WO2021002630A1 - 파에오닥틸룸 트리코르누툼의 신규 프로모터 hasp1와 이의 신호 펩타이드 및 이의 용도 - Google Patents

파에오닥틸룸 트리코르누툼의 신규 프로모터 hasp1와 이의 신호 펩타이드 및 이의 용도 Download PDF

Info

Publication number
WO2021002630A1
WO2021002630A1 PCT/KR2020/008251 KR2020008251W WO2021002630A1 WO 2021002630 A1 WO2021002630 A1 WO 2021002630A1 KR 2020008251 W KR2020008251 W KR 2020008251W WO 2021002630 A1 WO2021002630 A1 WO 2021002630A1
Authority
WO
WIPO (PCT)
Prior art keywords
hasp1
protein
promoter
present
gfp
Prior art date
Application number
PCT/KR2020/008251
Other languages
English (en)
French (fr)
Inventor
판철호
에르덴돌고르에르덴-오치르
송대근
신복규
권벼리
Original Assignee
한국과학기술연구원
주식회사 알지프로나
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술연구원, 주식회사 알지프로나 filed Critical 한국과학기술연구원
Priority to EP20835401.9A priority Critical patent/EP4032982A4/en
Publication of WO2021002630A1 publication Critical patent/WO2021002630A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/12—Unicellular algae; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8221—Transit peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence

