WO2011071207A1 - 미량 원소 함량이 증가된 벼 품종 및 그의 용도 - Google Patents

미량 원소 함량이 증가된 벼 품종 및 그의 용도 Download PDF

Info

Publication number
WO2011071207A1
WO2011071207A1 PCT/KR2009/007603 KR2009007603W WO2011071207A1 WO 2011071207 A1 WO2011071207 A1 WO 2011071207A1 KR 2009007603 W KR2009007603 W KR 2009007603W WO 2011071207 A1 WO2011071207 A1 WO 2011071207A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
gene
osnas2
osnas3
iron
Prior art date
Application number
PCT/KR2009/007603
Other languages
English (en)
French (fr)
Inventor
안진흥
전은실
김유선
이시철
김윤근
Original Assignee
포항공과대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 포항공과대학교 산학협력단 filed Critical 포항공과대학교 산학협력단
Priority to JP2012543001A priority Critical patent/JP2013513381A/ja
Priority to CN2009801634143A priority patent/CN103025152A/zh
Publication of WO2011071207A1 publication Critical patent/WO2011071207A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
    • A01G22/00—Cultivation of specific crops or plants not otherwise provided for
    • A01G22/20—Cereals
    • A01G22/22—Rice
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L7/00—Cereal-derived products; Malt products; Preparation or treatment thereof
    • A23L7/10—Cereal-derived products
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L7/00—Cereal-derived products; Malt products; Preparation or treatment thereof
    • A23L7/10—Cereal-derived products
    • A23L7/196—Products in which the original granular shape is maintained, e.g. parboiled rice
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/12—Antidiarrhoeals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08—Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/14—Drugs for dermatological disorders for baldness or alopecia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/12—Drugs for disorders of the metabolism for electrolyte homeostasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/12—Antihypertensives

