, i .e. a polymer consisting of nucleotides. These nucleotides are usual ly deoxy- adenosine-monophosphate, deoxy-thymidine-monophosphate, deoxy-guanosine- monophosphate and deoxy-cytidi ne-monophosphate monomers which are - by themselves - composed of a sugar moiety (deoxyribose), a base moiety and a phosphate moiety, and polymerise by a characteristic backbone structure.
- the backbone structure is, typically, formed by phosphodiester bonds between the sugar moiety of the nucleotide, i .e. deoxyribose, of a first and a phosphate moiety of a second, adjacent monomer.
- the specific order of the monomers i .e. the order of the bases l inked to the sugar/phosphate-backbone, is cal led the DNA sequence.
- DNA may be single stranded or double stranded. I n the double stranded form, the nucleotides of the first strand typical ly hybridize with the nucleotides of the second strand, e.g. by A/T-base-pairi ng and G/C-base-pairing.
- T cel l epitopes or parts of the protei ns in the context of the present invention may comprise fragments preferably having a length of about 6 to about 20 or even more amino acids, e.g. fragments as processed and presented by MHC class I molecules, preferably having a length of about 8 to about 1 0 amino acids, e.g. 8, 9, or 1 0, (or even 1 1 , or 1 2 amino acids), or fragments as processed and presented by MHC class II molecules, preferably havi ng a length of about 1 3 or more amino acids, e.g.
- B cel l epitopes are typically fragments located on the outer surface of (native) protein or peptide antigens as defined herein, preferably having 5 to 1 5 amino acids, more preferably having 5 to 1 2 amino acids, even more preferably having 6 to 9 amino acids, which may be recognized by antibodies, i.e. i n their native form.
- Such epitopes of proteins or peptides may furthermore be selected from any of the herein mentioned variants of such proteins or peptides.
- antigenic determinants can be conformational or discontinuous epitopes which are composed of segments of the proteins or peptides as defined herein that are discontinuous in the amino acid sequence of the proteins or peptides as defined herein but are brought together in the three-dimensional structure or continuous or linear epitopes which are composed of a single polypeptide chain.
- a fragment of a sequence may typically be a shorter portion of a full-length sequence of e.g. a nucleic acid molecule or an amino acid sequence. Accordingly, a fragment, typically, consists of a sequence that is identical to the corresponding stretch within the full-length sequence.
- a preferred fragment of a sequence in the context of the present invention consists of a continuous stretch of entities, such as nucleotides or amino acids corresponding to a continuous stretch of entities in the molecule the fragment is derived from, which represents at least 5%, 10%, 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, and most preferably at least 80% of the total (i.e. full-length) molecule from which the fragment is derived.
- entities such as nucleotides or amino acids corresponding to a continuous stretch of entities in the molecule the fragment is derived from, which represents at least 5%, 10%, 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, and most preferably at least 80% of the total (i.e. full-length) molecule from which the fragment is derived.
- a G/C-modified nucleic acid may typically be a nucleic acid, preferably an artificial nucleic acid molecule as defined herein, based on a modified wild-type sequence comprising a preferably increased number of guanosine and/or cytosine nucleotides as compared to the wild-type sequence. Such an increased number may be generated by substitution of codons containing adenosine or thymidine nucleotides by codons containing guanosine or cytosine nucleotides. If the enriched G/C content occurs in a coding region of DNA or RNA, it makes use of the degeneracy of the genetic code. Accordingly, the codon substitutions preferably do not alter the encoded amino acid residues, but exclusively increase the G/C content of the nucleic acid molecule.
- Gene therapy may typically be understood to mean a treatment of a patient's body or isolated elements of a patient's body, for example isolated tissues/cells, by nucleic acids encoding a peptide or protein. It typically may comprise at least one of the steps of a) administration of a nucleic acid, preferably an artificial nucleic acid molecule as defined herein, directly to the patient - by whatever administration route - or in vitro to isolated cel ls/tissues of the patient, which results in transfection of the patient's cells either in vivo/ ex vivo or in vitro; b) transcription and/or translation of the introduced nucleic acid molecule; and optionally c) re-administration of isolated, transfected cells to the patient, if the nucleic acid has not been administered directly to the patient.
- a nucleic acid preferably an artificial nucleic acid molecule as defined herein
- Genetic vaccination may typically be understood to be vaccination by administration of a nucleic acid molecule encoding an antigen or an immunogen or fragments thereof.
- the nucleic acid molecule may be administered to a subject's body or to isolated cells of a subject. Upon transfection of certain cells of the body or upon transfection of the isolated cells, the antigen or immunogen may be expressed by those cells and subsequently presented to the immune system, eliciting an adaptive, i.e. antigen- specific immune response.
- genetic vaccination typically comprises at least one of the steps of a) administration of a nucleic acid, preferably an artificial nucleic acid molecule as defined herein, to a subject, preferably a patient, or to isolated cells of a subject, preferably a patient, which usually results in transfection of the subject's cells either in vivo or in vitro; b) transcription and/or translation of the introduced nucleic acid molecule; and optionally c) re-administration of isolated, transfected cells to the subject, preferably the patient, if the nucleic acid has not been administered directly to the patient.
- a nucleic acid preferably an artificial nucleic acid molecule as defined herein
- Heterologous sequence Two sequences are typically understood to be 'heterologous' if they are not derivable from the same gene. I.e., although heterologous sequences may be derivable from the same organism, they naturally (in nature) do not occur in the same nucleic acid molecule, such as in the same mRNA.
- Humoral immunity refers typically to antibody production and optionally to accessory processes accompanying antibody production.
- a humoral immune response may be typically characterized, e.g., by Th2 activation and cytokine production, germinal center formation and isotype switching, affinity maturation and memory cell generation.
- Humoral immunity also typically may refer to the effector functions of antibodies, which include pathogen and toxin neutralization, classical complement activation, and opsonin promotion of phagocytosis and pathogen elimination.
- Immunogen In the context of the present invention an immunogen may be typically understood to be a compound that is able to stimulate an immune response.
- an immunogen is a peptide, polypeptide, or protein.
- an immunogen in the sense of the present invention is the product of translation of a provided nucleic acid molecule, preferably an artificial nucleic acid molecule as defined herein.
- an immunogen elicits at least an adaptive immune response.
- Immunostimulatory composition In the context of the invention, an immunostimulatory composition may be typically understood to be a composition containing at least one component which is able to induce an immune response or from which a component which is able to induce an immune response is derivable. Such immune response may be preferably an innate immune response or a combination of an adaptive and an innate immune response.
- an immunostimulatory composition in the context of the invention contains at least one artificial nucleic acid molecule, more preferably an RNA, for example an mRNA molecule.
- the immunostimulatory component such as the mRNA may be complexed with a suitable carrier.
- the immunostimulatory composition may comprise an mRNA/carrier-complex.
- the immunostimulatory composition may comprise an adjuvant and/or a suitable vehicle for the immunostimulatory component, such as the mRNA.
- Immune response An immune response may typically be a specific reaction of the adaptive immune system to a particular antigen (so called specific or adaptive immune response) or an unspecific reaction of the innate immune system (so called unspecific or innate immune response), or a combination thereof.
- the immune system may protect organisms from infection. If a pathogen succeeds in passing a physical barrier of an organism and enters this organism, the innate immune system provides an immediate, but non-specific response. If pathogens evade this innate response, vertebrates possess a second layer of protection, the adaptive immune system.
- the immune system adapts its response during an infection to improve its recognition of the pathogen. This improved response is then retained after the pathogen has been eliminated, in the form of an immunological memory, and allows the adaptive immune system to mount faster and stronger attacks each time this pathogen is encountered.
- the immune system comprises the innate and the adaptive immune system. Each of these two parts typically contains so called humoral and cellular components.
- Immunostimulatory RNA in the context of the invention may typically be an RNA that is able to induce an innate immune response. It usually does not have an open reading frame and thus does not provide a peptide-antigen or immunogen but elicits an immune response e.g. by binding to a specific kind of Toll-like- receptor (TLR) or other suitable receptors.
- TLR Toll-like- receptor
- mRNAs having an open reading frame and coding for a peptide/protein may induce an innate immune response and, thus, may be immunostimulatory RNAs.
- the innate immune system also known as non-specific (or unspecific) immune system, typically comprises the cells and mechanisms that defend the host from infection by other organisms in a non-specific manner. This means that the cells of the innate system may recognize and respond to pathogens in a generic way, but unlike the adaptive immune system, it does not confer long-lasting or protective immunity to the host.
- the innate immune system may be, e.g., activated by ligands of Toll-like receptors (TLRs) or other auxiliary substances such as lipopolysaccharides, TNF-alpha, CD40 ligand, or cytokines, monokines, lymphokines, interleukins or chemokines, IL-1 , IL-2, IL-3, IL-4, IL- 5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-1 1 , IL-1 2, IL-1 3, IL-1 4, IL-1 5, IL-1 6, IL-1 7, IL-1 8, IL-1 9, IL- 20, IL-21 , IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31 , IL-32, IL-33, IFN- alpha, IFN-beta, IFN-gamma, GM-C
- the pharmaceutical composition according to the present invention may comprise one or more such substances.
- a response of the innate immune system includes recruiting immune cells to sites of infection, through the production of chemical factors, including specialized chemical mediators, called cytokines; activation of the complement cascade; identification and removal of foreign substances present in organs, tissues, the blood and lymph, by specialized white blood cells; activation of the adaptive immune system; and/or acting as a physical and chemical barrier to infectious agents.
- a cloning site is typically understood to be a segment of a nucleic acid molecule, which is suitable for insertion of a nucleic acid sequence, e.g., a nucleic acid sequence comprising an open reading frame. Insertion may be performed by any molecular biological method known to the one skilled in the art, e.g. by restriction and ligation.
- a cloning site typically comprises one or more restriction enzyme recognition sites (restriction sites). These one or more restrictions sites may be recognized by restriction enzymes which cleave the DNA at these sites.
- a cloning site which comprises more than one restriction site may also be termed a multiple cloning site (MCS) or a polylinker.
- MCS multiple cloning site
- Nucleic acid molecule is a molecule comprising, preferably consisting of nucleic acid components.
- the term nucleic acid molecule preferably refers to DNA or RNA molecules. It is preferably used synonymous with the term "polynucleotide".
- a nucleic acid molecule is a polymer comprising or consisting of nucleotide monomers which are covalently linked to each other by phosphodiester-bonds of a sugar/phosphate-backbone.
- the term "nucleic acid molecule” also encompasses modified nucleic acid molecules, such as base-modified, sugar-modified or backbone-modified etc. DNA or RNA molecules.
- Open reading frame An open reading frame (ORF) in the context of the invention may typically be a sequence of several nucleotide triplets which may be translated into a peptide or protein.
- An open readi ng frame preferably contains a start codon, i.e. a combination of three subsequent nucleotides coding usually for the amino acid methionine (ATG), at its 5'- end and a subsequent region which usually exhibits a length which is a multiple of 3 nucleotides. Typically, this is the only stop-codon of the open reading frame.
- an open reading frame in the context of the present invention is preferably a nucleotide sequence, consisti ng of a number of nucleotides that may be divided by three, which starts with a start codon (e.g. ATG) and which preferably termi nates with a stop codon (e.g., TAA, TGA, or TAG).
- the open reading frame may be isolated or it may be i ncorporated in a longer nucleic acid sequence, for example in a vector or an mRNA.
- An open reading frame may also be termed "protei n codi ng region".
- a peptide or polypeptide is typical ly a polymer of amino acid monomers, l i nked by peptide bonds. It typical ly contai ns less than 50 monomer units. Nevertheless, the term peptide is not a disclaimer for molecules having more than 50 monomer units. Long peptides are also cal led polypeptides, typical ly havi ng between 50 and 600 monomeric units.
- a pharmaceutical ly effective amount in the context of the invention is typically understood to be an amount that is sufficient to induce a pharmaceutical effect, such as an immune response, altering a pathological level of an expressed peptide or protein, or substituting a lacking gene product, e.g., in case of a pathological situation.
- Protein A protein typical ly comprises one or more peptides or polypeptides.
- a protein is typically folded into 3-dimensional form, which may be required for to protein to exert its biological function.
- Poly(A) sequence A poly(A) sequence, also cal led poly(A) tail or 3 '-poly(A) tai l, is typically understood to be a sequence of adenosi ne nucleotides, e.g., of up to about 400 adenosine nucleotides, e.g. from about 20 to about 400, preferably from about 50 to about 400, more preferably from about 50 to about 300, even more preferably from about 50 to about 250, most preferably from about 60 to about 250 adenosi ne nucleotides.
- a poly(A) sequence is typical ly located at the 3'end of an mRNA.
- a poly(A) sequence may be located within an mRNA or any other nucleic acid molecule, such as, e.g., in a vector, for example, in a vector serving as template for the generation of an RNA, preferably an mRNA, e.g., by transcription of the vector.
- Polyadenylation is typical ly understood to be the addition of a poly(A) sequence to a nucleic acid molecule, such as an RNA molecule, e.g. to a premature mRNA. Polyadenylation may be induced by a so cal led polyadenylation signal. This signal is preferably located within a stretch of nucleotides at the 3'-end of a nucleic acid molecule, such as an RNA molecule, to be polyadenylated.
- a polyadenylation signal typical ly comprises a hexamer consisting of adenine and uracil/thymine nucleotides, preferably the hexamer sequence AAUAAA.
- RNA maturation from pre-mRNA to mature mRNA comprises the step of polyadenylation.
- restriction site also termed restriction enzyme recognition site, is a nucleotide sequence recognized by a restriction enzyme.
- a restriction site is typical ly a short, preferably pali ndromic nucleotide sequence, e.g. a sequence comprising 4 to 8 nucleotides.
- a restriction site is preferably specifically recognized by a restriction enzyme.
- the restriction enzyme typically cleaves a nucleotide sequence comprising a restriction site at this site. In a double-stranded nucleotide sequence, such as a double-stranded DNA sequence, the restriction enzyme typically cuts both strands of the nucleotide sequence.
- RNA is the usual abbreviation for ribonucleic-acid. It is a nucleic acid molecule, i.e. a polymer consisting of nucleotides. These nucleotides are usually adenosine- monophosphate, uridine-monophosphate, guanosine-monophosphate and cytidine- monophosphate monomers which are connected to each other along a so-called backbone.
- the backbone is formed by phosphodiester bonds between the sugar, i.e. ribose, of a first and a phosphate moiety of a second, adjacent monomer.
- the specific succession of the monomers is called the RNA-sequence.
- RNA may be obtainable by transcription of a DNA-sequence, e.g., inside a cell.
- transcription is typically performed inside the nucleus or the mitochondria.
- transcription of DNA usually results in the so-called premature RNA which has to be processed into so-called messenger-RNA, usually abbreviated as mRNA.
- Processing of the premature RNA e.g. in eukaryotic organisms, comprises a variety of different posttranscriptional-modifications such as splicing, 5'-capping, polyadenylation, export from the nucleus or the mitochondria and the like. The sum of these processes is also called maturation of RNA.
- the mature messenger RNA usually provides the nucleotide sequence that may be translated into an amino-acid sequence of a particular peptide or protein.
- a mature mRNA comprises a 5'-cap, a 5'-UTR, an open reading frame, a 3'-UTR and a poly(A) sequence.
- messenger RNA several non-coding types of RNA exist which may be involved in regulation of transcription and/or translation.
- Sequence of a nucleic acid molecule The sequence of a nucleic acid molecule is typically understood to be the particular and individual order, i.e. the succession of its nucleotides.
- sequence of a protein or peptide is typically understood to be the order, i.e. the succession of its amino acids.
- Sequence identity Two or more sequences are identical if they exhibit the same length and order of nucleotides or amino acids.
- the percentage of identity typically describes the extent to which two sequences are identical, i.e. it typically describes the percentage of nucleotides that correspond in their sequence position with identical nucleotides of a reference-sequence.
- the sequences to be compared are considered to exhibit the same length, i.e. the length of the longest sequence of the sequences to be compared. This means that a first sequence consisting of 8 nucleotides is 80% identical to a second sequence consisting of 10 nucleotides comprising the first sequence.
- identity of sequences preferably relates to the percentage of nucleotides of a sequence which have the same position in two or more sequences having the same length. Gaps are usually regarded as non-identical positions, irrespective of their actual position in an alignment.
- a stabilized nucleic acid molecule is a nucleic acid molecule, preferably a DNA or RNA molecule that is modified such, that it is more stable to disintegration or degradation, e.g., by environmental factors or enzymatic digest, such as by an exo- or endonuclease degradation, than the nucleic acid molecule without the modification.
- a stabilized nucleic acid molecule in the context of the present invention is stabilized in a cell, such as a prokaryotic or eukaryotic cell, preferably in a mammalian cell, such as a human cell.
- the stabilization effect may also be exerted outside of cells, e.g. in a buffer solution etc., for example, in a manufacturing process for a pharmaceutical composition comprising the stabilized nucleic acid molecule.
- Transfection refers to the introduction of nucleic acid molecules, such as DNA or RNA (e.g. mRNA) molecules, into cells, preferably into eukaryotic cells.
- nucleic acid molecules such as DNA or RNA (e.g. mRNA) molecules
- transfection encompasses any method known to the skilled person for introducing nucleic acid molecules into cells, preferably into eukaryotic cel ls, such as into mammalian cells. Such methods encompass, for example, electroporation, lipofection, e.g.
- the introduction is non-viral.
- Translation efficiency typically relates to a property of a nucleic acid molecule (e.g. mRNA) comprising an open reading frame (ORF). Translation efficiency is experimentally quantifiable. Translation efficiency is typically measured by determining the quantity of protein translated from the ORF. For experimental quantification of translation efficiency, the ORF preferably encodes a reporter protein or any other protein that can be quantified. However, without wishing to be bound to a particular theory, it is understood that high translation efficiency is typically provided by a specific UTR element (a specific 5'-UTR element or a specific 3'-UTR element).
- the term translation efficiency is particularly used in relation to nucleic acid molecules which, in addition to the ORF, comprise at least one 5'-UTR element and/or at least one 3'-UTR element, preferably as defined herein.
- the ORF suitably encodes a reporter protein or any other protein that can be quantified, the present invention is not limited to such purposes; consequently, the at least one 5'-UTR element and/or at least one 3'-UTR element of the invention (which provides high translation efficiency) can be comprised i n a nucleic acid molecule comprising an ORF, which does not encode a reporter protei n.
- Translation efficiency is a relative term.
- the translation efficiency of various, e.g. two or more, nucleic acid molecules can be determined and compared, e.g. by experimental quantification of protein encoded by the ORF. This can be done under standardized conditions, e.g. in a standardized assay as described herein.
- translation efficiency determined under standardized conditions is an objective feature.
- the translation efficiency of two nucleic acid molecules is determined and compared.
- the fi rst of said two nucleic acid molecules can be referred to as "subject nucleic acid molecule" or "subject construct”
- the second of said two nucleic acid molecules can be referred to as "reference nucleic acid molecule" or "reference construct”.
- the subject nucleic acid molecule can be an artificial nucleic acid molecule according to the present i nvention.
- reference nucleic acid molecule and subject nucleic acid molecule share the same ORF (identical nucleic acid sequence); and preferably the nucleic acid sequence of the subject nucleic acid molecule is identical to the nucleic acid sequence of the reference nucleic acid molecule, with the exception of the UTR element that is tested, i.e.
- subject nucleic acid molecule and reference nucleic acid molecule are transfected into mammalian cel ls, and translation efficiency is determined.
- the translation efficiency of the subject nucleic acid molecule is higher than the translation efficiency of the reference nucleic acid molecule, then the subject nucleic acid molecule is said to be characterized by high translation efficiency.
- the 5'- UTR element or the 3'-UTR element which disti nguishes the subject nucleic acid molecule from the reference nucleic acid molecule is said to provide high translation efficiency (to the subject nucleic acid molecule).
- the high translation efficiency is said to be "provided” by the specific 5'-UTR element or the 3'-UTR element which is present in the subject nucleic acid molecule but not i n the reference nucleic acid molecule; and the subject nucleic acid molecule (or artificial nucleic acid molecule) which comprises such 5'- UTR or 3'-UTR and at least one ORF is said to "be characterized by" high translation efficiency.
- a vaccine is typically understood to be a prophylactic or therapeutic material providing at least one antigen, preferably an immunogen.
- the antigen or immunogen may be derived from any material that is suitable for vaccination.
- the antigen or immunogen may be derived from a pathogen, such as from bacteria or virus particles etc., or from a tumor or cancerous tissue.
- the antigen or immunogen stimulates the body's adaptive immune system to provide an adaptive immune response.
- Vector refers to a nucleic acid molecule, preferably to an artificial nucleic acid molecule.
- a vector in the context of the present invention is suitable for incorporating or harboring a desired nucleic acid sequence, such as a nucleic acid sequence comprising an open reading frame.
- Such vectors may be storage vectors, expression vectors, cloning vectors, transfer vectors etc.
- a storage vector is a vector which al lows the convenient storage of a nucleic acid molecule, for example, of an mRNA molecule.
- the vector may comprise a sequence correspondi ng, e.g., to a desired mRNA sequence or a part thereof, such as a sequence corresponding to the open reading frame and the 3'-UTR and/or the 5'-UTR of an mRNA.
- An expression vector may be used for production of expression products such as RNA, e.g. mRNA, or peptides, polypeptides or proteins.
- an expression vector may comprise sequences needed for transcription of a sequence stretch of the vector, such as a promoter sequence, e.g. an RNA polymerase promoter sequence.
- a cloning vector is typically a vector that contai ns a cloning site, which may be used to incorporate nucleic acid sequences into the vector.
- a cloning vector may be, e.g., a plasmid vector or a bacteriophage vector.
- a transfer vector may be a vector which is suitable for transferring nucleic acid molecules into cells or organisms, for example, viral vectors.
- a vector in the context of the present invention may be, e.g., an RNA vector or a DNA vector.
- a vector is a DNA molecule.
- a vector in the sense of the present application comprises a cloning site, a selection marker, such as an antibiotic resistance factor, and a sequence suitable for multiplication of the vector, such as an origin of replication.
- a vector in the context of the present application is a plasmid vector.
- a vehicle is typically understood to be a material that is suitable for storing, transporting, and/or administering a compound, such as a pharmaceutically active compound.
- a compound such as a pharmaceutically active compound.
- it may be a physiologically acceptable liquid which is suitable for storing, transporting, and/or administering a pharmaceutically active compound.
- 3'-untranslated region 3'-UTR: Generally, the term “3'-UTR” refers to a part of the artificial nucleic acid molecule, which is located 3' (i.e. "downstream") of an open reading frame and which is not translated into protein. Typically, a 3'-UTR is the part of an mRNA which is located between the protein coding region (open reading frame (ORF) or coding sequence (CDS)) and the poly(A) sequence of the mRNA. In the context of the invention, the term 3'-UTR may also comprise elements, which are not encoded in the template, from which an RNA is transcribed, but which are added after transcription during maturation, e.g. a poly(A) sequence.
- a 3'-UTR of the mRNA is not translated into an amino acid sequence.
- the 3'-UTR sequence is generally encoded by the gene which is transcribed into the respective mRNA during the gene expression process.
- the genomic sequence is first transcribed into pre-mature mRNA, which comprises optional introns.
- the pre-mature mRNA is then further processed into mature mRNA in a maturation process.
- This maturation process comprises the steps of 5'capping, splicing the pre-mature mRNA to excise optional introns and modifications of the 3'-end, such as polyadenylation of the 3'-end of the premature mRNA and optional endo-/ or exonuclease cleavages etc..
- a 3'-UTR corresponds to the sequence of a mature mRNA which is located between the stop codon of the protein coding region, preferably immediately 3' to the stop codon of the protein coding region, and the poly(A) sequence of the mRNA.
- the term "corresponds to” means that the 3'-UTR sequence may be an RNA sequence, such as in the mRNA sequence used for defining the 3'-UTR sequence, or a DNA sequence which corresponds to such RNA sequence.
- the term "a 3'- UTR of a gene” is the sequence which corresponds to the 3'-UTR of the mature mRNA derived from this gene, i.e.
- 3'-UTR of a gene encompasses the DNA sequence and the RNA sequence (both sense and antisense strand and both mature and immature) of the 3'-UTR.
- the 3'UTRs have a length of more than 20, 30, 40 or 50 nucleotides.
- 5'-untranslated region 5'-UTR: Generally, the term “5'-UTR” refers to a part of the artificial nucleic acid molecule, which is located 5' (i.e. "upstream") of an open reading frame and which is not translated into protein.
- a 5'-UTR is typically understood to be a particular section of messenger RNA (mRNA), which is located 5' of the open reading frame of the mRNA.
- mRNA messenger RNA
- the 5'-UTR starts with the transcriptional start site and ends one nucleotide before the start codon of the open reading frame.
- the 5'UTRs have a length of more than 20, 30, 40 or 50 nucleotides.
- the 5'-UTR may comprise elements for controlling gene expression, also called regulatory elements.
- the 5'-UTR may be posttranscriptional ly modified, for example by addition of a 5'-CAP.
- a 5'-UTR of the mRNA is not translated into an amino acid sequence.
- the 5'-UTR sequence is generally encoded by the gene which is transcribed into the respective mRNA during the gene expression process.
- the genomic sequence is first transcribed into pre-mature mRNA, which comprises optional introns.
- the pre-mature mRNA is then further processed into mature mRNA in a maturation process.
- This maturation process comprises the steps of 5'capping, splicing the pre-mature mRNA to excise optional introns and modifications of the 3'-end, such as polyadenylation of the 3'-end of the premature mRNA and optional endo-/ or exonuclease cleavages etc..
- a 5'-UTR corresponds to the sequence of a mature mRNA which is located between the start codon and, for example, the 5'-CAP.
- the 5'-UTR corresponds to the sequence which extends from a nucleotide located 3' to the 5'-CAP, more preferably from the nucleotide located immediately 3' to the 5'-CAP, to a nucleotide located 5' to the start codon of the protein coding region, preferably to the nucleotide located immediately 5' to the start codon of the protein coding region.
- the nucleotide located immediately 3' to the 5'-CAP of a mature mRNA typically corresponds to the transcriptional start site.
- the term “corresponds to” means that the 5'-UTR sequence may be an RNA sequence, such as in the mRNA sequence used for defining the 5'-UTR sequence, or a DNA sequence which corresponds to such RNA sequence.
- a 5'-UTR of a gene is the sequence which corresponds to the 5'-UTR of the mature mRNA derived from this gene, i.e. the mRNA obtained by transcription of the gene and maturation of the pre-mature mRNA.
- the term “5'-UTR of a gene” encompasses the DNA sequence and the RNA sequence (both sense and antisense strand and both mature and immature) of the 5'-UTR.
- TOP 5 ermina
- Oligopyrimidine Tract The 5'terminal oligopyrimidine tract (TOP) is typically a stretch of pyrimidine nucleotides located in the 5' terminal region of a nucleic acid molecule, such as the 5' terminal region of certain mRNA molecules or the 5' terminal region of a functional entity, e.g. the transcribed region, of certain genes.
- the sequence starts with a cytidine, which usually corresponds to the transcriptional start site, and is followed by a stretch of usually about 3 to 30 pyrimidine nucleotides.
- the TOP may comprise 3, 4, 5, 6, 7, 8, 9, 1 0, 1 1 , 12, 13, 14, 1 5, 1 6, 1 7, 18, 1 9, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30 or even more nucleotides.
- Messenger RNA that contains a 5'terminal oligopyrimidine tract is often referred to as TOP mRNA. Accordingly, genes that provide such messenger RNAs are referred to as TOP genes.
- TOP sequences have, for example, been found in genes and mRNAs encoding peptide elongation factors and ribosomal proteins.