Definitions

  • the present invention relates to a novel promoter HASP1 of the microalgae Paeodactylum tricornutum , a signal peptide thereof, and a use thereof.
  • the present invention relates to a novel promoter that induces overexpression of a protein in Paeodactylum tricornutum.
  • HASP1 signal peptide HASP1-SP
  • a novel protein secretion sequence that induces the secretion of the expressed protein
  • an expression vector including the HASP1 and HASP1-SP a transformant in which the expression vector is introduced into a host cell
  • the transformant A method of producing a protein of interest comprising the step of culturing to obtain a culture, a method of expressing a target protein comprising transforming the expression vector into a host cell, and transforming the expression vector into a host cell It relates to a method of increasing the expression level of a protein of interest in a host cell comprising a.
  • Microalgae are in the spotlight as a bio factory for producing high-value natural products and functional proteins.
  • diatoms are phytoplankton, unicellular eukaryotes living in marine and freshwater environments, and account for about 20% of the major photosynthetic productivity on Earth.
  • the diatoms have better carbon fixability than other microalgae.
  • Diatoms are being actively studied in various biotechnology applications, and can be used as bioreactors for the production of biopharmaceuticals and secondary metabolites.
  • Par ohdak tilrum tree cor nutum (Phaeodactylum tricornutum) from diatoms diatoms is a shore using the silicon (silicon).
  • the entire genome of the Paeodactylum trichonutum is about 27.6 Mb in size and is composed of 33 chromosomes including 12,177 genes.
  • ESTs expressed sequence tags
  • a number of expressed sequence tags (ESTs) have been identified in cells of Paeodactylum tricornutum grown under various conditions including nutrients, light sources, and abiotic stresses.
  • genetic engineering tools such as gene overexpression, gene silencing, gene editing, and plasmid delivery are being studied in Paeodactylum tricornutum.
  • the pPha-T1 vector was first developed as a genetic engineering tool for the transformation of Paeodactylum tricornutum (Apt, Grossman et al., 1996).
  • the pPha-T1 was used as a fucoxanthin chlorophyll a binding protein (FcpA) promoter associated with photosynthesis.
  • FcpA fucoxanthin chlorophyll a binding protein
  • an expression vector to which a nitrate reductase (NR) promoter is expressed when nitrate is deficient was also developed (Poulsen and Kroger., 2005).
  • both promoters have the disadvantage of expressing the protein in the exponential phase of the growth cycle, but significantly decreasing the expression in the stationary phase.Therefore, a promoter that induces overexpression of the recombinant protein in microalgae is still present. It is an absent situation.
  • ARS1 of Chlamydomonas reinhardtii has been reported as a secretion peptide of microalgae (Ramos et al., 2017), but in Paeodactylum Tricornutum, it is secreted into the culture medium when human IgG antibody is expressed. It is known that it is known (Hempel et al., 2012), but there has been no research on secreted peptides.
  • the present inventors have found that a strong overexpression of the recombinant protein in microalgae par ohdak tilrum tree cor nutum (Phaeodactylum tricornutum) example to develop new expression systems for production of recombinant proteins at high levels in efforts result, par ohdak tilrum tree cor nutum
  • the present invention by confirming that the productivity of the recombinant protein is increased by strongly inducing expression in all growth stages, especially in the stationary stage, and the HASP1 promoter, which is a novel promoter to induce, and the signal peptide HASP1-SP that efficiently promotes secretion from the culture medium. was completed.
  • One object of the present invention is to provide a HASP1 promoter consisting of the polynucleotide of SEQ ID NO: 1.
  • Another object of the present invention is to provide a HASP1 signal peptide consisting of the polynucleotide of SEQ ID NO: 2.
  • Another object of the present invention is to provide an expression vector comprising the HASP1 promoter and/or the HASP1 signal peptide.
  • Another object of the present invention is to provide a transformant in which the expression vector is introduced into a host cell.
  • Another object of the present invention is to provide a method for producing a protein of interest comprising the step of culturing the transformant to obtain a culture and recovering the target protein from the culture.
  • Another object of the present invention is to provide a method of expressing a protein of interest comprising transforming the expression vector into a host cell.
  • Another object of the present invention is to provide a method of increasing the expression level of a protein of interest in a host cell comprising the step of transforming the expression vector into a host cell.
  • Another object of the present invention is to provide the use of the promoter and/or signal peptide to increase the expression level of a protein of interest in a host cell.
  • New promoters to drive expression of the protein in par ohdak tilrum tree cor nutum (Phaeodactylum tricornutum) of the present invention HASP1, a signal peptide sequence that induces secretory novel protein secretion of the expressed protein HASP1-SP, and the HASP1 and HASP1- It is expected that the expression vector containing SP can be used as a powerful genetic tool that can significantly increase the productivity of the recombinant protein.
  • 1 is a diagram showing the results of SDS-PAGE for analysis of proteins in the culture medium of Paeodactylum tricornutum .
  • Figure 2 is a diagram showing the specific sequence of the HASP1 protein present in the culture medium of Paeodactylum tricornutum ( Phaeodactylum tricornutum ) through LC-MS/MS.
  • Figure 3 is a diagram showing the location of the HASP1 promoter and signal peptide sequences on genomic DNA of Paeodactylum tricornutum ( Phaeodactylum tricornutum ).
  • Figure 4 is a diagram showing an expression vector including the HASP1 promoter or the HASP1 promoter and signal peptide.
  • Figure 5 shows the action of the HASP1 promoter and signal peptide according to the growth cycle of Paeodactylum tricornutum ( Phaeodactylum tricornutum ),
  • Figure 5a is a diagram showing the concentration of GFP expression in cells according to the growth cycle
  • Figure 5b is growth It is a diagram showing the change in the concentration of GFP secreted into the medium according to the cycle.
  • FIG. 6 is a fluorescence microscope showing the GFP expression according to the culture cycle and the GFP expression position changed according to the presence or absence of the signal peptide
  • FIG. 6A is a diagram showing a control in which GFP is not expressed
  • FIG. 6B is expressed by the FcpA promoter
  • Fig. 6C is a diagram showing GFP expressed by the HASP1 promoter
  • Fig. 6D is a diagram showing GFP expressed in the presence of the HASP1 signal peptide.
  • One aspect of the present invention for achieving the above object is to provide a HASP1 promoter that induces overexpression of a protein of interest in microalgae, consisting of the polynucleotide of SEQ ID NO: 1.
  • HASP1 of the present invention is a protein (highly abundant secreted protein 1; HASP1) detected in a high content in the microalgae Paeodactylum tricornutum, and is similar to a phytase in the C-terminal region consisting of 1,793 amino acids. It is a protein belonging to the phytase superfamily containing domains.
  • microalgae of the present invention refers to phytoplankton present in water that performs photosynthetic action. It is present in the ocean or fresh water with more than 500,000 species and has vitality in harsh environments such as hot springs and deep seas. The microalgae are highly useful as biofuels and functional proteins.
  • Par ohdak tilrum tree cor nutum (Phaeodactylum tricornutum)" of the present invention is a coastal diatoms using a silicon (silicon).
  • the diatoms are single-celled eukaryotes living in marine and freshwater environments, and are microalgae with excellent carbon fixation ability to account for about 20% of the major photosynthetic amount on Earth.
  • the entire genome of the Paeodactylum trichonutum is about 27.6 Mb in size, and consists of 33 chromosomes including 12,177 genes.
  • Promoter of the present invention refers to a polynucleotide sequence that allows and regulates transcription of an operably linked gene.
  • the promoter includes a recognition sequence for binding RNA polymerase and a transcription start site. It is selected to express a protein of interest in a particular cell type or host cell. That is, an untranslated nucleic acid sequence upstream of the coding region, which includes the binding site for the polymerase and has an activity to initiate transcription of the lower gene of the promoter into the mRNA, that is, the polymerase binds to initiate transcription of the gene. It refers to the region of DNA that is to be performed It is located at the 5'site of the initiation site of mRNA transcription.
  • the "HASP1 promoter” of the present invention is a promoter derived from Paeodactylum tricornutum, contains the polynucleotide of SEQ ID NO: 1, and induces overexpression of the target protein in microalgae.
  • the promoter is present in the 499bp upstream region before the start codon of the HASP1 gene.
  • the HASP1 gene is a gene encoding the HASP1 protein (PHATRDRAFT_47612), and its base sequence can be obtained from a known database such as GenBank of NCBI (NCBI accession number: XM_002181840.1).
  • the HASP1 promoter of the present invention is a novel promoter identified for the first time in Paeodactylum tricornutum .
  • a base sequence showing 99% or more homology may be included without limitation.
  • a nucleotide sequence having such homology it is obvious that a nucleotide sequence in which some sequences are deleted, modified, substituted or added are also included within the scope of the present invention.
  • “Homology” in the present invention refers to the percent of identity between two polynucleotide or polypeptide moieties. Homology between sequences from one moiety to another can be determined by known art techniques. For example, homology aligns sequence information and uses readily available computer programs to determine sequence information between two polynucleotide molecules or two polypeptide molecules, e.g. score, identity and similarity. It can be determined by directly aligning the parameters of the back (eg BLAST 2.0). In addition, homology between polynucleotides can be determined by hybridizing polynucleotides under conditions that form a stable double-stranded between homologous regions and then decomposing them with single-strand-specific nucleases to determine the size of the digested fragment.
  • target protein of the present invention refers to a protein that is operably linked to the HASP1 promoter provided by the present invention, and is intended to specifically induce an increase in expression in microalgae using the promoter.
  • it may be a protein that exists in or can be produced from microalgae, but is not limited thereto, and may be appropriately selected by those skilled in the art according to the purpose of the invention. More specifically, it is a protein intended to specifically induce an increase in expression in diatoms, and more specifically, it may mean a protein intended to specifically induce an increase in expression in Paeodactylum tricornutum.
  • target protein and “target product” may be used interchangeably and described.
  • the HASP1 promoter derived from the Paeodactylum tricornutum may provide an effect of inducing an increase in the expression of a target protein in microalgae.
  • the effect of this promoter was first identified by the present inventors.
  • HASP1 signal peptide expressed by the polynucleotide of SEQ ID NO: 2 or consisting of the amino acid sequence of SEQ ID NO: 3.
  • HASP1 of the present invention is as described above.
  • the "signal peptide" of the present invention is located at the N-terminus of a secreted protein or membrane protein, and refers to a special region consisting of 15 to 20 amino acids that signal when the protein passes through the membrane.
  • the "HASP1 signal peptide” of the present invention is 54 bp in the 3'direction of the HASP1 gene, 18 amino acids responsible for HASP1 secretion, and includes a polynucleotide of SEQ ID NO: 2.
  • a base sequence showing 99% or more homology may be included without limitation.
  • a nucleotide sequence having such homology it is obvious that a nucleotide sequence in which some sequences are deleted, modified, substituted or added are also included within the scope of the present invention.
  • the HASP1 signal peptide efficiently induces the entry of the GFP protein, which is the target protein (Example 6).
  • Another aspect of the present invention provides an expression vector comprising the HASP1 promoter of SEQ ID NO: 1 and/or the HASP1 signal peptide of SEQ ID NO: 2.
  • HASP1 "promoter”, “HASP1 promoter”, “signal peptide”, and “HASP1 signal peptide” of the present invention are as described above.
  • the "expression vector" of the present invention refers to an artificial DNA molecule containing genetic material so as to express a target gene in a suitable host, and specifically refers to a DNA preparation containing the nucleotide sequence of a gene operably linked to a suitable regulatory sequence.
  • the regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. Not limited.
  • the promoter of the present invention may be a HASP1 promoter.
  • the recombinant expression vector may include a foreign gene encoding a protein of interest, operably linked to the promoter.
  • the term "foreign gene” of the present invention refers to a gene introduced into a plant from the outside, and may already exist in an individual (ie, a subject to induce transformation) or may not exist.
  • the nucleotide sequence of the foreign gene can be obtained through codon optimization of the target protein.
  • the "operably linked" of the present invention means that the gene sequence and the promoter sequence are functionally linked so that the nucleic acid sequence having promoter activity of the present invention initiates and mediates the transcription of the gene encoding the protein of interest.
  • the operable linkage may be prepared using a gene recombination technique known in the art, and the site-specific DNA linkage may be prepared using a linking enzyme or the like in the art, but is not limited thereto.
  • the vector used in the present invention is not particularly limited as long as it can replicate in host cells, and any vector known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • pWE15, M13, ⁇ MBL3, ⁇ MBL4, ⁇ IXII, ⁇ ASHII, ⁇ APII, ⁇ t10, ⁇ t11, Charon4A, and Charon21A can be used as a phage vector or a cosmid vector, and as a plasmid vector, pBR-based, pUC-based, pBluescriptII-based , pGEM system, pTZ system, pCL system, pET system, etc. can be used.
  • the vector usable in the present invention is not particularly limited, and a known expression vector may be used.
  • pDZ pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pCES208 vectors, etc.
  • pPha vectors but are not limited thereto.
  • an endogenous promoter in a chromosome with a nucleic acid molecule having promoter activity of the present invention through a vector for chromosome insertion into a host cell.
  • the insertion of the nucleic acid molecule into the chromosome can be accomplished by any method known in the art, for example, by homologous recombination. Since the vector of the present invention can be inserted into a chromosome by causing homologous recombination, it may further include a selection marker for confirming whether the chromosome is inserted.
