WO2014209036A1 - 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg10 단백질과 그 유전자 및 이들의 용도 - Google Patents

식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg10 단백질과 그 유전자 및 이들의 용도 Download PDF

Info

Publication number
WO2014209036A1
WO2014209036A1 PCT/KR2014/005700 KR2014005700W WO2014209036A1 WO 2014209036 A1 WO2014209036 A1 WO 2014209036A1 KR 2014005700 W KR2014005700 W KR 2014005700W WO 2014209036 A1 WO2014209036 A1 WO 2014209036A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
atpg10
gene
seq
aging
Prior art date
Application number
PCT/KR2014/005700
Other languages
English (en)
French (fr)
Inventor
이동희
이인철
김국진
김동수
Original Assignee
제노마인(주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 제노마인(주) filed Critical 제노마인(주)
Publication of WO2014209036A1 publication Critical patent/WO2014209036A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates to an ATPG10 protein having its productivity enhancing function, stress resistance function and delaying aging function, genes thereof and uses thereof.
  • Plant senescence is considered to be a major step in the plant's lifecycle, and progresses in a highly sophisticated manner at the cellular, tissue, organ and individual levels through genetically regulated reactions. The aging process can occur differently in different organs of the plant. In the case of leaves, the degradation of chloroplasts is followed by the degradation of lipids, proteins and nucleic acids.
  • Cell structures such as cell membranes and intracellular compartments, are maintained until the end and lead to death after rearrangement of the degraded product nitrogen and nutrients (Lohman et al., Physiologia Plantarum, 1994, 92: 322-8 .; Smart, New Phytologist, 1994, 126: 419-48; Pruzinska et al., Plant Physiology, 2005, 139: 52-63).
  • the timing at which plants determine aging is related to nutrient retention and rearrangement, so flowering and seed production are often factors that promote aging. Plants also progress the aging process as a species-wide survival strategy for seasonal or unforeseen external environmental changes.
  • SAGs Senescence Associated Genes
  • U.S. Patent No. 5689042 discloses a method of delaying aging by combining cytokinin synthesis-related genes with promoters of SAG12 or SAG13 genes, and recombination of IPT genes with SAG12 gene promoters shows a 50% increase in productivity in tobacco.
  • Tomatoes have been reported to control the ripening of fruits by inhibiting the ethylene synthesis process (Oeller et al., Science. 1991, 254 (5030): 437-9) and also inhibit the expression of polygalacturonase genes involved in cell wall degradation.
  • Flav-O-Savor which increases the transport and storage properties of tomatoes, may be a typical commercialized example (Giovannoni et al., 1989, Plant Cell 1 (1): 53-63).
  • GmSARK gene and WRKY53, WRKY6 and AtNAP genes belonging to the NAC family have been reported as genes overexpressed during aging (Miao et al., Plant Mol. Biol. 2004, 55: 853-867; Guo and Gan et al. , Plant J. 2006, 46 (4): 601-12; Li et al., Plant Mol Biol. 2006, 61: 829-844; Besseau et al., J Exp Bot 2012, 63 (7): 2667-79 Genes such as CBF2 and CBF3 are known to inhibit aging (Sobieszczuk-Nowicka et al., Physiol Plant 2007; 130: 590-600).
  • U.S. Pat.No.8420890 discloses a method for delaying aging by inhibiting the expression of AtNAP gene. Recently, studies have been conducted for overexpressing AtNAP to facilitate the harvesting of cotton or the like or to help ripening fruit. (Kou et al., J Exp Bot. 2012, 63 (17): 6139-47).
  • TobEA Tobacco Expression Atlas
  • the present invention also discloses a gene having a function of delaying aging and the like, which can improve the productivity of crops and the like.
  • Another object of the present invention is to provide a gene encoding the protein.
  • Still another object of the present invention is to provide a method for producing a plant having a yield increasing characteristic.
  • Still another object of the present invention is to provide a method for producing a plant having stress resistance.
  • Still another object of the present invention is to provide a method for producing a plant having aging delay characteristics.
  • the present invention relates to an ATPG10 protein having a productivity enhancing function of a plant, a stress resistance function, and a delaying aging function.
  • the inventor isolates the gene of the protein based on the nucleotide sequence of Predicted AT-hook DNA-binding family protein (GeneBank accession number NP_199781.1) of Arabidopsis, and as identified in the following Examples.
  • the productivity increase characteristics such as increased biomass and / or increased seed productivity are apparent, and the resistance to drought stress or oxidative stress is also obvious, and the aging retardation phenomenon of the plant is obvious. It was confirmed to appear.
  • the present inventors have named the gene to gene and protein ATPG10 ATPG10 (AT -hook p rotein of G enomine 10), these nucleotide sequences and amino acid sequences are disclosed in SEQ ID NOS: 1 and 2, respectively.
  • the ATPG10 protein of the present invention is one of the polypeptides of (a), (b) and (c) below.
  • protein are used interchangeably with each other in the same sense as a polypeptide
  • gene is used interchangeably with each other in the same sense as a polynucleotide.
  • a "polypeptide comprising a substantial portion of the amino acid sequence set forth in SEQ ID NO: 2" still retains increased productivity and stress resistance, and delayed plant aging as compared to the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: It is defined as a polypeptide comprising a portion of an amino acid sequence of SEQ ID NO: 2 sufficient to the following.
  • the length of the polypeptide and the degree of activity of such a polypeptide is not a problem since it still needs to be sufficient to retain productivity and stress resistance and to delay plant aging.
  • polypeptide As such a polypeptide, the polypeptide which deleted the N-terminal part or C-terminal part in the polypeptide containing the amino acid sequence of SEQ ID NO: 2 is mentioned. This is because it is generally known in the art that even if the N- or C-terminal portion is deleted, such a polypeptide has the function of the original polypeptide. Of course, in some cases, the N-terminal or C-terminal moiety is necessary for maintaining the function of the protein, so that a polypeptide deleted with the N-terminal or C-terminal moiety does not exhibit this function. It is within the ordinary skill of one of ordinary skill in the art to distinguish and detect inactive polypeptides from active polypeptides.
  • the deletion of the N-terminal or C-terminal moiety as well as other moieties may still have the function of the original polypeptide.
  • one of ordinary skill in the art will be able to ascertain whether such deleted polypeptide still has the function of the original polypeptide within the scope of its usual ability.
  • the present specification discloses the nucleotide sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2, furthermore, a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1 and consisting of the amino acid sequence of SEQ ID NO: 2 increases productivity and stress resistance of plants.
  • the present invention discloses an embodiment confirming whether the plant has a delaying function of aging, and thus, a polypeptide having a partial deletion in the amino acid sequence of SEQ ID NO: 2 may still retain the function of the polypeptide comprising the amino acid sequence of SEQ ID NO: 2 It is very clear that those skilled in the art can fully confirm within the ordinary capability range. Therefore, in the present invention, the "polypeptide comprising a substantial part of the amino acid sequence as set forth in SEQ ID NO: 2", as defined above, delays the aging of a plant that a person skilled in the art can manufacture within the range of its usual capacity based on the disclosure herein. It is to be understood as meaning including all polypeptides in a deleted form that have function and productivity enhancing function.
  • polypeptide substantially similar to the polypeptide of (a) and (b) includes a function comprising one or more substituted amino acids, but comprising the amino acid sequence of SEQ ID NO: 2, ie, the productivity of a plant. It refers to a polypeptide possessing augmentation and stress resistance functions and a delay in plant aging.
  • the degree of activity or amino acid substitution of the polypeptide is not a problem as long as the polypeptide containing at least one substituted amino acid retains the productivity of the plant, the stress resistance function, and the delayed plant aging function.
  • a polypeptide comprising one or more substituted amino acids contains a large number of substituted amino acids, even if its activity is lower than that of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, the polypeptide is a plant productivity. It is included in the present invention as long as it possesses augmentation and stress tolerance functions, and a plant aging delay function. Even if one or more amino acids are substituted, if the amino acid before substitution is chemically equivalent to the substituted amino acid, the polypeptide comprising such substituted amino acid will still retain the function of the original polypeptide.
  • the polypeptide having such substituted amino acid (s) may be It will still retain the function of the original polypeptide.
  • a negatively charged amino acid such as glutamic acid
  • another negatively charged amino acid such as aspartic acid
  • polypeptide having such substituted amino acid (s) will still retain the function of the original polypeptide even if its activity is low. will be.
  • a polypeptide comprising amino acid (s) substituted at the N-terminal or C-terminal portion of the polypeptide will still retain the function of the original polypeptide.
  • One skilled in the art would prepare a polypeptide that contains one or more substituted amino acids as described above, but still retains the productivity and stress resistance functions of plants comprising the amino acid sequence of SEQ ID NO. can do.
  • polypeptides comprising one or more substituted amino acids still has this function.
  • the present disclosure discloses the nucleotide sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2, and also the polypeptide comprising the amino acid sequence of SEQ ID NO: 2 has a function of increasing productivity and stress resistance of plants, and delaying plant aging. Since the confirmed examples are disclosed, it is evident that the "polypeptides substantially similar to the polypeptides of (a) and (b)" of the present invention can be easily implemented by those skilled in the art.
  • polypeptide substantially similar to the polypeptide of (a) or (b) above is meant to include all polypeptides that contain one or more substituted amino acids but still have plant productivity and stress resistance and delayed aging of plants. Should be understood as. As such, the term “polypeptide substantially similar to the polypeptide of (a) or (b)” includes all polypeptides that contain one or more substituted amino acids but still have plant productivity and stress resistance functions, and plant aging function. In view of the degree of activity, however, the polypeptide is preferably higher in sequence homology with the amino acid sequence of SEQ ID NO.
  • the polypeptide has at least 60% sequence homology at the lower end of sequence homology, while at the upper limit of sequence homology, it is preferred that the polypeptide has 100% sequence homology. More specifically, the above sequence homology is 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% in order of higher.
  • polypeptides substantially similar to the polypeptides of (a) and (b) above are not only “polypeptides substantially similar to polypeptides comprising the entire amino acid sequence of SEQ ID NO: 2", All descriptions above are intended to include “substantially similar to polypeptides comprising the entire amino acid sequence of SEQ ID NO: 2" as well as “amino acids of SEQ ID NO: 2", since the polypeptide comprising substantially part thereof is included. The same applies to polypeptides that are substantially similar to polypeptides comprising substantial portions of the sequence.
  • polypeptide as described above refers to a polypeptide comprising the entire amino acid sequence of SEQ ID NO: 2, a substantial portion of the amino acid sequence of SEQ ID NO. Including polypeptides, and polypeptides substantially similar to the above polypeptides, as well as all polypeptides of the preferred embodiments as described above.
  • the polynucleotide of the present invention is an isolated polynucleotide encoding a polypeptide comprising all or a substantial part of the amino acid sequence of SEQ ID NO: 2 and having a function of increasing productivity and stress resistance of plants, and delaying aging of plants
  • Polypeptides encoding polypeptides that are substantially similar to the polypeptides include isolated polynucleotides and, in a preferred embodiment, the sequences in the order of sequence homology as described above, with increasing plant productivity and stress resistance, and delayed plant aging. It includes an isolated polynucleotide encoding all polypeptides with homology. When amino acid sequences are found, those skilled in the art can readily prepare polynucleotides encoding such amino acid sequences based on those amino acid sequences.
  • isolated polynucleotide herein includes both chemically synthesized polynucleotides, polynucleotides isolated from organisms, particularly Arabidopsis thaliana , and polynucleotides containing modified nucleotides, which are single stranded or double-stranded. It is defined as including all polymers of stranded RNA or DNA.
  • the present invention relates to a method for producing a plant having productivity enhancing properties.
  • Method for producing a plant having a productivity enhancing feature of the present invention comprises the steps of (a) overexpressing a gene having a nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 in the plant and (b) increased productivity And selecting the plant having the characteristic.
  • productivity enhancing properties means that the biomass (size and / or mass) of the whole, stem, root and / or leaves of the plant is increased compared to wild type plants and / or the productivity of the seed of the plant (plant 1). Number and / or mass of seeds per individual) is increased compared to wild type plants.
  • plant is meant to include mature plants, immature plants (plants), plant seeds, plant cells, plant tissues and the like.
  • plant cells or plant tissues are described in European Patent EP0116718, European Patent EP0270822, International Patent WO 84/02913, Gould et al. 1991, Plant Physiol 95,426-434, etc., can be used to develop and grow into mature plants.
  • plant includes all plants for which productivity enhancing properties and the like can give useful results to human beings. Therefore, the meaning of the plant includes crops (specifically, crops such as edible crops, feed crops, craft crops, and horticultural crops), forest trees, and ornamental plants.
  • gene consisting of a sequence similar to the nucleotide sequence of SEQ ID NO: 1 is a gene encoding the first amino acid of SEQ ID NO: 2 while having a base sequence different from that of the gene of SEQ ID NO: 1 due to codon degeneracy
  • homologue of genes consisting of the nucleotide sequence of SEQ ID NO: 1 having the characteristics of increasing the productivity of the plant, etc. due to the evolutionary pathways different according to the type of plant consisting of the nucleotide sequence of SEQ ID NO: 1 and other nucleotide sequences It is meant to include all genes.
  • the gene consisting of a sequence similar to the nucleotide sequence of SEQ ID NO: 1 is preferably higher in sequence homology with the nucleotide sequence of SEQ ID NO: 1, and most preferably, having 100% sequence homology.
  • the gene has a sequence homology of 60% or more with the nucleotide sequence of SEQ ID NO: 1.
  • sequence homology is 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73 %, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, Higher in order of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% is preferred.
  • overexpression means expression above the level expressed in wild-type plants.
  • Such “overexpression” can be directly determined by quantifying the gene of SEQ ID NO: 1 or a gene consisting of a sequence similar to the nucleotide sequence of SEQ ID NO: 1, or indirectly by quantifying the protein encoded by the gene. have. It can also be confirmed by the phenotype that appears according to the characteristics of the gene.
  • step (a) may be performed by a genetic engineering method.
  • Genetic engineering method includes the steps of: (i) inserting a gene having the sequence of SEQ ID NO: 1 or a sequence similar to the sequence of SEQ ID NO: 1 into an expression vector to be operably linked to a regulatory sequence capable of overexpressing it, and ( ii) transforming the expression vector into a plant.
  • operably means that the transcription and / or translation of a gene is linked to be affected. For example, if a promoter influences the transcription of a gene linked to it, the promoter and the gene are operably linked.
  • regulatory sequence is meant to include all sequences whose presence may affect the transcription and / or translation of a gene linked thereto, and such regulatory sequences include a promoter sequence and a polyadenylation signal. ), The replication start point.
  • promoter follows the conventional meaning known in the art, specifically located at the top (5 'side) based on the transcription initiation point of a gene, binding to DNA-dependent RNA polymerase By nucleic acid sequences having the function of controlling transcription of one or more genes, including sites, transcriptional initiation sites, transcription factor binding sites, and the like.
  • This promoter may be a TATA box (usually located at the transcription start point (+1) -20 to -30 position) above the transcription initiation point if it is of eukaryotes, and a CAAT box (typically about -75 position compared to the transcription start site) Present), a 5 'enhancer, a transcription repression factor, and the like.
  • Usable promoters include constitutive promoters (promoters which induce constant expression in all plant tissues), inducible promoters (expression of target genes in response to specific external stimuli) as long as they are promoters capable of overexpressing the gene of SEQ ID NO. 1 linked thereto. Promoters that induce expression or promoters that specifically induce expression in specific developmental periods or specific tissues).
  • constitutive promoters include the promoter of the 35S RNA gene of cauliflower mosaic virus (CaMV), and the ubiquitin family of promoters (Christensen et al., 1992, Plant Mol). Biol. 18, 675-689; EP0342926; Cornejo et al., 1993, Plant Mol. Biol.
  • rice actin promoter Zhang et al. 1991, The Plant Cell 3, 1155-1165
  • rice actin promoter Zhang et al. 1991, The Plant Cell 3, 1155-1165
  • inducible promoters include the yeast metallothionein promoter (Mett et al., Proc. Natl. Acad. Sci., USA, 90: 4567, 1993), which is activated by copper ions, substituted by substituted benzenesulfonamides.
  • In2-1 and In2-2 promoters (Hershey et al., Plant Mol. Biol., 17: 679, 1991), GRE regulatory sequences regulated by glucocorticoids (Schena et al., Proc. Natl. Acad.
  • the transcription termination sequence is a sequence that acts as a poly (A) addition signal (polyadenylation signal) to enhance the integrity and efficiency of transcription.
  • transcription termination sequences that can be used include the transcription termination sequence of the nopaline synthase (NOS) gene, the transcription termination sequence of the rice ⁇ -amylase RAmy1 A gene, and the transcription termination of the Octopine gene of Agrobacterium tumefaciens.
  • the expression vector may include a selection marker gene.
  • marker gene refers to a gene encoding a trait that enables the selection of a plant comprising such a marker gene.
  • the marker gene may be an antibiotic resistance gene or may be a herbicide resistance gene.
  • suitable selectable marker genes include genes of adenosine deaminase, genes of dihydrofolate reductase, genes of hygromycin-B-phosphortransferase, genes of thymidine kinase, genes of xanthine-guanine phosphoribosyltransfer Laze gene, phosphinnothricin acetyltransferase gene, basta herbicide resistance bar gene, etc. are mentioned.
  • the term "transformation” refers to a modification of the genotype of a host plant by the introduction of a hereditary gene, and regardless of the method used for the transformation, the herb gene is a host plant, more precisely a cell of the host plant. Introduced into and integrated into the genome of a cell.
  • the hereditary genes include homologous and heterologous genes, wherein “homologous genes” refer to endogenous genes of a host organism or the same species, and “heterologous genes” are genes that do not exist in the organism to which they are transformed.
  • Arabidopsis derived genes are homologous to Arabidopsis plants, but heterologous to tomato plants.
  • a method of transforming a plant with an exogenous gene may use a method known in the art, such as a direct gene transfer method using a gene gun, an in planta transformation method using a floral dip, pollen mediation, and the like. Transformation methods, protoplast transformation methods, viral mediated transformation methods, liposome mediated transformation methods, and the like can be used.
  • a transformation method suitable for a specific plant for example, a method for transforming corn is described in US Pat. No.
  • Generally used in transforming plants is a method of infecting seedlings, plant seeds and the like with the transformed Agrobacterium.
  • Such Agrobacterium mediated transformation methods are well known in the art (Chilton et al., 1977, Cell 11: 263: 271; European Patent EP 0116718; US Patent US 4,940,838), and methods suitable for particular plants are also known in the art.
  • the Agrobacterium mediated transformation method uses Ti-plasmid, which will contain left and right border sequences that allow the integration of T-DNA into the genome of plant cells.
  • the selection step (b) may be selected through the characteristics of the inserted gene by growing and growing the transformed plant, or, if the selection marker gene is transformed together during transformation, the selection marker gene may be selected. Can be.
  • the characteristics of the inserted gene include the biomass of the plant and / or the productivity of the seed.
  • the present invention relates to a method for producing a plant having stress resistance properties of the present invention.
  • the method of producing a stress-resistant plant of the present invention comprises the steps of: (a) overexpressing a gene having the nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 in the plant, and (b) It comprises a step of selecting a plant having.
  • the method of producing a stress resistant plant of the present invention comprises the steps of (a) overexpressing a gene having the nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 in the plant, and (b) a stress resistant phenotype It comprises a step of selecting a plant having a.
  • stress refers to drought stress and / or oxidative stress.
  • Step (a) may be performed genetically, as for the genetic engineering method, as described with reference to the method of manufacturing a plant having the productivity increasing characteristic of the present invention.
  • the step (b) is selected by comparing the stress resistance of the plant which is a characteristic of the inserted gene (for example, by selecting the degree of progress of leaf yellowing or necrosis, chlorophyll content, photosynthetic efficiency, etc.).
  • the selection marker gene When the selection marker gene is transformed together at the time, the selection marker gene may be used for selection, or a combination thereof may be used for selection.
  • the present invention relates to a method for producing a plant having aging delay properties.
  • the method for producing a plant having a aging retardation property of the present invention comprises the steps of (a) overexpressing a gene having a nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 in the plant, and (b) Selecting the plant with the delayed phenotype.
