WO2015182913A1 - 유전자 침묵에 의한 목적 단백질의 과발현 방법 - Google Patents

유전자 침묵에 의한 목적 단백질의 과발현 방법 Download PDF

Info

Publication number
WO2015182913A1
WO2015182913A1 PCT/KR2015/004998 KR2015004998W WO2015182913A1 WO 2015182913 A1 WO2015182913 A1 WO 2015182913A1 KR 2015004998 W KR2015004998 W KR 2015004998W WO 2015182913 A1 WO2015182913 A1 WO 2015182913A1
Authority
WO
WIPO (PCT)
Prior art keywords
glucoamylase
expression
seq
target protein
gene
Prior art date
Application number
PCT/KR2015/004998
Other languages
English (en)
French (fr)
Inventor
반재구
김의중
박승환
이동범
김은영
Original Assignee
주식회사 제노포커스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 제노포커스 filed Critical 주식회사 제노포커스
Publication of WO2015182913A1 publication Critical patent/WO2015182913A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/145—Fungal isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/66—Aspergillus
    • C12R2001/685—Aspergillus niger

Definitions

  • the present invention provides an expression vector comprising a polynucleotide encoding shRNA capable of RNAi (RNA interference) expression, a recombinant microorganism into which the expression vector and a gene encoding a target protein are introduced, and the recombinant microorganism. It relates to a method for producing a target protein.
  • RNAi RNA interference
  • Fungi are available for producing commercially useful proteins and organic acids.
  • Filamentous fungi including Aspergillus niger, are widely used in the production of enzymes, food additives and antibiotics.
  • Cellulase or glucoamylase can be produced in high yields of 30 g / L or more through industrial process development.
  • the fungal expression system has an eukaryotic cell expression system that can efficiently produce foreign proteins derived from eukaryotic cells, including humans, because transcription, processing, and transformation processes (eg, modification, glycosylation, disulfide bridge formation, etc.) are performed. have.
  • the fungal expression system is known as a system that can effectively prevent problems such as hyperglycosylation.
  • Wild-type strains such as Aspergillus Niger 8795P or Aspergillus Niger N402, have high protease activity and present many difficulties in producing foreign proteins.
  • screening for strains with low protease activity and high glucoamylase expression is required.
  • the glucoamylase gene is more than 10 copies of the wild type, and the mRNA level is also high.
  • Such strains possess good strain characteristics that can only express foreign proteins purely when the glucoamylase gene is removed.
  • Gene inactivation in fungi is achieved by gene replacement.
  • gene inactivation is highly dependent on the rate of transformation, and the degree varies from individual to individual.
  • the defect rate is also low, 0-40%.
  • the number of glucoamylase genes is 10 or more, and in many cases the method by gene replacement cannot be used.
  • the inventors of the present application provide an invention related to a method that can enhance the expression of a target protein, such as catalase or peroxydiase, using gene inactivation mechanisms by RNAi.
  • RNAi plays a unique role in gene regulation and can be used to silence desired genes. RNAi induces the destruction of the target gene mRNA after transcription by dsRNA by introducing double-stranded RNA consisting of sense RNA, which is homologous to the target gene mRNA, and antisense RNA, which is complementary thereto, to induce the destruction of the target gene mRNA after transcription by 80%. This is a phenomenon that can be suppressed abnormally.
  • dsRNA is then shortly processed into 21-25 nucleotides by Dicer protein, RNase III.
  • the binding of siRNA single strands complementary to mRNA degrades the mRNA by nucleases.
  • RNA silencing occurs by RNA-dependent RNA polymerase in Aspergillus needleans and Aspergillus aurise. It has been reported that shRNA vectors can be produced from Aspergillus aurise to induce silencing of amylase and brlA genes, thereby inhibiting expression by more than 90%.
  • Catalase and peroxydiases are enzymes that decompose hydrogen peroxide into water and oxygen, and are used for bleaching fibers, washing contact lenses, and post-treatment of wastewater in semiconductor plants. In the textile treatment process, it is used to prevent non-uniform dyeing before the dyeing process.
  • Catalase is one of the important enzymes in the fiber process because it has an excellent energy and time saving effect compared to the chemical method of surfactant.
  • the inventors of the present application have produced a recombinant microorganism into which an expression vector comprising a polynucleotide encoding shRNA capable of RNAi glucoamylase and a gene of a protein of interest is introduced, and then culturing the recombinant microorganism. It was confirmed that expression of the protein can be increased, and the present invention was completed.
  • the present invention relates to an expression vector comprising a promoter and a polynucleotide operably linked to the promoter, wherein the polynucleotide encodes an shRNA capable of RNAi expression of glucoamylase.
  • the present invention also relates to a recombinant microorganism into which the expression vector is introduced.
  • the present invention further comprises the steps of: expressing a target protein by culturing a recombinant microorganism into which the expression vector and the gene encoding the target protein are introduced; And it relates to a method for producing a target protein comprising the step of recovering the expressed target protein.
  • FIG. 1 is a schematic diagram of a glucoamylase (glaA) 2206 bp structural gene containing an intron.
  • FIG. 2 is a schematic of shRNA vectors forming a glucoamylase hairpin loop.
  • Figure 3a shows the real time PCR results of GF101 strain and glucoamylase gene silencing transformants.
  • Figure 3b is the result of SDS-page analysis of glucoamylase gene silencing.
  • M marker; 1: GF101 strain; 2: pRIT44 transformant 12; 3: pRIT44 transformant 17; 4: pRIT44 transformant 2; 5: pRIT44 Transformant 13
  • 4A is a schematic representation of the Aspergillus niger transgenic antibiotic pleomycin pAN7-Fleo vector.
  • 4B is a schematic diagram of pDCAT in which a terminator of the Aspergillus aurise pdcA gene is inserted into a glucoamylase gene silencing vector.
  • 4C is a schematic diagram of pGLAP inserted with a glucoamylase promoter to induce glucoamylase gene silencing.
  • Figure 5a is a schematic diagram of the shRNA expression vector pIRT41 to induce glucoamylase gene silencing.
  • Figure 5b is a schematic diagram of the shRNA expression vector pIRT42 to induce glucoamylase gene silencing.
  • Figure 5c is a schematic diagram of the shRNA expression vector pIRT43 to induce glucoamylase gene silencing.
  • Figure 5d is a schematic diagram of the shRNA expression vector pIRT44 to induce glucoamylase gene silencing.
  • Figure 5e is a schematic diagram of the shRNA expression vector pIRT45 to induce glucoamylase gene silencing.
  • FIG. 6A is a schematic diagram of the hyromycin pAN7-Hyg vector for catalase transformation selection.
  • FIG. 6A is a schematic diagram of the hyromycin pAN7-Hyg vector for catalase transformation selection.
  • 6B is a schematic of the pDCAT-Hyg vector with the catalase terminator inserted.
  • Figure 6c is a schematic diagram of the pGLASSP vector inserted with the glucoamylase promoter and glucoamylase signal sequence to induce the expression of catalase.
  • FIG. 7A is a schematic diagram of a catalase expression vector pGLASSP-ScyA expressed by a glucoamylase promoter and a glucoamylase signal sequence.
  • Figure 7b is the result of SDS-page analysis of catalase transformants. Arrows indicate expressed catalase.
  • 8A is a schematic diagram of the peroxidase vector pGLASSP-Cip1 expressed by a glucoamylase promoter and a glucoamylase signal sequence.
  • 8B shows the results of SDS-page analysis of peroxidase transformants. Arrows indicate expressed peroxidase.
  • FIG. 9 is a diagram showing a nucleotide sequence capable of forming glucoamylase dsRNA. Italics indicate introns. Underline indicates primer positions capable of PCR of the glucoamylase sense strand and antisense strand.
  • the present invention relates to an expression vector comprising a promoter and a polynucleotide operably linked to the promoter, wherein the polynucleotide encodes an shRNA capable of RNAi expression of glucoamylase.
  • promoter refers to a DNA sequence that regulates the expression of a polynucleotide sequence operably linked in a particular recombinant microorganism or host cell.
  • a promoter a promoter (constitutive promoter) which induces the expression of a gene of interest at all times of the day or a promoter (inducible promoter) which induces the expression of a gene of interest at a specific position and time may be used.
  • the promoters of the present invention may be native, homologous, foreign or heterologous to a recombinant microorganism or host, and may be useful for inducing transcription in a fungal host, aspergillus niger neutral amylase promoter, acidic amylase promoter and It may be one or more selected from the group consisting of ⁇ -glucosidase promoter, but is not limited thereto.
  • the promoter may be the Aspergillus Niger derived glucoamylase gene of SEQ ID NO: 2 capable of transcribing a polynucleotide.
  • operably linked refers to the parallel of two or more components, where the components are in a relationship such that they act in the intended manner.
  • a promoter acts to control or regulate the transcription of a linked sequence
  • it is operably linked to a coding sequence.
  • the operably linked DNA sequence can be contiguous, wherein the two or more coding for the secretory leader / signal sequence and the polynucleotides that are contiguous and within the reading frame.
  • the polyadenylation site is operably linked to the coding sequence when located at the downstream end of the coding sequence, such that transcription proceeds through the coding sequence into the polyadenylation sequence. Linking can be performed by recombinant methods known in the art, for example PCR methods and the like.
  • vector refers to DNA fragment (s), nucleic acid molecules that are delivered into a cell, and can be used interchangeably with plasmids.
  • the vector is, for example, pIRT 41 having a cleavage map of FIG. 1A, pIRT 42 having a cleavage map of FIG. 1B, pIRT 43 having a cleavage map of FIG. 1C, and pIRT 44 having a cleavage map of FIG. 1D. It may be one or more selected from the group consisting of pIRT 45 having a cleavage map.
  • a "polynucleotide” may include nucleic acid molecules such as DNA, RNA or modifications thereof.
  • the polynucleotide may be a naturally occurring polynucleotide molecule, a synthetic polynucleotide molecule, or a combination of one or more naturally occurring polynucleotide molecules and one or more synthetic polynucleotide molecules. Also encompassed by this definition are naturally occurring polynucleotide molecules in which one or more nucleotides are changed, deleted, or added, for example, by mutation.
  • polynucleotides can be characterized by the sequence of individual nucleotides, and processes and methods for converting the amino acid sequence of a polypeptide to the corresponding nucleotide sequence encoding it are well known to those skilled in the art.
  • shRNA has a single-stranded RNA in a stem-loop structure in vivo, and complementary long RNA is composed of base pairs on both sides of the loop to include sense and antisense. Form a double stranded stem.
  • the shRNA is generally transcribed and synthesized by a linked promoter in vivo, and then the shRNA is cleaved by Dicer and interacts with RISC similar to siRNA.
  • dsRNA it may be referred to as dsRNA according to the structure formed in vivo.
  • the polynucleotide of the present invention encodes shRNA capable of RNAi expression of glucoamylase, wherein the glucoamylase has a glucoamylase having a sequence represented by SEQ ID NO: 1, for example, a glucoamylase derived from Aspergillus niger. Can be.
  • the polynucleotide encoding the shRNA of the present invention is, for example, the 5'-URT region of the transcriptional portion of the glucoamylase except for the signal sequence and the precursor sequence, the sense sequence and the antisense sequence start point is the same, but the antisense sequence is It may be smaller than the sense sequence.
  • the sense sequence and the antisense sequence homology site may be more than 50% and less than 75%, the size of the sense sequence may be more than 400 bp 1,000 bp.
  • the loop sequence may be a sequence excluding the antisense and homologous portion of the sense sequence, and the size of the loop may be larger than the antisense, for example, 155 bp or more and 300 bp or less.
  • the dsRNA may be encoded from one or more sequences selected from the group consisting of, for example, SEQ ID NOs: 3, 4, 6, 8, 10-13.
  • the dsRNA is a sense of SEQ ID NO: 3, antisense of SEQ ID NO: 4 and a loop of SEQ ID NO: 5 (pIRT 41), sense of SEQ ID NO: 4, as described in Table 2 of Example 4, Antisense of SEQ ID NO: 6 and loop of SEQ ID NO: 7 (pIRT 42), sense of SEQ ID NO: 6, antisense of SEQ ID NO: 8 and loop of p.
  • the dsRNA can inhibit glucoamylase gene silencing or expression of glucoamylase.
  • Glucoamylase gene silencing by the dsRNA according to the invention may be, for example, about 30% or more relative to the control, and optimal gene silencing may be 90% or more.
  • the expression vector pIRT44 transformants including the sense of SEQ ID NO: 10, the antisense of SEQ ID NO: 11, and the loop of SEQ ID NO: 12 were all expressed only about 10% of the glucoamylase expression rate compared to the control group. Expression was also reduced by 80-90% (Table 4).
  • expression refers to transcriptional and / or translational processes occurring in a cell.
  • the level of transcription of the desired product in the recombinant microorganism or host cell can be determined based on the amount of corresponding mRNA present in the cell.
  • mRNA transcribed from the sequence can be quantified by PCR or the like.
  • Polypeptides encoded by the polynucleotides may be subjected to various methods, such as ELISA, assay for the biological activity of the polypeptide, or assays independent of the activity, such as radioimmunoassay using immunoglobulins that are recognized and bound to the polypeptide, or It can be quantified using Western blotting.
  • the vectors of the present invention include a replication origin (eg, a ColE1 or oriP origin of replication), selectable markers for replication and selection of the vector, include suitable terminators, and are useful for dsRNA transcription in eukaryotic cells. Polyadenylation sequences may be linked.
  • a replication origin eg, a ColE1 or oriP origin of replication
  • selectable markers for replication and selection of the vector include suitable terminators, and are useful for dsRNA transcription in eukaryotic cells.
  • Polyadenylation sequences may be linked.
  • the selectable marker may be, for example, a ble gene, which may be used for selection of non-transformed strains and strains transformed with genes having properties that can be selected from antibiotic pleomycin.
  • the terminator or polyadenylation sequence may be, for example, the transcription terminator of the pdcA gene or the transcription terminator of glucoamylase.
  • the transcription terminator of the pdcA gene may have a sequence of SEQ ID NO: 15 derived from A. oryzae, and the transcription terminator of glucoamylase is derived from Aspergillus niger (A. niger). It may have a sequence of SEQ ID NO: 16.
  • the present invention relates to a recombinant microorganism into which the expression vector is introduced.
  • recombinant microorganism refers to a host cell into which a polynucleotide encoding, for example, a heterologous polypeptide or protein or constituting a shRNA can be introduced or transfected.