  • the selection marker is used to select cells transformed with a vector, that is, to confirm whether a target nucleic acid molecule is inserted, and select a selectable phenotype such as drug resistance, nutritional demand, resistance to cytotoxic agents, or expression of surface proteins. Markers to give can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, and thus transformed cells can be selected.
  • the expression vector of the present invention may be an expression vector including the HASP1 promoter or the HASP1 promoter and the HASP1 signal peptide.
  • Another aspect of the present invention provides a transformant in which the expression vector is introduced into a host cell.
  • the "expression vector" of the present invention is as described above.
  • Transformation refers to introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide includes all of them, whether inserted into the chromosome of the host cell or located outside the chromosome.
  • the polynucleotide includes DNA and RNA encoding the protein of interest.
  • the polynucleotide may be introduced in any form as long as it can be introduced into a host cell and expressed.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements necessary for self-expression.
  • the expression cassette usually includes a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the promoter may include a nucleic acid molecule having promoter activity having the polynucleotide sequence of SEQ ID NO: 1 of the present invention.
  • the expression cassette may be in the form of an expression vector capable of self-replicating.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell.
  • the method of transforming the vector of the present invention includes any method of introducing a nucleic acid into a cell, and can be performed by selecting a suitable standard technique as known in the art depending on the host cell. For example, particle bombardment, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, Cationic liposome method, lithium acetate-DMSO method, and the like, but are not limited thereto.
  • a suitable standard technique as known in the art depending on the host cell. For example, particle bombardment, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, Cationic liposome method, lithium acetate-DMSO method, and the like, but are not limited thereto.
  • the "host cell” of the present invention refers to a microorganism capable of functioning as a promoter by introducing a nucleic acid molecule having promoter activity of the present invention.
  • the microorganism may be a microalgae, specifically Paeodactylum sp., may be more specifically Paeodactylum tricornutum ( Phaeodactylum tricornutum ), It is not limited thereto.
  • the "transformant" of the present invention refers to a microorganism transformed by introducing an expression vector including a HASP1 promoter and/or a HASP1 signal peptide and a protein of interest into the host cell, Paeodactylum trikornutum.
  • the transformant was confirmed that the expression of the target protein, GFP, was overexpressed even in the stationary phase of the cell growth cycle (Example 5).
  • Another aspect of the present invention provides a method for producing a target protein comprising the step of culturing the transformant to obtain a culture, and recovering the target protein from the culture.
  • “Culture” of the present invention means to grow microorganisms in an appropriately artificially controlled environmental condition.
  • a method of preparing a target product using microorganisms in Paeodactylum can be performed using a method widely known in the art.
  • the culture may be continuously cultured in a batch process, an injection batch or a repeated fed batch process, but is not limited thereto.
  • sugar sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid. , Fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, organic acids such as gluconic acid, acetic acid, and pyruvic acid, but are not limited thereto. These materials can be used individually or as a mixture.
  • Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, It is not limited thereto.
  • the nitrogen source can also be used individually or as a mixture.
  • Personnel that may be used may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a corresponding sodium-containing salt, but are not limited thereto.
  • the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate required for growth.
  • essential growth substances such as amino acids and vitamins can be used in addition to the above substances.
  • precursors suitable for the culture medium may be used. The above-described raw materials may be added batchwise or continuously to the culture during the culture process by an appropriate method.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acid compounds such as phosphoric acid or sulfuric acid can be used in an appropriate manner to adjust the pH of the culture.
  • foaming can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester.
  • Oxygen or oxygen-containing gas may be injected into the culture to maintain an aerobic condition.
  • the temperature of the culture may be usually 20°C to 45°C, preferably 25°C to 40°C, but may be changed according to conditions, but is not limited thereto.
  • the method of preparing the target product of the present invention may include the step of recovering the target product from a microorganism or culture.
  • the "recovery" of the present invention is to obtain a desired product from a microorganism or culture, and methods known in the art, such as centrifugation, filtration, anion exchange chromatography, crystallization and HPLC, etc. may be used, but are limited to these examples no.
  • the recovery step may include a purification process, and one of ordinary skill in the art may select and utilize among various known purification processes as needed.
  • Another aspect of the present invention provides a method for expressing a protein of interest comprising transforming the expression vector into a host cell.
  • Another aspect of the present invention provides a method of increasing the expression level of a target protein in a host cell, comprising transforming the expression vector into a host cell.
  • the expression of the recombinant target protein, GFP is significantly increased than the control. Confirmed that. In addition, it was confirmed that the expression level of the target protein was increased not only during the log phase but also during the stationary phase during the cell growth phase (Examples 5 to 6).
  • the expression vector including the HASP1 promoter and/or its signal peptide of the present invention can be a powerful tool for efficient expression and secretion of recombinant proteins throughout all growth stages of Paeodactylum tricornutum . .
  • Another aspect of the present invention provides the use of the promoter or signal peptide to increase the expression level of a target protein in a host cell.
  • Phaeodactylum tricornutum Phaeodactylum tricornutum
  • the Paeodactylum tricornutum strain was cultured by inoculating 200 mL of F/2 medium containing 50% artificial seawater sterilized by high temperature and high pressure at an initial concentration of 1 ⁇ 10 5 cells/mL.
  • LC-MS/MS LTQ XL linear ion trap mass spectrum, Thermo Scientific
  • C18 trap column 2.5 cm ⁇ 100 ⁇ m (Upchurch Scientific and a homemade reverse phase C18 micro column. column) 10 cm ⁇ 100 ⁇ m (Nanobaume) was used to analyze.
  • MS/MS data analysis was performed through Sorcerer-SEQUEST (version 3.5) and a protein search was performed through the UniProt P. tricornutum protein database.
  • the protein is a highly abundant secreted protein 1 (HASP1) protein composed of 1,793 amino acids, and belongs to the phytase superfamily containing a phytase-like domain in the C-terminal region.
  • HASP1 highly abundant secreted protein 1
  • the HASP1 protein was significantly higher than that of other proteins in the culture medium (Table 1).
  • HASP1 protein was selected, and potential promoter regions and signal peptides that were effective in the production and secretion of recombinant proteins in Paeodactylum tricornutum were isolated.
  • the fcpA promoter which is mainly used in Paeodactylum tricornutum, was used as a control.
  • the Paeodactylum trichornutum genome has a relatively higher gene density than other higher eukaryotes.
  • the endogenous gene region of about 500 bp was sufficient to strongly induce transgene expression to obtain promoter activity.
  • the 499bp upstream region before the start codon of the HASP1 gene was selected as a potential promoter (FIG. 3).
  • Par ohdak tilrum from gDNA of tree cor nutum was gene amplification through HASP1-F and HASP1-R primers and pfu PCR using polymerase (polymerase), using NdeI and EcoRI restriction enzymes pPha-T1 vector (vector) fcpA of By replacing the promoter, the pPha-HASP1p vector was constructed.
  • the GFP gene was amplified by PCR using GFP-F and GFP-R primers from the pEGFP-C2 vector, and inserted after the HASP1 promoter using NheI and BamHI to construct a pPha-HASP1p-GFP vector.
  • HASP1 signal peptide HASP1-SP
  • HASP1-SP The HASP1 signal peptide was gene-synthesized, and a pPha-HASP1p-SP-GFP vector was constructed by inserting a gene between the promoter and GFP using EcoRI and NheI restriction enzymes in the pPha-HASP1p-GFP vector ( Fig. 4).
  • a pPha-T1-GFP vector and a pPha-T1-SP-GFP vector were constructed in the pPha-T1 vector by the above method.
  • the primers used to construct the vector and the synthesized genes are shown in Table 2.
  • Example 2 The vectors constructed in Example 2 were transformed in E.coli DH5 ⁇ (NEB® 5-alpha Competent E.coli ) and then transformed E.coli was cultured in LB medium to which 100 ⁇ g/mL ampicillin was added. I did.
  • the target vectors were extracted from the cultured E.coli by the Midi-prep method, and the phenol/chloroform gene purification method and the ethanol (Ethanol) precipitation method were used to extract the target vectors from P. tricornutum ( P. tricornutum). ) A high purity vector (concentration 1.0 ⁇ g/ ⁇ L) required for transformation was obtained.
  • the vector was coated on gold nanoparticles, and then transformed by transferring the target vector to Paeodactylum trikornutum through a gene gun method (Particle bombardment).
  • the transformants were selected on F/2 agar medium containing 100 ⁇ g/mL of zeocin.
  • Example 3 the Paeodactylum tricornutum cells were prepared in five different structures (fcpApro:SP-GFP, HASP1pro:SP-GFP, fcpApro:GFP, HASP1pro:GFP and promoter- by particle bombardment). less GFP).
  • the putative transformants were selected for 2 to 4 weeks on F/2 agar medium containing zeocin. Subsequently, zeocin-resistant colonies were transferred to the same medium for further growth, and their zeocin resistance was reevaluated and confirmed. The presence of the transformant in the genome of the putative transformant was confirmed by gDNA-PCR using Paeodactylum trichornutum genomic DNA as a template. More than 400 colonies were grown and selected in zeocin containing medium.
  • Each transformant colony was inoculated into 200 ⁇ L of F/2 medium containing 50% artificial seawater, cultured for 5 days, and then centrifuged (3500 rpm, 15 minutes, 20° C.) to remove the supernatant. After 10 ⁇ L dissolution buffer (2% Nonidet P-40) was added, the solution was used for PCR after 10 minutes. Thereafter, PCR was performed using pPha-Up-NdeI-F and pPha-Down-MCS-R primers and taq polymerase.
  • Transformants having confirmed the insertion of the target gene were inoculated in 200 mL of F/2 agar medium containing 50% artificial seawater at an initial concentration of 1.0 ⁇ 10 5 cells/mL, and cultured while aeration.
  • the expression pattern according to the number of culture days was confirmed by observing the GFP expression according to the number of culture days by observation with a fluorometer and a fluorescence microscope.
  • the GFP content secreted into the culture medium was also measured by the same method.
  • a lysis buffer 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM) PMSF, 1 mM EDTA, 1% Nonidet P40, 0.1% Tweeen 20
  • the supernatant was taken again through centrifugation (3500 rpm, 15 minutes, 4° C.), and the GFP concentration was measured through a fluorescence meter (excitation 485/20 nm, emission 528/20 nm) and observed with a fluorescence microscope.
  • Transformants were generated growth curves over 22 days with a par ohdak tilrum tree cor nutum (P. tricornutum) periodic assessment of the cell inoculation and cell switching. From the growth curve obtained by culturing the transformed Paeodactylum tricornutum, it was confirmed that it took approximately 4 and 8 days to reach the log phase and stationary phase. Cell density in all transgenic lines exceeded 1 ⁇ 10 7 cells/mL in stationary phase.
  • real-time RT-OCR real-time RT-OCR
  • the levels of GFP-containing transcripts in the transgenic lines expressing HASP1pro:GFP were 3 and 44 times higher than those expressing fcpApro:GFP on days 4 and 8, respectively (FIG. 5A).
  • the fcpA promoter is primarily activated during the log phase.
  • the HASP1 promoter activity was higher than that of the fcpA promoter during the same step.
  • GFP expression was maintained high even in the stationary phase. Rather, the HASP1 promoter activity was maintained at a higher level in the stationary phase than in the log phase.
  • the HASP1 promoter is a suitable tool for overexpressing a recombinant protein in Paeodactylum tricornutum.
  • GFP fluorescence could not be detected in the culture supernatant of the transformed line expressing HASP1pro:GFP or fcpApro:GFP. This is because the signal peptide is deficient (FIG. 5B).
  • the fluorescence signal from the intracellular GFP of the HASP1pro:SP-GFP transgenic line was similar to the fcpApro:SP-GFP transgenic line during the log phase, but was 3 times higher in the stationary phase.
  • the level of GFP secreted from the fcpApro:SP-GFP transgenic line was increased by 0.01 ⁇ g/mL in the stationary phase (FIG. 5B).
  • HASP1 promoter significantly increased the amount of GFP expression than the fcpA promoter, suggesting that it works remarkably strongly in the stationary phase.
  • GFP fluorescence green
  • chlorophyll autofluorescence red
  • GFP fluorescence in the fcpApro:GFP transgenic line diffused throughout the cytoplasm in both the logarithmic and early quiescent phase, but abruptly decreased in the late quiescent phase (Fig. 6b).
  • the HASP1 signal peptide brought about significant changes in the intracellular localization of GFP during all growth stages.
  • GFP fluorescence of the fcpApro:SP-GFP line was weakly localized near the chloroplast compartment in the log phase.
  • the GFP fluorescence of the HASP1pro:SP-GFP line rapidly increased from the log phase to the early arrest phase (8 days) and remained at a high level throughout the late arrest phase (FIG. 6D).
  • HASP1 signal peptide efficiently induces the entry of GFP into the protein secretion pathway.
  • the promoter and signal peptide of the HASP1 gene can be a powerful tool for the efficient expression and secretion of the recombinant protein throughout all growth stages of Phaeodactylum tricornutum .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Botany (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 파에오닥틸룸 트리코르누툼에서 단백질의 과발현을 유도하는 신규 프로모터 HASP1, 상기 발현된 단백질의 분비를 유도하는 신규 단백질 분비서열인 신호 펩타이드 HASP1-SP, 상기 HASP1 및 HASP1-SP를 포함하는 발현벡터, 발현벡터가 숙주세포에 도입된 형질전환체, 상기 형질전환체를 배양하여 배양물을 수득하는 단계를 포함하는 목적 단백질의 생산방법, 상기 발현벡터를 숙주세포에 형질전환하는 단계를 포함하는 목적 단백질을 발현시키는 방법 및 상기 발현벡터를 숙주세포에 형질전환하는 단계를 포함하는 숙주세포에서 목적 단백질의 발현량을 증가시키는 방법에 관한 것이다. 본 발명의 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)에서 단백질의 과발현을 유도하는 신규 프로모터 HASP1, 상기 발현된 단백질의 분비를 유도하는 신규 단백질 분비서열인 신호 펩타이드 HASP1-SP, 및 상기 HASP1 및 HASP1-SP를 포함하는 발현벡터를 이용하여 재조합 단백질의 생산성을 현저히 증대시킬 수 있는 강력한 유전자 도구로 사용될 수 있을 것으로 기대된다.