  • aging delay refers to a property of prolonged plant life as compared to wild-type plants, and specifically, the yellowing and / or necrosis of leaves and / or stems is delayed compared to wild-type plants or the chlorophyll content of plants is wild-type. It is more characteristic than plants or photosynthetic efficiency of plants is higher than wild type plants.
  • Step (a) may be performed genetically, as for the genetic engineering method, as described with reference to a method for preparing a plant having productivity enhancing characteristics of the present invention.
  • the selected plant is selected using a delayed aging characteristic, which is a characteristic of a gene inserted by developing and growing a transformed plant (measuring the progress of yellowing or necrosis of leaves, chlorophyll content, photosynthetic efficiency, etc.).
  • a delayed aging characteristic which is a characteristic of a gene inserted by developing and growing a transformed plant (measuring the progress of yellowing or necrosis of leaves, chlorophyll content, photosynthetic efficiency, etc.).
  • the present invention relates to a method for increasing productivity of a plant.
  • the method for increasing the productivity of a plant of the present invention includes (a) an expression vector such that a gene having a nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to that of SEQ ID NO: 1 is operably linked to a control sequence capable of overexpressing it And (b) transforming the expression vector into a plant.
  • the present invention relates to a method for increasing stress resistance of a plant.
  • the method of increasing the stress resistance of a plant of the present invention is (a) operably linking a gene having a nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to that of SEQ ID NO: 1 to a regulatory sequence capable of overexpressing it Inserting into the expression vector preferably and (b) transforming the expression vector into a plant.
  • the present invention relates to a method for delaying aging of a plant.
  • the method for delaying aging of a plant of the present invention is to (a) operably link a gene having a nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to that of SEQ ID NO: 1 to a regulatory sequence capable of overexpressing it. Inserting into the expression vector and (b) transforming the expression vector into a plant.
  • Steps (a) and (b) in the above methods are as described with reference to the method for producing a plant having the productivity enhancing properties of the present invention.
  • the present invention is an overexpression of a gene having a nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 obtained by the method for producing a plant having a productivity enhancing feature of the present invention
  • the present invention relates to a transgenic plant having improved productivity.
  • the plant is a transgenic plant having a productivity enhancing property by introducing the gene encoding the ATPG10 protein consisting of the amino acid sequence of SEQ ID NO: 2, in particular the gene ATPG10 having the nucleotide sequence of SEQ ID NO: 1, into the plant and overexpressing it. .
  • the present invention is a stress resistance overexpressed a gene having a nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 obtained by the method for producing a stress resistant plant of the present invention It relates to a transgenic plant having a.
  • the plant is a transgenic plant having a stress resistance by introducing a gene encoding the ATPG10 protein consisting of the amino acid sequence of SEQ ID NO: 2, in particular, the gene ATPG10 having the nucleotide sequence of SEQ ID NO: 1 into the plant and overexpressing it.
  • the present invention is an overexpression of a gene having a nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 obtained by the method for producing a plant having the aging delay characteristics of the present invention
  • the present invention relates to a transgenic plant having delayed aging characteristics.
  • the plant is a transgenic plant having delayed aging characteristics by being introduced into the plant and overexpressing the gene encoding the ATPG10 protein consisting of the amino acid sequence of SEQ ID NO: 2, in particular, the gene having the nucleotide sequence of SEQ ID NO: 1.
  • the "transformed plant” is derived from a plant cell into which the gene is introduced and transformed as well as a plant cell, plant tissue, or plant seed transformed with the gene that is capable of developing and growing into a mature plant. Plant cells, plant tissues or plant seeds.
  • an ATPG10 protein and a gene having a productivity enhancing function and a stress resistance function of a plant and a aging delaying function Since the gene provides a function of increasing productivity and stress resistance and delaying aging of the plant, when the plant is transformed with the gene, the gene may not only increase productivity but also produce a plant having a stress-resistant and aging delaying function of the plant. Can be.
  • Figure 1 shows the structure (schematic) of the pCSEN-ATPG10 recombinant vector in which the ATPG10 gene, which has a function of increasing productivity of plants and has a aging delay and stress resistance function, is introduced in the sense direction.
  • Figure 2 is a photo of the Arabidopsis grown 50 days and 70 days after germination of the Arabidopsis T 2 line transformed with the pCSEN-ATPG10 recombinant vector of FIG.
  • ATPG10 ox-2 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • ATPG10 ox-4 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • ATPG10 ox-6 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • Figure 3 shows the results of analyzing the expression of the ATPG10 gene of Arabidopsis thalass cultivated for 24 days after cotyledon generation of the Arabidopsis T 2 line transformed with the pCSEN-ATPG10 recombinant vector of Figure 1 through qRT-PCR will be.
  • ATPG10 ox-2 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • ATPG10 ox-4 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • ATPG10 ox-6 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • FIG. 4 is a diagram for increasing the productivity of the Arabidopsis line of FIG.
  • ATPG10 ox-2 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • ATPG10 ox-4 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • ATPG10 ox-6 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • FIG. 5 shows drought treatment of Arabidopsis wild-type or control (Con) and variants ATPG10 ox-2, ATPG10 ox-4 , and ATPG10 ox-6 for 12 days after germination , and shows the phenotypic changes of plants occurring during the day. It is an illustration.
  • ATPG10 ox-2 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • ATPG10 ox-4 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • ATPG10 ox-6 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • FIG. 6 shows drought treatment of Arabidopsis wild-type or control (Con) and variants ATPG10 ox-2, ATPG10 ox-4 , and ATPG10 ox-6 for 12 days and 30 days after germination. This figure shows the change in weight.
  • FIG. 7 shows the treatment of H 2 O 2 with detached left lobe 3-4 of Arabidopsis wild-type or control (Con) and variants ATPG10 ox-2, ATPG10 ox-4 , and ATPG10 ox-6 at 25 days after germination. This figure shows a change in the phenotype of a leaf.
  • ATPG10 ox-2 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • ATPG10 ox-4 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • ATPG10 ox-6 Arabidopsis T 2 line transformed with pCSEN-ATPG10 recombinant vector
  • FIG. 8 shows detachment of the left lobe 3-4 of the Arabidopsis wild-type or control group (Con) and variants ATPG10 ox-2, ATPG10 ox-4 , and ATPG10 ox-6 at 25 days after germination, and treated with H 2 O 2 for 6 days.
  • Figure shows changes in chlorophyll content in leaves.
  • FIG. 9 shows the treatment of H 2 O 2 with detached left lobe 3-4 of Arabidopsis wild-type or control group (Con) and variants ATPG10 ox-2, ATPG10 ox-4 , and ATPG10 ox-6 at 25 days after germination.
  • the figure shows the change in photosynthetic efficiency of the leaves in Fv / Fm.
  • FIG. 11 shows from 12 days after cotyledon generation to the 40th every 4 days of the leaf leaf of Arabidopsis wild-type (Con) and variants ATPG10 ox-2, ATPG10 ox-4 , and ATPG10 ox-6 Figure shows the chlorophyll content of leaves.
  • FIG. 13 shows from day 12 after cotyledon generation to rosette leaf 3-4 of the Arabidopsis wild-type (Con) and variants ATPG10 ox-2, ATPG10 ox-4 , and ATPG10 ox-6 every 40 days.
  • Expression of senescence marker genes in the leaves was analyzed by qRT-PCR, and ACT2 was used as a PCR-positive control.
  • CAB2 is a chlorophyll a / b binding protein gene
  • SEN4 and SAG12 are aging genes and aging marker genes.
  • Figure 14 detaches the left lobe of the Arabidopsis wild-type (Con) and variants ATPG10 ox-2, ATPG10 ox-4 , and ATPG10 ox-6 3-4 days after germination to maintain cancer state every 14 days This picture shows the phenotype of the leaf.
  • Figure 15 detaches the left lobe of the Arabidopsis wild-type (Con) and variants ATPG10 ox-2, ATPG10 ox-4 , and ATPG10 ox-6 3-4 days after germination to maintain cancer state every 14 days
  • FIG. 16 detaches the left lobe 3-4 of the Arabidopsis wild-type (Con) and variants ATPG10 ox-2, ATPG10 ox-4 , and ATPG10 ox-6 at 21 days after germination to maintain cancer state every 14 days.
  • the photosynthetic efficiency of leaves in Fv / Fm was investigated.
  • FIG. 17 detaches the left lobe 3-4 of the Arabidopsis wild-type (Con) and variants ATPG10 ox-2, ATPG10 ox-4 , and ATPG10 ox-6 at 21 days after germination to maintain cancer state every 14 days.
  • the expression pattern of the senescence marker gene of the leaves was analyzed by qRT-PCR, and ACT2 was used as a PCR positive control.
  • CAB2, SEN4, and SAG12 are aging marker genes.
  • Arabidopsis cultivars were grown in pots containing soil or Petri dishes containing MS (Murashige and Skoog salts, Sigma, USA) medium containing 2% sucrose (pH 5.7) and 0.8% agar. . When cultivated in a pollen, it was grown in a growth chamber controlled at a light cycle of 16/8 hours at a temperature of 22 ° C.
  • a forward primer (PacI / 5g49700 SOE-), shown as SEQ ID NO: 3 and containing the sequence of restriction enzyme Pac I F, 5'-TTA ATT AA A TGA AAG GTG AAT ACA GAG AGC AA-3 ') and reverse primer (XbaI / At5g49700 SOE-R, 5'-) as shown in SEQ ID NO: 4 and containing the sequence of restriction enzyme Xba I TCT AGA TTA GTA TGG CGG TGG AGC TCT G-3 ').
  • the two primers were used to amplify and isolate full-length cDNA from polymerase chain reaction (PCR) from Arabidopsis cDNA prepared in Example 1-2.
  • the isolated cDNA As a result of the analysis of the isolated cDNA, it has a 831 bp transcriptional translation frame (ORF) encoding 276 amino acids having a molecular weight of about 29.4 kDa, it was confirmed that it consists of one exon, AT- It has a hook domain I was named them as ATPG10 (AT -hook p rotein of G enomine 10).
  • ATPG10 AT -hook p rotein of G enomine 10.
  • the isoelectric point of the ATPG10 protein encoded by the gene was found to be 8.34 (hereinafter, the gene is called " ATPG10 " or " ATPG10 gene” using italics, and the protein is called "ATPG10" or "ATPG10 protein”).
  • a transgenic Arabidopsis in which the ATPG10 gene was introduced in the sense direction was prepared to change the expression of the ATPG10 transcript.
  • ATPG10 cDNA was purified by PCR from Arabidopsis cDNA using a forward primer represented by SEQ ID NO: 3 and containing a sequence of restriction enzyme Pac I and a reverse primer represented by SEQ ID NO: 4 and containing a sequence of restriction enzyme Xba I. Amplified.
  • the DNA was digested with restriction enzymes Pac I and Xba I and cloned in the sense direction into a pCSEN vector designed to be controlled by the SEN1 promoter, an inducible promoter, pCSEN-ATPG10 recombinant vector, which is a sense construct for the ATPG10 gene.
  • the SEN1 promoter has specificity for the gene expressed according to the growth stage of the plant.
  • FIG. 1 is a diagram illustrating a pCSEN-ATPG10 recombinant vector in which an ATPG10 gene is introduced in a sense direction into a pCSEN vector.
  • BAR indicates a phosphinothricin acetyltransferase gene ( BAR gene) that confers resistance to a Vaster herbicide
  • RB is a right border
  • LB is a left border
  • P35S is a CaMV 35S promoter
  • PSEN is the SEN1 promoter
  • Nos-A refers to the polyA of the nopaline synthase gene.
  • the pCSEN-ATPG10 recombinant vector was introduced into Agrobacterium tumefaciens using an electroporation method.
  • the transformed Agrobacterium cultures were incubated at 28 ° C. until the OD600 value was 1.0, and the cells were harvested by centrifugation at 25 ° C. at 5,000 rpm for 10 minutes.
  • Harvested cells were suspended in Infiltration Medium (IM; 1X MS SALTS, 1X B5 vitamin, 5% sucrose, 0.005% Silwet L-77, Lehle Seed, USA) medium until the final OD600 value was 2.0.
  • IM Infiltration Medium
  • the Arabidopsis was placed in a polyethylene bag for 24 hours. Thereafter, the transformed Arabidopsis cultivars continued to grow to harvest seeds (T1).
  • T1 a non-transformed wild type Arabidopsis or a Arabidopsis transformed with only a vector (pCSEN vector) containing no ATPG10 gene was used.
  • Seeds harvested from the transformed Arabidopsis larvae as in ⁇ Example 2-1> were selected by immersing and incubating for 30 minutes in a 0.1% Bassta herbicide (light, South Korea) solution. Thereafter, during the growth of the transformed Arabidopsis, the pollen was treated 5 times with the Basta herbicide, and the transformed Arabidopsis was selected from each pollen.
  • the T1 Arabidopsis transformed with the pCSEN-ATPG10 vector was surprisingly distinct in comparison to their phenotype when compared to the control group ( Acrophobia or wild-type Arabidopsis transformed with a vector without the ATPG10 gene). Increased productivity and delayed aging such as increased size and seed yield.
  • T2 transgenic seeds were received from the T1 transgenic Arabidopsis and the phenotypes of these lines were examined.
  • T2 transformed seeds which had been cold treated (4 ° C.) for 3 days were grown in pots, and then T2 transgenic Arabidopsis was selected through the treatment of Basta herbicide.
  • Phenotyping of selected Arabidopsis T2 transformation lines was performed 50 days and 70 days after germination (FIG. 2).
  • ATPG10 ox-2, ATPG10 ox-4 and ATPG10 ox-6 variant lines with pCSEN-ATPG10 constructs showed a marked increase in plant productivity when compared to Arabidopsis control (Con).
  • ATPG10 ox-4 and ATPG10 ox-6 variant lines showed delayed aging.
  • Variants with increased productivity were similar or slightly smaller in size than the wild type when grown for 50 days after germination, but increased in productivity, such as increased size and seed yield, when grown for 70 days after germination.
  • the delay in aging and the increase in productivity were slightly different for each line. This is because the overexpression of genes is slightly different for each line as shown in FIG. 3.
  • PCR was performed using the primers specific to the following [Table 1] for the ATPG10 gene and the ACT gene used as a PCR positive control.
  • PCR denatured template DNA by heating at 94 ° C. for 2 minutes and then 1 minute at 94 ° C .; 1 minute 30 seconds at 55 ° C; And 1 cycle at 72 °C one cycle was performed a total of 30 times, followed by a final reaction for 15 minutes at 72 °C.
  • the PCR product was confirmed by 1% agarose gel electrophoresis, the results are shown in FIG.
  • the expression of the ATPG10 gene of the ATPG10 ox-2, ATPG10 ox-4 and ATPG10 ox-6 variants was significantly increased. This fact proves that these variants are overexpression of the ATPG10 gene. .
  • ATPG10 ox-2, ATPG10 ox-4, and ATPG10 ox-6 variant lines with high relative expression levels of ATPG10 genes showed higher productivity traits such as individual size and seed yield than the control group. It is interesting to note that the ATPG10 ox-2 variant with low relative gene expression was relatively weaker in delaying aging than the ATPG10 ox-4 and ATPG10 ox-6 variants. Therefore, the expression level control of the present gene is thought to be able to arbitrarily produce plants with phenotypic characteristics for increased productivity and delay aging. In particular, ATPG10 can be used as an excellent gene source for the development of high-productivity crops, as it is easy to produce plants that increase productivity with the same harvesting season as Arabidopsis wild type through the regulation of gene expression.
  • productivity increase index such as seed yield was applied to each of the lines of the variants ATPG10 ox-2, ATPG10 ox-4 and ATPG10 ox-6 to be compared with Arabidopsis control. Compared.
  • the productivity growth indicators applied are plant height, silique number (NTS), biomass (FW), biodry weight (DW), total seed weight (TSW), total seed number (TNS), and 1,000 seeds. Weight (1,000 SW), and the result is the average of 20 objects per line.
  • the ATPG10 ox-2, ATPG10 ox-4 and ATPG10 ox-6 variant lines all showed increased seed production compared to Arabidopsis control, and this increase in seed production was attributed to the long shell length and increased production.
  • the whole variant was found to have no significant variation compared to the control. This fact suggests that the expression of this gene affects the increase in the total weight, not the individual size of the seed, and this trait promotes the formation of fire, leading to an increase in total length and formation, resulting in overall It is thought to cause an increase in seed weight.
  • the overexpressed mutants also had a marked increase in biomass and biomass compared to the control.
  • the ATPG10 ox-4 variant lines have a marked increase in biodrying compared to the ATPG10 ox-2 and ATPG10 ox-6 variant lines.
  • This fact suggests that the relative increase in gene expression is highly effective in increasing biomass such as biomass.
  • the ATPG10 gene causes an increase in crop productivity, such as an increase in seed production and biomass, such as an increase in biomass / biodrying (Fig. 4). It is believed that this is due to a difference in the degree of expression of the star ATPG10 gene. Therefore, the application of this crop to other crops is considered to be of great utility in terms of productivity.
  • Drought tolerance analysis of overexpressed variants of the ATPG10 gene was performed after 12 days of drought treatment for 30-day-old plants, comparing the phenotypic changes of the entire plant with the change in leaf weight per plant. The degree of resistance to drought was confirmed. The results are shown in Figs. 5 and 6, and the values shown are the mean value ⁇ standard deviation of each of six or more lines per line.
  • the overexpression of the ATPG10 gene showed that the greening of the leaves was still progressing during drought treatment, and the weight of the leaves was much higher than that of the wild type.
  • the ATPG10 ox-4 and ATPG10 ox-6 variant lines have a much higher drought stress resistance than the ATPG10 ox-2 variant lines, which is believed to be due to the relative gene expression of these variants. Therefore, the high expression of the ATPG10 gene means that the plant retains maximum moisture retention even under drought stress, thereby inducing resistance to drought stress.
  • Chlorophyll content was measured according to the method of Lichtenthaler and Wellburn ( Biochemical Society Transduction 603: 591 ⁇ 592, 1983) using extinction coefficients of 663.2 nm and 664.8 nm, and the photosynthetic efficiency was measured by Oh et al . ( Plant Mol. Biol). 30: 939 followed in 1996).
  • the fluorescence of chlorophyll was measured using a Plant Efficiency Analyzer (Hansatech), and photosynthetic efficiency was determined using fluorescence characteristics of chlorophyll. It is represented by the photochemical efficiency of PSII (photosystem II), which is expressed as the ratio of maximum variable fluorescence (Fv) to maximum value of fluorescence (Fm) (Fv / Fm). . Higher values indicate better photosynthetic efficiency.
  • the ATPG10 overexpression variant delayed the sulfidation of leaves, and also the decrease in chlorophyll content and photosynthetic efficiency, in particular, the decrease in chlorophyll content, compared to the Arabidopsis wild type (FIGS. 7, 8 and 9).
  • the ATPG10 ox-4 and ATPG10 ox-6 variant lines have significantly higher H 2 O 2 stress resistance compared to the ATPG10 ox-2 variant lines, which are attributed to the relative gene expression of these variants. do. This fact means that ATPG10 provides resistance to oxidative stress in plants.
  • the ATPG10 gene is expected to provide many advantages in the development of stress-producing, productivity-producing crops by providing not only plant productivity but also resistance to drought and oxidative stress.
  • Chlorophyll was extracted from each sample leaf using 80% (V / V) acetone to measure chlorophyll content. Chlorophyll content was measured according to the method of Lichtenthaler and Wellburn (Biochemical Society Transduction 603: 591 ⁇ 592, 1983) using extinction coefficients of 663.2 nm and 664.8 nm. The results are shown in FIG. 11, and the values shown are the mean value ⁇ standard deviation of six or more objects per line.
  • chlorophyll content decreased sharply after 20 days after cotyledon production, and chlorophyll content decreased to the lowest level on day 32, but 32 days after cotyledon production in ATPG10 ox-2, ATPG10 ox-4 and ATPG10 ox-6
  • the chlorophyll content of 60% or more at the beginning of the measurement was shown, and then the chlorophyll content was rapidly decreased.
  • the ATPG10 ox-4 and ATPG10 ox-6 variants showed more pronounced phenotypes for delayed chlorophyll content reduction compared to the ATPG10 ox-2 variants as in the previous phenotypic analysis. And it was found.
  • senescence-associated genes SAGs
  • ATPG10 ox-2, ATPG10 ox-4 and ATPG10 ox-6 variants To compare the expression of senescence-associated genes ( SAGs) in wild species and in ATPG10 ox-2, ATPG10 ox-4 and ATPG10 ox-6 variants, the ATPG10 gene and each aging associated with time during leaf development. Expression patterns of genes were confirmed by qRT-PCR analysis.
  • Quantitative analysis of the ATPG10 gene and marker genes for aging was confirmed by Quantitative real-time PCR (qRT-PCR) using Applied Bio-systems' 7300 Real Time PCR System. Aging marker gene was used as a SAG12, SEN4 and CAB2 genes, as qRT-PCR was used as a positive control ACT2 gene.
  • the primers used are shown in Table 2 below.
  • SEN4 expression known to be while the 32-day expression increased to the maximum in the wild, ATPG10 overexpressing mutant their degree of wild-type it did not show expression increased continuously up or a large increment in the SEN4 during the aging process, SEN4 expression of the mutant It was found to be significantly lower than the degree of expression during aging.
  • the expression patterns of the ATPG10 gene show that the wild type shows little expression during aging, whereas the ATPG10 gene overexpression variants have a significantly higher expression level during the pre-aging process compared to the wild type, and are still wild type despite the decrease in some sections. In comparison with the above, it was shown to maintain a high expression sequence (Fig. 13).
  • the aging delay phenomenon of overexpression variants is induced by overexpression of the ATPG10 gene.
  • the higher the expression level of the gene the stronger the phenotypic characteristics of aging delay.
  • the ATPG10 gene delays the onset of aging at the molecular level and subsequently regulates physiological phenomena such as chlorophyll content and photosynthetic efficiency, resulting in phenotypically prolonged leaf life.
  • Overexpression of the ATPG10 gene provides agricultural traits such as increased plant populations, increased biomass / biodrying , and increased yields, as well as a delay in aging along with resistance to drought or oxidative stress. These transductions depend on the degree of overexpression of the ATPG10 gene. Overexpression at the appropriate level of the ATPG10 gene is more effective in providing agricultural traits such as increased individual size, increased biomass / biodryness, and increased yields. In particular, the regulation of expression at the appropriate level of this gene is