- TOP motif In the context of the present invention, a TOP motif is a nucleic acid sequence which corresponds to a 5'TOP as defined above. Thus, a TOP motif in the context of the present invention is preferably a stretch of pyrimidine nucleotides having a length of 3-30 nucleotides.
- the TOP-motif consists of at least 3 pyrimidine nucleotides, preferably at least 4 pyrimidine nucleotides, preferably at least 5 pyrimidine nucleotides, more preferably at least 6 nucleotides, more preferably at least 7 nucleotides, most preferably at least 8 pyrimidine nucleotides, wherein the stretch of pyrimidine nucleotides preferably starts at its 5'end with a cytosine nucleotide.
- the TOP-motif preferably starts at its 5'end with the transcriptional start site and ends one nucleotide 5' to the first purin residue in said gene or mRNA.
- a TOP motif in the sense of the present invention is preferably located at the 5'end of a sequence which represents a 5'- UTR or at the 5'end of a sequence which codes for a 5'-UTR.
- TOP motif a stretch of 3 or more pyrimidine nucleotides is called "TOP motif" in the sense of the present invention if this stretch is located at the 5'end of a respective sequence, such as the artificial nucleic acid molecule, the 5'-UTR element of the artificial nucleic acid molecule, or the nucleic acid sequence which is derived from the 5'-UTR of a TOP gene as described herein.
- a stretch of 3 or more pyrimidine nucleotides which is not located at the 5'- end of a 5'-UTR or a 5'-UTR element but anywhere within a 5'-UTR or a 5'-UTR element, is preferably not referred to as "TOP motif".
- TOP genes are typical ly characterised by the presence of a 5' terminal oligopyrimidine tract. Furthermore, most TOP genes are characterized by a growth- associated translational regulation. However, also TOP genes with a tissue specific translational regulation are known. As defined above, the 5'-UTR of a TOP gene corresponds to the sequence of a 5'-UTR of a mature mRNA derived from a TOP gene, which preferably extends from the nucleotide located 3' to the 5'-CAP to the nucleotide located 5' to the start codon. A 5'-UTR of a TOP gene typically does not comprise any start codons, preferably no upstream AUGs (uAUGs) or upstream open reading frames (uORFs).
- uAUGs upstream AUGs
- uORFs upstream open reading frames
- upstream AUGs and upstream open reading frames are typically understood to be AUGs and open reading frames that occur 5' of the start codon (AUG) of the open reading frame that should be translated.
- the 5'-UTRs of TOP genes are generally rather short.
- the lengths of 5'-UTRs of TOP genes may vary between 20 nucleotides up to 500 nucleotides, and are typically less than about 200 nucleotides, preferably less than about 1 50 nucleotides, more preferably less than about 100 nucleotides.
- Exemplary 5'-UTRs of TOP genes in the sense of the present invention are the nucleic acid sequences extending from the nucleotide at position 5 to the nucleotide located immediately 5' to the start codon (e.g. the ATG) in the sequences according to SEQ ID Nos. 1 -1 363 of the patent application W0201 3/143700, whose disclosure is incorporated herewith by reference.
- a particularly preferred fragment of a 5'-UTR of a TOP gene is a 5'-UTR of a TOP gene lacking the 5'TOP motif.
- the terms "5'-UTR of a TOP gene" or "5'-TOP UTR" preferably refer to the 5'-UTR of a naturally occurring TOP gene.
- a preferred example is represented by SEQ ID NO: 208 (5'-UTR of human ribosomal protein Large 32 lacking the 5' terminal oligopyrimidine tract); corresponding to SEQ ID NO. 1368 of the patent application WO201 3/143700).
- Wild-type e.g. wild-type nucleic acid molecule
- the term "wi ld-type” may be understood as a sequence occurring in nature.
- a wi ld-type nucleic molecule may typically be understood to be a nucleic acid molecule, e.g. a DNA or an RNA, that occurs naturally.
- an artificial nucleic acid molecule may be understood as a natural nucleic acid molecule.
- Such nucleic acid molecule may be natural due to its individual sequence (which occurs naturally) and/or due to other modifications, e.g. structural modifications of nucleotides which occur naturally.
- a wild-type nucleic acid molecule may be a DNA molecule, an RNA molecule or a hybrid-molecule comprising DNA and RNA portions.
- the term "wi ld-type” refers to any sequence as long as it occurs in nature, reflection in publically accessible sequence collections such as GenBank is not required.
- the National Institute of Health (NIH) provides a publically accessible, annotated collection of publicly available nucleotide sequences ("GenBank", accessible through the NCBI Entrez retrieval system: http://www.ncbi.nlm.nih.gov), (Nucleic Acids Research, 201 3; 41 (D1 ):D36-42), including publicly available wild-type sequences.
- Each GenBank record is assigned a unique constant identifier called an accession number and appears on the ACCESSION line of a GenBank record; and changes to the sequence data are tracked by an integer extension of the accession number which appears on the VERSION line of the GenBank record.
- wild-type nucleic acid molecule is not restricted to mean “one single molecule” but is, typically, understood to comprise an ensemble of identical molecules. Accordingly, it may relate to a plurality of identical molecules contained in an aliquot.
- the invention relates to an artificial nucleic acid molecule comprising at least one open reading frame and at least one 3'-untranslated region element (3'-UTR element) and/or at least one 5'-untranslated region element (5'-UTR element), wherein said artificial nucleic acid molecule is characterized by high translation efficiency.
- the translation efficiency is contributed, at least in part, by the 5'-UTR element or the 3'-UTR element, or both of the 5'- UTR element and the 3'-UTR element.
- the invention further relates to the use of such an artificial nucleic acid molecule in gene therapy and/or genetic vaccination. Furthermore, novel 3'-UTR elements and 5'-UTR elements are provided.
- the present invention relates to an artificial nucleic acid molecule comprising
- ORF open reading frame
- the artificial nucleic acid molecule of the invention may differ from other (e.g. wild-type or artificial) nucleic acid molecules in that at least one 3'-UTR element (preferably one 3'-UTR element) is replaced by at least one nonidentical 3'-UTR element (preferably one 3'-UTR element) or in that at least one 5'-UTR element (preferably one 5'-UTR element) is replaced by at least one nonidentical 5'-UTR element (preferably one 5'-UTR element).
- at least one 3'-UTR element preferably one 3'-UTR element
- at least one nonidentical 3'-UTR element preferably one 3'-UTR element
- at least one 5'-UTR element preferably one 5'-UTR element
- replacing one (or least one) 3'-UTR element or replacing one (or least one) 5'- UTR element (in a starting nucleic acid molecule or reference nucleic acid molecule) generally means that a sequence of at least some nucleotides of said 3'-UTR element or of said 5'-UTR element is replaced by a nonidentical nucleic acid sequence.
- a continuous sequence of nucleotides of the 5'-UTR element is replaced by a nonidentical continuous sequence (element) of nucleotides; and when replacing a 3'-UTR element, a continuous sequence of nucleotides of the 3'-UTR element is replaced by a nonidentical continuous sequence (element) of nucleotides.
- the continuous sequence of nucleotides of the original (replaced) element and of the replacing element can each be independently of any lengths, such as from 1 to more than 500 nucleotides, 20 to 500 nucleotides, 40 to 400 nucleotides, 60 to 300 nucleotides, 80 to 200 nucleotides or 1 00 to 1 50 nucleotides.
- a (5'- or 3'-) UTR element is replaced, this does not necessarily mean that all nucleotides located 5' of the start codon or all nucleotides located 3' of the stop codon are replaced.
- a continuous sequence which is a subset of all the nucleotides located 5' of the start codon or a subset of all nucleotides located 3' of the stop codon, respectively, is replaced. Examples thereof are shown in Fig. 1 B (5') and 1 C (3'). It is possible to exactly replace a known 5'-UTR element, or a known 3'- UTR element, present in the staring sequence or reference sequence. For example, when a (e.g.
- nucleic acid comprises a 5'-UTR element corresponding to the sequence according to SEQ ID NO: 208; the artificial nucleic acid molecule of the present invention can be made by replacing exactly the entire continuous sequence according to SEQ ID NO: 208 by a nonidentical continuous 5'-UTR element according to the present invention, i.e. a 5'-UTR element which provides high translation efficiency.
- a known UTR element is not replaced exactly, e.g. a continuous nucleic acid sequence comprising additional nucleotides, i.e. in addition to the known UTR element, is replaced, or e.g. only a fraction (usually a major fraction, i.e.
- the artificial nucleic acid molecule according to the present invention does not comprise a 3'-UTR (element) and/or a 5'-UTR (element) of ribosomal protein S6, of RPL36AL, of rps1 6 or of ribosomal protein L9. More preferably, the artificial nucleic acid molecule according to the present invention does not comprise a 3'-UTR (element) and/or a 5'-UTR (element) of ribosomal protein S6, of RPL36AL, of rps1 6 or of ribosomal protein L9 and the open reading frame of the artificial nucleic acid molecule according to the present invention does not code for a GFP protein.
- the artificial nucleic acid molecule according to the present invention does not comprise a 3'-UTR (element) and/or a 5'-UTR (element) of ribosomal protein S6, of RPL36AL, of rps16 or of ribosomal protein L9 and the open reading frame of the artificial nucleic acid molecule according to the present invention does not code for a reporter protein, e.g., selected from the group consisting of globin proteins (particularly beta-globin), luciferase protein, GFP proteins, glucuronidase proteins (particularly beta- glucuronidase) or variants thereof, for example, variants exhibiting at least 70% sequence identity to a globin protein, a luciferase protein, a GFP protein, or a glucuronidase protein.
- a reporter protein e.g., selected from the group consisting of globin proteins (particularly beta-globin), luciferase protein, GFP proteins, glucuronidase
- 3'-UTR element refers to a nucleic acid sequence which comprises or consists of a nucleic acid sequence that is derived from a 3'-UTR or from a variant or a fragment of a 3'-UTR.
- a "3'-UTR element” preferably refers to a nucleic acid sequence which is comprised by a 3'-UTR of an artificial nucleic acid sequence, such as an artificial mRNA. Accordingly, in the sense of the present invention, preferably, a 3'-UTR element may be comprised by the 3'-UTR of an mRNA, preferably of an artificial mRNA, or a 3'-UTR element may be comprised by the 3'-UTR of the respective transcription template.
- a 3'-UTR element is a nucleic acid sequence which corresponds to the 3'-UTR of an mRNA, preferably to the 3'-UTR of an artificial mRNA, such as an mRNA obtained by transcription of a genetically engineered vector construct.
- a 3'-UTR element in the sense of the present invention functions as a 3'-UTR or codes for a nucleotide sequence that fulfils the function of a 3'-UTR.
- the term "5'-UTR element” refers to a nucleic acid sequence which comprises or consists of a nucleic acid sequence that is derived from a 5'-UTR or from a variant or a fragment of a 5'-UTR.
- a "5'-UTR element” preferably refers to a nucleic acid sequence which is comprised by a 5'-UTR of an artificial nucleic acid sequence, such as an artificial mRNA.
- a 5'-UTR element may be comprised by the 5'-UTR of an mRNA, preferably of an artificial mRNA, or a 5'- UTR element may be comprised by the 5'-UTR of the respective transcription template.
- a 5'-UTR element is a nucleic acid sequence which corresponds to the 5'-UTR of an mRNA, preferably to the 5'-UTR of an artificial mRNA, such as an mRNA obtained by transcription of a genetically engineered vector construct.
- a 5'-UTR element in the sense of the present invention functions as a 5'-UTR or codes for a nucleotide sequence that fulfils the function of a 5'-UTR.
- the 3'-UTR element and/or the 5'-UTR element in the artificial nucleic acid molecule according to the present invention provides high translation efficiency to said artificial nucleic acid molecule.
- the artificial nucleic acid molecule according to the present invention may in particular comprise:
- the artificial nucleic acid molecule according to the present invention comprises a 3'-UTR element which provides high translation efficiency to said artificial nucleic acid molecule and/or a 5'-UTR element which provides high translation efficiency to said artificial nucleic acid molecule.
- the artificial nucleic acid molecule according to the present invention comprises at least one 3'-UTR element and at least one 5'-UTR element, i.e. at least one 3'-UTR element which provides high translation efficiency to said artificial nucleic acid molecule and at least one 5'-UTR element which provides high translation efficiency to said artificial nucleic acid molecule.
- said at least one 3'-UTR element which provides high translation efficiency to said artificial nucleic acid molecule or said at least one 5'-UTR element which provides high translation efficiency to said artificial nucleic acid molecule can be selected from naturally occurring (preferably heterologous) 3'-UTR elements and 5'- UTR elements (together naturally occurring UTR elements or wild-type UTR elements), and from artificial 3'-UTR elements and artificial 5'-UTR elements (together artificial UTR elements).
- Wild-type UTR elements can be selected from the group comprising wild-type UTR elements published in the literature and in publically accessible databases, such as GenBank (NCBI), and wild-type UTR elements not previously published.
- the latter can be identified by sequencing mRNas found in cells, preferably mammalian cells. Using this approach, the present inventors identified several wild-type UTR elements not previously published, and UTR elements of this type are provided in the present invention.
- the term artificial UTR element is not particularly limited and can refer to any nucleic acid sequence not found in nature, i.e. nonidentical to a wild-type UTR element.
- the artificial UTR element used in the present invention is a nucleic acid sequence which shows a certain degree of sequence identity to a wild-type UTR element, such as 10 to 99.9 %, 20 to 99 %, 30 to 98 %, 40 to 97 %, 50 to 96 %, 60 to 95 %, 70 to 90 %.
- artificial UTR used in the present invention is identical to a wild-type UTR except that one, or two, or three, or four, or five, or more than five nucleotides have been substituted by the same number of nucleotides (e.g. one nucleotide being substituted by one nucleotide).
- substitution of one nucleotide is a substitution by the respective complementary nucleotide.
- Preferred artificial UTR elements correspond to wild-type UTR elements, except that (i) some or all ATG triplets in a wild- type 5'-UTR element (if present) are converted to the triplet TAG; and/or (ii) selected cleavage site(s) for a particular restriction enzyme in a wild-type 5'-UTR element or in a in a wild-type 3'-UTR element (if present) are eliminated by substituting one nucleotide within the cleavage site for said specific restriction enzyme by the complementary nucleotide, thereby removing the cleavage sites for said specific restriction enzyme.
- UTR element comprises a cleavage site for said specific restriction enzyme, and when said particular restriction enzyme is (planned to be) used in subsequent cloning steps. Since such internal cleavage of 5'-UTR elements and 3'-UTR elements is undesired, an artificial UTR element can be generated in which the restriction cleavage site for said specific restriction enzyme is eliminated. Such substitution can be done by any suitable method known to the person skilled in the art, e.g. use of modified primers by PCR.
- the artificial nucleic acid molecule according to the present invention comprises at least one 3'-UTR element and at least one 5'-UTR element, i.e. at least one 3'- UTR element which prolongs and/or increases protein production from said artificial nucleic acid molecule and at least one 5'-UTR element which prolongs and/or increases protein production from said artificial nucleic acid molecule.
- Protein production Assay for determining whether protein production is prolonged and/or increased
- “Prolonging and/or increasing protein production from said artificial nucleic acid molecule” in general refers to the amount of protein produced from the artificial nucleic acid molecule according to the present invention with the respective 3'-UTR element and/or the 5'-UTR element in comparison to the amount of protein produced from a respective reference nucleic acid lacking a 3'-UTR and/or a 5'-UTR or comprising a reference 3'-UTR and/or a reference 5'-UTR, such as a 3'-UTR and/or a 5'-UTR naturally occurring in combination with the ORF.
- the at least one 3'-UTR element and/or the 5'-UTR element of the artificial nucleic acid molecule according to the present invention prolongs protein production from the artificial nucleic acid molecule according to the present invention, e.g. from an mRNA according to the present invention, compared to a respective nucleic acid lacking a 3'-UTR and/or 5'-UTR or comprising a reference 3'-UTR and/or 5'-UTR, such as a 3'- and/or 5'-UTR naturally occurring in combination with the ORF.
- the at least one 3'-UTR element and/or 5'-UTR element of the artificial nucleic acid molecule according to the present invention increases protein production, in particular the protein expression and/or total protein production, from the artificial nucleic acid molecule accordi ng to the present i nvention, e.g. from an mRNA according to the present invention, compared to a respective nucleic acid lacking a 3'- and/or 5'-UTR or comprisi ng a reference 3'- and/or 5'-UTR, such as a 3'- and/or 5'-UTR naturally occurring in combi nation with the ORF.
- the at least one 3 '-UTR element and/or the at least one 5'-UTR element of the artificial nucleic acid molecule according to the present invention do not negatively influence translational efficiency of a nucleic acid compared to the translational efficiency of a respective nucleic acid lacki ng a 3'-UTR and/or a 5'-UTR or comprising a reference 3'- UTR and/or a reference 5'-UTR, such as a 3'-UTR and/or a 5'-UTR natural ly occurring in combi nation with the ORF.
- the translation efficiency is enhanced by the 3'- UTR and/or a 5'-UTR in comparison to the translation efficiency of the protei n encoded by the respective ORF i n its natural context.
- nucleic acid molecule or “reference nucleic acid molecule” as used herein means that - apart from the different 3'-UTRs and/or 5'-UTRs - the reference nucleic acid molecule is comparable, preferably identical, to the artificial nucleic acid molecule of the invention comprising the 3'-UTR element and/or the 5'-UTR element.
- n i .e. in vitro referring to ("living") cells and/or tissue, includi ng tissue of a livi ng subject; cells include in particular cell l i nes, primary cel ls, cel ls in tissue or subjects, preferred are mammalian cel ls, e.g.
- human cel ls and mouse cells and particularly preferred are the human cel l l i nes HeLa, HEPG2 and U-937 and the mouse cell l ines NIH3T3, JAWSII and L929, furthermore primary cel ls are particularly preferred, i n particular preferred embodiments human dermal fibroblasts (HDF) by the inventive artificial nucleic acid molecule, the expression of the encoded protein is determined following injection/transfection of the inventive artificial nucleic acid molecule into target cells/tissue and compared to the protein expression induced by the reference nucleic acid. Quantitative methods for determining protein expression are known in the art (e.g. Western-Blot, FACS, ELISA, mass spectrometry).
- an artificial nucleic acid according to the invention or a reference nucleic acid is introduced into the target tissue or cell, e.g. via transfection or injection, preferably in a mammalian expression system, such as in mammalian cells, e.g. in HDF, L929, HepG2 and/or Hela cells.
- a target cel l sample is collected and measured via FACS and/or lysed. Afterwards the lysates can be used to detect the expressed protein (and thus determine the efficiency of protein expression) using several methods, e.g. Western-Blot, FACS, ELISA, mass spectrometry or by fluorescence or luminescence measurement.
- the protein expression from an artificial nucleic acid molecule according to the invention is compared to the protein expression from a reference nucleic acid molecule at a specific point in time (e.g. 6, 1 2, 24, 48 or 72 hours post initiation of expression or post introduction of the nucleic acid molecule), both nucleic acid molecules are introduced separately into target tissue/cells, a sample from the tissue/cells is collected after a specific point in time, protein lysates are prepared according to the particular protocol adjusted to the particular detection method (e.g. Western Blot, ELISA, fluorescence or luminescence measurement, etc. as known in the art) and the protein is detected by the chosen detection method.
- a specific point in time e.g. 6, 1 2, 24, 48 or 72 hours post initiation of expression or post introduction of the nucleic acid molecule
- polystyrene end products may also be determined by using FACS analysis.
- the term "prolonging protein production" from an artificial nucleic acid molecule such as an artificial mRNA preferably means that the protein production from the artificial nucleic acid molecule such as the artificial mRNA is prolonged compared to the protein production from a reference nucleic acid molecule such as a reference mRNA, e.g.
- protein produced from the artificial nucleic acid molecule such as the artificial mRNA is observable for a longer period of time than what may be seen for a protein produced from a reference nucleic acid molecule.
- the amount of protein produced from the artificial nucleic acid molecule such as the artificial mRNA measured at a later point in time, e.g.
- the amount of protein produced from a reference nucleic acid molecule such as a reference mRNA at a corresponding later point in time is larger than the amount of protein produced from a reference nucleic acid molecule such as a reference mRNA at a corresponding later point in time.
- a reference nucleic acid molecule such as a reference mRNA
- Such a "later point in time” may be, for example, any time beyond 24 hours post initiation of expression, such as post transfection of the nucleic acid molecule, e.g. 36, 48, 60, 72, 96 hours post initiation of expression, i.e. after transfection.
- the amount of protein produced at a later point in time may be normalized to the amount produced an earlier (reference) point in time, for example the amount of protein at a later point in time may be expressed as percentage of the amount of protein at 24 h after transfection.
- an encoded reporter protein such as luciferase
- a mammalian expression system such as in HDF, L929, HEP2G or HeLa cells
- a protein which is expressed at ti in an amount of "80", at ti in an amount of "20", and at t 3 in an amount of "10" the relative amount of protein at t 2 would be 25%, and at h 12,5%.
- These relative amounts at a later point in time may then be compared in a step (iv) to relative protein amounts for the corresponding points in time for a nucleic acid molecule lacking a 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively.
- nucleic acid molecule lacking a 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively, a factor may be determined by which the protein production from the artificial nucleic acid molecule according to the present invention is prolonged compared to the protein production from the reference nucleic acid molecule.
- the at least one 3'- and/or 5'-UTR element in the artificial nucleic acid molecule according to the invention prolongs protei n production from said artificial nucleic acid molecule at least 1 .2 fold, preferably at least 1 .5 fold, more preferably at least 2 fold, even more preferably at least 2.5 fold, compared to the protein production from a reference nucleic acid molecule lacking 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively.
- the (relative) amount of protein produced from the artificial nucleic acid molecule accordi ng to the invention at a certain later point in time as described above is increased by a factor of at least 1 .2, preferably at least 1 .5, more preferably at least 2, even more preferably at least 2.5, compared to the (relative) amount of protein produced from a reference nucleic acid molecule, which is e.g. lacki ng a 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively, for the same later point in time.
- the effect of prolongi ng protein production may also be determined by (i) measuring protein amounts, e.g. obtained by expression of an encoded reporter protein such as luciferase, preferably in a mammal ian expression system such as i n H DF, L929, HEP2G or HeLa cel ls, over time, (i i) determining the point in time at which the protein amount undercuts the amount of protein observed, e.g., at 1 , 2, 3, 4, 5, or 6 hours post initiation of expression, e.g.
- an encoded reporter protein such as luciferase
- a mammal ian expression system such as i n H DF, L929, HEP2G or HeLa cel ls
- the protei n production from the artificial nucleic acid molecule such as the artificial mRNA - in an amount which is at least the amount observed in the i nitial phase of expression, such as 1 , 2, 3, 4, 5, or 6 hours post initiation of expression, such as post transfection of the nucleic acid molecule - is prolonged by at least about 5 hours, preferably by at least about 1 0 hours, more preferably by at least about 24 hours compared to the protei n production from a reference nucleic acid molecule, such as a reference mRNA, i n a mammal ian expression system, such as in mammal ian cells, e.g. in HDF, L929, HEP2G or HeLa cel ls.
- the artificial nucleic acid molecule according to the present invention preferably allows for prolonged protein production in an amount which is at least the amount observed in the initial phase of expression, such as 1 , 2, 3, 4, 5, or 6 hours post initiation of expression, such as post transfection, by at least about 5 hours, preferably by at least about 10 hours, more preferably by at least about 24 hours compared to a reference nucleic acid molecule lacking a 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively.
- the period of protein production from the artificial nucleic acid molecule according to the present invention is extended at least 1 .2 fold, preferably at least 1 .5 fold, more preferably at least 2 fold, even more preferably at least 2.5 fold, compared to the protein production from a reference nucleic acid molecule lacki ng a 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively.
- this prolonging effect on protein production is achieved, whi le the total amount of protein produced from the artificial nucleic acid molecule accordi ng to the present invention, e.g. withi n a time span of 48 or 72 hours, corresponds at least to the amount of protein produced from a reference nucleic acid molecule lacking a 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively, such as a 3'-UTR and/or 5'-UTR naturally occurring with the ORF of the artificial nucleic acid molecule.
- the present invention provides an artificial nucleic acid molecule which allows for prolonged protein production in a mammal ian expression system, such as i n mammalian cel ls, e.g. in H DF, L929, HEP2G or HeLa cel ls, as specified above, wherein the total amount of protein produced from said artificial nucleic acid molecule, e.g. within a time span of 48 or 72 hours, is at least the total amount of protei n produced, e.g.
- n said time span, from a reference nucleic acid molecule lacking a 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively, such as a 3'- and/or 5'-UTR naturally occurring with the ORF of the artificial nucleic acid molecule.
- prolonged protei n expression also includes “stabi lized protein expression", whereby "stabi lized protein expression” preferably means that there is more uniform protein production from the artificial nucleic acid molecule according to the present invention over a predetermined period of time, such as over 24 hours, more preferably over 48 hours, even more preferably over 72 hours, when compared to a reference nucleic acid molecule, for example, an mRNA comprising a reference 3'- and/or 5'-UTR, respectively, or lacking a 3'- and/or 5'-UTR, respectively.
- the level of protein production e.g. in a mammalian system, from the artificial nucleic acid molecule comprising a 3'- and/or 5'-UTR element according to the present invention, e.g. from an mRNA according to the present invention, preferably does not drop to the extent observed for a reference nucleic acid molecule, such as a reference mRNA as described above.
- a reference nucleic acid molecule such as a reference mRNA as described above.
- 24 hours post transfection of the artificial nucleic acid molecule according to the present invention into a cell may be compared to the amount of protein observed 48 hours after initiation of expression, e.g. 48 hours post transfection.
- the ratio of the amount of protein encoded by the ORF of the artificial nucleic acid molecule according to the present invention such as the amount of a reporter protein, e.g., luciferase, observed at a later point in time, e.g. 48 hours, post initiation of expression, e.g. post transfection, to the amount of protein observed at an earlier point in time, e.g. 24 hours, post initiation of expression, e.g.
- the ratio of the amount of protein encoded by the ORF of the artificial nucleic acid molecule according to the present invention such as the amount of a reporter protein, e.g., luciferase, observed at a later point in time, e.g. 48 hours, post initiation of expression, e.g. post transfection, to the amount of protein observed at an earlier point in time, e.g. 24 hours, post initiation of expression, e.g.
- telomere length is preferably at least 0.2, more preferably at least about 0.3, even more preferably at least about 0.4, even more preferably at least about 0.5, and particularly preferably at least about 0.7.
- a respective reference nucleic acid molecule e.g. an mRNA comprising a reference 3'- and/or 5'-UTR, respectively, or lacking a 3'- and/or 5'-UTR, respectively
- said ratio may be, for example between about 0.05 and about 0.35.
- the present invention provides an artificial nucleic acid molecule comprising an ORF and a 3'- and/or 5'-UTR element as described above, wherein the ratio of the protein amount, e.g. the amount of luciferase, observed 48 hours after initiation of expression to the protein amount observed 24 hours after initiation of expression, preferably in a mammalian expression system, such as in mammalian cells, e.g. in HDF cells or in HeLa cells, is preferably at least 0.2, more preferably at least about 0.3, more preferably at least about 0.4, even more preferably at least about 0.5, even more preferably at least about 0.6, and particularly preferably at least about 0.7.
- a mammalian expression system such as in mammalian cells, e.g. in HDF cells or in HeLa cells
- the total amount of protein produced from said artificial nucleic acid molecule corresponds at least to the total amount of protein produced, e.g. within said time span, from a reference nucleic acid molecule lacking a 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively, such as a 3'-UTR and/or 5'-UTR naturally occurring with the ORF of the artificial nucleic acid molecule.