Description

파에오닥틸룸 트리코르누툼의 신규 프로모터 HASP1와 이의 신호 펩타이드 및 이의 용도
본 발명은 미세조류 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)의 신규 프로모터 HASP1와 이의 신호 펩타이드 및 이의 용도에 관한 것으로, 구체적으로 본 발명은 파에오닥틸룸 트리코르누툼에서 단백질의 과발현을 유도하는 신규 프로모터 HASP1, 상기 발현된 단백질의 분비를 유도하는 신규 단백질 분비서열인 신호 펩타이드 HASP1-SP, 상기 HASP1 및 HASP1-SP를 포함하는 발현벡터, 발현벡터가 숙주세포에 도입된 형질전환체, 상기 형질전환체를 배양하여 배양물을 수득하는 단계를 포함하는 목적 단백질의 생산방법, 상기 발현벡터를 숙주세포에 형질전환하는 단계를 포함하는 목적 단백질을 발현시키는 방법 및 상기 발현벡터를 숙주세포에 형질전환하는 단계를 포함하는 숙주세포에서 목적 단백질의 발현량을 증가시키는 방법에 관한 것이다.
미세조류는 고부가 천연물 및 기능성 단백질을 생산하기 위한 바이오 공장으로 각광받고 있다. 미세조류 중에서 규조류는 해양 및 담수 환경에서 서식하는 단세포성 진핵생물인 식물 플랑크톤으로 지구상 주요 광합성 생산성의 약 20%를 차지한다. 상기 규조류는 다른 미세조류보다 탄소 고정능이 우수하다.
규조류는 다양한 생물공학 응용 분야에서 활발하게 연구되고 있으며, 생물 약제 및 2차 대사산물의 생산을 위한 생물 반응기(bioreactor)로 사용될 수 있다.
규조류 중에서 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)은 규소(silicon)을 이용하는 해안 규조류이다. 상기 파에오닥틸룸 트리코르누툼의 전체 게놈(genome)은 약 27.6Mb의 크기이며, 12,177개의 유전자를 포함하는 33개의 염색체로 이루어져 있다. 영양소, 광원, 및 비생물학적 스트레스를 포함하는 다양한 조건에서 생장한 파에오닥틸룸 트리코르누툼의 세포에서 다수의 발현 서열 태그(expressed sequence tags; ESTs)가 확인되고 있다. 또한, 파에오닥틸룸 트리코르누툼에서는 유전자 과발현, 유전자 침묵, 유전자 편집, 및 플라스미드 전달과 같은 유전자 조작 도구가 연구되고 있다.
구체적으로, 파에오닥틸룸 트리코르누툼의 형질전환에 대한 유전자 조작 도구로서 pPha-T1 벡터가 처음으로 개발되었다(Apt, Grossman et al., 1996). 상기 pPha-T1은 광합성과 연관된 푸코잔틴 클로로필 a 결합 단백질(fucoxanthin chlorophyll a binding protein; FcpA) 프로모터를 사용하였다. 또한 니트레이트 결핍시 발현되는 니트레이트 환원 효소(nitrate reductase; NR) 프로모터를 적용한 발현벡터도 개발되었다(Poulsen and Kroger., 2005).
하지만, 상기 두 프로모터는 모두 성장주기 중 대수기(exponential phase)에 단백질을 발현하다가 정지기(stationary phase)에서는 발현이 현저히 감소하는 단점이 있어, 여전히 미세조류에서 재조합 단백질의 과발현을 유도하는 프로모터가 부재한 상황이다.
한편, 단백질 과발현 후, 정제과정의 효율성을 위해 단백질의 분비 유도가 필수적이므로, 이에 적합한 분비 신호 펩타이드가 필요하다.
미세조류의 분비 펩타이드(secretion peptide)로서 클라미도모나스 레인하드티아이(Chlamydomonas reinhardtii)의 ARS1이 보고되어 있지만(Ramos et al., 2017), 파에오닥틸룸 트리코르누툼에서는 인간 IgG 항체 발현 시 배양액으로 분비되는 것이 알려져 있을 뿐(Hempel et al., 2012), 분비 펩타이드에 대한 연구는 진행된 바가 없다.
따라서, 미세조류로부터 단백질의 발현 및 정제과정의 효율 증대를 위해 발현단백질의 분비를 유도하는 신호 펩타이드의 개발 역시 필요한 실정이다.
본 발명자들은 미세조류 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)에서 재조합 단백질을 높은 수준으로 생산하기 위한 새로운 발현 시스템을 개발하기 위해 예의 노력한 결과, 파에오닥틸룸 트리코르누툼에서 재조합 단백질의 과발현을 강력하게 유도하는 신규 프로모터인 HASP1 프로모터 및 배양 배지로부터 분비를 효율적으로 촉진하는 신호 펩타이드 HASP1-SP를 개발하였고, 모든 성장단계 특히, 정지기에서도 발현을 강력히 유도하여 재조합 단백질의 생산성이 증대됨을 확인함으로써 본 발명을 완성하였다.
본 발명의 하나의 목적은 서열번호 1의 폴리뉴클레오티드로 이루어진 HASP1 프로모터를 제공하는 것이다.
본 발명의 다른 목적은 서열번호 2의 폴리뉴클레오티드로 이루어진 HASP1 신호 펩타이드를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 HASP1 프로모터 및/또는 HASP1 신호 펩타이드를 포함하는 발현벡터를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 발현벡터가 숙주세포에 도입된 형질전환체를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 형질전환체를 배양하여 배양물을 수득하는 단계 및 상기 배양물로부터 목적 단백질을 회수하는 단계를 포함하는 목적 단백질의 생산방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 발현벡터를 숙주세포에 형질전환하는 단계를 포함하는 목적 단백질을 발현시키는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 발현벡터를 숙주세포에 형질전환하는 단계를 포함하는 숙주세포에서 목적 단백질의 발현량을 증가시키는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 숙주세포에서 목적 단백질의 발현량을 증가시키기 위한, 상기 프로모터 및/또는 신호 펩타이드의 용도를 제공하는 것이다.
본 발명의 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)에서 단백질의 과발현을 유도하는 신규 프로모터 HASP1, 상기 발현된 단백질의 분비를 유도하는 신규 단백질 분비서열인 신호 펩타이드 HASP1-SP, 및 상기 HASP1 및 HASP1-SP를 포함하는 발현벡터를 이용하여 재조합 단백질의 생산성을 현저히 증대시킬 수 있는 강력한 유전자 도구로 사용될 수 있을 것으로 기대된다.
도 1은 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)의 배양액에서 단백질의 분석을 위한 SDS-PAGE 결과를 나타낸 도이다.
도 2는 LC-MS/MS를 통해 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)의 배양액에 존재하는 HASP1 단백질의 서열을 특정한 도이다.
도 3은 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)의 genomic DNA 상에서 HASP1 프로모터 및 신호 펩타이드 서열의 위치를 나타낸 도이다.
도 4는 HASP1 프로모터 또는 HASP1 프로모터 및 신호 펩타이드를 포함하는 발현 벡터를 나타낸 도이다.
도 5는 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)의 성장주기에 따른 HASP1 프로모터 및 신호 펩타이드의 작용을 나타낸 것으로, 도 5a는 성장주기에 따른 세포 내 GFP 발현 농도를 나타낸 도이고, 도 5b는 성장주기에 따른 배지로 분비되는 GFP의 농도 변화를 나타낸 도이다.
도 6은 형광현미경을 통해 배양 주기에 따른 GFP 발현 및 신호 펩타이드 존재 여부에 따라 변화된 GFP 발현 위치를 나타낸 것으로, 도 6a는 GFP가 발현되지 않은 대조군을 나타낸 도이고, 도 6b는 FcpA 프로모터에 의해 발현되는 GFP를 나타낸 도이며, 도 6c는 HASP1 프로모터에 의해 발현되는 GFP를 나타낸 도이고, 도 6d는 HASP1 신호 펩타이드가 있는 경우 발현되는 GFP를 나타낸 도이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 발명에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시형태에도 적용될 수 있다. 즉, 본 발명에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 볼 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 발명에 기재된 본 발명의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 발명에 포함되는 것으로 의도된다
상기 목적을 달성하기 위한 본 발명의 하나의 양태는 하기 서열번호 1의 폴리뉴클레오티드로 이루어진, 미세조류에서 목적 단백질의 과발현을 유도하는 HASP1 프로모터를 제공한다.
서열번호 1
5'-catacagtga atgtaacttt cgaattgaca gtattagtag tcgtattgac agtgaggcac
gcccctcaat gtgcgaggtg gaaaatatac cagcatgaca atgaatcttg gagattcttt
tgctgtcatc aagattcacc gccaaatctt caggaaccta tcacgtccac aggcgatgtt
aattcttgag tcgtcaaaac aaagtcctgt cctacctgta gaagttgaca gcgagcaatt
gtatgcaaac ttctgacttt gttataataa cattaaaggt aattaagtat cttcaattag
gcattttgtc actgtcagtc cgttccgaca atataggtag atttggaatg aatcttttct
atgctgctgc gaatcttgta cacctttgag gccgtagatt ctgtccgacg aagcgataat
tattgcaaaa tacatggact cattattttg attcgatttc tttttggtat ccgactcgaa
aagatccatc acggcgagc-3'
본 발명의 "HASP1"은 미세조류 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)에서 높은 함량으로 검출된 단백질(highly abundant secreted protein 1; HASP1)로서, 1,793개의 아미노산으로 구성된 C-말단 영역에 피타아제 유사 도메인을 함유한 피타아제 수퍼패밀리에 속하는 단백질이다.
본 발명의 "미세조류"는 광합성 작용을 하는 수중에 존재하는 식물 플랑크톤을 말한다. 50여만 종으로 해양 또는 담수에 존재하며 온천, 심해 등의 열악한 환경에서도 생명력을 가진다. 상기 미세조류는 바이오 연료 및 기능성 단백질로서 활용도가 높다.
본 발명의 "파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)"은 규소(silicon)을 이용하는 해안 규조류이다. 상기 규조류는 해양 및 담수 환경에서 서식하는 단세포성 진핵생물로서, 지구상 주요 광합성량의 약 20%를 차지할 정도로 탄소 고정능이 뛰어난 미세조류이다. 상기 파에오닥틸룸 트리코르누툼의 전체 게놈(genome)은 약 27.6Mb의 크기이며, 12,177개의 유전자를 포함하는 33개의 염색체로 이루어져 있다.
본 발명의 "프로모터"는 작동 가능하게 연결된 유전자의 전사를 허용하고 조절하는 폴리뉴클레오티드 서열을 말한다. 상기 프로모터는 RNA 폴리머라제를 결합시키기 위한 인식 서열 및 전사용 개시 부위를 포함한다. 특정 세포 유형 또는 숙주 세포내 목적 단백질을 발현시키기 위해 선택된다. 즉, 상기 폴리머라제에 대한 결합 부위를 포함하고 프로모터 하위 유전자의 mRNA로의 전사 개시 활성을 가지는, 암호화 영역의 상위(upstream)의 비해독된 핵산서열, 즉, 폴리머라제가 결합하여 유전자의 전사를 개시하도록 하는 DNA 영역을 말한다. mRNA 전사 개시부위의 5'부위에 위치한다.
본 발명의 "HASP1 프로모터"는 상기 파에오닥틸룸 트리코르누툼 유래 프로모터로서, 서열번호 1의 폴리뉴클레오티드를 포함하고, 미세조류에서 목적 단백질의 과발현을 유도한다. 상기 프로모터는 HASP1 유전자의 개시 코돈 이전의 499bp 상위 영역(upstream region)에 존재한다. 상기 HASP1 유전자는 HASP1 단백질(PHATRDRAFT_47612)을 코딩하는 유전자이며, 이의 염기서열은 NCBI의 GenBank 등의 공지된 데이터베이스에서 얻을 수 있다(NCBI accession number: XM_002181840.1).
본 발명의 HASP1 프로모터는 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)에서 처음으로 규명된 신규한 프로모터이다.
상기 폴리뉴클레오티드로 이루어진 핵산 분자와 동일하거나 상응하게 프로모터로 작용할 수 있다면, 상기 서열과 85% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 98% 이상, 보다 더욱 구체적으로는 99% 이상의 상동성을 나타내는 염기 서열도 제한없이 포함할 수 있다. 또한 이러한 상동성을 갖는 염기서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 염기서열도 본 발명의 범위 내에 포함됨은 자명하다.
본 발명의 "상동성"은 두 개의 폴리뉴클레오티드 또는 폴리펩타이드 모이티 사이의 동일성의 퍼센트를 말한다. 하나의 모이티로부터 다른 하나의 모이티까지의 서열 간 상동성은 알려진 당해 기술에 의해 결정될 수 있다. 예를 들면, 상동성은 서열정보를 정렬하고 용이하게 입수 가능한 컴퓨터 프로그램을 이용하여 두 개의 폴리뉴클레오티드 분자 또는 두 개의 폴리펩티드 분자 간의 서열 정보, 예로는 점수(score), 동일성(identity) 및 유사도(similarity) 등의 매개 변수(parameter)를 직접 정렬하여 결정될 수 있다(예: BLAST 2.0). 또한, 폴리뉴클레오티드 간 상동성은 상동 영역 간의 안정된 이중가닥을 이루는 조건하에서 폴리뉴클레오티드의 혼성화한 후, 단일-가닥-특이적 뉴클레아제로 분해시켜 분해된 단편의 크기를 결정함으로써 결정할 수 있다.
본 발명의 "목적 단백질"은 본 발명에서 제공하는 HASP1 프로모터와 작동가능하게 연결되어, 상기 프로모터를 사용하여 미세조류에서 특이적으로 발현의 증가를 유도하고자 하는 단백질을 의미한다. 구체적인 예로, 미세조류에 존재하거나 또는 미세조류로부터 생산될 수 있는 단백질일 수 있으나, 이에 제한되지 않으며, 발명의 목적에 맞게 당업자에 의해 적절히 선택될 수 있다. 보다 구체적으로는 규조류에서 특이적으로 발현의 증가를 유도하고자 하는 단백질이며, 보다 더 구체적으로는 파에오닥틸룸 트리코르누툼에서 특이적으로 발현의 증가를 유도하고자 하는 단백질을 의미할 수 있다.
본 발명에서는 "목적 단백질"과 "목적 산물"이 혼용되어 기재될 수 있다.
상기 파에오닥틸룸 트리코르누툼 유래 HASP1 프로모터는 미세조류에서 목적 단백질의 발현 증가를 유도하는 효과를 제공할 수 있다. 이러한 상기 프로모터의 효과는 본 발명자들에 의하여 처음으로 규명된 것이다.