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

본 발명은 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 ATPG10 단백질과 그 유전자 및 이들의 용도를 개시한다. 상기 유전자가 도입되어 과별현된 식물체는 생산성이 증대되는 특성을 가질 뿐만 아니라 스트레스 내성 특성과 노화 지연 특성도 가진다.

Description

식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 ATPG10 단백질과 그 유전자 및 이들의 용도
본 발명은 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 ATPG10 단백질과 그 유전자 및 이들의 용도에 관한 것이다.
식물의 노화(plant senescence)는 식물의 생애 주기(lifecycle) 중 주요한 단계로 여겨지며, 유전적으로 조절된 반응들을 통하여 세포, 조직, 기관 및 개체 수준에서 매우 정교하게 연계되어 진행된다. 노화 과정의 진행은 식물체의 여러 기관에서 다르게 일어날 수 있는데 잎의 경우 엽록체의 분해에 이어서 지질, 단백질, 핵산의 분해가 순차적으로 일어난다. 세포막과 세포 내 구획 등의 세포 구조물은 마지막까지 유지되며 분해된 산물인 질소와 영양분의 재배치가 일어난 후 죽음에 이르게 된다(Lohman et al., Physiologia Plantarum, 1994, 92:322-8.; Smart, New Phytologist, 1994, 126:419-48; Pruzinska et al., Plant Physiology, 2005, 139:52-63). 식물체가 노화를 결정하는 시기는 영양분의 보유상태나 재배치와 연관이 있기 때문에 개화나 종자의 생산은 종종 노화를 촉진하는 요인이 된다. 또한 식물체는 계절적인 변화나 예측하지 못했던 외부 환경 변화에 대한 종 전체의 생존 전략으로도 노화 과정을 진행시킨다.
식물에서 유용물질을 얻기 위하여 재배를 할 경우, 유용물질 생산에 사용 가능한 식물의 양과 시기가 한정적이며 기후 풍토 등의 외부 인자에 의한 영향에 민감하게 반응하여 식물이 노화 및 죽음에 이르는 문제점이 있기 때문에 식물의 노화에 대한 연구는 생물학적인 측면에서 생명 현상의 이해를 위해서뿐만 아니라 생산성, 저장성, 수송성 등의 증진을 통한 경제적 이윤 창출 측면에서도 매우 중요하다.
노화 과정은 여러 유전자의 발현 변화에 따라 진행되는데 광합성과 기초 대사 관련 유전자의 발현은 감소하며 세포사멸, 스트레스 반응 유전자, 가수분해 효소 관련 유전자의 발현은 증가하게 된다(Hopkins et al., New Phytologist, 2007, 175:201-14; Lim et al., Annual Review of Plant Biology, 2007, 58:115-136). 이러한 식물의 노화 관련 유전자(Senescence Associated Genes, SAGs)에 대한 연구는 학문적, 산업적 측면에서의 중요성 때문에 활발히 이루어지고 있다.
아실-가수분해효소 활성(acyl hydrolase activity)을 지니는 SAG101 유전자의 antisense 서열을 식물체에 도입시켜 노화를 지연시키는 기술(He and Gan, Plant Cell, 2002, 14(4):805-15)과 같이 직접적으로 노화 촉진 유전자의 발현을 저해하는 방법이 개발되었으며 노화 진행 시기 동안 노화를 저해하는 유전자를 과발현하는 방법도 개발되었다. 미국 등록특허 제 5689042호에는 SAG12 나 SAG13 유전자의 promoter에 cytokinin 합성 관련 유전자를 결합시켜 노화를 지연시키는 방법이 개시되어 있는데 SAG12 유전자의 promoter에 IPT 유전자를 재조합 할 경우 담배에서 50%의 생산성 증대를 볼 수 있었다. 같은 방법으로 상추에 도입시켰을 때 수확 후 저장성이 크게 증가되는 것을 알 수 있었다(McCabe et al., Plant Physiol. 2001, 127(2):505-16). 또한 SAG12 promoter에 옥수수의 homeobox gene(knotted1)을 발현시킨 담배에서 cytokinin의 level이 증가하고 잎의 노화도 지연되었다는 보고가 있었다(Naomi et al., Plant Cell, 1999, 11:1073-1080).
토마토의 경우 ethylene 합성과정을 저해하여 과일의 숙성을 조절한 사례가 보고되어 있으며(Oeller et al., Science. 1991, 254(5030):437-9) 또한 세포벽 분해와 관련된 polygalacturonase 유전자의 발현을 억제시켜 토마토의 운송성과 저장성을 증가시킨 Flav-O-Savor의 경우가 대표적으로 상업화된 예가 될 수 있다(Giovannoni et al., 1989, Plant Cell 1(1):53-63).
또한 노화 진행시 과발현되는 유전자로서 GmSARK 유전자와 NAC family에 속하는 WRKY53, WRKY6 및 AtNAP 유전자 등이 보고되었으며(Miao et al., Plant Mol. Biol. 2004, 55:853-867; Guo and Gan et al., Plant J. 2006, 46(4):601-12; Li et al., Plant Mol Biol. 2006, 61:829-844; Besseau et al., J Exp Bot 2012, 63(7):2667-79) CBF2, CBF3와 같은 유전자들은 노화를 억제시키는 것으로 알려졌다(Sobieszczuk-Nowicka et al., Physiol Plant 2007;130:590-600). 이들 유전자의 발현 조절은 노화를 지연시켜 결과적으로 작물의 생산성 등의 향상을 가져올 수 있다. 미국등록특허 제8420890호에는 AtNAP 유전자의 발현 억제를 통한 노화의 지연 방법이 개시되어 있는데 최근에는 AtNAP를 과발현시켜 목화 등의 수확을 용이하게 하거나 과실의 빠른 성숙을 돕는데 이용하기 위한 연구도 진행되고 있다(Kou et al., J Exp Bot. 2012, 63(17):6139-47).
최근 담배의 생애 주기에 따른 유전자 발현 조사(Edwards et al., BMC Genomics. 2010, 11:142)를 통하여 Tobacco Expression Atlas (TobEA) 데이터베이스가 확보되었으며 식물의 노화와 생장 조절에 대한 유전자 연구는 더욱 가속화 되고 있다.
본 발명도 작물의 생산성 등의 향상을 가져올 수 있는 노화 지연 등의 기능을 가지는 유전자 등을 개시한다.
본 발명의 목적은 식물의 생산성 증대 기능을 가지고 스트레스 내성 기능을 가지며 노화 지연 기능을 가지는 ATPG10 단백질을 제공하는 데 있다.
본 발명의 다른 목적은 상기 단백질을 암호화하는 유전자를 제공하는 데 있다.
본 발명의 또 다른 목적은 생산량 증대 특성을 갖는 식물체의 제조 방법을 제공하는 데 있다.
본 발명의 또 다른 목적은 스트레스 내성을 갖는 식물체의 제조 방법을 제공하는 데 있다.
본 발명의 또 다른 목적은 노화 지연 특성을 갖는 식물체의 제조 방법을 제공하는 데 있다.
본 발명의 기타의 목적은 이하에서 제시될 것이다.
본 발명은 일 측면에 있어, 식물의 생산성 증대 기능을 가지고 스트레스 내성 기능을 가지며 노화 지연 기능을 가지는 ATPG10 단백질에 관한 것이다.
본 발명자(들)는 하기 실시예에서 확인되는 바와 같이, 애기장대의 Predicted AT-hook DNA-binding family protein (GeneBank accession number NP_199781.1) 염기서열을 기초로 상기 단백질의 유전자를 분리하고 상기 유전자를 애기장대에 형질전환시켜 과발현시켰을 때, 개체의 생체량 증가 및/또는 종자 생산성 증가라는 생산성 증대 특성이 뚜렷하게 나타나고, 가뭄 스트레스 또는 산화적 스트레스에 대한 내성 특성도 뚜렷하게 나타나며 이와 더불어 식물의 노화 지연 현상이 뚜렷하게 나타남을 확인하였다.
이러한 실험 결과는 상기 유전자 및 단백질이 식물의 생산성을 증대시키고 스트레스에 대한 내성을 제공하며, 또한 식물체의 노화를 지연시키는 데 관여한다는 것을 의미한다고 할 수 있다.
본 발명자들은 상기 유전자를 ATPG10 (AT-hook protein of Genomine 10) 유전자 및 ATPG10 단백질로 명명하였으며, 이들 염기 서열 및 아미노산 서열은 각각 서열번호 1 및 2에 개시되어 있다.
본 발명의 ATPG10 단백질은 하기 (a), (b) 및 (c)의 폴리펩티드들 중 하나이다.
(a) 서열번호 2에 기재된 아미노산 서열 전체를 포함하는 폴리펩티드;
(b) 서열번호 2에 기재된 아미노산 서열의 실질적인 부분을 포함하는 폴리펩티드; 및
(c) 상기 (a) 또는 (b)의 폴리펩티드와 실질적으로 유사한 폴리펩티드.
본 명세서에서, "단백질"이라는 용어는 폴리펩티드와 동일한 의미로서 서로 혼용되어 사용되며, "유전자"라는 용어는 폴리뉴클레오티드와 동일한 의미로서 서로 혼용되어 사용된다.
본 명세서에서, "서열번호 2에 기재된 아미노산 서열의 실질적인 부분을 포함하는 폴리펩티드"는 서열번호 2에 기재된 아미노산 서열로 이루어진 폴리펩티드와 비교하였을 때 여전히 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 보유하기에 충분한 정도의 서열번호 2의 아미노산 서열의 일부분을 포함하는 폴리펩티드로서 정의된다. 여전히 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 보유하기에 충분하면 되므로, 상기 폴리펩티드의 길이 그리고 그러한 폴리펩티드가 가지는 활성의 정도는 문제되지는 않는다. 즉 서열번호 2에 기재된 아미노산 서열을 포함하는 폴리펩티드에 비해 활성이 낮더라도, 여전히 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 가지는 폴리펩티드라면 그 길이야 어떻든 상기 "서열번호 2에 기재된 아미노산 서열의 실질적인 부분을 포함하는 폴리펩티드"에 포함된다는 것이다. 당업자라면, 즉 본 출원시를 기준으로 공지된 관련 선행기술을 숙지하고 있는 자라면, 서열번호 2에 기재된 아미노산 서열을 포함하는 폴리펩티드에서 일부분이 결실되더라도 그러한 폴리펩티드는 여전히 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 보유할 것이라고 기대할 것이다. 그러한 폴리펩티드로서 서열번호 2에 기재된 아미노산 서열을 포함하는 폴리펩티드에서 N-말단 부분 또는 C-말단 부분이 결실된 폴리펩티드를 들 수 있다. 그것은 일반적으로 N-말단 부분 또는 C-말단 부분이 결실되더라도 그러한 폴리펩티드는 본래의 폴리펩티드가 가지는 기능을 가진다고 당업계에 공지되어 있기 때문이다. 물론 경우에 따라서는, N-말단 부분 또는 C-말단 부분이 단백질의 기능 유지에 필수적이서 N-말단 부분 또는 C-말단 부분이 결실된 폴리펩티드가 상기 기능을 나타내지 않는 경우가 있을 수 있겠지만, 그럼에도 그러한 비활성의 폴리펩티드를 활성의 폴리펩티드와 구분하고 검출해내는 것은 당업자의 통상의 능력 범위 내에 속한다. 나아가 N-말단 부분 또는 C-말단 부분뿐만 아니라 그 이외의 다른 부분이 결실되더라도 본래의 폴리펩티드가 가지는 기능을 여전히 가질 수 있다. 여기서도 당업자라면 그의 통상의 능력의 범위 내에서 이러한 결실된 폴리펩티드가 여전히 본래의 폴리펩티드가 가지는 기능을 가지는가를 충분히 확인할 수 있을 것이다. 특히 본 명세서가 서열번호 1의 염기서열 및 서열번호 2의 아미노산 서열을 개시하고 있고 나아가 서열번호 1의 염기서열에 의해 암호화되고 서열번호 2의 아미노산 서열로 이루어진 폴리펩티드가 식물의 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 보유하는지를 확인한 실시예를 개시하고 있다는 점에서, 서열번호 2의 아미노산 서열에서 일부 서열이 결실된 폴리펩티드가 서열번호 2의 아미노산 서열을 포함하는 폴리펩티드가 가지는 기능을 여전히 보유할 것인가를 당업자는 그의 통상의 능력 범위 내에서 충분히 확인할 수 있다는 것이 매우 자명해진다. 그러므로 본 발명에 있어서 상기 "서열번호 2에 기재된 아미노산 서열의 실질적인 부분을 포함하는 폴리펩티드"는 상기 정의와 같이 본 명세서의 개시 내용에 기초하여 당업자가 그의 통상의 능력 범위 내에서 제조 가능한 식물의 노화 지연 기능 및 생산성 증대 기능을 가지는 결실된 형태의 모든 폴리펩티드를 포함하는 의미로서 이해되어야 한다.
또한 본 명세서에서, "상기 (a) 및 (b)의 폴리펩티드와 실질적으로 유사한 폴리펩티드"란 하나 이상의 치환된 아미노산을 포함하지만, 서열번호 2의 아미노산 서열을 포함하는 폴리펩티드가 가지는 기능, 즉 식물의 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 보유하는 폴리펩티드를 말한다. 여기서도 하나 이상의 치환된 아미노산을 포함하는 폴리펩티드가 식물의 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 보유하기만 한다면 그러한 폴리펩티드가 가지는 활성의 정도나 아미노산이 치환된 정도는 문제되지 않는다. 바꿔 얘기해서, 하나 이상의 치환된 아미노산을 포함하는 폴리펩티드가 서열번호 2의 아미노산 서열을 포함하는 폴리펩티드에 비해 그 활성이 아무리 낮더라도 또 많은 수의 치환된 아미노산을 포함하고 있다고 하더라도 그러한 폴리펩티드가 식물의 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 보유하기만 한다면 본 발명에 포함된다는 것이다. 하나 이상의 아미노산이 치환되더라도 치환되기 전의 아미노산이 치환된 아미노산과 화학적으로 등가라면, 그러한 치환된 아미노산을 포함하는 폴리펩티드는 여전히 본래의 폴리펩티드의 기능을 보유할 것이다. 예컨대, 소수성 아미노산인 알라닌이 다른 소수성의 아미노산, 예를 들면 글리신, 또는 보다 더 소수성인 아미노산, 예를 들면 발린, 류신 또는 이소류신으로 치환되더라도 그러한 치환된 아미노산(들)을 가지는 폴리펩티드는 활성은 낮더라도 본래의 폴리펩티드가 가지는 기능을 여전히 보유할 것이다. 마찬가지로, 음으로 하전된 아미노산 예컨대, 글루탐산이 다른 음으로 하전된 아미노산, 예컨대 아스파르산으로 치환되더라도 그러한 치환된 아미노산(들)을 가지는 폴리펩티드도 활성은 낮더라도 본래의 폴리펩티드가 가지는 기능을 여전히 보유할 것이며, 또한 양으로 하전된 아미노산, 예컨대 아르기닌이 다른 양으로 하전된 아미노산, 예컨대, 리신으로 치환되더라도 그러한 치환된 아미노산(들)을 가지는 폴리펩티드 또한 활성은 낮더라도 본래의 폴리펩티드가 가지는 기능을 여전히 보유할 것이다. 또한 폴리펩티드의 N-말단 또는 C-말단 부분에서 치환된 아미노산(들)을 포함하는 폴리펩티드도 본래의 폴리펩티드가 가지는 기능을 여전히 보유할 것이다. 당업자라면, 그 전술한 바의 하나 이상의 치환된 아미노산을 포함하면서도, 서열번호 2의 아미노산 서열을 포함하는 폴리펩티드가 가지는 식물의 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 여전히 보유하는 폴리펩티드를 제조할 수 있다. 또한 당업자라면 하나 이상의 치환된 아미노산을 포함하는 폴리펩티드가 여전히 위 기능을 가지는가를 확인할 수 있다. 더구나 본 명세서가 서열번호 1의 염기서열 및 서열번호 2의 아미노산 서열을 개시하고 있고 또한 서열번호 2의 아미노산 서열을 포함하는 폴리펩티드가 식물의 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 지님을 확인한 실시예를 개시하고 있기 때문에, 본 발명의 "상기 (a) 및 (b)의 폴리펩티드와 실질적으로 유사한 폴리펩티드"는 당업자에게 용이하게 실시 가능한 것임이 분명하다. 그러므로 "상기 (a) 또는 (b)의 폴리펩티드와 실질적으로 유사한 폴리펩티드"는 하나 이상의 치환된 아미노산을 포함하면서도 여전히 식물의 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 가지는 모든 폴리펩티드를 포함하는 의미로서 이해되어야 한다. 이처럼 "상기 (a) 또는 (b)의 폴리펩티드와 실질적으로 유사한 폴리펩티드"는 하나 이상의 치환된 아미노산을 포함하면서도 여전히 식물의 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 가지는 모든 폴리펩티드를 포함하는 의미이지만, 그럼에도 활성의 정도라는 관점에서 봤을 때, 상기 폴리펩티드는 서열번호 2의 아미노산 서열과 서열 상동성이 높을수록 바람직하다. 상기 폴리펩티드는 서열 상동성의 하한에 있어서 60% 이상의 서열 상동성을 지니는 것이 바람직한 반면, 서열 상동성의 상한에 있어서는 당연히 100%의 서열 상동성을 지니는 것이 바람직하다. 보다 더 구체적으로 위 서열 상동성은 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%의 순서대로 높아질수록 바람직하다. 그리고 본 발명의 "상기 (a) 및 (b)의 폴리펩티드와 실질적으로 유사한 폴리펩티드"는 "서열번호 2의 아미노산 서열 전체를 포함하는 폴리펩티드에 실질적으로 유사한 폴리펩티드" 뿐만 아니라 '서열번호 2의 아미노산 서열의 실질적인 부분을 포함하는 폴리펩티드에 실질적으로 유사한 폴리펩티드'를 포함하므로 전술한 바의 모든 설명은 "서열번호 2의 아미노산 서열 전체를 포함하는 폴리펩티드에 실질적으로 유사한 폴리펩티드"에 대해서 뿐만 아니라 "서열번호 2의 아미노산 서열의 실질적인 부분을 포함하는 폴리펩티드에 실질적으로 유사한 폴리펩티드"에 대해서도 적용되어진다.
본 발명은 다른 측면에 있어서, 전술한 바의 폴리펩티드를 암호화하는 단리된 폴리뉴클레오티드에 대한 것이다. 여기서 "전술한 바의 폴리펩티드"란 식물의 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 지니면서 서열번호 2에 기재된 아미노산 서열 전체를 포함하는 폴리펩티드, 서열번호 2에 기재된 아미노산 서열의 실질적인 부분을 포함하는 폴리펩티드, 및 위 폴리펩티드들과 실질적으로 유사한 폴리펩티드를 포함할 뿐만 아니라, 전술한 바의 바람직한 양태의 모든 폴리펩티드들을 포함하는 의미이다. 그러므로 본 발명의 폴리뉴클레오티드는 식물의 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 지니면서, 서열번호 2에 기재된 아미노산 서열 전체 또는 그 실질적인 부분을 포함하는 폴리펩티드를 암호화하는 단리된 폴리뉴클레오티드 및 이러한 폴리펩티드들에 실질적으로 유사한 폴리펩티드를 암호화는 단리된 폴리뉴클레오티드를 포함하며, 나아가 바람직한 양태로서 식물의 생산성 증대 및 스트레스 내성 기능, 그리고 식물 노화 지연 기능을 지니면서 전술한 바의 서열 상동성의 순서대로 그 서열 상동성을 지니는 모든 폴리펩티드를 암호화하는 단리된 폴리뉴클레오티드를 포함한다. 아미노산 서열이 밝혀졌을 때, 그러한 아미노산 서열에 기초하여 그러한 아미노산 서열을 암호화하는 폴리뉴클레오티드를 당업자라면 용이하게 제조할 수 있다.