Definitions

  • the present invention relates to a transgenic plant in which the content of trace elements is increased by the activation of OsNAS2 gene or OsNAS2 gene of a plant, and a functional food containing a product produced from the transgenic plant.
  • Iron is the fourth most abundant element on Earth, but it is not readily accessible by plants. This is because most of the iron in the soil exists in the form of oxyhydrate and has a very low solubility. In addition, about 30% of the world's soil is basic. In soils with these properties, iron is present in the form of Fe 2 O 3 with very low solubility, making plant growth difficult (Mori, Curr Opin Plant Biol 2: 250-253, 1999). This lack of iron has a devastating effect on plants. In particular, iron deficiency affects the synthesis of chlorophyll and the development of chloroplasts, thus reducing the production of plants.
  • Iron is also important for human health. Iron is one of the indispensable trace metal elements required for various functions in cells. According to the World Health Organization (WHO), about 30% of the world's population is anemic due to iron deficiency and most of them are concentrated in underdeveloped countries. Zinc deficiency inhibits plant growth, stress tolerance and chlorophyll production. It is also known that zinc plays an important role in the immune response of humans, increasing resistance to infection, and regulating cell growth and wound healing.
  • WHO World Health Organization
  • Plants are known to overcome iron deficiency in two ways (Marschner et al., J. Plant Nutr 9: 3-7, 1986). Most plants absorb Fe 3+ after they are reduced to Fe 2+ , while rice plants such as rice and barley produce iron-binding substances called phytosiderophore (Fe 3+ ) Thereby increasing the solubility and absorbing the complex of iron and phytocydelopore.
  • Rice is an important stock for civilization, and the development of rice varieties containing a large amount of iron is important for promoting human health. Therefore, the cultivation of rice varieties with high iron content by genetic engineering has been proposed as an alternative to overcome the limitations of traditional breeding methods and to solve human health problems caused by iron deficiency (Qu et al., Planta 222: 225- 233, 2005).
  • a gene expressing ferritin is isolated from soybean and rice, and then it is combined with an endosperm-specific promoter isolated from globulin, glutelin and jane which are seed storage proteins of rice and corn, Specific expression vectors are prepared and transformed with these expression vectors to describe rice having high iron production capacity.
  • this method uses genes derived from soybean, corn and the like other than rice.
  • NAAT nicotianamine aminotransferase
  • a gene coding for a reducing enzyme that reduces keto to 2'-deoxy myosinic acid of nicotianamine is introduced to produce a plant having enhanced iron deficiency resistance .
  • this method uses a gene encoding a reductase that reduces the keto to nicotianamine into 2'-deoxy myosinic acid.
  • NA nicotianamine
  • NAS Nicotianamine synthase
  • Angiotensin converting enzyme an important enzyme in the renin-angiotensin system (RAS), an important mechanism of hypertension, is the most frequently occurring chronic systemic disease. I (angiotensin I: Ang I) to angiotensin II (angiotension II: Ang II). It is known that the converted Ang II contracts blood vessels and increases blood pressure. Thus, for the purpose of improving hypertension, ACE inhibitors have been developed and are commercially available, and there have been several reports showing that nicotianamine acts as an ACE inhibitor (Usuda et al., Plant Biotech J 7: 87-95, 2009).
  • the inventor of the present invention has found that the content of trace elements is increased when the OsNAS2 gene or OsNAS2 gene originally present in rice is activated, thus completing the present invention.
  • the present invention is to provide a transgenic plant in which the content of trace elements is increased by the activation of a gene present in the plant itself as compared with the wild type, and a functional food containing the product produced from the transgenic plant.
  • Exemplary embodiments of the invention provide plants with increased content of trace elements.
  • Another exemplary embodiment of the present invention is a method of growing a plant comprising the step of growing a plant according to the exemplary embodiment of the present invention described above under conditions in which one or more members selected from the group consisting of iron and zinc are deficient .
  • Another exemplary embodiment of the present invention provides a method of growing a plant comprising the step of growing the plant according to the exemplary embodiment of the present invention in the presence of an excessive amount of heavy metal.
  • Another exemplary embodiment of the present invention provides a functional food containing the plant or the product produced therefrom.
  • Another exemplary embodiment of the present invention provides a pharmaceutical composition comprising the plant or the product produced therefrom.
  • Another exemplary embodiment of the present invention provides a method of making a plant with increased trace element content.
  • Another exemplary embodiment of the present invention provides a method of growing a plant, comprising growing the plant as described above at high pH conditions.
  • FIG. 1 shows a form of a DNA structure into which T-DNA is inserted.
  • FIG. 2A shows quantitative real-time RT-PCR analysis of the expression pattern of the OsNAS2 gene in leaves or roots grown for 7 days in a medium supplemented with 0, 1, 10, and 500 ⁇ M Fe (III) -EDTA on MS medium It is.
  • FIG. 2B shows that rice seeds were cultured for 7 days in MS medium without addition of 100 ⁇ M Fe (III) -EDTA and then transferred to a medium supplemented with 100 ⁇ M Fe (III) -EDTA. After that, rice leaves and roots The expression of OsNAS2 was measured from RNA extracted from E. coli.
  • Fig. 3 compares the expression levels of OsNAS2 with respect to OsNAS2-D1 and its wild type (WT).
  • Fig. 4 is a graph showing the results of a comparison between the MS solid medium (MS) containing both iron and zinc, the MS solid medium (Fe-) without iron, the wild type (WT) grown with MS solid medium (Zn- -D1 is a phenotype.
  • Figure 5 shows the phenotype and elongation of the wild type (WT) and OsNAS2-D1 grown in MS medium (MS / pH 8.5) at pH 8.5, MS medium (Fe- / pH 8.5)
  • FIG. 5 shows the phenotype and elongation of the wild type (WT) and OsNAS2-D1 grown in MS medium (MS / pH 8.5) at pH 8.5, MS medium (Fe- / pH 8.5)
  • Figure 6 is a phenotype of wild type (WT) and OsNAS2-D1 grown in each solid MS medium supplemented with excess zinc (5 mM), copper (0.3 mM) or nickel (0.5 mM).
  • FIG. 7 shows a form of a DNA structure into which T-DNA is inserted.
  • Figures 8, 9 and 10 show the expression patterns of the OsNASl, OsNAS2 or OsNAS3 genes in rice leaves or roots grown in media not containing Fe, Zn, Cu or Mn in MS medium and MS medium using quantitative real time RT-PCR Respectively.
  • FIG 11 compares the expression levels of OsNAS3 in OsNAS3- D1 and its wild type (WT), OsNAS3- D2 and its wild type (WT).
  • Fig. 12 shows the results of a comparison between the wild-type (WT) and the OsNAS3 - derived wild type (MS) solid medium (MS) containing iron and zinc, MS solid medium (Fe-) without iron, MS solid medium It is a leaf for examining phenotype and whitening phenomenon of D1.
  • Figure 13 shows the phenotype and elongation of wild type (WT) and OsNAS3- D1 grown on each solid MS medium supplemented with excess zinc (5 mM), copper (0.3 mM) or nickel (0.5 mM).
  • Figure 14 shows the phenotype and elongation of wild-type (WT) and OsNAS3- D1 grown in MS medium (MS / pH 8.5), pH 8.5, and iron-free MS medium (Fe- / pH 8.5) .
  • Nicotyanamine synthase 2 present in rice OsNAS2
  • OsNAS2 Nicotyanamine synthase 2 present in rice
  • Nicotianaamine synthase ( OsNAS1 , OsNAS2 , OsNAS3 ) is present in rice and has activity as an enzyme (Inoue et al., Plant J 36: 366-381, 2003).
  • the expression level of OsNAS2 gene was determined by the concentration of iron supplied from the outside. Seeds of rice were cultivated in a medium supplemented with MS medium (0.1 ⁇ M CuSO 4 , 100 ⁇ M Fe (III) -EDTA, 30 ⁇ M ZnSO 4 , 10 ⁇ M MnSO 4 ) and 0 ⁇ M, 1 ⁇ M, 10 ⁇ M and 500 ⁇ M Fe Rice seeds were germinated on MS medium and grown for 7 days.
  • rice seeds were grown on MS medium without addition of 100 ⁇ M Fe (III) -EDTA for 7 days, and transferred to MS medium supplemented with 100 ⁇ M Fe (III) -EDTA to grow and grow to confirm the expression of OsNAS2 .
  • RNA was prepared from the roots and leaves of rice and the degree of expression was analyzed by quantitative real-time RT-PCR.
  • the PCR conditions were maintained at 95 ⁇ for 1 minute and then repeated 45 times at 94 ⁇ for 15 seconds, at 56 ⁇ for 10 seconds, and at 72 ⁇ for 10 seconds.
  • the primers used were as follows.
  • rice actin 1 gene was amplified.
  • OsNAS2 -forward primer 5'-CGTCTGAgtgcgtgcatagta -3 '(SEQ ID NO: 3)
  • OsNAS2 -reverse primer 5'- GAAGCACAAACACAAACCGATA -3 '(SEQ ID NO: 4)
  • OsAct1 -forward primer 5'-TGGAAGCTGCGGGTATCCAT-3 '(SEQ ID NO: 5)
  • OsAct1 -reverse primer 5'-TACTCAGCCTTGGCAATCCACA-3 '(SEQ ID NO: 6)
  • the vertical axis indicates the degree of expression based on the expression level of rice actin 1 gene.
  • FIG. 2A shows the OsNAS2 gene was strongly induced in leaves when rice was grown in a medium containing no iron, but not in medium containing Fe (III) -EDTA of 1 ⁇ M or more. In the roots, the highest expression was observed in the medium containing no iron, and the expression decreased with increasing iron concentration.
  • FIG. 2B shows the expression of OsNAS2 with 100 ⁇ M of Fe (III) -EDTA in the medium and elapsed time.
  • the rice used in Fig. 2 is Dongjin rice.
  • the pGA2715 vector a T-DNA vector, was used as a construct for producing transformed rice (Jeong et al., Plant Physiol 130: 1636-1644, 2002).
  • the vector contains a beta-glucuronidase (GUS) reporter gene adjacent to the right border and includes a tetramerized transcription enhancer derived from the CaMV 35S promoter adjacent the left border.
  • GUS beta-glucuronidase
  • the pGA2715 vector was transformed into Agrobacterium and transformed into wild type Dongjin rice using the transformed Agrobacterium to prepare a population of rice plants transfected with pGA2715 (Lee et al, J Plant Biol 42: 310-316 , 1999; Jeong et al., Plant Physiol 130: 1636-1644, 2002; Jeong et al., Plant Journal 45: 123-132, 2006).
  • Genomic DNA isolated from the transgenic rice plants was subjected to inverse PCR to confirm the insertion position of T-DNA in the pGA2715 vector.
  • OsNAS2-D1 one transgenic plant in which T-DNA was inserted around the OsNAS2 gene was isolated.
  • Fig. 1 shows the insertion position of T-DNA in OsNAS2-D1 .
  • OsNAS2- D1 selected in Example 1 was determined through PCR. Genomic DNA was extracted from leaves of the T2 generation of OsNAS2- D1 and used as template DNA for PCR.
  • OsNAS2 -D1 2 of the gene-specific primers F (5'- ACCTTACTCCCCCGAACTAA -3 ': SEQ ID NO: 7) and R (5'- CAAGGAGCTGTCCGTCTAAC -3': SEQ ID NO: 8 and the T-DNA specific primers RB ( (100 ⁇ M Fe (III) -EDTA) of each of the homozygotes of OsNAS2- D1 and each wild-type rice, ie, Dong-Jin rice (WT), was used in order to examine the expression level of 5'-CAAGTTAGTCATGTAATTAGCCAC- RNA was isolated from leaves and roots, flag leaves, flower buds, and immature seeds grown for 7 days in the medium with or without the addition of reverse transcriptase RT-PCR was performed using primers of SEQ ID NO
  • OsNAS2 gene was increased in all the conditions of OsNAS2- D1 compared to the wild type (WT).
  • Example 3 Increase in the amount of Niconinamine in seeds of transgenic plants
  • the amount of nicotianamine in the seeds was measured.
  • the seeds were finely ground using Muilti-Beads Shocker (Yasui kikai, Osaka Japan), and then 20 mg of the powder was extracted with 400 ⁇ l of 80% ethanol for 15 minutes three times to extract nicotianamine.
  • the extracted nicotianamine was quantitatively analyzed using LC-ESI-TOF-MS. The results are shown in Table 1 below.
  • the amount of nicotianamine in the OsNAS2-D1 seeds was about 19.8-fold higher than that in the wild type.
  • OsNAS2-D1 increased 3.0 times iron, 2.7 times zinc, and 1.2 times copper, compared to the wild type. In comparison with wild tongue, OsNAS2-D1 increased 1.4 times in iron and zinc and 1.5 times in copper.
  • Example 5 Analysis of seedling phenotype of transgenic plants in the absence of iron and zinc
  • Wild type (WT) and OsNAS2- D1 were germinated in MS solid medium containing iron and zinc, MS solid medium (Fe-) without iron, MS solid medium (Zn-) without zinc, And the seedling phenotype was observed. The results are shown in Table 3. In addition, the elongation and chlorophyll contents of the phenotype were measured and shown in Table 3. Chlorophyll was collected from leaves, weighed, and extracted with 80% acetone.
  • OsNAS2 - D1 was 1.7 times higher than that of wild type (WT) in stem and root, and the concentration of iron increased 1.5 and 1.7 times in stem and root, respectively .
  • WT wild type
  • the pH of the soil has a great effect on the solubility of the elements required for the plant. For example, when the pH is 8.0 or more, iron is converted into a Fe 2 O 3 form having a low solubility, so that the plant can not be used and absorbed properly. As a result, iron shortage occurs.
  • Wild type (WT) and OsNAS2 - D1 were germinated on MS medium (MS / pH 8.5) adjusted to 8.5 and grown for 10 days and phenotype was observed. The phenotype was also observed by the same method in an iron-free MS medium (Fe- / pH 8.5). The phenotype and the elongation of the plant are shown in Fig. As shown in FIG. 5, it can be seen that OsNAS2 - D1 is more elongated and more resistant to wild type (WT) in MS medium (MS / pH 8.5) adjusted to pH 8.5. These results were more evident in the iron-free MS medium (Fe- / pH 8.5).
  • Wild type (WT) and OsNAS2- D1 were germinated in solid MS medium supplemented with excess amount of zinc (5 mM), copper (0.3 mM) or nickel (0.5 mM) and grown for 10 days to observe the seedling phenotype.
  • the phenotype, the elongation of the plant and the concentrations of heavy metals are shown in FIG. 6 and Table 5.
  • OsNAS2- D1 was taller than the wild type, and the whitening phenomenon progressed less. These results indicate that OsNAS2- D1 is more resistant to toxicity by heavy metals than wild type (WT).
  • the concentration of zinc, copper and nickel in the stem and roots was measured by the same method as in Example 4 when grown in solid MS medium containing excessive amounts of zinc, copper and nickel, and the results are shown in Table 6 .
  • OsNAS2 - D1 increased 1.4 times, 1.5 times, 1.4 times, 1.4 times, 1.4 times and 1.2 times, respectively, in the roots and roots of wild type (WT).
  • a mouse feeding assay was performed to determine whether the increase in iron content of the seeds of OsNAS2-D1 was absorbed by seed intake and the bioavailability of iron used was increased.
  • Groups of rats fed the normal diet from the beginning were measured in the control group (control group, CD).
  • Hb and Hct were measured by taking blood at 1 week, 2 weeks, and 4 weeks after rice. The results are shown in Table 8. As shown in Table 8, there was no significant difference between the Hb and Hct of the mice until they fed the rice from wild type (WT) or OsNAS2-D1 seeds.
  • the Hb and Hct of the two groups were measured, and the second group showed a slight increase in Hb and Hct compared to the first group. After one week, Hb and Hct were measured. In this case, the second group showed a significant increase in Hb and Hct compared to the first group.
  • the results were similar to those of the normal feed group, The Hb and Hct of the second group were significantly higher than those of the first group and were similar to the group fed with sufficient iron.
  • Table 7 A group of rats fed an iron-rich diet A group of mice fed with iron-deficient feed Hb (g / L) 16.10 ⁇ 0.37 10.50 ⁇ 1.50 Hct (%) 49.60 ⁇ 1.79 37.00 + - 4.80
  • Table 8 group When to measure 1 0 weeks 1 week 2 weeks 4 weeks Hb (g / L) CD 16.10 ⁇ 0.37 17.00 ⁇ 1.20 17.80 + - 0.42 16.00 + - 0.40 WT 9.90 + - 0.35 10.83 + - 0.57 11.00 ⁇ 0.52 12.80 ⁇ 0.57 OsNAS2-D1 11.00 ⁇ 0.82 12.08 ⁇ 1.25 16.10 + - 0.57 15.30 ⁇ 0.17 Hct (%) CD 49.60 ⁇ 1.79 51.40 ⁇ 1.81 54.40 ⁇ 0.90 52.00 ⁇ 1.43 WT 34.80 ⁇ 1.20 41.10 ⁇ 3.14 40.80 +/- 1.37 46.70 ⁇ 1.55 OsNAS2-D1 37.10 ⁇ 2.15 47.35 ⁇ 2.27 52.30 + - 0.54 51.40 ⁇ 0.92
  • a mouse feeding assay was performed to determine whether the increase in zinc content of the seeds of OsNAS2-D1 was increased by bioavailability of zinc which was absorbed upon seed ingestion.
  • mice weighing approximately 13 g were fed with sufficient feed (30 mg Zn / kg diet, Control Diet (CD)) and zinc-deficient diet (modified AIN-93G diet containing iron 3 mg / kg diet, Iron-depleted Diet (ZD)). Two weeks later, blood was drawn from both groups of rats. The zinc content was measured. As a result, zinc in the blood of rats fed zinc-deficient feeds was reduced to 66% compared to rats fed enough feed of zinc (Table 9).
  • Table 9 A group of rats fed zinc with sufficient feed Group of rats fed with zinc-deficient feed Zn ( ⁇ ⁇ / ml) 2.017 + 0.260 1.341 + 0.187
  • Zinc levels were measured in rats fed a normal diet as controls. Blood samples were taken at 2, 6, 10, 15, 20 and 30 days after feeding with normal diet and rice. The results are shown in Table 10. As shown in Table 10, it was found that the zinc level increased from two days after feeding the normal diet or rice.
  • the group fed the OsNAS2-D1 seed showed similar zinc levels to the group fed the normal diet in 10 days, while the group fed the wild-type seeds still showed a low level after 30 days.
  • the zinc-deficient diet and the group that changed to normal diet also had zinc levels that were similar to those of the group that had been fed from the beginning to about 20 days.
  • the present inventors have also found that the rice varieties OsNAS2-D1 having an increased amount of trace metals obtained in the above-mentioned Examples were used as a result of a study by the International Depositary Authority (Korea Research Institute of Bioscience and Biotechnology) Research Institute of Bioscience and Biotechnology: KRIBB), and received seed accession number KCTC 11597BP.
  • Nicotianaamine synthase (OsNAS1, OsNAS2 , OsNAS3 ) is present in rice and has activity as an enzyme (Inoue et al., Plant J 36: 366-381, 2003). The expression level of the above 3 genes according to presence or absence of trace elements was examined. Rice seeds were germinated in MS (Murashige and Skoog) medium (containing 0.1 ⁇ M CuSO 4 , 100 ⁇ M Fe (III) -EDTA, 30 ⁇ M ZnSO 4 , 10 ⁇ M MnSO 4 ) and grown for 7 days.
  • OsNASl-forward primer 5'-ACTCCATTTGGTTGTCATTTT-3 '(SEQ ID NO: 13)
  • OsNAS1-reverse primer 5'-GGTTGACGTAGTTGCCGTAGTA-3 '(SEQ ID NO: 14)
  • OsNAS2 -forward primer 5'-GTGATCAACTCCGTCATCGT-3 '(SEQ ID NO: 15)
  • OsNAS2 -reverse primer 5'-TGACAAACACCTCTTGCTTTC-3 '(SEQ ID NO: 16)
  • OsNAS3 -forward primer 5'-GTGATCAACTCCGTCATCATC-3 '(SEQ ID NO: 17)
  • OsNAS3 -reverse primer 5'-TCAGTCTCATCATGGGAAAAA-3 '(SEQ ID NO: 18)
  • OsAct1 -forward primer 5'-TGGAAGCTGCGGGTATCCAT-3 '(SEQ ID NO: 23)
  • OsAct1 -reverse primer 5'-TACTCAGCCTTGGCAATCCACA-3 '(SEQ ID NO: 24)
  • Figs. 8, 9 and 10 The results are shown in Figs. 8, 9 and 10.
  • the vertical axis indicates the degree of expression based on the expression level of rice actin 1 gene.
  • the pGA2715 vector a T-DNA vector, was used as a construct for producing transformed rice (Jeong et al., Plant Physiol 130: 1636-1644, 2002).
  • the vector contains a beta-glucuronidase (GUS) reporter gene adjacent to the right border and includes a tetramerized transcription enhancer derived from the CaMV 35S promoter adjacent the left border.
  • GUS beta-glucuronidase
  • Genomic DNA isolated from the transgenic rice plants was subjected to inverse PCR to confirm the insertion position of T-DNA in the pGA2715 vector. As a result, two transgenic plants with T-DNA inserted around the OsNAS3 gene were isolated.
  • the OsNAS3- D1 transgenic plant has inserted the T-DNA containing the 35S enhancer at the left border at about 1.5 kb downstream of the OsNAS3 gene, the 35S enhancer at about 1.9 kb downstream of the OsNAS3- D2 transgenic plant, The T-DNA contained in the border is inserted.
  • FIG. 7 shows insertion positions of T-DNA in OsNAS3- D1 and OsNAS3- D2.
  • OsNAS3- D1 and OsNAS3- D2 selected in Example 9 were determined by PCR. Genomic DNA was extracted from the leaves of the T2 generation of OsNAS3- D1 and OsNAS3- D2 and used as template DNA for PCR.
  • OsNAS3- D1 two gene-specific primers F2 (5'-TTTAGGGGAAATGGAGGTTACT-3 ', SEQ ID NO: 19) and R2 (5'-CAAGTTAGTCATGTAATTAGCCAC-3 ', SEQ ID NO: 21) was used.
  • two gene-specific primers F2 (SEQ ID NO: 19) and R3 (5'-GGCTTGCTCTTGTCATAGGC-3 ', SEQ ID NO: 22) and T-DNA specific primer RB (SEQ ID NO: 21) .
  • RNA was isolated from 10-day-old leaves of homozygous bodies of OsNAS3- D1 and OsNAS3- D2 and wild-type rice, i.e., Dongjin rice (WT), and each cDNA was prepared using reverse transcriptase Respectively.
  • Real-time RT-PCR was performed using primers of SEQ ID NOS: 17 and 18 with the prepared cDNA as a template, and the transcription amount of OsNAS3 gene was compared. The results are shown in FIG. In FIG. 11, the vertical axis represents the transfer amount relative to the rice actin 1 gene transfer amount.
  • OsNAS3 gene was increased about 60-fold in OsNAS3- D1 compared to wild-type (WT), and increased about 30-fold in OsNAS3- D2 compared with wild-type (WT).
  • the activation of the genes were measured OsNAS3 trace elements in order to examine the effects of the trace elements, accumulation in rice, wild-type (WT), the transgenic plant OsNAS3 -D1 and D2-OsNAS.
  • the mature seed and flag leaves of the wild-type and transgenic plants were used as samples, and the method for measuring trace elements was described in Kim et al., Physiol Plant 116: 368-372, 2002.
  • the samples were dried at 70 ° C for 2 days, the dried amount recorded, and the obtained samples were decomposed in 1 ml of 11N HNO 3 for 3 days in a 180 ° C oven.
  • the contents of iron, zinc, copper and manganese in the samples were measured by atomic absorption spectroscopy (AAS) (Solaar 989, Unicam Atomic Absorptation, Cambridge, UK). The results are shown in Table 11 below.
  • the amounts of copper and manganese did not show any significant change.
  • iron was 1.5 times higher than wild type (WT) and zinc was 1.4 times higher than that of wild type (WT).
  • Iron and zinc of OsNAS3-D2 increased 1.2 times as compared to wild type (WT).
  • WT wild type
  • the amount of iron and zinc increased significantly in the leaves of OsNAS3- D1 and OsNAS3- D2.
  • seeds increased 2.9 times in iron, 2.2 times in zinc, and 1.7 times in copper, compared with wild type (WT).
  • the iron increased 1.7 times, the zinc 1.5 times, and the copper 1.3 times, compared to the wild type.
  • Example 12 Analysis of seedling phenotype of transgenic plants under iron and zinc deficiency conditions
  • Wild type (WT) and OsNAS3- D1 were germinated in MS solid medium containing iron and zinc, MS solid medium without iron, MS solid medium containing no zinc, and seedling phenotype was observed for 8 days. The results are shown in Fig. In addition, the elongation and chlorophyll content of the phenotype were measured and are shown in Table 12 below. Chlorophyll was collected from leaves, weighed, and extracted with 80% acetone. After ice-making using liquid nitrogen, the crushed leaves and 80% acetone were mixed well (1 ml of 80% acetone added per 100 mg of leaf) and allowed to stand for 15 minutes on ice.
  • OsNAS3- D1 As shown in Fig. 12 and Table 13, the size of the plant was similar in the medium (MS) containing iron and zinc, and showed no difference in phenotype.
  • MS medium containing iron
  • OsNAS3- D1 was taller than wild type (WT) and chlorophyll increased by more than 50% as compared with wild type (WT) chlorosis) progressed less. Therefore, it can be seen that OsNAS3- D1 is more resistant to the growth conditions under which iron is less than wild type.
  • the growth rate of OsNAS3- D1 was faster than that of wild-type (WT), even in the zinc-free medium (Zn-). Therefore, it can be seen that OsNAS3- D1 grows better under the growth conditions in which zinc is deficient compared to the wild type (WT).
  • Example 13 Phenotypic analysis of transgenic plants under conditions of excessive heavy metals
  • Wild type (WT) and OsNAS3- D1 were germinated in the solid MS medium supplemented with excess zinc (5 mM), copper (0.3 mM) or nickel (0.5 mM) and grown for 10 days to observe the seedling phenotype.
  • the phenotype and the elongation of the plant are shown in Fig.
  • OsNAS3- D1 was taller than the wild-type and less bleached . These results indicate that OsNAS3- D1 is more resistant to toxicity by heavy metals than wild type (WT). Particularly, when grown in solid MS medium containing excessive zinc, the zinc concentration in the stem and root was measured in the same manner as in Example 11, and the results are shown in Table 14. [
  • OsNAS3- D1 showed a 2.3-fold higher zinc concentration in the stem than the wild type (WT).
  • Example 14 Phenotypic observation of transgenic plants under high pH conditions
  • the pH of the soil has a great effect on the solubility of the elements required for the plant. For example, if the pH is greater than 8, the iron is converted to Fe 2 O 3, which has a low solubility, and the plant is in a state where it can not be used or absorbed properly. As a result, iron shortage occurs.
  • Wild type (WT) and OsNAS3- D1 were germinated on MS medium (MS) adjusted to pH 8.5 and grown for 10 days.
  • the phenotype was also observed in the MS medium (Fe -) (pH 8.5) containing no iron by the same method.
  • the phenotype and the elongation of the plant are shown in Fig.
  • OsNAS3- D1 is elongated and more resistant to wild type (WT) in MS medium (MS / pH 8.5) adjusted to pH 8.5. These results were more evident in iron-free MS medium (Fe- / pH 8.5).
  • blood was collected and Hb and Hct were measured.
  • Hb and Hct were measured by feeding rice in the same manner and taking blood again after 2 weeks. The results are shown in Table 16.
  • Table 15 A group of rats fed an iron-rich diet A group of mice fed with iron-deficient feed Hb (g / L) 16.10 + - 0.25 12.50 + - 0.48 Hct (%) 54.00 0.73 42.6 ⁇ 1.62
  • the present inventors deposited rice seeds OsNAS3-D1 and OsNAS3-D2 with increased amounts of trace metals obtained in the above examples on July 14, 2008, at the Institute of Agricultural Biotechnology, respectively, under the seed deposit number KACC 98004P And KACC 98005P.
  • the present inventors have also found that the rice varieties OsNAS3-D1 , in which the amount of the trace metals obtained in the above-described examples have been increased, were deposited on Nov. 18, 2009 under the Budapest Treaty by Korea Deposit Insurance Corporation Institute of Bioscience and Biotechnology: KRIBB), and received seed accession number KCTC 11598BP.
  • Exemplary embodiments of the invention provide plants with increased content of trace elements.
  • the plant may be one in which the content of one or more metals selected from iron, zinc and copper is increased relative to the wild-type plant.
  • the plant may have increased iron and / or zinc relative to the wild-type plant.
  • the increased degree of metal content may be at least 10%, at least 20%, at least 30%, at least 50%, or at least 70%.
  • the plant may have an increased expression of OsNAS2 gene or OsNAS2 gene.
  • the OsNAS2 gene may be a gene encoding a polypeptide having an amino acid sequence of SEQ ID NO: 2 (GenBank permission number: AB023818).
  • the gene may have the nucleotide sequence of SEQ ID NO: 1.
  • the OsNAS2 gene includes any one encoding a polypeptide having OsNAS2 protein activity.
  • mutants of the protein having the OsNAS2 protein activity such as SEQ ID NO: 2 may be included, but the present invention is not limited to these examples.
  • the OsNAS3 gene may be a gene encoding a polypeptide having an amino acid sequence of SEQ ID NO: 11 (GenBank permission number: AB023819).
  • the gene may have the nucleotide sequence of SEQ ID NO: 10.
  • the OsNAS3 gene includes any one encoding a polypeptide having OsNAS3 protein activity.
  • mutants of the protein having the OsNAS3 protein activity such as the above-mentioned SEQ ID NO: 11, may be included, but the present invention is not limited to these examples.
  • the plant may be a monocot plant.
  • the plant may be a whole plant, a root, a leaf, a seed, and a cell isolated from the plant.
  • the plant also includes seeds produced from plants.
  • the expression of the OsNAS2 gene or the OsNAS3 gene may be increased by any method known in the art for increasing the expression of an endogenous gene present in a cell.
  • an insertion mutation method may be used in which an insertion element such as a transposable element (TE) or T-DNA is introduced into a genome of a plant.
  • the insertion mutation method has the advantage that the inserted element acts as a tag for gene identification.
  • a modified insertion mutation method can be used.
  • a modified insertion mutagenesis method is a gene trap system that includes fusion of the tagged gene with a reporter gene such as? -Glucuronidase (GUS) or green fluorescent protein (GFP) )to be.
  • GUS -Glucuronidase
  • GFP green fluorescent protein
  • the gene can be identified based on the expression pattern. Insertion of a promoter-free reporter disrupts normal gene function, and if the direction of the inserted reporter gene is correct, a reporter is expressed and reflects the expression of the inserted gene, so that a useful promoter can be isolated.
  • Another example of a modified insertion mutagenesis method is the activation tagging system. The system uses a T-DNA or a transposable element (TE) containing a multimeric CaMV 35S enhancer. Because the enhancer functions at a considerable distance from the coding region, regardless of orientation, it can induce transcriptional activation of the adjacent gene, resulting in dominant gain-of-function mutations.
  • TE transposable element
  • the plants can be obtained by selecting individuals with increased expression of the OsNAS2 gene among the mutants formed by the above methods (Jung et al., Plant Physiology 130: 1636-1644).
  • the CaMV 35S enhancer may, for example, be one having the nucleotide sequence of SEQ ID NO: 12.
  • the plant may be one in which an enhancer has been introduced to increase the expression of the OsNAS2 gene or the OsNAS3 gene, or an amplified copy number of the gene.
  • Examples of such enhancers may be the CaMV 35S enhancer or a linker thereof (e.g., 4 linkers), which may be a vector, such as pGA2715 (Jung et al.
  • the enhancer may be located at the right position and the OsNAS2 OsNAS3 gene or genes according to the characteristics of the chosen enhancer. For example, the 5 ', 3' or 5 'and 3' ends of the OsNAS2 gene or the OsNAS3 gene may be flanked or spaced apart.
  • the enhancer may be a CaMV 35S enhancer introduced downstream of the OsNAS2 gene, for example, within about 10 kb downstream of the stop codon of the gene, for example, about 2.06 kb .
  • the enhancer is a CaMV 35S enhancer and may be introduced upstream of the OsNAS2 gene, for example, within about 10 kb upstream of the start codon of the gene, for example, about 2.06 kb.
  • the enhancer is a CaMV 35S enhancer, which is introduced downstream of the OsNAS3 gene, for example, within 10 kb downstream from the stop codon of the gene, for example, 1.5 kb and / or 1.9 kb Lt; / RTI >
  • the enhancer is a CaMV 35S enhancer and may be introduced upstream of the OsNAS3 gene, for example, within 10 kb upstream from the start codon of the gene, for example, 1.5 kb and / or 1.9 kb .
  • the enhancer may be solely or plurally connected.
  • the enhancer may be one in which four copies of the CaMV 35S enhancer are continuously connected.
  • a method of introducing an exogenous nucleic acid construct, for example, an enhancer, into a plant is known.
  • the introduction of the structure can be introduced through Agrobacterium tumefaciens Ti plasmids, electroporation and bombardment.
  • the introduction of the foreign nucleic acid construct into the plant can be carried out by introducing it locally at a specific site, or randomly introducing it, and then selecting a plant having a specific trait.
  • An example of the plant may be rice deposited with the seed deposit number: KACC 98008P, the seed deposit number: KACC 98004P or KACC 98005P.
  • Another example of such a plant may be OsNAS2-D1 rice (Oryza sativa) deposited with the seed deposit number KCTC 11597BP or OsNAS3-D1 rice (Oryza sativa) deposited with the seed deposit number KCTC 11598BP.
  • the content of iron and zinc in the rice is higher than that of wild type rice.
  • the rice can be grown with tolerance under increased conditions of zinc, copper or nickel.
  • the heavy metal may be at least one selected from zinc, copper, and nickel.
  • the degree of resistance may be such that it can grow in zinc of 5 mM or more, copper of 0.3 mM or more, or nickel of 0.5 mM or more.
  • Another exemplary embodiment of the present invention is a method of growing a plant comprising the step of growing a plant according to the exemplary embodiment of the present invention described above under conditions in which one or more members selected from the group consisting of iron and zinc are deficient .
  • concentrations of iron and zinc may be, for example, cultured under MS medium not containing iron and zinc or similar conditions.
  • Another exemplary embodiment of the present invention provides a method of growing a plant comprising the step of growing the plant according to the exemplary embodiment of the present invention in the presence of an excessive amount of heavy metal.
  • the heavy metal may be at least 5 mM zinc, at least 0.3 mM copper, or at least 0.5 mM nickel.
  • Another exemplary embodiment of the present invention provides a functional food containing the plant or the product produced therefrom.
  • the functional food is one in which at least one selected from iron, zinc and copper is increased.
  • the functional food may be a seed of the plant, for example, a product containing or processed from rice.
  • Another exemplary embodiment of the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising the plant or the product produced therefrom.
  • the plant may be selected from the group consisting of roots, leaves, stems, seeds and combinations thereof.
  • the product may be obtained by processing a plant selected from the group consisting of roots, leaves, stems, seeds, and combinations thereof.
  • the plant may be obtained by subjecting the plant to physical or chemical treatment.
  • the product may be obtained by one or more processes selected from the group consisting of boiling, grinding, extracting, separating and purifying the plant, and combinations thereof.
  • the pharmaceutical composition may comprise a pharmaceutically acceptable diluent or carrier.
  • the carrier or diluent may be any carrier known in the art.
  • the carrier or diluent may be selected from the group consisting of conventional excipients, disintegrants, binders, lubricants, and the like.
  • conventional excipients such as tablets or hard capsules
  • microcrystalline cellulose, lactose, low-substituted hydroxy cellulose and the like can be used as excipients.
  • disintegrant starch glycolate, sodium starch glycolate, Hydrogen may be used.
  • binder polyvinylpyrrolidone, low-substituted hydroxypropylcellulose, hydroxypropylcellulose and the like can be used.
  • lubricant magnesium stearate, silicon dioxide, talc and the like can be selected and used.
  • composition may be formulated into parenteral formulations such as granules, powders, solutions, tablets, capsules, oral preparations such as dry syrups or injections, but the present invention is not limited to these formulations.
  • parenteral formulations such as granules, powders, solutions, tablets, capsules, oral preparations such as dry syrups or injections, but the present invention is not limited to these formulations.
  • the composition may be in the form of granules, tablets or capsules, or in the form of a liquid or injection.
  • the therapeutically effective amount of the plant or its product used in the composition can be determined by a person skilled in the art by determining the content of the trace element in the plant and the age, sex, severity and weight of the subject in need thereof .
  • the amount may be 100 g to 500 g, for example 100 g to 400 g, 100 g to 300 g, 200 g to 300 g, or 150 to 300 g per day.
  • composition may be administered orally or parenterally.
  • the composition can be administered orally, e.g., via a conventional meal.
  • the above administration can be administered once a day or divided into several times.
  • the composition may be for treating a disease caused by a deficiency of a substance selected from iron, zinc, copper, and combinations thereof.
  • the disease may be an iron deficiency symptom.
  • the iron deficiency symptoms may include, for example, anemia, fatigue, pallor, hair loss, irritability, weakness, pica, brittle or grooved nails, plummer-vinson syndrome, and impaired immune function.
  • the disease includes symptoms caused by zinc deficiency.
  • the disease may be hypozincia. Hypogonadism refers to a state in which zinc is not sufficient for metabolic demand. Zinc deficiency symptoms can be hair damage, skin lesions, diarrhea, wasting of body tissue.
  • Acrodermatitis enteropathica, anorexia, cognitive and motor function impairment, and dysmenorrhea may be a disease caused by copper deficiency. Copper deficiency can be a syndrome of anemia or pancytopenia, neurodegeneration, menkes disease, spasticity, ataxia, and neuropathy. have.
  • Another exemplary embodiment of the present invention provides a method of making a plant with increased trace element content.
  • One example of such a method comprises introducing a construct comprising a foreign enhancer into a plant to obtain a plant having increased expression of the OsNAS2 gene or the OsNAS3 gene.
  • Enhancer, plant, method of introducing the construct into the plant, and OsNAS2 gene or OsNAS3 gene are as described above.
  • Whether or not the expression of the OsNAS2 gene or the OsNAS3 gene is increased can be determined by a method known in the art. For example, by measuring the enzymatic activity directly, measuring the mRNA level of the OsNAS2 gene or the OsNAS3 gene by the nucleic acid amplification method, or measuring the amount of the expressed protein.
  • the nucleic acid amplification method includes PCR including RT-PCR and the like.
  • the method may further include determining whether expression of the OsNAS2 gene or the OsNAS3 gene is increased and whether at least one selected from iron, zinc, and copper is increased as compared to the wild type. Methods for measuring the content of iron and / or zinc are known.
  • the method comprises: introducing a Ti plasmid into which a 35S enhancer derived from a promoter of cauliflower mosaic virus is inserted; Selecting the plant inserted at one or more positions upstream and downstream of the gene encoding the OsNAS2 activity or the OsNAS3 activity by the 35S enhancer.
  • the Ti plasmid is a circular plasmid contained in Agrobacterium tumefaciens and is used to introduce genetic material into plants.
  • the introduction of the 35S enhancer into the Ti plasmid can be easily carried out by those skilled in the art using appropriate restriction enzymes and ligases.
  • the 35S enhancer may be located on the left and / or right border of the T-DNA of the Ti plasmid.
  • the 35S enhancer may be one in which one or more, for example, four are adjacent. For example, by the pGA2715 vector or the pGA2772 vector.
  • the introduction of the Ti plasmid into a plant can be achieved by introducing the Ti plasmid into Agrobacterium tumefaciens and infecting the plant with the Agrobacterium tumefaciens into which the Ti plasmid has been introduced.
  • the T-DNA region of the Ti plasmid is inserted into the chromosome of the plant.
  • the method comprises selecting a plant inserted at one or more positions upstream and downstream of the gene encoding the OsNAS2 activity or OsNAS3 activity.
  • OsNAS2 activity means a reaction catalytic activity of converting three molecules of S-adenosyl-L-methionine to 3S-methyl-5'-thioadenosine + niconianamine or vice versa.
  • the OsNAS2 activity may be due to a protein having the amino acid sequence of SEQ ID NO: 2.
  • the gene encoding the OsNAS2 activity may be a gene encoding a protein having the amino acid sequence of SEQ ID NO: 2, for example, having a nucleotide sequence of SEQ ID NO: 1.
  • the 35S enhancer is inserted at one or more positions upstream and downstream of the gene encoding OsNAS2 can be determined by sequencing or nucleic acid amplification.
  • the plant is preferably rice ( Oryza sativa ).
  • the 35S enhancer may be inserted at about 2.06 kb downstream of the nucleotide sequence of SEQ ID NO: 1 encoding OsNAS2 activity.
  • OsNAS3 activity refers to the activity of a reaction catalyst that converts three molecules of S-adenosyl-L-methionine to 3S-methyl-5'-thioadenosine + niconianamine or vice versa.
  • the OsNAS3 activity may be due to a protein having the amino acid sequence of SEQ ID NO: 11.
  • the gene coding for the OsNAS3 activity may be a gene encoding a protein having the amino acid sequence of SEQ ID NO: 11, for example, having a nucleotide sequence of SEQ ID NO: 10.
  • the 35S enhancer is inserted at one or more positions upstream and downstream of the gene encoding OsNAS3 can be determined by sequencing or nucleic acid amplification.
  • the plant is preferably rice ( Oryza sativa ).
  • the 35S enhancer may be inserted at about 1.5 kb or about 1.9 kb downstream of the nucleotide sequence of SEQ ID NO: 10 encoding the OsNAS3 activity.
  • FIG. 1 shows a form of a DNA structure into which T-DNA is inserted.
  • the boxed portion from ATG to TGA represents the exon of the OsNAS2 gene.
  • T-DNA can be inserted about 2.06 kb after the TGA termination codon of the OsNAS2 gene ( OsNAS2- D1 transgenic plant).
  • FIG. 6 shows a form of a DNA structure into which T-DNA is inserted.
  • the boxed portion from ATG to TGA represents the exon of the OsNAS3 gene.
  • T-DNA can be inserted about 1.5 kb after the TGA termination codon of the OsNAS3 gene ( OsNAS3- D1 transgenic plant).
  • T-DNA can be inserted about 1.9 kb after the TGA termination codon of the OsNAS3 gene ( OsNAS3- D2 transgenic plant).
  • Another exemplary embodiment of the present invention provides a method of growing a plant, comprising growing the plant as described above at high pH conditions.
  • the pH may be 8.5 to 14, for example 8.5 to 12.
  • the content of the trace element is higher than that of the wild type (WT), so that it can have high agricultural and nutritional benefits.
  • a plant having an increased trace element content can be effectively produced.
  • the method for growing a plant it is possible to grow the plant in a growth condition containing a heavy metal deficiency such as iron or zinc or a growth condition containing excessive amounts of heavy metals such as copper, zinc or nickel
  • a heavy metal deficiency such as iron or zinc
  • a growth condition containing excessive amounts of heavy metals such as copper, zinc or nickel
  • the plant can be grown.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Nutrition Science (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Immunology (AREA)
  • Dermatology (AREA)
  • Botany (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Reproductive Health (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Diabetes (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)