  • the recombinant microorganism may be derived from a eukaryote capable of efficiently producing a foreign polypeptide or protein derived from eukaryotic cells, including humans, and preferably may be a fungus.
  • Fungi have an eukaryotic expression system that can be used to efficiently produce eukaryotic-derived foreign polypeptides or proteins because they are transcribed, processed, and modified.
  • the fungus used in the present invention may be a strain in which glucoamylase is overexpressed, for example Aspergillus niger.
  • the strain is produced through several mutagenesis and passage culture, the spore color is brown, the growth rate may be more than 30% than the wild type.
  • Polynucleotides encoding the protein of interest may be further introduced into such recombinant microorganisms.
  • the target protein By introducing a gene encoding a target protein into the recombinant microorganism, the target protein can be co-expressed in a state where the expression of glucoamylase is suppressed.
  • introduction may be carried out by a process related to the protoplast transformation followed by the protoplast preparation and cell wall reproduction.
  • DNA inserted into the protoplast can be inserted into the chromosome of the recombinant microorganism.
  • a commonly known gene manipulation method may be used as a method of inserting a gene on a chromosome of a host cell. For example, electroporation, lipofection, microinjection, ballistic method, virosome, liposome, immunoliposome, polyvalent cation Or lipid: nucleic acid conjugates, naked DNA, artificial virons, and chemically-promoted DNA influx.
  • Sonorization for example methods using the Sonitron 2000 system (Rich-Mar), can also be used for the delivery of nucleic acids.
  • Other representative nucleic acid delivery systems are Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland). And BTX Molecular Syetem (Holliston, Mass.).
  • Lipofection methods are specified in US Pat. No. 5,049,386, US Pat. No. 4,946,787 and US Pat. No. 4,897,355 and lipofection reagents are commercially available, for example, Transfectam TM and Lipofectin TM.
  • Suitable cations or neutral lipids for effective receptor-recognition lipofection of polynucleotides include lipids from Felgner (WO91 / 17424 and WO91 / 16024) and can be delivered to cells via in vitro introduction and to target tissues via in vivo introduction. have.
  • nucleic acid complexes including target liposomes such as immunolipid complexes
  • Methods of preparing lipid: nucleic acid complexes, including target liposomes such as immunolipid complexes are well known in the art (Crystal, Science., 270: 404-410, 1995; Blaese et al., Cancer Gene Ther., 2: 291 297, 1995; Behr et al., Bioconjugate Chem., 5: 382389, 1994; Remy et al., Bioconjugate Chem., 5: 647-654, 1994; Gao et al., Gene Therapy., 2: 710- 722, 1995; Ahmad et al., Cancer Res., 52: 4817-4820, 1992; US Patent 4,186,183; US Patent 4,217,344; US Patent 4,235,871; US Patent 4,261,975; US Patent 4,485,054 US Patent 4,501,728 US Patent 4,774,085 US Patent 4,837,028 US Patent
  • the present invention provides a method of expressing a target protein by culturing a recombinant microorganism into which a polynucleotide encoding shRNA capable of RNAi expression of the glucoamylase and a gene encoding a target protein are introduced; And it relates to a method for producing a target protein comprising the step of recovering the expressed target protein.
  • the target protein may be a protein heterologous to a recombinant microorganism, for example, catalase or peroxidase.
  • catalase or peroxidase which is a protein of interest
  • SEQ ID NO: 1 the expression of glucoamylase represented by SEQ ID NO: 1 is suppressed. It was confirmed that the catalase expression rate was increased by about 5 times in the strains in which glucoamylase gene silencing was caused by shRNA in strains with high glucoamylase expression (Example 11), and that the peroxidase expression rate was increased by about 7.8 times (Example). 14).
  • the expression vector including the gene encoding the target protein may be, for example, a pGLAPSS vector having a cleavage map of FIG. 6C.
  • the expression vector also includes a suitable terminator, and polyadenylation sequences can be linked to be useful for transcription of the protein of interest in eukaryotic cells.
  • the terminator or polyadenylation sequence can be, for example, the transcription terminator of the pdcA gene or the glucoamylase transcription terminator.
  • the transcription terminator of the pdcA gene may have a sequence of SEQ ID NO: 15 derived from A. oryzae, and the transcription terminator of glucoamylase is derived from Aspergillus niger (A. niger). It may have a sequence of SEQ ID NO: 16.
  • the expression vector may also include one or more selectable markers.
  • the selectable marker may be, for example, a hyg gene, and may be used for selecting a non-transformed strain and a strain transformed with a gene having a characteristic that can be selected from the antibiotic hygromycin.
  • an expression vector comprising a polynucleotide encoding shRNA capable of RNAi expression of glucoamylase and a recombinant microorganism into which the polynucleotide encoding the target protein is further introduced are cultured, and then the expressed target protein is recovered.
  • the recombinant microorganism may be cultured in a predetermined medium for inducing the operation of the inserted promoter, for example, the medium may include glucose or starch as a carbon source.
  • the amount of carbon source included can be, for example, about 1-6% (w / v) or less.
  • the protein of interest produced from the recombinant microorganism may be isolated or substantially purified.
  • it may be separated or purified by a known method such as centrifugation, dialysis, chromatography, etc., may be substantially free of other cellular material or culture medium by separation or purification.
  • 500 ml preparation is as follows.
  • Sodium nitrate (NaNO 3 ) 76g, potassium phosphate monobezic (KH 2 PO 4 ) 38g, potassium phosphate die sic (K 2 HPO 4 ) 38g, potassium chloride (KCl) 26g, magnesium sulfate (MgSO 4 ) 26g, gin Sulfate (ZnSO 4 7H 2 O) 1.10 g, boric acid (H 2 BO 3 ) 0.55 g, manganese chloride (MnCl 2 4H 2 O) 0.25 g, ferric sulfate (FeSO 4 7H 2 O) 0.25 g, cobalt 0.08 g of chromide (CoCl 2 ⁇ 6H 2 O), copper sulfate, 0.051 g, 0.055 g of ammonium molybdate, 0.38 g of EDTA.
  • NaNO 3 sodium nitrate
  • KH 2 PO 4 potassium phosphate monobe
  • A402 spores were harvested with 0.08% Tween 80 from the culture dish incubated for 4 days and then diluted to 103 cells / ml. 1 ml of the diluent was inoculated into the starch-added solid medium and placed on a turntable rotated at 60 rpm to incubate for 10-30 minutes at uv 300J while rotating the culture dish with the petri dish cover removed. Incubated for 5 days. Mutants in which rings were formed by inoculation on the same medium from cultured mutant colonies were selected. Strains with low protease activity and high glucoamylase expression were selected first. Final selection of genetically stable strains with 10 generation subculture and single spore isolation. This was named GF101. The GF101 strain has low activity of acidic protease and glucoamylase activity of 1,000 to 1,300 U / ml.
  • 1-6% glucose and 1-6% jade were used as carbon sources, and 6% soy flour, 6% CSL, 0.05% antifoaming agent, and ⁇ -amylase 0.01% were heated and heated to 70 ⁇ 80 °C to liquefy for 30 minutes. Let it be. 50 ml of the liquefied liquid was dispensed into a 250 ml flask and sterilized at 121 ° C for 15 minutes. The spores were harvested with 0.1% Tween 80 from the culture plate in which the mutant strains were cultured for 5 days, and then harvested at 1 ⁇ 10 6 cells / ml to inoculate 1 ml of the diluted solution.
  • Amplification of the terminator region of the pdcA gene derived from Aspergillus oryzae KACC 44997 and cloning of the PCR product were performed as follows. PCR was carried out using pdcA F containing Hind III, BamH1, Spe I and NotI at the 5 ⁇ -end and pdcAR primer containing Xba I at the 5 ⁇ -end to prepare a PCR product of the pAN7-Ble vector (FIG. 4A). Cloned in Hind III / Xba I and named pDCAT-ble (FIG. 4B).
  • Amplification of the promoter region shown in SEQ ID NO: 2 of the glucoamylase gene derived from Aspergillus niger GF101 and cloning of the PCR product were performed as follows. PCR was performed with glucoamylase PF containing Hind III at the 5′-end and glucoamylase PR primer containing BamH1 at the 5′-end, and the PCR product was cloned into Hind III / BamH of the pDCAT vector and named pGLAP. . The plasmid is shown in Figure 4c.
  • GlaAPHF SEQ ID NO: 19
  • GlaAPR SEQ ID NO: 20
  • the DNA fragment (SEQ ID NO: 3) was amplified by 1000 bp DNA using si BAF1 and si SPR3 primers, cloned into the Glycoamylase promoter downstream BamH1 / Spe I, and the antisense fragment ( SEQ ID NO: 4) amplified 699 bp DNA using si NOF1 and si SP R2 primers and constructed Spe I / Not I and named it pIRT 41 (FIG. 5A).
  • the dsRNA expressed in this vector forms a loop (SEQ ID NO: 5) structure.
  • the shRNA expression vectors were named pIRT 41, pIRT 42, pIRT 43, pIRT 44, and pIRT 45 according to the location and size of glucoamylase.
  • Primer base sequences and sense strand, antisense strand, loop strand DNA sizes used in shRNA vectors are shown in FIG. 9 and Table 2.
  • Cloning method was constructed using the same restriction enzyme as the pIRT 41 vector construction method after PCR using each primer. Italics indicate introns. Underline indicates primer positions capable of PCR of the glucoamylase sense strand and antisense strand.
  • si NOF1 SEQ ID NO: 23
  • si NOF2 SEQ ID NO: 24
  • the transformation of the vector into host cells was performed by modifying the Tilburn et al., (1983) method.
  • Aspergillus Niger GF101 strain spores were evenly dispersed in CYS (Corn starch 1%, yeast extract 0.15%, sorbitol 21.86%) medium, and then cultured for 5-6 days at 30 ° C. until spores were evenly formed.
  • CYS Cornn starch 1%, yeast extract 0.15%, sorbitol 21.86%) medium
  • the spores were inoculated in an appropriate amount of 0.01% (w / v) YPD medium, and then incubated at 30 ° C until mycelia were formed.
  • the mycelium was filtered through filter paper, washed with sterile water, and then washed well with 0.7 M KCl solution.
  • the mycelium was added with 0.7 M KCl solution and an appropriate amount of Lysing enzyme-sigma to break down the outer wall, followed by reaction for 2-3 hours to form protoplasts.
  • the formed protoplasts were collected by separating the mycelia using filter paper. Wash with 10 ml of 0.7 M KCl buffer, then wash with 15 ml of SB buffer (1.2 M sorbitol, 10 mM Tris-HCl, 20 mM CaCl 2 ) and then suspend with SB buffer.
  • Metastasis was induced by mixing 10 ⁇ g of expression plasmid with 90 ⁇ l of protoplasts and then adding 13 ul of 25% PEG 6000. The mixed solution was injected into a minimal medium to which pleomycin (100 ug / ml) was added, and 4.5 ml of the same medium was overlaid and incubated at 30 ° C. for 5 days.
  • RTglaAF SEQ ID NO: 30
  • RTglaAP SEQ ID NO 31
  • RTglaAR SEQ ID NO: 32
  • RTactF SEQ ID NO: 33
  • RTactP SEQ ID NO: 34
  • RTactR SEQ ID NO: 35
  • Amplification of the terminator region of the pdcA gene derived from Aspergillus aurise and cloning of the PCR product were performed as follows. PCR product was carried out using pdcA F containing Hind III, StuI, Not I at 5 ⁇ -end and pdcAR primer containing Xba I at 5 ⁇ -end, and the PCR product of Hind III of pAN7-hyg (FIG. 6A) vector. Cloned into / Xba I and named pDCAT-hyg (FIG. 6B).
  • Amplification of the promoter + signal sequence + precursor sequence region of the glucoamylase gene derived from Aspergillus niger GF101 and cloning of the PCR product were performed as follows. PCR was performed with glucoamylase PF containing Hind III at the 5′-end and glucoamylase PR primer containing StuI at the 5′-end, and the PCR product was cloned into Hind III / StuI of the pDCAT-hyg vector to obtain pGLAPSS. Named it. Plasmids are shown in Figure 6c. Catalase gene was obtained by PCR using nucleotides ScyA F and ScyA R containing NotI at the 5 ⁇ -end after S. thermofilum gDNA extraction, and then cloned into StuI / NotI of pGLASSP vector to PGLASSP-ScyA (FIG. 7A). Was named).
  • GlaAPHF SEQ ID NO: 38
  • GlaASSSR SEQ ID NO: 39
  • the mycelia were reacted for 2-3 hours with a suitable amount of 0.7M KCl solution and a lysing enzyme (sigma) in order to break down the outer wall to form protoplasts.
  • the formed protoplasts were collected by separating the mycelia using filter paper. Washed with 10 ml of 0.7 M KCl buffer, then 15 ml of SB buffer (1.2 M sorbitol, 10 mM Tris-HCl, 20 mM CaCl 2 ) and then suspended with SB buffer. 10 ⁇ g of plasmid of each pGlaASS-ScyA was mixed with 90 ⁇ l of protoplasts, and then 13 ⁇ l of 25% PEG 6000 was added to induce metastasis. The mixed solution was injected into a minimal medium to which pleomycin (100 ug / ml) was added and incubated at 30 ° C. for 5 days by overlaying 4.5 ml of the same medium.
  • pleomycin 100 ug /
  • 1 U is the amount of enzyme that breaks down 1 ⁇ mole of hydrogen peroxide per minute.
  • 50 mM potassium phosphate buffer (pH 7.0) was added 0.1 ml of 30% Hydrogen Peroxide. 30ul of fermentation broth was added to measure absorbance at 255 nm.
  • the catalase activity of the GF101 and IRT417 strains was less than 10 U / ml.
  • Catalase activity was 548 U / ml in strains with high glucoamylase expression, and 3000 U / ml in strains in which glucoamylase gene silencing was induced by shRNA.
  • Catalase expression was increased approximately 5 fold overall by glucoamylase gene silencing (FIG. 7B).
  • the C. cinerius peroxidase gene was obtained by PCR using nucleotides Cip1A F and Cip1R containing NotI at the 5 ⁇ -end after extraction of C. cinerius gDNA, and then cloned into StuI / NotI of pGLASSP vector. PGLASSP-Cip1 was named (FIG. 8A).
  • Cip1 F SEQ ID NO: 42
  • Cip1 R SEQ ID NO: 43
  • Aspergillus Niger IRT417 strain spores were evenly dispersed in CYS (Corn starch 1%, yeast extract 0.15%, sorbitol 21.86%) medium, and then cultured for 5-6 days at 30 ° C. until spores were evenly formed. After mixing well in 5 ml 0.08% Tween 80, spores were inoculated in an appropriate amount of 0.01% (w / v) YPD medium and incubated at 30 ° C. until mycelia were formed. The mycelium was filtered through filter paper, washed with sterile water, and then washed well with 0.7 M KCl solution.
  • the mycelia were reacted for 2-3 hours with a suitable amount of 0.7 M KCl solution and a lysing enzyme (sigma) in order to break down the outer wall to form protoplasts.
  • the formed protoplasts were collected by separating the mycelia using filter paper. After washing with 10 ml of 0.7 M KCl buffer, 15 ml of SB buffer (1.2 M sorbitol, 10 mM Tris-HCl, 20 mM CaCl 2 ) was then suspended with SB buffer.
  • Each pGlaASS-Cip1 10 ⁇ g plasmid and 90 ⁇ l of the protoplasts were mixed and 13% of 25% PEG 6000 was added to induce metastasis.
  • the mixed solution was injected into a minimal medium to which pleomycin (100 ug / ml) was added and incubated at 30 ° C. for 5 days by overlaying 4.5 ml of the same medium.
  • 1 U is the amount of enzyme that breaks down 1 ⁇ mole of hydrogen peroxide per minute.
  • 49.9 ml of 50 mM potassium phosphate buffer (pH 7.0) is added by adding 0.1 ml of 30% H 2 O 2.
  • 30ul of fermentation broth was added to measure absorbance at 255 nm.
  • Catalase activity was 149.9 U / ml in GF101 strains with high glucoamylase expression, and 1,176 U / ml activity in strains in which glucoamylase gene silencing was caused by shRNA.
  • the glucoamylase gene silencing increased the peroxidase expression rate by about 7.8 fold overall (FIG. 8B).
  • the target protein may be produced under conditions in which only the glucoamylase gene is silenced without removing specific genes that may affect the expression of the target protein.