한편 본 명세서에서 상기 "단리된 폴리뉴클레오티드"는 화학적으로 합성된 폴리뉴클레오티드, 생물체 특히 애기장대(Arabidopsis thaliana)에서 분리된 폴리뉴클레오티드 및 변형된 뉴클레오티드를 함유한 폴리뉴클레오티드를 모두 포함하며, 단일 가닥 또는 이중 가닥의 RNA 또는 DNA의 중합체를 모두 포함하는 것으로서 정의된다.
본 발명은 또 다른 측면에 있어, 생산성 증대 특성을 갖는 식물체의 제조 방법에 관한 것이다.
본 발명의 생산성 증대 특성을 갖는 식물체의 제조 방법은 (a) 식물체에서 서열번호 1의 염기서열을 갖는 유전자 또는 서열번호 1의 염기서열과 유사한 서열을 갖는 유전자를 과발현시키는 단계 및 (b) 생산성 증대 특성을 갖는 식물체를 선별하는 단계를 포함하여 구성된다.
본 명세서에서, "생산성 증대 특성"이란 식물체의 전체, 줄기, 뿌리 및/또는 잎의 생체량(biomass; 크기 및/또는 질량)이 야생형 식물체에 비하여 증가한 특성 및/또는 식물체의 종자의 생산성(식물 1개체 당 종자의 수 및/또는 질량)이 야생형 식물체에 비하여 증가한 특성을 말한다.
또한 본 명세서에서, "식물체"란 성숙한 식물, 미성숙 식물(유식물체), 식물 종자, 식물 세포, 식물 조직 등을 포함하는 의미이다. 식물 세포나 식물 조직이 형질전환에 사용될 경우에 형질전환된 식물 세포나 식물 조직은 유럽특허 EP0116718, 유럽특허 EP0270822, 국제특허 WO 84/02913, 문헌[Gould et al. 1991, Plant Physiol 95,426-434] 등에 개시된 방법을 사용하여 성숙한 식물체로 발육·생장시킬 수 있다.
또한 본 명세서에서, "식물"이란 생산성 증대 특성 등이 인간에게 유용한 결과를 줄 수 있는 모든 식물을 포함한다. 따라서 상기 식물의 의미에는 작물(구체적으로 식용작물, 사료작물, 공예작물 등의 농작물과 원예작물을 포함함), 임목, 관상식물을 포함된다. 구체적으로는 벼, 밀, 보리, 옥수수, 콩, 감자, 팥, 귀리, 수수, 십자화과 채소(배추, 청경채, 케일, 콜리플라워, 브로콜리, 열무(young radish), 무, 갓 등), 고추, 딸기, 토마토, 수박, 오이, 양배추, 참외, 호박, 파, 양파, 당근, 인삼, 담배, 목화, 참깨, 사탕수수, 사탕무우, 들깨, 땅콩, 유채, 사과나무, 배나무, 대추나무, 복숭아, 양다래, 포도, 감귤, 감, 자두, 살구, 바나나 등이 포함될 것이고, 또한 스위치그라스, 억새, 갈대 등과 같은 바이오에너지 작물과 기타 라이그라스, 레드클로버, 오차드그라스, 알파알파, 톨페스큐, 페레니얼라이그라스, 장미, 글라디올러스, 거베라, 카네이션, 국화, 백합, 튤립 등이 포함될 것이다.
또한 본 명세서에서 "서열번호 1의 염기서열과 유사한 서열로 이루어진 유전자"란 첫째 서열번호 2의 아미노산을 암호화하면서도 코돈의 축퇴성(codon degeneracy)으로 인하여 서열번호 1의 유전자와 다른 염기서열을 갖는 유전자와, 서열번호 1의 염기서열로 이루어진 유전자의 동족체(homologue)로서 식물의 생산성 증대 특성 등을 지니면서 식물의 종류에 따른 진화적 경로의 상이로 인하여 서열번호 1의 염기서열과 다른 염기서열로 이루어진 모든 유전자를 포함하는 의미이다. 여기서 서열번호 1의 염기서열과 유사한 서열로 이루어진 유전자는 서열번호 1의 염기서열과 서열 상동성이 높을수록 바람직하고, 가장 바람직하게는 당연히 100%의 서열 상동성을 지닐 때이다. 한편, 서열 상동성의 하한에 있어서는 상기 유전자가 서열번호 1의 염기서열과 60% 이상의 서열 상동성을 지니는 경우가 바람직할 것이다. 보다 더 구체적으로는 위 서열 상동성이 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 및 99%의 순서대로 높아질수록 바람직하다.
또한 본 명세서에서, "과발현"이란 야생형 식물체에서 발현되는 수준 이상의 발현을 의미한다. 이러한 "과발현"여부는 상기 서열번호 1의 유전자나 서열번호 1의 염기서열과 유사한 서열로 이루어진 유전자(예컨대 cDNA)를 정량하여 직접적으로 결정하거나 그 유전자가 암호화하는 단백질을 정량하여 간접적으로 정량할 수 있다. 또한 그 유전자의 특성에 따라 나타난 표현형을 통해서도 확인할 수 있다.
본 발명의 생산성 증대 특성을 갖는 식물체의 제조 방법에 있어서, 상기 단계 (a)는 유전공학적 방법으로 수행될 수 있다.
유전공학적인 방법은 (i) 상기 서열번호 1의 유전자 또는 서열번호 1의 염기서열과 유사한 서열을 갖는 유전자를 그것을 과발현시킬 수 있는 조절 서열에 작동 가능하게 연결되도록 발현벡터에 삽입시키는 단계, 및 (ii) 그 발현벡터를 식물체에 형질전환하는 단계를 포함하여 구성된다.
본 명세서에서, "작동 가능하게"란 어떤 유전자의 전사 및/또는 번역이 영향을 받도록 연결된다는 의미이다. 예컨대 어떠한 프로모터가 그것에 연결된 어떤 유전자의 전사에 영향을 준다면 그 프로모터와 그 유전자는 작동 가능하게 연결된 것이다.
또 본 명세서에서, "조절 서열"이란 그것의 존재가 그것에 연결된 유전자의 전사 및/또는 번역에 영향을 미칠 수 있는 모든 서열을 포함하는 의미이며, 이러한 조절 서열에는 프로모터 서열, 전사종결 서열(polyadenylation signal), 복제 개시점을 포함한다.
또한 본 명세서에서, "프로모터"는 당업계에 알려진 통상의 의미를 따르는데, 구체적으로는 어떤 유전자의 전사 개시점을 기준으로 상위(5'쪽)에 위치하고, DNA-의존 RNA 중합효소에 대한 결합 부위, 전사 개시점, 전사 인자 결합 부위 등을 포함하는, 하나 이상의 유전자의 전사를 제어하는 기능을 갖는 핵산 서열을 의미한다. 이러한 프로모터는 그것이 진핵생물 유래일 경우 전사 개시점 상위에 있는 TATA 박스(통상 전사 개시점(+1) -20 내지 -30 위치에 존재), CAAT 박스(통상 전사 개시 부위와 비교하여 대략 -75 위치에 존재), 5'인핸서, 전사 억제 인자 등을 포함한다.
사용 가능한 프로모터는 그것에 연결된 서열번호 1의 유전자를 과발현시킬 수 있는 프로모터라면 구성적 프로모터(모든 식물체 조직에서 상시적으로 발현을 유도하는 프로모터), 유도성 프로모터(특정 외부 자극에 반응하여 목적 유전자의 발현을 유도하는 프로모터 또는 특정 발달 시기나 특정 조직에서 특이적으로 발현을 유도하는 프로모터) 모두 사용될 수 있다. 사용 가능한 구성적 프로모터의 대표적인 예로는 콜리플라워 모자이크 바이러스(CaMV: cauliflower mosaic virus)의 35S RNA 유전자의 프로모터를 들 수 있고, 그 밖에 유비퀴틴(ubiquitin) 계열의 프로모터(Christensen et al., 1992, Plant Mol. Biol. 18, 675-689; EP0342926; Cornejo et al., 1993, Plant Mol. Biol. 23, 567-581), 벼 액틴 프로모터(Zhang et al. 1991, The Plant Cell 3, 1155-1165) 등을 들 수 있다. 사용 가능한 유도성 프로모터의 예로는 구리 이온에 의해 활성화되는 효모 메탈로티오네인 프로모터(Mett 등, Proc. Natl. Acad. Sci., U.S.A., 90:4567, 1993), 치환 벤젠설폰아미드에 의해 활성화되는 In2-1 및 In2-2 프로모터(Hershey 등, Plant Mol. Biol., 17:679, 1991), 글루코코르티코이드에 의해 조절되는 GRE 조절 서열(Schena 등, Proc. Natl. Acad. Sci., U.S.A., 88:10421, 1991), 에탄올 조절성 프로모터(Caddick 등, Nature Biotech., 16:177, 1998), 리뷸로스 비스-포스페이트 카르복실라제(ssRUBISCO)의 소 서브유니트에서 유래한 광 조절성 프로모터(Coruzzi 등, EMBO J., 3:1671, 1984; Broglie 등, Science, 224:838, 1984), 만노핀 신타제 프로모터(Velten 등, EMBO J., 3:2723, 1984), 노팔린 신타제(NOS) 프로모터, 옥토핀 신타제(OCS) 프로모터, 열 충격 프로모터(Gurley 등, Mol. Cell. Biol., 6:559, 1986; Severin 등, Plant Mol. Biol., 15:827, 1990) 벼 글루테린(glutelin) 프로모터, 콩 유래 렉틴(lectin) 프로모터, 배추 유래 나핀(napin) 프로모터 등을 들 수 있다.
전사 종결 서열은 poly(A) 첨가 신호(polyadenylation signal)로 작용하는 서열로서 전사의 완결성 및 효율성을 높이기 위한 것이다. 사용될 수 있는 전사 종결 서열의 예로는 노팔린 신타아제(NOS) 유전자의 전사 종결 서열, 벼 α-아밀라아제 RAmy1 A 유전자의 전사 종결 서열, 아그로박테리움 투메파시엔스의 옥토파인(Octopine) 유전자의 전사 종결 서열, 밀 열 쇼크 단백질 17의 전사 종결 서열, 밀 유비퀴틴 유전자의 전사 종결 서열, 벼 글루테린 유전자의 전사 종결 서열, 벼 락테이트 디하이드로게나제 유전자의 전사 종결 서열 등을 들 수 있다.
상기 발현벡터는 선별 마커 유전자를 포함할 수 있다. 여기서 "마커 유전자"란 그러한 마커 유전자를 포함하는 식물체의 선별을 가능하게 하는 형질을 암호화하는 유전자를 의미한다. 마커 유전자는 항생물질 내성 유전자일 수 있고 제초제 내성 유전자일 수도 있다. 적합한 선별 마커유전자의 예로는 아데노신 데아미나제의 유전자, 디히드로폴레이트 리덕타제의 유전자, 하이그로마이신-B-포스포트랜스퍼라제의 유전자, 티미딘 키나제의 유전자, 크산틴-구아닌 포스포리보실트랜스퍼라제의 유전자, 포스핀노트리신 아세틸트랜스퍼라제 유전자, 바스타 제초제 저항성 bar 유전자 등을 들 수 있다.
본 명세서에서, 상기 "형질전환"이란 왜래 유전자가 도입됨에 의한 숙주 식물체의 유전자형의 변형을 의미하며, 그 형질전환에 사용된 방법과 상관없이 그 왜래 유전자가 숙주 식물체, 더 정확하게는 숙주 식물의 세포 내로 도입되어 세포의 게놈에 통합된 것을 의미한다. 여기서 왜래 유전자에는 동종성 유전자와 이종성 유전자가 포함되는데, "동종성 유전자"란 숙주 유기체 또는 그와 동일한 생물종의 내인성 유전자를 의미하며, "이종성 유전자"란 그것이 형질전환되는 유기체에서는 존재하지 않는 유전자를 말한다. 예컨대 애기장대 유래 유전자는 애기장대 식물에게는 동종성 유전자이지만 토마토 식물에서는 이종성 유전자가 된다.
한편, 외래성 유전자로 식물을 형질전환시키는 방법은 당업계에 공지된 방법을 사용할 수 있는데, 예컨대 유전자 총을 사용한 직접적인 유전자 전달 방법, 프로랄 딥(floral dip)을 이용한 in planta 형질전환 방법, 화분 매개 형질전환 방법, 원형질체의 형질전환 방법, 바이러스 매개 형질전환 방법, 리포좀 매개 형질전환 방법 등을 사용할 수 있다. 또한 특정 식물체에 적합한 형질전환 방법을 선택하여 사용할 수도 있는데, 예컨대 옥수수를 형질전환시키는 방법은 미국특허 US 6,140,553, 문헌(Fromm et al, 1990, Bio/Technology 8, 833-839), 문헌(Gordon-Kamm et al, 1990, The Plant Cell 2, 603-618) 등에 개시된 방법을 사용할 수 있으며, 벼를 형질전환시키기 위한 방법은 문헌(Shimamoto et al, 1989, Nature 338, 274-276), 문헌(Datta et al 1990, Bio/Technology 8, 736-740), 국제특허 WO 92/09696, 국제특허 WO 94/00977, 국제특허 WO 95/06722 등에 개시된 방법을 사용할 수 있다. 또 토마토나 담배 형질전환에 있어서는 문헌(An G. et al., 1986, Plant Physiol. 81: 301-305), 문헌 (Horsch R.B. et al, 1988, In: Plant Molecular Biology Manual A5, Dordrecht, Netherlands, Kluwer Academic Publishers, pp 1-9), 문헌(Koornneef M. et al, 1986, In: Nevins DJ. and R.A. Jones, eds. Tomato Biotechnology, New York, NY, USA, Alan R. Liss, Inc. pp 169-178) 등에 개시된 방법을 사용할 수 있다.
일반적으로 식물을 형질전환시킴에 있어 많이 사용되는 것이, 형질전환된 아그로박테리움으로 유식물체, 식물 종자 등을 감염시키는 방법이다.
이러한 아그로박테리움이 매개된 형질전환 방법은 당업계에 잘 공지되어 있으며(Chilton 등, 1977, Cell 11:263:271; 유럽특허 EP 0116718; 미국특허 US 4,940,838), 특정 식물체에 적합한 방법도 당업계에 공지되어 있다. 예컨대 목화에 대해서는 미국특허 US 5,159,135, 콩에 대해서는 미국특허 US 5,824,877, 옥수수에 대해서는 미국특허 US 5,591,616 등을 참조할 수 있다. 아그로박테리움 매개 형질전환 방법은 Ti-플라스미드를 이용하는데, 이 플라스미드에는 T-DNA를 식물 세포의 게놈으로 통합시킬 수 있는 좌우 경계(border) 서열이 포함될 것이다.
한편, 상기 (b) 선별 단계는 형질전환된 식물체를 발육·성장시켜 삽입된 유전자의 특성을 통해 선별하거나, 형질전환 시에 선별 마커 유전자가 함께 형질전환될 경우에는 선별 마커 유전자를 이용하여 선별할 수 있다. 삽입된 유전자의 특성으로서는 식물체의 생체량 및/또는 종자의 생산성을 들 수 있다.
또 다른 측면에 있어서, 본 발명의 스트레스 내성 특성을 갖는 식물체의 제조 방법에 관한 것이다.
본 발명의 스트레스 내성을 갖는 식물체의 제조 방법은 (a) 식물체에서 서열번호 1의 염기서열을 갖는 유전자 또는 서열번호 1의 염기서열과 유사한 서열을 갖는 유전자를 과발현시키는 단계 및 (b) 스트레스 내성을 갖는 식물체를 선별하는 단계를 포함하여 구성된다.
본 발명의 스트레스 내성을 갖는 식물체의 제조 방법은 (a) 식물체에서 서열번호 1의 염기서열을 갖는 유전자 또는 서열번호 1의 염기서열과 유사한 서열을 갖는 유전자를 과발현시키는 단계 및 (b) 스트레스 내성 표현형을 갖는 식물체를 선별하는 단계를 포함하여 구성된다.
본 명세서에서, "스트레스"는 가뭄 스트레스 및/또는 산화적 스트레스를 의미한다.
상기 (a) 단계는 유전공학적으로 수행될 수 있는데, 이러한 유전공학적 방법에 대해서는 상기 본 발명의 생산성 증대 특성을 갖는 식물체의 제조 방법과 관련하여 설명한 바와 같다.
상기 (b) 단계는 삽입된 유전자의 특성인 식물체의 스트레스 내성을 비교하여 선별하거나(예컨대 잎의 황화 현상이나 괴사 현상의 진행 정도, 엽록소 함량, 광합성 효율 등을 이용하여 선별하는 방법임) 형질전환 시에 선별 마커 유전자가 함께 형질전환될 경우에는 선별 마커 유전자를 이용하여 선별할 수 있으며, 또는 이들의 방법을 혼합하여 선별할 수도 있다.
또 다른 측면에 있어서, 본 발명은 노화 지연 특성을 갖는 식물체의 제조 방법에 관한 것이다.
본 발명의 노화 지연 특성을 갖는 식물체의 제조 방법은 (a) 식물체에서 서열번호 1의 염기서열을 갖는 유전자 또는 서열번호 1의 염기서열과 유사한 서열을 갖는 유전자를 과발현시키는 단계 및 (b) 노화가 지연된 표현형을 갖는 식물체를 선별하는 단계를 포함하여 구성된다.
본 명세서에서, "노화 지연"이란 야생형 식물체에 비하여 식물 수명이 연장된 특성을 말하며, 구체적으로는 잎 및/또는 줄기의 황화 현상 및/또는 괴사 현상이 야생형 식물체 비하여 지연되거나 식물체의 엽록소 함량이 야생형 식물체에 비하여 많거나 식물체의 광합성 효율이 야생형 식물체 비하여 높은 특성 말한다.
상기 (a) 단계는 유전공학적으로 수행될 수 있는데, 이러한 유전공학적 방법에 대해서는 본 발명의 생산성 증대 특성을 갖는 식물체의 제조 방법과 관련하여 설명한 바와 같다.
상기 (b) 선별 단계는 형질전환된 식물체를 발육·성장시켜 삽입된 유전자의 특성인 노화 지연 특성을 이용하여 선별하거나(잎의 황화 현상이나 괴사 현상의 진행 정도, 엽록소 함량, 광합성 효율 등을 측정하는 방법, 상기 방법들을 혼합한 방법 등을 통해 선별하는 방법임), 형질전환 시에 선별 마커 유전자가 함께 형질전환될 경우에는 선별 마커 유전자를 이용하여 선별할 수 있다.
또 다른 측면에 있어서, 본 발명은 식물체의 생산성 증대 방법에 관한 것이다.
본 발명의 식물체의 생산성 증대 방법은 (a) 서열번호 1의 염기서열을 갖는 유전자 또는 서열번호 1의 염기서열과 유사한 서열을 갖는 유전자를 그것을 과발현시킬 수 있는 조절 서열에 작동 가능하게 연결되도록 발현벡터에 삽입시키고 (b) 그 발현벡터를 식물체에 형질전환하는 단계를 포함한다.
또 다른 측면에 있어서, 본 발명은 식물체의 스트레스 내성을 증가시키는 방법에 관한 것이다.
본 발명의 식물체의 스트레스 내성을 증가시키는 방법은 (a) 서열번호 1의 염기서열을 갖는 유전자 또는 서열번호 1의 염기서열과 유사한 서열을 갖는 유전자를 그것을 과발현시킬 수 있는 조절 서열에 작동 가능하게 연결되도록 발현벡터에 삽입시키고 (b) 그 발현벡터를 식물체에 형질전환하는 단계를 포함한다.
또 다른 측면에 있어서, 본 발명은 식물체의 노화를 지연시키는 방법에 관한 것이다.
본 발명의 식물체의 노화를 지연시키는 방법은 (a) 서열번호 1의 염기서열을 갖는 유전자 또는 서열번호 1의 염기서열과 유사한 서열을 갖는 유전자를 그것을 과발현시킬 수 있는 조절 서열에 작동 가능하게 연결되도록 발현벡터에 삽입시키고 (b) 그 발현벡터를 식물체에 형질전환하는 단계를 포함한다.
상기 방법들에서 상기 (a) 및 (b) 단계는 상기 본 발명의 생산성 증대 특성을 갖는 식물체의 제조 방법과 관련하여 설명한 바와 같다.
또 다른 측면에 있어서, 본 발명은 상기 본 발명의 생산성 증대 특성을 갖는 식물체의 제조 방법에 의하여 얻어진, 서열번호 1의 염기서열을 갖는 유전자 또는 서열번호 1의 염기서열과 유사한 서열을 갖는 유전자가 과발현된 생산성 증대 특성을 갖는 형질전환 식물체에 관한 것이다.
바람직한 측면에 있어서, 상기 식물체는 서열번호 2의 아미노산 서열로 이루어진 ATPG10 단백질을 암호화하는 유전자, 특히 서열번호 1의 염기서열을 갖는 유전자 ATPG10이 식물체로 도입되어 과발현됨으로써 생산성 증대 특성을 갖는 형질전환 식물체이다.
또 다른 측면에 있어서, 본 발명은 상기 본 발명의 스트레스 내성 식물체의 제조 방법에 의하여 얻어진, 서열번호 1의 염기서열을 갖는 유전자 또는 서열번호 1의 염기서열과 유사한 서열을 갖는 유전자가 과발현된 스트레스 내성을 갖는 형질전환 식물체에 관한 것이다.
바람직한 측면에 있어서, 상기 식물체는 서열번호 2의 아미노산 서열로 이루어진 ATPG10 단백질을 암호화하는 유전자, 특히 서열번호 1의 염기서열을 갖는 유전자 ATPG10이 식물체로 도입되어 과발현됨으로써 스트레스 내성을 갖는 형질전환 식물체이다.