Abstract

본 발명은 벼의 OsNAS2 유전자 또는 OsNAS3 유전자의 활성화에 의해 미량 원소의 함량이 야생형에 비해 증가된 형질전환 식물체 및 상기 형질전환 식물체로부터 생성된 산물을 함유하는 기능성 식품에 관한 것이다.

Description

미량 원소 함량이 증가된 벼 품종 및 그의 용도
본 발명은 식물체의 OsNAS2 유전자 또는 OsNAS2 유전자의 활성화에 의해 미량 원소의 함량이 증가된 형질전환 식물체 및 상기 형질전환 식물체로부터 생성된 산물을 함유하는 기능성 식품에 관한 것이다.
철은 지구상에 존재하는 원소들 중에서 4번째로 많은 양을 차지하고 있으나, 식물에 의해 쉽게 이용되지 못한다. 왜냐하면, 토양에서 철은 대부분 옥시히드레이트 (oxyhydrate) 형태로 존재하고, 용해도도 매우 낮기 때문이다. 또한, 전 세계 토양의 약 30%는 염기성을 나타낸다. 이러한 성질을 갖는 토양에서 철은 용해도가 극히 낮은 Fe2O3 형태로 존재하여, 식물의 생장을 어렵게 만든다 (Mori, Curr Opin Plant Biol 2:250-253, 1999). 이렇게 철의 부족은 식물에 치명적인 영향을 미친다. 특히, 철의 부족은 엽록소의 합성과 엽록체의 발달에 영향을 미쳐 식물의 생산량을 감소시킨다.
철은 인간 건강에도 중요한 의미를 갖는다. 철은 세포 내 여러 가지 기능에 필요한 필수 불가결한 미량의 금속 원소 중의 하나이다. 세계 보건 기구 (WHO)에 따르면, 전 세계 인구의 30% 정도는 철 부족으로 인한 빈혈에 걸려 있고, 이들 대부분은 저개발 국가에 집중되어 있다. 아연의 부족은 식물의 성장, 스트레스에 대한 내성 및 엽록소 생성을 저해한다. 또한 아연은 사람의 면역 반응에 중요한 역할을 하여, 감염에 대한 저항성을 높여주고, 세포의 생장, 상처의 회복에 관여한다고 알려져 있다.
식물은 두 가지 방법으로 철 부족을 극복한다고 알려져 있다 (Marschner et al., J. Plant Nutr 9:3-7, 1986). 대부분의 식물은 Fe3+를 Fe2+로 환원시킨 후 흡수하는 반면, 벼나 보리와 같은 벼과 식물은 철이 부족할 때 파이토시데로포어 (phytosiderophore)라는 철 결합 물질을 토양에 분비하여 Fe3+를 결합시켜 용해도를 높혀, 철과 파이토시데로포어의 복합체 (complex)를 흡수한다.
벼는 인류에게 중요한 주식으로, 다량의 철을 함유하는 벼 품종의 개발은 인간의 건강 증진을 위해 중요한 의미를 갖는다. 따라서, 유전 공학에 의해 철이 많은 벼 품종을 육성하는 것은 전통적인 육종 방법의 한계를 극복하고 철 부족으로 인한 인류의 건강 문제를 해결하기 위한 대안으로 제시되고 있다 (Qu et al., Planta 222:225-233, 2005).
이러한 노력의 일환으로, 식물에 원래 존재하는 철 저장 단백질인 페리틴 (ferritin)의 양을 증가시켜 철 함량을 높이는 방법이 제시되었다 (Theil et al., Annu Rev Biochem 56:289-315, 1997). 이 방법은 콩의 페리틴 유전자를 배유 특이적 발현 (endosperm-specific expression)을 보이는 벼의 글루텔린 (glutelin) 프로모터를 이용하여 형질전환시킨 것으로, 생성된 벼 종자는 대조군에 비하여 철 함량이 3배 증가하였다 (Goto et al., Nat Biotech 17:282-286, 1999). 또한, 강남콩 (Phaseolus vulgaris)의 페리틴 유전자를 벼 종자에서 과발현시킨 결과, 철 함량이 2배 증가하였다 (Lucca et al., Theor Appl Genet 102:392-397, 2001).
대한민국 등록특허 제10-471679호에 따르면, 콩과 벼로부터 페리틴을 발현하는 유전자를 분리한 다음, 벼와 옥수수의 종자 저장 단백질인 글로불린, 글루텔린 및 제인으로부터 분리된 배유 특이 프로모터와 결합하여 배유에서만 특이적으로 발현하는 발현 벡터를 제조하고, 이 발현 벡터로 형질전환시켜 고농도로 철 생산 능력을 가진 벼에 대해 기술하고 있다. 그러나, 이 방법은 벼 이외의 작물인 콩, 옥수수 등으로부터 유래된 유전자를 이용하는 것이다.
대한민국 등록특허 제10-454083호에 따르면, 뮤지네이산류 생합성 경로 중의 효소인 니코티아나민 아미노그룹 전이효소 (nicotianamine aminotransferse: NAAT)를 코딩하는 유전자를 벼과 식물에 도입하여, 철 흡수성이 개선된 벼과 식물을 기술하고 있다. 그러나, 이 방법은 니코티아나민 아미노그룹 전이효소를 코딩하는 유전자를 이용하는 것이다.
대한민국 공개특허 제10-2003-84892에 따르면, 니코티아나민의 케토체를 2'-데옥시뮤지네이산으로 환원하는 환원효소를 코딩하는 유전자를 도입하여 철 결핍 내성이 강화된 식물을 제조하는 것을 기술하고 있다. 그러나, 이 방법은 니코티아나민의 케토체를 2'-데옥시뮤지네이산으로 환원하는 환원효소를 코딩하는 유전자를 이용한 것이다.
한편, 니코티아나민 (nicotianamine, NA)은 식물체 내에 존재하는 금속 원소들과 결합하는 킬레이터 (chelator)로서, 금속 원소들의 흡수와 항상성 유지에 중요한 역할을 한다 (Douchkov et al., Plant Cell Environ 28:365-374, 2005). NA는 식물에 존재하는 니코티아나민 합성효소 (Nicotianamine synthase, NAS) 유전자에 의해 3 개의 S-아데노실-L-메티오닌 분자로부터 만들어진다.
고혈압은 만성 순환기계 질환 중 발생빈도가 가장 높은 질환으로, 혈압 상승의 중요한 기전인, 레닌-안지오텐신 시스템 (Renin-Angiotensin System: RAS)에서 중요한 효소인 안지오텐신 전환 효소 (angiotensin converting enzyme: ACE)는 안지오텐신 I (angiotensin Ⅰ: AngI)을 안지오텐신 II (angiotension Ⅱ: Ang II)로 전환하는 효소로서, 전환된 Ang II가 혈관을 수축시키고 혈압을 상승시킨다고 알려져 있다. 따라서, 고혈압을 개선 할 목적으로, ACE 저해제가 개발되어 상용되고 있는데, 니코티아나민이 ACE 저해제로 작용함을 보여주는 여러 보고가 있었다 (Usuda et al., Plant Biotech J 7:87-95, 2009).
본 발명자는 벼에 원래 존재하는 OsNAS2 유전자 또는 OsNAS2 유전자를 활성화시켰을 때 미량 원소의 함량이 증가되는 것을 밝혀 본 발명을 완성하였다.
본 발명은 식물체 자체에 존재하는 유전자의 활성화에 의해 미량 원소의 함량이 야생형에 비하여 증가된 형질전환 식물체 및 상기 형질전환 식물체로부터 생성된 산물을 함유하는 기능성 식품을 제공하기 위한 것이다.
본 발명의 예시적 구체예는 미량 원소의 함량이 증가된 식물체를 제공한다.
본 발명의 다른 예시적 구체예는, 상기한 본 발명의 예시적 구체예에 따른 식물체를 철 및 아연으로 구성되는 군으로부터 선택된 하나 이상이 부족한 조건에 생육시키는 단계를 포함하는, 식물체를 생육시키는 방법을 제공한다.
본 발명의 다른 예시적 구체예는, 상기한 본 발명의 예시적 구체예에 따른 식물체를 과량의 중금속이 존재하는 조건에 생육시키는 단계를 포함하는, 식물체를 생육시키는 방법을 제공한다.
본 발명의 다른 예시적 구체예는, 상기 식물체를 포함하거나 그로부터 생성된 산물을 함유하는 기능성 식품을 제공한다.
본 발명의 다른 예시적 구체예는, 상기 식물체를 포함하거나 그로부터 생성된 산물을 함유하는 약학적 조성물을 제공한다.
본 발명의 다른 예시적 구체예는, 미량 원소 함량이 증가된 식물체를 제조하는 방법을 제공한다.
본 발명의 다른 예시적 구체예는, 상기한 바와 같은 식물체를 높은 pH 조건에서 생육시키는 단계를 포함하는, 식물체를 생육시키는 방법을 제공한다.
도 1은 T-DNA가 삽입된 DNA 구조체의 일 형태를 나타낸 것이다.
도 2a는 MS 배지에 각각 0, 1, 10, 500 μM Fe(III)-EDTA를 첨가한 배지에서 7 일간 자란 벼의 잎 또는 뿌리에서 OsNAS2 유전자의 발현 양상을 정량적 실시간 RT-PCR을 이용하여 분석한 것이다. 도 2b는 벼 종자를 100 μM Fe(III)-EDTA을 첨가 하지 않은 MS 배지서 7일간 키운 후, 100 μM Fe(III)-EDTA를 첨가한 배지로 옮겨 생육시킨 후 일정한 시간에 벼 잎과 뿌리로부터 추출한 RNA로부터, OsNAS2의 발현을 측정한 결과이다.
도 3은 OsNAS2-D1과 그의 야생형(WT)에 대하여, OsNAS2의 발현량을 비교한 것이다.
도 4는 철과 아연을 모두 포함하는 MS 고체 배지(MS), 철을 함유하지 않는 MS 고체 배지(Fe-), 아연을 함유하지 않는 MS 고체 배지(Zn-)에서 기른 야생형 (WT)과 OsNAS2-D1의 표현형이다.
도 5는 pH 8.5로 맞춘 MS 배지 (MS/pH 8.5), pH 8.5로 철을 함유하지 않은 MS 배지 (Fe-/pH 8.5)에서 생육시킨 야생형 (WT)과 OsNAS2-D1의 표현형과 신장을 나타낸 도면이다.
도 6은 과량의 아연(5 mM), 구리(0.3 mM) 또는 니켈(0.5 mM)이 첨가된 각각의 고체 MS 배지에서 기른 야생형(WT)과 OsNAS2-D1의 표현형이다.
도 7은 T-DNA가 삽입된 DNA 구조체의 일 형태를 나타낸 것이다.
도 8, 9 및 10은 MS 배지 및 MS 배지에서 Fe, Zn, Cu 또는 Mn을 포함하지 않는 배지에서 자란 벼의 잎 또는 뿌리에서 OsNAS1, OsNAS2 또는 OsNAS3 유전자의 발현 양상을 정량적 실시간 RT-PCR을 이용하여 분석한 것이다.
도 11은 OsNAS3-D1과 그의 야생형(WT), OsNAS3-D2와 그의 야생형(WT)에서 OsNAS3의 발현량을 비교한 것이다.
도 12는 철과 아연을 모두 함유하는 MS 고체 배지(MS), 철을 함유하지 않는 MS 고체 배지(Fe-), 아연을 함유하지 않는 MS 고체 배지(Zn)에서 기른 야생형(WT)과 OsNAS3-D1의 표현형 및 백화 현상을 알아보기 위한 잎을 나타낸 것이다.
도 13은 과량의 아연(5 mM), 구리(0.3 mM) 또는 니켈(0.5 mM)이 첨가된 각각의 고체 MS 배지에서 기른 야생형(WT)과 OsNAS3-D1의 표현형과 신장을 나타낸 것이다.
도 14은 pH 8.5로 맞춘 MS 배지(MS/pH 8.5), pH 8.5로 철을 함유하지 않는 MS 배지(Fe-/pH 8.5)에서 기른 야생형(WT)과 OsNAS3-D1의 표현형과 신장을 나타낸 것이다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 그러나, 본 발명이 하기 실시예에 의해 제한되는 것은 아니다.
실시예1: OsNAS2 유전자의 발현이 활성화된 형질전환 식물체의 분리
(1) 벼에 존재하는 니코티아나민 합성효소2 ( OsNAS2 ) 유전자의 발현 분석
벼에는 3개의 니코니아나민 신타제 (Nicotianamine synthase) (OsNAS1, OsNAS2, OsNAS3)가 존재하고, 효소로서의 활성이 있음이 보고되었다 (Inoue et al., Plant J 36:366-381, 2003). 외부에서 공급한 철의 농도에 따른 OsNAS2 유전자의 발현 정도를 알아보았다. 벼의 종자를, MS 배지 (0.1μM CuSO4, 100μM Fe(III)-EDTA, 30μM ZnSO4, 10μM MnSO4를 포함함)와 각각 0μM, 1μM, 10μM 및 500μM Fe(III)-EDTA가 첨가된 MS 배지에서 벼 종자를 발아시키고, 7일 동안 생육시켰다. 또한, 벼 종자를 100μM Fe(III)-EDTA를 첨가하지 않은 MS 배지에서 7일 동안 생육시킨 후, 100μM Fe(III)-EDTA를 첨가한 MS 배지에 옮겨 심고 생육시켜 OsNAS2가 발현 변화를 확인하였다.
벼의 뿌리와 잎으로부터 RNA를 준비하였고, 그 발현 정도를 정량적 실시간 RT-PCR로 분석하였다. PCR 조건은, 95℃에서 1 분을 유지한 후, 94℃에서 15초, 56℃에서 10초 및 72℃에서 10초를 45회 반복하였다. 사용한 프라이머는 다음과 같다. 발현 대조군으로서, 벼 액틴 1 유전자를 증폭하였다.
프라이머 서열
OsNAS2-정방향 프라이머: 5'- CGTCTGAgtgcgtgcatagta -3'(서열번호 3)
OsNAS2-역방향 프라이머: 5'- GAAGCACAAACACAAACCGATA -3'(서열번호 4)
OsAct1-정방향 프라이머: 5'-TGGAAGCTGCGGGTATCCAT-3' (서열번호 5)
OsAct1-역방향 프라이머:5'-TACTCAGCCTTGGCAATCCACA-3'(서열번호 6)
그 결과를 도 2에 나타내었다. 도 2에서, 세로축은 벼 액틴 1 유전자의 발현 양을 기준으로 발현 정도를 나타낸다.
도 2a에 나타낸 바와 같이, OsNAS2 유전자는 벼가 철을 포함하지 않는 배지에서 자라는 경우, 잎에서는 강하게 유도되었으나, 1μM 이상의 Fe(III)-EDTA를 포함하는 배지에서는 별현되지 않았다. 뿌리에서는 철을 포함하지 않은 배지에서 자란 경우가 발현이 가장 높았으며, 철의 농도가 증가할수록 발현은 감소하였다. 도 2b는 100μM의 Fe(III)-EDTA를 배지에 공급하고 경과한 시간에 따른 OsNAS2의 발현을 나타낸 것이다. 도 2에서 사용되는 벼는 동진 벼이다.
(2) OsNAS2 유전자의 발현이 활성화된 형질전환 식물체의 제조와 분리
형질전환 벼를 제조하기 위한 구조체로서 T-DNA 벡터인 pGA2715 벡터를 이용하였다 (Jeong et al., Plant Physiol 130:1636-1644,2002). 상기 벡터는 우측 경계에 인접하여 β-글루쿠로니다제 (GUS) 리포터 유전자를 포함하고 있고, 좌측 경계에 인접하여 CaMV 35S 프로모터 유래 테트라머화된 전사 인핸서를 포함한다. 상기 pGA2715 벡터를 Agrobacterium에 형질 전환시키고, 형질 전환된 Agrobacterium을 이용하여 야생형인 동진 벼에 형질전환하여, pGA2715가 형질 도입된 벼 식물체 집단을 제조하였다 (Lee et al, J Plant Biol 42:310-316, 1999; Jeong et al., Plant Physiol 130:1636-1644, 2002; Jeong et al., Plant Journal 45:123-132, 2006).
형질도입된 벼 식물체로부터 분리된 게놈 DNA에 대하여 역전-PCR (inverse PCR)을 통하여 pGA2715 벡터 중의 T-DNA가 삽입된 위치를 확인하였다. 그 결과 T-DNA가 OsNAS2 유전자의 주변에 삽입된 한 개의 형질전환 식물체 (OsNAS2-D1)를 분리하였다.
OsNAS2-D1 형질전환 식물체는 OsNAS2 유전자의 하류 약 2.06 kb에 35S 인핸서를 좌측 경계 부위에 포함하는 T-DNA가 삽입되어 있다. 도 1은 OsNAS2-D1에서 T-DNA의 삽입 위치를 나타낸 것이다.
실시예 2: 형질전환 식물체에서 OsNAS2 의 발현 증가
상기 실시예1에서 선별된 OsNAS2-D1의 유전형을 PCR을 통해 결정하였다. OsNAS2-D1의 T2 세대 개체들의 잎에서 게놈 DNA를 추출하였고 이를 PCR의 주형 DNA로 사용하였다. OsNAS2-D1에 대해서는, 2개의 유전자-특이적 프라이머 F (5'- ACCTTACTCCCCCGAACTAA -3': 서열번호 7)와 R (5'- CAAGGAGCTGTCCGTCTAAC -3': 서열번호 8 및 T-DNA 특이적 프라이머 RB (5'-CAAGTTAGTCATGTAATTAGCCAC-3': 서열번호 9)를 사용하였다. 발현량을 알아보기 위하여, OsNAS2-D1의 동형접합체 및 각각의 야생형 벼, 즉 동진 벼(WT)의, 100μM Fe(III)-EDTA를 첨가하거나 첨가 하지 않은 배지에서 7일간 자란 유묘 (seedling)의 잎과 뿌리, 지엽 (flag leaves), 10 cm 크기의 꽃 (flower), 및 미성숙 종자 (immature seeds)로부터 RNA를 분리하고, 역전사 효소를 이용하여 각각의 cDNA를 제조하였다. 제조한 cDNA를 주형으로 하고 서열번호 1과 2의 프라이머를 이용하여 실시간 RT-PCR을 수행하여, OsNAS2 유전자 전사량을 비교하였으며, 그 결과를 도 3에 나타내었다. 도 3에서 세로축은 벼 액틴 1 유전자 전사량에 대한 상대적인 전사량을 나타낸 것이다.
도 3에서와 같이, OsNAS2 유전자의 발현은 OsNAS2-D1에서는 야생형 (WT)에 비해 실험한 모든 조건에서 증가하였다.
실시예 3: 형질전환 식물체의 종자에서 니코니아나민 양의 증가
OsNAS2 유전자의 발현의 증가가, 작용 효소의 산물인 니코티아나민 (nicotianamine) 양의 증가에 대한 영향을 알아보기 위해 종자에서 니코티아나민 양을 측정 하였다. 종자를 Muilti-Beads Shocker (Yasui kikai, Osaka Japan)를 이용하여 잘게 부순 후, 20 mg의 가루를 400 ㎕의 80% 에탄올을 이용하여 15분간 3회에 걸쳐 니코티아나민을 추출하였다. 추출된 니코티아나민을 LC-ESI-TOF-MS를 이용하여 정량적 분석을 하였다. 그 결과를 하기 표 1에 나타내었다.
표 1
유전형 니코티아나민 (mg/g)
WT 5.59±3.06
OsNAS2-D1 110.45±11.33
표 1에 나타낸 바와 같이, OsNAS2-D1 종자의 니코티아나민 양은 야생형에 비해 약 19.8배 증가하였다.
실시예 4: 형질전환 식물체에서 미량 원소 함량의 측정
OsNAS2 유전자의 활성화가 벼의 미량 원소 축적에 미치는 영향을 알아보기 위하여, 야생형 (WT), 형질전환 식물체인 OsNAS2-D1에서 미량 원소를 측정하였다. 야생형과 형질전환 식물체의 성숙한 종자 및 지엽 (flag leaves)을 시료로 사용하였고, 미량 원소 측정 방법은 Lee et al., Plant Physiol 150:786-800, 2009에 기재된 방법을 참고하였다. 시료를 70℃에서 2일 동안 건조시키고, 건조량을 기록하고, 얻은 시료를 11N HNO3 1 ml에서 3일 동안 180℃ 오븐에서 분해시켰다. 희석한 다음, 원자 흡수 분광분석법 (atomic absorption spectroscopy: AAS) (SpectrAA-800, Varian, Palo Alto, CA, USA)에 의해 시료 내 미량 원소 철과 아연의 함량을 측정하였다. 표 2는 형질전환 식물체 중의 미량 원소 함량을 나타낸다.