Abstract

본 발명은 글루코아밀라제의 발현을 RNAi (RNA interference)시킬 수 있는 shRNA를 코딩하는 폴리뉴클레오티드를 포함하는 발현벡터, 상기 발현벡터와 목적 단백질을 코딩하는 유전자가 도입되어 있는 재조합 미생물 및 상기 미생물을 이용한 목적 단백질의 제조방법에 관한 것이다. 본 발명을 통해, 아스퍼질러스 나이거에서 유전자를 치환에 의해 제거하지 않고, RNAi 기작을 통해 글루코아밀라제을 억제한 조건에서 목적 단백질의 발현을 증가시킬 수 있으므로, 산업적으로 유용한 목적 단백질을 대량으로 생산할 수 있다. 또한, 목적 단백질의 발현에 영향을 줄 수 있는 특정 유전자들을 제거하지 않고, 글루코아밀라제 유전자만을 침묵시킨 조건에서 목적 단백질을 생산할 수 있다.

Description

유전자 침묵에 의한 목적 단백질의 과발현 방법
본 발명은 글루코아밀라제의 발현을 RNAi (RNA interference)시킬 수 있는 shRNA를 코딩하는 폴리뉴클레오티드를 포함하는 발현벡터, 상기 발현벡터와 목적 단백질을 코딩하는 유전자가 도입되어 있는 재조합 미생물 및 상기 재조합 미생물을 이용한 목적 단백질의 제조방법에 관한 것이다.
균류는 상업적으로 유용한 단백질 및 유기산을 생산하는데 이용 가능하다. 아스퍼질러스 나이거 (Aspergillus niger)를 포함한 사상성 진균류는 효소, 식품 첨가제 및 항생제 등의 생산에 광범위하게 사용되고 있다. 셀룰라아제나 글루코아밀라제의 경우 산업적 공정 개발을 통해 30 g/L 이상의 고수율로 생산이 가능하다.
곰팡이 발현 시스템은 진핵세포의 발현체계를 가지고 있어서 전사, 가공, 변형 공정 (예를 들어, modification, glycosylation, disulfide bridge formation 등)이 이루어지기 때문에 사람을 비롯한 진핵세포 유래의 외래 단백질을 효율적으로 생산할 수 있다. 특히, 곰팡이 발현 시스템은 하이퍼글라이코실레이션 (hyperglycosylation) 등의 문제를 효율적으로 방지할 수 있는 시스템으로 알려져 있다.
또한, 효율적인 분비 체계를 갖추고 있어서, 대장균 시스템에서의 발현에 의한 인클루젼 바디(inclusion body) 형성 등에 따른 불활성화 등의 문제점을 극복할 수 있다. 또한, 단백질을 농축하여 정제하는데 있어서도 타 미생물에 비해서 공정상 간편하고 비용이 낮다. 사상성 진균류와 같은 많은 균주들은 미국에서도 GRAS (generally recognized as safe)로 인정하고 있어 다른 균주에 비하여 의약제품의 생산과 응용에서 장점을 가지고 있다.
아스퍼질러스 나이거 8795P 또는 아스퍼질러스 나이거 N402 등의 야생형 균주들은 프로테아제 활성이 높아 외래 단백질 생산에 여러 어려움이 존재한다. 숙주로 이용하기 위해서는 프로테아제 활성은 낮고 글루코아밀라제 발현이 높은 균주에 대한 선별이 필요하다. 글루코아밀라제 발현이 높은 균주에서 글루코아밀라제 유전자는 야생형 대비 10 카피 이상이며, mRNA 수준 역시 높게 발현된다. 이와 같은 균주는 글루코아밀라제 유전자를 제거할 경우 순수하게 외래 단백질만을 발현할 수 있는 좋은 균주 특성을 보유하고 있다.
곰팡이에서 유전자 불활성은 유전자 치환에 의해 이루어진다. 그러나, 유전자 불활성은 형질전환률에 의해 크게 좌우되며, 개체마다 그 정도가 다르다. 결손률도 0-40%로 낮다. 특히, 글루코아밀라제 유전자수가 10개 이상 존재하여 유전자 치환에 의한 방법을 이용할 수 없는 경우가 다수이다.
이에, 본 출원의 발명자들은 RNAi에 의한 유전자 불활성화 기작을 이용하여 목적 단백질, 예를 들어 카탈라아제 또는 퍼옥시디아제의 발현을 증대시킬 수 있는 방법과 관련된 발명을 제공한다.
RNAi는 유전자 조절에 고유한 역할을 하며, 목적 유전자 침묵에 이용될 수 있다. RNAi는 표적 유전자 mRNA와 상동 서열인 센스 RNA와 이것과 상보적인 서열인 안티센스 RNA로 구성되는 이중 사슬 RNA를 곰팡이에 도입함으로써 dsRNA에 의해 전사 후 표적 유전자 mRNA의 파괴를 유도하여 유전자의 발현을 80%이상 억제할 수 있는 현상이다.
이후, RNase III인 Dicer 단백질에 의해 dsRNA는 21-25 뉴클레오타이드로 짧게 가공된다. mRNA에 상보적인 siRNA 단일 가닥이 결합하면 뉴클라아제에 의해 mRNA가 분해된다. 곰팡이에서는 뉴로스포라에서 Romano 및 Macino에 의해 처음 확인되었고, 아스퍼질러스 니들란스, 아스퍼질러스 오리제에서도 RNA-dependent RNA polymerase의해서 RNA 침묵이 일어난다. 아스퍼질러스 오리제에서 shRNA 벡터를 제작하여 아밀라제 유전자와 brlA 유전자의 침묵을 유도하여 90 % 이상 발현을 억제할 수 있다고 보고되었다.
한편, 카탈라아제와 퍼옥시디아제는 과산화수소를 물과 산소로 분해시키는 효소로 섬유의 표백 공정, 콘택트렌즈 세척, 반도체 공장의 폐수 후처리 공정 등에 이용된다. 섬유 처리 공정에서는 염색 공정 전에 불균일 염색을 방지하기 위해 사용된다. 카탈라아제 사용시 화학적 방법인 계면활성제를 사용하는 것에 비해 에너지와 시간적인 면에서 탁월한 절약효과가 있어 섬유공정에서 중요한 효소 중 하나이다.
이러한 배경하에서, 본 출원의 발명자들은 글루코아밀라제를 RNAi시킬 수 있는 shRNA를 코딩하는 폴리뉴클레오티드를 포함하는 발현벡터와 목적 단백질의 유전자가 도입되어 있는 재조합 미생물을 제작하고, 상기 재조합 미생물을 배양한 결과 목적 단백질의 발현이 증가될 수 있음을 확인하고, 본 발명을 완성하였다.
발명의 요약
본 발명의 목적은 글루코아밀라제 유전자 침묵에 의한 목적 단백질의 발현을 증가시키는 방법을 제공하는데 있다.
본 발명은 프로모터 및 상기 프로모터에 작동가능하게 연결된 폴리뉴클레오티드를 포함하고, 상기 폴리뉴클레오티드는 글루코아밀라제의 발현을 RNAi시킬 수 있는 shRNA를 코딩하는 것임을 특징으로 하는 발현벡터에 관한 것이다.
본 발명은 또한, 상기 발현벡터가 도입되어 있는 재조합 미생물에 관한 것이다.
본 발명은 더욱이, 상기 발현벡터 및 목적 단백질을 코딩하는 유전자가 도입된 재조합 미생물을 배양하여 목적 단백질을 발현시키는 단계; 및 상기 발현된 목적 단백질을 회수하는 단계를 포함하는 목적 단백질의 제조방법에 관한 것이다.
도 1은 인트론을 포함하는 글루코아밀라제(glaA) 2206bp 구조 유전자 모식도이다.
도 2는 글루코아밀라제 헤어핀 루프를 형성하는 shRNA 벡터의 모식도이다.
도 3a는 GF101 균주와 글루코아밀라제 유전자 침묵 형질전환체들의 실시간 (Real time PCR) 결과를 나타낸 것이다.
도 3b는 글루코아밀라제 유전자 침묵의 SDS-page 분석 결과이다. M: marker; 1: GF101 균주; 2: pRIT44 형질전환체 12; 3:pRIT44 형질전환체 17; 4: pRIT44 형질전환체 2; 5: pRIT44 형질전환체 13
도 4a는 아스퍼질러스 나이거 형질전환 항생제 플레오마이신 pAN7-Fleo 벡터의 모식도이다.
도 4b는 글루코아밀라제 유전자 침묵 벡터에 아스퍼질러스 오리제 pdcA 유전자의 종결인자가 삽입된 pDCAT 모식도이다.
도 4c는 글루코아밀라제 유전자 침묵을 유도할 글루코아밀라제 프로모터가 삽입된 pGLAP 모식도이다.
도 5a는 글루코아밀라제 유전자 침묵을 유도할 shRNA 발현벡터 pIRT41 모식도이다.
도 5b는 글루코아밀라제 유전자 침묵을 유도할 shRNA 발현벡터 pIRT42 모식도이다.
도 5c는 글루코아밀라제 유전자 침묵을 유도할 shRNA 발현벡터 pIRT43 모식도이다.
도 5d는 글루코아밀라제 유전자 침묵을 유도할 shRNA 발현벡터 pIRT44 모식도이다.
도 5e는 글루코아밀라제 유전자 침묵을 유도할 shRNA 발현벡터 pIRT45 모식도이다.
도 6a는 카탈라아제 형질전환 선택용 하이로마이신 pAN7-Hyg 벡터의 모식도이다.
도 6b는 카탈라아제 종결인자가 삽입된 pDCAT-Hyg 벡터의 모식도이다.
도 6c는 카탈라아제의 발현을 유도할 글루코아밀라제 프로모터와 글루코아밀라제 신호서열이 삽입된 pGLASSP 벡터의 모식도이다.
도 7a는 글루코아밀라제 프로모터, 글루코아밀라제 신호서열에 의해 발현되는 카탈라아제 발현벡터 pGLASSP-ScyA의 모식도이다.
도 7b는 카탈라아제 형질전환체들의 SDS-page 분석 결과이다. 화살표는 발현된 카탈라아제를 나타낸다.
도 8a는 글루코아밀라제 프로모터, 글루코아밀라제 신호서열에 의해 발현되는 퍼옥시다아제 벡터 pGLASSP-Cip1의 모식도이다.
도 8b는 퍼옥시다아제 형질전환체들의 SDS-page 분석 결과이다. 화살표는 발현된 퍼옥시다아제를 나타낸다.
도 9는 글루코아밀라제 dsRNA를 형성할 수 있는 염기서열을 표기한 도면이다. 이탤릭체는 인트론을 나타낸다. 언더라인은 글루코아밀라제 센스 가닥 및 안티센스 가닥를 PCR 할 수 있는 프라이머 위치를 나타낸다.
발명의 상세한 설명 및 바람직한 구현예
본 발명은 일 관점에서, 프로모터 및 상기 프로모터에 작동가능하게 연결된 폴리뉴클레오티드를 포함하고, 상기 폴리뉴클레오티드는 글루코아밀라제의 발현을 RNAi시킬 수 있는 shRNA를 코딩하는 것임을 특징으로 하는 발현벡터에 관한 것이다.
본 명세서에서 사용되는 "프로모터"는 특정한 재조합 미생물 또는 숙주세포에서 작동 가능하게 연결된 폴리뉴클레오티드 서열의 발현을 조절하는 DNA 서열을 의미한다. 프로모터로는 모든 시간대에 상시적으로 목적 유전자의 발현을 유도하는 프로모터(constitutive promoter) 또는 특정한 위치, 시기에 목적 유전자의 발현을 유도하는 프로모터(inducible promoter)를 사용할 수 있다.