- the present invention provides an artificial nucleic acid molecule comprising an ORF and a 3'-UTR element and/or a 5'-UTR element as described above, wherein the ratio of the protein amount, e.g. the amount of luciferase, observed 72 hours after initiation of expression to the protein amount observed 24 hours after initiation of expression, preferably in a mammalian expression system, such as in mammalian cells, e.g. in HeLa cells or HDF cells, is preferably above about 0.05, more preferably above about 0.1 , more preferably above about 0.2, even more preferably above about 0.3, wherein preferably the total amount of protein produced from said artificial nucleic acid molecule, e.g.
- a reference nucleic acid molecule lacking a 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively, such as a 3'- and/or 5'-UTR naturally occurring with the ORF of the artificial nucleic acid molecule.
- “Increased protein expression” or “enhanced protein expression” in the context of the present invention preferably means an increased/enhanced protein expression at one point in time after initiation of expression or an increased/enhanced total amount of expressed protein compared to the expression induced by a reference nucleic acid molecule.
- the protein level observed at a certain point in time after initiation of expression, e.g. after transfection, of the artificial nucleic acid molecule according to the present invention e.g. after transfection of an mRNA according to the present invention, for example, 6, 12, 24, 48 or 72 hours post transfection, is preferably higher than the protein level observed at the same point in time after initiation of expression, e.g.
- the maximum amount of protein (as determined e.g. by protein activity or mass) expressed from the artificial nucleic acid molecule is increased with respect to the protein amount expressed from a reference nucleic acid comprising a reference 3'- and/or 5'-UTR, respectively, or lacking a 3'- and/or 5'-UTR, respectively.
- Peak expression levels are preferably reached within 48 hours, more preferably within 24 hours and even more preferably within 12 hours after, for instance, transfection.
- the term "increased total protein production” or “enhanced total protein production” from an artificial nucleic acid molecule according to the invention refers to an increased/enhanced protein production over a time span, in which protein is produced from an artificial nucleic acid molecule, e.g. 48 hours or 72 hours, preferably in a mammalian expression system, such as in mammalian cells, e.g. in HDF, L929, HEP2G or HeLa cells in comparison to a reference nucleic acid molecule lacking a 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively.
- the cumulative amount of protein expressed over time is increased when using the artificial nucleic acid molecule according to the invention.
- the total amount of protein for a specific time period may be determined by (i) collecting tissue or cells at several points in time after introduction of the artificial nucleic acid molecule (e.g. 6, 12, 24, 48 and 72 hours post initiation of expression or post introduction of the nucleic acid molecule), and the protein amount per point in time can be determined as explained above.
- a mathematical method of determining the total amount of protein can be used, e.g. the area under the curve (AUC) can be determined according to the following formula:
- total protein production preferably refers to the area under the curve (AUC) representing protein production over time.
- the at least one 3'- or 5'-UTR element according to the present invention increases protein production from said artificial nucleic acid molecule at least 1 .5 fold, preferably at least 2 fold, more preferably at least 2.5 fold, compared to the protein production from a reference nucleic acid molecule lacking a 3'- and/or 5'-UTR, respectively.
- post transfection is increased by a factor of at least 1 .5, preferably at least 2, more preferably at least 2.5, compared to the (relative) amount of protein produced from a reference nucleic acid molecule, which is e.g. lacking a 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively, for the corresponding later point in time.
- a reference nucleic acid molecule which is e.g. lacking a 3'- and/or 5'-UTR, respectively, or comprising a reference 3'- and/or 5'-UTR, respectively, for the corresponding later point in time.
- the mRNA and/or protein production prolonging effect and efficiency and/or the protein production increasing effect and efficiency of the variants fragments and/or variant fragments of the 3'-UTR and/or the 5'-UTR as well as the mRNA and/or protein production prolonging effect and efficiency and/or the protein production increasing effect and efficiency of the at least one 3'-UTR element and/or the at least one 5'-UTR element of the artificial nucleic acid molecule according to the present invention may be determined by any method suitable for this purpose known to ski lled person.
- artificial mRNA molecules may be generated comprising a coding sequence/open reading frame (ORF) for a reporter protein, such as luciferase, and a 3'-UTR element according to the present invention, i.e. which prolongs and/or increases protein production from said artificial mRNA molecule.
- a reporter protein such as luciferase
- a 3'-UTR element according to the present invention, i.e. which prolongs and/or increases protein production from said artificial mRNA molecule.
- inventive mRNA molecule may further comprise a 5'-UTR element according to the present invention, i.e. which prolongs and/or increases protein production from said artificial mRNA molecule, no 5'-UTR element or a 5'-UTR element which is not according to the present invention, e.g. a reference 5'-UTR.
- artificial mRNA molecules may be generated comprising a coding sequence/open reading frame (ORF) for a reporter protein, such as luciferase, and a 5'-UTR element according to the present invention, i.e. which prolongs and/or increases protein production from said artificial mRNA molecule.
- a reporter protein such as luciferase
- a 5'-UTR element according to the present invention
- such an inventive mRNA molecule may further comprise a 3'-UTR element according to the present invention, i.e. which prolongs and/or increases protein production from said artificial mRNA molecule, no 3'-UTR element or a 3'-UTR element which is not according to the present invention, e.g. a reference 3'-UTR.
- mRNAs may be generated, for example, by in vitro transcription of respective vectors such as plasmid vectors, e.g. comprising a T7 promoter and a sequence encoding the respective mRNA sequences.
- the generated mRNA molecules may be transfected into cells by any transfection method suitable for transfecting mRNA, for example they may be lipofected into mammalian cells, such as HeLa cells or HDF cells, and samples may be analyzed certain points in time after transfection, for example, 6 hours, 24 hours, 48 hours, and 72 hours post transfection. Said samples may be analyzed for mRNA quantities and/or protein quantities by methods well known to the skilled person.
- the quantities of reporter mRNA present in the cells at the sample points in time may be determined by quantitative PCR methods.
- the quantities of reporter protein encoded by the respective mRNAs may be determined, e.g., by Western Blot, ELISA assays, FACS analysis or reporter assays such as luciferase assays depending on the reporter protein used.
- the effect of stabilizing protein expression and/or prolonging protein expression may be, for example, analyzed by determining the ratio of the protein level observed 48 hours post transfection and the protein level observed 24 hours post transfection. The closer said value is to 1 , the more stable the protein expression is within this time period. Such measurements may of course also be performed at 72 or more hours and the ratio of the protein level observed 72 hours post transfection and the protein level observed 24 hours post transfection may be determined to determine stability of protein expression.
- Translation Efficiency Assay for determi ning translation efficiency
- translation efficiency is a property of a nucleic acid molecule (e.g. m NA) comprising an open reading frame (ORF) and is typical ly provided by a specific UTR element (a specific 5'-UTR element or a specific 3'-UTR element) comprised in the nucleic acid molecule.
- Translation efficiency is typical ly measured by means of the quantity of protei n translated from the ORF.
- the present invention provides general methods as wel l as a specific assay.
- the translation efficiency of various, e.g. two or more, nucleic acid molecules can be compared, e.g. by experimental quantification of protein encoded by the ORF.
- cel l-based methods are employed. Translation efficiency is experimentally tested in vivo or in vitro as defined herein (i.e. in vitro referring to ("livi ng") cel ls and/or tissue, i ncluding tissue of a livi ng subject; cel ls i nclude in particular cell l ines, primary cel ls, cel ls in tissue or subjects, preferred are mammalian cells, e.g.
- human cel ls and mouse cel ls and particularly preferred are the human cell l ines HeLa, HEPG2 and U-937 and the mouse cel l lines NIH3T3, JAWSII and L929, furthermore primary cells are particularly preferred, in particular preferred embodiments human dermal fibroblasts (HDF) by the inventive artificial nucleic acid molecule, the expression of the encoded protein is determined followi ng injection/transfection of the i nventive artificial nucleic acid molecule into target cel ls/tissue and compared to the protei n expression induced by the reference nucleic acid. Quantitative methods for determining protein expression are known in the art (e.g. Western-Blot, FACS, ELISA, mass spectrometry).
- an artificial nucleic acid according to the invention or a reference nucleic acid is i ntroduced into the target tissue or cel l, e.g. via transfection or injection, preferably in a mammalian expression system, such as in mammalian cells, e.g. in H DF, L929, HepG2 and/or Hela cells.
- a mammalian expression system such as in mammalian cells, e.g. in H DF, L929, HepG2 and/or Hela cells.
- a target cel l sample is col lected and measured via FACS and/or lysed. Afterwards the lysates can be used to detect the expressed protein (and thus determine the translation efficiency) using several methods, e.g. Western-Blot, FACS, ELISA, mass spectrometry or by fluorescence or lumi nescence measurement. Therefore, if the protein expression from an artificial nucleic acid molecule according to the invention is compared to the protein expression from a reference nucleic acid molecule at a specific poi nt in time (e.g.
- both nucleic acid molecules are i ntroduced separately into target tissue/cells, a sample from the tissue/cel ls is collected after a specific point i n time, protein lysates are prepared according to the particular protocol adjusted to the particular detection method (e.g. Western Blot, ELISA, fluorescence or luminescence measurement, etc. as known i n the art) and the protei n is detected by the chosen detection method.
- the particular detection method e.g. Western Blot, ELISA, fluorescence or luminescence measurement, etc. as known i n the art
- the high translation efficiency is provided to the artificial nucleic acid molecule of the present invention by the at least one 3'-untranslated region element (3'-UTR element) and/or the at least one 5'-untranslated region element (5'-UTR element), "provided by” means that in the absence of the at least one 3'-untranslated region element (3'-UTR element) and/or the at least one 5'-untranslated region element (5'-UTR element), the translation efficiency is not high, as defined herein.
- high translation efficiency can be used to compare the translation efficiency of an artificial nucleic acid molecule of the present i nvention to a reference nucleic acid molecule.
- reference nucleic acid molecule as used herein means that - apart from the different 3'-UTRs and/or 5'-UTRs - the reference nucleic acid molecule is comparable, preferably identical, to the artificial nucleic acid molecule of the invention comprising the 3'-UTR element and/or the 5'-UTR element.
- the translation efficiency of the artificial nucleic acid molecule can be compared to the translation efficiency of a reference nucleic acid molecule.
- a respective method for comparing the translation efficiency is provided herei n.
- one of the parallel experiments relates to a reference nucleic acid molecule (which may be wild-type or artificial), and the other one relates to an artificial nucleic molecule (also termed subject nucleic acid molecule.
- This method allows for comparing whether the subject nucleic acid molecule is characterized by high translation efficiency; i.e. whether it is an artificial nucleic acid molecule according to the present invention.
- Particular aspects of the method for comparing the translation efficiency are the following:
- the reference nucleic acid molecule comprises at least one open reading frame (ORF), which is identical to the at least one open reading frame (ORF) of the artificial nucleic acid molecule; and the reference nucleic acid molecule does not comprise at least one 3'-untranslated region element (3'-UTR element) of the artificial nucleic acid molecule and/or at least one 5'-untranslated region element (5'-UTR element) of the artificial nucleic acid molecule.
- ORF open reading frame
- the translation efficiency of the artificial nucleic acid molecule and the translation efficiency of the reference nucleic acid molecule are compared by a method comprising the steps: (i) transfecting mammalian cells with the artificial nucleic acid molecule and measuring expressed amounts of the protein encoded by the ORF of the artificial nucleic acid molecule at a certain point in time after transfection (e.g. 24 or 48 h),
- a factor may be determined by which the translation efficiency of the artificial nucleic acid molecule according to the present invention is increased compared to the translation efficiency of the reference nucleic acid molecule.
- after transfection is used to refer to the point in time at which the cells have been transfected with the subject nucleic acid molecule and the reference nucleic acid molecule.
- the at least one 3'- and/or 5'-UTR element in the artificial nucleic acid molecule according to the invention increases translation efficiency of said artificial nucleic acid molecule at least 1 .2 fold, preferably at least 1 .5 fold, more preferably at least 2 fold, even more preferably at least 2.5 fold, compared to the protein production from a reference nucleic acid molecule comprising a reference 3'- and/or 5'-UTR, respectively (i.e. the ratio calculated in (iii) is at least 1 .2, preferably at least 1 .5, more preferably at least 2, even more preferably at least 2.5).
- the translation efficiency is increased by a factor of at least 1 .2, preferably at least 1 .5, more preferably at least 2, even more preferably at least 2.5, compared to the translation efficiency of a reference nucleic acid molecule, for the same point in time.
- the high translation efficiency is conferred by the 5'-UTR or by the 3'-UTR by which the subject nucleic acid molecule differs from the reference nucleic acid molecule.
- the reference nucleic acid molecule comprises at a 3'-UTR element which is not present in the artificial nucleic acid molecule, or (ii) the reference nucleic acid molecule comprises a 5'-UTR element which is not present in the artificial nucleic acid molecule.
- the reference nucleic acid molecule comprises at a 3'-UTR element which is derived from a 3'-UTR of an albumin gene, preferably a 3'-UTR corresponding to the sequence according to SEQ ID NO: 207, or (ii) the reference nucleic acid molecule comprises a 5'-UTR element which is derived from a 5'-UTR of a TOP gene, preferably a 5'-UTR of human ribosomal protein Large 32 lacking the 5' terminal oligopyrimidine tract, preferably a 5'-UTR corresponding to the sequence according to SEQ ID NO: 208.
- the reference nucleic acid molecule does not comprise any 3'-untranslated region element (3'-UTR element), or (ii) the reference nucleic acid molecule does not comprise any 5'-untranslated region element (5'-UTR element).
- the cells used in the step of transfection of the artificial nucleic acid molecule and the reference nucleic acid molecule are mammalian cells, preferably selected from the group of HDF, L929, HEP2G and HeLa cells. It can further be preferred that the method is carried out in parallel in more than one type of mammalian cells, such as in parallel in a combination of any two, preferably any three, more preferably all four of the above cell lines.
- a subject nucleic acid molecule can be considered to be characterized by high translation efficiency when the ratio calculated in step (iii) is > 1 , preferably > 1 , in at least one type of mammalian cells used.
- a subject nucleic acid molecule is considered to be characterized by high translation efficiency when the ratio calculated in step (iii) is > 1 , preferably > 1 , in at least two types, such as at least three types, such as four types, of mammalian cells used.
- the expressed amounts of the protein encoded by the ORF of the artificial nucleic acid molecule and the reference nucleic acid molecule are measured at a certain point in time after transfection (e.g. 12 h, 24 h, 36 h, 48 h or 72 h). Preferably the expressed amounts of the protein encoded by the ORF are measured 24 h after transfection.
- the present invention also provides a specific preferred reference construct that can be used in the method of the present invention.
- the reference nucleic acid molecule is an mRNA of SEQ ID NO: 205 ( Figure 1 A).
- the reference nucleic acid molecule differs from the artificial nucleic acid molecule only in that the at least one 3'-UTR element is replaced by at least one other 3'- UTR element (preferably one 3'-UTR element) or in that at least one 5'-UTR element is replaced by at least one other 5'-UTR element (preferably one 5'-UTR element). In either case, this allows for directly testing whether said other 3'-UTR element or other 5'-UTR element, respectively, provides high translation efficiency.
- the cells are mammalian cells which are selected from the group of HDF, L929, HEP2G and HeLa cells;
- the reference nucleic acid molecule is an mRNA of SEQ ID NO: 205 ( Figure 1 A); and preferably, (d) the reference nucleic acid molecule differs from the artificial nucleic acid molecule only in that (i) the at least one 3'-UTR element (preferably one 3'-UTR element) is replaced by at least one other 3'-UTR element (preferably one 3'-UTR element), or (ii) the at least one 5'-UTR element (preferably one 5'-UTR element)) is replaced by at least one other 5'-UTR element (preferably one 5'-UTR element); in other words, the subject nucleic acid molecule is identical to the reference nucleic acid molecule, except that at least one 5'-UTR element differs from the 5'-UTR shown in Figure 1 A, or that the at least one 3'-UTR element differs from the 3'-UTR shown in Figure 1 A.
- An example of 5'-UTR element replacement is shown in Figure 1 B; an example of 3'-UTR
- the method is also referred to as "standardized assay for determining translation efficiency", or simply “assay for determining translation efficiency”. It is particularly preferred that an artificial nucleic acid molecule of the invention is characterized by high translation efficiency as determinable by this standard assay for determining translation efficiency. This standard assay allows for the straightforward identification of particularly advantageous artificial nucleic acid molecules.
- the standard assay was used in Example 3 of the present invention. Thereby, the present inventors found that a group of new artificial nucleic acids shares the advantageous feature of high translation efficiency, i.e. higher than the translation efficiency of the reference nucleic acid molecule of Figure 1 A, see Example 3.5.
- said reference nucleic acid molecule comprises a 3'-UTR element which is derived from a 3'-UTR of an albumin gene (a 3'-UTR corresponding to the DNA sequence according to SEQ I D NO: 207), and a 5'- UTR element which is derived from a 5'-UTR of a TOP gene, particularly a 5'-UTR of human ribosomal protein Large 32 lacking the 5' terminal oligopyrimidine tract (a 5'-UTR corresponding to the DNA sequence according to SEQ I D NO: 208).
- Such 3'-UTR elements and 5'-UTR elements are known to be advantageous in the context of protein translation in a cell (for a 3'-UTR derived from an albumin gene, see W0201 3/1 43700; for a 5'-TOP- UTR, see W0201 3/1 43700).
- the present invention provides a further improvement.
- the ORF of the artificial nucleic acid molecule encodes a protein that can be quantified, preferably a reporter protein. These embodiments are very suitable in the method for comparing the translation efficiency according to the present invention.
- the ORF of the artificial nucleic acid molecule does not encode a protei n that can be quantified, preferably a reporter protei n.
- usi ng an ORF of the artificial nucleic acid molecule encodes a protein that can be quantified, to provide high translation efficiency, said 5'-UTR or a 3'-UTR can be recombined with any ORF.
- the ORF encodes a reporter protein
- artificial nucleic acids of the present i nvention are not l imited to the ORF used in the standardized assay.
- an artificial nucleic acid molecule which has been been determined by the method herein to be characterized by high translation efficiency, can itself be used as "reference construct" for a subsequent round of the method herein.
- This enables testing whether yet further artificial nucleic acid molecule is characterized by even higher translation efficiency (or whether a UTR comprised i n the further artificial nucleic acid molecule provides even higher translation efficiency).
- This enables the identification of even further improved artificial nucleic acid molecules and UTRs.
- the at least one 3'-UTR element and/or the at least one 5'-UTR element in the artificial nucleic acid molecule according to the present invention is derived from a stable mRNA.
- "derived" from a stable mRNA means that the at least one 3'- UTR element and/or the at least one 5'-UTR element shares at least 50%, preferably at least 60%, preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, even more preferably at least 95%, and particularly preferably at least 98% sequence identity with a 3'-UTR element and/or a 5'-UTR element of a stable mRNA.
- the stable mRNA is a naturally occurring mRNA and, thus, a 3'-UTR element and/or a 5'-UTR element of a stable mRNA refers to a 3'-UTR and/or a 5'-UTR, or fragments or variants thereof, of naturally occurring mRNA.
- a 3'-UTR element and/or a 5'-UTR element derived from a stable mRNA preferably also refers to a 3'-UTR element and/or a 5'-UTR element, which is modified in comparison to a naturally occurring 3'-UTR element and/or 5'-UTR element, e.g. in order to increase RNA stability even further and/or to prolong and/or increase protein production.
- RNA stability e.g. in comparison to a naturally occurring (non-modified) 3'-UTR element and/or 5'-UTR element.
- mRNA refers to an mRNA molecule, however, it may also refer to an mRNA species as defined herein.
- the stability of mRNA is assessed under standard conditions, for example standard conditions (standard medium, incubation, etc.) for a certain cell line used.
- standard conditions standard medium, incubation, etc.
- stable mRNA refers in general to an mRNA having a slow mRNA decay.
- a “stable mRNA” has typically a long half-life.
- the half-life of an mRNA is the the time required for degrading 50% of the in vivo or in vitro existing mRNA molecules.
- stability of mRNA is usually assessed in vivo or in vitro.
- in vitro refers in particular to ("living") cells and/or tissue, including tissue of a living subject.
- Cells include in particular cell lines, primary cells, cells in tissue or subjects.
- cell types al lowing cell culture may be suitable for the present invention.
- Particularly preferred are mammalian cells, e.g. human cells and mouse cells.
- the human cell lines HeLa, HEPG2 and U-937 and the mouse cell lines NIH3T3, JAWSII and L929 are used.
- primary cells are particularly preferred, in particular preferred embodiments human dermal fibroblasts (HDF) may be used.
- HDF human dermal fibroblasts
- the half-life of a "stable mRNA" is at least 5 h, at least 6 h, at least 7 h, at least 8 h, at least 9 h, at least 10 h, at least 1 1 h, at least 12 h, at least 13 h, at least 14 h, and/or at least 1 5 h.
- the half-life of an mRNA of interest may be determined by different methods known to the person skilled in the art.
- the half-life of an mRNA of interest is determined by determining the decay constant, whereby usually an ideal in vivo (or in vitro as defined above) situation is assumed, in which transcription of the mRNA of interest can be "turned off" completely (or at least to an undetectable level). In such an ideal situation it is usually assumed that mRNA decay follows first-order kinetics. Accordingly, the decay of an mRNA may usually be described by the following equation:
- A(t) Ao * e Xt with Ao being the amount (or concentration) of the mRNA of interest at time 0, i.e. before the decay starts, A(t) being the amount (or concentration) of the mRNA of interest at a time t during decay and ⁇ being the decay constant.
- the decay constant ⁇ may be calculated.
- the amount or concentration of the mRNA is determined during the RNA decay process in vivo (or in vitro as defined above).
- various methods may be used, which are known to the ski lled person. Non-limiting examples of such methods include general inhibition of transcription, e.g. with a transcription inhibitor such as actinomycin D, use of inducible promotors to specifically promote transient transcription, e.g.
- c-fos serum-inducible promotor system and Tet-off regulatory promotor system and kinetic labelling techniques, e.g. pulse labelling, for example by 4-thiouridine (4sU), 5-Ethynyluridine (EU) or 5'-bromo-uridine (BrU).
- 4-thiouridine (4sU) 4-thiouridine
- EU 5-Ethynyluridine
- BaU 5'-bromo-uridine
- a "stable mRNA" in the sense of the present invention has a slower mRNA decay compared to average mRNA, preferably assessed in vivo (or in vitro as defined above).
- "average mRNA decay” may be assessed by investigating mRNA decay of a plurality of mRNA species, preferably 1 00, at least 300, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10000, at least 1 1000, at least 12000, at least 1 3000, at least 14000, at least 1 5000, at least 1 6000, at least 1 7000, at least 1 8000, at least 19000, at least 20000, at least 21000, at least 22000, at least 23000, at least 24000, at least 25000, at least 26000, at least 27000, at least 28000, at least 29000, at least 30000 mRNA species. It is
- mRNA species corresponds to a genomic transcription unit, i.e. usually to a gene.
- different transcripts may occur, for example, due to mRNA processing.
- an mRNA species may be represented by a spot on a microarray.
- a microarray provides an advantageous tool to determine the amount of a plurality of mRNA species, e.g. at a certain point in time during mRNA decay.
- RNA-seq e.g. RNA-seq, quantitative PCR etc.
- a stable mRNA is characterized by an mRNA decay wherein the ratio of the amount of said mRNA at a second point in time to the amount of said mRNA at a first point in time is at least 0.5 (50%), at least 0.6 (60%), at least 0.7 (70%), at least 0.75 (75%), at least 0.8 (80%), at least 0.85 (85%), at least 0.9 (90%), or at least 0.95 (95%).
- the second point in time is later in the decay process than the first point in time.
- the fi rst poi nt in time is selected such that only mRNA undergoing a decay process is considered, i .e. emerging mRNA - e.g. in ongoing transcription - is avoided.
- the first point in time is preferably selected such that the incorporation of the label into mRNA is completed, i.e. no ongoing i ncorporation of the label i nto mRNA occurs.
- the first poi nt i n time may be at least 1 0 mi n, at least 20 mi n, at least 30 min, at least 40 min, at least 50 mi n, at least 60 mi n, at least 70 min, at least 80 min, or at least 90 min after the end of the experimental labelli ng procedure, e.g. after the end of the i ncubation of cells with the label.
- the first point i n time may be preferably from 0 to 6 h after the stop of transcription (e.g. by a transcriptional i nhibitor), stop of promotor induction in case of inducible promoters or after stop of pulse or label supply, e.g. after end of labelling. More preferably, the first point in time may be 30 mi n to 5 h, even more preferably 1 h to 4 h and particu larly preferably about 3 h after the stop of transcription (e.g. by a transcriptional i nhibitor), stop of promotor induction in case of i nducible promotors or after stop of pulse or label supply, e.g. after end of label ling.
- the second point i n time is selected as late as possible duri ng the mRNA decay process.
- the second point in time is preferably selected such that still a considerable amount of the plurality of mRNA species, preferably at least 1 0% of the mRNA species, is present in a detectable amount, i.e. in an amount higher than 0.
- the second point i n time is at least 5 h, at least 6 h, at least 7 h, at least 8 h, at least 9 h, at least 1 0 h, at least 1 1 h, at least 1 2 h, at least 1 3 h, at least 1 4 h, or at least 1 5 h after the end of transcription or the end of the experimental labelling procedure.
- the time span between the fi rst point i n time and the second poi nt in time is preferably as large as possible within the above described limits.
- the time span between the first point in time and the second point in time is preferably at least 4 h, at least 5 h, at least 6 h, at least 7 h, at least 8 h, at least 9 h, at least 1 0 h, at least 1 1 h, or at least 1 2 h.
- the at least one 3'-UTR element and/or the at least one 5'-UTR element in the artificial nucleic acid molecule according to the present invention is identified by a method for identifying a 3'-UTR element and/or a 5'-UTR element according to the present invention as described herei n. It is particularly preferred that the at least one 3'-UTR element and/or the at least one 5'-UTR element in the artificial nucleic acid molecule according to the present invention, is identified by a method for identifying a 3'- UTR element and/or a 5'-UTR element, which provides high translation efficiency to an artificial nucleic acid molecule, as described herein.
- the at least one 3'-UTR element and/or the at least one 5'-UTR element in the artificial nucleic acid molecule according to the present invention comprises or consists of a nucleic acid sequence which is derived from the 3'-UTR and/or the 5'-UTR of a eukaryotic protein coding gene, preferably from the 3'-UTR and/or the 5'-UTR of a vertebrate protein codi ng gene, more preferably from the 3'-UTR and/or the 5'-UTR of a mammal ian protein coding gene, e.g. from mouse and human protei n coding genes, even more preferably from the 3'-UTR and/or the 5'-UTR of a primate or rodent protein coding gene, in particular the
- the at least one 3'-UTR element in the artificial nucleic acid molecule according to the present i nvention comprises or consists of a nucleic acid sequence which is preferably derived from a natural ly (i n nature) occurring 3'-UTR
- the at least one 5'-UTR element in the artificial nucleic acid molecule according to the present invention comprises or consists of a nucleic acid sequence which is preferably derived from a natural ly (i n nature) occurring 5'-UTR.
- the at least one open reading frame is heterologous to the at least one 3'-UTR element and/or to the at least one 5'-UTR element.
- heterologous i n this context means that two sequence elements comprised by the artificial nucleic acid molecule, such as the open reading frame and the 3'-UTR element and/or the open reading frame and the 5'-UTR element, do not occur naturally (in nature) i n this combination. They are typical ly recombinant.
- the 3'-UTR element and/or the 5'-UTR element are/is derived from a different gene than the open readi ng frame.
- the ORF may be derived from a different gene than the 3'-UTR element and/or to the at least one 5'-UTR element, e.g. encoding a different protein or the same protein but of a different species etc.
- the open reading frame is derived from a gene which is distinct from the gene from which the 3'-UTR element and/or to the at least one 5'-UTR element is derived.