표 2
조직 유전형 Fe (㎍/g-DW) Zn (㎍/g-DW) Cu (㎍/g-DW)
성숙종자 WT 8.56±0.22 19.61±1.85 2.54±0.33
OsNAS2-D1 25.54±0.65 53.46±4.42 3.12±0.23
지엽 WT 103.86±10.67 24.07±1.53 3.69±0.12
OsNAS2-D1 148.23±13.56 34.19±4.63 5.49±1.09
표 2에 나타낸 바와 같이, 성숙한 종자에서 OsNAS2-D1은 야생형에 비해, 철은 3.0배, 아연은 2.7배, 구리는 1.2 배 증가하였다. 지엽에서는 OsNAS2-D1이 야생혀과 비교 시, 철과 아연은 1.4배, 구리는 1.5 배 증가하였다.
실시예 5: 철과 아연이 부족한 조건에서 형질전환 식물체의 유묘 표현형 분석
철과 아연이 부족한 조건에서 OsNAS2 유전자의 활성화가 미치는 영향을 알아보았다. 철과 아연을 모두 함유하는 MS 고체 배지, 철을 함유하지 않는 MS 고체 배지 (Fe-), 아연을 함유하지 않는 MS 고체 배지(Zn-)에서 야생형(WT)과 OsNAS2-D1을 발아시키고 8일 동안 생육시켜 유묘 표현형을 관찰하였다. 그 결과를 표 3에 나타내었다. 또한, 표현형의 신장과 엽록소의 함량을 측정하여 표 3에 나타내었다. 엽록소의 측정은 잎을 채취하여, 무게를 측정하고, 80% 아세톤을 이용하여 추출하였다. 액체 질소를 이용하여 얼린 후, 잘게 부순 잎과 80% 아세톤을 잘 섞어 (잎 100mg당 1ml 80% 아세톤 첨가), 얼음에 15분 방치 후, 15,000g로 원심 분리하여, 상등액을 분주하여, 666nm및 646nm에서 흡광도를 측정한 후 Arnon, Plant Physiol 24:1-15, 1949에 기재된 방법으로 엽록소a와 염록소b를 포함하는 염록소의 양을 측정하였다.
표 3
배지 유전형 표현형 신장(cm) 엽록소의 함량(㎍/ml-추출액)
MS WT 16.6±0.9 138.87±12.33
OsNAS2-D1 16.1±1.3 145.22±10.55
Fe- WT 14.1±1.4 67.33±7.98
OsNAS2-D1 17.1±1.2 101.43±10.22
Zn- WT 17.6±0.9 120.33±13.77
OsNAS2-D1 19.1±0.6 125.43±10.66
도 4 및 표3에 나타낸 바와 같이, 철과 아연을 모두 함유하는 배지(MS) 조건에서는 상기한 바와 같이, 표현형의 차이를 보이지 않았다. 그러나, 철을 함유하지 않은 배지 (Fe-) 조건에서는 OsNAS2-D1은 야생형(WT)에 비하여 키도 크고, 엽록소도 야생형 (WT)에 비하여 50% 이상 증가하여 철 부족의 대표적 증상인 백화 현상 (chlorosis)도 덜 진행되었다. 따라서, OsNAS2-D1은 야생형에 비하여 철이 부족한 생육 조건에서 더 잘 견디는 것을 알 수 있다. 아연을 함유하지 않는 배지 조건(Zn-)에서도 OsNAS2-D1은 야생형(WT)에 비하여 생장 속도가 빨랐다. 따라서, OsNAS2-D1은 야생형(WT)에 비하여 아연이 부족한 생육 조건에서도 더 잘 자라는 것을 알 수 있다.
상기 실험 결과를 검증하기 위하여, 각각의 조건에서 유묘 시기의 야생형(WT)과 OsNAS2-D1의 줄기와 뿌리를 채취하고 철과 아연의 농도를 상기 실시예 4과 동일한 방법으로 측정하였다. 그 결과를 표 4에 나타내었다.
표 4
배지 조직 유전형 Fe (㎍/g-DW) Cu (㎍/g-DW)
MS 줄기 WT 215.36±27.96 61.87±11.45
OsNAS2-D1 349.79±34.86 113.14±10.98
뿌리 WT 344.34±46.36 103.83±13.98
OsNAS2-D1 499.22±27.36 143.64±14.46
Fe- 줄기 WT 91.62±9.86 97.51±8.31
OsNAS2-D1 154.15±28.42 150.27±7.63
뿌리 WT 94.81±15.06 112.39±29.30
OsNAS2-D1 173.33±24.88 193.86±13.95
Zn- 줄기 WT 240.14±24.24 30.41±6.87
OsNAS2-D1 413.88±41.38 52.14±12.06
뿌리 WT 385.88±42.16 22.60±2.93
OsNAS2-D1 561.06±39.30 38.06±4.69
도 3에 나타낸 바와 같이, 철과 아연을 모두 함유하는 배지(MS) 조건에서는 상기에서 살핀 바와 같이 표현형의 차이는 없었다. 그러나, 표 4에 나타낸 바와 같이, OsNAS2-D1은 야생형(WT)에 비하여 철의 농도가 줄기와 뿌리에서 각각 1.6배, 1.4배 증가하였고, 아연의 농도는 줄기와 뿌리에서 각각 1.8배, 1.4배 증가하였다. 또한, 철을 함유하지 않는 배지 조건에서는 OsNAS2-D1은 야생형(WT)에 비하여 철의 농도가 줄기와 뿌리에서 각각 1.9배, 1.8배 증가하였으며, 아연의 농도는 줄기와 뿌리에서 1.7배, 1.5 배 증가하였다. 또한, 아연을 함유하지 않는 배지 조건에서도 OsNAS2-D1은 야생형(WT)에 비하여 아연의 농도가 줄기와 뿌리에서 모두 1.7배 증가였으며, 철의 농도는 줄기와 뿌리에서 각각 1.5배, 1.7배 증가하였다. 따라서, OsNAS2-D1은 철 또는 아연이 부족한 생육 조건에서 더 잘 견디는 것을 알 수 있다.
실시예 6: pH가 높은 조건에서 형질전환 식물체의 표현형 관찰
토양의 pH는 식물에 필요한 원소의 용해도에 많은 영향을 미친다. 예를 들면, pH가 8.0이상이면, 철은 용해도가 낮은 Fe2O3 형태로 변화되어, 식물이 제대로 이용 및 흡수할 수 없는 상태가 된다. 그 결과 철 부족 현상을 일으키게 된다.
pH. 8.5로 맞춘 MS 배지 (MS/pH 8.5)에서 야생형 (WT)과 OsNAS2-D1을 발아시키고 10일 동안 생육시키고 표현형을 관찰하였다. 또한, 철을 함유하지 않은 MS 배지 (Fe-/pH 8.5)에서도 동일한 방법을 실시하여 표현형을 관찰하였다. 표현형과 식물체의 신장을 도 5에 나타내었다. 도 5에 나타낸 바와 같이, pH 8.5로 맞춘 MS 배지(MS/pH 8.5)에서 OsNAS2-D1이 야생형 (WT)에 비하여 신장도 크고 더 잘 견디는 것을 알 수 있다. 이러한 결과는 철을 함유하지 않은 MS 배지 (Fe-/pH 8.5)에서 더 분명하게 나타났다.
실시예 7: 과량의 중금속이 함유된 조건에서 형질전환 식물체의 표현형 분석
OsNAS2 활성화가 과량의 중금속 처리시 발생되는 독성에 어떤 영향을 주는지 알아보았다. 과량의 아연 (5 mM), 구리 (0.3 mM) 또는 니켈 (0.5 mM)이 각각 첨가된 고체 MS 배지에서 야생형(WT)과 OsNAS2-D1을 발아시키고 10일 동안 길러 유묘 표현형을 관찰하였다. 표현형과 식물체의 신장 및 중금속의 농도를 도 6 및 표 5에 나타내었다.
도 6 및 표 5에 나타낸 바와 같이, OsNAS2-D1은 야생형에 비하여 키도 크고, 백화 현상이 덜 진행되었다. 이러한 결과는 OsNAS2-D1이 야생형(WT)에 비하여 과량의 중금속에 의한 독성에 대한 내성이 향상되었음을 나타낸다.
표 5
배지 유전형 표현형 신장(cm)
Zn 5.0mM WT 11.4±1.1
OsNAS2-D1 14.0±0.8
Cu 0.3mM WT 9.4±1.1
OsNAS2-D1 12.4±1.4
Ni 0.5mM WT 14.6±1.0
OsNAS2-D1 18.6±1.2
특히, 과량의 아연, 구리 및 니켈을 함유하는 고체 MS 배지에서 길렀을 때, 줄기와 뿌리의 아연, 구리 및 니켈 농도를 상기 실시예 4와 동일한 방법으로 측정하였고, 그 결과를 표 6에 나타내었다.
표 6
조직 유전형 Zn (㎍/g-DW) Cu (㎍/g-DW) Ni (㎍/g-DW)
줄기 WT 2.106±0.335 27.295±4.890 0.449±0.072
OsNAS2-D1 2.876±0.199 37.912±5.436 0.621±0.093
뿌리 WT 9.758±0.683 375.833±31.188 3.925±0.917
OsNAS2-D1 14.273±1.895 461.196±26.030 5.509±0.738
표 6에 나타낸 바와 같이, OsNAS2-D1은 야생형(WT)에 비교하여 줄기와 뿌리에서 아연은 1.4배, 1.5배, 니켈은 1.4배, 구리는 각각 1.4배, 1.2배 증가하였다.
실시예 7: 철의 생물학적 이용도 (bioavailability) 조사
OsNAS2-D1의 종자의 철 증가가, 종자 섭취 시 흡수되어 이용되는 철의 생물학적 이용도의 증가 여부를 알기 위해 마우스 식이 분석 (mouse feeding assay)을 수행 하였다.
생후 3주된 암컷 Balb/c 마우스에, 철이 충분한 사료 (AIN-93G Purified Diet-45 mgFe/kg 사료, Control Diet(CD))와 철이 부족한 사료 (modified AIN-93G diet containing iron 3 mg/kg 사료, Iron-depleted Diet (ID))를 공급하였다. 2주 후, 이 두 그룹의 쥐들로부터 혈액을 채취하였다. 이것은 빈혈을 유발함과 동시에, 빈혈의 정도를 알아보기 위하여 혈액의 헤모글로빈 (Hb)과 헤마토크릿 (Hct)을 측정하기 위함이다. 측정 결과 철이 부족한 사료를 먹인 쥐들의 헤모글로빈 (Hb)과 헤마토크릿 (Hct) 수치가, 철이 충분한 사료를 먹인 쥐들에 비해서 각각 75 및 65%로 감소하였다 (표 7). 이것은 철이 부족한 사료를 먹였을 때 빈혈이 유발됨을 알 수 있었다. 이 후, 철분이 부족한 사료를 먹인 쥐들을 두 그룹으로 나누어서, 제 1그룹(야생형, WT, n=10)은 야생형(WT) 종자로부터 나온 쌀을 먹였고, 제 2그룹 (OsNAS2-D1, n=9)은 OsNAS2-D1의 종자로부터 나온 쌀을 먹였다. 그리고, 처음부터 정상 사료를 먹인 쥐 그룹을 대조군 (control 그룹, CD)으로 측정하였다. 쌀을 먹인지 1주, 2주, 4주 경과 후 혈액을 채취하여 Hb와 Hct를 측정하였다. 그 결과를 표 8에 나타내었다. 표 8에서와 같이, 야생형(WT) 또는 OsNAS2-D1의 종자로부터 나온 쌀을 먹이기 전까지 마우스의 Hb와 Hct는 유의성 있는 차이를 보이지 않았다. 1주 경과 후 두 그룹의 Hb와 Hct를 측정 한 결과, 제2 그룹은 제1 그룹에 비해 Hb와 Hct의 약간의 증가를 보여주었다. 다시 1주 경과 후 Hb와 Hct를 측정 한 결과, 이 경우 제2 그룹은 제1 그룹에 비해 Hb와 Hct의 현저한 증가를 보여, 정상 사료를 먹인 그룹과 비슷한 수치를 보였으며, 다시 2주 경과후의 제2 그룹의 Hb와 Hct는 제1 그룹에 비해 현저히 높았으며, 철이 충분한 사료를 먹인 그룹과 비슷하였다.
표 7
철분이 충분한 사료를 먹인 쥐 그룹 철분이 부족한 사료를 먹인 쥐 그룹
Hb(g/L) 16.10±0.37 10.50±1.50
Hct(%) 49.60±1.79 37.00±4.80
표 8
그룹 측정 시기1
0주 1주 2주 4주
Hb(g/L) CD 16.10±0.37 17.00±1.20 17.80±0.42 16.00±0.40
WT 9.90±0.35 10.83±0.57 11.00±0.52 12.80±0.57
OsNAS2-D1 11.00±0.82 12.08±1.25 16.10±0.57 15.30±0.17
Hct(%) CD 49.60±1.79 51.40±1.81 54.40±0.90 52.00±1.43
WT 34.80±1.20 41.10±3.14 40.80±1.37 46.70±1.55
OsNAS2-D1 37.10±2.15 47.35±2.27 52.30±0.54 51.40±0.92
1: 태어난 지 3주된, 마우스에 2주간 정상 사료와 철분이 부족한 사료를 먹인 후, 두 그룹으로 나누어, 철이 부족한 사료를 대신하여, WT 또는 OsNAS2-D1 종자로 바꿔 먹이기 시작할 때부터 경과한 시간.
실시예 8: 아연의 생물학적 이용도 (bioavailability) 조사
OsNAS2-D1의 종자의 아연 증가가, 종자 섭취 시 흡수되어 이용되는 아연의 생물학적 이용도의 증가 여부를 알기 위해 마우스 식이 분석 (mouse feeding assay)을 수행하였다.
몸무게가 약 13g 정도인 마우스에, 아연이 충분한 사료 (30 mg Zn/kg 사료, Control Diet(CD))와 아연이 부족한 사료 (modified AIN-93G diet containing iron 3 mg/kg 사료, Iron-depleted Diet (ZD))를 공급하였다. 2주 후, 이 두 그룹의 쥐들로부터 혈액을 채취하여. 아연의 함량을 측정하였다. 측정 결과 아연이 부족한 사료를 먹인 쥐들의 혈액 내 아연 수치가, 아연이 충분한 사료를 먹인 쥐들에 비해 66% 로 감소하였다 (표 9).
표 9
아연이 충분한 사료를 먹인 쥐 그룹 아연이 부족한 사료를 먹인 쥐 그룹
Zn(㎍/ml) 2.017±0.260 1.341±0.187
그 후, 아연이 부족한 사료를 먹인 쥐들을 세 그룹으로 나누어서, 제 1그룹은 아연이 충분한 정상 사료 (Zn-/CD, n=10)를 먹였으며, 제 2그룹은 야생형(WT) 종자로부터 나온 쌀을 먹였고 (Zn-/WT, n=10)은, 제 3그룹은 OsNAS2-D1의 종자로부터 나온 쌀을 먹였다 (Zn-/OsNAS2-D1). 대조군으로 처음부터 정상 사료를 먹인 쥐 그룹의 아연 수치를 측정하였다. 정상 사료와 쌀을 먹인지 2일, 6일, 10일, 15일, 20일 그리고 30일에 혈액을 채취하여 아연의 수치의 회복 정도를 측정하였다. 그 결과를 표 10에 나타내었다. 표 10에서와 같이, 정상 사료나 쌀을 먹인지 2일 후부터 아연의 수치가 증가함을 알 수 있었다. 하지만, 그 회복 되는 속도를 보면, OsNAS2-D1 종자를 먹인 그룹은 10일만에 정상 사료를 먹인 그룹과 아연 수치가 비슷하였으나, 야생형 종자를 먹인 그룹은 30일이 지나도 여전히 낮은 수치를 보인다. 또한 아연이 부족한 사료를 먹이다가, 정상 사료로 바꾼 그룹도 약 20일이 되어야, 처음부터 정상 사료를 먹인 그룹과 비슷한 아연 수치를 보였다.
표 10
측정 시기(일) 그룹
CD Zn-/CD Zn-/WT Zn-/OsNAS2-D1
2 2.102±0.017 1.658±0.077 1.471±0.033 1.706±0.097
6 2.102±0.017 1.802±0.063 1.671±0.076 1.836±0.132
10 2.125±0.086 1.889±0.091 1.736±0.081 2.013±0.101
15 2.152±0.155 1.948±0.011 1.789±0.072 2.164±0.109
20 2.309±0.073 2.204±0.112 1.933±0.182 2.237±0.089
30 2.274±0.278 2.015±0.164 1.900±0.211 2.182±0.133
본 발명자들은 상기한 실시예에서 얻어진 미량 금속의 함량이 증가된 벼 품종 OsNAS2-D1를 2009년 4월 30일자로 국립농업과학원 농업유전자원센터에 특허종자를 기탁하였으며, 종자 수탁번호 KACC98008P를 부여 받았다.
또한, 본 발명자들은 상기한 실시예에서 얻어진 미량 금속의 함량이 증가된 벼 품종 OsNAS2-D1를 2009년 11월 18일자로 부다페스트 조약에 따른 국제기탁기관 (International Depositary Authority)인 한국생명공학연구원(Korea Research Institute of Bioscience and Biotechnology: KRIBB)에 종자를 기탁하였으며, 종자 수탁번호 KCTC 11597BP를 부여 받았다.
실시예9: OsNAS3 유전자의 발현이 활성화된 형질전환 식물체의 분리
(1) 벼에 존재하는 3개의 니코티아나민 합성효소 유전자의 발현 분석
벼에는 3개의 니코니아나민 신타제 (Nicotianamine synthase) (OsNAS1, OsNAS2, OsNAS3)가 존재하고, 효소로서의 활성이 있음이 보고되었다 (Inoue et al., Plant J 36:366-381, 2003). 미량 원소의 유무에 따른 위 3개의 유전자의 발현 정도를 알아보았다. 벼의 종자를, MS (Murashige and Skoog) 배지 (0.1μM CuSO4, 100μM Fe(III)-EDTA, 30μM ZnSO4, 10μM MnSO4를 포함함)에서 발아시키고, 7일 동안 길렀다. 동일한 방법으로 0.1μM CuSO4, 100μM Fe(III)-EDTA, 30μM ZnSO4, 또는 10μM MnSO4이 없는 MS 배지에서 벼 종자를 발아시키고, 7일 동안 길렀다. 벼의 뿌리와 잎으로부터 RNA를 준비하였고, 그 발현 정도를 정량적 실시간 RT-PCR로 분석하였다. PCR 조건은, 95℃에서 1 분을 유지한 후, 94℃에서 15초, 56℃에서 10초 및 72℃에서 10초를 45회 반복하였다. 사용한 프라이머는 다음과 같다. 발현 대조군으로서, 벼 액틴 1 유전자를 증폭하였다.
프라이머 서열
OsNAS1-정방향 프라이머: 5'-ACTCCATTTGGTTGTCATTTT-3'(서열번호 13)
OsNAS1-역방향 프라이머: 5'-GGTTGACGTAGTTGCCGTAGTA-3'(서열번호 14)
OsNAS2-정방향 프라이머: 5'-GTGATCAACTCCGTCATCGT-3'(서열번호 15)
OsNAS2-역방향 프라이머: 5'-TGACAAACACCTCTTGCTTTC-3'(서열번호 16)
OsNAS3-정방향 프라이머: 5'-GTGATCAACTCCGTCATCATC-3'(서열번호 17)
OsNAS3-역방향 프라이머: 5'-TCAGTCTCATCATGGGAAAAA-3'(서열번호 18)
OsAct1-정방향 프라이머: 5'-TGGAAGCTGCGGGTATCCAT-3' (서열번호 23)
OsAct1-역방향 프라이머:5'-TACTCAGCCTTGGCAATCCACA-3'(서열번호 24)
그 결과를 도 8, 9 및 10에 나타내었다. 도 8, 9 및 10에서, 세로축은 벼 액틴 1 유전자의 발현 양을 기준으로 발현 정도를 나타낸다.
도 8, 9 및 10에 나타낸 바와 같이, OsNAS1과 OsNAS2 유전자는 벼가 철을 포함하지 않는 배지에서 자라는 경우, 철을 충분히 포함하는 배지에서 자란 경우에 비하여, 상대적으로 잎에서 강하게 발현이 유도되었으며, 뿌리에서는 그 유도 정도가 약하게 증가하였다. 반면, OsNAS3 유전자는 벼가 철을 포함하지 않는 배지에서 자라는 경우, 철을 충분히 포함하는 배지에서 자란 경우에 비하여, 뿌리에서 약 2배 정도 강하게 발현이 유도되었으나, 잎에서는 철이 부족한 조건에서는 발현이 오히려 감소하였다. 이는 OsNAS3이 OsNAS1과 OsNAS2와는 다른 역할을 하는 것으로 추측되어, OsNAS3을 표적 유전자로 선택하였다. 도 8, 9 및 10에서 사용되는 벼는 동진 벼이다.