하나의 실시예에서, 본 발명의 프로모터는 재조합 미생물 또는 숙주에 천연, 동종, 외래 또는 이종일 수 있으며, 균류 숙주에서 전사를 유용하게 유도할 수 있는 아스퍼질러스 나이거 중성 아밀라제 프로모터, 산성 아밀라제 프로모터 및 α-글루코시다제 프로모터로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 제한되는 것은 아니다. 바람직하게, 상기 프로모터는 폴리뉴클레오티드를 전사할 수 있는 서열번호 2의 아스퍼질러스 나이거 유래 글루코아밀라제 유전자일 수 있다.
"작동가능하게 연결된"은 2개 이상의 성분의 병렬을 지칭하고, 이 때 상기 성분은 의도된 방식으로 작용하도록 하는 관계에 있다. 예를 들어, 프로모터가 연결된 서열의 전사를 제어하거나 조절하도록 작용하는 경우, 코딩 서열에 작동가능하게 연결된다. 상기 작동가능하게 연결된 DNA 서열은 인접하고, 이 때 분비 리더/신호 서열 및 인접하고 리딩 프레임 내에 있는 폴리뉴클레오티드를 코딩하는 2개 이상을 접합시킬 수 있다. 폴리아데닐화 부위는 전사가 코딩 서열을 통해 폴리아데닐화 서열 내로 진행하도록, 코딩 서열의 다운스트림 말단에 위치하는 경우, 코딩 서열에 작동가능하게 연결된다. 연결은 본 발명의 분야에 공지된 재조합 방법, 예를 들어 PCR 방법 등에 의해 수행될 수 있다.
본 명세서에서 사용되는 "벡터"는 세포 내로 전달하는 DNA 단편(들), 핵산 분자를 의미하며, 플라스미드와 혼용될 수 있다. 상기 벡터는 예를 들어, 도 1A의 개열지도를 가지는 pIRT 41, 도 1B의 개열지도를 가지는 pIRT 42, 도 1C의 개열지도를 가지는 pIRT 43, 도 1D의 개열지도를 가지는 pIRT 44 및 도 1E의 개열지도를 가지는 pIRT 45로 이루어진 군에서 선택된 하나 이상일 수 있다.
본 명세서에서 사용되는 "폴리뉴클레오티드"는 핵산 분자, 예를 들어 DNA, RNA 또는 이들의 변형을 포함할 수 있다. 상기 폴리뉴클레오티드는 자연적으로 발생하는 폴리뉴클레오티드 분자, 합성 폴리뉴클레오티드 분자, 또는 하나 이상의 자연적으로 발생하는 폴리뉴크레오티드 분자와 하나 이상의 합성 폴리뉴클레오티드 분자의 조합일 수 있다. 또한, 하나 이상의 뉴클레오티드가 예를 들어 돌연변이에 의해 변화되거나, 결실되거나, 또는 첨가되는 자연적으로 발생하는 폴리뉴클레오티드 분자가 상기 정의에 포괄된다. 상기 폴리뉴클레오티드는 개별 뉴클레오티드의 서열에 의해 특징지어 질 수 있으며, 폴리펩티드의 아미노산 서열을 이를 코딩하는 대응 뉴클레오티드 서열로 전환시키는 과정 및 방법은 당업자에게 널리 공지되어 있다.
본 명세서에서 사용되는 shRNA는 단일가닥의 RNA가 in vivo상에서 스템-루프(stem-loop) 구조를 이루고 있으며, 루프(loop) 부위 양쪽으로 상보적으로 긴 RNA가 염기쌍을 이루어 센스 및 안티센스를 포함하는 이중가닥의 스템(stem)을 형성한다. shRNA는 일반적으로 in vivo상에서 연결된 프로모터에 의해 전사되어 합성되며 이후 shRNA는 다이서(Dicer)에 의해 루프가 절단되고 siRNA와 유사하게 RISC와 작용하게 된다. 이후, 본 명세서에서는 in vivo상에서 형성된 구조에 따라 dsRNA로 명명하기도 한다.
본 발명의 폴리뉴클레오티드는 글루코아밀라제의 발현을 RNAi시킬 수 있는 shRNA를 코딩하는 것으로, 상기 글루코아밀라제는 예를 들어, 아스퍼질러스 나이거 유래의 글루코아밀라제인 서열번호 1로 표시되는 서열을 가지는 글루코아밀라제일 수 있다.
본 발명의 shRNA를 코딩하는 폴리뉴클레오티드는 예를 들어, 글루코아밀라제의 전사 부분 중 5'-URT 부위와 신호서열 및 전구체 서열을 제외한 부분으로, 센스 서열과 안티센스 서열 시작점은 동일하게 하나, 안티센스 서열은 센스 서열보다 작을 수 있다. 하나의 실시예에서, 센스서열과 안티센스 서열 상동 부위는 50% 이상 75% 미만일 수 있고, 센스서열의 크기는 400 bp이상 1,000 bp 이하일 수 있다. 루프 서열은 센스 서열 중 안티센스와 상동 부분을 제외한 서열일 수 있으며, 루프의 크기는 안티센스 보다 클 수 있고, 예를 들어 155 bp 이상 300 bp 이하일 수 있다.
상기 dsRNA는 예를 들어, 서열번호 3, 4, 6, 8, 10-13으로 표시되는 서열들로 이루어진 군에서 선택된 하나 이상의 서열로부터 코딩될 수 있다. 구체적으로, 상기 dsRNA는 실시예 4의 표 2에 기재한 바와 같이, 발현벡터에 따라 서열번호 3의 센스, 서열번호 4의 안티센스 및 서열번호 5의 루프 (pIRT 41), 서열번호 4의 센스, 서열번호 6의 안티센스 및 서열번호 7의 루프 (pIRT 42), 서열번호 6의 센스, 서열번호 8의 안티센스 및 서열번호 9의 루프 (pIRT 43), 서열번호 10의 센스, 서열번호 11의 안티센스 및 서열번호 12의 루프 (pIRT 44), 서열번호 11의 센스, 서열번호 13의 안티센스 및 서열번호 14의 루프 (pIRT 45)로부터 코딩될 수 있다.
본 발명의 실시예에 따르면, 상기 dsRNA는 글루코아밀라제 유전자 침묵 또는 글루코아밀라제의 발현을 억제할 수 있음을 확인하였다. 본 발명에 따른 dsRNA에 의해 글루코아밀라제 유전자 침묵은 대조군 대비 예를 들어, 약 30% 이상일 수 있으며, 최적 유전자 침묵은 90% 이상일 수 있다. 이와 관련하여, 본 발명의 실시예 7에 따르면, 대조군에 비해 많게는 90% 감소하였으며, 적게는 34% 감소하였음을 확인하였다. 특히, 서열번호 10의 센스, 서열번호 11의 안티센스 및 서열번호 12의 루프를 포함하는 발현벡터 pIRT44 형질전환체인 IRT44 균주들은 모두 글루코아밀라제 발현률이 대조군에 비해 10 % 정도 발현됨에 불과하였으며, 총 단백질량 발현 역시 80~90 % 감소하였음을 확인하였다 (표 4).
본 발명에서 사용되는 "발현"은 세포내에서 발생하는 전사 및/또는 번역 과정을 지칭한다. 재조합 미생물 또는 숙주세포내의 목적 생성물의 전사 수준은 세포 내에 존재하는 상응하는 mRNA의 양을 기준으로 결정될 수 있다. 예를 들어, 해당 서열로부터 전사된 mRNA는 PCR 등에 의해 정량화될 수 있다. 상기 폴리뉴클레오티드에 의해 코딩된 폴리펩티드는 다양한 방법, 예를 들어 ELISA, 폴리펩티드의 생물학적 활성에 대한 분석, 또는 상기 활성에 대해 독립적인 분석, 예컨대 인지되고 폴리펩티드에 결합된 면역글로불린을 사용하는 방사면역분석 또는 웨스턴 블롯팅(Western blotting)을 사용하여 정량화될 수 있다.
또한, 본 발명의 벡터는 복제 원점(예를 들어, 복제의 ColE1 또는 oriP 원점), 벡터의 복제 및 선별을 위한 선택성 마커를 포함하고, 적합한 종결인자를 포함하며, 진핵세포에서 dsRNA 전사에 유용하도록 폴리아데닐화 서열이 연결될 수 있다.
상기 선택성 마커는 예를 들어, ble 유전자일 수 있으며, 이는 항생제 플레오마이신에서 선별할 수 있는 특성을 가지고 있는 유전자로 형질전환된 균주와 비형질전환 균주 선별에 이용할 수 있다.
또한, 상기 종결인자 또는 폴리아데닐화 서열은 예를 들어, pdcA 유전자의 전사 종결인자 또는 글루코아밀라제의 전사 종결인자일 수 있다. 상기 pdcA 유전자의 전사 종결인자는 아스퍼질러스 오리제(A. oryzae) 유래의 서열번호 15의 서열을 가질 수 있으며, 상기 글루코아밀라제의 전사 종결인자는 아스퍼질러스 나이거 (A. niger) 유래의 서열번호 16의 서열을 가질 수 있다.
본 발명은 다른 관점에서, 상기 발현벡터가 도입되어 있는 재조합 미생물에 관한 것이다.
본 명세서에서 사용되는 "재조합 미생물"은 예를 들어 이종 폴리펩티드 또는 단백질을 코딩하거나 shRNA를 구성하는 폴리뉴클레오티드가 도입 또는 형질감염될 수 있는 숙주세포를 의미한다. 상기 재조합 미생물은 사람을 비롯한 진핵세포 유래의 외래 폴리펩티드 또는 단백질을 효율적으로 생산할 수 있는 진핵생물 유래일 수 있으며, 바람직하게는 곰팡이일 수 있다. 곰팡이는 진핵세포의 발현체계를 가지고 있어서 전사, 가공, 변형 공정이 이루어지기 때문에 진핵생물 유래의 외래 폴리펩티드 또는 단백질을 효율적으로 생산할 수 있다.
특히, 본 발명에서 사용되는 곰팡이는 글루코아밀라제가 과발현되는 균주일 수 있으며, 예를 들어 아스퍼질러스 나이거일 수 있다. 상기 균주는 수회의 돌연변이 유발과 계대 배양을 통하여 생산된 것으로, 포자 색은 갈색이며, 야생형보다 성장률이 30% 이상 증가된 상태일 수 있다.
이러한 재조합 미생물에 목적 단백질을 코딩하는 폴리뉴클레오티드가 추가로 도입될 수 있다. 상기 재조합 미생물에 목적 단백질을 코딩하는 유전자를 도입시킴으로써, 글루코아밀라제의 발현이 억제된 상태에서 목적 단백질이 공동 발현될 수 있다.
본 명세서에서 사용되는 "도입"은 원형질체 제작과 세포벽 재생산이 후속되는 원형질체의 형질전환과 관련된 과정에 의하여 수행된 것일 수 있다. 원형질체 내에 삽입된 DNA는 재조합 미생물의 염색체 안으로 삽입될 수 있다. 유전자를 숙주세포의 염색체상에 삽입하는 방법으로는 통상적으로 알려진 유전자조작방법을 사용할 수 있으며, 예를 들어 전기천공법, 리포펙션, 미세주사, 탄도법, 비로솜, 리포솜, 면역리포솜, 다가 양이온 또는 지질:핵산 접합체, 네이키드 DNA, 인공 바이론 및 화학물질 촉진 DNA 유입을 포함한다. 소노포레이션, 예를 들어 Sonitron 2000 시스템(Rich-Mar)을 이용한 방법도 핵산의 전달에 사용할 수 있으며, 다른 대표적인 핵산 전달 시스템은 Amaxa Biosystems(Cologne, Germany), Maxcyte, Inc.(Rockville, Maryland) 및 BTX Molecular Syetem(Holliston, MA)의 방법을 포함한다. 리포펙션 방법은 미국특허 제5,049,386호, 미국특허 제4,946,787호 및 미국특허 제4,897,355호에 명시되어 있으며 리포펙션 시약은 상업적으로 시판되고 있으며, 예를 들어, Transfectam™ 및 Lipofectin™ 이 있다. 폴리뉴클레오티드의 효과적인 리셉터-인식 리포펙션에 적당한 양이온 또는 중성 지질은 Felgner의 지질을 포함하며 (WO91/17424 및 WO91/16024), 생체 외 도입을 통해 세포로, 생체 내 도입을 통해 표적 조직으로 전달할 수 있다. 면역지질 복합체 등 표적 리포솜을 포함하는 지질:핵산 복합체의 제조 방법은 당해 업계에 잘 알려져 있다 (Crystal, Science., 270:404-410, 1995; Blaese et al., Cancer Gene Ther., 2:291-297, 1995; Behr et al., Bioconjugate Chem., 5:382389, 1994; Remy et al., Bioconjugate Chem., 5:647-654, 1994; Gao et al., Gene Therapy., 2:710-722, 1995; Ahmad et al., Cancer Res., 52:4817-4820, 1992; 미국특허 제4,186,183호; 미국특허 제4,217,344호; 미국특허 제4,235,871호; 미국특허 제4,261,975호; 미국특허 제4,485,054호; 미국특허 제4,501,728호; 미국특허 제4,774,085호; 미국특허 제4,837,028호; 미국특허 제4,946,787호). 삽입된 DNA 서열은 세포내에서 안정하게 유지된다. DNA는 통상적으로 염색체 내 상동성, 비상동성 부위로 삽입되며, 통상 1카피에서 20카피 이상 삽입된다.