또 다른 측면에 있어서, 본 발명은 상기 본 발명의 노화 지연 특성을 갖는 식물체의 제조 방법에 의하여 얻어진, 서열번호 1의 염기서열을 갖는 유전자 또는 서열번호 1의 염기서열과 유사한 서열을 갖는 유전자가 과발현된 노화 지연 특성을 갖는 형질전환 식물체에 관한 것이다.
바람직한 측면에 있어서, 상기 식물체는 서열번호 2의 아미노산 서열로 이루어진 ATPG10 단백질을 암호화하는 유전자, 특히 서열번호 1의 염기서열을 갖는 유전자로 식물체로 도입되어 과발현됨으로써 노화 지연 특성을 갖는 형질전환 식물체이다.
본 명세서에서, 상기 "형질전환 식물체"는 성숙한 식물로 발육·성장할 수 있는 상기 유전자가 도입되어 형질전환된 식물 세포, 식물 조직, 또는 식물 종자뿐만 아니라 상기 유전자가 도입되어 형질전환된 식물로부터 유래한 식물 세포, 식물 조직 또는 식물 종자를 포함한다.
전술한 바와 같이, 본 발명에 따르면 식물의 생산성 증대 기능과 스트레스 내성 기능을 가지고 또한 노화 지연 기능을 가지는 ATPG10 단백질과 그 유전자를 제공할 수 있다. 상기 유전자는 식물의 생산성 증대 기능 및 스트레스 내성 기능과 노화 지연 기능을 제공하므로, 이 유전자로 식물체를 형질전환시킬 경우, 생산성을 증가시킬 뿐만 아니라 식물의 스트레스 내성 기능과 노화 지연 기능을 가지는 식물체를 제작할 수 있다.
도 1은 식물의 생산성 증대 기능을 가지고 또한 노화 지연과 스트레스 내성 기능을 가지는 ATPG10 유전자가 센스 방향으로 도입된 pCSEN-ATPG10 재조합 벡터의 구조(모식도)를 나타낸 것이다.
도 2는 상기 도 1의 pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대의 T2 라인을 발아 후 50일과 70일 동안 생육시킨 애기장대의 사진이다.
Con: 애기장대 야생형 혹은 대조구
ATPG10 ox-2: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
ATPG10 ox-4: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
ATPG10 ox-6: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
도 3은 상기 도 1의 pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대의 T2 라인을 자엽 생성 후 24일 동안 생육시킨 애기장대의 ATPG10 유전자의 발현 양상을 qRT-PCR을 통하여 분석한 결과를 나타낸 것이다.
Con: 애기장대 야생형
ATPG10 ox-2: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
ATPG10 ox-4: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
ATPG10 ox-6: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
도 4는 상기 도 3의 애기장대 라인의 생산성 증대에 대한 그림이다.
Con: 애기장대 야생형
ATPG10 ox-2: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
ATPG10 ox-4: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
ATPG10 ox-6: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
Height: 키, NTS: 장각과 수, FW: 생체량, DW: 생체 건량, TSW: 총 종자 무게, TNS: 총 종자 수, 1,000SW: 1,000개의 종자 무게
도 5는 발아 후 30일째 애기장대 야생형 혹은 대조구(Con)와 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6을 12일 동안 가뭄을 처리하고, 그 동안에 일어난 식물의 표현형적 변화를 도시한 그림이다.
Col: 애기장대 야생형
Con: 애기장대 대조구
ATPG10 ox-2: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
ATPG10 ox-4: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
ATPG10 ox-6: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
도 6은 발아 후 30일째 애기장대 야생형 혹은 대조구(Con)와 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6을 12일 동안 가뭄을 처리하고, 6일과 12일 동안에 일어난 식물 잎의 무게 변화를 도시한 그림이다.
도 7은 발아 후 25일째 애기장대 야생형 혹은 대조구(Con)와 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6의 3-4번 좌엽을 detach하여 6일간 H2O2를 처리한 잎의 표현형 변화를 도시한 그림이다.
Col: 애기장대 야생형
Con: 애기장대 대조구
ATPG10 ox-2: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
ATPG10 ox-4: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
ATPG10 ox-6: pCSEN-ATPG10 재조합 벡터로 형질전환된 애기장대 T2 라인
도 8은 발아 후 25일째 애기장대 야생형 혹은 대조구(Con)와 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6의 3-4번 좌엽을 detach하여 6일간 H2O2를 처리한 잎의 엽록소 함량 변화를 도시한 그림이다.
도 9는 발아 후 25일째 애기장대 야생형 혹은 대조구(Con)와 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6의 3-4번 좌엽을 detach하여 6일간 H2O2를 처리한 잎의 광합성 효율 변화를 Fv/Fm로 도시한 그림이다.
도 10은 자엽 생성 후 12일부터 애기장대 야생형(Con)과 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6의 3-4번 좌엽(rosette leaf)을 매 4일마다 40일까지 잎의 표현형을 관찰한 그림이다.
도 11은 자엽 생성 후 12일부터 애기장대 야생형(Con)과 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6의 3-4번 좌엽(rosette leaf)을 매 4일마다 40일까지 잎의 엽록소 함량을 조사한 그림이다.
도 12는 자엽 생성 후 12일부터 애기장대 야생형(Con)과 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6의 3-4번 좌엽(rosette leaf)을 매 4일마다 40일까지 잎의 광합성 효율을 Fv/Fm로 조사한 그림이다.
도 13은 자엽 생성 후 12일부터 애기장대 야생형(Con)과 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6의 3-4번 좌엽(rosette leaf)을 매 4일마다 40일까지 잎의 노화 마커 유전자의 발현 양상을 qRT-PCR을 통하여 분석한 결과를 나타낸 것이며, ACT2를 PCR 양성 대조구로 사용하였다. CAB2은 엽록소 a/b 결합 단백질 유전자이고, SEN4 및 SAG12는 노화 유전자로서, 노화 마커 유전자들이다.
도 14는 발아 후 21일째 애기장대 야생형(Con)과 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6의 3-4번 좌엽을 detach하여 암상태를 유지하여 매 2일마다 14일까지 잎의 표현형을 관찰한 그림이다.
도 15는 발아 후 21일째 애기장대 야생형(Con)과 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6의 3-4번 좌엽을 detach하여 암상태를 유지하여 매 2일마다 14일까지 잎의 엽록소 함량을 조사한 그림이다.
도 16는 발아 후 21일째 애기장대 야생형(Con)과 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6의 3-4번 좌엽을 detach하여 암상태를 유지하여 매 2일마다 14일까지 잎의 광합성 효율을 Fv/Fm로 조사한 그림이다.
도 17은 발아 후 21일째 애기장대 야생형(Con)과 변이체 ATPG10 ox-2, ATPG10 ox-4, 그리고 ATPG10 ox-6의 3-4번 좌엽을 detach하여 암상태를 유지하여 매 2일마다 14일까지 잎의 노화 마커 유전자의 발현 양상을 qRT-PCR을 통하여 분석한 결과를 나타낸 것이며, ACT2를 PCR 양성 대조구로 사용하였다. CAB2, SEN4, 그리고 SAG12는 노화 마커 유전자이다.
이하 본 발명의 실시예를 참조하여 설명한다. 그러나 본 발명의 범위가 이러한 실시예에 한정되는 것은 아니다.
<실시예 1> 애기장대로부터 식물의 생산성 증대와 스트레스 내성을 제공하고 또한 노화 지연을 조절하는 ATPG10 유전자의 분리
식물의 생산성 증대와 스트레스 내성 기능을 가지고 노화 지연 기능을 가지는 ATPG10 유전자를 애기장대로부터 분리하기 위하여 다음과 같은 과정을 수행하였다.
<실시예 1-1> 애기장대의 재배 및 배양
애기장대는 토양을 담은 화분에서 재배하거나, 2% 수크로즈(sucrose, pH 5.7)와 0.8% 아가(agar)가 포함된 MS(Murashige and Skoog salts, Sigma, USA) 배지를 넣은 페트리 디쉬에서 재배하였다. 화분에서 재배할 때는 22℃의 온도에서 16/8시간 명암 주기로 조절되는 생장 조절기(growth chamber)내에서 재배하였다.
<실시예 1-2> RNA 추출과 cDNA 라이브러리의 제조
애기장대 cDNA 라이브러리를 만들기 위해서 여러 분화 단계의 애기장대 전체 기관으로부터 RNasey Plant Mini Kit (QIAGEN, Germany)을 사용하여 RNA를 추출하였고, 추출된 전체 RNA로부터 Superscript III Reverse Tanscriptase (INVITROGEN, USA)을 이용하여 cDNA를 합성하였다.
<실시예 1-3> 식물의 생산성 증대과 스트레스 내성 기능을 가지고 또한 노화 지연을 제공하는 ATPG10 유전자 분리
애기장대의 Predicted AT-hook DNA-binding family protein (GeneBank accession number NP_199781.1)의 염기서열을 기초로 하여 서열번호 3으로 표시되고 제한효소 PacI의 서열이 포함된 정방향 프라이머(PacI/5g49700 SOE-F, 5'-TTA ATT AA A TGA AAG GTG AAT ACA GAG AGC AA-3')와 서열번호 4로 표시되고 제한효소 XbaI의 서열이 포함된 역방향 프라이머(XbaI/At5g49700 SOE-R, 5'-TCT AGA TTA GTA TGG CGG TGG AGC TCT G-3')를 합성하였다. 상기 두 프라이머를 사용하여 상기 <실시예 1-2>에서 제조된 애기장대 cDNA로부터 PCR(polymerase chain reaction)을 이용하여 전장 cDNA를 증폭하고 분리하였다.
상기 분리된 cDNA의 분석 결과, 약 29.4 kDa의 분자량을 갖는 276개의 아미노산을 암호화하는 831bp 크기의 전사 해독 틀(ORF)을 가지고 있으며, 1 개의 엑손(exon)으로 구성되어 있음을 확인하였고, AT-hook 도메인을 가지고 있어 이를 ATPG10 (AT-hook protein of Genomine 10)으로 명명하였다. 상기 유전자가 암호화하는 ATPG10 단백질의 등전점(isoelectric point)은 8.34로 나타났다(이하 유전자는 이탤릭체를 사용하여 "ATPG10" 혹은 "ATPG10 유전자"라 하고, 단백질은 "ATPG10" 혹은 "ATPG10 단백질"이라고 한다).
<실시예 2> ATPG10 유전자에 대한 센스 구성체(construct)가 도입된 형질전환 애기장대의 제조 및 특성 분석
<실시예 2-1> ATPG10 유전자에 대한 센스 구성체가 도입된 형질전환 애기장대의 제조
상기 유전자가 식물의 생산성 증대와 스트레스 내성 기능을 가지고 또한 노화 지연을 제공하는지를 확인하기 위하여 ATPG10 유전자가 센스 방향으로 도입된 형질전환 애기장대를 제조하여 ATPG10 전사체의 발현을 변화시켰다.
서열번호 3으로 표시되고 제한효소 PacI의 서열이 포함된 정방향 프라이머 및 서열번호 4로 표시되고 제한효소 XbaI의 서열이 포함된 역방향 프라이머를 이용하여 애기장대의 cDNA로부터 PCR을 이용하여 ATPG10 cDNA를 증폭하였다. 상기 DNA를 제한효소 PacI과 XbaI으로 절단하고, 유도성 프로모터(inducible promoter)인 SEN1 프로모터의 조절을 받도록 제작한 pCSEN 벡터에 센스 방향으로 클로닝하여 ATPG10 유전자에 대한 센스 구성체인 pCSEN-ATPG10 재조합 벡터를 제작하였다. 상기 SEN1 프로모터는 식물의 생장 단계에 따라 발현되는 유전자에 대해 특이성을 갖는다.
한편, 도 1은 pCSEN 벡터에 ATPG10 유전자가 센스 방향으로 도입된 pCSEN-ATPG10 재조합 벡터를 도시한 그림이다. 도 1에서 BAR는 바스타 제초제에 대한 저항성을 부여하는 BAR 유전자(phosphinothricin acetyltransferase gene)를 가리키고, RB는 오른쪽 경계(Right Border), LB는 왼쪽 경계(Left Border), P35S는 CaMV 35S 프로모터, 35S-A는 CaMV 35S RNA polyA, PSEN은 SEN1 프로모터, Nos-A는 노파린 합성 유전자(nopaline synthase gene)의 polyA를 가리킨다.
상기 pCSEN-ATPG10 재조합 벡터를 아그로박테리움 튜머파시엔스 (Agrobacterium tumefaciens)에 일랙트로포레이션(electroporation) 방법을 이용하여 도입시켰다. 형질전환된 아그로박테리움 배양액을 28℃에서 O.D.600 값이 1.0이 될 때까지 배양하였고, 25℃에서 5,000rpm으로 10분 동안 원심분리하여 세포를 수확하였다. 수확된 세포를 최종 O.D.600 값이 2.0이 될 때까지 Infiltration Medium (IM; 1X MS SALTS, 1X B5 vitamin, 5% sucrose, 0.005% Silwet L-77, Lehle Seed, USA) 배지에 현탁하였다. 4주된 애기장대를 진공 챔버(vacuum chamber)에 있는 아그로박테리움 현탁액에 침지시키고, 10분 동안 104 Pa의 진공 하에 두었다. 침지 후, 애기장대를 24시간 동안 폴리에틸렌 백(polyethylene bag)에 두었다. 이후, 형질전환된 애기장대를 계속 생장시켜 종자(T1)를 수확하였다. 대조군으로는 형질전환되지 않은 야생형(wild type) 애기장대 또는 ATPG10 유전자가 포함되지 않은 벡터(pCSEN 벡터)만으로 형질전환된 애기장대를 사용하였다.
<실시예 2-2> T2 형질전환 애기장대의 특성 분석
상기 <실시예 2-1>에서와 같이 형질전환한 애기장대에서 수확한 종자는 0.1% 바스타(Basta) 제초제(경농, 한국) 용액에서 30분 동안 침지시키고 배양함으로써 선별하였다. 이후 형질전환한 애기장대의 생육 동안 상기 화분에 바스타 제초제를 5회 처리한 후, 각 화분에서 형질전환된 애기장대를 선별하였다. pCSEN-ATPG10 벡터로 형질전환된 T1 애기장대는 대조군(ATPG10 유전자가 포함되지 않은 벡터(pCSEN 벡터)만으로 형질전환된 애기장대 혹은 야생형 애기장대)과 그들의 표현형을 비교하여 볼 때, 놀랍게도 변이체들은 뚜렷한 개체 크기 및 종자 수확량 증가와 같은 생산성 증대와 노화 지연 특성을 보였다.
이러한 형질전환 애기장대의 표현형 변화를 보다 정확히 확인하기 위하여 T1 형질전환 애기장대로부터 T2 형질전환 종자를 받아 이들 라인의 표현형을 조사하였다. 우선, 3일 동안 저온 처리(4℃)한 T2 형질전환 종자를 화분에서 재배한 후 바스타 제초제 처리를 통하여 T2 형질전환 애기장대를 선별하였다.
선별된 애기장대 T2 형질전환 라인들의 표현형 확인은 발아 후 50일째, 그리고 70일째 수행하였다(도 2).
pCSEN-ATPG10 구성체를 가지고 있는 ATPG10 ox-2, ATPG10 ox-4와 ATPG10 ox-6 변이체 라인은 애기장대 대조구(Con)와 비교하여 볼 때, 식물체의 생산성 증대 현상이 뚜렷하게 나타났으며 흥미로운 점은 이들 변이체 중 ATPG10 ox-4와 ATPG10 ox-6 변이체 라인은 노화 지연 현상이 뚜렷하게 나타났다. 생산성 증대 특성을 가지는 변이체들은 발아 후 50일 동안 생육했을 때는 개체 크기에 있어서 야생형에 비하여 비슷하거나 혹은 약간 작았으나, 발아 후 70일 동안 생육했을 때는 개체 크기 및 종자 생산량 증가와 같은 생산성 증대에 있어서 애기장대 야생형에 비하여 뚜렷한 증가 현상이 나타났다. 이러한 노화 지연 현상과 생산성 증대는 라인 마다 약간씩 차이가 있었는데 이는 도 3에서 나타나듯이 유전자의 과발현이 라인 마다 조금씩 차이가 있음에 기인하는 것으로 판단된다.
선별된 노화 지연/생산성 증대 표현형을 가지는 변이체의 ATPG10 유전자의 발현 양상을 분석하기 위하여 자엽 생성 후 24일 동안 생육한 애기장대 야생형과 ATPG10 ox-2, ATPG10 ox-4와 ATPG10 ox-6 변이체의 잎으로부터 RNasey Plant Mini Kit (QIAGEN, Germany)을 사용하여 전체 RNA를 각각 추출하였다. 각각 1㎍의 RNA를 주형으로 하고, Superscript III Reverse Tanscriptase(INVITROGEN, USA)을 이용하여 65℃에서 5분; 50℃에서 60분; 및 70℃에서 15분의 조건으로 cDNA를 합성하였다. 이후, 합성된 cDNA를 주형으로 하고, 하기 ATPG10 유전자와 PCR 양성 대조구로 사용된 ACT 유전자에 대해 하기 [표 1]의 특이적인 프라이머를 사용하여 PCR을 수행하였다. PCR은 94℃에서 2분간 가열하여 주형 DNA를 변성시킨 후, 94℃에서 1분; 55℃에서 1분 30초; 및 72℃에서 1분을 한 사이클로 하여 총 30회 반복 수행한 다음, 72℃에서 15분간 최종 반응시켜 수행하였다. 이후, 1% 아가로스 겔 전기영동으로 PCR 산물을 확인하였으며, 그 결과는 도 3에 도시되었다. 애기장대 야생형에 비하여 ATPG10 ox-2, ATPG10 ox-4와 ATPG10 ox-6 변이체의 ATPG10 유전자의 발현이 전체적으로 현저히 증가되는 것을 확인할 수 있었으며, 이러한 사실은 본 변이체들이 ATPG10 유전자의 과발현체임을 증명하고 있다.