(2) OsNAS3 유전자의 발현이 활성화된 형질전환 식물체의 제조와 분리
형질전환 벼를 제조하기 위한 구조체로서 T-DNA 벡터인 pGA2715 벡터를 이용하였다 (Jeong et al., Plant Physiol 130:1636-1644,2002). 상기 벡터는 우측 경계에 인접하여 β-글루쿠로니다제 (GUS) 리포터 유전자를 포함하고 있고, 좌측 경계에 인접하여 CaMV 35S 프로모터 유래 테트라머화된 전사 인핸서를 포함한다. 상기 pGA2715 벡터를 Agrobacterium에 형질 전환시키고, 형질 전환된 Agrobacterium을 이용하여 양생형인 동진 벼에 형질전환하여, pGA2715가 형질 도입된 벼 식물체 집단을 제조하였다 (Lee et al, J Plant Biol 42:310-316, 1999; Jeong et al., Plant Physiol 130:1636-1644, 2002).
형질도입된 벼 식물체로부터 분리된 게놈 DNA에 대하여 역전-PCR (inverse PCR)을 통하여 pGA2715 벡터 중의 T-DNA가 삽입된 위치를 확인하였다. 그 결과 T-DNA가 OsNAS3 유전자의 주변에 삽입된 두 개의 형질전환 식물체를 분리하였다.
그 중 OsNAS3-D1 형질전환 식물체는 OsNAS3 유전자의 하류 약 1.5 kb에 35S 인핸서를 좌측 경계 부위에 포함하는 T-DNA가 삽입되어 있고, OsNAS3-D2 형질전환 식물체는 하류 약 1.9 kb에 35S 인핸서를 좌측 경계 부위에 포함하는 T-DNA가 삽입되어 있는 것이다. 도 7은 OsNAS3-D1과 OsNAS3-D2에서 T-DNA의 삽입 위치를 나타낸 것이다.
실시예 10: 형질전환 식물체에서 OsNAS3 의 발현 증가
상기 실시예9에서 선별된 OsNAS3-D1과 OsNAS3-D2의 유전형을 PCR을 통해 결정하였다. OsNAS3-D1과 OsNAS3-D2의 T2 세대 개체들의 잎에서 게놈 DNA를 추출하였고 이를 PCR의 주형 DNA로 사용하였다. OsNAS3-D1에 대해서는, 2개의 유전자-특이적 프라이머 F2 (5'-TTTAGGGGAAATGGAGGTTACT-3', 서열번호 19)와 R2 (5'-CTGTAACACTTTAACGCACCAA-3', 서열번호 20) 및 T-DNA 특이적 프라이머 RB (5'-CAAGTTAGTCATGTAATTAGCCAC-3', 서열번호 21)를 사용하였다. OsNAS3-D2에 대해서는, 2개의 유전자-특이적 프라이머 F2 (서열번호 19)와 R3 (5'-GGCTTGCTCTTGTCATAGGC-3', 서열번호 22) 및 T-DNA 특이적 프라이머 RB (서열번호 21)를 사용하였다.
발현량을 알아보기 위하여, OsNAS3-D1과 OsNAS3-D2의 동형접합체 및 각각의 야생형 벼, 즉 동진 벼(WT)의 10일령의 잎으로부터 RNA를 분리하고, 역전사 효소를 이용하여 각각의 cDNA를 제조하였다. 제조한 cDNA를 주형으로 하고 서열번호 17과 18의 프라이머를 이용하여 실시간 RT-PCR을 수행하여, OsNAS3 유전자 전사량을 비교하였으며, 그 결과를 도 11에 나타내었다. 도 11에서 세로축은 벼 액틴 1 유전자 전사량에 대한 상대적인 전사량을 나타낸 것이다.
도 11에서와 같이, OsNAS3 유전자의 발현은 OsNAS3-D1에서는 야생형 (WT)에 비해 약 60배 증가하였고, OsNAS3-D2에서는 야생형 (WT)에 비해 약 30배 증가하였다.
실시예 11: 형질전환 식물체에서 미량 원소 함량의 측정
OsNAS3 유전자의 활성화가 벼의 미량 원소 축적에 미치는 영향을 알아보기 위하여, 야생형 (WT), 형질전환 식물체인 OsNAS3-D1과 OsNAS-D2에서 미량 원소를 측정하였다. 야생형과 형질전환 식물체의 성숙한 종자 및 지엽 (flag leaves)을 시료로 사용하였고, 미량 원소 측정 방법은 Kim et al., Physiol Plant 116:368-372, 2002에 기재된 방법을 참고하였다. 시료를 70℃에서 2일 동안 건조시키고, 건조량을 기록하고, 얻은 시료를 11N HNO3 1 ml에서 3일 동안 180℃ 오븐에서 분해시켰다. 희석한 다음, 원자 흡수 분광분석법 (atomic absorption spectroscopy: AAS) (Solaar 989, Unicam Atomic Abosorption, Cambridge, UK)에 의해 시료 내 미량 원소 철, 아연, 구리, 망간의 함량을 측정하였다. 그 결과를 하기 표 11에 나타내었다.
표 11
조직 표현형 유전형 Fe(㎍/g-Dw) Zn(㎍/g-Dw) Cu(㎍/g-Dw) Mn(㎍/g-Dw)
지엽 OsNAS3-D1 W/W 92.26±5.98 20.37±3.55 3.93±0.84 652.69±66.43
T/T 135.57±19.53 28.57±4.73 4.58±0.02 682.95±75.03
OsNAS-D2 W/W 88.43±4.38 21.43±2.77 3.78±0.73 700.46±88.34
T/T 108.90±10.43 25.42±1.90 4.35±0.88 711.43±66.32
성숙한 종자 OsNAS3-D1 W/W 11.58±0.25 19.88±0.52 1.25±0.15 30.63±0.83
T/T 33.92±1.82 44.16±3.48 2.14±0.14 33.62±0.75
OsNAS-D2 W/W 9.53±0.09 22.22±1.36 1.32±0.20 29.30±3.82
T/T 16.55±2.44 32.55±3.41 1.68±0.16 33.73±1.46
표 11에서와 같이, 구리와 망간의 양은 큰 변화를 보이지 않았다. OsNAS3-D1의 경우 야생형(WT)에 비하여 철은 1.5배, 아연은 1.4배 증가 하였으며, OsNAS3-D2의 철과 아연이 야생형(WT) 대비 1.2배 증가 하였다. 성숙한 종자에서, OsNAS3-D1과 OsNAS3-D2의 지엽에서는 철과 아연의 양이 뚜렷하게 증가하였다. 종자에서는 OsNAS3-D1의 경우, 야생형 (WT)에 비하여 철은 2.9배, 아연은 2.2배, 구리는 1.7배 증가하였다. 종자에서는 OsNAS3-D2의 경우, 야생형에 비하여 철은 1.7배, 아연은 1.5배, 구리는 1.3배 증가하였다.
실시예 12: 철과 아연이 부족한 조건에서 형질전환 식물체의 유묘 표현형 분석
철과 아연이 부족한 조건에서 OsNAS3 유전자의 활성화가 미치는 영향을 알아보았다. 철과 아연을 모두 함유하는 MS 고체 배지, 철을 함유하지 않는 MS 고체 배지, 아연을 함유하지 않는 MS 고체 배지에서 야생형(WT)과 OsNAS3-D1을 발아시키고 8일동안 길러 유묘 표현형을 관찰하였다. 그 결과를 도 12에 나타내었다. 또한, 표현형의 신장과 엽록소의 함량을 측정하여 하기 표 12에 나타내었다. 엽록소의 측정은 잎을 채취하여, 무게를 측정하고, 80% 아세톤을 이용하여 추출하였다. 액체 질소를 이용하여 얼린 후, 잘게 부순 잎과 80% 아세톤을 잘 섞어 (잎 100mg당 1ml 80% 아세톤 첨가), 얼음에 15분 방치 후, 15000g로 원심 분리하여, 상등액을 분주하여, 666nm및 646nm에서 흡광도를 측정한 후 Arnon, Plant Physiol 24:1-15, 1949에 기재된 방법으로 엽록소a와 염록소b를 포함하는 염록소의 양을 측정하였다.
표 12
배지 유전형 표현형 신장(cm) 엽록소의 함량(㎍/ml-추출액)
MS WT 16.6±1.2 146.89±19.57
OsNAS3-D1 16.9±1.4 150.64±3.07
Fe- WT 11.3±1.3 71.23±6.56
OsNAS3-D1 14.3±0.8 106.95±6.95
Zn- WT 15.2±0.9 120.44±10.23
OsNAS3-D1 16.4±1.1 130.66±5.55
도 12와 표 13에서와 같이, 철과 아연을 모두 함유하는 배지(MS) 조건에서는 식물체의 크기도 비슷하여, 표현형의 차이를 보이지 않았다. 그러나, 철을 함유하지 않는 배지 (Fe-) 조건에서는 OsNAS3-D1은 야생형(WT)에 비하여 키도 크고, 엽록소도 야생형(WT)에 비하여 50% 이상 증가하여 철 부족의 대표적 증상인 백화 현상 (chlorosis)도 덜 진행되었다. 따라서, OsNAS3-D1은 야생형에 비하여 철이 부족한 생육 조건에서 더 잘 견디는 것을 알 수 있다. 아연을 함유하지 않는 배지 조건 (Zn-)에서도 OsNAS3-D1은 야생형(WT)에 비하여 생장 속도가 빨랐다. 따라서, OsNAS3-D1은 야생형(WT)에 비하여 아연이 부족한 생육 조건에서도 더 잘 자라는 것을 알 수 있다.
상기 실험 결과를 검증하기 위하여, 각각의 조건에서 유묘 시기의 야생형(WT)과 OsNAS3-D1의 줄기와 뿌리를 채취하고 철과 아연의 농도를 상기 실시예 11과 동일한 방법으로 측정하였다. 그 결과를 표 13에 나타내었다.
표 13
배지 조직 유전형 Fe(㎍/g-Dw) Zn(㎍/g-Dw)
MS 줄기 WT 242.33±10.23 67.43±12.38
OsNAS3-D1 420.44±13.24 133.76±12.64
뿌리 WT 330.13±13.65 116.28±12.98
OsNAS3-D1 540.22±23.88 189.43±23.11
Fe- 줄기 WT 65.43±12.98 nt＊
OsNAS3-D1 143.66±22.59 nt
뿌리 WT 102.43±12.65 nt
OsNAS3-D1 203.66±28.76 nt
Zn- 줄기 WT nt 48.57±2.56
OsNAS3-D1 nt 68.77±3.89
뿌리 WT nt 32.18±6.77
OsNAS3-D1 nt 45.77±3.49
*: 측정하지 않음.
표 13에서와 같이, 철과 아연을 모두 함유하는 배지(MS) 조건에서는 상기에서 살핀 바와 같이 표현형의 차이는 없었다. 그러나, OsNAS3-D1은 야생형(WT)에 비하여 철의 농도가 줄기와 뿌리에서 각각 1.7배, 1.6배 증가하였고, 아연의 농도는 줄기와 뿌리에서 각각 2배, 1.6배 증가하였다. 또한, 철을 함유하지 않는 배지 조건에서는 OsNAS3-D1은 야생형(WT)에 비하여 철의 농도가 줄기와 뿌리에서 각각 2.2배, 2배 증가하였다. 또한, 아연을 함유하지 않는 배지 조건에서도 OsNAS3-D1은 야생형(WT)에 비하여 아연의 농도가 줄기와 뿌리에서 모두 1.4배 증가하였다. 따라서, OsNAS3-D1은 철 또는 아연이 부족한 생육 조건에서 더 잘 견디는 것을 알 수 있다.
실시예 13: 과량의 중금속이 함유된 조건에서 형질전환 식물체의 표현형 분석
OsNAS3 활성화가 과량의 중금속 처리시 발생되는 독성에 어떤 영향을 주는지 알아보았다. 과량의 아연 (5 mM), 구리 (0.3 mM) 또는 니켈 (0.5 mM)이 각각 첨가된 고체 MS 배지에서 야생형(WT)과 OsNAS3-D1을 발아시키고 10일 동안 길러 유묘 표현형을 관찰하였다. 표현형과 식물체의 신장을 도 13에 나타내었다.
도 13에서와 같이, OsNAS3-D1은 야생형에 비하여 키도 크고, 백화 현상이 덜 진행되었다. 이러한 결과는 OsNAS3-D1이 야생형(WT)에 비하여 과량의 중금속에 의한 독성에 대한 내성이 향상되었음을 나타낸다. 특히, 과량의 아연을 함유하는 고체 MS 배지에서 길렀을 때, 줄기와 뿌리의 아연 농도를 상기 실시예 11과 동일한 방법으로 측정하였고, 그 결과를 표 14에 나타내었다.
표 14
조직 유전형 Zn(㎍/g-DW)
줄기 WT 2.05±0.23
OsNAS3-D1 4.77±0.89
뿌리 WT 10.21±2.10
OsNAS3-D1 9.77±0.36
표 14에서와 같이, OsNAS3-D1은 줄기에서 야생형(WT)에 비하여 2.3배 높은 아연 농도를 보였다.
실시예 14: pH가 높은 조건에서 형질전환 식물체의 표현형 관찰
토양의 pH는 식물에 필요한 원소의 용해도에 많은 영향을 미친다. 예를 들어, pH가 8 이상이면, 철은 용해도가 낮은 Fe2O3 형태로 변화되어, 식물이 제대로 이용 및 흡수할 수 없는 상태가 된다. 그 결과 철 부족 현상을 일으키게 된다.
pH 8.5로 맞춘 MS 배지 (MS)에서 야생형(WT)과 OsNAS3-D1을 발아시키고 10일 동안 길러 표현형을 관찰하였다. 또한, 철을 함유하지 않는 MS 배지 (Fe-)(pH 8.5)에서도 동일한 방법을 실시하여 표현형을 관찰하였다. 표현형과 식물체의 신장을 도 14에 나타내었다.
도 14에서와 같이, pH 8.5로 맞춘 MS 배지 (MS/pH8.5)에서 OsNAS3-D1이 야생형(WT)에 비하여 신장도 크고 더 잘 견디는 것을 알 수 있다. 이러한 결과는 철을 함유하지 않는 MS 배지 (Fe-/pH8.5)에서 더 분명하게 나타났다.
실시예 15: 생물학적 이용도 (bioavailability) 조사
OsNAS3-D1의 종자에서 증가된 철 함량이 동물에서 철 흡수에 미치는 영향을 확인하기 위하여는, 상기 종자를 먹이로 하여 마우스 식이 분석 (mouse feeding assay)을 통하여 철의 생물학적 이용도를 확인하였다.
생후 3주된 암컷 Balb/c 마우스에, 철이 충분한 사료 (AIN-93G Purified Diet-45 mgFe/kg 사료)와 철이 부족한 사료 (modified AIN-93G diet containing iron 3 mg/kg 사료)를 공급하였다. 2주 후, 이 두 그룹의 쥐들로부터 혈액을 채취하였다. 이것은 빈혈을 유발함과 동시에, 빈혈의 정도를 알아보기 위하여 혈액의 헤모글로빈 (Hb)과 헤마토크릿 (Hct)를 측정하기 위함이다. 측정 결과 철이 부족한 사료를 먹인 쥐들의 헤모글로빈 (Hb)과 헤마토크릿 (Hct) 수치가, 철이 충분한 사료를 먹인 쥐들에 비해서 각각 77% 및 79% 감소하였다 (표 15). 이것은 철이 부족한 사료를 먹였을 때 빈혈이 유발됨을 알 수 있었다.
이 후, 철분이 부족한 사료를 먹인 쥐들을 두 그룹으로 나누어서, 제 1그룹(야생형, WT, n=10)은 야생형(WT) 종자로부터 나온 쌀을 먹였고, 제 2그룹 (OsNAS3-D1, n=9)은 OsNAS3-D1의 종자로부터 나온 쌀을 먹였다. 2주 경과 후 혈액을 채취하여 Hb와 Hct를 측정하였다. 동일한 방법으로 쌀을 먹이고 다시 2주 더 경과 후 혈액을 채취하여 Hb와 Hct를 측정하였다. 그 결과를 표 16에 나타내었다.
표 16에서와 같이, 야생형(WT) 또는 OsNAS3-D1의 종자로부터 나온 쌀을 먹이기 전까지 마우스의 Hb와 Hct는 유의성 있는 차이를 보이지 않았다. 2주 경과 후 두 그룹의 Hb와 Hct를 측정 한 결과, 제2 그룹은 제1 그룹에 비해 Hb와 Hct의 현저한 증가를 보여주었다. 다시 2주 경과 후 Hb와 Hct를 측정 한 결과, 이 경우에도 제2 그룹은 제1 그룹에 비해 Hb와 Hct의 현저한 증가를 보여주었다.
표 15
철분이 충분한 사료를 먹인 쥐 그룹 철분이 부족한 사료를 먹인 쥐 그룹
Hb(g/L) 16.10±0.25 12.50±0.48
Hct(%) 54.00±0.73 42.6±1.62
표 16
그룹 명 측정 시기1
0주 2주 5주
Hb(g/L) WT 12.80±0.53 13.70±0.55 15.50±0.66
OsNAS3-D1 12.10±0.84 16.50±0.46 16.70±0.69
Hct(%) WT 43.70±1.80 46.20±1.44 47.70±2.46
OsNAS3-D1 41.20±2.83 52.50±1.79 50.40±2.68
1: 태어난 지 3주된, 마우스에 2주간 철이 부족한 사료를 먹인 후, 두 그룹으로 나누어, 철이 부족한 사료를 대신하여, WT 또는 OsNAS3-D1 종자로 바꿔 먹이기 시작할 때부터 경과한 시간.
본 발명자들은 상기한 실시예에서 얻어진 미량 금속의 함량이 증가된 벼 품종 OsNAS3-D1과 OsNAS3-D2를 2008년 7월 14일자로 농업생명공학연구원에 특허종자를 기탁하였으며, 각각 종자 수탁번호 KACC 98004P 및 KACC 98005P를 부여받았다.
본 발명자들은 또한 상기한 실시예에서 얻어진 미량 금속의 함량이 증가된 벼 품종 OsNAS3-D1를 2009년 11월 18일자로 부다페스트 조약에 따른 국제기탁기관 (International Depositary Authority)인 한국생명공학연구원(Korea Research Institute of Bioscience and Biotechnology: KRIBB)에 종자를 기탁하였으며, 종자 수탁번호 KCTC 11598BP를 부여 받았다.
본 발명의 예시적 구체예는 미량 원소의 함량이 증가된 식물체를 제공한다.
상기 식물체는 철, 아연 및 구리로부터 선택되는 하나 이상의 금속 함량이 야생형 식물체에 비하여 증가되어 있는 것일 수 있다. 예를 들면, 상기 식물체는, 철 및/또는 아연이 야생형 식물체에 비하여 증가되어 있는 것일 수 있다. 상기 금속 함량의 증가된 정도는, 10%이상, 20%이상, 30%이상, 50%이상 또는 70%이상일 수 있다.
상기 식물체는 OsNAS2 유전자 또는 OsNAS2 유전자의 발현이 증가되어 있는 것일 수 있다. 상기 OsNAS2 유전자는 서열번호 2 (GenBank 허가번호 : AB023818)의 아미노산 서열을 갖는 폴리펩티드를 코딩하는 유전자일 수 있다. 예를 들면, 상기 유전자는 서열번호 1의 뉴클레오티드 서열을 갖는 것일 수 있다. 그러나, 상기 OsNAS2 유전자는 OsNAS2 단백질 활성을 갖는 폴리펩티드를 코딩하는 것은 어느 것이나 포함된다. 예를 들면, OsNAS2 단백질 활성을 갖는, 상기 서열번호 2와 같은 단백질의 변이체가 포함될 수 있으나, 이들 예에 한정되는 것은 아니다. 상기 OsNAS3 유전자는 서열번호 11 (GenBank 허가번호 : AB023819)의 아미노산 서열을 갖는 폴리펩티드를 코딩하는 유전자일 수 있다. 예를 들면, 상기 유전자는 서열번호 10의 뉴클레오티드 서열을 갖는 것일 수 있다. 그러나, 상기 OsNAS3 유전자는 OsNAS3 단백질 활성을 갖는 폴리펩티드를 코딩하는 것은 어느 것이나 포함된다. 예를 들면, OsNAS3 단백질 활성을 갖는, 상기 서열번호 11과 같은 단백질의 변이체가 포함될 수 있으나, 이들 예에 한정되는 것은 아니다.
상기 식물체는 단자엽 식물일 수 있다. 예를 들면, 벼, 보리 및 옥수수일 수 있다. 상기 식물체는, 식물체 전체, 뿌리, 잎, 종자, 및 상기 식물체로부터 분리된 세포일 수 있다. 또한, 상기 식물체에는 식물체로부터 생산된 종자도 포함한다.