본 발명은 또 다른 관점에서, 상기 글루코아밀라제의 발현을 RNAi시킬 수 있는 shRNA를 코딩하는 폴리뉴클레오티드 및 목적 단백질을 코딩하는 유전자가 도입된 재조합 미생물을 배양하여 목적 단백질을 발현시키는 단계; 및 상기 발현된 목적 단백질을 회수하는 단계를 포함하는 목적 단백질의 제조방법에 관한 것이다.
상기 목적 단백질은 재조합 미생물에 이종인 단백질일 수 있으며, 예를 들어 카탈라아제 또는 퍼옥시다아제일 수 있다. 본 출원의 발명자들은 서열번호 1로 표시되는 글루코아밀라제의 발현이 억제된 상태에서 목적 단백질인 카탈라아제 또는 퍼옥시다아제의 발현이 증가함을 확인하였다. 글루코아밀라제 발현량이 많은 균주에서 shRNA에 의해 글루코아밀라제 유전자 침묵이 일어난 균주에서 카탈라아제 발현율이 약 5배 증가하였음을 확인하였고 (실시예 11), 퍼옥시다아제 발현율은 약 7.8배 증가하였음을 확인하였다 (실시예 14).
상기 목적 단백질을 코딩하는 유전자를 포함하는 발현벡터는 예를 들어, 도 6C의 개열지도를 가지는 pGLAPSS 벡터일 수 있다. 상기 발현벡터 역시, 적합한 종결인자를 포함하고, 진핵세포에서 목적 단백질의 전사에 유용하도록 폴리아데닐화 서열이 연결될 수 있다.
상기 종결인자 또는 폴리아데닐화 서열은 예를 들어, pdcA 유전자의 전사 종결인자 또는 글루코아밀라제 전사 종결인자일 수 있다. 상기 pdcA 유전자의 전사 종결인자는 아스퍼질러스 오리제(A. oryzae) 유래의 서열번호 15의 서열을 가질 수 있으며, 상기 글루코아밀라제의 전사 종결인자는 아스퍼질러스 나이거 (A. niger) 유래의 서열번호 16의 서열을 가질 수 있다.
상기 발현벡터는 또한, 하나 이상의 선택성 마커를 포함할 수 있다. 상기 선택성 마커는 예를 들어, hyg 유전자일 수 있으며, 항생제 하이그로마이신에서 선별할 수 있는 특성을 가지고 있는 유전자로 형질전환된 균주와 비 형질전환 균주 선별에 이용할 수 있다.
이후, 글루코아밀라제의 발현을 RNAi 시킬 수 있는 shRNA를 코딩하는 폴리뉴클레오티드를 포함하는 발현벡터 및 목적 단백질을 코딩하는 폴리뉴클레오티드가 추가로 도입된 재조합 미생물을 배양하고, 이후 발현된 목적 단백질을 회수한다.
상기 배양 단계에서, 재조합 미생물은 삽입된 프로모터의 작동을 유도하기 위한 소정의 배지에서 배양할 수 있으며, 예를 들어 상기 배지는 포도당 또는 녹말을 탄소원으로 포함할 수 있다. 포함되는 탄소원의 양은 예를 들어 약 1-6% (w/v) 이하일 수 있다.
상기 회수 단계에서, 재조합 미생물로부터 생산된 목적 단백질은 분리되거나 또는 실질적으로 정제될 수 있다. 예를 들어, 원심분리, 투석, 크로마토그래피 등 공지의 방법으로 분리 또는 정제될 수 있으며, 분리 또는 정제에 의해 다른 세포성 물질이나 배양 배지가 실질적으로 포함되어 있지 않을 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
[재료 및 방법]
1. MM Salt 용액
500ml 제조는 다음과 같다. 소듐나이트래이트(NaNO3) 76g, 포타슘포스페이트모노베직(KH2PO4) 38g, 포타슘포스페이트다이베직(K2HPO4) 38g, 포타슘클로라이드(KCl) 26g, 마그네슘설페이트(MgSO4) 26g, 진크설페이트(ZnSO47H2O) 1.10g, 붕산(H2BO3) 0.55g, 망가니스그클로라이드(MnCl2·4H2O) 0.25g, 페릭설페이트(FeSO4·7H2O) 0.25g, 코발트크로라이드(CoCl2·6H2O) 0.08g, 쿠퍼설페이트 (Copper sulfate), 0.051g, 암모늄모리브데이트(Ammonium molybdate) 0.055g, 이디티에이(EDTA) 0.38g.
2. 곰팡이로부터 gDNA 추출
아스퍼질러스 오리제(A. oryzae KACC 44997, 농업유전자원정보센터로부터 구입), 아스퍼질러스 나이거(A. niger N402, FGSC, Fungal Genetic Stock Center)로부터 DNA 추출은 LEE 와 Taylar의 방법으로 수행하였다. 말려진 균사체 가루 20-60 mg을 EP 튜브에 담아 400 ul 용해 버퍼 (50 mM EDTA, 50mM Tris-Hcl, pH8.0, 3% SDS, 1% 2-Mercaptoethanol)를 첨가하여 잘 혼합하였다. 이러한 EP 튜브를 65℃에서 1시간 동안 반응시킨 후, 2배의 페놀/클로로포름을 넣어 gDNA 분리하였다. 분리된 gDNA를 에탄올로 침전하여 추출하였다.
3. 곰팡이로부터 RNA 추출
물기를 제거한 후 균사체를 액체질소에 넣어 빠르게 얼린 다음, 냉동 건조 하였다. 말려진 균사체를 가루로 만든 후 1 ml의 트라이졸를 첨가하였다. RT에서 5분 반응 후 0.2 ml의 크로로포름 첨가한 다음 원심분리하여 상층액만 취하였다. 상층액에 2배의 에탄올로 침전하여 RNA를 추출하였다.
실시예 1: 돌연변이 유발
N402 균주를 4일간 배양한 배양접시로부터 0.08% Tween 80으로 무성포자를 수확한 다음 103 cell/㎖로 희석하였다. 희석액 1 ㎖을 녹말이 첨가된 최소 고체배지에 접종하여 60 rpm으로 회전하는 턴테이블 위에 배양접시 덮개를 제거한 배양 접시를 올려 놓고 회전시키면서 uv 300J에서 10-30분간 돌연변이를 유발한 한 후, 28℃에서 5일간 배양하였다. 배양된 돌연변이 콜로니들로부터 동일한 배지 위에 점접종하여 환이 형성되는 돌연변이들을 골라내었다. 프로테아제 활성이 낮고 글루코아밀라제 발현이 높은 균주를 1차 선별하였다. 10세대 계대배양 및 단일 포자 분리(single spore isolation)로 유전적으로 안정한 균주를 최종 선별하고. 이를 GF101이라 명명하였다. GF101 균주는 산성 프로테아제는 활성이 낮으며, 글루코아밀라제 활성은 1,000~1,300 U/ml로 발현량이 높다.
실시예 2. 플라스크 및 발효조에서 글루코아밀라제 발현량 확인
탄소원으로 1-6%의 포도당과 1-6% 옥분을 각각 이용하였으며, 6% 대두분, 6% CSL, 0.05% 소포제, α-아밀라제 0.01%를 넣고, 70~80℃까지 가열하여 30분간 액화시킨다. 액화액을 250ml 플라스크에 50ml 분주하고, 121℃에서 15분간 멸균하였다. 돌연변이 균주를 5일간 배양한 배양접시로부터 0.1% Tween 80으로 무성포자를 수확한 다음, 1×106 cell/㎖로 수확하여 희석액을 1ml 접종하였다. 진탕 배양기에서 28℃, 200rpm, 4일 동안 배양하였다. 배양 후 규체을 제거하고 글루코아밀라제 활성을 확인하였다. 탄소원으로 포도당 및 옥분을 이용하여 배양 한 결과 1,000U/ml 이상 발현하였다 (표 1). 5L 발효조에서 14% 옥분, 6% 대두분, 6% CSL, 0.05% 소포제 조성물을 이용하여 배양한 결과, GF101 균주의 전체 아밀라제 활성은 4,000~4,500 U/ml로 발현량이 높았다. 이 중 글루코아밀라제는 G1, G2, G3 타입이 모두 발현되며, 약120 kDa의 G1 타입이 가장 높게 발현되었다. 산성 프로테아제는 N402와 SP56 균주에 비해 활성이 약 2배 정도 낮았다.
표 1 GF101 균주 중 글루코아밀라제 발현량
Carbon Source 배양시간
24h 48h 96h 120h
Totalamylase(U/ml) Totalprotein(mg/ml) Totalamylase(U/ml) Totalprotein(mg/ml) Totalamylase(U/ml) Totalprotein(mg/ml) Totalamylase(U/ml) Totalprotein(mg/ml)
Glucose1％ 43.9 0.46 54.4 0.84 69.9 0.91 68.4 0.96
Glucose2％ 91.2 1.25 135.2 1.82 95.4 1.56 157.2 1.33
Glucose4％ 180.6 1.81 299.2 3.18 331.3 3.86 358.9 3.98
Glucose6％ 268.1 2.01 537.6 4.64 803.0 4.86 1001.3 5.55
Corn meal 1％ 61.6 0.64 99.2 1.00 75.1 0.89 93.4 0.94
Corn meal 2％ 105.7 1.40 161.7 1.95 134.0 1.90 173.9 1.89
Corn meal 4％ 251.3 2.05 556.1 3.61 666.3 4.44 1056.0 5.69
Corn meal 6％ 356.1 2.19 922.8 5.03 1022.0 5.68 1327.2 7.37
실시예 3. 글루코아밀라제 프로모터 유전자와 pdcA 종결인자 클로닝