본 발명의 구체적인 일 구현예에서, HASP1 프로모터 및 목적 단백질 GFP가 포함된 발현벡터를 파에오닥틸룸 트리코르누툼에 형질전환시킨 경우, 상기 GFP의 발현이 대조군에 비해 현저히 증가하는 것을 확인하였다(실시예 5).
본 발명의 다른 하나의 양태는 하기 서열번호 2의 폴리뉴클레오티드에 의해 발현되거나 또는 하기 서열번호 3의 아미노산 서열로 구성된 HASP1 신호 펩타이드를 제공한다.
서열번호 2
5'-accatgaatc ttcgttgtat ccttccgttt ctcctcgcaa gcttctcggc tggg-3'
서열번호 3
N-MNLRCILPFLLASFSAGA-C
본 발명의 "HASP1"은 상기 기재된 바와 같다.
본 발명의 "신호 펩타이드"는 분비 단백질 또는 막 단백질의 N 말단에 위치하며, 단백질이 막을 통과할 때 신호가 되는 15 내지 20개의 아미노산으로 구성된 특수한 영역을 말한다.
본 발명의 "HASP1 신호 펩타이드"는 HASP1 유전자의 3'방향으로 54bp인, HASP1 분비를 담당하는 18개의 아미노산으로, 서열번호 2의 폴리뉴클레오티드를 포함한다.
상기 폴리뉴클레오티드로 이루어진 핵산 분자와 동일하거나 상응하게 신호 펩타이드로 작용할 수 있다면, 상기 서열과 85% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 98% 이상, 보다 더욱 구체적으로는 99% 이상의 상동성을 나타내는 염기 서열도 제한없이 포함할 수 있다. 또한 이러한 상동성을 갖는 염기서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 염기서열도 본 발명의 범위 내에 포함됨은 자명하다.
본 발명의 "상동성"은 상기 기재된 바와 같다.
본 발명의 구체적인 일 구현예에서, 상기 HASP1 신호 펩타이드는 목적 단백질인 GFP 단백질의 진입을 효율적으로 유도함을 확인하였다(실시예 6).
본 발명의 또 다른 하나의 양태는 상기 서열번호 1의 HASP1 프로모터 및/또는 서열번호 2의 HASP1 신호 펩타이드를 포함하는 발현벡터를 제공한다.
본 발명의 "HASP1", "프로모터", "HASP1 프로모터", "신호 펩타이드", 및 "HASP1 신호 펩타이드"는 상기 기재된 바와 같다.
본 발명의 "발현벡터"는 적합한 숙주 내에서 목적 유전자를 발현시킬 수 있도록 유전 물질을 보유하는 인위적인 DNA 분자로, 구체적으로 적합한 조절 서열에 작동 가능하게 연결된 유전자의 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있으나, 이에 제한되지 않는다. 본 발명의 프로모터는 HASP1 프로모터일 수 있다.
본 발명의 목적상, 상기 재조합 발현벡터는 상기 프로모터와 작동 가능하게 연결된, 목적 단백질을 암호화하는 외래 유전자를 포함할 수 있다.
본 발명의 용어, "외래 유전자"는 외부에서 식물체로 도입되는 유전자를 의미하며, 개체(즉, 형질전환을 유도하고자 하는 대상)에 이미 존재하는 것이거나, 또는 존재하지 않는 것일 수 있다. 상기 외래 유전자의 염기 서열은 목적 단백질의 코돈 최적화를 통하여 얻어질 수 있다.
본 발명의 "작동 가능하게 연결"은 본 발명의 프로모터 활성을 갖는 핵산 서열이 목적 단백질을 코딩하는 유전자의 전사를 개시 및 매개하도록, 상기 유전자 서열과 프로모터 서열이 기능적으로 연결되어 있는 것을 의미한다. 작동가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 연결은 당업계의 연결 효소 등을 사용하여 제작할 수 있으나, 이에 제한되지 않는다.
본 발명에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, λMBL3, λMBL4, λⅨII, λASHII, λAPII, λt10, λt11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 본 발명에서 사용 가능한 벡터는 특별히 제한되는 것이 아니며, 공지된 발현 벡터를 사용할 수 있다. 그 예로 pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pCES208 벡터 등을 사용할 수 있고, 구체적으로 pPha 벡터일 수 있으나, 이에 제한되지 않는다.
또한, 숙주세포 내 염색체 삽입용 벡터를 통해 염색체 내에 내재적 프로모터를 본 발명의 프로모터 활성을 갖는 핵산 분자로 교체시킬 수 있다. 상기 핵산 분자의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합에 의하여 이루어질 수 있다. 본 발명의 벡터는 상동재조합을 일으켜서 염색체 내로 삽입될 수 있으므로 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 발명의 발현벡터는 HASP1 프로모터 또는 HASP1 프로모터 및 HASP1 신호 펩타이드를 포함하는 발현벡터일 수 있다.
본 발명의 또 다른 하나의 양태는 상기 발현벡터가 숙주세포에 도입된 형질전환체를 제공한다.
본 발명의 "발현벡터"는 상기 기재된 바와 같다.
본 발명의 "형질전환"은 표적 단백질을 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 단백질이 발현할 수 있도록 하는 것을 말한다.
형질전환된 폴리뉴클레오티드는 숙주세포 내에 발현될 수 있기만 하면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함한다. 또한, 상기 폴리뉴클레오티드는 목적 단백질을 코딩하는 DNA 및 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 폴리뉴클레오티드는, 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함한다. 본 발명의 목적상 상기 프로모터는 본 발명의 서열번호 1의 폴리뉴클레오티드 서열을 가지는 프로모터 활성을 갖는 핵산 분자를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어, 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있다.
본 발명의 벡터를 형질전환시키는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당해 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 유전자총(particle bombardment), 전기천공법(electroporation), 인산칼슘 (CaPO4) 침전, 염화칼슘 (CaCl2) 침전, 미세주입법 (microinjection), 폴리에틸렌글리콜 (PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
본 발명의 "숙주세포"는 본 발명의 프로모터 활성을 갖는 핵산 분자가 도입되어 프로모터로 작동할 수 있는 미생물을 말한다. 본 발명의 구체적인 일 구현예에서, 상기 미생물은 미세조류일 수 있고, 구체적으로 파에오닥틸룸 속(Phaeodactylum sp.)일 수 있으며, 보다 구체적으로 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)일 수 있으나, 이에 제한되지 않는다.
본 발명의 "형질전환체"는 HASP1 프로모터 및/또는 HASP1 신호 펩타이드 및 목적단백질을 포함하는 발현벡터를 상기 숙주세포인 파에오닥틸룸 트리코르누툼 내로 도입하여 형질전환된 미생물을 말한다.
본 발명의 구체적인 일 구현예에서, 상기 형질전환체는 목적 단백질인 GFP의 발현이 세포 성장주기 중 정지기에서도 과발현되는 것을 확인하였다(실시예 5).
본 발명의 또 다른 하나의 양태는 상기 형질전환체를 배양하여 배양물을 수득하는 단계, 및 상기 배양물로부터 목적 단백질을 회수하는 단계를 포함하는 목적 단백질의 생산방법을 제공한다.
본 발명의 "형질전환체", 및 "목적 단백질"은 상기 기재된 바와 같다.
본 발명의 "배양"은 미생물을 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다. 본 발명에서 파에오닥틸룸 속 미생물을 이용하여 목적 산물을 제조하는 방법은 당업계에 널리 알려져 있는 방법을 이용하여 수행할 수 있다. 구체적으로, 상기 배양은 배치 공정, 주입 배치 또는 반복 주입 배치 공정(fed batch or repeated fed batch process)에서 연속식으로 배양할 수 있으나, 이에 제한되지 않는다.
본 발명의 배양에 사용되는 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 한다. 사용될 수 있는 당원으로는 글루코즈, 수크로즈, 락토즈, 프락토즈, 말토즈, 전분, 셀룰로즈와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 글루콘산, 아세트산, 피루브산과 같은 유기산이 포함될 수 있으나, 이에 제한되는 것은 아니다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있다.
사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산 암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함될 수 있으나, 이에 제한되는 것은 아니다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있다.
사용될 수 있는 인원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함될 수 있으나, 이에 제한되는 것은 아니다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있다. 마지막으로, 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장 물질이 사용될 수 있다. 또한, 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기된 원료들은 배양과정에서 배양물에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있다.
수산화나트륨, 수산화칼륨, 암모니아와 같은 기초 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다. 또한, 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 호기 상태를 유지하기 위해 배양물 내로 산소 또는 산소-함유 기체를 주입할 수 있다. 배양물의 온도는 보통 20℃ 내지 45℃, 바람직하게는 25℃ 내지 40℃일 수 있으나, 조건에 따라 변경이 가능하나, 이에 제한되지 않는다.
본 발명의 목적 산물을 제조하는 방법은, 미생물 또는 배양물로부터 목적 산물 회수하는 단계를 포함할 수 있다. 본 발명의 "회수"는 미생물 또는 배양물로부터 목적 산물을 수득하는 것으로서 당업계에 알려진 방법, 예컨대 원심분리, 여과, 음이온 교환 크로마토그래피, 결정화 및 HPLC 등이 사용될 수 있으나, 이들 예에 제한되는 것은 아니다.
상기 회수 단계는 정제 공정을 포함할 수 있으며, 당업자는 공지된 여러 정제 공정 중 필요에 따라 선택하여 활용할 수 있다.
본 발명의 또 다른 하나의 양태는 상기 발현벡터를 숙주세포에 형질전환하는 단계를 포함하는 목적 단백질을 발현시키는 방법을 제공한다.
본 발명의 또 다른 하나의 양태는 상기 발현벡터를 숙주세포에 형질전환하는 단계를 포함하는 숙주세포에서 목적 단백질의 발현량을 증가시키는 방법을 제공한다.
본 발명의 "발현벡터", "숙주세포", "형질전환", 및 "목적 단백질"은 상기 기재된 바와 같다.
본 발명의 구체적인 일 구현예에서, HASP1 프로모터 및/또는 HASP1-SP 신호 펩타이드를 포함하는 발현벡터를 파에오닥틸룸 트리코르누툼에 형질전환시킨 경우, 재조합된 목적 단백질인 GFP의 발현이 대조군보다 현저히 증가함을 확인하였다. 아울러, 세포 성장단계 중 대수기뿐 아니라 정지기에서도 상기 목적 단백질의 발현량이 증대됨을 확인하였다(실시예 5 내지 6).
이에, 본 발명의 HASP1 프로모터 및/또는 이의 신호 펩타이드를 포함하는 발현벡터는 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)의 모든 성장단계에 걸쳐 재조합 단백질의 효율적인 발현 및 분비를 위한 강력한 도구가 될 수 있다.
본 발명의 또 다른 하나의 양태는, 숙주세포에서 목적 단백질의 발현량을 증가시키기 위한, 상기 프로모터 또는 신호 펩타이드의 용도를 제공한다.
이하, 실시예를 통하여 본 발명을 보다 상세히 설명하고자 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 한정되는 것은 아니다.
실시예 1. 파에오닥틸룸 트리코르누툼( Phaeodactylum tricornutum )의 분비 단백질 선별 및 동정
본 발명의 미세조류 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)은 미국 오스틴 소재 텍사스 대학의 조류 균주 은행(UTEX culture collection of Algae)으로부터 분양 받았다. 상기 파에오닥틸룸 트리코르누툼 균주는 고온고압으로 멸균된 50% 인공 해수를 포함하는 F/2 배지 200mL에 초기 농도 1 Х 105 cells/mL 농도로 접종하여 배양하였다.
파에오닥틸룸 트리코르누툼이 성장주기 상 정지기(stationary phase)에 도달했을 때, 즉 배양 후 5 내지 6일 차에 20℃에서 15분간 3500rpm으로 원심분리하여 세포 펠렛을 제거하고, 남은 배양액을 5kDa 차단막(cut-off membrane)을 갖춘 원심분리 필터(Vivaspin, Satorius, Goettingen, Germany)를 사용하여 농축하였다.
12% SDS-PAGE 젤에서 전기영동을 통해 단백질을 분리한 후, 쿠마시블루 염색(Coomassie blue staining)으로 시각화하였다(도 1). 상기 분리된 단백질을 젤에서 절단하여 in-gel digestion을 통해 수득하였다.
이 후, LC-MS/MS(LTQ XL linear ion trap mass spectrum, Thermo Scientific)을 통해 C18 트랩 컬럼(trap column) 2.5 cm Х 100 μm(Upchurch Scientific 및 수제 역상(homemade reverse phase) C18 마이크로 컬럼(micro column) 10 cm Х 100 μm(Nanobaume)을 이용하여 분석하였다.
Sorcerer-SEQUEST(version 3.5)를 통해 MS/MS data 분석 및 UniProt P. tricornutum 단백질 데이터베이스를 통해 단백질 서치(search)를 진행하였다.
그 결과, 468개의 단백질을 검출하였고, 그 중에서 가장 높은 함량을 보인 단백질은 PHATRDRAFT_47612 (NCBI accession number: XM_002181840.1)이며 44 %의 서열 범위(sequence coverage)로 데이터베이스 검색을 통해 동정되었다(도 2). 상기 단백질은 1,793개의 아미노산으로 구성된 HASP1(highly abundant secreted protein 1)단백질로서, C-말단 영역에 피타아제 유사 도메인(phytase-like domain)을 함유하는 피타아제 수퍼패밀리에 속한다.