ATPG10 유전자의 상대적 발현 정도가 높은 ATPG10 ox-2, ATPG10 ox-4와 ATPG10 ox-6 변이체 라인 모두는 대조구에 비하여 개체 크기, 종자 수확량 등의 생산성 증대 형질이 높은 것으로 나타났다. 그런데 흥미로운 사실은 유전자의 상대적 발현 정도가 낮은 ATPG10 ox-2 변이체는 ATPG10 ox-4과 ATPG10 ox-6 변이체에 비하여 노화 지연에 대한 효과는 상대적으로 약한 것으로 나타났다. 따라서 본 유전자의 발현량 조절은 생산성 증대와 노화 지연에 대한 표현형적 특징을 가진 식물을 임의로 제작할 수 있을 것으로 판단된다. 특히 유전자의 발현 조절을 통하여 애기장대 야생형과 같은 수확시기를 가지고 생산성이 증대되는 식물의 제작이 용이함에 따라 ATPG10은 우량 생산성 증대 작물 개발에 있어 훌륭한 유전자원으로 활용할 수 있을 것이다.
표 1 ATPG10 유전자와 ACT2 유전자 발현을 위한 프라이머 서열 및 서열번호
No. 유전자명 정방향/역방향 프라이머(서열번호)
1 ATPG10 GCGGTGAAGAGTCAGGACAGA(서열번호 5)/CACCCATGTGGCAACTGTACAT(서열번호 6)
2 ACT ATGGCCGATGGTGAGGATATTC (서열번호 7)/CACCAGCAAAACCAGCCTTC (서열번호 8)
<실시예 3> ATPG10 과발현 변이체의 생산성 증대에 대한 특성 분석
ATPG10 유전자의 과발현을 통하여 얻어진 식물체의 생산성 증대에 대한 특성을 확인하기 위하여 변이체 ATPG10 ox-2, ATPG10 ox-4와 ATPG10 ox-6의 라인별로 종자 수확량 등과 같은 생산성 증대 지표를 적용하여 애기장대 대조구와 비교해 보았다.
적용된 생산성 증대 지표는 식물의 키(height), 장각과(silique) 수(NTS), 생체량(FW), 생체건량(DW), 총 종자 무게(TSW), 총 종자 수(TNS), 그리고 1,000개의 종자 무게(1,000SW)이며, 결과는 라인별로 각 20개체의 평균값이다.
ATPG10 ox-2, ATPG10 ox-4와 ATPG10 ox-6 변이체 라인들은 모두 애기장대 대조구에 비하여 종자 생산이 증가하는 것으로 나타났으며, 이러한 종자 생산의 증가는 변이체의 장각과 생산 증가에 기인하는 것으로 나타났다. 한편 종자 1,000개의 무게에서 변이체 전체는 대조구에 비하여 큰 변이가 없는 것으로 나타났다. 이러한 사실로 미루어보아 본 유전자의 발현은 종자의 개체 크기가 아닌 전체 무게의 증가에 영향을 미치는 것으로 판단되며, 이러한 형질은 본 유전자가 화기 형성을 촉진하여 전체 장각과 형성의 증가를 유도하여 결과적으로 전체 종자 무게의 증가를 유발하는 것으로 판단된다. 그리고 생체량과 생체 건량에 있어서도 과발현 변이체는 대조구에 비하여 뚜렷한 증가 현상을 가졌다. 흥미로운 사실은 ATPG10 ox-4 변이체 라인은 ATPG10 ox-2와 ATPG10 ox-6 변이체 라인들에 비하여 생체건량 증가에 있어서 뚜렷한 증가 현상은 가진다는 것이다. 이러한 사실로 미루어 보아 본 유전자 발현의 상대적 증가는 생체 건량과 같은 바이오매스 증가에 효과가 높음을 나타낸다. 상기의 내용을 종합해보면 ATPG10 유전자가 종자 생산량 증가와 더불어 생체량/생체건량 증가와 같은 바이오매스 증가와 같은 작물의 생산성 증대를 유발하며(도 4), 이러한 과발현 변이체의 라인별 생산성 증대의 차이는 라인별 ATPG10 유전자의 발현 정도의 차이에 기인하는 것으로 판단된다. 따라서 본 유전자의 타 작물 적용은 생산성 증대라는 측면에서 효용 가치가 매우 높을 것으로 생각된다.
흥미로운 사실은 생산성 증대 특정 형질을 가지는 변이체 라인들의 수확 시기는 애기장대 대조구와 큰 차이가 없다는 것이다. 이러한 사실은 본 유전자의 과발현으로 인한 생산성 증대는 대조구의 수확시기가 비슷하여 작물의 수확시기에 대한 문제점을 최소화할 수 있다는 것이다.
이러한 결과를 종합해보면, APTG10 유전자 발현의 적정 범위 조절은 수확시기가 대조구와 비슷한 식물의 생산성 증대 특징을 강력하게 나타내는 것으로 판단된다. 따라서 본 유전자의 발현을 조절할 수 있는 프로모터(비교적 발현이 낮은 프로모터, 유도성 프로모터, 기관 혹은 화합물 특이적 프로모터 등)를 적용하면 생산성 증대 작물 개발에 많은 장점을 제공하리라 판단된다.
<실시예 4> ATPG10 과발현 변이체의 스트레스에 대한 특성 분석
<실시예 5-1> ATPG10 과발현 변이체의 가뭄 스트레스에 대한 특성 분석
ATPG10 유전자의 과발현 변이체에 대한 가뭄 저항성(drought tolerance) 분석은 발아 후 30일 된 식물을 12일 동안 가뭄을 처리하고, 그 동안에 일어나는 전체 식물의 표현형적 변화와 식물 개체당 잎의 무게 변화를 비교하여 가뭄에 대한 저항성 정도를 확인하였다. 그 결과는 도 5와 6에 도시되었으며, 제시된 값은 라인별로 각 6개체 이상의 평균값±표준편차이다. 야생형 애기장대는 가뭄에 의해 잎의 황화 현상이 급속히 진행됨을 알 수 있었으며, 또한 잎의 무게에 있어서도 가뭄에 의하여 현저히 감소함을 알 수 있었다. 그에 비하여 ATPG10 유전자의 과발현 변이체는 가뭄 처리에도 잎의 녹화가 여전히 진행되고 있으며, 또한 잎의 무게에 있어서도 야생형에 비하여 월등히 높음을 알 수 있었다. 특히 ATPG10 ox-4와 ATPG10 ox-6 변이체 라인들은 ATPG10 ox-2 변이체 라인에 비하여 훨씬 높은 가뭄 스트레스 저항성을 가지는데 이는 본 변이체들의 상대적 유전자 발현 정도에 기인하는 것으로 판단된다. 따라서 ATPG10 유전자의 높은 발현은 가뭄 스트레스 하에서도 식물의 수분 보유를 최대한 가능하게 해 식물의 가뭄 스트레스에 대한 저항성을 유도한다는 것을 의미한다.
<실시예 5-2> ATPG10 과발현 변이체의 H 2 O 2 스트레스에 대한 특성 분석
ATPG10 과발현 변이체의 산화적 스트레스에 대한 저항성을 조사하기 위하여 3mM MES 용액에 50mM H2O2를 첨가하여 발아 후 25일 된 3, 4번 잎을 detach하여 floating한 후 매 3일 간격으로 6일 동안 엽록소 함량과 광합성 효율을 측정하여 H2O2 스트레스에 대한 저항성 정도를 라인별로 각 6개체 이상을 조사하였다.
엽록소 함량은 663.2 nm와 664.8 nm의 흡광 계수를 이용하여 Lichtenthaler와 Wellburn의 방법(Biochemical Society Transduction 603:591~592, 1983)에 따라 측정하였으며, 광합성 효율의 측정은 오 등의 방법(Plant Mol. Biol. 30:939, 1996)에 따랐다.
구체적으로 각 DAE(day after emersion)의 잎을 15분간 암 처리한 후, 식물 효율 분석기(Plant Efficiency Analyzer)(Hansatech)를 이용하여 엽록소의 형광을 측정하였고, 광합성 효율은 엽록소의 형광도 특성을 이용한 PSⅡ(photosystemⅡ)의 광화학적 효율(photochemical efficiency)로 나타내었는데, 형광도 최대치(maximum value of fluorescence; Fm)에 대한 최대 변형 형광도(maximum variable fluorescence; Fv)의 비율(Fv/Fm)로 나타내었다. 상기 수치가 높을수록 광합성 효율이 우수함을 나타낸다.
그 결과 애기장대 야생형에 비하여 ATPG10 과발현 변이체에서는 잎의 황화 현상 지연과, 또한 엽록소 함량 및 광합성 효율의 감소, 특히 엽록소 함량의 감소가 지연됨을 확인할 수 있었다(도 7, 8과 9). 앞선 가뭄 스트레스 저항성과 마찬가지로 ATPG10 ox-4와 ATPG10 ox-6 변이체 라인들은 ATPG10 ox-2 변이체 라인에 비하여 훨씬 높은 H2O2 스트레스 저항성을 가지는데 이는 본 변이체들의 상대적 유전자 발현 정도에 기인하는 것으로 판단된다. 이러한 사실은 ATPG10이 식물의 산화 스트레스에 대한 저항성을 제공한다는 것을 의미한다.
따라서 ATPG10 유전자는 식물의 생산성 증대뿐만 아니라 식물의 가뭄 및 산화적 스트레스에 대한 내성도 제공하여 스트레스 저항성을 가진 생산성 증대 작물 개발에 있어 많은 장점을 제공할 것으로 생각된다.
<실시예 5> ATPG10 과발현 변이체의 노화 조절에 대한 특성 분석
<실시예 5-1> ATPG10 과발현 변이체의 나이-의존적 노화에 따른 잎의 표현형적 변화
ATPG10 과발현 변이체의 노화 지연 형질을 확인하기 위하여, T2 세대에서 자엽 생성 후 12일 이후부터 3-4번 좌엽(rosette leaf)을 매 4일마다 40일까지 표현형 관찰, 잎 엽록소 함량, 광합성 활성, 그리고 노화 관련 유전자의 발현율을 측정하여 애기장대 대조구와 비교하였다.
자엽 생성 후 12일 이후부터 3-4번 좌엽을 매 4일마다 40일까지 잎의 표현형을 라인별로 각 6개체 이상에서 관찰하였다. 그 결과, 애기장대 야생형의 경우 24일 이후 잎의 황화 현상이 급격하게 나타났으며 32일째부터 잎이 괴사(necrosis) 상태에 접어들었다. 반면 ATPG10 ox-2, ATPG10 ox-4와 ATPG10 ox-6의 경우 잎의 황화 현상이 36일 이후부터 진행되었으며 잎의 괴사 현상은 40일 이후부터 일어남을 확인할 수 있었다(도 10). 이러한 사실로 미루어보아, ATPG10 유전자는 식물체 노화 지연에 있어 중요한 역할을 담당하리라고 판단된다. 그리고 ATPG10 ox-4와 ATPG10 ox-6 변이체들은 ATPG10 ox-2 변이체에 비하여 노화지연의 표현형질이 보다 뚜렷함을 알 수 있었다. 이러한 사실은 본 유전자의 발현이 높으면 높을수록 노화 지연의 표현형질이 강력해짐을 제시할 수 있다.
<실시예 5-2> ATPG10 과발현 변이체의 나이-의존적 노화에 따른 엽록소 함량 변화
엽록소의 함량 측정을 위해 각 시료 잎을 80% (V/V) acetone을 사용하여 엽록소를 추출하였다. 엽록소 함량은 663.2 nm와 664.8 nm의 흡광 계수를 이용하여 Lichtenthaler와 Wellburn의 방법(Biochemical Society Transduction 603:591~592, 1983)에 따라 측정하였다. 그 결과는 도 11에 도시되었으며, 제시된 값은 라인별로 각 6개체 이상의 평균값±표준편차이다. 야생종의 경우 엽록소 함량이 자엽 생성 후 20일 이후부터 급격한 감소를 보이며 32일째 엽록소의 함량이 최저치로 떨어졌으나, ATPG10 ox-2, ATPG10 ox-4와 ATPG10 ox-6의 경우 자엽 생성 후 32일이 되었을 때도 측정 초기의 60% 이상의 엽록소 함량을 보이며, 그 후 엽록소 함량의 감소가 급격히 일어남을 확인할 수 있었다. 또한 변이체 라인들의 엽록소 함량 변화를 비교해 보았을 때, 앞의 표현형 분석에서와 마찬가지로 ATPG10 ox-4와 ATPG10 ox-6 변이체들은 ATPG10 ox-2 변이체에 비하여 엽록소 함량 감소의 지연에 대한 표현형질이 보다 뚜렷함을 알 수 있었다.
<실시예 5-3> ATPG10 과발현 변이체의 나이-의존적 노화에 따른 광합성 효율 변화
광합성 효율은 전술한 바의 오 등의 방법(Plant Mol. Biol. 30:939, 1996)을 이용하여 측정하였다.
결과를 도 12에 도시하였으며, 제시된 값은 라인별로 각 6개체 이상의 평균값±표준편차이다. 야생종은 자엽 생성 후 24일 이후부터 급격히 감소하기 시작해 32일 이후부터 활성이 대부분 사라졌으나, ATPG10 ox-2, ATPG10 ox-4와 ATPG10 ox-6의 경우 자엽 생성 후 36일에도 광합성 효율이 초기의 80%를 유지하고 있었다. 이러한 광합성 효율의 감소 지연도 앞선 엽록소 함량에서와 마찬가지로 ATPG10 ox-4와 ATPG10 ox-6 변이체들이 ATPG10 ox-2 변이체에 비하여 보다 뚜렷한 표현형을 보였다. 그러나 전체적인 경향을 보면 모든 변이체들은 야생형에 비하여 광합성 효율 감소의 지연 효과가 강력했으며, 변이체간의 지연 효과는 큰 차이가 없는 것으로 나타났다. 상기 결과로부터, ATPG10 과발현 변이체는 야생종에 비해 잎의 수명이 훨씬 긴 표현형을 갖는 것으로 나타났으며, 이러한 수명연장의 효과는 ATPG10 유전자에 의한 엽록소 함량 감소 및 광합성 효율 감소로 표현되는 노화에 따른 생화학적 변화가 지연됨으로써 유발되는 것으로 생각된다.
<실시예 5-4> ATPG10 과발현 변이체의 나이-의존적 노화에 따른 노화 관련 유전자의 발현 변화
야생종과 ATPG10 ox-2, ATPG10 ox-4와 ATPG10 ox-6 변이체에서 노화 관련 유전자(senescence-associated gene; SAG)들의 발현을 비교하기 위해, 잎 발달 과정 동안 시간 경과에 따른 ATPG10 유전자와 각 노화 관련 유전자들의 발현 양상을 qRT-PCR 분석을 통해 확인하였다.
Total RNA의 분리는 WelPrepTMTotal RNA Isolation Reagent (JBI)를 이용하였으며, DNase I (Ambion)을 처리한 후, 정량을 통해 0.75ug을 ImProm-IITM Reverse Transcription System (Promega)을 이용해 first cDNA를 합성하였다.
ATPG10 유전자 및 노화에 대한 마커(marker) 유전자들에 대한 정량적인 분석은 Applied Bio-systems의 7300 Real Time PCR System을 이용한 Quantitative real-time PCR (qRT-PCR) 과정을 통해 확인하였다. 노화 마커 유전자로는 SAG12, SEN4 및 CAB2 유전자를 사용하였으며, qRT-PCR 양성 대조구로는 ACT2 유전자를 사용하였다. 사용된 프라이머는 하기 표 2에서 제시하였다.
표 2 노화 관련 유전자의 발현을 위한 프라이머 서열번호
No. 유전자명 정방향/역방향 프라이머(서열번호)
1 CAB2 CCGAGGACTTGCTTTACCCC (서열번호 9)/ AACTCAGCGAAGGCCTCTGG (서열번호 10)
2 SEN4 CGTCGATGACACACCCATTAGAG(서열번호11)/ CATCGGCTTGTTCTTTGGAAAC(서열번호12)
3 SAG12 ACGATTTTGGCTGCGAAGG (서열번호 13)/ TCAGTTGTCAAGCCGCCAG (서열번호 14)
4 ACT2 ATGGCCGATGGTGAGGATATTC (서열번호 7)/ CACCAGCAAAACCAGCCTTC (서열번호 8)
5 ATPG10 GCGGTGAAGAGTCAGGACAGA(서열번호 5)/ CACCCATGTGGCAACTGTACAT(서열번호 6)
야생종의 경우, CAB2(엽록소 a/b 결합 단백질)와 같은 광합성에 관련된 유전자의 발현은 시간이 지날수록 노화에 비례하여 감소하였으나, ATPG10 과발현 변이체들은 CAB2의 발현 감소가 지연되는 것으로 나타났다. 노화의 signal로 사용되는 SAG12 발현의 경우, 야생종은 20일에 발현되어 32일째 최대 발현을 나타내는 반면, ATPG10 과발현 변이체들은 40일까지 증가 현상이 거의 나타나지 않았으며, 식물의 노화 동안 점진적으로 발현이 증가되는 것으로 알려진 SEN4의 발현은 야생종에서는 32일째 발현이 최대로 증가하는 반면, ATPG10 과발현 변이체들은 노화 과정 동안 SEN4의 발현 증가가 지속적으로 일어나나 큰 증가폭을 나타내지 않았으며, 변이체의 SEN4 발현 정도는 야생형의 노화 동안의 발현 정도에 비하여 현저히 낮음을 알 수 있었다. 한편 ATPG10 유전자의 발현 양상을 조사해보면, 야생형의 경우 노화 동안 발현이 거의 나타나지 않는 반면 ATPG10 유전자 과발현 변이체들은 야생형에 비하여 노화 전 과정 동안 발현 수준이 현저히 높으며 일부 구간에서 감소 현상을 가짐에도 불구하고 여전히 야생형에 비해서는 높은 발현 수순을 유지하고 있는 것으로 나타났다(도 13). 따라서 과발현 변이체들의 노화 지연 현상은 ATPG10 유전자의 과발현에 의해 유도되는 것으로, 특히 본 유전자 발현의 정도가 높으면 높을수록 노화 지연의 표현형적 특징은 강력할 것으로 생각된다. 이러한 사실을 종합해보면 ATPG10 유전자는 분자적 수준에서 노화의 시작을 지연하여 이후 엽록소 함량, 광합성 효율 등과 같은 생리적 현상을 조절함으로써 결과적으로 표현형적으로 잎 수명의 연장을 유발하는 것으로 판단된다.
<실시예 5-5> ATPG10 과발현 변이체의 암 처리에 따른 노화 특성 분석
노화를 촉진한다고 알려진 요인인 암 처리에 대한 ATPG10 과발현 변이체의 잎의 노화 지연 형질의 특성을 분석하기 위하여 T2 세대에서 발아 후 21일째 3-4번 좌엽(rosette leaf)을 detach하여 3mM MES 완충용액 (2-[N-morpholino]-ethanesulfonic acid, pH 5.8)에 부유시킨 후, 암 상태를 유지하여 매 2일마다 표현형 관찰, 잎 엽록소 함량, 광합성 효율 및 노화관련 유전자 발현을 상기 <실시예 5-1 내지 5-4>와 동일한 방법으로 각 변이체 라인별로 6개체 이상을 대상으로 측정하여 야생종 애기장대와 비교하였다.
그 결과, 애기장대 야생형의 경우 암처리 후 4일 이후부터 잎의 황화 현상이 진행되어 8일째 잎이 괴사(necrosis) 상태에 접어들었다. 반면 ATPG10 ox-2, ATPG10 ox-4와 ATPG10 ox-6의 경우 잎의 황화 현상이 야생형에 비하여 지연되는 것으로 보여지며(도 14), 암 처리에 의한 노화 동안 엽록소 함량과 광합성 효율 변화에 있어서도 야생종에 비하여 ATPG10 변이체들은 정도의 차이는 있지만 함량 및 활성 감소가 지연됨을 알 수 있었다(도 15과 16).
또한, 노화 지표 유전자인 SEN4와 SAG12, 그리고 광의존적 유전자인 CAB2의 발현을 상기 <실시예 5-4>와 동일한 방법에 따라 조사하였다. 그 결과, 도 17에 도시된 바와 같이, 야생형에 비하여 ATPG10 변이체들은 CAB2의 발현 감소는 유사하였으나 SAG12의 발현은 지연되고, SEN4의 발현율은 억제됨을 알 수 있었다. 이러한 사실로 미루어 보아 ATPG10 유전자는 노화 지표 유전자의 발현 시기를 늦추거나 혹은 발현율을 억제시켜 노화를 지연시키는 것으로 판단된다.
상기의 실시예를 종합해보면 다음과 같은 결론을 내릴 수 있다. ATPG10 유전자의 과발현은 식물의 개체 크기 증가, 생체량/생체건량 증가, 종자 수확량과 같은 생산성 증대라는 농업형질을 제공하며, 또한 가뭄 혹은 산화 스트레스에 대한 저항성 제공과 더불어 노화 지연이라는 형질을 제공한다. 이러한 형질 제공은 ATPG10 유전자의 과발현 정도에 따라 나타나는데, ATPG10 유전자의 적정 수준에서의 과발현은 개체크기 증가, 생체량/생체건량 증가, 종자 수확량와 같은 생산성 증대라는 농업형질 제공에 보다 효과적이다. 특히 본 유전자의 적정 수준에서의 발현 조절은
수확시기가 야생형과 비슷한 식물의 생산성 증대 특징을 강력하게 나타내는 것으로 판단된다. 따라서 본 유전자의 발현을 조절할 수 있는 프로모터(비교적 발현이 낮은 프로모터, 유도성 프로모터, 기관 혹은 화합물 특이적 프로모터 등)를 적용하면 생산성 증대 작물 개발에 많은 장점을 제공하리라 판단된다. 한편 ATPG10 유전자의 발현 정도에 비례하여 식물의 노화 지연 및 스트레스 저항성에 대한 형질이 강력하게 나타나는 것으로 판단된다. 따라서 본 유전자의 적절한 발현 조절은 작물의 생산성 증대와 더불어 스트레스 저항성을 제공하여 다수안정성 작물 개발에 많은 장점을 제공할 뿐만 아니라 작물의 노화지연 기능을 제공하여 생산성 증대 및 녹기연장 형질을 요구하는 작물의 개발에도 많은 장점을 제공하리라 판단된다.