아스퍼질러스 오리제(Aspergillus oryzae) KACC 44997로부터 유래된 pdcA 유전자의 종결인자 영역의 증폭 및 PCR 산물의 클로닝을 다음과 같이 수행하였다. 5`-말단에 Hind III, BamH1, Spe I, NotI이 포함된 pdcA F와 5`-말단에 Xba I이 포함되어 있는 pdcAR 프라이머로 PCR를 실시하여 PCR 산물을 pAN7-Ble벡터 (도 4a)의 Hind III/ Xba I에 클로닝하고 pDCAT-ble라 명명하였다 (도 4b).
pDCAT벡터 구축에 이용한 프라이머 :
pdcAHBSNF (서열번호 17)
ATATAAGCTTGGATCCACTAGTGCGGCCGCAAGCTTGGCACTGGCCGTCGTTTTACAACGTC
pdcAX R (서열번호 18)
ATATTCTAGAGTTCACCCTCCCACCCGAGAGAG
아스퍼질러스 나이거 GF101로부터 유래된 글루코아밀라제 유전자의 서열번호 2에 표시된 프로모터 영역의 증폭 및 PCR 산물의 클로닝을 다음과 같이 수행하였다. 5`-말단에 Hind III 가 포함된 글루코아밀라제 PF와 5`-말단에 BamH1이 포함되어 있는 글루코아밀라제 PR 프라이머로 PCR를 실시하여 PCR 산물을 pDCAT 벡터의 Hind III/ BamH에 클로닝하여 pGLAP라 명명하였다. 상기 플라스미드를 도 4c에 표시하였다.
pGLAP 벡터 구축에 이용한 프라이머
GlaAPHF (서열번호 19)
ATATAAGCTTGACTCCAACCGGGGGGAGTAC
GlaAPR (서열번호 20)
ATATGGATCCTGCTGAGGTGTAATGATGCTG
실시예 4. dsRNA 발현벡터 구축
아스퍼질러스 나이거 GF101로부터 유래된, 인트론이 포함된 글루코아밀라제 유전자의 ORF 영역 (도 2)의 증폭 및 PCR 산물의 클로닝을 다음과 같이 수행하였다. 5`-말단에 Hind III 가 포함된 글루코아밀라제 ORFF와 5`-말단에 XbaI이 포함되어 있는 글루코아밀라제 ORFR 프라이머로 PCR를 실시하여 PCR 산물을 pAN7-Ble 벡터의 Hind III/XbaI에 글루코아밀아제 유전자를 클로닝하여 pGLAORF라 명명하였다.
dsRNA를 생성하는 발현벡터를 구축하기 위해, DNA 절편(서열번호 3)은 si BAF1과 si SPR3 프라이머를 이용하여 1000bp DNA를 증폭 후 글구코아밀라제 프로모터 다운스트림 BamH1/Spe I에 클로닝하고, 안티센스 절편 (서열번호 4)은 si NOF1와 si SP R2 프라이머를 이용하여 699bp DNA를 증폭 후 Spe I/Not I에 구축하여 pIRT 41라 명명하였다 (도 5a). 이러한 벡터에서 발현된 dsRNA는 루프 (서열번호 5)구조를 형성한다. shRNA 발현벡터는 글루코아밀라제 위치와 크기에 따라 pIRT 41, pIRT 42, pIRT 43, pIRT 44, pIRT 45(도 5b, 5c, 5d, 5e)라 명명 하였다.
shRNA 벡터에 사용된 프라이머 염기 서열 및 센스 가닥, 안티센스 가닥, 루프 가닥 DNA 크기를 도 9 및 표 2에 표기하였다. 클로닝 방법은 각각의 프라이머를 이용하여 PCR 후 pIRT 41 벡터 구축 방법과 동일한 제한 효소를 이용하여 구축 하였다. 이탤릭체는 인트론을 나타낸다. 언더라인은 글루코아밀라제 센스 가닥 및 안티센스 가닥를 PCR 할 수 있는 프라이머 위치를 나타낸다.
표 2
Figure PCTKR2015004998-appb-T000001
Figure PCTKR2015004998-appb-I000001
Figure PCTKR2015004998-appb-I000002
Figure PCTKR2015004998-appb-I000003
pIRT 41 벡터
Sense 1000 bp, Antisense 699 bp, Loop 301bp
Sense 프라이머 (si BAF1 / si SPR3), Antisense 프라이머 (si NOF1 / si SPR2)
pIRT 42 벡터
Sense 699 bp, Antisense 502 bp, Loop 199 bp
Sense 프라이머 (si BAF1 / si SPR2), Antisense 프라이머 (si NOF1 / si SPR1)
pIRT 43 벡터
Sense 502 bp, Antisense 347 bp, Loop 155bp
Sense 프라이머 (si BAF1 / si SPR1), Antisense 프라이머 (si NOF1 / si SPR0)
pIRT 44 벡터
Sense 700 bp, Antisense 400 bp, Loop 300 bp
Sense 프라이머 (si BAF2 / si SPR4), Antisense 프라이머 (si NOF2 / si SPR3)
pIRT 45 벡터
Sense 400 bp, Antisense 100 bp, Loop 300bp
Sense 프라이머 (si BAF2 / si SPR3), Antisense 프라이머(si NOF2 / si SPR2)
pIRT 벡터 구축에 이용한 프라이머
si BAF1: 서열번호 21
ATATGGATCCGACCTTGGATTCATGGTTGAG
si BAF2: 서열번호 22
ATATGGATCCTCGTTAGGAACGACCTGTCG
si NOF1: 서열번호 23
ATATGCGGCCGCGACCTTGGATTCATGGTTGAG
si NOF2: 서열번호 24
ATATGCGGCCGCTCGTTAGGAACGACCTGTCG
si SPR0: 서열번호 25
ATATACTAGTTGATACCCTGGACAATTGCC
si SPR1: 서열번호 26
ATATACTAGTAAGCAGCCACTGCCCGAAGC
si SPR2: 서열번호 27
ATATACTAGTGCTCTGCTGGCGCATCTTTGG
si SPR3: 서열번호 28
ATATACTAGTAGCAGGGCTGGAAGGTGGAG
si SPR4: 서열번호 29
ATATACTAGTTATAAGTCGAACTGGACGAAG
실시예 5. pIRT 벡터들의 형질전환
숙주세포에 벡터의 형질전환은 Tilburn et al., (1983) 방법을 변형하여 실행하였다. CYS (Corn 녹말 1%, 효모추출물 0.15%, 솔비톨 21.86%) 배지에 아스퍼질러스 나이거 GF101 균주 포자를 골고루 분산시킨 후, 30℃하에 포자가 골고루 형성될 때까지 5-6일간 배양하였다. 5 ml 0.08% 트윈 80에 잘 섞은 후 포자를 적절한 량의 0.01% (w/v) YPD 배지에 접종한 다음, 30℃에서 균사가 형성될 때까지 배양하였다. 균사체는 여과지에 여과한 후 살균한 물로 세척한 다음 다시 0.7 M KCl 용액으로 잘 세척하였다. 균사를 적절한 양의 0.7 M KCl 용액과 세포외벽을 파쇄하기 위해서 라이싱 효소 (Lysing enzyme-sigma)를 넣은 후 2∼3시간 반응하여 원형질체를 형성시켰다. 형성된 원형질체는 여과지를 이용하여 균사를 제거한 다음, 분리 수집하였다. 0.7 M KCl 완충용액 10 ml로 세척하고, 이후 SB 완충용액(1.2 M sorbitol, 10 mM Tris-HCl, 20 mM CaCl2) 15 ml로 세척한 다음 SB 완충 용액으로 현탁하였다. 각 10 ㎍의 발현 플라스미드와 90 ㎕의 원형질체를 섞은 후 25% PEG 6000 13 ul을 첨가하여 전이를 유도하였다. 믹서된 액을 플레오마이신(100ug/ml)이 첨가된 최소배지에 주입하고, 동일한 배지 4.5 ml을 오버레이하여 30℃에서 5일간 배양하였다.
실시예 6. pIRTs 형질전환체들의 플라스크 배양
14% 옥분, 6% 대두분, 6% CSL, 0.05% 소포제, α-아밀라제 0.01%를 넣고, 70~80℃까지 가열하여 30분간 액화시켰다. 액화액을 250ml 플라스크에 50ml 분주 하고, 121℃에서 15분간 멸균하였다. 돌연변이 균주를 5일간 배양한 배양접시로부터 0.1% Tween 80으로 무성포자를 수확한 다음 1×106 cell/㎖로 수확하여 희석액을 1ml 접종하였다. 진탕배양기에서 28℃, 200rpm, 4일 동안 배양하였다. 형질전환체들은 모두 글루코아밀라제 침묵이 일어났으며, 그 중 pIRT44 형질전환체들의 유전자 침묵 현상이 가장 높았다 (표 3).
표 3 pIRT 형질전환체들의 글루코아밀라제 유전자 침묵 결과
벡터 Transformant GlaA(U/ml) Total protein(mg/ml)
GF101 606.2 6.33
pIRT41 6 230.3 2.43
10 294.6 2.70
pIRT42 1 310.3 3.50
2 360.7 3.61
4 327.1 3.44
5 401.6 3.42
pIRT43 1 296.9 2.68
3 285.6 2.59
4 237.4 2.41
5 285.6 2.59
pIRT44 12 102.5 1.40
17 58.1 1.20
pIRT45 2 495.7 4.33
13 435.8 4.23
실시예 7. pIRTs 형질전환체들의 Real Time PCR
각각의 형질전환체는 24h 배양된 균사체를 액체 질소를 이용하여 분쇄한 뒤 트라이졸 (Invitrogen, USA)을 이용하여 RNA를 분쇄하였다. 각각의 pIRT 발현 백터에 의해 형성된 shRNA 효과는 많게는 90% 감소하였으며, 적게는 34% 감소 하였다 (표 4).
특히, Real Time PCR 결과, pIRT44 형질전환체인 IRT44 균주들은 모두 글루코아밀라제 발현률이 GF101과 비교해 10 %정도 발현되었으며, 총 단백질량은 GF101 대비 80~90 % 감소하였다. 글루코아밀라제의 발현량이 감소하면서 상대적으로 알파-글루코시다아제 발현량은 증가함을 확인하였다 (도 3A 및 3B).
표 4
Strain 벡터 mRNA level (％)
GF101 ― 100
116
IRG16 pIRT41 39
40
IRT21 pIRT42 52
59
IRT24 pIRT42 53
58
IRT34 pIRT43 41
45
IRT417 pIRT44 11
10
RTPCR에 이용한 프라이머
glaA 유전자
RTglaAF: 서열번호 30
ACACGTACTACAACGGCAACC
RTglaAP: 서열번호 31
TTCCTGTGCACCTTGGCTGCC
RTglaAR: 서열번호 32
CTTCACGGCATCTACAATGCT
b-actin 유전자
RTactF: 서열번호 33
CGTGACATCAAGGAGAAGCTC
RTactP: 서열번호 34