상기 HASP1 단백질은 배양 배지에서 다른 단백질의 단백질 수준보다 현저히 높았다(표 1).
# Description Uniprot accession number Molecular weight Spectrum counts Note
1 Predicted protein OS=Phaeodactylum tricornutum (strain CCAP 1055/1) GN=PHATRDRAFT_47612 PE=4 SV=1 B7G4A0_PHATC 84 kDa 1811 HASP1
2 Predicted protein OS=Phaeodactylum tricornutum (strain CCAP 1055/1) GN=PHATR_46677 PE=4 SV=1 B5Y3F2_PHATC 51 kDa 245
3 Predicted protein OS=Phaeodactylum tricornutum (strain CCAP 1055/1) GN=PHATRDRAFT_43513 PE=4 SV=1 B7FSH1_PHATC 49 kDa 211
4 Endo-1,3-beta-glucosidase OS=Phaeodactylum tricornutum (strain CCAP 1055/1) GN=PHATRDRAFT_54681 PE=4 SV=1 B7G259_PHATC 112 kDa 201
5 Predicted protein OS=Phaeodactylum tricornutum (strain CCAP 1055/1) GN=PHATRDRAFT_49678 PE=4 SV=1 B7GBF3_PHATC 79 kDa 157
따라서, HASP1 단백질을 선택하고, 파에오닥틸룸 트리코르누툼에서 재조합 단백질의 생산 및 분비에 효과가 있는 잠재적인 프로모터 영역과 신호 펩타이드를 분리하였다. 또한, 파에오닥틸룸 트리코르누툼에서 주로 사용되는 fcpA 프로모터를 대조군으로 사용하였다.
실시예 2. 파에오닥틸룸 트리코르누툼( Phaeodactylum tricornutum )으로부터 프로모터 HASP1 및 신호 펩타이드 HASP1-SP 분리와 이를 포함하는 벡터의 구성
파에오닥틸룸 트리코르누툼 게놈은 다른 고등 진핵생물보다 상대적으로 높은 유전자 밀도를 가지고 있다. 이에, 약 500bp의 내인성 유전자 영역이 전이 유전자 발현을 강력하게 유도하여 프로모터 활성을 수득하기에 충분하였다.
이에, HASP1 유전자의 개시 코돈 이전의 499bp 상위영역(upstream region)을 잠재적인 프로모터로 선정하였다(도 3).
또한, SignalP 소프트웨어를 사용하여 HASP1 유전자의 3'방향으로 54bp인, 즉 HASP1 분비를 담당하는 18개의 아미노산 길이의 신호 펩타이드를 선정하였다(도 3).
이후, 50% 인공해수가 포함된 F/2 배지에서 배양한 파에오닥틸룸 트리코르누툼 배양액 50mL을 20℃에서 3500rpm으로 15분간 원심분리하여 세포 펠렛을 수득한 후, 이로부터 genomic DNA(gDNA)를 추출하였다.
파에오닥틸룸 트리코르누툼의 gDNA로부터 HASP1-F 및 HASP1-R 프라이머 및 pfu 중합효소(polymerase)를 사용한 PCR을 통해 유전자 증폭하였고, NdeI 및 EcoRI 제한효소를 사용하여 pPha-T1 벡터(vector)의 fcpA 프로모터를 교체 하여 pPha-HASP1p 벡터를 구성하였다.
GFP 유전자는 pEGFP-C2 벡터로부터 GFP-F 및 GFP-R 프라이머를 사용한 PCR을 통해 증폭하였고, NheI 및 BamHI 를 사용하여 HASP1 프로모터 뒤에 삽입하여 pPha- HASP1p-GFP 벡터를 구성하였다.
HASP1 신호 펩타이드(HASP1-SP)는 유전자 합성을 하였고, pPha-HASP1p-GFP 벡터에 EcoRI 및 NheI 제한효소를 사용하여 프로모터 와 GFP 사이에 유전자를 삽입하여 pPha-HASP1p-SP-GFP 벡터를 구성하였다(도 4).
HASP1 프로모터와 fcpA 프로모터 특성 비교를 위해 pPha-T1 벡터에 상기 방법에 의해 pPha-T1-GFP 벡터 및 pPha-T1-SP-GFP 벡터를 구성하였다.
상기 벡터를 구성하기 위해 사용한 프라이머(primer) 및 합성되는 유전자는 표 2와 같다.
# Name Sequence Restriction enzyme Annotation
1 HASP1-F CATATGCATACAGTGAATGTAACTTTCG NdeI pPha-T1-HASP1; PCR and Genomic-DNA PCR
2 HASP1-R GAATTCGCTCGCCGTGATGGATCTTTTC EcoRI pPha-T1-HASP1; PCR
3 GFP-NheI-F GCTAGCATGGTGAGCAAGGGCGAGGAG
4 GFP-EcoRI-F GAATTCATGGTGAGCAAGGGCGAGGAG NheI/EcoRI/NdeI pPha-T1-gfp; PCR
5 GFP-R GGATCCTTACTTGTACAGCTCGTCCATGC BamHI pPha-T1-gfp; PCR
6 Kozak-SP-GFP GAATTCACCATGAATCTTCGTTGTATCCTTCCGTTTCTCCTCGCAAGCTTCTCGGCTGGGGCTAGCATGGTGAGCAAGGGCGAGGAG EcoRI-NheI Long primer for SP amplification; PCR
7 pPha-Up-NdeI-F GTGTCGGGGCTGGCTTAAC Genomic DNA PCR
8 pPha-Down-MCS-R GCCGCACGTCCCTGGTTG Genomic DNA PCR
실시예 3. 파에오닥틸룸 트리코르누툼( Phaeodactylum tricornutum )의 형질전환(transformation)
상기 실시예 2에서 구성한 벡터들은 E.coli DH5α(NEB® 5-alpha Competent E.coli)에 형질전환 후 형질전환된 E.coli를 100 μg/mL 앰피실린(ampicillin)이 첨가된 LB 배지에서 배양하였다.
배양한 E.coli로부터 미디프렙(Midi-prep) 방법으로 목적 벡터들을 추출하고, 페놀/클로로포름(phenol/chloroform) 유전자 정제법 및 에탄올(Ethanol) 침전법으로 파에오닥틸룸 트리코르누툼(P. tricornutum) 형질전환에 필요한 고순도 벡터(농도 1.0 μg/μL)를 확보하였다.
상기 벡터를 금나노입자에 코팅한 후, 유전자총 방법(Particle bombardment) 을 통해 파에오닥틸룸 트리코르누툼으로 목적 벡터를 전달함으로써 형질전환(transformation)시켰다.
상기 형질전환체는 제오신(zeocin) 100 μg/mL이 함유된 F/2 한천배지에서 선별(selection)을 진행하였다.
실시예 4. 파에오닥틸룸 트리코르누툼( Phaeodactylum tricornutum )의 형질전환체(transformant) 내 목적 유전자 삽입 여부의 확인
상기 실시예 3에서, 파에오닥틸룸 트리코르누툼 세포는 유전자총 방법(particle bombardment)에 의해 5가지 다른 구조(fcpApro:SP-GFP, HASP1pro:SP-GFP, fcpApro:GFP, HASP1pro:GFP 및 promoter-less GFP)로 형질 전환되었다. 추정된 형질전환체를 제오신(zeocin)을 함유하는 F/2 한천배지에서 2 내지 4주 동안 선별 하였다. 이어서, 제오신 내성 콜로니를 동일한 배지로 옮겨 더 성장시키고, 이들의 제오신 내성을 재평가하고 확인하였다. 추정된 형질전환체의 게놈 내의 형질전환 유전자의 존재는 파에오닥틸룸 트리코르누툼 게놈 DNA를 주형으로 사용하여 gDNA-PCR에 의해 확인되었다. 400개 이상의 콜로니가 제오신 함유 배지에서 생장되고 선택되었다.
각 형질전환체 콜로니를 50% 인공해수가 포함된 F/2 배지 200μL에 접종하여 5일간 배양한 후, 원심분리(3500rpm, 15분, 20℃) 후 상등액을 제거하였다. 10μL 용해버퍼(2% Nonidet P-40)를 첨가한 후 10분 후 상기 용액을 PCR에 사용하였다. 이 후, pPha-Up-NdeI-F 및 pPha-Down-MCS-R 프라이머 및 taq 중합효소(polymerase)를 사용하여 PCR을 진행하였다.
이를 통해, 제오신 내성 콜로니의 70% 이상이 게놈에 상응하는 형질전환된 유전자를 갖는 것을 확인하였다.
실시예 5. 파에오닥틸룸 트리코르누툼( Phaeodactylum tricornutum )의 HASP1 프로모터 활성 및 신호 펩타이드 HASP1-SP의 기능 확인
5-1. GFP 발현을 유도하는 HASP1 프로모터 활성의 정량화
목적 유전자의 삽입 여부를 확인한 형질전환체를 50% 인공해수가 포함된 F/2 한천배지 200mL에 초기농도 1.0 Х 105 cells/mL 로 접종하여 통기(aeration)를 하면서 배양하였다. 배양일수에 따라 GFP 발현을 형광측정기(fluorometer) 및 형광현미경(fluorescence microscope) 관찰을 통해 배양일수에 따른 발현 패턴을 확인하였다. 또한, 배양액으로 분비되는 GFP 함량도 같은 방법으로 측정하였다.
구체적으로, 4 mL 샘플을 취하여 원심분리(3500rpm, 15분, 20℃)에서 세포 펠렛(cell pellet)을 확보한 후, 용해버퍼(50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM PMSF, 1 mM EDTA, 1% Nonidet P40, 0.1 % Tweeen 20)를 첨가하고, 20분간 반응시켰다. 이후, 다시 원심분리(3500 rpm, 15분, 4 ℃)를 통해 상등액을 취하여 형광 측정기(excitation 485/20 nm, emission 528/20 nm)를 통해 GFP 농도를 측정하였고 형광현미경으로 관찰하였다.
배양액 50 mL을 취하여 원심분리(3500rpm, 15분, 20℃)를 통해 상등액을 취한 후, 5kDa 차단막(cut-off membrane)을 갖춘 원심분리 필터(Vivaspin, Satorius, Goettingen, Germany)를 사용하여 농축하였고, 형광 측정을 통해 GFP 농도를 측정하였다.
형질전환된 파에오닥틸룸 트리코르누툼(P. tricornutum) 세포를 접종하고 세포 수의 주기적인 평가와 함께 22일 동안 생장곡선을 생성시켰다. 형질전환된 파에오닥틸룸 트리코르누툼을 배양하여 수득한 생장곡선으로부터, 대수기 및 정지기에 도달하는데 대략적으로 4일 및 8일이 걸리는 것을 확인하였다. 모든 형질전환 계통(transgenic line)에서 세포 밀도는 정지기에서 1 Х 107 cells/mL를 초과하였다.
대수기(4일차) 및 정지기(8일차)에서 각각의 형질전환 세포주로부터 총 RNA를 추출하여, 실시간-RT-PCR(real-time RT-OCR)에 의한 GFP-함유된 전사체의 수준을 측정함으로써 HASP1 프로모터의 활성을 fcpA 프로모터의 활성과 비교하였다. HASP1pro:GFP를 발현하는 형질전환 계통에서의 GFP-함유된 전사체의 수준(level)은 각각 4일째 및 8일째에 fcpApro:GFP를 발현하는 것보다 3배 및 44배 더 높았다(도 5a).
또한, 프로모터가 없는 GFP 대조군과 비교했을 때, HASP1 프로모터에 의해 유도된 GFP 발현 수준은 각각 4일 및 8일에 35배 및 764배 증가한 것을 확인하였다 (도 5a).
한편, fcpA 프로모터가 대수기 동안 주로 활성화된다는 것은 잘 알려져 있다. 주목할 것은, HASP1 프로모터 활성은 동일한 단계 동안 fcpA 프로모터의 활성보다 높았다는 점이다. 또한, HASP1 프로모터를 사용한 경우, 정지기에도 GFP 발현이 높게 유지되는 것을 확인하였다. 오히려 HASP1 프로모터 활성은 대수기보다 정지기에서 더 높은 수준으로 유지되었다.
반면, fcpA 프로모터를 사용한 경우는 대수기에서 GFP 발현이 증가하다가 정지기에서는 발현이 현저히 감소하였다(도 5a).
이는, HASP1 프로모터를 사용한 경우, GFP의 발현량이 fcpA 프로모터를 사용하는 경우보다 현저하게 증가하는 것을 나타낸다.
따라서, HASP1 프로모터는 파에오닥틸룸 트리코르누툼에서 재조합 단백질을 과발현 시키는 데 적합한 도구(tool)임을 시사한다.
5-2. GFP 분비를 효율적으로 유도하는 신호 펩타이드 HASP1-SP의 확인
GFP 분비에서 HASP1의 추정 신호 펩타이드의 역할을 조사하기 위해, 시간이 지남에 따라 파에오닥틸룸 트리코르누툼의 동일한 배양액에서 세포 내 분비된 GFP의 형광 신호를 측정하였다.
HASP1pro:GFP 또는 fcpApro:GFP를 발현하는 형질전환 계통의 배양 상등액에서 GFP 형광을 검출할 수 없었다. 이는 신호 펩타이드가 결핍되었기 때문이다(도 5b).
HASP1pro:SP-GFP 형질전환 계통의 세포 내 GFP로부터의 형광 신호는 대수기 동안 fcpApro:SP-GFP 형질전환 계통과 유사했지만, 정지기에서는 3배 더 높았다. fcpApro:SP-GFP 형질전환 계통에서 분비된 GFP 수준은 정지기에서 0.01μg/mL 증가하였다(도 5b).
한편, HASP1pro:SP-GFP 형질전환 계통에서 분비된 GFP 수준은 대수기에서 정지기까지 꾸준히 증가했다. 세포 외 GFP 농도는 대수기, 초기 정지기 및 후기 정지기에서 각각 0.01, 0.1 및 0.3μg/mL에 도달했다.
이는, fcpApro:SP-GFP 형질전환 계통에 비해 3배, 8배, 19배 증가한 값이다.
이를 통해, HASP1 프로모터가 fcpA 프로모터보다 GFP 발현양을 유의미하게 증가시키는 것을 확인하였고, 특히 정지기에서 현저히 강력하게 작동하는 것을 시사한다.
또한, HASP1 단백질로부터 유래한 신호 펩타이드가 효율적으로 GFP 분비를 유도한다는 것을 나타낸다.
실시예 6. HASP1 단백질의 신호 펩타이드 존재 여부에 따른 GFP의 세포 내 위치
HASP1 신호 펩타이드의 존재 여부에 따른 GFP의 세포 내 위치를 관찰하기 위해, 모든 형질 전환 계통에서 GFP 형광(녹색) 및 엽록소 자가형광(적색)을 공 초점 레이저 스캐닝 현미경으로 시각화하였다. 프로모터가 없는 GFP를 지닌 형질전환 계통을 대조군으로서 병렬로 분석하였다(도 6a).
fcpApro:GFP 형질 전환 계통에서의 GFP 형광은 대수기 및 초기 정지기 모두에서 세포질 전반에 걸쳐 확산 되었지만, 후기 정지기에서는 갑자기 감소하였다(도 6b).
반면, HASP1pro:GFP 형질전환 계통의 GFP 형광은 전체 세포질을 통해 대수기에서 초기 정지기에도 강하게 증가하였고, 정지기 전반에 걸쳐 높은 수준으로 GFP 형광이 유지되었다(도 6c).
한편, HASP1 신호 펩타이드는 모든 성장단계 동안 GFP의 세포 내 지방화에 상당한 변화를 가지고 왔다. fcpApro:SP-GFP 계통의 GFP 형광은 대수기에서 엽록체 구획 근처에서 약하게 국소화되었다. 그러나 HASP1pro:SP-GFP 계통의 GFP 형광은 대수기에서 초기 정지기(8일)로 빠르게 증가하여 후기 정지기 전반에 걸쳐 높은 수준으로 유지되었다(도 6d).
이를 통해, HASP1 신호 펩타이드가 단백질 분비경로로 GFP의 진입을 효율적으로 유도함을 시사한다.
이상의 결과를 종합하면, HASP1 유전자의 프로모터와 신호 펩타이드가 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)의 모든 성장단계에 걸쳐 재조합 단백질의 효율적인 발현 및 분비를 위한 강력한 도구가 될 수 있음을 알 수 있었다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (14)