Claims (14)

  1. 서열번호 2에 개시된 아미노산 서열과 90% 이상의 서열 상동성을 갖고, 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 ATPG10 단백질.
  2. 제1항의 단백질을 암호화하는 ATPG10 유전자.
  3. (a) 제2항의 유전자를 그것을 과발현시킬 수 있는 조절 서열에 작동 가능하게 연결되도록 발현벡터에 삽입시키는 단계,
    (b) 그 발현벡터를 식물체에 형질전환하는 단계, 및
    (c) 생산성 증대 특성을 갖는 식물체를 선별하는 단계를 포함하여 구성되는 생산성 증대 특성을 갖는 식물체의 제조 방법.
  4. 제3항에 있어서,
    상기 유전자는 서열번호 1의 염기 서열을 포함하는 유전자인 것을 특징으로 하는 생산성 증대 특성을 갖는 식물체의 제조 방법.
  5. (a) 제2항의 유전자를 그것을 과발현시킬 수 있는 조절 서열에 작동 가능하게 연결되도록 발현벡터에 삽입시키는 단계,
    (b) 그 발현벡터를 식물체에 형질전환하는 단계, 및
    (c) 스트레스 내성 특성을 갖는 식물체를 선별하는 단계를 포함하여 구성되는 스트레스 내성 특성을 갖는 식물체의 제조 방법.
  6. 제5항에 있어서,
    상기 유전자는 서열번호 1의 염기 서열을 포함하는 유전자인 것을 특징으로 하는 스트레스 내성 특성을 갖는 식물체의 제조 방법.
  7. (a) 제2항의 유전자를 그것을 과발현시킬 수 있는 조절 서열에 작동 가능하게 연결되도록 발현벡터에 삽입시키는 단계,
    (b) 그 발현벡터를 식물체에 형질전환하는 단계, 및
    (c) 노화 지연 특성을 갖는 식물체를 선별하는 단계를 포함하여 구성되는 노화 지연 특성을 갖는 식물체의 제조 방법.
  8. 제7항에 있어서,
    상기 유전자는 서열번호 1의 염기 서열을 포함하는 유전자인 것을 특징으로 하는 노화 지연 특성을 갖는 식물체의 제조 방법.
  9. (a) 서열번호 2의 아미노산 서열을 암호화하는 유전자를 그것을 과발현시킬 수 있는 조절 서열에 작동 가능하게 연결되도록 발현벡터에 삽입시키는 단계, 및
    (b) 그 발현벡터를 식물체에 형질전환하는 단계를 포함하는
    식물체의 생산성을 증대시키는 방법.
  10. (a) 서열번호 2의 아미노산 서열을 암호화하는 유전자를 그것을 과발현시킬 수 있는 조절 서열에 작동 가능하게 연결되도록 발현벡터에 삽입시키는 단계, 및
    (b) 그 발현벡터를 식물체에 형질전환하는 단계를 포함하는
    식물체의 스트레스 내성을 증가시키는 방법.
  11. (a) 서열번호 2의 아미노산 서열을 암호화하는 유전자를 그것을 과발현시킬 수 있는 조절 서열에 작동 가능하게 연결되도록 발현벡터에 삽입시키는 단계, 및
    (b) 그 발현벡터를 식물체에 형질전환하는 단계를 포함하는
    식물체의 노화를 지연시키는 방법.
  12. 제3항 기재의 방법에 의하여 얻어진 것으로서, 서열번호 2의 아미노산 서열을 암호화하는 유전자가 식물체에 도입되어 과발현됨으로써 생산성 증대 특성을 갖는 형질전환 식물체.
  13. 제5항 기재의 방법에 의하여 얻어진 것으로서, 서열번호 2의 아미노산 서열을 암호화하는 유전자가 식물체에 도입되어 과발현됨으로써 스트레스 내성 특성을 갖는 형질전환 식물체.
  14. 제7항 기재의 방법에 의하여 얻어진 것으로서, 서열번호 2의 아미노산 서열을 암호화하는 유전자가 식물체에 도입되어 과발현됨으로써 노화 지연 특성을 갖는 형질전환 식물체.
PCT/KR2014/005700 2013-06-28 2014-06-26 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg10 단백질과 그 유전자 및 이들의 용도 WO2014209036A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020130075022A KR20150001926A (ko) 2013-06-28 2013-06-28 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg10 단백질과 그 유전자 및 이들의 용도
KR10-2013-0075022 2013-06-28