ACGGAAACGCTCGTTGCCGAT
RTactR: 서열번호 35
TGAAGGTGGTCTCGTGGATAC
실시예 8. S. 써모필룸(Scytalidium thermophilum) 카탈라제 발현벡터 제작
아스퍼질러스 오리제로부터 유래된 pdcA 유전자의 종결인자 영역의 증폭 및 PCR 산물의 클로닝을 다음과 같이 수행하였다. 5`-말단에 Hind III, StuI, Not I이 포함된 pdcA F와 5`-말단에 Xba I이 포함되어 있는 pdcAR 프라이머로 PCR을 실시하여 PCR 산물을 pAN7-hyg (도 6a)벡터의 Hind III/Xba I에 클로닝하고 pDCAT-hyg라 명명하였다 (도 6b).
아스퍼질러스 나이거 GF101로부터 유래된 글루코아밀라제 유전자의 프로모터+신호서열+전구체 서열 영역의 증폭 및 PCR 산물의 클로닝을 다음과 같이 수행하였다. 5`-말단에 Hind III가 포함된 글루코아밀라제 PF와 5`-말단에 StuI이 포함되어 있는 글루코아밀라제 PR 프라이머로 PCR을 실시하여 PCR 산물을 pDCAT-hyg 벡터의 Hind III/StuI에 클로닝하여 pGLAPSS라 명명하였다. 플라스미드를 (도 6c)에 표시하였다. 카탈라아제 유전자는 S. 써모필룸 gDNA 추출 후 뉴클레오타이드 ScyA F와 5`-말단에 NotI이 포함된 ScyA R을 이용하여 PCR을 통해 확보한 후 pGLASSP 벡터의 StuI/NotI에 클로닝하여 PGLASSP-ScyA (도 7a)라 명명하였다.
[pDCAT 벡터 구축에 이용한 프라이머]
pdcA 프라이머
pdcAHSNF: 서열번호 36
ATATAAGCTTAGGCCTGCGGCCGCAAGCTTGGCACTGGCCGTCGTTTTACAACGTC
pdcAX R: 서열번호 37
ATATTCTAGAGTTCACCCTCCCACCCGAGAGAG
pGLAPSS 벡터 구축에 이용한 프라이머
glaA 프라이머
GlaAPHF: 서열번호 38
ATATAAGCTTGACTCCAACCGGGGGGAGTAC
GlaASSSR: 서열번호 39
ATATAGGCCTCTTGGAAATCACATTTGCCAAC
[pGLAPSS-ScyA 벡터 구축에 이용한 프라이머]
카탈라제 프라이머
ScyA F: 서열번호 40
CAAGCAACATGTCCCTTTGCGGAC
ScyA R: 서열번호 41
ATATGCGGCCGCTAAGAGTCGAGAGCAAACCGATC
실시예 9. PGLASSP-ScyA의 형질전환
CYS (Corn 녹말 1%, 효모추출물 0.15%, 솔비톨 21.86%) 배지에 아스퍼질러스 나이거 IRT417 균주 포자를 골고루 분산시킨 후 30℃하에 포자가 골고루 형성될 때까지 5-6일간 배양하였다. 5 ml 0.08% 트윈 80에 잘 섞은 후 포자를 적절한 량의 0.01% (w/v) YPD 배지에 접종한 다음, 30℃에서 균사가 형성될 때까지 배양하였다. 균사체는 여과지에 여과한 후 살균한 물로 세척한 다음, 다시 0.7 M KCl 용액으로 잘 세척하였다. 균사를 적절한 량의 0.7M KCl 용액과 세포외벽을 파쇄하기 위해서 라이싱 효소(sigma)를 넣은 후 2∼3시간 반응하여 원형질체를 형성시켰다. 형성된 원형질체는 여과지를 이용하여 균사를 제거한 다음 분리 수집하였다. 0.7 M KCl 완충용액 10 ml로 세척하고, 다음 SB 완충용액(1.2 M sorbitol, 10 mM Tris-HCl, 20 mM CaCl2) 15 ml로 세척한 다음 SB 완충용액으로 현탁하였다. 각 pGlaASS-ScyA 10 ㎍의 플라스미드와 90 ㎕의 원형질체에 섞은 후 25% PEG 6000 13 ul을 첨가하고 전이를 유도하였다. 믹서된 액을 플레오마이신(100ug/ml)이 첨가된 최소배지에 주입하고 동일한 배지 4.5 ml을 오버레이하여 30℃에서 5일간 배양하였다.
실시예 10. PGLASSP-ScyA 형질전환체들의 플라스크 배양
14% 옥분, 6% 대두분, 6% CSL, 0.05% 소포제, α-아밀라제 0.01%를 넣고, 70~80℃까지 가열하여 30분간 액화시켰다. 액화액을 250ml 플라스크에 50ml 분주 하고, 121C에서 15분간 멸균하였다. 돌연변이 균주를 5일간 배양한 배양접시로부터 0.1% Tween 80으로 무성포자를 수확한 다음, 1×106 cell/㎖로 수확하여 희석액을 1ml 접종하였다. 진탕배양기에서 28C, 200rpm, 4일 동안 배양하였다.
표 5
Strain Transformants U/ml
Host GF101 9
GF101 형질전환체 GF101-PGLASSP-ScyA 548
Host IRT417 10
IRT417 형질전환체 PGLASSP-ScyA 1 2,357
PGLASSP-ScyA 2 2,645
PGLASSP-ScyA 4 3,212
PGLASSP-ScyA 5 3,446
PGLASSP-ScyA 7 3,162
실시예 11. PGLASSP-ScyA 형질전환체들의 활성 확인
1U는 분당 1μmole의 과산화수소를 분해하는 효소의 양이다. 50mM 포타슘포스페이트버퍼 (pH 7.0) 49.9ml에 30% Hydrogen Peroxide 0.1ml을 첨가하여 제조한다. 발효액 30ul를 첨가하여 255nm에서 흡광도를 측정하였다. GF101 및 IRT417 균주의 카탈라제 활성은 10U/ml 미만이었다. 글루코아밀라제 발현량이 많은 균주에서 카탈라제 활성은 548U/ml이며, shRNA에 의해 글루코아밀라제 유전자 침묵이 일어난 균주에서는 3000U/ml의 활성을 보였다. 글루코아밀라제 유전자 침묵에 의해 카탈라아제 발현율은 전체적으로 약 5배 증가하였다 (도 7b).
실시예 12. C. 시네리우스(Coprinus cinereus) 퍼옥시다아제 발현벡터 제작
C. 시네리우스 퍼옥시디아제 유전자는 C. 시네리우스 gDNA 추출 후 뉴클레오타이드 Cip1A F와 5`-말단에 NotI이 포함된 Cip1R을 이용하여 PCR를 통해 확보한 후, pGLASSP벡터의 StuI/ NotI에 클로닝하여 PGLASSP-Cip1이라 명명하였다 (도 8a).
[pGLAPSS-Cip1 벡터 구축에 이용한 프라이머]
Cip1 F: 서열번호 42
CCGATGCTGCAGCATAATGC
Cip1 R: 서열번호 43
ATATGCGGCCGCTTCGCTAGGCTAGTCGGAAGGC
실시예 13. PGLASSP-Cip1 형질전환 및 형질전환체 플라스크 배양
CYS (Corn 녹말 1%, 효모추출물 0.15%, 솔비톨 21.86%) 배지에 아스퍼질러스 나이거 IRT417 균주 포자를 골고루 분산시킨 후, 30℃하에 포자가 골고루 형성될 때까지 5-6일간 배양하였다. 5 ml 0.08% 트윈 80에 잘 섞은 후 포자를 적절한 량의 0.01% (w/v) YPD배지에 접종한 후 30℃에서 균사가 형성될 때까지 배양하였다. 균사체는 여과지에 여과한 후 살균한 물로 세척한 다음, 다시 0.7 M KCl 용액으로 잘 세척하였다. 균사를 적절한 량의 0.7 M KCl 용액과 세포외벽을 파쇄하기 위해서 라이싱 효소(sigma)를 넣은 후 2∼3시간 반응하여 원형질체를 형성시켰다. 형성된 원형질체는 여과지를 이용하여 균사를 제거한 다음 분리 수집하였다. 0.7 M KCl 완충용액 10 ml로 세척한 다음 SB 완충용액(1.2 M sorbitol, 10 mM Tris-HCl, 20 mM CaCl2) 15 ml로 세척한 다음 SB 완충용액으로 현탁하였다. 각 pGlaASS-Cip1 10 ㎍의 플라스미드와 90 ㎕의 원형질체에 섞은 후 25% PEG 6000 13 ul을 첨가하고 전이를 유도하였다. 믹서된 액을 플레오마이신(100ug/ml)이 첨가된 최소배지에 주입하고 동일한 배지 4.5 ml을 오버레이하여 30℃에서 5일간 배양하였다.
실시예 14. PGLASSP-Cip1 형질전환체들의 플라스크 배양
14% 옥분, 6% 효모추출물 2% CSL, 0.05% 소포제, α-아밀라제 0.01%를 넣고, 70~80℃까지 가열하여 30분간 액화시켰다. 액화액을 250ml 플라스크에 50ml 분주 하고, 121℃에서 15분간 멸균하였다. 돌연변이 균주를 5일간 배양한 배양접시로부터 0.1% Tween 80으로 무성포자를 수확한 다음, 1×106 cell/㎖로 수확하여 희석액을 1ml 접종하였다. 진탕배양기에서 28℃, 200rpm, 4일 동안 배양하였다.
실시예 15. PGLASSP-Cip1 형질전환체들의 활성 확인
1U는 분당 1 μmole의 과산화수소를 분해하는 효소의 양이다. 50mM 포타슘포스페이트 버퍼 (pH7.0) 49.9ml에 30% H2O2 0.1ml을 첨가하여 만든다. 발효액 30ul를 첨가하여 255nm에서 흡광도를 측정하였다. 글루코아밀라제 발현량이 많은 GF101 균주에서 카탈라제 활성은 149.9U/ml이며, shRNA에 의해 글루코아밀라제 유전자 침묵이 일어난 균주에서는 1,176U/ ml 활성을 보였다. 글루코아밀라제 유전자 침묵에 의해 퍼옥시다아제 발현율은 전체적으로 약 7.8배 증가하였다 (도 8b).
표 6 PGLASSP-Cip1 형질전환체들의 활성 확인
Strain Transformants U/ml
Host GF101 0
GF101 형질전환체 GF101-PGLASSP cip 1 149.9
Host IRT417 10
IRT417 형질전환체 PGLASSP-Cip1-1 751
PGLASSP-Cip1-8 1,054
PGLASSP-Cip1-10 1,176
본 발명이 속한 분야에서 통상의 지식을 가진 자라면 상기 내용을 바탕으로 본 발명의 범주내에서 다양한 응용 및 변형을 행하는 것이 가능할 것이다.
본 발명을 통해, 아스퍼질러스 나이거에서 유전자를 치환에 의해 제거하지 않고, RNAi 기작을 통해 글루코아밀라제을 억제한 조건에서 목적 단백질의 발현을 증가시킬 수 있으므로, 산업적으로 유용한 목적 단백질을 대량으로 생산할 수 있다. 또한, 목적 단백질의 발현에 영향을 줄 수 있는 특정 유전자들을 제거하지 않고, 글루코아밀라제 유전자만을 침묵시킨 조건에서 목적 단백질을 생산할 수 있다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.