  1. 서열번호 1의 폴리뉴클레오티드로 이루어진 HASP1 프로모터.
  2. 서열번호 2의 폴리뉴클레오티드에 의해 발현되거나 또는 서열번호 3의 아미노산 서열로 구성된 HASP1 신호 펩타이드.
  3. 서열번호 1의 프로모터 및/또는 서열번호 2의 신호 펩타이드를 포함하는 발현벡터.
  4. 제3항의 발현벡터가 숙주세포에 도입된 형질전환체.
  5. 제4항에 있어서,
    상기 숙주세포는 미세조류인 것인, 형질전환체.
  6. 제5항에 있어서,
    상기 미세조류는 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)인 것인, 형질전환체.
  7. (a) 제4항 내지 제6항 중 어느 한 항의 형질전환체를 배양하여 배양물을 수득하는 단계; 및
    (b) 상기 배양물로부터 목적 단백질을 회수하는 단계를 포함하는, 목적 단백질의 생산방법.
  8. 제3항의 발현벡터를 숙주세포에 형질전환하는 단계를 포함하는, 목적 단백질을 발현시키는 방법.
  9. 제8항에 있어서,
    상기 숙주세포는 미세조류인 것인, 목적 단백질을 발현시키는 방법.
  10. 제9항에 있어서,
    상기 미세조류는 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)인 것인, 목적 단백질을 발현시키는 방법.
  11. 제3항의 발현벡터를 숙주세포에 형질전환하는 단계를 포함하는, 숙주세포에서 목적 단백질의 발현량을 증가시키는 방법.
  12. 제11항에 있어서,
    상기 숙주세포는 미세조류인 것인, 목적 단백질의 발현량을 증가시키는 방법.
  13. 제12항에 있어서,
    상기 미세조류는 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)인 것인, 목적 단백질의 발현량을 증가시키는 방법.
  14. 숙주세포에서 목적 단백질의 발현량을 증가시키기 위한, 제1항의 프로모터 또는 제2항의 신호 펩타이드의 용도.
PCT/KR2020/008251 2019-07-01 2020-06-25 파에오닥틸룸 트리코르누툼의 신규 프로모터 hasp1와 이의 신호 펩타이드 및 이의 용도 WO2021002630A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP20835401.9A EP4032982A4 (en) 2019-07-01 2020-06-25 NEW HASP1 PROMOTER OF PHAEODACTYLUM TRICORNUTUM AND ITS SIGNAL PEPTIDE, AND ITS USE