- the ORF does not encode a human or plant (e.g., Arabidopsis) ribosomal protein, preferably does not encode human ribosomal protein S6 (RPS6), human ribosomal protein L36a-l ike (RPL36AL) or Arabidopsis ribosomal protein S1 6 (RPS1 6).
- the open reading frame does not encode ribosomal protein S6 (RPS6), ribosomal protein L36a-like (RPL36AL) or ribosomal protein S1 6 (RPS1 6).
- the open reading frame does not code for a reporter protein, e.g., selected from the group consisting of globin proteins (particularly beta-globin), luciferase protein, GFP proteins or variants thereof, for example, variants exhibiti ng at least 70% sequence identity to a globi n protein, a luciferase protei n, or a GFP protein.
- a reporter protein e.g., selected from the group consisting of globin proteins (particularly beta-globin), luciferase protein, GFP proteins or variants thereof, for example, variants exhibiti ng at least 70% sequence identity to a globi n protein, a luciferase protei n, or a GFP protein.
- the open reading frame does not code for a GFP protein.
- the open reading frame does not encode a reporter gene or is not derived from a reporter gene, wherei n the reporter gene is preferably not selected from group consisti ng of globin proteins (particularly beta-globin), luciferase protein, beta-glucuronidase (GUS) and GFP proteins or variants thereof, preferably not selected from EGFP, or variants of any of the above genes, typical ly exhibiting at least 70% sequence identity to any of these reporter genes, preferably a globin protei n, a luciferase protein, or a GFP protei n.
- the reporter gene is preferably not selected from group consisti ng of globin proteins (particularly beta-globin), luciferase protein, beta-glucuronidase (GUS) and GFP proteins or variants thereof, preferably not selected from EGFP, or variants of any of the above genes, typical ly exhibiting at least 70% sequence identity to any of these reporter genes, preferably a globin protei n, a
- the 3'-UTR element and/or the 5'-UTR element is heterologous to any other element comprised in the artificial nucleic acid as defined herein.
- the artificial nucleic acid accordi ng to the invention comprises a 3'-UTR element from a given gene, it does preferably not comprise any other nucleic acid sequence, in particular no functional nucleic acid sequence (e.g. coding or regulatory sequence element) from the same gene, including its regulatory sequences at the 5' and 3' terminus of the gene's ORF.
- the artificial nucleic acid according to the invention comprises a 5'-UTR element from a given gene, it does preferably not comprise any other nucleic acid sequence, in particular no functional nucleic acid sequence (e.g. coding or regulatory sequence element) from the same gene, including its regulatory sequences at the 5' and 3' terminus of the gene's ORF.
- no functional nucleic acid sequence e.g. coding or regulatory sequence element
- the artificial nucleic acid according to the present invention comprises at least one open reading frame, at least one 3'-UTR (element) and at least one 5'-UTR (element), whereby either the at least one 3'-UTR (element) is a 3'-UTR element according to the present invention and/or the at least one 5'-UTR (element) is a 5'-UTR element according to the present invention.
- each of the at least one open reading frame, the at least one 3'-UTR (element) and the at least one 5'-UTR (element) are heterologous, i.e. neither the at least one 3'-UTR (element) and the at least one 5'-UTR (element) nor the open reading frame and the 3'-UTR (element) or the 5'-UTR (element), respectively, are occurring naturally (in nature) in this combination.
- the artificial nucleic acid molecule comprises an ORF, a 3'- UTR (element) and a 5'-UTR (element), all of which are heterologous to each other, e.g. they are recombinant as each of them is derived from different genes (and their 5' and 3' UTR's).
- the 3'-UTR (element) is not derived from a 3'- UTR (element) of a viral gene or is not of viral origin.
- the at least one 3'-UTR element and/or to the at least one 5'-UTR element is functionally linked to the ORF.
- the 3'-UTR element and/or to the at least one 5'-UTR element is associated with the ORF such that it may exert a function, such as an enhancing or stabilizing function on the expression of the encoded peptide or protein or a stabilizing function on the artificial nucleic acid molecule.
- the ORF and the 3'-UTR element are associated in 5'->3' direction and/or the 5'-UTR element and the ORF are associated in 5'->3' direction.
- the artificial nucleic acid molecule comprises in general the structure 5'-[5'-UTR element]-(optional)-linker-ORF- (optional)-linker-[3'-UTR element]-3', wherein the artificial nucleic acid molecule may comprise only a 5'-UTR element and no 3'-UTR element, only a 3'-UTR element and no 5'- UTR element, or both, a 3'-UTR element and a 5'-UTR element.
- the linker may be present or absent.
- the linker may be one or more nucleotides, such as a stretch of 1 -50 or 1 -20 nucleotides, e.g., comprising or consisting of one or more restriction enzyme recognition sites (restriction sites).
- the at least one 3'-UTR element and/or the at least one 5'-UTR element comprises or consists of a nucleic acid sequence which is derived from the 3'-UTR and/or the 5'-UTR of a transcript of a gene selected from the group consisting of ZNF460, TGM2, IL7R, BGN, TK1 , RAB3B, CBX6, FZD2, COL8A1 , NDUFS7, PHGDH, PLK2, TSPO, PTGS1 , FBX032, NID2, ATP5D, EXOSC4, NOL9, UBB4B, VPS1 8, ORMDL2, FSCN1 , TMEM33, TUBA4A, EMP3, TMEM201 , CRIP2, BRAT1 , SERPINH1 , CD9, DPYSL2, CDK9, TFRC, PSMB3 5'-UTR, FASN, PSMB6, PRSS56, KPNA6, SFT2D
- the at least one 3'-UTR element and/or the at least one 5'-UTR element of the artificial nucleic acid molecule according to the present invention comprises or consists of a "functional fragment", a "functional variant” or a "functional fragment of a variant” of the 3'-UTR and/or the 5'-UTR of a transcript of a gene.
- the at least one 5'-UTR element comprises a nucleic acid sequence which is derived from the 5'-UTR of a transcript of a gene selected from the group consisting of ZNF460-5'-UTR, TGM2-5'-UTR, IL7R-5'-UTR, BGN-5'-UTR, T 1 -5'-UTR, RAB3B-5'-UTR, CBX6-5'-UTR, FZD2-5'-UTR, COL8A1 -5'-UTR, NDUFS7-5'-UTR, PHGDH-5'-UTR, PLK2- 5'-UTR, TSPO-5'-UTR, PTGS1 -5'-UTR, FBX032-5'-UTR, NID2-5'-UTR, ATP5D-5'-UTR, EXOSC4-5'-UTR, NOL9-5'-UTR, UBB4B-5'-UTR, VPS1 8-5'-UTR, ORMDL
- the at least one 3'-UTR element comprises or consists of a nucleic acid sequence which is derived from the 3'-UTR of a transcript of a gene selected from the group consisting of NDUFS7-3'-UTR, PHGDH-3'-UTR, TSPO-3'-UTR, ATP5D-3'-UTR, EXOSC4- 3'-UTR, TUBB4B-3'-UTR, TUBA4A-3'-UTR, EMP3-3'-UTR, CRIP2-3'-UTR, BRAT1 -3'-UTR, CD9-3'-UTR, CDK9-3'-UTR, PSMB3-3'-UTR, PSMB6-3'-UTR, PRSS56-3'-UTR, SCAND1 -3'- UTR, AMN-3'-UTR, CYBA-3'-UTR, PCOLCE-3'-UTR, MAPI S-3'-UTR, VTN-3'-UTR, ALDH1 6A1
- the artificial nucleic acid of the invention comprises both (i) at least one preferred 5'-UTR and (i) at least one preferred 3'-UTR.
- the at least one 5'-UTR element comprises a nucleic acid sequence which is derived from the 5'-UTR of a transcript of a gene selected from the group consisting of ZNF460-5'-UTR, TGM2-5'-UTR, IL7R-5'-UTR, COL8A1 -5'-UTR, NDUFS7-5'-UTR, PLK2-5'-UTR, FBX032-5'-UTR, ATP5D-5'-UTR, TUBB4B-5'-UTR, ORMDL2-5'-UTR, FSCN1 -5'-UTR, CD9-5'-UTR, PYSL2-5'-UTR, PSMB3-5'-UTR, PSMB6-5'- UTR, KPNA6-5'-UTR, SFT2 D2-5'-UTR, LCLAT1 -5'-UTR, FBXL18-5'-UTR, SLC35F6-5'-UTR, VMA21
- the at least one 3'-UTR element comprises a nucleic acid sequence which is derived from the 3'-UTR of a transcript of a gene selected from the group consisting of NDUFS7-3'-UTR, PHGDH-3'-UTR, TSPO-3'-UTR, ATP5D-3'-UTR, EXOSC4-3'-UTR, TUBB4B-3'-UTR, TUBA4A-3'-UTR, EMP3-3'-UTR, CRIP2-3'-UTR, BRAT1 -3'-UTR, CD9-3'-UTR, CDK9-3'-UTR, PSMB3-3'-UTR, PSMB6-3'-UTR, PRSS56-3'- UTR, SCAND1 -3'-UTR, AMN-3'-UTR, CYBA-3'-UTR, PCOLCE-3'-UTR, MAPI S-3'-UTR, VTN-3'
- nucleic acid sequence which is derived from the 3'-UTR and/or the 5'-UTR of a of a transcript of a gene preferably refers to a nucleic acid sequence which is based on the 3'-UTR sequence and/or on the 5'-UTR sequence of a transcript of a gene or a fragment or part thereof, preferably a natural ly occurring gene or a fragment or part thereof.
- the term naturally occurring is used synonymously with the term wild-type.
- This phrase includes sequences corresponding to the entire 3'-UTR sequence and/or the entire 5'-UTR sequence, i.e.
- a fragment of a 3'-UTR and/or a 5'-UTR of a transcript of a gene consists of a continuous stretch of nucleotides corresponding to a continuous stretch of nucleotides in the full-length 3'-UTR and/or 5'-UTR of a transcript of a gene, which represents at least 5%, 10%, 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, and most preferably at least 90% of the full-length 3'-UTR and/or 5'-UTR of a transcript of a gene.
- Such a fragment in the sense of the present invention, is preferably a functional fragment as described herein.
- the fragment retains a regulatory function for the translation of the ORF linked to the 3'-UTR and/or 5'-UTR or fragment thereof.
- variant of the 3'-UTR and/or variant of the 5'-UTR of a of a transcript of a gene refers to a variant of the 3'-UTR and/or 5'-UTR of a transcript of a naturally occurring gene, preferably to a variant of the 3'-UTR and/or 5'-UTR of a transcript of a vertebrate gene, more preferably to a variant of the 3'-UTR and/or 5'-UTR of a transcript of a mammalian gene, even more preferably to a variant of the 3'-UTR and/or 5'-UTR of a transcript of a primate gene, in particular a human gene as described above.
- Such variant may be a modified 3'-UTR and/or 5'-UTR of a transcript of a gene.
- a variant 3'-UTR and/or a variant of the 5'-UTR may exhibit one or more nucleotide deletions, insertions, additions and/or substitutions compared to the naturally occurring 3'-UTR and/or 5'-UTR from which the variant is derived.
- a variant of a 3'-UTR and/or variant of the 5'- UTR of a of a transcript of a gene is at least 40%, preferably at least 50%, more preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% identical to the naturally occurring 3'- UTR and/or 5'-UTR the variant is derived from.
- the variant is a functional variant as described herein.
- a nucleic acid sequence which is derived from a variant of the 3'-UTR and/or from a variant of the 5'-UTR of a of a transcript of a gene preferably refers to a nucleic acid sequence which is based on a variant of the 3'-UTR sequence and/or the 5'-UTR of a transcript of a gene or on a fragment or part thereof as described above.
- This phrase includes sequences corresponding to the entire sequence of the variant of the 3'-UTR and/or the 5'-UTR of a transcript of a gene, i.e.
- the full length variant 3'-UTR sequence and/or the full length variant 5'-UTR sequence of a transcript of a gene and sequences corresponding to a fragment of the variant 3'-UTR sequence and/or a fragment of the variant 5'-UTR sequence of a transcript of a gene.
- a fragment of a variant of the 3'-UTR and/or the 5'-UTR of a transcript of a gene consists of a continuous stretch of nucleotides corresponding to a continuous stretch of nucleotides in the full-length variant of the 3'-UTR and/or the 5'-UTR of a transcript of a gene, which represents at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, and most preferably at least 90% of the full-length variant of the 3'-UTR and/or the 5'- UTR of a transcript of a gene.
- Such a fragment of a variant in the sense of the present invention, is preferably a functional fragment of a variant as described herein.
- the terms “functional variant”, “functional fragment”, and “functional fragment of a variant” in the context of the present invention, mean that the fragment of the 3'-UTR and/or the 5'-UTR, the variant of the 3'-UTR and/or the 5'- UTR, or the fragment of a variant of the 3'-UTR and/or the 5'-UTR of a transcript of a gene fulfils at least one, preferably more than one function of the naturally occurring 3'-UTR and/or 5'-UTR of a transcript of a gene of which the variant, the fragment, or the fragment of a variant is derived.
- Such function may be, for example, stabilizing mRNA and/or enhancing, stabilizing and/or prolonging protein production from an mRNA and/or increasing protein expression or total protein production from an mRNA, preferably in a mammalian cell, such as in a human cel l.
- the function of the 3'-UTR and/or the 5'-UTR concerns the translation of the protein encoded by the ORF. More preferably, the function comprises enhancing translation efficiency of the ORF linked to the 3'-UTR and/or the 5'-UTR or fragment or variant thereof.
- the variant, the fragment, and the variant fragment in the context of the present invention fulfil the function of stabilizing an mRNA, preferably in a mammalian cell, such as a human cell, compared to an mRNA comprising a reference 3'-UTR and/or a reference 5'-UTR or lacking a 3'-UTR and/or a 5'-UTR, and/or the function of enhancing, stabilizing and/or prolonging protein production from an mRNA, preferably in a mammalian cell, such as in a human cell, compared to an mRNA comprising a reference 3'-UTR and/or a reference 5'-UTR or lacking a 3'-UTR and/or a 5'-UTR, and/or the function of increasing protein production from an mRNA, preferably in a mammalian cell, such as in a human cell, compared to an mRNA comprising a reference 3'-UTR and/or a reference 5'-UTR or lacking
- a reference 3'-UTR and/or a reference 5'-UTR may be, for example, a 3'-UTR and/or a 5'-UTR naturally occurring in combination with the ORF.
- a functional variant, a functional fragment, or a functional variant fragment of a 3'-UTR and/or a 5'-UTR of a transcript of a gene preferably does not have a substantially diminishing effect on the efficiency of translation of the mRNA which comprises such variant, fragment, or variant fragment of a 3'-UTR and/or a 5'-UTR compared to the wild-type 3'-UTR and/or the wild- type 5'-UTR from which the variant, the fragment, or the variant fragment is derived.
- a particularly preferred function of a "functional fragment", a “functional variant” or a “functional fragment of a variant” of the 3'-UTR and/or the 5'-UTR of a transcript of a gene in the context of the present invention is the enhancement, stabilization and/or prolongation of protein production by expression of an mRNA carrying the functional fragment, functional variant or functional fragment of a variant as described above.
- the efficiency of the one or more functions exerted by the functional variant, the functional fragment, or the functional variant fragment, such as providing translation efficiency is increased by at least 5%, more preferably by at least 1 0%, more preferably by at least 20%, more preferably by at least 30%, more preferably by at least 40%, more preferably by at least 50%, more preferably by at least 60%, even more preferably by at least 70%, even more preferably by at least 80%, most preferably by at least 90% with respect to the translation efficiency exhibited by the naturally occurring 3'-UTR and/or 5'- UTR of a transcript of a gene from which the variant, the fragment or the variant fragment is derived.
- a fragment of the 3'-UTR and/or of the 5'-UTR of a transcript of a gene or of a variant of the 3'-UTR and/or of the 5'-UTR of a transcript of a gene preferably exhibits a length of at least about 3 nucleotides, preferably of at least about 5 nucleotides, more preferably of at least about 1 0, 1 5, 20, 25 or 30 nucleotides, even more preferably of at least about 50 nucleotides, most preferably of at least about 70 nucleotides.
- such fragment of the 3'-UTR and/or of the 5'-UTR of a transcript of a gene or of a variant of the 3'-UTR and/or of the 5'-UTR of a transcript of a gene is a functional fragment as described above.
- the 3'-UTR and/or the 5'-UTR of a transcript of a gene or a fragment or variant thereof exhibits a length of between 3 and about 500 nucleotides, preferably of between 5 and about 1 50 nucleotides, more preferably of between 1 0 and 100 nucleotides, even more preferably of between 1 5 and 90, most preferably of between 20 and 70.
- the 5'-UTR element and/or the 3'-UTR element is characterized by less than 500, 400, 300, 200, 1 50 or less than 1 00 nucleotides. 5'-UTR elements
- the at least one 5'-UTR element comprises or consists of a nucleic acid sequence which has an identity of at least about 1 , 2, 3, 4, 5, 1 0, 1 5, 20, 30 or 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99% to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 1 51 or the corresponding RNA sequence, respectively, or wherein the at least one 5'-UTR element comprises or consists of a fragment of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99% to a nucleic acid
- SEQ ID NO: 54 Homo sapiens SLC35F6 5' -UTR
- SEQ ID NO: 60 Homo sapiens SEZ6L2 5' -UTR
- SEQ ID NO: 66 Homo sapiens KPNA6 5' -UTR (identical to SEQ ID NO: 44)
- 5'-UTR elements selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 98, SEQ ID NO: 1 06, SEQ ID NO: 109, SEQ ID NO: 1 1 5, SEQ ID NO: 1 1 8, SEQ ID NO: 125, SEQ ID NO: 1 27, SEQ ID NO: 1 31 , SEQ ID NO: 1 35 are contributed by the present invention and may be employed in any aspect of the present invention.
- the 5'-UTR element according to the present invention differs from a wi ld-type 5'-UTR element.
- Such 5'-UTR elements are designated "artificial 5'-UTR elements”.
- an artificial 5'-UTR element shows a degree of sequence identity to a wild-type 5'-UTR element which is (a) less than 1 00 %, and at the same time (B) more than 1 0 %, more than 20 %, more than 30 %, more than 40 %, more than 50 %, more than 60 %, more than 70 %, more than 80 %, more than 90 %, more than 95 %, such wi ld-type 5'- UTR element being selected from the group consisting of SEQ ID NOs: 1 to 136.
- the artificial 5'-UTR element differs from the wild-type 5'-UTR element it is based on in that at least one nucleotide, such as two nucleotides, three nucleotides, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides, ten nucleotides, or more than ten nucleotides, is/are exchanged.
- a nucleotide exchange may be recommendable in case the wild-type 5'-UTR element comprises a nucleotide element which is considered disadvantageous.
- a nucleotide element which is considered disadvantageous is selected from (i) an internal ATG triplet (i.e. an ATG triplet other than the start codon of the open reading frame of the nucleic acid of the invention) or (ii) a restriction enzyme recognition site (cleavage site), particularly the restriction enzyme recognition site (cleavage site) which is recognized (cleavable) by a restriction enzyme used in the process of making (cloning) the artificial nucleic acid of the present invention.
- the artificial 5'-UTR elements is selected from the group consisting of SEQ ID NOs: 1 37 to 1 51 :
- SEQ ID NO: 147 Artificial Sequence (based on SEQ ID NO: 109) GGCAATTCCACGCCACCTCCGCGCGCTCTGCGCTCTGGGATCCGGAGCGACCAGGACCTGGTGAGA CCCTCAGCTCCCCTCCACCTTCCCCGAGGTCCAGCACACCAGAACTGGAACCTGAGCAGCCCAGAA GCCAGGGTGGCACCACTGTGTCTCCTGTCTGAAGACCCGGATATTTTCTCAGACTTGGCGACAC GTTCCTTTAAAAGATCAGC
- SEQ ID NO: 148 Artificial Sequence (based on SEQ ID NO: 110) AAAGACCACGCCCCAGTCACGTCACGCGGCGGTTACCGCGCTTGGCGCTCGCGATTTAAAACTTAC TCCGGAGACGTGGAGAGCAAG
- SEQ ID NO: 149 Artificial Sequence (based on SEQ ID NO: 119) TTATTAGTCCAGCTGGAAGCCTGGCTGTCCCTAGAAAAGCTGGAAGCCTGACTGCCCCTCAAAAGA CCTGCTCTTTAGGAGAGCTAGATATTGTTTACTGAAGACAAGTGTGAAAACTGGGAACCTCAGTCT CCATC
- SEQ ID NO: 150 Artificial Sequence (based on SEQ ID NO: .120) AATAGGTCGTCGAGGGAAGGCGCCTCATCGCGCCGTGAATT
- the at least one 3'-UTR element comprises or consists of a nucleic acid sequence which has an identity of at least about 1 , 2, 3, 4, 5, 1 0, 1 5, 20, 30 or 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99% to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 52 to 204 or the corresponding DNA or RNA sequence, respectively, or wherein the at least one 3'-UTR element comprises or consists of a fragment of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99% to
- SEQ ID NO: 1 52 to 203 can be considered as wild-type 3'-UTR sequences, and SEQ ID NO: 204 can be considered as artificial 5'-UTR sequence.
- 3'-UTR elements selected from the group consisting of SEQ ID NO: 1 79, SEQ ID NO: 1 80, SEQ ID NO: 1 82, SEQ ID NO: 1 83, SEQ ID NO: 1 97, SEQ ID NO: 200 are contributed by the present invention and may be employed in any aspect of the present invention.
- the 3'-UTR element according to the present invention differs from a wild-type 3'-UTR element.
- Such 3'-UTR elements are designated "artificial 3'-UTR elements”.
- an artificial 3'-UTR element shows a degree of sequence identity to a wild-type 3'-UTR element which is (a) less than 1 00 %, and at the same time (B) more than 1 0 %, more than 20 %, more than 30 %, more than 40 %, more than 50 %, more than 60 %, more than 70 %, more than 80 %, more than 90 %, more than 95 %, such wild-type 3'- UTR element being selected from the group consisting of SEQ ID NOs: 1 52 to 203.
- the artificial 3'-UTR element differs from the wild-type 3'-UTR element it is based on in that at least one nucleotide, such as two nucleotides, three nucleotides, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides, ten nucleotides, or more than ten nucleotides, is/are exchanged.
- a nucleotide exchange may be recommendable in case the wild-type 3'-UTR element comprises a nucleotide element which is considered disadvantageous.
- a nucleotide element which is considered disadvantageous is a restriction enzyme recognition site (cleavage site), particularly the restriction enzyme recognition site (cleavage site) which is recognized (cleavable) by a restriction enzyme used in the process of making (cloning) the artificial nucleic acid of the present invention.
- cleavage site a restriction enzyme recognition site
- cleavage site the restriction enzyme recognition site which is recognized (cleavable) by a restriction enzyme used in the process of making (cloning) the artificial nucleic acid of the present invention.
- the artificial 3'-UTR elements is SEQ ID NO: 204:
- SEQ ID NO: 204 Artificial Sequence (based on SEQ ID NO: 192) TGACTTCAAATAATGATCTGTTTGATATCACACTAGCCTCTTCCCCTCCCCAGAAAACTTTGGGCA CCTTCTGGCTTTGGTTAGGAACTGAGTTGGACAGGTTGGGTAAATTTCAACCTCAGGGCATCATGC CCAGGAAAGCTGGGGAGAGGCGATGTTCTTTTCCTCAGTTTGGAGCGGGAAGAAGGAGTTTTAATG ACTGTGCTTCCTCTTCTCCTCCCCATGGAAGGGGGGGGGGATCCCTGGCTCAGCATCCACTGCTGG TGGAAACCTCGCTGCGAGGTGCCGCTGTGAGGTGTGCCGCTGTGAGGTGCGTGCTCTGGAAGAGAG GCGGAGCTTGTCCGCTGCTGCCTCTGCCTGCAGTACCACCCTCGGTCTAAGCACTCATGATT TTATACTTTCAGAAAAAAGTTTTAAGACTTCTTTGGGTTTTTTGTTTGTTGAAGCCTAAGAA AGTCACT
- Novel 5'-UTR elements and novel 3'-UTR elements are novel 5'-UTR elements and novel 3'-UTR elements
- the present invention also provides novel 5'-UTR elements and novel 3'-UTR elements, i.e. 5'-UTR elements and 3'-UTR elements which the present inventors found to be expressed in human cells and mouse cells, respectively, but which are not known from public databases (see Example 1 ).
- Any 5'-UTR selected from the group consisting of SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49 can be preferred in some embodiments of this invention.
- Any 5'- UTR selected from the group consisting of SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 98, SEQ ID NO: 1 06, SEQ ID NO: 1 09, SEQ ID NO: 1 1 5, SEQ ID NO: 1 18, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 1 31 , SEQ ID NO: 135 can be preferred in some embodiments of this invention.
- Any 3'-UTR selected from the group consisting of SEQ ID NO: 1 79, SEQ ID NO: 180, SEQ ID NO: 1 82, SEQ ID NO: 1 83, SEQ ID NO: 1 97, SEQ ID NO: 200 can be preferred in some embodiments of this invention.
- the at least one 3'-UTR element of the artificial nucleic acid molecule according to the present invention comprises or consists of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about
- ALDH1 6A1 -3'-UTR (all human), Acox2-3'-UTR, Ubc-3'-UTR, Slpi-3'-UTR, lgf2bp1 -3'-
- the at least one 3'-UTR element of the artificial nucleic acid molecule according to the present invention comprises or consists of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99%, most preferably of 100% to a sequence selected from the group consisting of SEQ ID NO: 1 52, SEQ ID NO: 1 53, SEQ ID NO: 1 54, SEQ ID NO: 1 55, SEQ ID NO: 1 56, SEQ ID NO: 1 57, SEQ ID NO: 1 58, SEQ ID NO: 1 59, SEQ ID NO: 1 60, SEQ ID NO: 1 61 , SEQ ID NO: 1 64, SEQ ID NO: 1 65, SEQ ID NO: 1 67, SEQ ID NO: 1 68, SEQ ID NO:
- the at least one 5'-UTR element of the artificial nucleic acid molecule according to the present invention comprises or consists of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99%, most preferably of 1 00% to the 5'-UTR sequence of a transcript of ZNF460-5'-UTR, TGM2-5'-UTR, IL7R-5'-UTR, COL8A1 -5'-UTR, NDUFS7-5'- UTR, PLK2-5'-UTR, FBX032-5'-UTR, ATP5D-5'-UTR, TUBB4B-5'-UTR, ORMDL2-5'-UTR, FSCN1 -5'-UTR, CD9-5'-UTR
- the at least one 5'-UTR element of the artificial nucleic acid molecule according to the present invention comprises or consists of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99%, most preferably of 100% to a sequence according to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 137 (alternatively SEQ ID NO: 3), SEQ ID NO: 138 (alternatively SEQ ID NO: 9), SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 140 (alternatively SEQ ID NO: 17), SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 143 (alternatively SEQ ID NO: 31), SEQ ID NO: 32
- the at least one 3'-UTR element of the artificial nucleic acid molecule according to the present invention may also comprise or consist of a fragment of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99%, most preferably of 100% to the nucleic acid sequence of the 3'-UTR of a transcript of a gene, such as to the 3'-UTR of a sequence according to SEQ ID NOs: 1 52 to 204, wherein the fragment is preferably a functional fragment or a functional variant fragment as described above.
- Such fragment preferably exhibits a length of at least about 3 nucleotides, preferably of at least about 5 nucleotides, more preferably of at least about 1 0, 1 5, 20, 25 or 30 nucleotides, even more preferably of at least about 50 nucleotides, most preferably of at least about 70 nucleotides.