상기 식물체에 있어서, OsNAS2 유전자 또는 OsNAS3 유전자의 발현을 증가시키는 것은, 세포 내에 존재하는 내재적 유전자의 발현을 증가시키는 것과 관련된 분야에서 알려진 임의의 방법에 의하여 이루어진 것일 수 있다. 예를 들면, 트란스포존 요소 (transposable element: TE)나 T-DNA와 같은 삽입 요소 (insertion element)를 식물체의 게놈 내에 도입하는 삽입 돌연변이 법이 사용될 수 있다. 삽입 돌연변이 법은 삽입된 요소가 유전자 확인을 위한 태그 (tag)로서 작용한다는 잇점이 있다. 또한, 변형된 삽입 돌연변이 법이 사용될 수 있다. 변형된 삽입 돌연변이 법의 일 예는, 상기 태그되는 유전자와 β-글루쿠로니다제 (GUS) 또는 녹색형광단백질 (GFP)과 같은 리포터 유전자 사이를 융합시키는 것을 포함하는 유전자 포획 시스템 (gene trap system)이다. 이 시스템에 의하면, 발현 양상에 근거하여 유전자를 확인할 수 있다. 프로모터 없는 리포터의 삽입은 정상 유전자 기능을 파괴할 뿐만 아니라, 삽입된 리포터 유전자의 방향이 맞으면, 리포터가 발현되어 삽입된 유전자의 발현을 반영함으로 유용한 프로모터 분리도 가능하다. 변형된 삽입 돌연변이 법의 다른 예는, 활성화 태그시스템 (activation tagging system)이다. 이 시스템은 멀티머화된 CaMV 35S 인핸서를 포함하는 T-DNA 또는 TE (transposable element)를 사용한다. 인핸서는 방향에 무관하게 코딩 영역으로부터 상당한 거리에서도 기능을 하기 때문에, 인접하는 유전자의 전사활성화를 야기시켜, 우성 기능획득 돌연변이체 (dominant gain-of-function mutations)를 형성시킬 수 있다. 상기 방법들에 의하여 형성된 돌연변이체 중에서 OsNAS2 유전자의 발현을 증가된 개체를 선발함으로써, 상기 식물체를 얻을 수 있다 (Jung et al., Plant Physiology 130: 1636-1644). 상기 CaMV 35S 인핸서는 예를 들면, 서열번호 12의 뉴클레오티드 서열을 갖는 것일 수 있다. 상기 식물체는, 예를 들면, 상기 OsNAS2 유전자 또는 OsNAS3 유전자의 발현을 증가시키기 위하여 인핸서가 도입된 것, 또는 상기 유전자의 카피 수가 증폭된 것일 수 있다. 상기 인핸서의 예에는, CaMV 35S 인핸서 (Cauliflower mosaic virus 35S enhancer) 또는 이들의 연결체 (예를 들면, 4개의 연결체)일 수 있으며, 이들 인핸서는 벡터, 예를 들면, pGA2715 (Jung et al., Plant Physiology 130: 1636-1644) 및 pGA2772 ( Jung et al., Plant J 45:123-132, 2006)와 같은 활성화 태그 벡터 (activation tagging vector)에 의하여 식물체의 게놈 내로 도입되는 것일 수 있다. 상기 인핸서는 선택된 인핸서의 특성에 따라, 상기 OsNAS2 유전자 또는 OsNAS3 유전자와 적절한 위치에 배치될 수 있다. 예를 들면, 상기 OsNAS2 유전자 또는 OsNAS3 유전자의 5', 3' 또는 5' 및 3'말단에 인접(flank)하거나, 이격되어 위치할 수 있다. 예를 들면, 상기 인핸서는 CaMV 35S 인핸서이며, 상기 OsNAS2 유전자의 하류 (downstream), 예를 들면, 유전자의 중지 코돈으로부터의 하류로 약 10kb 이내, 예를 들면, 약 2.06kb에 도입된 것일 수 있다. 또한, 상기 인핸서는 CaMV 35S 인핸서이며, 상기 OsNAS2 유전자의 상류 (upstream), 예를 들면, 유전자의 시작 코돈으로부터 상류로 약 10kb 이내, 예를 들면, 약 2.06kb에 도입된 것일 수 있다. 예를 들면, 상기 인핸서는 CaMV 35S 인핸서이며, 상기 OsNAS3 유전자의 하류 (downstream), 예를 들면, 유전자의 중지 코돈으로부터의 하류로 10kb 이내, 예를 들면, 1.5kb 및/또는 1.9kb에 도입된 것일 수 있다. 또한, 상기 인핸서는 CaMV 35S 인핸서이며, 상기 OsNAS3 유전자의 상류 (upstream), 예를 들면, 유전자의 시작 코돈으로부터 상류로 10kb 이내, 예를 들면, 1.5kb 및/또는 1.9kb에 도입된 것일 수 있다. 상기 인핸서는 단독 또는 복수 개가 연결되어 있는 것일 수 있다. 예를 들면, 상기 인핸서는 4개 카피의 CaMV 35S 인핸서가 연속하여 연결되어 있는 것일 수 있다.
식물체에 외래 핵산 구조체, 예를 들면, 인핸서를 도입하는 방법은 알려져 있다. 예를 들면, 상기 구조체의 도입은 아그로박테리움 투메파시엔스 (Agrobacterium tumefaciens) Ti 플라미스미드, 전기천공 (electroporation) 및 충격법 (bombardment)을 통하여 도입될 수 있다. 또한, 식물체에 외래 핵산 구조체를 도입하는 것은, 특정한 위치에 위치 특이적으로 도입하거나, 무작위적으로 도입한 후 특정한 형질을 갖는 식물체를 선발함으로써 이루어질 수 있다.
상기 식물체의 일 예는, 종자 수탁번호: KACC 98008P, 종자 수탁번호: KACC 98004P 또는 KACC 98005P로 기탁된 벼가 될 수 있다. 상기 식물체의 다른 예는, 종자 수탁번호 KCTC 11597BP로 기탁된 OsNAS2-D1 벼 (Oryza sativa) 또는 종자 수탁번호 KCTC 11598BP로 기탁된 OsNAS3-D1 벼 (Oryza sativa)인 것일 수 있다. 상기 벼는 철 및 아연 함량이 야생형 벼에 비하여, 증가되어 있다. 또한, 상기 벼는 아연, 구리 또는 니켈이 증가된 조건에서 내성을 가지고 생육할 수 있다.
본 발명의 다른 예시적 구체예는, 중금속에 대하여 내성을 갖는 식물체를 제공한다. 상기 식물체에 대하여는 상기한 바와 같다. 상기 중금속은 아연, 구리, 및 니켈로부터 선택되는 하나 이상일 수 있다. 상기 내성의 정도는 5mM 이상의 아연, 0.3mM 이상의 구리, 또는 0.5mM 이상의 니켈에서 생육할 수 있는 것일 수 있다.
본 발명의 다른 예시적 구체예는, 상기한 본 발명의 예시적 구체예에 따른 식물체를 철 및 아연으로 구성되는 군으로부터 선택된 하나 이상이 부족한 조건에 생육시키는 단계를 포함하는, 식물체를 생육시키는 방법을 제공한다. 상기 철 및 아연의 농도는 예를 들면, 철 및 아연이 포함되어 있지 않은 MS 배지 또는 그와 유사한 조건에서 배양하는 것일 수 있다.
본 발명의 다른 예시적 구체예는, 상기한 본 발명의 예시적 구체예에 따른 식물체를 과량의 중금속이 존재하는 조건에 생육시키는 단계를 포함하는, 식물체를 생육시키는 방법을 제공한다. 상기 중금속은 5mM 이상의 아연, 0.3mM 이상의 구리, 또는 0.5mM 이상의 니켈인 것일 수 있다.
본 발명의 다른 예시적 구체예는, 상기 식물체를 포함하거나 그로부터 생성된 산물을 함유하는 기능성 식품을 제공한다. 상기 기능성 식품은 철, 아연 및 구리로부터 선택된 하나 이상이 증가되어 있는 것이다. 상기 기능성 식품은 상기 식물체의 종자, 예를 들면, 쌀을 포함하거나 그로부터 가공된 산물일 수 있다.
본 발명의 다른 예시적 구체예는, 상기 식물체를 포함하거나 그로부터 생성된 산물을 함유하는 약학적 조성물을 제공한다. 상기 식물체는 뿌리, 잎, 줄기, 씨앗 및 이들의 조합으로 이루어진 군으로부터 선택되는 것일 수 있다. 또한, 상기 산물은 뿌리, 잎, 줄기, 씨앗 및 이들의 조합으로 이루어진 군으로부터 선택되는 식물체를 가공하여 얻어지는 것일 수 있다. 예를 들면, 상기 식물체를 물리적 또는 화학적 처리하여 얻어지는 것일 수 있다. 예를 들면, 상기 산물은 상기 식물체를 증숙, 분쇄, 추출, 분리 정제 및 이들의 조합으로부터 선택되는 하나 이상의 과정을 거처 얻어지는 것일 수 있다.
상기 약학적 조성물은 약학적으로 허용가능한 희석제 또는 담체를 포함할 수 있다. 상기 담체 또는 희석제는 당업계에 알려진 임의의 담체일 수 있다. 상기 담체 또는 희석제는 통상적인 부형제, 붕해제, 결합제, 활택제 등 중에서 1종 또는 2종 이상을 선택적으로 사용할 수 있다. 예를 들어, 상기 조성물을 정제 또는 경질캅셀제 등의 고형제형으로 제조할 경우, 부형제로서 미결정 셀룰로오즈, 유당, 저치환도 히드록시셀룰로오즈 등이 사용될 수 있고, 붕해제로서 전분글리콜산 나트륨, 무수인산일수소 칼슘 등이 사용될 수 있다. 결합제로는 폴리비닐피롤리돈, 저치환도 히드록시프로필셀룰로오즈, 히드록시프로필셀룰로오즈 등이 사용될 수 있고, 활택제로서는 스테아린산 마그네슘, 이산화규소, 탈크 등으로부터 선택하여 사용할 수 있다.
상기 조성물은 과립제, 산제, 액제, 정제, 캅셀제, 또는 건조시럽제 등의 경구용 제제 또는 주사제 등의 비경구용 제형으로 제제화할 수 있으나, 이러한 제형에 한정되는 것은 아니다. 바람직하게는 상기 조성물은 과립, 정제 또는 캅셀제 형태이거나, 액제 또는 주사제의 형태일 수 있다.
상기 조성물에서 사용되는 상기 식물체 또는 그 산물의 치료학적으로 유효한 양은 상기 식물체 중의 미량 원소의 함량과 그를 필요로 하는 개체의 나이, 성별, 질병의 경중 및 체중 등의 상황을 판단하여 당업자가 용이하게 결정할 수 있다. 예를 들면, 상기 식물체 또는 산물이 쌀인 경우, 상기 양은 하루 100g 내지 500g, 예를 들면 100g 내지 400g, 100g 내지 300g, 200g 내지 300g, 또는 150 내지 300g일 수 있다.
상기 조성물은 경구 또는 비경구적으로 투여될 수 있다. 예를 들면, 상기 조성물은 경구, 예를 들면, 통상적인 식사를 통하여 경구적으로 투여될 수 있다. 또한, 상기 투여는 1일 1회 또는 수회에 나누어 투여될 수 있다.
상기 조성물은 철, 아연, 구리 및 이들의 조합으로부터 선택되는 물질의 부족으로 인하여 야기되는 질병을 치료하기 위한 것일 수 있다. 상기 질병은 철 결핍 증상일 수 있다. 상기 철 결핍 증상은 예를 들면, 빈혈 (anemia), 피로 (fatigue), 창백(pallor), 모발 손상 (hair loss), 가지러움 (irritability), 약함 (weakness), 이식증(pica), 손발톱 부서짐 (brittle or grooved nails), 플루머-빈손 증후군 (plummer-vinson syndrome), 및 손상된 면역 기능(impaired immune function)을 포함한다. 상기 질병은 아연 결핍 (zinc deficiency)으로 야기되는 증상을 포함한다. 상기 질병은 저아연혈증 (hypozincemia)일 수 있다. 저아연혈증은 대사 요구에 필요한 아연이 충분하지 않을 상태를 말한다. 아연 결핍 증상은 모발 손상, 피부 손상 (skin lesion), 설사, 체조직의 웨이스팅 (wasting of body tissue), 일 수 있다. 창자병증말단피부염 (acrodermatitis enteropathica), 거식증 (anorexia), 인지 및 운동 기능 상실 (cognitive and motor function impairment) 및 무월경증(dysmenorrhea)을 포함한다. 상기 질병은 구리 결핍으로 야기되는 질병일 수 있다. 구리 결핍은 변혈증 (syndrome of anemia) 또는 범혈구감소증 (pancytopenia), 신경퇴화 (neurodegeration), 멘케스병 (Menkes disease), 경직(spasticity), 조화운동불능(ataxia) 및 신경병증(neuropahty)일 수 있다.
본 발명의 다른 예시적 구체예는, 미량 원소 함량이 증가된 식물체를 제조하는 방법을 제공한다.
상기 방법의 일 예는, 외래 인핸서를 포함하는 구조체를 식물체에 도입하여, OsNAS2 유전자 또는 OsNAS3 유전자의 발현이 증가된 식물체를 얻는 단계를 포함한다. 인핸서, 식물체, 상기 구조체를 식물체에 도입하는 방법 및 OsNAS2 유전자 또는 OsNAS3 유전자에 대하여는 상기한 바와 같다. 상기 OsNAS2 유전자 또는 OsNAS3 유전자의 발현이 증가되었는지 여부는, 당업계에 알려진 방법에 의하여 이루어질 수 있다. 예를 들면, 직접적인 효소 활성 측정, 핵산 증폭 방법에 의한 OsNAS2 유전자 또는 OsNAS3 유전자의 mRNA 수준의 측정, 또는 발현된 단백질의 양을 측정함으로써 이루어질 수 있다. 상기 핵산 증폭 방법에는 RT-PCR 등을 포함한 PCR이 포함된다. 상기 단백질의 양 측정에는, ELISA, 웨스턴 블롯팅 등과 같은 면역학적 방법이 사용될 수 있다. 상기 방법은, 상기 OsNAS2 유전자 또는 OsNAS3 유전자의 발현이 증가 여부와 함께, 철, 아연 및 구리로부터 선택된 하나 이상이 야생형에 비하여 증가되었는지 결정하는 단계를 더 포함할 수 있다. 철 및/또는 아연의 함량을 측정하는 방법은 알려져 있다.
예를 들면, 상기 방법은, 꽃양배추 모자이크 바이러스의 프로모터로부터 유래한 35S 인핸서가 삽입된 Ti 플라스미드를 식물체 도입하는 단계; 상기 35S 인핸서가 OsNAS2 활성 또는 OsNAS3 활성을 코딩하는 유전자의 상류 및 하류 중 하나 이상의 위치에 삽입된 식물체를 선발하는 단계를 포함하는 것일 수 있다.
상기 Ti 플라스미드는 아그로박테리움 투메파시엔스에 포함된 원형 플라스미드로서, 식물체에 유전 물질을 도입하기 위하여 사용된다. 상기 35S 인핸서를 Ti 플라스미드에 도입하는 것은, 적절한 제한효소 및 리가제 등을 사용하여 당업자가 용이하게 제조할 수 있다. 상기 35S 인핸서는 Ti 플라스미드의 T-DNA의 좌측 및/또는 우측 경계 (border)에 위치할 수 있다. 상기 35S 인핸서는 하나 이상, 예를 들면, 4개가 인접되어 있는 것일 수 있다. 예를 들면 pGA2715 벡터 또는 pGA2772 벡터에 의해 삽입될 수 있다. 상기 Ti 플라스미드를 식물체에 도입하는 것은, Ti 플라스미드를 아그로박테리움 투메파시엔스에 도입하고, Ti 플라스미드가 도입된 아그로박테리움 투메파시엔스를 식물체에 감염시킴으로써 이루어질 수 있다. 일반적으로, Ti 플라스미드의 T-DNA 영역이 식물체의 염색체에 삽입된다.
상기 방법은 상기 35S 인핸서가 OsNAS2 활성 또는 OsNAS3 활성을 코딩하는 유전자의 상류 및 하류 중 하나 이상의 위치에 삽입된 식물체를 선발하는 단계를 포함한다. "OsNAS2 활성"이란 3분자의 S-아데노실-L-메티오닌을 3 S-메틸-5'-티오아데노신 + 니코니아나민으로 전환시키거나 그 역으로 전환시키는 반응 촉매하는 활성을 의미한다. 바람직하게는, 상기 OsNAS2 활성은 서열번호 2의 아미노산 서열을 갖는 단백질에 의한 것일 수 있다. 상기 OsNAS2 활성을 코딩하는 유전자에는 서열번호 2의 아미노산 서열을 갖는 단백질을 코딩하는 유전자, 예를 들면, 서열번호 1의 뉴클레오티드 서열을 갖는 것일 수 있다. 상기 35S 인핸서가 OsNAS2을 코딩하는 유전자 상류 및 하류 중 하나 이상의 위치에 삽입되었는지 여부는, 서열분석 또는 핵산 증폭에 의하여 이루어질 수 있다. 상기 식물체는 바람직하게는 벼 (Oryza sativa)이다. 예를 들면, 상기 35S 인핸서는 OsNAS2 활성을 코딩하는 서열번호 1의 염기 서열의 하류 약 2.06 kb에 삽입될 수 있다.
"OsNAS3 활성"이란 3분자의 S-아데노실-L-메티오닌을 3 S-메틸-5'-티오아데노신 + 니코니아나민으로 전환시키거나 그 역으로 전환시키는 반응 촉매하는 활성을 의미한다. 바람직하게는, 상기 OsNAS3 활성은 서열번호 11의 아미노산을 갖는 단백질에 의한 것일 수 있다. 상기 OsNAS3 활성을 코딩하는 유전자에는 서열번호 11의 아미노산을 갖는 단백질을 코딩하는 유전자, 예를 들면, 서열번호 10의 뉴클레오티드 서열을 갖는 것일 수 있다. 상기 35S 인핸서가 OsNAS3을 코딩하는 유전자 상류 및 하류 중 하나 이상의 위치에 삽입되었는지 여부는, 서열분석 또는 핵산 증폭에 의하여 이루어질 수 있다. 상기 식물체는 바람직하게는 벼 (Oryza sativa)이다. 예를 들면, 상기 35S 인핸서는 OsNAS3 활성을 코딩하는 서열번호 10의 염기 서열의 하류 약 1.5 kb 또는 약 1.9 kb에 삽입될 수 있다.
도 1은 T-DNA가 삽입된 DNA 구조체의 일 형태를 나타낸 것이다. 도 1에서 ATG에서 TGA까지의 박스로 표시된 부분은 OsNAS2 유전자의 엑손을 나타낸다. T-DNA는 OsNAS2 유전자의 TGA 종결코돈 뒤 약 2.06 kb에 삽입될 수 있다 (OsNAS2-D1 형질전환 식물체).
도 6은 T-DNA가 삽입된 DNA 구조체의 일 형태를 나타낸 것이다. 도 6에서 ATG에서 TGA까지의 박스로 표시된 부분은 OsNAS3 유전자의 엑손을 나타낸다. T-DNA는 OsNAS3 유전자의 TGA 종결코돈 뒤 약 1.5kb에 삽입될 수 있다 (OsNAS3-D1 형질전환 식물체). 또한, T-DNA는 OsNAS3 유전자의 TGA 종결코돈 뒤 약 1.9kb에 삽입될 수 있다 (OsNAS3-D2 형질전환 식물체).
본 발명의 다른 예시적 구체예는, 상기한 바와 같은 식물체를 높은 pH 조건에서 생육시키는 단계를 포함하는, 식물체를 생육시키는 방법을 제공한다.
상기 pH는 8.5 내지 14, 예를 들면, 8.5 내지 12일 수 있다.
본 발명의 일 구체예에 따른 식물체에 의하면, 야생형 (WT)에 비하여 증가된 미량 원소의 함량을 가질 수 있다.
또한, 본 발명의 일 구체예에 따른 기능성 식품에 의하면, 야생형 (WT)에 비하여 증가된 미량 원소의 함량을 가지고 있어 높은 농업적 및 영양학적 이익을 가질 수 있다.
또한, 본 발명의 일 구체예에 따른 미량 원소 함량이 증가된 식물체를 제조하는 방법에 의하면, 미량 원소 함량이 증가된 식물체를 효과적으로 제조할 수 있다.
또한, 본 발명의 일 구체예에 따른 식물체를 생육시키는 방법에 의하면, 식물체를 철 또는 아연과 같은 중금속이 부족한 양으로 포함된 생육 조건 또는 구리, 아연 또는 니켈과 같은 중금속이 과량으로 포함된 생육 조건에서 식물체를 생육시킬 수 있다.
본 명세서에서 인용된 서열번호 1 내지 24의 서열은 서열목록 파일을 통하여 제출하며, 상기 서열목록 파일의 내용은 그 전체가 원용에 의하여 본 명세서에 포함되어 진다.