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0079014 2019-07-01
KR1020190079014A KR102211740B1 (ko) 2019-07-01 2019-07-01 파에오닥틸룸 트리코르누툼(Phaeodactylum tricornutum)의 신규 프로모터 HASP1와 이의 신호 펩타이드 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2021002630A1 true WO2021002630A1 (ko) 2021-01-07

Family

ID=74100897

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/008251 WO2021002630A1 (ko) 2019-07-01 2020-06-25 파에오닥틸룸 트리코르누툼의 신규 프로모터 hasp1와 이의 신호 펩타이드 및 이의 용도

Country Status (3)

Country Link
EP (1) EP4032982A4 (ko)
KR (1) KR102211740B1 (ko)
WO (1) WO2021002630A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115197947A (zh) * 2022-05-26 2022-10-18 宁波大学 一种三角褐指藻热激转录因子PtHSF1基因及其编码蛋白和应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180050237A (ko) * 2016-11-04 2018-05-14 한국과학기술연구원 인간상피세포 성장인자 또는 피부침투성 인간상피세포 성장인자 발현용 벡터 및 상기 벡터로 형질전환된 미세조류

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3845555A1 (en) * 2019-12-31 2021-07-07 Algaeprona Inc. Vector for producing and expressing human growth factor and microalgae transformed with the vector

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180050237A (ko) * 2016-11-04 2018-05-14 한국과학기술연구원 인간상피세포 성장인자 또는 피부침투성 인간상피세포 성장인자 발현용 벡터 및 상기 벡터로 형질전환된 미세조류

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
"NCBI", Database accession no. XM_002181840.1
DATABASE Nucleotide ANONYMOUS: "Phaeodactylum tricornutum CCAP 1055/1 predicted protein mRNA", XP055771185, retrieved from NCBI Database accession no. XM_002181840.1 *
ERDENEDOLGOR ERDENE-OCHIR, SHIN BOK-KYU, KWON BYEORI, JUNG CHOONKYUN, PAN CHEOL-HO: "Identification and characterisation of the novel endogenous promoter HASP1 and its signal peptide from Phaeodactylum tricornutum", SCIENTIFIC REPORTS, vol. 9, no. 1, 9941, 9 July 2019 (2019-07-09), pages 1 - 10, XP055771154, ISSN: 2045-2322, DOI: 10.1038/s41598-019-45786-9 *
LIOUDMILA A ZASLAVSKAIA , J CASEY LIPPMEIER , PETER G KROTH , ARTHUR R GROSSMAN , KIRK E APT: "Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes", JOURNAL OF PHYCOLOGY, vol. 36, no. 2, 1 April 2000 (2000-04-01), pages 379 - 386, XP002628990, ISSN: 0022-3646, DOI: 10.1046/j.1529-8817.2000.99164.x *
MICHAEL ADAN CABALLERO: "Investigating the biochemistry and genetics of chrysolaminarin metabolism in a model marine diatom", THESES AND DISSERTATIONS, 1 January 2007 (2007-01-01), pages 1 - 178, XP055771175 *
SEUNGBEOM SEO, JEON HANCHEOL, HWANG SEONGBIN, JIN EONSEON, CHANG KWANG SUK: "Development of a new constitutive expression system for the transformation of the diatom Phaeodactylum tricornutum", ALGAL RESEARCH, vol. 11, 1 September 2015 (2015-09-01), pages 50 - 54, XP055771161, ISSN: 2211-9264, DOI: 10.1016/j.algal.2015.05.012 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115197947A (zh) * 2022-05-26 2022-10-18 宁波大学 一种三角褐指藻热激转录因子PtHSF1基因及其编码蛋白和应用

Also Published As

Publication number Publication date
KR102211740B1 (ko) 2021-02-04
EP4032982A1 (en) 2022-07-27
EP4032982A4 (en) 2023-10-25
KR20210003007A (ko) 2021-01-11

Similar Documents

Publication Publication Date Title
WO2019004778A2 (ko) 신규한 아스파토키나제 변이체 및 이를 이용한 l-아미노산의 제조방법
WO2018124440A2 (ko) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2020111890A1 (ko) 바이오레티놀을 생산하는 미생물 및 이를 이용한 바이오레티놀의 생산방법
WO2014148743A1 (ko) 퓨트레신 생산 재조합 미생물 및 이를 이용한 퓨트레신 생산방법
WO2019117671A1 (ko) 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법
WO2014208970A1 (ko) 트랜스케톨라아제 유전자 프로모터 변이체 및 이의 용도
WO2016200207A1 (ko) 젖산을 생산하는 미생물 및 이를 이용한 젖산 제조 방법
WO2019190192A1 (ko) 신규한 프로모터 및 이를 이용한 l-아미노산 생산 방법
WO2019035612A1 (ko) 마이코스포린 유사 아미노산을 생산하는 미생물 및 이를 이용한 마이코스포린 유사 아미노산의 생산방법
WO2017007159A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2021002630A1 (ko) 파에오닥틸룸 트리코르누툼의 신규 프로모터 hasp1와 이의 신호 펩타이드 및 이의 용도
WO2017052299A1 (ko) 신규한 캔디다 인판티콜라 균주, 이의 변이균주 및 형질전환균주, 및 이를 이용하여 디오익 산류를 생산하는 방법
WO2015156583A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
CN108220306B (zh) 具有三脂酰甘油合成功能的基因及其在理性调控产油微藻三脂酰甘油含量或饱和度中的应用
WO2019004779A2 (ko) 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법
WO2018093033A1 (ko) L-라이신을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-라이신의 생산방법
WO2020067618A1 (ko) 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법
WO2020166943A1 (ko) 유전자 총법을 이용한 미세조류의 교정 방법
WO2018199546A1 (ko) 신규한 피루브산 전달효소
US20230039558A1 (en) Chloroplast or accumulated lipid particle enriched with an oil-body protein fusion polypeptide and method for producing the same in algae
WO2022239953A1 (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2019004780A2 (ko) 신규한 o-숙시닐 호모세린 트랜스퍼라제 변이체 및 이를 이용한 o-숙시닐 호모세린의 제조방법
WO2021125867A1 (ko) 화합물을 생산하는 미생물 및 이를 이용한 화합물의 생산 방법
US20200172948A1 (en) Recombinant polypeptide enriched algal chloroplasts, methods for producing the same and uses thereof
KR102093372B1 (ko) 재조합 단백질 생산용 에스케리키아 속 미생물 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20835401

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020835401

Country of ref document: EP

Effective date: 20220201