- the fragment or variant thereof exhibits a length of between 3 and about 500 nucleotides, preferably of between 5 and about 1 50 nucleotides, more preferably of between 1 0 and 1 00 nucleotides, even more preferably of between 1 5 and 90, most preferably of between 20 and 70.
- said variants, fragments or variant fragments are functional variants, functional fragments, or functional variant fragments of the 3'-UTR, prolong protein production from the artificial nucleic acid molecule according to the invention with an efficiency of at least 30%, preferably with an efficiency of at least 40%, more preferably of at least 50%, more preferably of at least 60%, even more preferably of at least 70%, even more preferably of at least 80%, most preferably of at least 90% of the protein production prolonging efficiency exhibited by an artificial nucleic acid molecule comprising the nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 52, SEQ ID NO: 1 53, SEQ ID NO: 1 54, SEQ ID NO: 1 55, SEQ ID NO: 1 56, SEQ ID NO: 1 57, SEQ ID NO: 1 58, SEQ ID NO: 1 59, SEQ ID NO: 1 60, SEQ ID NO: 1 61 , SEQ ID NO: 1 64, SEQ ID NO: 1 65, SEQ ID NO: 1 67,
- the at least one 5'-UTR element of the artificial nucleic acid molecule according to the present invention may also comprise or consist of a fragment of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99%, most preferably of 100% to the nucleic acid sequence of the 5'-UTR of a transcript of a gene, such as to the 5'-UTR of a sequence according to SEQ ID NO: 1 to 1 51 , wherein the fragment is preferably a functional fragment or a functional variant fragment as described above.
- Such fragment preferably exhibits a length of at least about 3 nucleotides, preferably of at least about 5 nucleotides, more preferably of at least about 1 0, 1 5, 20, 25 or 30 nucleotides, even more preferably of at least about 50 nucleotides, most preferably of at least about 70 nucleotides.
- the fragment or variant thereof exhibits a length of between 3 and about 500 nucleotides, preferably of between 5 and about 1 50 nucleotides, more preferably of between 10 and 100 nucleotides, even more preferably of between 1 5 and 90, most preferably of between 20 and 70.
- said variants, fragments or variant fragments are functional variants, functional fragments, or functional variant fragments of the 5'-UTR, increase protein production from the artificial nucleic acid molecule according to the invention with an efficiency of at least 30%, preferably with an efficiency of at least 40%, more preferably of at least 50%, more preferably of at least 60%, even more preferably of at least 70%, even more preferably of at least 80%, most preferably of at least 90% of the protein production increasing efficiency exhibited by an artificial nucleic acid molecule comprising the nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 137 (alternatively SEQ ID NO: 3), SEQ ID NO: 1 38 (alternatively SEQ ID NO: 9), SEQ ID NO: 1 0, SEQ ID NO: 12, SEQ ID NO: 1 5, SEQ ID NO: 140 (alternatively SEQ ID NO: 1 7), SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 23, SEQ
- the at least one 3'-UTR element and/or the at least one 5'-UTR element of the artificial nucleic acid molecule according to the present invention exhibits a length of at least about 3 nucleotides, preferably of at least about 5 nucleotides, more preferably of at least about 10, 1 5, 20, 25 or 30 nucleotides, even more preferably of at least about 50 nucleotides, most preferably of at least about 70 nucleotides.
- the upper limit for the length of the at least one 3'-UTR element and/or the at least one 5'-UTR element may be 500 nucleotides or less, e.g. 400, 300, 200, 150 or 100 nucleotides.
- the upper limit may be chosen within the range of 50 to 1 00 nucleotides.
- the fragment or variant thereof may exhibit a length of between 3 and about 500 nucleotides, preferably of between 5 and about 1 50 nucleotides, more preferably of between 10 and 100 nucleotides, even more preferably of between 1 5 and 90, most preferably of between 20 and 70.
- the UTR element comprised in the artificial nucleic acid molecule comprises (or consists of) a continuous sequence which is shorter than any sequence selected from SEQ I D NOs: 1 to 204 provided herein, but sti ll shares a degree of identity of 70 % or more, 80 % or more, 90 % or more or 95 % or more with the respective sequence any sequence selected from SEQ I D NOs: 1 to 204.
- the replacing UTR element comprises of a continuous sequence which is over its entire length identical to any sequence selected from SEQ ID NOs: 1 to 204; however, the replacing UTR element is shorter, e.g has a length of 70 % or more, 80 % or more, 90 % or more or 95 % or more with respect to the total length of the sequence it is otherwise identical to, and which is selected from SEQ ID NOs: 1 to 204.
- the artificial nucleic acid molecule accordi ng to the present invention may comprise more than one 3'-UTR elements and/or more than one 5'-UTR elements as described above.
- the artificial nucleic acid molecule according to the present invention may comprise one, two, three, four or more 3'-UTR elements, and/or one, two, three, four or more 5'-UTR elements, wherei n the i ndividual 3 '-UTR elements may be the same or they may be different, and simi larly, the individual 5'-UTR elements may be the same or they may be different.
- the artificial nucleic acid molecule according to the present invention may comprise two essential ly identical 3'-UTR elements as described above, e.g.
- the artificial nucleic acid molecule according to the present invention may comprise two essential ly identical 5'-UTR elements as described above, e.g.
- two 5'-UTR elements comprisi ng or consisti ng of a nucleic acid sequence, which is derived from the 5'-UTR of a transcript of a gene, such as from a sequence accordi ng to SEQ ID NO: 1 to 1 51 , or from a fragment or variant of the 5'-UTR of a transcript of a gene, functional variants thereof, functional fragments thereof, or functional variant fragments thereof as described above.
- an artificial nucleic acid molecule comprising a 3'- UTR element as described above and/or a 5'-UTR element as described above may represent or may provide an mRNA molecule, which provides high translation efficiency.
- a 3'-UTR element as described herein and/or a 5'-UTR element as described herein may improve translation efficiency of an mRNA molecule.
- the artificial nucleic acid molecule according to the invention may comprise (i) at least one 3'-UTR element and at least one 5'-UTR element, which provides high translation efficiency; (ii) at least one 3'-UTR element, which provides high translation efficiency, but no 5'-UTR element, which provides high translation efficiency; or (iii) at least one 5'-UTR element, which provides high translation efficiency, but no 3'-UTR element, provides high translation efficiency.
- the artificial nucleic acid molecule according to the present invention may further comprise one or more "further 3'-UTR elements and/or 5'-UTR elements", i.e. 3'-UTR elements and/or 5'-UTR elements which do not fulfil the requirements as described above.
- an artificial nucleic acid molecule according to the invention which comprises a 3'-UTR element according to the present invention, i.e. a 3'-UTR element which provides high translation efficiency to said artificial nucleic acid molecule, may additionally comprise any further 3'-UTR and/or any further 5'-UTR, in particular a further 5'-UTR, e.g.
- an artificial nucleic acid molecule according to the invention which comprises a 5'-UTR element according to the present invention, i.e. a 5'-UTR element which provides high translation efficiency to said artificial nucleic acid molecule, may additionally comprise any further 3'-UTR and/or any further 5'-UTR, in particular a further 3'-UTR, e.g.
- a 3'-UTR derived from a 3'-UTR of an albumin gene particularly preferably a 3'-UTR comprising a sequence according to SEQ ID NO: 206 or 207, in particular to SEQ ID NO: 207, or any other 3'-UTR or 3'-UTR element.
- the inventive at least one 5'-UTR element and/or to the inventive at least one 3'-UTR element which provides high translation efficiency
- a further 3'-UTR (element) and/ or a further 5'-UTR (element) are present in the artificial nucleic acid molecule according to the invention
- the further 5'-UTR (element) and/or the further 3'-UTR (element) may interact with the inventive 3'-UTR element and/or inventive 5'-UTR element and, thus, support the translation efficiency effect of the inventive 3'-UTR element and/or of the inventive 5'-UTR element, respectively.
- Such further 3'-UTR and/or 5'-UTR (elements) may further support stability and translational efficiency.
- an inventive 3'-UTR element and an inventive 5'-UTR element are present in the artificial nucleic acid molecule according to the invention, a translation efficiency effect of the inventive 5'-UTR element and the inventive 3'-UTR element results preferably in the provision of high translation efficiency in a synergistic way.
- the further 3'-UTR comprises or consists of a nucleic acid sequence which is derived from a 3'-UTR of a gene selected from the group consisting of an albumin gene, an a-globin gene, a ⁇ -globin gene, a tyrosine hydroxylase gene, a lipoxygenase gene, and a collagen alpha gene, such as a collagen alpha 1 (1) gene, or from a variant of a 3'-UTR of a gene selected from the group consisting of an albumin gene, an a-globin gene, a ⁇ -globin gene, a tyrosine hydroxylase gene, a lipoxygenase gene, and a collagen alpha gene, such as a collagen alpha 1 (1) gene according to SEQ ID No.
- the further 3'-UTR comprises or consists of a nucleic acid sequence which is derived from a 3'-UTR of an albumin gene, preferably a vertebrate albumin gene, more preferably a mammalian albumin gene, most preferably a human albumin gene according to SEQ ID NO: 206:
- the further 3'-UTR comprises or consists of a nucleic acid sequence which is derived from a 3'-UTR of an a-globin gene, preferably a vertebrate a- or ⁇ -globin gene, more preferably a mammalian a- or ⁇ -globin gene, most preferably a human a- or ⁇ -globin gene according to SEQ ID No. 1370 of the patent application WO 201 3/143700 (3'-UTR of Homo sapiens hemoglobin, alpha 1 (HBA1 )), or according to SEQ ID No.
- the further 3'-UTR may comprise or consist of the center, a-complex-binding portion of the 3'-UTR of an a-globin gene, according to SEQ ID No. 1 393 of the patent application WO 2013/143700.
- the inventive nucleic acid molecule comprises a further 3'-UTR element derived from the nucleic acids according to SEQ ID No. 1369- 1390 of the patent application WO 2013/143700 or a fragment, homolog or variant thereof.
- the further 3'-UTR comprises the nucleic acid sequence derived from a fragment of the human albumin gene according to SEQ ID NO: 207:
- the further 3'-UTR of the inventive artificial nucleic acid molecule comprises or consists of the nucleic acid sequence according to SEQ ID NO: 207, or a corresponding RNA sequence.
- the further 3'-UTR comprises or consists of a nucleic acid sequence derived from a ribosomal protein coding gene, preferably as described in the international patent applications WO 2015/101414 or WO 2015/101415, the disclosure of which is herewith incorporated by reference.
- the further 3'-UTR may also comprise or consist of a nucleic acid sequence derived from a ribosomal protein coding gene, whereby ribosomal protein coding genes from which a further 3'-UTR may be derived include, but are not limited to, ribosomal protein L9 (RPL9), ribosomal protein L3 (RPL3), ribosomal protein L4 (RPL4), ribosomal protein L5 (RPL5), ribosomal protein L6 (RPL6), ribosomal protein L7 (RPL7), ribosomal protein L7a (RPL7A), ribosomal protein L11 (RPL11), ribosomal protein L12 (RPL12), ribosomal protein L13 (RPL13), ribosomal protein L23 (RPL23), ribosomal protein L18 (RPL18), ribosomal protein L18a (RPL18A), ribosomal protein L19 (RPL19),
- the further 5'-UTR comprises or consists of a nucleic acid sequence which is derived from the 5'-UTR of a TOP gene or which is derived from a fragment, homolog or variant of the 5'-UTR of a TOP gene.
- the 5'-UTR element does not comprise a TOP-motif or a 5 'TOP, as defined above.
- a 5'-UTR of a TOP gene is a 5'- UTR of a TOP gene lacking the TOP motif.
- the nucleic acid sequence which is derived from the 5'-UTR of a TOP gene is derived from a eukaryotic TOP gene, preferably a plant or animal TOP gene, more preferably a chordate TOP gene, even more preferably a vertebrate TOP gene, most preferably a mammal ian TOP gene, such as a human TOP gene.
- the further 5'-UTR is preferably selected from 5'-UTR elements comprisi ng or consisti ng of a nucleic acid sequence which is derived from a nucleic acid sequence selected from the group consisting of SEQ ID NOs. 1 -1 363, SEQ ID NO. 1 395, SEQ ID NO. 1 421 and SEQ ID NO. 1 422 of the patent application WO201 3/1 43700 whose disclosure is incorporated herein by reference, from the homologs of SEQ ID NOs. 1 -1 363, SEQ ID NO. 1 395, SEQ I D NO. 1 421 and SEQ ID NO. 1 422 of the patent application WO201 3/1 43700, from a variant thereof, or preferably from a corresponding RNA sequence.
- homologs of SEQ ID NOs. 1 -1 363, SEQ ID NO. 1 395, SEQ ID NO. 1421 and SEQ ID NO. 1 422 of the patent application WO201 3/1 43700 refers to sequences of other species than Homo sapiens, which are homologous to the sequences according to SEQ ID NOs. 1 -1 363, SEQ ID NO. 1 395, SEQ ID NO. 1 421 and SEQ ID NO. 1422 of the patent application WO2013/143700.
- the further 5'-UTR comprises or consists of a nucleic acid sequence which is derived from a nucleic acid sequence extending from nucleotide position 5 (i.e. the nucleotide that is located at position 5 in the sequence) to the nucleotide position immediately 5' to the start codon (located at the 3' end of the sequences), e.g. the nucleotide position immediately 5' to the ATG sequence, of a nucleic acid sequence selected from SEQ ID NOs. 1 -1363, SEQ ID NO. 1395, SEQ ID NO. 1421 and SEQ ID NO. 1422 of the patent application WO2013/143700, from the homologs of SEQ ID NOs.
- the further 5'-UTR is derived from a nucleic acid sequence extending from the nucleotide position immediately 3' to the 5 OP to the nucleotide position immediately 5' to the start codon (located at the 3' end of the sequences), e.g. the nucleotide position immediately 5' to the ATG sequence, of a nucleic acid sequence selected from SEQ ID NOs. 1 -1363, SEQ ID NO. 1395, SEQ ID NO. 1421 and SEQ ID NO.
- the further 5'-UTR comprises or consists of a nucleic acid sequence which is derived from a 5'-UTR of a TOP gene encoding a ribosomal protein or from a variant of a 5'-UTR of a TOP gene encoding a ribosomal protein.
- the 5'-UTR element comprises or consists of a nucleic acid sequence which is derived from a 5'-UTR of a nucleic acid sequence according to any of SEQ ID NOs: 1 70, 232, 244, 259, 1284, 1285, 1286, 1 287, 1288, 1289, 1290, 1291 , 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1 300, 1 301 , 1302, 1303, 1304, 1 305, 1 306, 1 307, 1 308, 1 309, 1 310, 1 31 1 , 1 31 2, 1 31 3, 1 314, 1 31 5, 1 31 6, 131 7, 131 8, 1 31 9, 1320, 1 321 , 1 322, 1 323, 1324, 1 325, 1326, 1327, 1 328, 1 329, 1330, 1 331 , 1 332, 1 333, 1 334, 1 335, 1 336, 1 337, 1 338, 1 339, 1340,
- the further 5'-UTR comprises or consists of a nucleic acid sequence which is derived from a 5'-UTR of a TOP gene encoding a ribosomal Large protein (RPL) or from a homolog or variant of a 5'-UTR of a TOP gene encoding a ribosomal Large protein (RPL).
- RPL ribosomal Large protein
- the 5'-UTR element comprises or consists of a nucleic acid sequence which is derived from a 5'-UTR of a nucleic acid sequence according to any of SEQ ID NOs: SEQ ID NOs: 67, 259, 1284-1 318, 1344, 1 346, 1348-1354, 1 357, 1 358, 1421 and 1422 of the patent application W0201 3/143700, a corresponding RNA sequence, a homolog thereof, or a variant thereof as described herein, preferably lacking the 5'TOP motif.
- the 5'-UTR element comprises or consists of a nucleic acid sequence which is derived from the 5'-UTR of a ribosomal protein Large 32 gene, preferably from a vertebrate ribosomal protein Large 32 (L32) gene, more preferably from a mammalian ribosomal protein Large 32 (L32) gene, most preferably from a human ribosomal protein Large 32 (L32) gene, or from a variant of the 5'-UTR of a ribosomal protein Large 32 gene, preferably from a vertebrate ribosomal protein Large 32 (L32) gene, more preferably from a mammalian ribosomal protein Large 32 (L32) gene, most preferably from a human ribosomal protein Large 32 (L32) gene, wherein preferably the further 5'-UTR does not comprise the 5'TOP of said gene.
- the further 5'-UTR comprises or consists of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99% to the nucleic acid sequence according to SEQ ID NO: 208 (5'-UTR of human ribosomal protein Large 32 lacking the 5' terminal oligopyrimidine tract:
- GGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATC (SEQ ID NO: 208); corresponding to SEQ ID NO. 1368 of the patent application WO201 3/143700) or preferably to a corresponding RNA sequence, or wherein the further 5'-UTR comprises or consists of a fragment of a nucleic acid sequence which has an identity of at least about 40%, preferably of at least about 50%, preferably of at least about 60%, preferably of at least about 70%, more preferably of at least about 80%, more preferably of at least about 90%, even more preferably of at least about 95%, even more preferably of at least about 99% to the nucleic acid sequence according to SEQ ID NO: 208 or more preferably to a corresponding RNA sequence, wherein, preferably, the fragment is as described above, i.e.
- the fragment exhibits a length of at least about 20 nucleotides or more, preferably of at least about 30 nucleotides or more, more preferably of at least about 40 nucleotides or more.
- the fragment is a functional fragment as described herein.
- the artificial nucleic acid molecule comprises a further 5'-UTR which comprises or consists of a nucleic acid sequence which is derived from the 5'-UTR of a vertebrate TOP gene, such as a mammalian, e.g.
- a human TOP gene selected from RPSA, RPS2, RPS3, RPS3A, RPS4, RPS5, RPS6, RPS7, RPS8, RPS9, RPS1 0, RPS1 1 , RPS12, RPS13, RPS14, RPS1 5, RPS1 5A, RPS1 6, RPS1 7, RPS1 8, RPS1 9, RPS20, RPS21 , RPS23, RPS24, RPS25, RPS26, RPS27, RPS27A, RPS28, RPS29, RPS30, RPL3, RPL4, RPL5, RPL6, RPL7, RPL7A, RPL8, RPL9, RPL1 0, RPL1 0A, RPL1 1 , RPL12, RPL1 3, RPL13A, RPL14, RPL1 5, RPL1 7, RPL18, RPL1 8A, RPL1 9, RPL21 , RPL22, RPL23, RPL23A, RPL24, RPL26, RPL27, RPL27A
- a further 5'-UTR comprises or consists of a nucleic acid sequence, which is derived from a 5'-UTR as described in the international patent application WO 2016/107877, the disclosure of which is herewith incorporated by reference.
- the artificial nucleic acid molecule according to the present invention may be RNA, such as mRNA or viral RNA or a replicon, DNA, such as a DNA plasmid or viral DNA, or may be a modified RNA or DNA molecule. It may be provided as a double-stranded molecule having a sense strand and an anti-sense strand, for example, as a DNA molecule having a sense strand and an anti-sense strand.
- the artificial nucleic acid molecule according to the present invention may further comprise optionally a 5'-cap.
- the optional 5'-cap is preferably located 5' to the ORF, more preferably 5' to the at least one 5'-UTR or to any further 5'-UTR within the artificial nucleic acid molecule according to the present invention.
- the artificial nucleic acid molecule according to the present invention further comprises a poly(A) sequence and/or a polyadenylation signal.
- the optional poly(A) sequence is located 3' to the at least one 3'-UTR element or to any further 3'-UTR, more preferably the optional poly(A) sequence is connected to the 3'-end of an 3'-UTR element.
- the connection may be direct or indirect, for example, via a stretch of 2, 4, 6, 8, 1 0, 20 etc. nucleotides, such as via a linker of 1 -50, preferably of 1 -20 nucleotides, e.g. comprising or consisting of one or more restriction sites.
- the artificial nucleic acid molecule according to the present invention does not comprise a 3'-UTR, for example if it only comprises at least one 5'-UTR element, it preferably still comprises a poly(A) sequence and/or a polyadenylation signal.
- the optional polyadenylation signal is located downstream of the 3' of the 3'-UTR element.
- consensus sequence may be recognised by most animal and bacterial cell-systems, for example by the polyadenylation-factors, such as cleavage/polyadenylation specificity factor (CPSF) cooperating with CstF, PAP, PAB2, CFI and/or CFII.
- CPSF cleavage/polyadenylation specificity factor
- the polyadenylation signal preferably the consensus sequence NN UANA
- the polyadenylation signal is located less than about 50 nucleotides, more preferably less than about 30 bases, most preferably less than about 25 bases, for example 21 bases, downstream of the 3'-end of the 3'-UTR element or of the ORF, if no 3'-UTR element is present.
- Transcription of an artificial nucleic acid molecu le according to the present invention e.g. of an artificial DNA molecule, comprising a polyadenylation signal downstream of the 3'- UTR element (or of the ORF) wi ll result in a premature-RNA containing the polyadenylation signal downstream of its 3'-UTR element (or of the ORF).
- the i nventive artificial nucleic acid molecule may be a DNA molecule comprisi ng a 3'-UTR element as described above and a polyadenylation signal, which may result in polyadenylation of an RNA upon transcription of this DNA molecule.
- a resulting RNA may comprise a combi nation of the inventive 3'-UTR element fol lowed by a poly(A) sequence.
- transcription of an artificial nucleic acid molecule according to the invention e.g. transcription of an artificial nucleic acid molecule comprising an open reading frame, a 3'-UTR element and/or a 5'-UTR element and optionally a polyadenylation-signal, may result in an mRNA molecule comprising an open reading frame, a 3'-UTR element and optional ly a poly(A) sequence.
- the invention also provides an artificial nucleic acid molecule, which is an mRNA molecule comprising an open reading frame, a 3'-UTR element as described above and/or a 5'-UTR element as described above and optional ly a poly(A) sequence.
- the 3'-UTR of the artificial nucleic acid molecule according to the invention does not comprise a polyadenylation signal or a poly(A) sequence.
- the artificial nucleic acid molecule according to the invention does not comprise a polyadenylation signal or a poly(A) sequence.
- the 3'-UTR of the artificial nucleic acid molecule, or the inventive artificial nucleic acid molecule as such does not comprise a polyadenylation signal, in particular it does not comprise the polyadenylation signal AAU/TAAA.
- the invention provides an artificial nucleic acid molecule which is an artificial DNA molecule comprising an open reading frame and a sequence selected from the group consisting of sequences according to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 1 37 (alternatively SEQ ID NO: 3), SEQ ID NO: 1 38 (alternatively SEQ ID NO: 9), SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 1 5, SEQ ID NO: 140 (alternatively SEQ ID NO: 1 7), SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 1 43 (alternatively SEQ ID NO: 31 ), SEQ ID NO: 32, SEQ ID NO: 39, SEQ ID NO: 41 , SEQ ID NO: 44 , SEQ ID NO: 45, SEQ ID NO: 1 46 (alternatively SEQ ID NO: 52), SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 57, SEQ ID NO:
- the invention provides an artificial nucleic acid molecule which may serve as a template for an RNA molecule, preferably for an mRNA molecule, which is characterized by high translation efficiency.
- the artificial nucleic acid molecule may be a DNA which may be used as a template for production of an mRNA.
- the obtainable mRNA may, in turn, be translated for production of a desired peptide or protein encoded by the open reading frame.
- the artificial nucleic acid molecule is a DNA, it may, for example, be used as a double-stranded storage form for continued and repetitive in vitro or in vivo production of mRNA.
- in vitro refers in particular to ("living") cells and/or tissue, including tissue of a living subject.
- Cells include in particular cell lines, primary cells, cells in tissue or subjects.
- cell types allowing cell culture may be suitable for the present invention.
- Particularly preferred are mammalian cells, e.g. human cells and mouse cells.
- the human cell lines HeLa, HEPG2 and U-937 and the mouse cell lines NIH3T3, JAWSII and L929 are used.
- primary cells are particularly preferred, in particular preferred embodiments human dermal fibroblasts (HDF) may be used.
- a preferred group of cell lines comprises
- tissue of a subject may be used.
- the artificial nucleic acid molecule according to the present invention further comprises a poly(A) sequence.
- a DNA molecule comprising an ORF, optionally followed by a 3' UTR may contain a stretch of thymidine nucleotides which can be transcribed into a poly(A) sequence in the resulting mRNA.
- the length of the poly(A) sequence may vary.
- the poly(A) sequence may have a length of about 20 adenine nucleotides up to about 300 adenine nucleotides, preferably of about 40 to about 200 adenine nucleotides, more preferably from about 50 to about 1 00 adenine nucleotides, such as about 60, 70, 80, 90 or 100 adenine nucleotides.
- the inventive nucleic acid comprises a poly(A) sequence of about 60 to about 70 nucleotides, most preferably 64 adenine nucleotides.
- RNA-molecules may also be obtainable in vitro by common methods of chemical- synthesis without being necessarily transcribed from a DNA-progenitor.
- the artificial nucleic acid molecule according to the present invention is an RNA molecule, preferably an mRNA molecule comprising in 5'-to- 3'-direction an open reading frame, a 3'-UTR element as described above and a poly(A) sequence or comprising in 5'-to-3'-direction a 5'-UTR element as described above, an open reading frame and a poly(A) sequence.
- the open reading frame is derived from a gene, which is distinct from the gene from which the 3'-UTR element and/or the 5'-UTR element of the inventive artificial nucleic acid is derived.
- the open reading frame does not code for a gene selected from the group consisting of ZNF460, TGM2, IL7R, BGN, TK1 , RAB3B, CBX6, FZD2, COL8A1 , NDUFS7, PHGDH, PLK2, TSPO, PTGS1 , FBX032, NID2, ATP5D, EXOSC4, NOL9, UBB4B, VPS1 8, ORMDL2, FSCN 1 , TMEM33, TUBA4A, EMP3, TMEM201 , CRIP2, BRAT1 , SERPINH1 , CD9, DPYSL2, CDK9, TFRC, PSMB3, FASN, PSMB6, PRSS56, KPNA6, SFT2D2, PARD6B, LPP, SPARC, SCAND1 , VASN, SLC26A1 , LCLAT1 , FBXL1 8, SLC35F6, RAB3D, MAPI B, VMA
- the ORF does not encode human or plant, in particular Arabidopsis, ribosomal proteins, in particular does not encode human ribosomal protein S6 (RPS6), human ribosomal protein L36a-like (RPL36AL) or Arabidopsis ribosomal protein SI 6 (RPS1 6).
- the open reading frame does not encode ribosomal protein S6 (RPS6), ribosomal protein L36a-like (RPL36AL) or ribosomal protein S1 6 (RPS1 6) of whatever origin.