Publications (1)

Publication Number Publication Date
WO2014209036A1 true WO2014209036A1 (ko) 2014-12-31

Family

ID=52142285

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/005700 WO2014209036A1 (ko) 2013-06-28 2014-06-26 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg10 단백질과 그 유전자 및 이들의 용도

Country Status (2)

Country Link
KR (1) KR20150001926A (ko)
WO (1) WO2014209036A1 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180038717A (ko) * 2016-10-07 2018-04-17 제노마인(주) 식물의 생산성 증대 기능과 노화 지연 기능을 갖는 MtATPG1 단백질과 그 유전자 및 이들의 용도
KR20180038718A (ko) * 2016-10-07 2018-04-17 제노마인(주) 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 MtATPG2 단백질과 그 유전자 및 이들의 용도

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6717034B2 (en) * 2001-03-30 2004-04-06 Mendel Biotechnology, Inc. Method for modifying plant biomass
US20100325753A1 (en) * 2007-07-20 2010-12-23 Basf Plant Science Gmbh Plants Having Increased Yield-Related Traits and a Method For Making The Same
WO2012148121A2 (ko) * 2011-04-26 2012-11-01 제노마인 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ7 단백질과 그 유전자 및 이들의 용도

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6717034B2 (en) * 2001-03-30 2004-04-06 Mendel Biotechnology, Inc. Method for modifying plant biomass
US20100325753A1 (en) * 2007-07-20 2010-12-23 Basf Plant Science Gmbh Plants Having Increased Yield-Related Traits and a Method For Making The Same
WO2012148121A2 (ko) * 2011-04-26 2012-11-01 제노마인 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ7 단백질과 그 유전자 및 이들의 용도

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI. 5 June 2013 (2013-06-05), accession no. M_124348.1 *
LIM ET AL.: "Overexpression af a chromatin architecture-controlling AT -hook protein extends leaf longevity and increases the post-harvest storage life of plants''.", THE PLANT JOURNAL, vol. 52, no. 6, 2007, pages 1140 - 1153 *

Also Published As

Publication number Publication date
KR20150001926A (ko) 2015-01-07

Similar Documents

Publication Publication Date Title
KR100861330B1 (ko) 식물 데옥시하이퓨신 신타제, 식물 진핵생물 개시 인자５ａ를 코딩하는 ｄｎａ, 트랜스제닉 식물 및 식물에서의노화 및 세포예정사멸 제어 방법
BRPI0708660A2 (pt) métodos para melhorar a performance de uma planta crescida em condições de alta densidade populacional, polinucleotìdeo isolado, cassete de expressão, planta, semente, método para modular a expressão de um polinucleotìdeo de interesse em uma planta
WO2012148121A2 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ7 단백질과 그 유전자 및 이들의 용도
WO2011090272A2 (ko) 식물의 외형(초형)을 변화시키고 수확량을 증가시키는 ＯｓＭＰＴ 유전자 및 이의 용도
WO2013062327A2 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ4 단백질과 그 유전자 및 이들의 용도
WO2010095910A2 (ko) 개화 지연 또는 성장 억제 기능을 지니는 폴리펩티드, 이를 암호화하는 폴리뉴클레오티드 및 이들의 용도
KR101850003B1 (ko) 식물의 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｈｇ１ 단백질과 그 유전자 및 이들의 용도
WO2018066897A2 (ko) 식물의 생산성 증대 기능과 노화 지연 기능을 갖는 mtatpg1 단백질과 그 유전자 및 이들의 용도
WO2014209036A1 (ko) 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg10 단백질과 그 유전자 및 이들의 용도
WO2014209060A1 (ko) 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 atpg6 단백질과 그 유전자 및 이들의 용도
WO2013125835A1 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ３ 단백질과 그 유전자 및 이들의 용도
Zhou et al. CHB2, a member of the SWI3 gene family, is a global regulator in Arabidopsis
WO2012148122A2 (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｐｇ8 단백질과 그 유전자 및 이들의 용도
KR20090049555A (ko) 식물 왜화 유도 기능을 가진 폴리펩티드, 이를 암호화하는 폴리뉴클레오티드 및 이들의 용도
WO2018066898A2 (ko) 식물의 생산성 증대 기능, 스트레스 내성 기능 및 노화 지연 기능을 갖는 mtatpg2 단백질과 그 유전자 및 이들의 용도
KR101592357B1 (ko) 식물의 냉해 스트레스 내성과 관련된 신규 유전자 및 그의 용도
WO2011096609A1 (ko) 식물의 노화 지연 기능 및 스트레스 내성 기능을 갖는 ａｔｈｇ１ 단백질과 그 유전자 및 이들의 용도
JP2004536560A (ja) 植物デオキシヒプシンシンターゼ、植物真核生物開始因子５ａをコードするｄｎａ、トランスジェニック植物並びに植物におけるプログラム老化及び細胞死を抑制する方法
WO2011122761A2 (ko) 식물의 수명 연장 기능 및 스트레스 내성 기능을 가지는 gsdl2 단백질, 그 유전자 및 이들의 용도
KR101190272B1 (ko) 벼 유래의 ＯｓＺＩＰ1 유전자 및 단백질
KR102072276B1 (ko) 식물의 저온 스트레스 저항성을 증진시키는 신규 유전자 및 이의 용도
KR101648559B1 (ko) 스트레스 유래 비정상적 단백질 제거를 통한 식물 스트레스 내성과 관련된 신규 유전자 및 그의 용도
KR20190068282A (ko) 식물의 생산성 증대 기능, 노화 지연 기능 및 스트레스 내성 기능을 갖는 ahl26 단백질과 그 유전자 및 이들의 용도
WO2016053022A2 (ko) Ore7 유전자를 이용한 식물 생산성 증대 방법, 식물 스트레스 내성 강화 방법 및 식물 노화 지연 방법
KR20230023402A (ko) 식물의 다수확성, 노화 지연 및 내재성 강화 기능을 갖는 메디카고 트런카툴라 AT-hook 단백질과 그 유전자 및 이들의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14816814

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14816814

Country of ref document: EP

Kind code of ref document: A1