Claims (21)

  1. 미량 원소의 함량이 증가되어 있는 식물체로서, 상기 미량 원소는 철, 아연 및 구리로 이루어진 군으로부터 선택된 것인 식물체.
  2. 제1항에 있어서, 상기 식물체는 벼, 보리 또는 옥수수인 것인 식물체.
  3. 제1항에 있어서, 상기 식물체는 OsNAS2 유전자 또는 OsNAS3 유전자의 발현이 증가된 것인 식물체.
  4. 제3항에 있어서, 상기 OsNAS2 유전자 또는 OsNAS3 유전자의 발현 증가는 OsNAS2 유전자 또는 OsNAS3 유전자의 상류 및 하류로 이루어진 군으로부터 선택된 하나 이상의 위치에서 인핸서의 삽입에 의하여 이루어진 것인 식물체.
  5. 제4항에 있어서, 4개의 CaMV 35S 인핸서가 연결된 구조체가 OsNAS2 유전자 또는 OsNAS3 유전자의 하류 약 10kb 내의 위치에 삽입되어 있는 것인 식물체.
  6. 제1항에 있어서, 상기 식물체는 종자 수탁번호 KCTC 11597BP로 기탁된 OsNAS2-D1 벼 (Oryza sativa) 또는 종자 수탁번호 KCTC 11598BP로 기탁된 OsNAS3-D1 벼 (Oryza sativa)인 것인 식물체.
  7. 제1항의 식물체로부터 생산된 산물을 함유하는 기능성 식품.
  8. 제1항의 식물체로부터 생산된 산물을 함유하는 약학적 조성물.
  9. 제8항에 있어서, 상기 조성물은 철, 아연, 구리 및 이들의 조합으로 이루어진 군으로부터 선택된 물질의 결핍에 의하여 야기되는 질병을 치료하기 위한 것인 조성물.
  10. 제8항에 있어서, 상기 질병은 철 결핍으로 야기된, 빈혈 (anemia), 피로 (fatigue), 창백(pallor), 모발 손상 (hair loss), 가지러움 (irritability), 약함 (weakness), 이식증(pica), 손발톱 부서짐 (brittle or grooved nails), 플루머-빈손 증후군 (plummer-vinson syndrome), 손상된 면역 기능(impaired immune function) 및 이들의 조합; 아연 결핍 (zinc deficiency)으로 야기된, 저아연혈증 (hypozincemia), 모발 손상, 피부 손상 (skin lesion), 설사, 체조직의 웨이스팅 (wasting of body tissue), 창자병증말단피부염 (acrodermatitis enteropathica), 거식증 (anorexia), 인지 및 운동 기능 상실 (cognitive and motor function impairment), 무월경증(dysmenorrhea) 및 이들의 조합; 구리 결핍으로 야기된, 변혈증 (syndrome of anemia), 범혈구감소증 (pancytopenia), 신경퇴화 (neurodegeration), 멘케스병 (Menkes disease), 경직(spasticity), 조화운동불능(ataxia), 신경병증(neuropahty) 및 이들의 조합으로 이루어진 군으로부터 선택된 것인 조성물.
  11. 외래 인핸서를 포함하는 구조체를 식물체에 도입하여, OsNAS2 유전자 또는 OsNAS3 유전자의 발현이 증가된 식물체를 얻는 단계를 포함하는, 철, 아연 및 구리로 이루어진 군으로부터 선택된 미량 원소 함량이 증가된 식물체를 제조하는 방법.
  12. 제11항에 있어서, 상기 구조체를 식물체에 도입하는 단계는 꽃양배추 모자이크 바이러스의 프로모터로부터 유래한 35S 인핸서가 삽입된 Ti 플라스미드를 식물체에 도입하는 단계이고, 상기 식물체를 얻는 단계는 상기 35S 인핸서가 OsNAS2 활성 또는 OsNAS3 활성을 코딩하는 유전자의 상류 및 하류 중 하나 이상의 위치에 삽입된 식물체를 선발하는 단계인 것인, 미량 원소 함량이 증가된 식물체를 제조하는 방법.
  13. 제12항에 있어서, 상기 35S 인핸서는 상기 서열번호 2 또는 서열번호 11의 아미노산 서열을 코딩하는 유전자의 하류 약 10kb 내의 위치에 삽입되는 것인 방법.
  14. 제12항에 있어서, 상기 35S 인핸서는 4카피가 연결된 것인 방법.
  15. 제11항에 있어서, 상기 식물체는 벼 (Oryza sativa)인 것인 방법.
  16. 제11항에 있어서, 상기 식물체는 종자 수탁번호 KCTC 11597BP로 기탁된 OsNAS2-D1 벼 (Oryza sativa) 또는 종자 수탁번호 KCTC 11598BP로 기탁된 OsNAS3-D1 벼 (Oryza sativa)인 것인 방법.
  17. 제1항 내지 제6항 중 어느 한 항에 따른 식물체를 철 및 아연으로 구성되는 군으로부터 선택된 하나 이상이 부족한 조건에 생육시키는 단계를 포함하는, 식물체를 생육시키는 방법.
  18. 제1항 내지 제6항 중 어느 한 항에 따른 식물체를 과량의 중금속이 존재하는 조건에 생육시키는 단계를 포함하는, 식물체를 생육시키는 방법.
  19. 제18항에 있어서, 상기 중금속은 5mM 이상의 아연, 0.3mM 이상의 구리, 또는 0.5mM 이상의 니켈인 것인 방법.
  20. 제1항 내지 제6항 중 어느 한 항에 따른 식물체를 높은 pH에 조건에서 생육시키는 단계를 포함하는, 식물체를 생육시키는 방법.
  21. 제20항에 있어서, 상기 pH는 8.5이상인 것인 방법.
PCT/KR2009/007603 2009-12-10 2009-12-18 미량 원소 함량이 증가된 벼 품종 및 그의 용도 WO2011071207A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2012543001A JP2013513381A (ja) 2009-12-10 2009-12-18 微量元素含有量が増加したイネ品種及びその用途
CN2009801634143A CN103025152A (zh) 2009-12-10 2009-12-18 痕量元素含量提高的水稻品种及其用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020090122543A KR101255336B1 (ko) 2009-12-10 2009-12-10 미량 원소 함량이 증가된 벼 품종 및 이를 이용한 기능성 식품
KR10-2009-0122543 2009-12-10