- the invention provides an artificial DNA molecule comprising an open reading frame, preferably an open reading frame derived from a gene, which is distinct from the gene from which the 3'-UTR element and/or the 5'-UTR element is derived; a 3'-UTR element comprising or consisting of a sequence which has at least about 60%, preferably at least about 70%, more preferably at least about 80%, more preferably at least about 90%, even more preferably at least about 95%; even more preferably at least 99%; even more preferably 100% sequence identity to a DNA sequence selected from the group consisting of sequences according to SEQ ID NO: 1 52, SEQ ID NO: 1 53, SEQ ID NO: 1 54, SEQ ID NO: 1 55, SEQ ID NO: 1 56, SEQ ID NO: 1 57, SEQ ID NO: 1 58, SEQ ID NO: 1 59, SEQ ID NO: 1 60, SEQ ID NO: 1 61 , SEQ ID NO: 1 64, SEQ ID NO: 1 65, SEQ ID
- the invention provides an artificial RNA molecule, preferably an artificial mRNA molecule or an artificial viral RNA molecule, comprising an open reading frame, preferably an open reading frame is derived from a gene, which is distinct from the gene from which the 3'-UTR element and/or the 5'-UTR element is derived; a 3'-UTR element comprising or consisting of a sequence which has at least about 60%, preferably at least about 70%, more preferably at least about 80%, more preferably at least about 90%, even more preferably at least about 95%; even more preferably at least 99%; even more preferably 100% sequence identity to an RNA sequence corresponding to a DNA sequence selected from the group consisting of sequences according to SEQ ID NO: 152, SEQ ID NO
- SEQ ID NO: 153 SEQ ID NO: 154, SEQ ID NO 155, SEQ ID NO 156, SEQ ID NO: 157, SEQ ID NO 158, SEQ ID NO: 159, SEQ ID NO 160, SEQ ID NO 161, SEQ ID NO: 164, SEQ ID NO 165, SEQ ID NO: 167, SEQ ID NO 168, SEQ ID NO 169, SEQ ID NO: 170, SEQ ID NO 171, SEQ ID NO: 172, SEQ ID NO 173; SEQ ID NO 174, SEQ ID NO: 175, SEQ ID NO 176, SEQ ID NO: 179, SEQ ID NO 180, SEQ ID NO 181, SEQ ID NO: 182, SEQ ID NO 183, SEQ ID NO: 184, SEQ ID NO 187, SEQ ID NO 188, SEQ ID NO: 189, SEQ ID NO
- SEQ ID NO: 191 SEQ ID NO: 204 (alternatively SEQ ID NO: 192), SEQ ID NO: 193, SEQ ID NO: 194, SEQ ID NO: 195, SEQ ID NO: 196, SEQ ID NO: 197, SEQ ID NO: 198, SEQ ID NO: 199, SEQ ID NO: 200, SEQ ID NO: 201, SEQ ID NO: 202, SEQ ID NO: 203, SEQ ID NO: 177, and/or a 5'-UTR element comprising or consisting of a sequence which has at least about 60%, preferably at least about 70%, more preferably at least about 80%, more preferably at least about 90%, even more preferably at least about 95%; even more preferably at least 99%; even more preferably 1 00% sequence identity to an RNA sequence corresponding to a DNA sequence selected from the group consisting of sequences according to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 1 37 (alternatively SEQ ID NO:
- the invention provides an artificial nucleic acid molecule, preferably an artificial mRNA, which may be characterized by high translation efficiency. Without being bound by any theory, high translation efficiency may result from reduction in degradation of the artificial nucleic acid molecule, such as an artificial mRNA molecule according to the present invention. Accordingly, the inventive 3'-UTR element and/or the inventive 5'-UTR element may prevent the artificial nucleic acid from degradation and decay.
- the artificial nucleic acid molecule may additionally comprise a histone stem- loop.
- an artificial nucleic acid molecule according to the present invention may, for example, comprise in 5'-to-3'-direction an ORF, a 3'-UTR element, an optional histone stem-loop sequence, an optional poly(A) sequence or polyadenylation signal and an optional poly(C) sequence or in 5'-to-3'-direction an 5'-UTR element, an ORF, an optional histone stem-loop sequence, an optional poly(A) sequence or polyadenylation signal and an optional poly(C) sequence or in 5'-to-3'-direction an 5'-UTR element, an ORF, a 3'-UTR element, an optional histone stem-loop sequence, an optional poly(A) sequence or polyadenylation signal and an optional poly(C) sequence.
- It may also comprise in 5'-to-3'- direction an ORF, an 3'-UTR element, an optional poly(A) sequence, an optional poly (C) sequence and an optional histone stem-loop sequence, or in 5'-to-3'-direction an 5'-UTR element, an ORF, an optional poly(A) sequence, an optional poly(C) sequence and an optional histone stem-loop sequence, or in 5'-to-3'-direction an 5'-UTR element, an ORF, a 3'-UTR element, an optional poly(A) sequence, an optional poly(C) sequence and an optional histone stem-loop sequence.
- the artificial nucleic acid molecule according to the invention further comprises at least one histone stem-loop sequence.
- histone stem-loop sequences are preferably selected from histone stem-loop sequences as disclosed in WO 201 2/019780, whose disclosure is incorporated herewith by reference.
- a histone stem-loop sequence suitable to be used within the present invention, is preferably selected from at least one of the following formulae (I) or (II): formula (I) (stem-loop sequence without stem bordering elements):
- steml loop stem2 formula (II) (stem-loop sequence with stem bordering elements):
- steml or stem2 bordering elements Ni is a consecutive sequence of 1 to 6, preferably of 2 to 6, more preferably of 2 to 5, even more preferably of 3 to 5, most preferably of 4 to 5 or 5 N, wherein each N is independently from another selected from a nucleotide selected from A, U, T, C and C, or a nucleotide analogue thereof;
- N0-2G N3-5 is reverse complementary or partially reverse complementary with element stem2, and is a consecutive sequence between of 5 to 7 nucleotides; wherein N0-2 is a consecutive sequence of 0 to 2, preferably of 0 to 1 , more preferably of 1 N, wherein each N is independently from another selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof; wherein N3-5 is a consecutive sequence of 3 to 5, preferably of 4 to 5, more preferably of 4 N, wherein each N is independently from another selected from a nucleotide selected from A, U,
- loop sequence [N (UAT)N 0 is located between elements steml and stem2, and is a consecutive sequence of 3 to 5 nucleotides, more preferably of 4 nucleotides; wherein each N0-4 is independent from another a consecutive sequence of 0 to 4, preferably of 1 to 3, more preferably of 1 to 2 N, wherein each N is independently from another selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof; and wherein U/T represents uridine, or optionally thymidine; stem2 [N3-5CN0 is reverse complementary or partially reverse complementary with element steml , and is a consecutive sequence between of 5 to 7
- each N is independently from another selected from a nucleotide selected from A, U, T, G or C or a nucleotide analogue thereof; and wherein C is cytidine or an analogue thereof, and may be optionally replaced by a guanosine or an analogue thereof provided that its complementary nucleoside guanosine in steml is replaced by cytidine;
- steml and stem2 are capable of base pairing with each other forming a reverse complementary sequence, wherein base pairing may occur between steml and stem2, e.g. by Watson-Crick base pairing of nucleotides A and U/T or G and C or by non-Watson-Crick base pairing e.g. wobble base pairing, reverse Watson-Crick base pairing, Hoogsteen base pairing, reverse Hoogsteen base pairing or are capable of base pairing with each other forming a partially reverse complementary sequence, wherein an incomplete base pairing may occur between steml and stem2, on the basis that one or more bases in one stem do not have a complementary base in the reverse complementary sequence of the other stem.
- histone stem-loop sequence may be selected according to at least one of the following specific formulae (la) or (Ma): formula (la) (stem-loop sequence without stem bordering elements):
- loop stem2 (Ha) (stem-loop sequence with stem bordering elements):
- N, C, G, T and U are as defined above.
- the artificial nucleic acid molecule sequence may comprise at least one histone stem-loop sequence according to at least one of the following specific formulae (lb) or (Mb): formula (lb) (stem-loop sequence without stem bordering elements):
- a particular preferred histone stem-loop sequence is the sequence according to SEQ ID NO: 209: CAAAGGCTCTTTTCAGAGCCACCA or more preferably the corresponding RNA sequence of the nucleic acid sequence according to SEQ ID NO: 209.
- the single elements may be present in the artificial nucleic acid molecule in the following order:
- the artificial nucleic acid molecule comprises further elements such as a 5'-cap, a poly(C) sequence and/or an IRES-motif.
- a 5'-cap may be added during transcription or post-transcriptionally to the 5'end of an RNA.
- the inventive artificial nucleic acid molecule particularly if the nucleic acid is in the form of an mRNA or codes for an mRNA, may be modified by a sequence of at least 10 cytidines, preferably at least 20 cytidines, more preferably at least 30 cytidines (so-called "poly(C) sequence").
- the inventive artificial nucleic acid molecule may contain, especially if the nucleic acid is in the form of an (m)RNA or codes for an mRNA, a poly(C) sequence of typically about 1 0 to 200 cytidine nucleotides, preferably about 10 to 1 00 cytidine nucleotides, more preferably about 1 0 to 70 cytidine nucleotides or even more preferably about 20 to 50 or even 20 to 30 cytidine nucleotides.
- the inventive nucleic acid comprises a poly(C) sequence of 30 cytidine residues.
- the artificial nucleic acid molecule according to the present invention comprises, preferably i n 5'-to-3' direction, at least one 5'-UTR element as described above, an ORF, at least one 3'-UTR element as described above, a poly(A) sequence or a polyadenylation signal, and a poly(C) sequence or, in 5'-to-3' direction, optional ly a further 5'-UTR, an ORF, at least one 3'-UTR element as described above, a poly(A) sequence or a polyadenylation signal, and a poly(C) sequence, or, i n 5'-to-3' direction, at least one 5'-UTR element as described above, an ORF, optional ly a further 3'-UTR, a poly(A) sequence or a polyadenylation signal, and a poly(C) sequence .
- IRES internal ribosome entry site
- IRES-motif may separate several open readi ng frames, for example if the artificial nucleic acid molecule encodes for two or more peptides or proteins.
- An I RES-sequence may be particularly helpful if the artificial nucleic acid molecule is a bi- or mu lticistronic nucleic acid molecule.
- the artificial nucleic acid molecule may comprise additional 5'-elements, preferably a promoter or a promoter containing-sequence.
- the promoter may drive and or regulate transcription of the artificial nucleic acid molecule according to the present invention, for example of an artificial DNA-molecule accordi ng to the present invention.
- the artificial nucleic acid molecule according to the present invention is at least partial ly G/C modified.
- the inventive artificial nucleic acid molecule may be thermodynamically stabi l ized by modifyi ng the G (guanosine)/C (cytidine) content of the molecule.
- the G/C content of the open reading frame of an artificial nucleic acid molecule accordi ng to the present invention may be increased compared to the G/C content of the open reading frame of a correspondi ng wi ld- type sequence, preferably by using the degeneration of the genetic code.
- the encoded ami no acid sequence of the artificial nucleic acid molecule is preferably not modified by the G/C modification compared to the coded ami no acid sequence of the particular wi ld- type sequence.
- the codons of the coding sequence or the whole artificial nucleic acid molecule, e.g. an mRNA, may therefore be varied compared to the wild-type coding sequence, such that they i nclude an i ncreased amount of G/C nucleotides whi le the translated amino acid sequence is maintai ned.
- the codi ng region of the inventive artificial nucleic acid molecule there are various possibi lities for modification of the nucleic acid sequence, e.g. the open reading frame, compared to its wi ld-type coding region.
- amino acids which are encoded by codons which contain exclusively G or C nucleotides, no modification of the codon is necessary.
- the codons for Pro CCC or CCG
- Arg CGC or CGG
- Ala GCC or GCG
- GGC or GGG Gly
- codons which contain A and/or U/T nucleotides may be modified by substitution of other codons which code for the same amino acids but contain no A and/or UAT.
- codons for Pro can be modified from CC(UAT) or CCA to CCC or CCG;
- the codons for Arg can be modified from CG(UAT) or CGA or AGA or AGG to CGC or CGG; the codons for Ala can be modified from GC(U/T) or GCA to GCC or GCG;
- the codons for Gly can be modified from GG(U/T) or GGA to GGC or GGG.
- a or (U/T) nucleotides cannot be elimi nated from the codons, it is however possible to decrease the A and (U T) content by using codons which contain a lower content of A and/or (UAT) nucleotides. Examples of these are:
- the codons for Phe can be modified from (UAT) (U T) (U/T) to (UAT) (U/T)C;
- the codons for Leu can be modified from (U/T) (UAT) A, (UAT) (UAT)G, C(UAT) (UAT) or C(U/T)A to C(UAT)C or C(UAT)G;
- the codons for Ser can be modified from (UAT)C(UAT) or (UAT)CA or AG (UAT) to (UAT)CC, (U T)CG or AGC;
- the codon for Tyr can be modified from (U/T)A(U T) to (U/T)AC;
- the codon for Cys can be modified from (U T)G(U T) to (U/T)GC;
- the codon for His can be modified from CA(U T) to CAC;
- the codon for Gin can be modified from CAA to CAG;
- the codons for lie can be modified from A(U T)(U/T) or A(U/T)A to A(U T)C;
- codons for Thr can be modified from AC(UAT) or ACA to ACC or ACG;
- the codon for Asn can be modified from AA(UAT) to AAC;
- the codon for Lys can be modified from AAA to AAG;
- the codons for Val can be modified from G(U/T)(U/T) or G(UAT)A to G(U/T)C or G(U/T)G; the codon for Asp can be modified from GA(U/T) to GAC;
- the codon for Glu can be modified from GAA to GAG;
- the stop codon (U/T)AA can be modified to (U T)AG or (U/T)GA.
- the codons for Met (A(U/T)G) and Trp ((U/T)GG) on the other hand, there is no possibility of sequence modification without altering the encoded amino acid sequence.
- substitutions listed above can be used either individually or in all possible combinations to increase the G/C content of the open reading frame of the inventive artificial nucleic acid molecule as defined herein, compared to its particular wild-type open reading frame (i.e. the original sequence).
- all codons for Thr occurring in the wild-type sequence can be modified to ACC (or ACG).
- the G/C content of the open reading frame of the inventive artificial nucleic acid molecule as defined herein is increased by at least 7%, more preferably by at least 15%, particularly preferably by at least 20%, compared to the G/C content of the wild-type coding region without altering the encoded amino acid sequence, i.e. using the degeneracy of the genetic code.
- At least 5%, 10%, 20%, 30%, 40%, 50%, 60%, more preferably at least 70 %, even more preferably at least 80% and most preferably at least 90%, 95% or even 1 00% of the substitutable codons in the open reading frame of the inventive artificial nucleic acid molecule or a fragment, variant or derivative thereof are substituted, thereby increasing the G/C content of said open reading frame.
- the open readi ng frame is preferably at least partially codon-optimized. Codon-optimization is based on the finding that the translation efficiency may be determined by a different frequency in the occurrence of transfer RNAs (tRNAs) in cel ls.
- the open readi ng frame of the inventive artificial nucleic acid molecule is preferably modified compared to the corresponding wi ld-type coding region such that at least one codon of the wild-type sequence which codes for a tRNA which is relatively rare in the cel l is exchanged for a codon which codes for a tRNA which is comparably frequent in the cel l and carries the same amino acid as the relatively rare tRNA.
- the open readi ng frame of the inventive artificial nucleic acid molecule as defi ned herein is modified such that codons for which frequently occurring tRNAs are avai lable may replace codons which correspond to rare tRNAs.
- all codons of the wild-type open reading frame which code for a rare tRNA may be exchanged for a codon which codes for a tRNA which is more frequent in the cel l and which carries the same amino acid as the rare tRNA.
- Which tRNAs occur relatively frequently in the cel l and which, in contrast, occur relatively rarely is known to a person skil led in the art; cf. e.g. Akashi, Curr. Opin. Genet. Dev. 2001 , 1 1 (6): 660-666.
- the open readi ng frame is codon-optimized, preferably with respect to the system i n which the artificial nucleic acid molecule accordi ng to the present invention is to be expressed, preferably with respect to the system i n which the artificial nucleic acid molecule accordi ng to the present i nvention is to be translated.
- the codon usage of the open readi ng frame is codon-optimized accordi ng to mammal ian codon usage, more preferably according to human codon usage.
- the open readi ng frame is codon-optimized and G/C-content modified. For further improving degradation resistance, e.g.
- the artificial nucleic acid molecule may further comprise modifications, such as backbone modifications, sugar modifications and/or base modifications, e.g., lipid- modifications or the like.
- modifications such as backbone modifications, sugar modifications and/or base modifications, e.g., lipid- modifications or the like.
- the transcription and/or the translation of the artificial nucleic acid molecule according to the present invention is not significantly impaired by said modifications.
- nucleotide analogues are defined as natively and non-natively occurring variants of the naturally occurring nucleotides adenosine, cytosine, thymidine, guanosine and uridine. Accordingly, analogues are e.g. chemically derivatized nucleotides with non-natively occurring functional groups, which are preferably added to or deleted from the naturally occurring nucleotide or which substitute the naturally occurring functional groups of a nucleotide.
- each component of the naturally occurring nucleotide may be modified, namely the base component, the sugar (ribose) component and/or the phosphate component forming the backbone (see above) of the RNA sequence.
- Analogues of guanosine, uridine, adenosine, thymidine and cytosine include, without implying any limitation, any natively occurring or non-natively occurring guanosine, uridine, adenosine, thymidine or cytosine that has been altered e.g.
- analogue as described above, particular preference may be given according to certain embodiments of the invention to those analogues that increase the protein expression of the encoded peptide or protein or that increase the immunogenicity of the artificial nucleic acid molecule of the invention and/or do not interfere with a further modification of the artificial nucleic acid molecule that has been introduced.
- the artificial nucleic acid molecule of the present invention can contain a lipid modification.
- the artificial nucleic acid molecule comprises, preferably from 5' to 3' direction, the following elements:
- a 5'-UTR element which provides high translation efficiency to said artificial nucleic acid molecule, preferably a nucleic acid sequence according to any of SEQ ID NO: 1 to 1 51 ; or a further 5'-UTR, preferably a 5'-TOP UTR;
- ORF open reading frame
- the ORF preferably comprises at least one modification with respect to the wild-type sequence
- a 3'-UTR element which provides high translation efficiency to said artificial nucleic acid molecule, preferably a nucleic acid sequence accordi ng to any of SEQ ID NO: 1 52 to 204; or a further 3'-UTR, preferably an albumin7 3'-UTR;
- a poly(A) sequence preferably comprisi ng 64 adenylates
- a poly(C) sequence preferably comprisi ng 30 cytidylates
- the artificial nucleic acid molecule according to the i nvention may further comprise one or more of the modifications described in the followi ng:
- modification as used herein with regard to the artificial nucleic acid molecule may refer to chemical modifications comprisi ng backbone modifications as wel l as sugar modifications or base modifications.
- the artificial nucleic acid molecule may contain nucleotide analogues/modifications, e.g. backbone modifications, sugar modifications or base modifications.
- a backbone modification in connection with the present i nvention is a modification, i n which phosphates of the backbone of the nucleotides contai ned i n a nucleic acid molecule as defined herei n are chemically modified.
- a sugar modification in connection with the present invention is a chemical modification of the sugar of the nucleotides of the nucleic acid molecule as defined herein.
- a base modification i n connection with the present invention is a chemical modification of the base moiety of the nucleotides of the nucleic acid molecule of the nucleic acid molecule.
- nucleotide analogues or modifications are preferably selected from nucleotide analogues which are applicable for transcription and/or translation.
- modified nucleosides and nucleotides which may be incorporated into the artificial nucleic acid molecule, preferably an RNA, as described herei n, can be modified in the sugar moiety.
- “Deoxy” modifications include hydrogen, amino (e.g. Nh ; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, di heteroaryl amino, or ami no acid); or the amino group can be attached to the sugar through a l inker, wherei n the l inker comprises one or more of the atoms C, N, and O.
- amino e.g. Nh ; alkylamino, dialkylamino, heterocyclyl, arylamino, diaryl amino, heteroaryl amino, di heteroaryl amino, or ami no acid
- the sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the correspondi ng carbon in ribose.
- a modified nucleic acid molecule can include nucleotides contai ning, for instance, arabinose as the sugar.
- the phosphate backbone may further be modified in the modified nucleosides and nucleotides, which may be incorporated into the artificial nucleic acid molecule, preferably an RNA, as described herei n.
- the phosphate groups of the backbone can be modified by replacing one or more of the oxygen atoms with a different substituent.
- the modified nucleosides and nucleotides can i nclude the full replacement of an unmodified phosphate moiety with a modified phosphate as described herein.
- modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, borano phosphates, borano phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates and phosphotriesters.
- Phosphorodithioates have both non-linking oxygens replaced by sulfur.
- the phosphate linker can also be modified by the replacement of a li nki ng oxygen with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylene-phosphonates).
- the modified nucleosides and nucleotides which may be incorporated into the artificial nucleic acid molecule, preferably an RNA molecule, as described herein, can further be modified in the nucleobase moiety.
- nucleobases found in RNA include, but are not l imited to, adeni ne, guanine, cytosine and uraci l.
- the nucleosides and nucleotides described herei n can be chemically modified on the major groove face.
- the major groove chemical modifications can i nclude an amino group, a thiol group, an alkyl group, or a halo group.
- the nucleotide analogues/modifications are selected from base modifications, which are preferably selected from 2-amino-6-chloropurineriboside-5 '-triphosphate, 2-aminopuri ne-riboside-5 '- tri phosphate; 2-ami noadenosi ne-5 '-triphosphate, 2 '-ami no-2 '-deoxycytidine-triphosphate, 2-thiocytidine-5 '-triphosphate, 2-thiouridine-5 '-triphosphate, 2 '-fluorothymidine-5 '- triphosphate, 2 '-0-methyli nosine-5'-triphosphate 4-thiouridine-5 '-triphosphate, 5- aminoal lylcytidi ne-5 '-triphosphate, 5-aminoal lyluridine-5 '-triphosphate, 5-bromocytidine- 5 '-triphosphate, 5-bromouridine-5 '-triphosphate,
- nucleotides for base modifications selected from the group of base- modified nucleotides consisti ng of 5-methylcytidine-5 '-triphosphate, 7-deazaguanosi ne-5'- triphosphate, 5-bromocytidine-5 '-triphosphate, and pseudouridine-5'-triphosphate.
- modified nucleosides include pyridin-4-one ribonucleoside, 5-aza- uridi ne, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridi ne, 5- hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1 -carboxymethyl- pseudouridi ne, 5-propynyl-uridine, 1 -propynyl-pseudouridine, 5-tauri nomethyluridi ne, 1 - taurinomethyl-pseudouridi ne, 5-taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio- uridi ne, 5-methyl-uridine, 1 -methyl-pseudouridine, 4-thio-1 -methyl-pseudouridi n
- modified nucleosides include 5-aza-cytidine, pseudoisocytidine, 3- methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5- hydroxymethylcytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4- thio-1 -methyl-pseudoisocytidine, 4-thio-l -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 - deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebula
- modified nucleosides include 2-aminopurine, 2,6-diaminopurine, 7- deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2- aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 - methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis- hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6- glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6
- modified nucleosides include inosine, 1 -methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7- deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl- guanosine, 7-methylinosine, 6-methoxy-guanosine, 1 -methylguanosine, N2- methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio- guanosine.
- the nucleotide can be modified on the major groove face and can include replaci ng hydrogen on C-5 of uraci l with a methyl group or a halo group.
- a modified nucleoside is 5 '-0-(1 -thiophosphate)-adenosine, 5 '-0-(1 - thiophosphate)-cytidine, 5 '-0-(1 -thiophosphate)-guanosine, 5'-0-(1 -thiophosphate)-uridi ne or 5 '-0-(1 -thiophosphate)-pseudouridi ne.