Claims (15)

  1. 프로모터 및 상기 프로모터에 작동가능하게 연결된 폴리뉴클레오티드를 포함하고, 상기 폴리뉴클레오티드는 글루코아밀라제의 발현을 RNAi시킬 수 있는 shRNA를 코딩하는 것임을 특징으로 하는 발현벡터.
  2. 제1항에 있어서, 상기 글루코아밀라제는 서열번호 1로 표시되는 서열을 가지는 것임을 특징으로 하는 발현벡터.
  3. 제1항에 있어서, 상기 shRNA는 서열번호 3, 4, 6, 8, 10-13으로 표시되는 서열들로 이루어진 군에서 선택된 하나 이상의 서열로부터 코딩되는 것임을 특징으로 하는 발현벡터.
  4. 제1항에 있어서, 상기 프로모터는 서열번호 2의 서열을 가지는 것임을 특징으로 하는 발현벡터.
  5. 제1항에 있어서, 상기 벡터는 도 1A의 개열지도를 가지는 pIRT 41, 도 1B의 개열지도를 가지는 pIRT 42, 도 1C의 개열지도를 가지는 pIRT 43, 도 1D의 개열지도를 가지는 pIRT 44 및 도 1E의 개열지도를 가지는 pIRT 45로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 발현벡터.
  6. 제1항에 있어서, pdcA 유전자의 전사 종결인자 또는 글루코아밀라제의 전사 종결인자를 추가로 포함하는 것을 특징으로 하는 발현벡터.
  7. 제6항에 있어서, 상기 pdcA 유전자의 전사 종결인자는 서열번호 15의 서열을 가지는 것을 특징으로 하는 발현벡터.
  8. 제6항에 있어서, 상기 글루코아밀라제 전사 종결인자는 서열번호 16의 서열을 가지는 것을 특징으로 하는 발현벡터.
  9. 제1항 내지 제8항 중 어느 하나의 발현벡터가 도입되어 있는 재조합 미생물.
  10. 제9항에 있어서, 곰팡이인 것을 특징으로 하는 재조합 미생물.
  11. 제10항에 있어서, 상기 곰팡이는 Aspergillus niger인 것을 특징으로 하는 재조합 미생물.
  12. 제9항에 있어서, 목적 단백질을 코딩하는 유전자가 추가로 도입되어 있는 것을 특징으로 하는 재조합 미생물.
  13. 제12항의 재조합 미생물을 배양하여 목적 단백질을 발현시키는 단계; 및 상기 발현된 목적 단백질을 회수하는 단계를 포함하는 목적 단백질의 제조방법.
  14. 제13항에 있어서, 상기 목적 단백질은 글루코아밀라제의 발현이 억제된 상태에서 발현이 증가하는 것임을 특징으로 하는 방법.
  15. 제13항에 있어서, 상기 목적 단백질은 카탈라아제 또는 퍼옥시다아제인 것을 특징으로 하는 방법.
PCT/KR2015/004998 2014-05-27 2015-05-19 유전자 침묵에 의한 목적 단백질의 과발현 방법 WO2015182913A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020140063976A KR101681669B1 (ko) 2014-05-27 2014-05-27 유전자 침묵에 의한 목적 단백질의 과발현 방법
KR10-2014-0063976 2014-05-27

Publications (1)

Publication Number Publication Date
WO2015182913A1 true WO2015182913A1 (ko) 2015-12-03

Family

ID=54699194

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/004998 WO2015182913A1 (ko) 2014-05-27 2015-05-19 유전자 침묵에 의한 목적 단백질의 과발현 방법

Country Status (2)

Country Link
KR (1) KR101681669B1 (ko)
WO (1) WO2015182913A1 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009029688A2 (en) * 2007-08-27 2009-03-05 Boston Biomedical, Inc. Compositions of asymmetric interfering rna and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009029688A2 (en) * 2007-08-27 2009-03-05 Boston Biomedical, Inc. Compositions of asymmetric interfering rna and uses thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE genbank [O] 17 February 2011 (2011-02-17), PEL, HJ: "Aspergillus niger contig An03c0200, genomic contig", XP055240961, retrieved from ncbi Database accession no. AM270061.1 *
MERTENS, J. A. ET AL.: "Plasmids for expression of heterologous proteins in Rhizopus oryzae", ARCH. MICROBIOL., vol. 186, no. 1, July 2006 (2006-07-01), pages 41 - 50, XP055240964, ISSN: 0302-8933 *
REY, M. W. ET AL.: "Cloning, heterologous expression, and characterization of Thielavia terrestris glucoamylase", APPL. BIOCHEM. BIOTECHNOL., vol. 111, no. 3, December 2003 (2003-12-01), pages 153 - 166, XP055240954 *

Also Published As

Publication number Publication date
KR101681669B1 (ko) 2016-12-02
KR20150136728A (ko) 2015-12-08

Similar Documents

Publication Publication Date Title
WO2015194921A1 (ko) 신규한 피키아 쿠드리압즈비 ng7 균주 및 이의 용도
EP0894126B1 (en) Alkaline protease deficient filamentous fungi
WO2019117671A1 (ko) 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법
WO2014208970A1 (ko) 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
WO2014148743A1 (ko) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법
WO2016200207A1 (ko) 젖산을 생산하는 미생물 및 이를 이용한 젖산 제조 방법
WO2020111890A1 (ko) 바이오레티놀을 생산하는 미생물 및 이를 이용한 바이오레티놀의 생산방법
JP2019511218A (ja) 微生物におけるタンパク質産生のための遺伝子操作されたリボソームプロモーター
EP4092128A1 (en) Factor regulating protein expression efficiency of trichoderma reesei, and regulation method and use thereof
WO2012046924A1 (ko) 아라비노스 대사경로가 도입된 자일리톨 생산균주 및 이를 이용한 자일리톨 생산방법
WO2015163682A1 (ko) 2，3－부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2，3－부탄디올의 생산 방법
JP2000501620A (ja) ａｒｅＡ，ｐｅｐＣ及び／又はｐｅｐＥ遺伝子が不活性化されている菌類
WO2011099670A1 (ko) 셀룰로시마이크로비움 펀케이 에이치와이-１３ 균주로부터 생산되는 신규한 자일라나아제
WO2011071207A1 (ko) 미량 원소 함량이 증가된 벼 품종 및 그의 용도
WO2021187750A1 (ko) 식물에서 목적 단백질을 대량생산하는 방법
US10550398B2 (en) RlmA-inactivated filamentous fungal host cell
WO2019004779A2 (ko) 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법
WO2015182913A1 (ko) 유전자 침묵에 의한 목적 단백질의 과발현 방법
WO2021002630A1 (ko) 파에오닥틸룸 트리코르누툼의 신규 프로모터 hasp1와 이의 신호 펩타이드 및 이의 용도
WO2019031804A9 (ko) 목적 유전자 발현 조절을 위한 대장균 및 코리네박테리움 글루타미쿰 셔틀 벡터
Long et al. Highly efficient transformation of a (hemi-) cellulases-producing fungus Eupenicillium parvum 4–14 by Agrobacterium tumefaciens
WO2020166943A1 (ko) 유전자 총법을 이용한 미세조류의 교정 방법
WO2019004780A2 (ko) 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법
WO2021054545A1 (ko) 7-adca 제조를 위한 데아세트옥시세팔로스포린 c의 고농도 생산 재조합 아크레모니움 크리소제눔 균주의 제조방법 및 이 방법으로 제조된 균주
WO2012141547A2 (ko) 활성이 증진된 변이 베타-글루코시다제 및 이를 이용한 바이오 에탄올의 제조방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15800578

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15800578

Country of ref document: EP

Kind code of ref document: A1