Publications (1)

Publication Number Publication Date
WO2011071207A1 true WO2011071207A1 (ko) 2011-06-16

Family

ID=44145739

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2009/007603 WO2011071207A1 (ko) 2009-12-10 2009-12-18 미량 원소 함량이 증가된 벼 품종 및 그의 용도

Country Status (4)

Country Link
JP (1) JP2013513381A (ko)
KR (1) KR101255336B1 (ko)
CN (1) CN103025152A (ko)
WO (1) WO2011071207A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3171741A1 (en) * 2014-07-21 2017-05-31 Abbott Laboratories Nutrient delivery system

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101771291B1 (ko) * 2014-08-13 2017-08-24 경희대학교 산학협력단 종자 생산성이 증대된 벼 품종 및 이의 제조방법
CN104513825B (zh) * 2014-12-25 2017-05-24 中国科学院遗传与发育生物学研究所 一种小麦耐盐基因TaNAS1及其应用
KR101779030B1 (ko) 2015-10-22 2017-09-15 충남대학교산학협력단 아연 함량이 증가된 식물체를 선별하기 위한 분자마커 및 이의 용도
CN110192948B (zh) * 2019-05-28 2022-01-04 河南省超亚医药器械有限公司 一种小儿腹部热敷贴
CN110192947B (zh) * 2019-05-28 2022-01-04 河南省超亚医药器械有限公司 一种小儿肺部热敷贴

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU759256B2 (en) * 1998-04-30 2003-04-10 Japan Science And Technology Agency Nicotianamine synthase and gene encoding the same
JP4084502B2 (ja) 1999-07-05 2008-04-30 独立行政法人科学技術振興機構 鉄欠乏耐性イネの創製
JPWO2002077240A1 (ja) * 2001-03-23 2004-07-15 科学技術振興事業団 デオキシムギネ酸合成酵素及びその遺伝子
KR100471679B1 (ko) 2003-05-12 2005-03-10 조용구 페리틴 유전자로 형질전환된 벼
JP5001602B2 (ja) * 2006-08-10 2012-08-15 独立行政法人科学技術振興機構 デオキシムギネ酸合成酵素およびその利用

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HARUHIKO INOUE, ET AL.: "Three rice nicotianamine synthase genes, OsNAS1, OsNAS2, and OsNAS3 are expressed in cells involved in long-distance transport of iron and differentially regulated by iron", THE PLANT JOURNAL, vol. 36, no. 3, November 2003 (2003-11-01), pages 366 - 381 *
KYOKO HIGUCHI, ET AL.: "Nicotiamine synthase gene expression differs in barley and rice under Fe-deficient conditions", THE PLANT JOURNAL, vol. 25, no. 2, 2001, pages 159 - 167 *
LAURA E. MURRAY-KOLB, ET AL.: "Transgenic rice is a source of iron for iron-depleted rats", J NUTR., vol. 132, 1 May 2002 (2002-05-01), pages 957 - 960 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3171741A1 (en) * 2014-07-21 2017-05-31 Abbott Laboratories Nutrient delivery system

Also Published As

Publication number Publication date
KR101255336B1 (ko) 2013-04-16
CN103025152A (zh) 2013-04-03
KR20110065863A (ko) 2011-06-16
JP2013513381A (ja) 2013-04-22

Similar Documents

Publication Publication Date Title
WO2011071207A1 (ko) 미량 원소 함량이 증가된 벼 품종 및 그의 용도
Li et al. Identification and characterization of dwarf 62, a loss-of-function mutation in DLT/OsGRAS-32 affecting gibberellin metabolism in rice
Lidholm et al. Homologues of the green algal gidA gene and the liverwort frxC gene are present on the chloroplast genomes of conifers
WO2019135639A1 (ko) 신규 폴리펩타이드 및 이를 이용한 imp 생산방법
KR100685520B1 (ko) 종자 특이적 프로모터, 이의 증폭용 프라이머, 이를포함하는 발현벡터 및 형질전환세포
WO2007147016A2 (en) Generation of plants with improved pathogen resistance
WO2019235907A1 (ko) Crispr/cas9 시스템을 이용하여 플라보노이드 생합성 유전체를 편집하기 위한 조성물 및 이의 이용
WO2012148121A2 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ7 단백질과 그 유전자 및 이들의 용도
CN102065680B (zh) 能生物合成辣椒素酯类物质的基因修饰植物
WO2018066897A2 (ko) 식물의 생산성 증대 기능과 노화 지연 기능을 갖는 mtatpg1 단백질과 그 유전자 및 이들의 용도
WO2013062327A2 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ4 단백질과 그 유전자 및 이들의 용도
CN111286510A (zh) 蛋白激酶基因pmf1在调控水稻抽穗期和产量中的应用
CN108456683B (zh) 一个调控水稻抽穗期基因sid1的功能及应用
WO2014209036A1 (ko) 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg10 단백질과 그 유전자 및 이들의 용도
WO2014209060A1 (ko) 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg6 단백질과 그 유전자 및 이들의 용도
WO2012148122A2 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ8 단백질과 그 유전자 및 이들의 용도
WO2013125835A1 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ３ 단백질과 그 유전자 및 이들의 용도
WO2020184764A1 (ko) 벼 유래의 ak102606 유전자의 항산화능, 환경 스트레스 및 수확량 조절자로서의 용도
WO2012093764A1 (ko) Ａｂｃ 수송체 단백질을 암호화하는 유전자를 포함하는 식물 종자의 크기 또는 종자 내 저장 지방의 함량 증가용 조성물
KR100803391B1 (ko) 전신 발현 프로모터, 이의 증폭용 프라이머, 이를 포함하는발현벡터 및 형질전환 식물체
WO2013027905A1 (ko) 식물 유래의 ｄｈａｒ 또는 ｍｄｈａｒ 유전자의 수확량 및 환경 스트레스 조절자로서의 용도
WO2022139106A1 (ko) 분질배유를 지니는 '삼광' 유래 돌연변이 벼 계통, 'samkwang(sa)-flo3'
WO2021101351A2 (ko) 비푸코실화된 담배를 이용하여 생산한 항체 및 이의 용도
CN113817750B (zh) 一种水稻胚乳粉质相关基因OsDAAT1及其编码蛋白质和应用
WO2023140722A1 (ko) 7-디하이드로콜레스테롤이 고농도로 함유된 토마토 및 이의 제조 방법

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200980163414.3

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09852100

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2012543001

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09852100

Country of ref document: EP

Kind code of ref document: A1