- the artificial nucleic acid molecule may comprise nucleoside modifications selected from 6-aza-cytidi ne, 2-thio- cytidine, a-thio-cytidine, pseudo-iso-cytidine, 5-ami noallyl-uridine, 5-iodo-uridine, N1 - methyl-pseudouridine, 5,6-dihydrouridi ne, a-thio-uridi ne, 4-thio-uridine, 6-aza-uridi ne, 5- hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, i nosine, a-thio- guanosi ne, 6-methyl-guanosine, 5-methyl-cytdine, 8-oxo-guanosi ne, 7-deaza-guanosine, N 1 -methyl-adenosine
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Rheumatology (AREA)
- Pain & Pain Management (AREA)
- Developmental Biology & Embryology (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (15)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2018110872A RU2772349C2 (ru) | 2015-08-28 | 2016-08-22 | Искусственные молекулы нуклеиновой кислоты |
| ES16759979T ES2924739T3 (es) | 2015-08-28 | 2016-08-22 | Moléculas de ácido nucleico artificiales |
| CN202210036661.4A CN114381470A (zh) | 2015-08-28 | 2016-08-22 | 人工核酸分子 |
| KR1020187008732A KR102645398B1 (ko) | 2015-08-28 | 2016-08-22 | 신규 인공 핵산 분자 |
| EP16759979.4A EP3341482B1 (en) | 2015-08-28 | 2016-08-22 | Artificial nucleic acid molecules |
| CA2992801A CA2992801A1 (en) | 2015-08-28 | 2016-08-22 | Artificial nucleic acid molecules |
| MX2018001040A MX395421B (es) | 2015-08-28 | 2016-08-22 | Moleculas de acido nucleico artificiales. |
| US15/755,739 US12258567B2 (en) | 2015-08-28 | 2016-08-22 | Artificial nucleic acid molecules |
| EP22176444.2A EP4108774A1 (en) | 2015-08-28 | 2016-08-22 | Artificial nucleic acid molecules |
| DK16759979.4T DK3341482T3 (da) | 2015-08-28 | 2016-08-22 | Kunstige nukleinsyremolekyler |
| AU2016316439A AU2016316439B2 (en) | 2015-08-28 | 2016-08-22 | Artificial nucleic acid molecules |
| CN201680049973.1A CN108026537B (zh) | 2015-08-28 | 2016-08-22 | 人工核酸分子 |
| BR112018001995-0A BR112018001995B1 (pt) | 2015-08-28 | 2016-08-22 | Molécula de ácido nucleico artificial, vetor, composição farmacêutica, método para aumentar a eficiência de tradução de uma molécula de ácido nucleico artificial, uso in vitro de um elemento 3´-utr e kit |
| JP2018511127A JP7304155B2 (ja) | 2015-08-28 | 2016-08-22 | 人工核酸分子 |
| US19/026,182 US20250171789A1 (en) | 2015-08-28 | 2025-01-16 | Artificial nucleic acid molecules |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP2015001755 | 2015-08-28 | ||
| EPPCT/EP2015/001755 | 2015-08-28 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/755,739 A-371-Of-International US12258567B2 (en) | 2015-08-28 | 2016-08-22 | Artificial nucleic acid molecules |
| US19/026,182 Continuation US20250171789A1 (en) | 2015-08-28 | 2025-01-16 | Artificial nucleic acid molecules |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017036580A1 true WO2017036580A1 (en) | 2017-03-09 |
Family
ID=54064264
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2016/001417 Ceased WO2017036580A1 (en) | 2015-08-28 | 2016-08-22 | Artificial nucleic acid molecules |
Country Status (12)
| Country | Link |
|---|---|
| US (2) | US12258567B2 (cg-RX-API-DMAC7.html) |
| EP (2) | EP4108774A1 (cg-RX-API-DMAC7.html) |
| JP (2) | JP7304155B2 (cg-RX-API-DMAC7.html) |
| KR (1) | KR102645398B1 (cg-RX-API-DMAC7.html) |
| CN (2) | CN108026537B (cg-RX-API-DMAC7.html) |
| AU (1) | AU2016316439B2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2992801A1 (cg-RX-API-DMAC7.html) |
| DK (1) | DK3341482T3 (cg-RX-API-DMAC7.html) |
| ES (1) | ES2924739T3 (cg-RX-API-DMAC7.html) |
| MX (1) | MX395421B (cg-RX-API-DMAC7.html) |
| SG (1) | SG10201913629VA (cg-RX-API-DMAC7.html) |
| WO (1) | WO2017036580A1 (cg-RX-API-DMAC7.html) |
Cited By (63)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018033254A2 (en) | 2016-08-19 | 2018-02-22 | Curevac Ag | Rna for cancer therapy |
| WO2018115507A2 (en) | 2016-12-23 | 2018-06-28 | Curevac Ag | Henipavirus vaccine |
| WO2018167320A1 (en) | 2017-03-17 | 2018-09-20 | Curevac Ag | Rna vaccine and immune checkpoint inhibitors for combined anticancer therapy |
| WO2018172556A1 (en) * | 2017-03-24 | 2018-09-27 | Curevac Ag | Nucleic acids encoding crispr-associated proteins and uses thereof |
| WO2019038332A1 (en) | 2017-08-22 | 2019-02-28 | Curevac Ag | VACCINE AGAINST BUNYAVIRUS |
| WO2019077001A1 (en) * | 2017-10-19 | 2019-04-25 | Curevac Ag | NEW ARTIFICIAL NUCLEIC ACID MOLECULES |
| WO2019092153A1 (en) | 2017-11-08 | 2019-05-16 | Curevac Ag | Rna sequence adaptation |
| WO2019115635A1 (en) | 2017-12-13 | 2019-06-20 | Curevac Ag | Flavivirus vaccine |
| WO2019122371A1 (en) | 2017-12-21 | 2019-06-27 | Curevac Ag | Linear double stranded dna coupled to a single support or a tag and methods for producing said linear double stranded dna |
| WO2019193183A2 (en) | 2018-04-05 | 2019-10-10 | Curevac Ag | Novel yellow fever nucleic acid molecules for vaccination |
| US10501768B2 (en) | 2015-07-13 | 2019-12-10 | Curevac Ag | Method of producing RNA from circular DNA and corresponding template DNA |
| US10517827B2 (en) | 2015-05-20 | 2019-12-31 | Curevac Ag | Dry powder composition comprising long-chain RNA |
| WO2020002525A1 (en) | 2018-06-27 | 2020-01-02 | Curevac Ag | Novel lassa virus rna molecules and compositions for vaccination |
| US10610605B2 (en) | 2012-02-15 | 2020-04-07 | Curevac Ag | Nucleic acid comprising or coding for a histone stem-loop and a poly(A) sequence or a polyadenylation signal for increasing the expression of an encoded therapeutic protein |
| US10653768B2 (en) | 2015-04-13 | 2020-05-19 | Curevac Real Estate Gmbh | Method for producing RNA compositions |
| WO2020128031A2 (en) | 2018-12-21 | 2020-06-25 | Curevac Ag | Rna for malaria vaccines |
| US10729654B2 (en) | 2015-05-20 | 2020-08-04 | Curevac Ag | Dry powder composition comprising long-chain RNA |
| WO2020161342A1 (en) | 2019-02-08 | 2020-08-13 | Curevac Ag | Coding rna administered into the suprachoroidal space in the treatment of ophtalmic diseases |
| US10760070B2 (en) | 2015-05-29 | 2020-09-01 | Curevac Real Estate Gmbh | Method for producing and purifying RNA, comprising at least one step of tangential flow filtration |
| US10780054B2 (en) | 2015-04-17 | 2020-09-22 | Curevac Real Estate Gmbh | Lyophilization of RNA |
| WO2020254535A1 (en) | 2019-06-18 | 2020-12-24 | Curevac Ag | Rotavirus mrna vaccine |
| CN112292395A (zh) * | 2018-04-17 | 2021-01-29 | 库瑞瓦格股份公司 | 用于疫苗接种的新型rsv rna分子和组合物 |
| WO2021028439A1 (en) | 2019-08-14 | 2021-02-18 | Curevac Ag | Rna combinations and compositions with decreased immunostimulatory properties |
| WO2021156267A1 (en) | 2020-02-04 | 2021-08-12 | Curevac Ag | Coronavirus vaccine |
| US11149278B2 (en) | 2014-12-12 | 2021-10-19 | Curevac Ag | Artificial nucleic acid molecules for improved protein expression |
| WO2021239880A1 (en) | 2020-05-29 | 2021-12-02 | Curevac Ag | Nucleic acid based combination vaccines |
| WO2022023559A1 (en) | 2020-07-31 | 2022-02-03 | Curevac Ag | Nucleic acid encoded antibody mixtures |
| WO2022043551A2 (en) | 2020-08-31 | 2022-03-03 | Curevac Ag | Multivalent nucleic acid based coronavirus vaccines |
| RU2775176C2 (ru) * | 2017-03-24 | 2022-06-28 | Куревак Аг | Нуклеиновые кислоты, кодирующие ассоциированные с crispr белки, и их применения |
| WO2022137133A1 (en) | 2020-12-22 | 2022-06-30 | Curevac Ag | Rna vaccine against sars-cov-2 variants |
| WO2022135993A2 (en) | 2020-12-22 | 2022-06-30 | Curevac Ag | Pharmaceutical composition comprising lipid-based carriers encapsulating rna for multidose administration |
| US11384375B2 (en) | 2015-04-30 | 2022-07-12 | Curevac Ag | Immobilized poly(n)polymerase |
| WO2022162027A2 (en) | 2021-01-27 | 2022-08-04 | Curevac Ag | Method of reducing the immunostimulatory properties of in vitro transcribed rna |
| WO2022200575A1 (en) | 2021-03-26 | 2022-09-29 | Glaxosmithkline Biologicals Sa | Immunogenic compositions |
| WO2022207862A2 (en) | 2021-03-31 | 2022-10-06 | Curevac Ag | Syringes containing pharmaceutical compositions comprising rna |
| WO2022233880A1 (en) | 2021-05-03 | 2022-11-10 | Curevac Ag | Improved nucleic acid sequence for cell type specific expression |
| WO2022256597A1 (en) | 2021-06-04 | 2022-12-08 | Translate Bio, Inc. | Assay for quantitative assessment of mrna capping efficiency |
| US11559570B2 (en) | 2015-05-15 | 2023-01-24 | CureVac SE | Prime-boost regimens involving administration of at least one mRNA construct |
| WO2023025404A1 (en) | 2021-08-24 | 2023-03-02 | BioNTech SE | In vitro transcription technologies |
| US11608513B2 (en) | 2015-05-29 | 2023-03-21 | CureVac SE | Method for adding cap structures to RNA using immobilized enzymes |
| US11661634B2 (en) | 2015-05-08 | 2023-05-30 | CureVac Manufacturing GmbH | Method for producing RNA |
| WO2023144330A1 (en) | 2022-01-28 | 2023-08-03 | CureVac SE | Nucleic acid encoded transcription factor inhibitors |
| WO2023227608A1 (en) | 2022-05-25 | 2023-11-30 | Glaxosmithkline Biologicals Sa | Nucleic acid based vaccine encoding an escherichia coli fimh antigenic polypeptide |
| US11865084B2 (en) | 2016-12-23 | 2024-01-09 | CureVac SE | MERS coronavirus vaccine |
| DE202023106198U1 (de) | 2022-10-28 | 2024-03-21 | CureVac SE | Impfstoff auf Nukleinsäurebasis |
| WO2024068545A1 (en) | 2022-09-26 | 2024-04-04 | Glaxosmithkline Biologicals Sa | Influenza virus vaccines |
| WO2024084089A1 (en) | 2022-10-21 | 2024-04-25 | BioNTech SE | Methods and uses associated with liquid compositions |
| GB202404607D0 (en) | 2024-03-29 | 2024-05-15 | Glaxosmithkline Biologicals Sa | RNA formulation |
| WO2024098361A1 (zh) * | 2022-11-11 | 2024-05-16 | 斯微(上海)生物科技股份有限公司 | 人工核酸分子 |
| WO2024160936A1 (en) | 2023-02-03 | 2024-08-08 | Glaxosmithkline Biologicals Sa | Rna formulation |
| WO2024171052A1 (en) | 2023-02-14 | 2024-08-22 | Glaxosmithkline Biologicals Sa | Analytical method |
| US12109275B2 (en) | 2010-08-13 | 2024-10-08 | CureVac SE | Nucleic acid comprising or coding for a histone stem-loop and a poly(A) sequence or a polyadenylation signal for increasing the expression of an encoded protein |
| WO2024223728A1 (en) | 2023-04-27 | 2024-10-31 | Glaxosmithkline Biologicals Sa | Influenza virus vaccines |
| WO2024223724A1 (en) | 2023-04-27 | 2024-10-31 | Glaxosmithkline Biologicals Sa | Influenza virus vaccines |
| WO2024230934A1 (en) | 2023-05-11 | 2024-11-14 | CureVac SE | Therapeutic nucleic acid for the treatment of ophthalmic diseases |
| US12168050B2 (en) | 2016-05-04 | 2024-12-17 | CureVac SE | Compositions comprising a norovirus nucleic acid and methods of use thereof |
| WO2024260570A1 (en) | 2023-06-23 | 2024-12-26 | CureVac SE | Nucleic acid encoded antibodies |
| US12201680B2 (en) | 2012-02-15 | 2025-01-21 | CureVac SE | Nucleic acid comprising or coding for a histone stem-loop and a poly(A) sequence or a polyadenylation signal for increasing the expression of an encoded pathogenic antigen |
| US12227549B2 (en) | 2016-05-04 | 2025-02-18 | CureVac SE | RNA encoding a therapeutic protein |
| EP4361270A4 (en) * | 2021-06-24 | 2025-05-21 | Hanmi Pharm. Co., Ltd. | Non-natural 5'-untranslated region and 3'-untranslated region and use thereof |
| WO2025132839A1 (en) | 2023-12-21 | 2025-06-26 | Glaxosmithkline Biologicals Sa | Influenza virus vaccines |
| JP2025525578A (ja) * | 2022-07-19 | 2025-08-05 | 深▲セン▼深信生物科技有限公司 | 新型コロナウイルスSタンパク質のmRNAおよびその使用 |
| US12460204B2 (en) | 2012-03-27 | 2025-11-04 | CureVac SE | Artificial nucleic acid molecules for improved protein or peptide expression |
Families Citing this family (60)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012116714A1 (en) | 2011-03-02 | 2012-09-07 | Curevac Gmbh | Vaccination in elderly patients |
| US9974845B2 (en) | 2013-02-22 | 2018-05-22 | Curevac Ag | Combination of vaccination and inhibition of the PD-1 pathway |
| BR112016001192A2 (pt) | 2013-08-21 | 2017-08-29 | Curevac Ag | Vacina contra a raiva |
| BR112016003361A2 (pt) | 2013-08-21 | 2017-11-21 | Curevac Ag | vacina do vírus sincicial respiratório (rsv) |
| AU2014310935B2 (en) | 2013-08-21 | 2019-11-21 | CureVac SE | Combination vaccine |
| WO2015062738A1 (en) | 2013-11-01 | 2015-05-07 | Curevac Gmbh | Modified rna with decreased immunostimulatory properties |
| CA2935878C (en) | 2014-03-12 | 2023-05-02 | Curevac Ag | Combination of vaccination and ox40 agonists |
| HUE060907T2 (hu) | 2014-06-25 | 2023-04-28 | Acuitas Therapeutics Inc | Új lipidek és lipid nanorészecske formulációk nukleinsavak bevitelére |
| AU2016253972B2 (en) | 2015-04-27 | 2020-01-02 | Acuitas Therapeutics Inc. | Nucleoside-modified RNA for inducing an adaptive immune response |
| PT3313829T (pt) | 2015-06-29 | 2024-07-08 | Acuitas Therapeutics Inc | Formulações de lípidos e de nanopartículas lipídicas para a administração de ácidos nucleicos |
| US11225682B2 (en) | 2015-10-12 | 2022-01-18 | Curevac Ag | Automated method for isolation, selection and/or detection of microorganisms or cells comprised in a solution |
| HRP20230209T1 (hr) | 2015-10-28 | 2023-04-14 | Acuitas Therapeutics Inc. | Novi lipidi i lipidne formulacije nanočestica za isporuku nukleinskih kiselina |
| EP3373965A1 (en) | 2015-11-09 | 2018-09-19 | CureVac AG | Rotavirus vaccines |
| EP3701963A1 (en) | 2015-12-22 | 2020-09-02 | CureVac AG | Method for producing rna molecule compositions |
| EP3394280A1 (en) | 2015-12-23 | 2018-10-31 | CureVac AG | Method of rna in vitro transcription using a buffer containing a dicarboxylic acid or tricarboxylic acid or a salt thereof |
| US12612654B2 (en) | 2016-02-12 | 2026-04-28 | CureVac SE | Method for analyzing RNA |
| SG10201913630YA (en) | 2016-02-17 | 2020-03-30 | Curevac Ag | Zika virus vaccine |
| US11920174B2 (en) | 2016-03-03 | 2024-03-05 | CureVac SE | RNA analysis by total hydrolysis and quantification of released nucleosides |
| EP3448427A1 (en) | 2016-04-29 | 2019-03-06 | CureVac AG | Rna encoding an antibody |
| US12508308B2 (en) | 2016-05-04 | 2025-12-30 | CureVac SE | Influenza mRNA vaccines |
| CN109475640B (zh) | 2016-06-09 | 2023-03-10 | 库瑞瓦格欧洲公司 | 核酸被运载物的混合载运体 |
| US12491261B2 (en) | 2016-10-26 | 2025-12-09 | Acuitas Therapeutics, Inc. | Lipid nanoparticle formulations |
| WO2018096179A1 (en) | 2016-11-28 | 2018-05-31 | Curevac Ag | Method for purifying rna |
| EP3551230A1 (en) | 2016-12-08 | 2019-10-16 | CureVac AG | Rna for treatment or prophylaxis of a liver disease |
| WO2018104540A1 (en) | 2016-12-08 | 2018-06-14 | Curevac Ag | Rnas for wound healing |
| US11464847B2 (en) | 2016-12-23 | 2022-10-11 | Curevac Ag | Lassa virus vaccine |
| CA3049991A1 (en) | 2017-01-11 | 2018-07-19 | The Trustees Of The University Of Pennsylvania | Nucleoside-modified rna for inducing an immune response against zika virus |
| WO2018191657A1 (en) | 2017-04-13 | 2018-10-18 | Acuitas Therapeutics, Inc. | Lipids for delivery of active agents |
| US11596679B2 (en) | 2017-04-27 | 2023-03-07 | Vanderbilt University | Hepatitis C virus gene sequences and methods of use therefor |
| CN110799492B (zh) | 2017-04-28 | 2023-06-27 | 爱康泰生治疗公司 | 用于递送核酸的新型羰基脂质和脂质纳米颗粒制剂 |
| EP3625363A1 (en) | 2017-05-17 | 2020-03-25 | CureVac Real Estate GmbH | Method for determining at least one quality parameter of an rna sample |
| CA3073020A1 (en) | 2017-08-16 | 2019-02-21 | Acuitas Therapeutics, Inc. | Lipids for use in lipid nanoparticle formulations |
| WO2019036030A1 (en) | 2017-08-17 | 2019-02-21 | Acuitas Therapeutics, Inc. | LIPIDS FOR USE IN LIPID NANOPARTICLE FORMULATIONS |
| EP4501322A3 (en) | 2017-08-17 | 2025-04-16 | Acuitas Therapeutics, Inc. | Lipids for use in lipid nanoparticle formulations |
| WO2019036028A1 (en) | 2017-08-17 | 2019-02-21 | Acuitas Therapeutics, Inc. | LIPIDS FOR USE IN LIPID NANOPARTICULAR FORMULATIONS |
| WO2020002598A1 (en) | 2018-06-28 | 2020-01-02 | Curevac Ag | Bioreactor for rna in vitro transcription |
| PL3833786T3 (pl) * | 2018-08-10 | 2024-05-06 | Pantherna Therapeutics Gmbh | Konstrukt rekombinowanego kwasu nukleinowego |
| IL281615B2 (en) | 2018-09-21 | 2026-01-01 | Acuitas Therapeutics Inc | Systems and methods for producing lipid nanoparticles and liposomes |
| CA3116576A1 (en) | 2018-10-18 | 2020-04-23 | Acuitas Therapeutics, Inc. | Lipids for lipid nanoparticle delivery of active agents |
| TW202039534A (zh) | 2018-12-14 | 2020-11-01 | 美商美國禮來大藥廠 | KRAS變體mRNA分子 |
| SG11202106666UA (en) | 2018-12-21 | 2021-07-29 | Curevac Ag | Methods for rna analysis |
| CN110812366B (zh) * | 2019-11-18 | 2023-11-17 | 珠海丽凡达生物技术有限公司 | 一种可用于激素补充的mRNA药物及其制备方法 |
| CN114901360A (zh) | 2019-12-20 | 2022-08-12 | 库瑞瓦格股份公司 | 用于递送核酸的新型脂质纳米颗粒 |
| US12194089B2 (en) | 2020-02-04 | 2025-01-14 | CureVac SE | Coronavirus vaccine |
| US11241493B2 (en) | 2020-02-04 | 2022-02-08 | Curevac Ag | Coronavirus vaccine |
| CN111494631B (zh) * | 2020-04-27 | 2022-10-18 | 北京大学人民医院 | 一种原发性免疫性血小板减少症miRNA标记物及其应用 |
| ES3054438T3 (en) | 2020-07-16 | 2026-02-03 | Acuitas Therapeutics Inc | Cationic lipids for use in lipid nanoparticles |
| EP4379055A4 (en) * | 2021-07-27 | 2025-08-06 | Sk Bioscience Co Ltd | MRNA FOR PROTEIN EXPRESSION AND TEMPLATE FOR IT |
| EP4450628A4 (en) * | 2021-12-13 | 2025-10-22 | Sml Biopharm Co Ltd | NUCLEIC ACID EXPRESSION PLATFORM WITH INCREASED EXPRESSION EFFICIENCY |
| CA3242402A1 (en) | 2021-12-16 | 2023-06-22 | Acuitas Therapeutics, Inc. | Lipids for use in lipid nanoparticle formulations |
| CN115404238A (zh) * | 2021-12-22 | 2022-11-29 | 江苏拓弘康恒医药有限公司 | 高翻译稳定性BDNF mRNA的设计和制备方法 |
| CN114540307A (zh) * | 2022-02-16 | 2022-05-27 | 多莱泌生物科技(武汉)有限公司 | 一种靶向肝脏的工程化外泌体制备方法 |
| CN115845043B (zh) * | 2022-07-20 | 2025-07-29 | 安徽智飞龙科马生物制药有限公司 | 一种模板DNA分子及其在制备mRNA和疫苗中的应用 |
| CN115896141B (zh) * | 2022-08-08 | 2025-09-16 | 复旦大学附属妇产科医院 | Prss56蛋白表达和酶活调控在近视治疗中的应用 |
| CN120112637A (zh) * | 2022-11-11 | 2025-06-06 | 斯微(上海)生物科技股份有限公司 | 人工核酸分子 |
| US20250144234A1 (en) * | 2023-11-02 | 2025-05-08 | Capstan Therapeutics Inc. | RNA for In vivo Transfection with Increased Expression |
| WO2025113556A1 (zh) * | 2023-11-30 | 2025-06-05 | 传信生物医药(苏州)有限公司 | 用于提高rna分子的翻译性能的3'utr |
| CN117487809B (zh) * | 2023-12-29 | 2024-03-19 | 艾斯拓康医药科技(北京)有限公司 | 一种优化的5`utr序列及其应用 |
| CN117535295B (zh) * | 2024-01-09 | 2024-04-26 | 艾斯拓康医药科技(北京)有限公司 | 一种优化的3`utr序列及其应用 |
| WO2025201286A1 (zh) * | 2024-03-26 | 2025-10-02 | 北京剂泰医药科技有限公司 | 促进rna翻译的utr |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002098443A2 (de) * | 2001-06-05 | 2002-12-12 | Curevac Gmbh | Stabilisierte mrna mit erhöhtem g/ c- gehalt und otimierter codon usage für die gentherapie |
| WO2012019630A1 (en) * | 2010-08-13 | 2012-02-16 | Curevac Gmbh | Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded protein |
| WO2014164253A1 (en) * | 2013-03-09 | 2014-10-09 | Moderna Therapeutics, Inc. | Heterologous untranslated regions for mrna |
Family Cites Families (83)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5132418A (en) | 1980-02-29 | 1992-07-21 | University Patents, Inc. | Process for preparing polynucleotides |
| US4500707A (en) | 1980-02-29 | 1985-02-19 | University Patents, Inc. | Nucleosides useful in the preparation of polynucleotides |
| US4458066A (en) | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
| US4668777A (en) | 1981-03-27 | 1987-05-26 | University Patents, Inc. | Phosphoramidite nucleoside compounds |
| US4973679A (en) | 1981-03-27 | 1990-11-27 | University Patents, Inc. | Process for oligonucleo tide synthesis using phosphormidite intermediates |
| US4415732A (en) | 1981-03-27 | 1983-11-15 | University Patents, Inc. | Phosphoramidite compounds and processes |
| US4373071A (en) | 1981-04-30 | 1983-02-08 | City Of Hope Research Institute | Solid-phase synthesis of polynucleotides |
| US4401796A (en) | 1981-04-30 | 1983-08-30 | City Of Hope Research Institute | Solid-phase synthesis of polynucleotides |
| US5153319A (en) | 1986-03-31 | 1992-10-06 | University Patents, Inc. | Process for preparing polynucleotides |
| US5047524A (en) | 1988-12-21 | 1991-09-10 | Applied Biosystems, Inc. | Automated system for polynucleotide synthesis and purification |
| US5262530A (en) | 1988-12-21 | 1993-11-16 | Applied Biosystems, Inc. | Automated system for polynucleotide synthesis and purification |
| US5700642A (en) | 1995-05-22 | 1997-12-23 | Sri International | Oligonucleotide sizing using immobilized cleavable primers |
| US6436703B1 (en) * | 2000-03-31 | 2002-08-20 | Hyseq, Inc. | Nucleic acids and polypeptides |
| DE10162480A1 (de) | 2001-12-19 | 2003-08-07 | Ingmar Hoerr | Die Applikation von mRNA für den Einsatz als Therapeutikum gegen Tumorerkrankungen |
| DE10229872A1 (de) | 2002-07-03 | 2004-01-29 | Curevac Gmbh | Immunstimulation durch chemisch modifizierte RNA |
| DE10335833A1 (de) | 2003-08-05 | 2005-03-03 | Curevac Gmbh | Transfektion von Blutzellen mit mRNA zur Immunstimulation und Gentherapie |
| DE102004042546A1 (de) | 2004-09-02 | 2006-03-09 | Curevac Gmbh | Kombinationstherapie zur Immunstimulation |
| DE102005023170A1 (de) | 2005-05-19 | 2006-11-23 | Curevac Gmbh | Optimierte Formulierung für mRNA |
| DE102006035618A1 (de) | 2006-07-31 | 2008-02-07 | Curevac Gmbh | Nukleinsäure der Formel (I): GlXmGn, insbesondere als immunstimulierendes Adjuvanz |
| DE102006061015A1 (de) | 2006-12-22 | 2008-06-26 | Curevac Gmbh | Verfahren zur Reinigung von RNA im präparativen Maßstab mittels HPLC |
| DE102007001370A1 (de) | 2007-01-09 | 2008-07-10 | Curevac Gmbh | RNA-kodierte Antikörper |
| EP2135080A4 (en) | 2007-03-08 | 2010-12-01 | Switchgear Genomics | FUNCTIONAL NETWORKS FOR THE CHARACTERIZATION OF TREATMENT OF REGULATORY ELEMENTS IN NON-TRANSLATED REGIONS OF GENES |
| WO2009030254A1 (en) | 2007-09-04 | 2009-03-12 | Curevac Gmbh | Complexes of rna and cationic peptides for transfection and for immunostimulation |
| WO2009046738A1 (en) | 2007-10-09 | 2009-04-16 | Curevac Gmbh | Composition for treating lung cancer, particularly of non-small lung cancers (nsclc) |
| WO2009046739A1 (en) | 2007-10-09 | 2009-04-16 | Curevac Gmbh | Composition for treating prostate cancer (pca) |
| DK2176408T5 (en) | 2008-01-31 | 2015-12-14 | Curevac Gmbh | Nucleic acids comprising FORMULA (NuGiXmGnNv) a AND DERIVATIVES AS IMMUNE STIMULATING AGENTS / ADJUVANTS. |
| WO2010037408A1 (en) | 2008-09-30 | 2010-04-08 | Curevac Gmbh | Composition comprising a complexed (m)rna and a naked mrna for providing or enhancing an immunostimulatory response in a mammal and uses thereof |
| US20110053829A1 (en) | 2009-09-03 | 2011-03-03 | Curevac Gmbh | Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids |
| WO2011069529A1 (en) | 2009-12-09 | 2011-06-16 | Curevac Gmbh | Mannose-containing solution for lyophilization, transfection and/or injection of nucleic acids |
| KR101761388B1 (ko) | 2010-07-30 | 2017-07-25 | 큐어백 아게 | 트랜스펙션 및 면역 자극을 위한 이황화-크로스링크된 양이온 성분 및 핵산의 복합체 |
| WO2012089225A1 (en) | 2010-12-29 | 2012-07-05 | Curevac Gmbh | Combination of vaccination and inhibition of mhc class i restricted antigen presentation |
| WO2012116715A1 (en) | 2011-03-02 | 2012-09-07 | Curevac Gmbh | Vaccination in newborns and infants |
| WO2012113413A1 (en) | 2011-02-21 | 2012-08-30 | Curevac Gmbh | Vaccine composition comprising complexed immunostimulatory nucleic acids and antigens packaged with disulfide-linked polyethyleneglycol/peptide conjugates |
| WO2012116714A1 (en) | 2011-03-02 | 2012-09-07 | Curevac Gmbh | Vaccination in elderly patients |
| WO2013113325A1 (en) | 2012-01-31 | 2013-08-08 | Curevac Gmbh | Negatively charged nucleic acid comprising complexes for immunostimulation |
| EP2623121A1 (en) | 2012-01-31 | 2013-08-07 | Bayer Innovation GmbH | Pharmaceutical composition comprising a polymeric carrier cargo complex and an antigen |
| WO2013113326A1 (en) | 2012-01-31 | 2013-08-08 | Curevac Gmbh | Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or peptide antigen |
| WO2013120498A1 (en) | 2012-02-15 | 2013-08-22 | Curevac Gmbh | Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded allergenic antigen or an autoimmune self-antigen |
| WO2013120499A1 (en) | 2012-02-15 | 2013-08-22 | Curevac Gmbh | Nucleic acid comprising or coding for a histone stem-loop and a poly (a) sequence or a polyadenylation signal for increasing the expression of an encoded pathogenic antigen |
| WO2013120500A1 (en) | 2012-02-15 | 2013-08-22 | Curevac Gmbh | Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded tumour antigen |
| WO2013120497A1 (en) | 2012-02-15 | 2013-08-22 | Curevac Gmbh | Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded therapeutic protein |
| SG11201405542UA (en) * | 2012-03-27 | 2014-10-30 | Curevac Gmbh | Artificial nucleic acid molecules |
| WO2013143700A2 (en) | 2012-03-27 | 2013-10-03 | Curevac Gmbh | Artificial nucleic acid molecules comprising a 5'top utr |
| MX362981B (es) | 2012-03-27 | 2019-02-28 | Curevac Ag | Moleculas artificiales de acido nucleico para la expresion mejorada de proteina o peptido. |
| WO2013151665A2 (en) * | 2012-04-02 | 2013-10-10 | modeRNA Therapeutics | Modified polynucleotides for the production of proteins associated with human disease |
| WO2013174409A1 (en) | 2012-05-25 | 2013-11-28 | Curevac Gmbh | Reversible immobilization and/or controlled release of nucleic acid containing nanoparticles by (biodegradable) polymer coatings |
| US9974845B2 (en) | 2013-02-22 | 2018-05-22 | Curevac Ag | Combination of vaccination and inhibition of the PD-1 pathway |
| AU2014310935B2 (en) | 2013-08-21 | 2019-11-21 | CureVac SE | Combination vaccine |
| BR112016001192A2 (pt) | 2013-08-21 | 2017-08-29 | Curevac Ag | Vacina contra a raiva |
| KR102354389B1 (ko) | 2013-08-21 | 2022-01-20 | 큐어백 아게 | Rna―암호화된 단백질의 발현을 증가시키는 방법 |
| MY174677A (en) | 2013-08-21 | 2020-05-06 | Curevac Ag | Composition and vaccine for treating lung cancer |
| RU2016109938A (ru) | 2013-08-21 | 2017-09-26 | Куревак Аг | Композиция и вакцина для лечения рака предстательной железы |
| BR112016003361A2 (pt) | 2013-08-21 | 2017-11-21 | Curevac Ag | vacina do vírus sincicial respiratório (rsv) |
| WO2015062738A1 (en) | 2013-11-01 | 2015-05-07 | Curevac Gmbh | Modified rna with decreased immunostimulatory properties |
| SG11201604198YA (en) | 2013-12-30 | 2016-07-28 | Curevac Ag | Methods for rna analysis |
| CN111304231A (zh) | 2013-12-30 | 2020-06-19 | 库瑞瓦格股份公司 | 人工核酸分子 |
| CA2927254C (en) | 2013-12-30 | 2023-10-24 | Curevac Ag | Artificial nucleic acid molecules |
| CA2935878C (en) | 2014-03-12 | 2023-05-02 | Curevac Ag | Combination of vaccination and ox40 agonists |
| US10369216B2 (en) | 2014-04-01 | 2019-08-06 | Curevac Ag | Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant |
| EP3155129B1 (en) | 2014-06-10 | 2019-01-16 | CureVac AG | Method for enhancing rna production |
| PT4023755T (pt) | 2014-12-12 | 2023-07-05 | CureVac SE | Moléculas de ácido nucleico artificiais para uma expressão melhorada de proteína |
| EP3233113A1 (en) | 2014-12-16 | 2017-10-25 | CureVac AG | Ebolavirus and marburgvirus vaccines |
| EP3240558A1 (en) | 2014-12-30 | 2017-11-08 | CureVac AG | Artificial nucleic acid molecules |
| EP4353257A3 (en) | 2015-04-13 | 2024-08-07 | CureVac Manufacturing GmbH | Method for producing rna compositions |
| EP4026568A1 (en) | 2015-04-17 | 2022-07-13 | CureVac Real Estate GmbH | Lyophilization of rna |
| CN108064176A (zh) | 2015-04-22 | 2018-05-22 | 库瑞瓦格股份公司 | 用于治疗肿瘤疾病的含有rna的组合物 |
| ES2897823T3 (es) | 2015-04-30 | 2022-03-02 | Curevac Ag | Poli(N)polimerasa inmovilizada |
| SG11201708681SA (en) | 2015-04-30 | 2017-11-29 | Curevac Ag | Method for in vitro transcription using an immobilized restriction enzyme |
| WO2016180430A1 (en) | 2015-05-08 | 2016-11-17 | Curevac Ag | Method for producing rna |
| WO2016184822A1 (en) | 2015-05-15 | 2016-11-24 | Curevac Ag | Prime-boost regimens involving administration of at least one mrna construct |
| WO2016184575A1 (en) | 2015-05-20 | 2016-11-24 | Curevac Ag | Dry powder composition comprising long-chain rna |
| EP3297682B1 (en) | 2015-05-20 | 2021-07-14 | CureVac AG | Dry powder composition comprising long-chain rna |
| EP4660315A3 (en) | 2015-05-29 | 2026-03-18 | CureVac Manufacturing GmbH | A method for producing and purifying rna, comprising at least one step of tangential flow filtration |
| EP3303575B1 (en) | 2015-05-29 | 2022-03-16 | CureVac AG | Method for adding cap structures to rna using immobilized enzymes |
| US20180296663A1 (en) | 2015-06-17 | 2018-10-18 | Curevac Ag | Vaccine composition |
| EP3317424B1 (en) | 2015-07-01 | 2023-09-06 | CureVac Manufacturing GmbH | Method for analysis of an rna molecule |
| US10501768B2 (en) | 2015-07-13 | 2019-12-10 | Curevac Ag | Method of producing RNA from circular DNA and corresponding template DNA |
| US20200085852A1 (en) | 2015-08-05 | 2020-03-19 | Curevac Ag | Epidermal mrna vaccine |
| WO2017025120A1 (en) | 2015-08-07 | 2017-02-16 | Curevac Ag | Process for the in vivo production of rna in a host cell |
| DE22195354T1 (de) | 2015-08-10 | 2023-05-25 | CureVac Manufacturing GmbH | Verfahren zur erhöhung der replikation eines zirkulären dna-moleküls |
| US11225682B2 (en) | 2015-10-12 | 2022-01-18 | Curevac Ag | Automated method for isolation, selection and/or detection of microorganisms or cells comprised in a solution |
| EP3373965A1 (en) | 2015-11-09 | 2018-09-19 | CureVac AG | Rotavirus vaccines |
| US20180126003A1 (en) | 2016-05-04 | 2018-05-10 | Curevac Ag | New targets for rna therapeutics |
-
2016
- 2016-08-22 WO PCT/EP2016/001417 patent/WO2017036580A1/en not_active Ceased
- 2016-08-22 AU AU2016316439A patent/AU2016316439B2/en active Active
- 2016-08-22 CA CA2992801A patent/CA2992801A1/en active Pending
- 2016-08-22 KR KR1020187008732A patent/KR102645398B1/ko active Active
- 2016-08-22 DK DK16759979.4T patent/DK3341482T3/da active
- 2016-08-22 MX MX2018001040A patent/MX395421B/es unknown
- 2016-08-22 CN CN201680049973.1A patent/CN108026537B/zh active Active
- 2016-08-22 CN CN202210036661.4A patent/CN114381470A/zh active Pending
- 2016-08-22 EP EP22176444.2A patent/EP4108774A1/en active Pending
- 2016-08-22 EP EP16759979.4A patent/EP3341482B1/en active Active
- 2016-08-22 SG SG10201913629VA patent/SG10201913629VA/en unknown
- 2016-08-22 JP JP2018511127A patent/JP7304155B2/ja active Active
- 2016-08-22 ES ES16759979T patent/ES2924739T3/es active Active
- 2016-08-22 US US15/755,739 patent/US12258567B2/en active Active
-
2021
- 2021-08-16 JP JP2021132110A patent/JP7245878B2/ja active Active
-
2025
- 2025-01-16 US US19/026,182 patent/US20250171789A1/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002098443A2 (de) * | 2001-06-05 | 2002-12-12 | Curevac Gmbh | Stabilisierte mrna mit erhöhtem g/ c- gehalt und otimierter codon usage für die gentherapie |
| WO2012019630A1 (en) * | 2010-08-13 | 2012-02-16 | Curevac Gmbh | Nucleic acid comprising or coding for a histone stem-loop and a poly(a) sequence or a polyadenylation signal for increasing the expression of an encoded protein |
| WO2014164253A1 (en) * | 2013-03-09 | 2014-10-09 | Moderna Therapeutics, Inc. | Heterologous untranslated regions for mrna |
Cited By (119)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12109275B2 (en) | 2010-08-13 | 2024-10-08 | CureVac SE | Nucleic acid comprising or coding for a histone stem-loop and a poly(A) sequence or a polyadenylation signal for increasing the expression of an encoded protein |
| US10898589B2 (en) | 2012-02-15 | 2021-01-26 | Cure Vac AG | Nucleic acid comprising or coding for a histone stem-loop and a poly(A) sequence or a polyadenylation signal for increasing the expression of an encoded therapeutic protein |
| US10610605B2 (en) | 2012-02-15 | 2020-04-07 | Curevac Ag | Nucleic acid comprising or coding for a histone stem-loop and a poly(A) sequence or a polyadenylation signal for increasing the expression of an encoded therapeutic protein |
| US12201680B2 (en) | 2012-02-15 | 2025-01-21 | CureVac SE | Nucleic acid comprising or coding for a histone stem-loop and a poly(A) sequence or a polyadenylation signal for increasing the expression of an encoded pathogenic antigen |
| US12460204B2 (en) | 2012-03-27 | 2025-11-04 | CureVac SE | Artificial nucleic acid molecules for improved protein or peptide expression |
| US11149278B2 (en) | 2014-12-12 | 2021-10-19 | Curevac Ag | Artificial nucleic acid molecules for improved protein expression |
| US11345920B2 (en) | 2014-12-12 | 2022-05-31 | Curevac Ag | Artificial nucleic acid molecules for improved protein expression |
| US11286492B2 (en) | 2014-12-12 | 2022-03-29 | Curevac Ag | Artificial nucleic acid molecules for improved protein expression |
| US12442005B2 (en) | 2014-12-12 | 2025-10-14 | CureVac SE | Artificial nucleic acid molecules for improved protein expression |
| US11761009B2 (en) | 2014-12-12 | 2023-09-19 | CureVac SE | Artificial nucleic acid molecules for improved protein expression |
| US11744886B2 (en) | 2015-04-13 | 2023-09-05 | CureVac Manufacturing GmbH | Method for producing RNA compositions |
| US10653768B2 (en) | 2015-04-13 | 2020-05-19 | Curevac Real Estate Gmbh | Method for producing RNA compositions |
| US10780054B2 (en) | 2015-04-17 | 2020-09-22 | Curevac Real Estate Gmbh | Lyophilization of RNA |
| US11491112B2 (en) | 2015-04-17 | 2022-11-08 | CureVac Manufacturing GmbH | Lyophilization of RNA |
| US11446250B2 (en) | 2015-04-17 | 2022-09-20 | Curevac Real Estate Gmbh | Lyophilization of RNA |
| US12194148B2 (en) | 2015-04-17 | 2025-01-14 | CureVac Manufacturing GmbH | Lyophilization of RNA |
| US11384375B2 (en) | 2015-04-30 | 2022-07-12 | Curevac Ag | Immobilized poly(n)polymerase |
| US11661634B2 (en) | 2015-05-08 | 2023-05-30 | CureVac Manufacturing GmbH | Method for producing RNA |
| US11559570B2 (en) | 2015-05-15 | 2023-01-24 | CureVac SE | Prime-boost regimens involving administration of at least one mRNA construct |
| US12318486B2 (en) | 2015-05-20 | 2025-06-03 | CureVac SE | Dry powder composition comprising long-chain RNA |
| US10729654B2 (en) | 2015-05-20 | 2020-08-04 | Curevac Ag | Dry powder composition comprising long-chain RNA |
| US11433027B2 (en) | 2015-05-20 | 2022-09-06 | Curevac Ag | Dry powder composition comprising long-chain RNA |
| US10517827B2 (en) | 2015-05-20 | 2019-12-31 | Curevac Ag | Dry powder composition comprising long-chain RNA |
| US11534405B2 (en) | 2015-05-20 | 2022-12-27 | Curevac Ag | Dry powder composition comprising long-chain RNA |
| US11179337B2 (en) | 2015-05-20 | 2021-11-23 | Curevac Ag | Dry powder composition comprising long-chain RNA |
| US12138348B2 (en) | 2015-05-20 | 2024-11-12 | CureVac SE | Dry powder composition comprising long-chain RNA |
| US11274293B2 (en) | 2015-05-29 | 2022-03-15 | Curevac Real Estate Gmbh | Method for producing and purifying RNA, comprising at least one step of tangential flow filtration |
| US12221605B2 (en) | 2015-05-29 | 2025-02-11 | CureVac Manufacturing GmbH | Method for producing and purifying RNA, comprising at least one step of tangential flow filtration |
| US11834651B2 (en) | 2015-05-29 | 2023-12-05 | CureVac Manufacturing GmbH | Method for producing and purifying RNA, comprising at least one step of tangential flow filtration |
| US11760992B2 (en) | 2015-05-29 | 2023-09-19 | CureVac Manufacturing GmbH | Method for producing and purifying RNA, comprising at least one step of tangential flow filtration |
| US11667910B2 (en) | 2015-05-29 | 2023-06-06 | CureVac Manufacturing GmbH | Method for producing and purifying RNA, comprising at least one step of tangential flow filtration |
| US11608513B2 (en) | 2015-05-29 | 2023-03-21 | CureVac SE | Method for adding cap structures to RNA using immobilized enzymes |
| US10760070B2 (en) | 2015-05-29 | 2020-09-01 | Curevac Real Estate Gmbh | Method for producing and purifying RNA, comprising at least one step of tangential flow filtration |
| US10501768B2 (en) | 2015-07-13 | 2019-12-10 | Curevac Ag | Method of producing RNA from circular DNA and corresponding template DNA |
| US12514918B2 (en) | 2016-05-04 | 2026-01-06 | CureVac SE | Nucleic acid molecules and uses thereof |
| US12168050B2 (en) | 2016-05-04 | 2024-12-17 | CureVac SE | Compositions comprising a norovirus nucleic acid and methods of use thereof |
| US12527856B2 (en) | 2016-05-04 | 2026-01-20 | CureVac SE | Artificial RNA molecules encoding a norovirus antigen and uses thereof |
| US12227549B2 (en) | 2016-05-04 | 2025-02-18 | CureVac SE | RNA encoding a therapeutic protein |
| WO2018033254A2 (en) | 2016-08-19 | 2018-02-22 | Curevac Ag | Rna for cancer therapy |
| WO2018115507A2 (en) | 2016-12-23 | 2018-06-28 | Curevac Ag | Henipavirus vaccine |
| US11865084B2 (en) | 2016-12-23 | 2024-01-09 | CureVac SE | MERS coronavirus vaccine |
| WO2018167320A1 (en) | 2017-03-17 | 2018-09-20 | Curevac Ag | Rna vaccine and immune checkpoint inhibitors for combined anticancer therapy |
| JP2020513824A (ja) * | 2017-03-24 | 2020-05-21 | キュアバック アーゲー | Crispr関連タンパク質をコードする核酸、及びその使用 |
| WO2018172556A1 (en) * | 2017-03-24 | 2018-09-27 | Curevac Ag | Nucleic acids encoding crispr-associated proteins and uses thereof |
| US11739335B2 (en) | 2017-03-24 | 2023-08-29 | CureVac SE | Nucleic acids encoding CRISPR-associated proteins and uses thereof |
| US20210403925A1 (en) * | 2017-03-24 | 2021-12-30 | Curevac Ag | Nucleic acids encoding crispr-associated proteins and uses thereof |
| US12371699B2 (en) | 2017-03-24 | 2025-07-29 | CureVac SE | Nucleic acids encoding CRISPR-associated proteins and uses thereof |
| RU2775176C2 (ru) * | 2017-03-24 | 2022-06-28 | Куревак Аг | Нуклеиновые кислоты, кодирующие ассоциированные с crispr белки, и их применения |
| AU2018240515B2 (en) * | 2017-03-24 | 2024-07-25 | CureVac SE | Nucleic acids encoding CRISPR-associated proteins and uses thereof |
| WO2019038332A1 (en) | 2017-08-22 | 2019-02-28 | Curevac Ag | VACCINE AGAINST BUNYAVIRUS |
| WO2019077001A1 (en) * | 2017-10-19 | 2019-04-25 | Curevac Ag | NEW ARTIFICIAL NUCLEIC ACID MOLECULES |
| JP2021501572A (ja) * | 2017-10-19 | 2021-01-21 | キュアバック アーゲー | 新規な人工核酸分子 |
| AU2018351481B2 (en) * | 2017-10-19 | 2025-04-03 | CureVac SE | Novel artificial nucleic acid molecules |
| JP2025131658A (ja) * | 2017-10-19 | 2025-09-09 | キュアバック エスイー | 新規な人工核酸分子 |
| KR20200071081A (ko) * | 2017-10-19 | 2020-06-18 | 큐어백 아게 | 신규 인공 핵산 분자 |
| KR102858623B1 (ko) * | 2017-10-19 | 2025-09-10 | 큐어백 에스이 | 신규 인공 핵산 분자 |
| CN111630173A (zh) * | 2017-10-19 | 2020-09-04 | 库瑞瓦格股份公司 | 新型人工核酸分子 |
| JP2024012523A (ja) * | 2017-10-19 | 2024-01-30 | キュアバック エスイー | 新規な人工核酸分子 |
| WO2019092153A1 (en) | 2017-11-08 | 2019-05-16 | Curevac Ag | Rna sequence adaptation |
| WO2019115635A1 (en) | 2017-12-13 | 2019-06-20 | Curevac Ag | Flavivirus vaccine |
| WO2019122371A1 (en) | 2017-12-21 | 2019-06-27 | Curevac Ag | Linear double stranded dna coupled to a single support or a tag and methods for producing said linear double stranded dna |
| US12385088B2 (en) | 2017-12-21 | 2025-08-12 | CureVac SE | Linear double stranded DNA coupled to a single support or a tag and methods for producing said linear double stranded DNA |
| WO2019193183A2 (en) | 2018-04-05 | 2019-10-10 | Curevac Ag | Novel yellow fever nucleic acid molecules for vaccination |
| DE202019006108U1 (de) | 2018-04-17 | 2024-12-16 | CureVac SE | Neue RSV-RNA-Moleküle und Zusammensetzungen für die Impfung |
| CN112292395A (zh) * | 2018-04-17 | 2021-01-29 | 库瑞瓦格股份公司 | 用于疫苗接种的新型rsv rna分子和组合物 |
| JP7613685B2 (ja) | 2018-04-17 | 2025-01-15 | キュアバック エスイー | 新規rsv rna分子及びワクチン接種用組成物 |
| EP4227319A1 (en) | 2018-04-17 | 2023-08-16 | CureVac SE | Novel rsv rna molecules and compositions for vaccination |
| JP2021519595A (ja) * | 2018-04-17 | 2021-08-12 | キュアバック アーゲー | 新規rsv rna分子及びワクチン接種用組成物 |
| US12350330B2 (en) | 2018-04-17 | 2025-07-08 | CureVac SE | RSV RNA molecules and compositions for vaccination |
| JP2024116227A (ja) * | 2018-04-17 | 2024-08-27 | キュアバック エスイー | 新規rsv rna分子及びワクチン接種用組成物 |
| WO2020002525A1 (en) | 2018-06-27 | 2020-01-02 | Curevac Ag | Novel lassa virus rna molecules and compositions for vaccination |
| WO2020128031A2 (en) | 2018-12-21 | 2020-06-25 | Curevac Ag | Rna for malaria vaccines |
| EP4491229A2 (en) | 2019-02-08 | 2025-01-15 | CureVac SE | Coding rna administered into the suprachoroidal space in the treatment of ophtalmic diseases |
| WO2020161342A1 (en) | 2019-02-08 | 2020-08-13 | Curevac Ag | Coding rna administered into the suprachoroidal space in the treatment of ophtalmic diseases |
| WO2020254535A1 (en) | 2019-06-18 | 2020-12-24 | Curevac Ag | Rotavirus mrna vaccine |
| WO2021028439A1 (en) | 2019-08-14 | 2021-02-18 | Curevac Ag | Rna combinations and compositions with decreased immunostimulatory properties |
| EP4147717A1 (en) | 2020-02-04 | 2023-03-15 | CureVac SE | Coronavirus vaccine |
| DE112021000012C5 (de) | 2020-02-04 | 2024-11-14 | CureVac SE | Coronavirus-Vakzine |
| DE112021000012C9 (de) | 2020-02-04 | 2025-02-06 | CureVac SE | Coronavirus-Vakzine |
| WO2021156267A1 (en) | 2020-02-04 | 2021-08-12 | Curevac Ag | Coronavirus vaccine |
| DE112021000012T5 (de) | 2020-02-04 | 2021-11-18 | Curevac Ag | Coronavirus-Vakzine |
| DE202021003575U1 (de) | 2020-02-04 | 2022-01-17 | Curevac Ag | Coronavirus-Vakzine |
| DE202021004123U1 (de) | 2020-02-04 | 2022-10-26 | Curevac Ag | Coronavirus-Vakzine |
| DE202021004130U1 (de) | 2020-02-04 | 2022-10-26 | Curevac Ag | Coronavirus-Vakzine |
| DE112021000012B4 (de) | 2020-02-04 | 2023-08-31 | CureVac SE | Coronavirus-Vakzine |
| WO2021239880A1 (en) | 2020-05-29 | 2021-12-02 | Curevac Ag | Nucleic acid based combination vaccines |
| WO2022023559A1 (en) | 2020-07-31 | 2022-02-03 | Curevac Ag | Nucleic acid encoded antibody mixtures |
| WO2022043551A2 (en) | 2020-08-31 | 2022-03-03 | Curevac Ag | Multivalent nucleic acid based coronavirus vaccines |
| WO2022135993A2 (en) | 2020-12-22 | 2022-06-30 | Curevac Ag | Pharmaceutical composition comprising lipid-based carriers encapsulating rna for multidose administration |
| US11872280B2 (en) | 2020-12-22 | 2024-01-16 | CureVac SE | RNA vaccine against SARS-CoV-2 variants |
| US11918643B2 (en) | 2020-12-22 | 2024-03-05 | CureVac SE | RNA vaccine against SARS-CoV-2 variants |
| WO2022137133A1 (en) | 2020-12-22 | 2022-06-30 | Curevac Ag | Rna vaccine against sars-cov-2 variants |
| WO2022162027A2 (en) | 2021-01-27 | 2022-08-04 | Curevac Ag | Method of reducing the immunostimulatory properties of in vitro transcribed rna |
| US12618060B2 (en) | 2021-03-15 | 2026-05-05 | CureVac SE | Nucleic acid molecules |
| WO2022200575A1 (en) | 2021-03-26 | 2022-09-29 | Glaxosmithkline Biologicals Sa | Immunogenic compositions |
| WO2022207862A2 (en) | 2021-03-31 | 2022-10-06 | Curevac Ag | Syringes containing pharmaceutical compositions comprising rna |
| WO2022233880A1 (en) | 2021-05-03 | 2022-11-10 | Curevac Ag | Improved nucleic acid sequence for cell type specific expression |
| WO2022256597A1 (en) | 2021-06-04 | 2022-12-08 | Translate Bio, Inc. | Assay for quantitative assessment of mrna capping efficiency |
| EP4361270A4 (en) * | 2021-06-24 | 2025-05-21 | Hanmi Pharm. Co., Ltd. | Non-natural 5'-untranslated region and 3'-untranslated region and use thereof |
| WO2023025404A1 (en) | 2021-08-24 | 2023-03-02 | BioNTech SE | In vitro transcription technologies |
| WO2023144330A1 (en) | 2022-01-28 | 2023-08-03 | CureVac SE | Nucleic acid encoded transcription factor inhibitors |
| WO2023227608A1 (en) | 2022-05-25 | 2023-11-30 | Glaxosmithkline Biologicals Sa | Nucleic acid based vaccine encoding an escherichia coli fimh antigenic polypeptide |
| JP2025525578A (ja) * | 2022-07-19 | 2025-08-05 | 深▲セン▼深信生物科技有限公司 | 新型コロナウイルスSタンパク質のmRNAおよびその使用 |
| WO2024068545A1 (en) | 2022-09-26 | 2024-04-04 | Glaxosmithkline Biologicals Sa | Influenza virus vaccines |
| WO2024083345A1 (en) | 2022-10-21 | 2024-04-25 | BioNTech SE | Methods and uses associated with liquid compositions |
| WO2024084089A1 (en) | 2022-10-21 | 2024-04-25 | BioNTech SE | Methods and uses associated with liquid compositions |
| DE202023106198U1 (de) | 2022-10-28 | 2024-03-21 | CureVac SE | Impfstoff auf Nukleinsäurebasis |
| US12186389B2 (en) | 2022-10-28 | 2025-01-07 | Glaxosmithkline Biologicals Sa | Nucleic acid base vaccine against emerging SARS-CoV-2 variants |
| WO2024089638A1 (en) | 2022-10-28 | 2024-05-02 | Glaxosmithkline Biologicals Sa | Nucleic acid based vaccine |
| WO2024098361A1 (zh) * | 2022-11-11 | 2024-05-16 | 斯微(上海)生物科技股份有限公司 | 人工核酸分子 |
| WO2024160936A1 (en) | 2023-02-03 | 2024-08-08 | Glaxosmithkline Biologicals Sa | Rna formulation |
| WO2024171052A1 (en) | 2023-02-14 | 2024-08-22 | Glaxosmithkline Biologicals Sa | Analytical method |
| WO2024223728A1 (en) | 2023-04-27 | 2024-10-31 | Glaxosmithkline Biologicals Sa | Influenza virus vaccines |
| WO2024223724A1 (en) | 2023-04-27 | 2024-10-31 | Glaxosmithkline Biologicals Sa | Influenza virus vaccines |
| WO2024230934A1 (en) | 2023-05-11 | 2024-11-14 | CureVac SE | Therapeutic nucleic acid for the treatment of ophthalmic diseases |
| WO2024260570A1 (en) | 2023-06-23 | 2024-12-26 | CureVac SE | Nucleic acid encoded antibodies |
| WO2025132839A1 (en) | 2023-12-21 | 2025-06-26 | Glaxosmithkline Biologicals Sa | Influenza virus vaccines |
| WO2025202360A1 (en) | 2024-03-29 | 2025-10-02 | Glaxosmithkline Biologicals Sa | Rna formulation |
| GB202404607D0 (en) | 2024-03-29 | 2024-05-15 | Glaxosmithkline Biologicals Sa | RNA formulation |
Also Published As
| Publication number | Publication date |
|---|---|
| DK3341482T3 (da) | 2022-08-15 |
| KR20180038564A (ko) | 2018-04-16 |
| JP2021192613A (ja) | 2021-12-23 |
| MX395421B (es) | 2025-03-25 |
| AU2016316439A1 (en) | 2018-02-08 |
| KR102645398B1 (ko) | 2024-03-07 |
| CN108026537B (zh) | 2022-02-08 |
| US12258567B2 (en) | 2025-03-25 |
| AU2016316439B2 (en) | 2022-02-24 |
| BR112018001995A2 (pt) | 2018-09-18 |
| US20250171789A1 (en) | 2025-05-29 |
| CN108026537A (zh) | 2018-05-11 |
| JP2018529329A (ja) | 2018-10-11 |
| JP7245878B2 (ja) | 2023-03-24 |
| EP4108774A1 (en) | 2022-12-28 |
| ES2924739T3 (es) | 2022-10-10 |
| US20180237786A1 (en) | 2018-08-23 |
| JP7304155B2 (ja) | 2023-07-06 |
| MX2018001040A (es) | 2018-06-15 |
| RU2018110872A (ru) | 2019-10-01 |
| CN114381470A (zh) | 2022-04-22 |
| RU2018110872A3 (cg-RX-API-DMAC7.html) | 2020-07-24 |
| SG10201913629VA (en) | 2020-03-30 |
| CA2992801A1 (en) | 2017-03-09 |
| EP3341482A1 (en) | 2018-07-04 |
| EP3341482B1 (en) | 2022-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250171789A1 (en) | Artificial nucleic acid molecules | |
| US20260071224A1 (en) | Artificial nucleic acid molecules for improved protein expression | |
| US20230399649A1 (en) | Artificial nucleic acid molecules | |
| JP6704850B2 (ja) | 人工核酸分子 | |
| AU2014375402A1 (en) | Artificial nucleic acid molecules | |
| EP3495486B1 (en) | Artificial nucleic acid molecules | |
| HK40077948A (en) | Artificial nucleic acid molecules for improved protein expression | |
| HK40077948B (en) | Artificial nucleic acid molecules for improved protein expression | |
| EP3090052B1 (en) | Artificial nucleic acid molecules | |
| BR112018001995B1 (pt) | Molécula de ácido nucleico artificial, vetor, composição farmacêutica, método para aumentar a eficiência de tradução de uma molécula de ácido nucleico artificial, uso in vitro de um elemento 3´-utr e kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16759979 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2992801 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2018/001040 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2016316439 Country of ref document: AU Date of ref document: 20160822 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11201800746U Country of ref document: SG |
|
| ENP | Entry into the national phase |
Ref document number: 2018511127 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15755739 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20187008732 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2018110872 Country of ref document: RU Ref document number: 2016759979 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112018001995 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112018001995 Country of ref document: BR Kind code of ref document: A2 Effective date: 20180130 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 15755739 Country of ref document: US |